Directory of Open Access Journals (Sweden)
Dongsha Wang
Full Text Available The main challenge in addressing the role of DNA methylation in human behaviour is the fact that the brain is inaccessible to epigenetic analysis in living humans. Using positron emission tomography (PET measures of brain serotonin (5-HT synthesis, we found in a longitudinal sample that adult males with high childhood-limited aggression (C-LHPA had lower in vivo 5-HT synthesis in the orbitofrontal cortex (OBFC. Here we hypothesized that 5-HT alterations associated with childhood aggression were linked to differential DNA methylation of critical genes in the 5-HT pathway and these changes were also detectable in peripheral white blood cells. Using pyrosequencing, we determined the state of DNA methylation of SLC6A4 promoter in T cells and monocytes isolated from blood of cohort members (N = 25 who underwent a PET scan, and we examined whether methylation status in the blood is associated with in vivo brain 5-HT synthesis. Higher levels of methylation were observed in both T cells and monocytes at specific CpG sites in the C-LHPA group. DNA methylation of SLC6A4 in monocytes appears to be associated more reliably with group membership than T cells. In both cell types the methylation state of these CpGs was associated with lower in vivo measures of brain 5-HT synthesis in the left and right lateral OBFC (N = 20 where lower 5-HT synthesis in C-LHPA group was observed. Furthermore, in vitro methylation of the SLC6A4 promoter in a luciferase reporter construct suppresses its transcriptional activity supporting a functional role of DNA methylation in SLC6A4 promoter regulation. These findings indicate that state of SLC6A4 promoter methylation is altered in peripheral white blood cells of individuals with physical aggression during childhood. This supports the relevance of peripheral DNA methylation for brain function and suggests that peripheral SLC6A4 DNA methylation could be a marker of central 5-HT function.
DNA methylation of amino acid transporter genes in the human placenta.
Simner, C; Novakovic, B; Lillycrop, K A; Bell, C G; Harvey, N C; Cooper, C; Saffery, R; Lewis, R M; Cleal, J K
2017-12-01
Placental transfer of amino acids via amino acid transporters is essential for fetal growth. Little is known about the epigenetic regulation of amino acid transporters in placenta. This study investigates the DNA methylation status of amino acid transporters and their expression across gestation in human placenta. BeWo cells were treated with 5-aza-2'-deoxycytidine to inhibit methylation and assess the effects on amino acid transporter gene expression. The DNA methylation levels of amino acid transporter genes in human placenta were determined across gestation using DNA methylation array data. Placental amino acid transporter gene expression across gestation was also analysed using data from publically available Gene Expression Omnibus data sets. The expression levels of these transporters at term were established using RNA sequencing data. Inhibition of DNA methylation in BeWo cells demonstrated that expression of specific amino acid transporters can be inversely associated with DNA methylation. Amino acid transporters expressed in term placenta generally showed low levels of promoter DNA methylation. Transporters with little or no expression in term placenta tended to be more highly methylated at gene promoter regions. The transporter genes SLC1A2, SLC1A3, SLC1A4, SLC7A5, SLC7A11 and SLC7A10 had significant changes in enhancer DNA methylation across gestation, as well as gene expression changes across gestation. This study implicates DNA methylation in the regulation of amino acid transporter gene expression. However, in human placenta, DNA methylation of these genes remains low across gestation and does not always play an obvious role in regulating gene expression, despite clear evidence for differential expression as gestation proceeds. Copyright © 2017. Published by Elsevier Ltd.
Elevated SLC26A4 gene promoter methylation is associated with the risk of presbycusis in men.
Xu, Jin; Zheng, Jiachen; Shen, Wanjing; Ma, Lili; Zhao, Ming; Wang, Xubo; Tang, Jiyuan; Yan, Jihong; Wu, Zhenhua; Zou, Zuquan; Bu, Shizhong; Xi, Yang
2017-07-01
Presbycusis affects approximately one-third of people over the age of 65 and is a worldwide health problem. In the current study, whether the methylation level of solute carrier family 26 member 4 (SLC26A4) predicted an increased risk of presbycusis was investigated. Peripheral blood samples from 102 patients with presbycusis and 104 controls were collected, and the methylation of the CpG sites of SLC26A4 was measured by applying pyrosequencing technology combined with sodium bisulfate DNA conversion chemistry. Within the SLC26A4 promoter region, one CpG site (CpG3) exhibited a significantly (Ppresbycusis (26.5±5.56%) compared with the controls (23.8±3.85%). Significantly different CpG3 methylation levels were observed between the patients with presbycusis and the controls among the male participants (P=0.0004). In addition, a significant decrease in the transcriptional level of SLC26A4 in peripheral blood was observed in the patients with presbycusis compared with the controls. Furthermore, analyses of the receiver operating characteristic (ROC) curves indicated that CpG3 methylation at the SLC26A4 promoter predicted the risk of presbycusis in the male participants (AUC=0.684, 95% CI=0.584‑0.784, P=0.001). The results demonstrated the significance of the CpG site methylation level of SLC26A4, and thus provides a potential marker for the diagnosis of presbycusis.
Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction
Directory of Open Access Journals (Sweden)
Yun-Fang Jia
2017-07-01
Full Text Available While downregulation of excitatory amino acid transporter 2 (EAAT2, the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD, the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2, encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR and thymine–adenine (TA cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2. DNA was isolated from blood samples drawn from BD patients (N = 150 with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls (N = 32. In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction (p = 0.0009 and binge eating (p = 0.0002 remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156 in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring.
DNA methylation modulates H19 and IGF2 expression in porcine female eye
Directory of Open Access Journals (Sweden)
Dongxu Wang
2017-03-01
Full Text Available Abstract The sexually dimorphic expression of H19/IGF2 is evolutionarily conserved. To investigate whether the expression of H19/IGF2 in the female porcine eye is sex-dependent, gene expression and methylation status were evaluated using quantitative real-time PCR (qPCR and bisulfite sequencing PCR (BSP. We hypothesized that H19/IGF2 might exhibit a different DNA methylation status in the female eye. In order to evaluate our hypothesis, parthenogenetic (PA cells were used for analysis by qPCR and BSP. Our results showed that H19 and IGF2 were over-expressed in the female eye compared with the male eye (3-fold and 2-fold, respectively. We observed a normal monoallelic methylation pattern for H19 differentially methylated regions (DMRs. Compared with H19 DMRs, IGF2 DMRs showed a different methylation pattern in the eye. Taken together, these results suggest that elevated expression of H19/IGF2 is caused by a specific chromatin structure that is regulated by the DNA methylation status of IGF2 DMRs in the female eye.
DNA methylation modulates H19 and IGF2 expression in porcine female eye
Wang, Dongxu; Wang, Guodong; Yang, Hao; Liu, Haibo; Li, Cuie; Li, Xiaolan; Lin, Chao; Song, Yuning; Li, Zhanjun; Liu, Dianfeng
2017-01-01
Abstract The sexually dimorphic expression of H19/IGF2 is evolutionarily conserved. To investigate whether the expression of H19/IGF2 in the female porcine eye is sex-dependent, gene expression and methylation status were evaluated using quantitative real-time PCR (qPCR) and bisulfite sequencing PCR (BSP). We hypothesized that H19/IGF2 might exhibit a different DNA methylation status in the female eye. In order to evaluate our hypothesis, parthenogenetic (PA) cells were used for analysis by qPCR and BSP. Our results showed that H19 and IGF2 were over-expressed in the female eye compared with the male eye (3-fold and 2-fold, respectively). We observed a normal monoallelic methylation pattern for H19 differentially methylated regions (DMRs). Compared with H19 DMRs, IGF2 DMRs showed a different methylation pattern in the eye. Taken together, these results suggest that elevated expression of H19/IGF2 is caused by a specific chromatin structure that is regulated by the DNA methylation status of IGF2 DMRs in the female eye. PMID:28266684
Directory of Open Access Journals (Sweden)
Angela M Devlin
2010-08-01
Full Text Available Prenatal and early postnatal exposure to maternal depression may "program" childhood behavior via epigenetic processes such as DNA methylation. Methylenetetrahydro-folate reductase (MTHFR is an important enzyme in the generation of methyl groups for DNA methylation. The common MTHFR C677T variant is associated with depression in men and non-pregnant women, and with global changes in DNA methylation. This study investigated the effect of maternal MTHFR C677T genotype on antenatal maternal mood, and their impact on the gene-specific methylation in pregnant women and their newborn infants. The methylation status of SLC6A4, which encodes the transmembrane serotonin transporter, and BDNF, which encodes brain derived neurotrophic factor, were assessed because of their potential role in behaviour.Depressed mood was assessed by the Edinburgh Postnatal Depression Scale (EPDS and the Hamilton Rating Scale for Depression (HAM-D in women (n = 82, all taking folate during the 2(nd and 3(rd trimesters of pregnancy. The methylation status of SLC6A4 and BDNF were assessed in 3rd trimester maternal peripheral leukocytes and in umbilical cord leukocytes collected from their infants at birth. Women with the MTHFR 677TT genotype had greater 2(nd trimester depressed mood (p<0.05. Increased 2(nd trimester maternal depressed mood (EPDS scores was associated with decreased maternal and infant SLC6A4 promoter methylation (p<0.05, but had no effect on BDNF promoter methylation.These findings show that the MTHFR C677T variant is associated with greater depressed mood during pregnancy. We further showed that prenatal exposure to maternal depressed mood affects gene-specific DNA methylation patterns. These findings support the concept that alterations in epigenetic processes may contribute to developmental programming of behaviour by maternal depression.
Parvovirus b19 DNA CpG dinucleotide methylation and epigenetic regulation of viral expression.
Directory of Open Access Journals (Sweden)
Francesca Bonvicini
Full Text Available CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression.The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections.The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19.
Parvovirus B19 DNA CpG Dinucleotide Methylation and Epigenetic Regulation of Viral Expression
Bonvicini, Francesca; Manaresi, Elisabetta; Di Furio, Francesca; De Falco, Luisa; Gallinella, Giorgio
2012-01-01
CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression. The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections. The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19. PMID:22413013
Directory of Open Access Journals (Sweden)
Irene Flønes
Full Text Available Biotin-thiamine responsive basal ganglia disease is a severe, but potentially treatable disorder caused by mutations in the SLC19A3 gene. Although the disease is inherited in an autosomal recessive manner, patients with typical phenotypes carrying single heterozygous mutations have been reported. This makes the diagnosis uncertain and may delay treatment.In two siblings with early-onset encephalopathy dystonia and epilepsy, whole-exome sequencing revealed a novel single heterozygous SLC19A3 mutation (c.337T>C. Although Sanger-sequencing and copy-number analysis revealed no other aberrations, RNA-sequencing in brain tissue suggested the second allele was silenced. Whole-genome sequencing resolved the genetic defect by revealing a novel 45,049 bp deletion in the 5'-UTR region of the gene abolishing the promoter. High dose thiamine and biotin therapy was started in the surviving sibling who remains stable. In another patient two novel compound heterozygous SLC19A3 mutations were found. He improved substantially on thiamine and biotin therapy.We show that large genomic deletions occur in the regulatory region of SLC19A3 and should be considered in genetic testing. Moreover, our study highlights the power of whole-genome sequencing as a diagnostic tool for rare genetic disorders across a wide spectrum of mutations including non-coding large genomic rearrangements.
Directory of Open Access Journals (Sweden)
Sofia Blazevic
Full Text Available We tested the hypothesis that gestational diabetes mellitus (GDM alters the DNA methylation pattern of the fetal serotonin transporter gene (SLC6A4, and examined the functional relevance of DNA methylation for regulation of the SLC6A4 expression in the human placenta. The study included 50 mother-infant pairs. Eighteen mothers were diagnosed with GDM and 32 had normal glucose tolerance (NGT. All neonates were of normal birth weight and born at term by planned Cesarean section. DNA and RNA were isolated from samples of tissue collected from the fetal side of the placenta immediately after delivery. DNA methylation was quantified at 7 CpG sites within the SLC6A4 distal promoter region using PCR amplification of bisulfite treated DNA and subsequent DNA sequencing. SLC6A4 mRNA levels were measured by reverse transcription-quantitative PCR (RT-qPCR. Functional SLC6A4 polymorphisms (5HTTLPR, STin2, rs25531 were genotyped using standard PCR-based procedures. Average DNA methylation across the 7 analyzed loci was decreased in the GDM as compared to the NGT group (by 27.1%, p = 0.037 and negatively correlated, before and after adjustment for potential confounder/s, with maternal plasma glucose levels at the 24th to 28th week of gestation (p0.05. The results suggest that DNA methylation of the fetal SLC6A4 gene is sensitive to the maternal metabolic state in pregnancy. They also indicate a predominant role of epigenetic over genetic mechanisms in the regulation of SLC6A4 expression in the human placenta. Longitudinal studies in larger cohorts are needed to verify these results and determine to which degree placental SLC6A4 changes may contribute to long-term outcomes of infants exposed to GDM.
McKay, Jill A; Xie, Long; Harris, Sarah; Wong, Yi K; Ford, Dianne; Mathers, John C
2011-07-01
DNA methylation patterns are tissue specific and may influence tissue-specific gene regulation. Human studies investigating DNA methylation in relation to environmental factors primarily use blood-derived DNA as a surrogate for DNA from target tissues. It is therefore important to know if DNA methylation changes in blood in response to environmental changes reflect those in target tissues. Folate intake can influence DNA methylation, via altered methyl donor supply. Previously, manipulations of maternal folate intake during pregnancy altered the patterns of DNA methylation in offspring but, to our knowledge, the consequences for maternal DNA methylation are unknown. Given the increased requirement for folate during pregnancy, mothers may be susceptible to aberrant DNA methylation due to folate depletion. Female mice were fed folate-adequate (2 mg folic acid/kg diet) or folate-deplete (0.4 mg folic acid/kg diet) diets prior to mating and during pregnancy and lactation. Following weaning, dams were killed and DNA methylation was assessed by pyrosequencing® in blood, liver, and kidney at the Esr1, Igf2 differentially methylated region (DMR)1, Igf2 DMR2, Slc39a4CGI1, and Slc39a4CGI2 loci. We observed tissue-specific differences in methylation at all loci. Folate depletion reduced Igf2 DMR1 and Slc39a4CGI1 methylation across all tissues and altered Igf2 DMR2 methylation in a tissue-specific manner (pmethylation measurements may not always reflect methylation within other tissues. Further measurements of blood-derived and tissue-specific methylation patterns are warranted to understand the complexity of tissue-specific responses to altered nutritional exposure. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Marieke I Bouwland-Both
Full Text Available Changes in epigenetic programming of embryonic growth genes during pregnancy seem to affect fetal growth. Therefore, in a population-based prospective birth cohort in the Netherlands, we examined associations between fetal and infant growth and DNA methylation of IGF2DMR, H19 and MTHFR. For this study, we selected 69 case children born small-for-gestational age (SGA, birth weight <-2SDS and 471 control children. Fetal growth was assessed with serial ultrasound measurements. Information on birth outcomes was retrieved from medical records. Infant weight was assessed at three and six months. Methylation was assessed in DNA extracted from umbilical cord white blood cells. Analyses were performed using linear mixed models with DNA methylation as dependent variable. The DNA methylation levels of IGF2DMR and H19 in the control group were, median (90% range, 53.6% (44.5-61.6 and 30.0% (25.6-34.2 and in the SGA group 52.0% (43.9-60.9 and 30.5% (23.9-32.9, respectively. The MTHFR region was found to be hypomethylated with limited variability in the control and SGA group, 2.5% (1.4-4.0 and 2.4% (1.5-3.8, respectively. SGA was associated with lower IGF2DMR DNA methylation (β = -1.07, 95% CI -1.93; -0.21, P-value = 0.015, but not with H19 methylation. A weight gain in the first three months after birth was associated with lower IGF2DMR DNA methylation (β = -0.53, 95% CI -0.91; -0.16, P-value = 0.005. Genetic variants in the IGF2/H19 locus were associated with IGF2DMR DNA methylation (P-value<0.05, but not with H19 methylation. Furthermore, our results suggest a possibility of mediation of DNA methylation in the association between the genetic variants and SGA. To conclude, IGF2DMR and H19 DNA methylation is associated with fetal and infant growth.
Directory of Open Access Journals (Sweden)
Karen M Vernau
Full Text Available Alaskan Husky Encephalopathy (AHE has been previously proposed as a mitochondrial encephalopathy based on neuropathological similarities with human Leigh Syndrome (LS. We studied 11 Alaskan Husky dogs with AHE, but found no abnormalities in respiratory chain enzyme activities in muscle and liver, or mutations in mitochondrial or nuclear genes that cause LS in people. A genome wide association study was performed using eight of the affected dogs and 20 related but unaffected control AHs using the Illumina canine HD array. SLC19A3 was identified as a positional candidate gene. This gene controls the uptake of thiamine in the CNS via expression of the thiamine transporter protein THTR2. Dogs have two copies of this gene located within the candidate interval (SLC19A3.2 - 43.36-43.38 Mb and SLC19A3.1 - 43.411-43.419 Mb on chromosome 25. Expression analysis in a normal dog revealed that one of the paralogs, SLC19A3.1, was expressed in the brain and spinal cord while the other was not. Subsequent exon sequencing of SLC19A3.1 revealed a 4bp insertion and SNP in the second exon that is predicted to result in a functional protein truncation of 279 amino acids (c.624 insTTGC, c.625 C>A. All dogs with AHE were homozygous for this mutation, 15/41 healthy AH control dogs were heterozygous carriers while 26/41 normal healthy AH dogs were wild type. Furthermore, this mutation was not detected in another 187 dogs of different breeds. These results suggest that this mutation in SLC19A3.1, encoding a thiamine transporter protein, plays a critical role in the pathogenesis of AHE.
SLC9B1 methylation predicts fetal intolerance of labor.
Knight, Anna K; Conneely, Karen N; Kilaru, Varun; Cobb, Dawayland; Payne, Jennifer L; Meilman, Samantha; Corwin, Elizabeth J; Kaminsky, Zachary A; Dunlop, Anne L; Smith, Alicia K
2018-01-01
Fetal intolerance of labor is a common indication for delivery by Caesarean section. Diagnosis is based on the presence of category III fetal heart rate tracing, which is an abnormal heart tracing associated with increased likelihood of fetal hypoxia and metabolic acidemia. This study analyzed data from 177 unique women who, during their prenatal visits (7-15 weeks and/or 24-32 weeks) to Atlanta area prenatal care clinics, consented to provide blood samples for DNA methylation (HumanMethylation450 BeadChip) and gene expression (Human HT-12 v4 Expression BeadChip) analyses. We focused on 57 women aged 18-36 (mean 25.4), who had DNA methylation data available from their second prenatal visit. DNA methylation patterns at CpG sites across the genome were interrogated for associations with fetal intolerance of labor. Four CpG sites (P value intolerance of labor. DNA methylation and gene expression were negatively associated when examined longitudinally during pregnancy using a linear mixed-effects model. Positive predictive values of methylation of these four sites ranged from 0.80 to 0.89, while negative predictive values ranged from 0.91 to 0.92. The four CpG sites were also associated with fetal intolerance of labor in an independent cohort (the Johns Hopkins Prospective PPD cohort). Therefore, fetal intolerance of labor could be accurately predicted from maternal blood samples obtained between 24-32 weeks gestation. Fetal intolerance of labor may be accurately predicted from maternal blood samples obtained between 24-32 weeks gestation by assessing DNA methylation patterns of SLC9B1. The identification of pregnant women at elevated risk for fetal intolerance of labor may allow for the development of targeted treatments or management plans.
Directory of Open Access Journals (Sweden)
Elmar W Tobi
Full Text Available Both the early environment and genetic variation may affect DNA methylation, which is one of the major molecular marks of the epigenome. The combined effect of these factors on a well-defined locus has not been studied to date. We evaluated the association of periconceptional exposure to the Dutch Famine of 1944-45, as an example of an early environmental exposure, and single nucleotide polymorphisms covering the genetic variation (tagging SNPs with DNA methylation at the imprinted IGF2/H19 region, a model for an epigenetically regulated genomic region. DNA methylation was measured at five differentially methylated regions (DMRs that regulate the imprinted status of the IGF2/H19 region. Small but consistent differences in DNA methylation were observed comparing 60 individuals with periconceptional famine exposure with unexposed same-sex siblings at all IGF2 DMRs (P(BH<0.05 after adjustment for multiple testing, but not at the H19 DMR. IGF2 DMR0 methylation was associated with IGF2 SNP rs2239681 (P(BH = 0.027 and INS promoter methylation with INS SNPs, including rs689, which tags the INS VNTR, suggesting a mechanism for the reported effect of the VNTR on INS expression (P(BH = 3.4 × 10(-3. Prenatal famine and genetic variation showed similar associations with IGF2/H19 methylation and their contributions were additive. They were small in absolute terms (<3%, but on average 0.5 standard deviations relative to the variation in the population. Our analyses suggest that environmental and genetic factors could have independent and additive similarly sized effects on DNA methylation at the same regulatory site.
Directory of Open Access Journals (Sweden)
Meeshanthini eVijayendran
2012-06-01
Full Text Available Altered regulation of the serotonin transporter (SLC6A4 is hypothesized to be a key event in many forms of neuropsychiatric illness, yet our understanding of the molecular mechanisms through which changes in gene function could lead to illness remains incomplete. In prior studies, we and others have demonstrated that methylation of CpG residues in the promoter associated CpG island alters SLC6A4 gene expression, that the extent of that DNA methylation in child abuse is genotype dependent, and that adverse childhood experiences such as child sex abuse are related to methylation. However, we have not examined whether these effects are splice variant specific, whether the association of methylation to gene expression varies as a function of genotype, and whether methylation in other SLC6A4 gene regions are more likely candidates for GxE effects. In the current investigation we measured methylation in lymphoblast DNA from 158 female subjects in the Iowa Adoption Studies at 16 CpG residues spread across the SLC6A4 locus, and analyzed their relationship to gene expression for two SLC6A4 splice variants. Methylation of two CpG residues in the shore of the CpG island (cg22584138 and cg05951817, a location immediately upstream from exon 1A, predicted gene expression for the splice variant containing Exon 1A + 1B. Methylation at two residues in the CpG island itself (cg 25769822 and cg05016953 was associated with total SLC6A4 expression. Examination of these four CpG residues indicated that methylation of cg22584138 was influenced by both genotype and sex abuse, whereas methylation of cg05016953 was influenced only by sex abuse history. Factors influencing methylation at other CpG dinucleotide pairs were not identified. We conclude that methylation effects on transcription may vary as a function of underlying gene motif and splice variant, and that the shore of CpG islands, upstream of TSS, may be of particular interest in examining environmental effects
Harrison, Joseph S; Cornett, Evan M; Goldfarb, Dennis; DaRosa, Paul A; Li, Zimeng M; Yan, Feng; Dickson, Bradley M; Guo, Angela H; Cantu, Daniel V; Kaustov, Lilia; Brown, Peter J; Arrowsmith, Cheryl H; Erie, Dorothy A; Major, Michael B; Klevit, Rachel E; Krajewski, Krzysztof; Kuhlman, Brian; Strahl, Brian D; Rothbart, Scott B
2016-09-06
The epigenetic inheritance of DNA methylation requires UHRF1, a histone- and DNA-binding RING E3 ubiquitin ligase that recruits DNMT1 to sites of newly replicated DNA through ubiquitylation of histone H3. UHRF1 binds DNA with selectivity towards hemi-methylated CpGs (HeDNA); however, the contribution of HeDNA sensing to UHRF1 function remains elusive. Here, we reveal that the interaction of UHRF1 with HeDNA is required for DNA methylation but is dispensable for chromatin interaction, which is governed by reciprocal positive cooperativity between the UHRF1 histone- and DNA-binding domains. HeDNA recognition activates UHRF1 ubiquitylation towards multiple lysines on the H3 tail adjacent to the UHRF1 histone-binding site. Collectively, our studies are the first demonstrations of a DNA-protein interaction and an epigenetic modification directly regulating E3 ubiquitin ligase activity. They also define an orchestrated epigenetic control mechanism involving modifications both to histones and DNA that facilitate UHRF1 chromatin targeting, H3 ubiquitylation, and DNA methylation inheritance.
Directory of Open Access Journals (Sweden)
Zhaoxu Lu
Full Text Available Mercury (Hg is a well-recognized environmental pollutant known by its toxicity of development and neurotoxicity, which results in adverse health outcomes. However, the mechanisms underlying the teratogenic effects of Hg are not well understood. Imprinting genes are emerging regulators for fetal development subjecting to environmental pollutants impacts. In this study, we examined the association between preconceptional Hg exposure and the alteration of DNA methylation of imprinting genes H19, Meg3, and Peg3 in human sperm DNA.A total of 616 men, aged from 22 to 59, were recruited from Reproductive Medicine Clinic of Maternal and Child Care Service Center and the Urologic Surgery Clinic of Shanxi Academy of Medical Sciences during April 2015 and March 2016. Demographic information was collected through questionnaires. Urine was collected and urinary Hg concentrations were measured using a fully-automatic double-channel hydride generation atomic fluorescence spectrometer. Methylation of imprinting genes H19, Meg3 and Peg3 of sperm DNA from 242 participants were examined by bisulfite pyrosequencing. Spearman's rank and multivariate regression analysis were used for correlation analysis between sperm DNA methylation status of imprinting genes and urinary Hg levels.The median concentration of Hg for 616 participants was 9.14μg/l (IQR: 5.56-12.52 μg/l; ranging 0.16-71.35μg/l. A total of 42.7% of the participants are beyond normal level for non-occupational exposure according to the criterion of Hg poisoning (≥10 μg/L. Spearman's rank analysis indicated a negative correlation between urinary Hg concentrations and average DNA methylation levels of imprinted genes H19 (rs = -0.346, p <0.05, but there was no such a correlation for Peg3 and Meg3. Further, we analyzed the correlation between methylation level at individual CpG site of H19 and urinary Hg level. The results showed a negative correlation between urinary Hg concentrations and three out of
DNA methylation of the IGF2/H19 imprinting control region and adiposity distribution in young adults
Directory of Open Access Journals (Sweden)
Huang Rae-Chi
2012-11-01
Full Text Available Abstract Background The insulin-like growth factor 2 (IGF2 and H19 imprinted genes control growth and body composition. Adverse in-utero environments have been associated with obesity-related diseases and linked with altered DNA methylation at the IGF2/H19 locus. Postnatally, methylation at the IGF2/H19 imprinting control region (ICR has been linked with cerebellum weight. We aimed to investigate whether decreased IGF2/H19 ICR methylation is associated with decreased birth and childhood anthropometry and increased contemporaneous adiposity. DNA methylation in peripheral blood (n = 315 at 17 years old was measured at 12 cytosine-phosphate-guanine sites (CpGs, analysed as Sequenom MassARRAY EpiTYPER units within the IGF2/H19 ICR. Birth size, childhood head circumference (HC at six time-points and anthropometry at age 17 years were measured. DNA methylation was investigated for its association with anthropometry using linear regression. Results The principal component of IGF2/H19 ICR DNA methylation (representing mean methylation across all CpG units positively correlated with skin fold thickness (at four CpG units (P-values between 0.04 to 0.001 and subcutaneous adiposity (P = 0.023 at age 17, but not with weight, height, BMI, waist circumference or visceral adiposity. IGF2/H19 methylation did not associate with birth weight, length or HC, but CpG unit 13 to 14 methylation was negatively associated with HC between 1 and 10 years. β-coefficients of four out of five remaining CpG units also estimated lower methylation with increasing childhood HC. Conclusions As greater IGF2/H19 methylation was associated with greater subcutaneous fat measures, but not overall, visceral or central adiposity, we hypothesize that obesogenic pressures in youth result in excess fat being preferentially stored in peripheral fat depots via the IGF2/H19 domain. Secondly, as IGF2/H19 methylation was not associated with birth size but negatively with early childhood HC, we
Metformin Is a Substrate and Inhibitor of the Human Thiamine Transporter, THTR-2 (SLC19A3).
Liang, Xiaomin; Chien, Huan-Chieh; Yee, Sook Wah; Giacomini, Marilyn M; Chen, Eugene C; Piao, Meiling; Hao, Jia; Twelves, Jolyn; Lepist, Eve-Irene; Ray, Adrian S; Giacomini, Kathleen M
2015-12-07
The biguanide metformin is widely used as first-line therapy for the treatment of type 2 diabetes. Predominately a cation at physiological pH's, metformin is transported by membrane transporters, which play major roles in its absorption and disposition. Recently, our laboratory demonstrated that organic cation transporter 1, OCT1, the major hepatic uptake transporter for metformin, was also the primary hepatic uptake transporter for thiamine, vitamin B1. In this study, we tested the reverse, i.e., that metformin is a substrate of thiamine transporters (THTR-1, SLC19A2, and THTR-2, SLC19A3). Our study demonstrated that human THTR-2 (hTHTR-2), SLC19A3, which is highly expressed in the small intestine, but not hTHTR-1, transports metformin (Km = 1.15 ± 0.2 mM) and other cationic compounds (MPP(+) and famotidine). The uptake mechanism for hTHTR-2 was pH and electrochemical gradient sensitive. Furthermore, metformin as well as other drugs including phenformin, chloroquine, verapamil, famotidine, and amprolium inhibited hTHTR-2 mediated uptake of both thiamine and metformin. Species differences in the substrate specificity of THTR-2 between human and mouse orthologues were observed. Taken together, our data suggest that hTHTR-2 may play a role in the intestinal absorption and tissue distribution of metformin and other organic cations and that the transporter may be a target for drug-drug and drug-nutrient interactions.
Brons, A-K; Henthorn, P S; Raj, K; Fitzgerald, C A; Liu, J; Sewell, A C; Giger, U
2013-01-01
Cystinuria, one of the first recognized inborn errors of metabolism, has been reported in many dog breeds. To determine urinary cystine concentrations, inheritance, and mutations in the SLC3A1 and SLC7A9 genes associated with cystinuria in 3 breeds. Mixed and purebred Labrador Retrievers (n = 6), Australian Cattle Dogs (6), Miniature Pinschers (4), and 1 mixed breed dog with cystine urolithiasis, relatives and control dogs. Urinary cystinuria and aminoaciduria was assessed and exons of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA. In each breed, male and female dogs, independent of neuter status, were found to form calculi. A frameshift mutation in SLC3A1 (c.350delG) resulting in a premature stop codon was identified in autosomal-recessive (AR) cystinuria in Labrador Retrievers and mixed breed dogs. A 6 bp deletion (c.1095_1100del) removing 2 threonines in SLC3A1 was found in autosomal-dominant (AD) cystinuria with a more severe phenotype in homozygous than in heterozygous Australian Cattle Dogs. A missense mutation in SLC7A9 (c.964G>A) was discovered in AD cystinuria in Miniature Pinschers with only heterozygous affected dogs observed to date. Breed-specific DNA tests were developed, but the prevalence of each mutation remains unknown. These studies describe the first AD inheritance and the first putative SLC7A9 mutation to cause cystinuria in dogs and expand our understanding of this phenotypically and genetically heterogeneous disease, leading to a new classification system for canine cystinuria and better therapeutic management and genetic control in these breeds. Copyright © 2013 by the American College of Veterinary Internal Medicine.
Regulation of DNA Methylation Patterns by CK2-Mediated Phosphorylation of Dnmt3a
Directory of Open Access Journals (Sweden)
Rachel Deplus
2014-08-01
Full Text Available DNA methylation is a central epigenetic modification that is established by de novo DNA methyltransferases. The mechanisms underlying the generation of genomic methylation patterns are still poorly understood. Using mass spectrometry and a phosphospecific Dnmt3a antibody, we demonstrate that CK2 phosphorylates endogenous Dnmt3a at two key residues located near its PWWP domain, thereby downregulating the ability of Dnmt3a to methylate DNA. Genome-wide DNA methylation analysis shows that CK2 primarily modulates CpG methylation of several repeats, most notably of Alu SINEs. This modulation can be directly attributed to CK2-mediated phosphorylation of Dnmt3a. We also find that CK2-mediated phosphorylation is required for localization of Dnmt3a to heterochromatin. By revealing phosphorylation as a mode of regulation of de novo DNA methyltransferase function and by uncovering a mechanism for the regulation of methylation at repetitive elements, our results shed light on the origin of DNA methylation patterns.
Directory of Open Access Journals (Sweden)
Maciej Pronicki
2017-06-01
Full Text Available Biotin-thiamine-responsive basal ganglia disease is a severe form of a rare neurogenetic disorder caused by pathogenic molecular variants in the thiamine transporter gene. Nowadays, a potentially effective treatment is known, therefore the early diagnosis is mandatory. The aim of the paper was to assess the contribution of neuropathological and magnetic resonance imaging (MRI studies to a proper diagnosis. We present the brain study of two Polish patients with SLC19A3 mutations, including (1 an infant with an intriguing “walnut” appearance of the brain autopsied many years before the discovery of the SLC19A3 defect, and (2 a one-year-old patient with clinical features of Leigh syndrome. In patient 2, biotin/thiamine responsiveness was not tested at the time of diagnosis and causal treatment started with one-year delay. The central nervous system lesions found in the patients displayed almost clearly a specific pattern for SLC19A3 defect, as previously proposed in diagnostic criteria. Our study presents a detailed description of neuropathological and MRI findings of both patients. We confirm that the autopsy and/or MRI of the brain is sufficient to qualify a patient with an unknown neuropathological disorder directly for SLC19A3 mutations testing and a prompt trial of specific treatment.
Stress, burnout and depression: A systematic review on DNA methylation mechanisms.
Bakusic, Jelena; Schaufeli, Wilmar; Claes, Stephan; Godderis, Lode
2017-01-01
Despite that burnout presents a serious burden for modern society, there are no diagnostic criteria. Additional difficulty is the differential diagnosis with depression. Consequently, there is a need to dispose of a burnout biomarker. Epigenetic studies suggest that DNA methylation is a possible mediator linking individual response to stress and psychopathology and could be considered as a potential biomarker of stress-related mental disorders. Thus, the aim of this review is to provide an overview of DNA methylation mechanisms in stress, burnout and depression. In addition to state-of-the-art overview, the goal of this review is to provide a scientific base for burnout biomarker research. We performed a systematic literature search and identified 25 pertinent articles. Among these, 15 focused on depression, 7 on chronic stress and only 3 on work stress/burnout. Three epigenome-wide studies were identified and the majority of studies used the candidate-gene approach, assessing 12 different genes. The glucocorticoid receptor gene (NR3C1) displayed different methylation patterns in chronic stress and depression. The serotonin transporter gene (SLC6A4) methylation was similarly affected in stress, depression and burnout. Work-related stress and depressive symptoms were associated with different methylation patterns of the brain derived neurotrophic factor gene (BDNF) in the same human sample. The tyrosine hydroxylase (TH) methylation was correlated with work stress in a single study. Additional, thoroughly designed longitudinal studies are necessary for revealing the cause-effect relationship of work stress, epigenetics and burnout, including its overlap with depression. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Sharma Shikhar
2012-01-01
Full Text Available Abstract Background DNA methylation, histone modifications and nucleosome occupancy act in concert for regulation of gene expression patterns in mammalian cells. Recently, G9a, a H3K9 methyltransferase, has been shown to play a role in establishment of DNA methylation at embryonic gene targets in ES cells through recruitment of de novo DNMT3A/3B enzymes. However, whether G9a plays a similar role in maintenance of DNA methylation in somatic cells is still unclear. Results Here we show that G9a is not essential for maintenance of DNA methylation in somatic cells. Knockdown of G9a has no measurable effect on DNA methylation levels at G9a-target loci. DNMT3A/3B remain stably anchored to nucleosomes containing methylated DNA even in the absence of G9a, ensuring faithful propagation of methylated states in cooperation with DNMT1 through somatic divisions. Moreover, G9a also associates with nucleosomes in a DNMT3A/3B and DNA methylation-independent manner. However, G9a knockdown synergizes with pharmacologic inhibition of DNMTs resulting in increased hypomethylation and inhibition of cell proliferation. Conclusions Taken together, these data suggest that G9a is not involved in maintenance of DNA methylation in somatic cells but might play a role in re-initiation of de novo methylation after treatment with hypomethylating drugs, thus serving as a potential target for combinatorial treatments strategies involving DNMTs inhibitors.
Directory of Open Access Journals (Sweden)
Hassan Brim
Full Text Available Colon cancer is one of the leading causes of cancer related deaths. Its impact on African Americans (AAs is higher than in the general population both in the incidence and mortality from the disease. Colon cancer aggressiveness in AAs as well as non-frequent check-ups and follow up in this population have been proposed as ways to explain the observed discrepancies. These facts made the detection of early carcinogenesis markers in this population a priority.Here, we analyzed 50 colon adenomas from AA patients for both microsatellite instability (MSI and the methylation status of SLC5A8 gene. This gene's product is involved in the transport of butyrate that has anti-proliferative properties through its effects on histone acetylation and gene expression. A proteomic analysis to check the expressed histones in adenoma and normal tissues was also performed.The analyzed samples displayed 82% (n = 41 methylation level of SLC5A8 gene in adenomas. The MSI-H (high adenoma were about 18% (n = 9 while the rest were mostly MSS (microsatellite stable with few MSI-L (Low. No association was found between SLC5A8 methylation and the MSI status. Also, there was no association between SLC5A8 methylation and the sex and age of the patients. However, there were more right sided adenomas with SLC5A8 methylation than the left sided ones. The proteomic analysis revealed distinct histone expression profiles between normal and adenoma tissues.SLC5A8 is highly methylated in AA colon adenomas which points to its potential use as a marker for early detection. The MSI rate is similar to that found in colon cancer tumors in AAs. These findings suggest that both processes stem from the same epigenetic and genetic events occurring at an early stage in colon carcinogenesis in AAs.
Directory of Open Access Journals (Sweden)
Laia Navarro-Martín
2011-12-01
Full Text Available Sex ratio shifts in response to temperature are common in fish and reptiles. However, the mechanism linking temperature during early development and sex ratios has remained elusive. We show in the European sea bass (sb, a fish in which temperature effects on sex ratios are maximal before the gonads form, that juvenile males have double the DNA methylation levels of females in the promoter of gonadal aromatase (cyp19a, the enzyme that converts androgens into estrogens. Exposure to high temperature increased the cyp19a promoter methylation levels of females, indicating that induced-masculinization involves DNA methylation-mediated control of aromatase gene expression, with an observed inverse relationship between methylation levels and expression. Although different CpGs within the sb cyp19a promoter exhibited different sensitivity to temperature, we show that the increased methylation of the sb cyp19a promoter, which occurs in the gonads but not in the brain, is not a generalized effect of temperature. Importantly, these effects were also observed in sexually undifferentiated fish and were not altered by estrogen treatment. Thus, methylation of the sb cyp19a promoter is the cause of the lower expression of cyp19a in temperature-masculinized fish. In vitro, induced methylation of the sb cyp19a promoter suppressed the ability of SF-1 and Foxl2 to stimulate transcription. Finally, a CpG differentially methylated by temperature and adjacent to a Sox transcription factor binding site is conserved across species. Thus, DNA methylation of the aromatase promoter may be an essential component of the long-sought-after mechanism connecting environmental temperature and sex ratios in vertebrate species with temperature-dependent sex determination.
Ferry, Laure; Fournier, Alexandra; Tsusaka, Takeshi; Adelmant, Guillaume; Shimazu, Tadahiro; Matano, Shohei; Kirsh, Olivier; Amouroux, Rachel; Dohmae, Naoshi; Suzuki, Takehiro; Filion, Guillaume J; Deng, Wen; de Dieuleveult, Maud; Fritsch, Lauriane; Kudithipudi, Srikanth; Jeltsch, Albert; Leonhardt, Heinrich; Hajkova, Petra; Marto, Jarrod A; Arita, Kyohei; Shinkai, Yoichi; Defossez, Pierre-Antoine
2017-08-17
DNA methylation is an essential epigenetic mark in mammals that has to be re-established after each round of DNA replication. The protein UHRF1 is essential for this process; it has been proposed that the protein targets newly replicated DNA by cooperatively binding hemi-methylated DNA and H3K9me2/3, but this model leaves a number of questions unanswered. Here, we present evidence for a direct recruitment of UHRF1 by the replication machinery via DNA ligase 1 (LIG1). A histone H3K9-like mimic within LIG1 is methylated by G9a and GLP and, compared with H3K9me2/3, more avidly binds UHRF1. Interaction with methylated LIG1 promotes the recruitment of UHRF1 to DNA replication sites and is required for DNA methylation maintenance. These results further elucidate the function of UHRF1, identify a non-histone target of G9a and GLP, and provide an example of a histone mimic that coordinates DNA replication and DNA methylation maintenance. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Naila Al Mahmuda
2016-05-01
Full Text Available Autism Spectrum Disorder (ASD is a group of neurodevelopmental disorders with complex genetic etiology. Recent studies have indicated that children with ASD may have altered folate or methionine metabolism, suggesting that the folate–methionine cycle may play a key role in the etiology of ASD. SLC19A1, also referred to as reduced folate carrier 1 (RFC1, is a member of the solute carrier group of transporters and is one of the key enzymes in the folate metabolism pathway. Findings from multiple genomic screens suggest the presence of an autism susceptibility locus on chromosome 21q22.3, which includes SLC19A1. Therefore, we performed a case-control study in a Japanese population. In this study, DNA samples obtained from 147 ASD patients at the Kanazawa University Hospital in Japan and 150 unrelated healthy Japanese volunteers were examined by the sequence-specific primer-polymerase chain reaction method pooled with fluorescence correlation spectroscopy. p < 0.05 was considered to represent a statistically significant outcome. Of 13 single nucleotide polymorphisms (SNPs examined, a significant p-value was obtained for AA genotype of one SNP (rs1023159, OR = 0.39, 95% CI = 0.16–0.91, p = 0.0394; Fisher’s exact test. Despite some conflicting results, our findings supported a role for the polymorphism rs1023159 of the SLC19A1 gene, alone or in combination, as a risk factor for ASD. However, the findings were not consistent after multiple testing corrections. In conclusion, although our results supported a role of the SLC19A1 gene in the etiology of ASD, it was not a significant risk factor for the ASD samples analyzed in this study.
DNA Methylation as a Biomarker for Body Fluid Identification
Directory of Open Access Journals (Sweden)
Rania Gomaa
2017-12-01
Full Text Available Currently, available identification techniques for forensic samples are either enzyme or protein based, which can be subjected to degradation, thus limiting its storage potentials. Epigenetic changes arising due to DNA methylation and histone acetylation can be used for body fluid identification. Markers DACT1, USP49, ZC3H12D, FGF7, cg23521140, cg17610929, chromosome 4 (25287119–25287254, chromosome 11 (72085678–72085798, 57171095–57171236, 1493401–1493538, and chromosome 19 (47395505–47395651 are currently being used for semen identification. Markers cg26107890, cg20691722, cg01774894 and cg14991487 are used to differentiate saliva and vaginal secretions from other body fluids. However, such markers show overlapping methylation pattern. This review article aimed to highlight the feasibility of using DNA methylation of certain genetic markers in body fluid identification and its implications for forensic investigations. The reviewed articles have employed molecular genetics techniques such as Bisulfite sequencing PCR (BSP, methylation specific PCR (MSP, Pyrosequencing, Combined Bisulfite Restriction Analysis (COBRA, Methylation-sensitive Single Nucleotide Primer Extension (SNuPE, and Multiplex SNaPshot Microarray. Bioinformatics software such as MATLAB and BiQ Analyzer has been used. Biological fluids have different methylation patterns and thus, this difference can be used to identify the nature of the biological fluid found at the crime scene. Using DNA methylation to identify the body fluids gives accurate results without consumption of the trace evidence and requires a minute amount of DNA for analysis. Recent studies have incorporated next-generation sequencing aiming to find out more reliable markers that can differentiate between different body fluids. Nonetheless, new DNA methylation markers are yet to be discovered to accurately differentiate between saliva and vaginal secretions with high confidence. Epigenetic changes are
Pei, Lijun; Zhu, Huiping; Ye, Rongwei; Wu, Jilei; Liu, Jianmeng; Ren, Aiguo; Li, Zhiwen; Zheng, Xiaoying
2015-01-01
Many studies have indicated that the reduced folate carrier gene (SLC19A1) is associated with an increased risk of neural tube defects (NTDs). However, the interaction between the SLC19A1 gene variant and maternal fever exposure and NTD risk remains unknown. The aim of this study was to investigate whether the risk for NTDs was influenced by the interactions between the SLC19A1 (rs1051266) variant and maternal first trimester fever. We investigated the potential interaction between maternal first trimester fever and maternal or offspring SLC19A1 polymorphism through a population-based case-control study. One hundred and four nuclear families with NTDs and 100 control families with nonmal newborns were included in the study. SLC19A1 polymorphism was determined using polymerase chain reaction-restricted fragment length polymorphism. Mothers who had the GG/GA genotype and first trimester fever had an elevated risk of NTDs (adjusted odds ratio, 11.73; 95% confidence interval, 3.02-45.58) as compared to absence of maternal first trimester fever and AA genotype after adjusting for maternal education, paternal education, and age, and had a significant interactive coefficient (γ = 3.17) between maternal GG/GA genotype and first trimester fever. However, there was no interaction between offspring's GG/GA genotype and maternal first trimester fever (the interactive coefficient γ = 0.97) after adjusting for confounding factors. Our findings suggested that the risk of NTDs was potentially influenced by a gene-environment interaction between maternal SLC19A1 rs1051266 GG/GA genotype and first trimester fever. Maternal GG/GA genotype may strengthen the effect of maternal fever exposure on NTD risk in this Chinese population. © 2014 Wiley Periodicals, Inc.
DNA methylation and gene expression of HIF3A
DEFF Research Database (Denmark)
Main, Ailsa Maria; Gillberg, Linn; Jacobsen, Anna Louisa
2016-01-01
from 48 families, from whom we had SAT and muscle biopsies. DNA methylation of four CpG sites in the HIF3A promoter was analyzed in the blood and SAT by pyrosequencing, and HIF3A gene expression was analyzed in SAT and muscle by qPCR. An index of whole-body insulin sensitivity was estimated from oral...... individuals, and whether HIF3A gene expression in SAT and skeletal muscle biopsies showed associations with BMI and insulin resistance. Furthermore, we aimed to investigate gender specificity and heritability of these traits. METHODS: We studied 137 first-degree relatives of type 2 diabetes (T2D) patients...... glucose tolerance tests. RESULTS: BMI was associated with HIF3A methylation at one CpG site in the blood, and there was a positive association between the blood and SAT methylation levels at a different CpG site within the individuals. The SAT methylation level did not correlate with HIF3A gene expression...
DNA methylation results depend on DNA integrity – role of post mortem interval
Directory of Open Access Journals (Sweden)
Mathias eRhein
2015-05-01
Full Text Available Major questions of neurological and psychiatric mechanisms involve the brain functions on a molecular level and cannot be easily addressed due to limitations in access to tissue samples. Post mortem studies are able to partly bridge the gap between brain tissue research retrieved from animal trials and the information derived from peripheral analysis (e.g. measurements in blood cells in patients. Here, we wanted to know how fast DNA degradation is progressing under controlled conditions in order to define thresholds for tissue quality to be used in respective trials. Our focus was on the applicability of partly degraded samples for bisulfite sequencing and the determination of simple means to define cut-off values.After opening the brain cavity, we kept two consecutive pig skulls at ambient temperature (19-21°C and removed cortex tissue up to a post mortem interval (PMI of 120h. We calculated the percentage of degradation on DNA gel electrophoresis of brain DNA to estimate quality and relate this estimation spectrum to the quality of human post-mortem control samples. Functional DNA quality was investigated by bisulfite sequencing of two functionally relevant genes for either the serotonin receptor 5 (SLC6A4 or aldehyde dehydrogenase 2 (ALDH2.Testing our approach in a heterogeneous collective of human blood and brain samples, we demonstrate integrity of measurement quality below the threshold of 72h PMI.While sequencing technically worked for all timepoints irrespective of conceivable DNA degradation, there is a good correlation between variance of methylation to degradation levels documented in the gel (R2=0.4311, p=0.0392 for advancing post mortem intervals (PMI. This otherwise elusive phenomenon is an important prerequisite for the interpretation and evaluation of samples prior to in-depth processing via an affordable and easy assay to estimate identical sample quality and thereby comparable methylation measurements.
Drong, Alexander W; Abbott, James; Wahl, Simone; Tan, Sian-Tsung; Scott, William R; Campanella, Gianluca; Chadeau-Hyam, Marc; Afzal, Uzma; Ahluwalia, Tarunveer S; Bonder, Marc Jan; Chen, Peng; Dehghan, Abbas; Edwards, Todd L; Esko, Tõnu; Go, Min Jin; Harris, Sarah E; Hartiala, Jaana; Kasela, Silva; Kasturiratne, Anuradhani; Khor, Chiea-Chuen; Kleber, Marcus E; Li, Huaixing; Yu Mok, Zuan; Nakatochi, Masahiro; Sapari, Nur Sabrina; Saxena, Richa; Stewart, Alexandre F R; Stolk, Lisette; Tabara, Yasuharu; Teh, Ai Ling; Wu, Ying; Wu, Jer-Yuarn; Zhang, Yi; Aits, Imke; Da Silva Couto Alves, Alexessander; Das, Shikta; Dorajoo, Rajkumar; Hopewell, Jemma C; Kim, Yun Kyoung; Koivula, Robert W; Luan, Jian’an; Lyytikäinen, Leo-Pekka; Nguyen, Quang N; Pereira, Mark A; Postmus, Iris; Raitakari, Olli T; Bryan, Molly Scannell; Scott, Robert A; Sorice, Rossella; Tragante, Vinicius; Traglia, Michela; White, Jon; Yamamoto, Ken; Zhang, Yonghong; Adair, Linda S; Ahmed, Alauddin; Akiyama, Koichi; Asif, Rasheed; Aung, Tin; Barroso, Inês; Bjonnes, Andrew; Braun, Timothy R; Cai, Hui; Chang, Li-Ching; Chen, Chien-Hsiun; Cheng, Ching-Yu; Chong, Yap-Seng; Collins, Rory; Courtney, Regina; Davies, Gail; Delgado, Graciela; Do, Loi D; Doevendans, Pieter A; Gansevoort, Ron T; Gao, Yu-Tang; Grammer, Tanja B; Grarup, Niels; Grewal, Jagvir; Gu, Dongfeng; Wander, Gurpreet S; Hartikainen, Anna-Liisa; Hazen, Stanley L; He, Jing; Heng, Chew-Kiat; Hixson, James E; Hofman, Albert; Hsu, Chris; Huang, Wei; Husemoen, Lise L N; Hwang, Joo-Yeon; Ichihara, Sahoko; Igase, Michiya; Isono, Masato; Justesen, Johanne M; Katsuya, Tomohiro; Kibriya, Muhammad G; Kim, Young Jin; Kishimoto, Miyako; Koh, Woon-Puay; Kohara, Katsuhiko; Kumari, Meena; Kwek, Kenneth; Lee, Nanette R; Lee, Jeannette; Liao, Jiemin; Lieb, Wolfgang; Liewald, David C M; Matsubara, Tatsuaki; Matsushita, Yumi; Meitinger, Thomas; Mihailov, Evelin; Milani, Lili; Mills, Rebecca; Mononen, Nina; Müller-Nurasyid, Martina; Nabika, Toru; Nakashima, Eitaro; Ng, Hong Kiat; Nikus, Kjell; Nutile, Teresa; Ohkubo, Takayoshi; Ohnaka, Keizo; Parish, Sarah; Paternoster, Lavinia; Peng, Hao; Peters, Annette; Pham, Son T; Pinidiyapathirage, Mohitha J; Rahman, Mahfuzar; Rakugi, Hiromi; Rolandsson, Olov; Ann Rozario, Michelle; Ruggiero, Daniela; Sala, Cinzia F; Sarju, Ralhan; Shimokawa, Kazuro; Snieder, Harold; Sparsø, Thomas; Spiering, Wilko; Starr, John M; Stott, David J; Stram, Daniel O; Sugiyama, Takao; Szymczak, Silke; Tang, W H Wilson; Tong, Lin; Trompet, Stella; Turjanmaa, Väinö; Ueshima, Hirotsugu; Uitterlinden, André G; Umemura, Satoshi; Vaarasmaki, Marja; van Dam, Rob M; van Gilst, Wiek H; van Veldhuisen, Dirk J; Viikari, Jorma S; Waldenberger, Melanie; Wang, Yiqin; Wang, Aili; Wilson, Rory; Wong, Tien-Yin; Xiang, Yong-Bing; Yamaguchi, Shuhei; Ye, Xingwang; Young, Robin D; Young, Terri L; Yuan, Jian-Min; Zhou, Xueya; Asselbergs, Folkert W; Ciullo, Marina; Clarke, Robert; Deloukas, Panos; Franke, Andre; Franks, Paul W; Franks, Steve; Friedlander, Yechiel; Gross, Myron D; Guo, Zhirong; Hansen, Torben; Jarvelin, Marjo-Riitta; Jørgensen, Torben; Jukema, J Wouter; kähönen, Mika; Kajio, Hiroshi; Kivimaki, Mika; Lee, Jong-Young; Lehtimäki, Terho; Linneberg, Allan; Miki, Tetsuro; Pedersen, Oluf; Samani, Nilesh J; Sørensen, Thorkild I A; Takayanagi, Ryoichi; Toniolo, Daniela; Ahsan, Habibul; Allayee, Hooman; Chen, Yuan-Tsong; Danesh, John; Deary, Ian J; Franco, Oscar H; Franke, Lude; Heijman, Bastiaan T; Holbrook, Joanna D; Isaacs, Aaron; Kim, Bong-Jo; Lin, Xu; Liu, Jianjun; März, Winfried; Metspalu, Andres; Mohlke, Karen L; Sanghera, Dharambir K; Shu, Xiao-Ou; van Meurs, Joyce B J; Vithana, Eranga; Wickremasinghe, Ananda R; Wijmenga, Cisca; Wolffenbuttel, Bruce H W; Yokota, Mitsuhiro; Zheng, Wei; Zhu, Dingliang; Vineis, Paolo; Kyrtopoulos, Soterios A; Kleinjans, Jos C S; McCarthy, Mark I; Soong, Richie; Gieger, Christian; Scott, James
2016-01-01
We carried out a trans-ancestry genome-wide association and replication study of blood pressure phenotypes among up to 320,251 individuals of East Asian, European and South Asian ancestry. We find genetic variants at 12 new loci to be associated with blood pressure (P = 3.9 × 10−11 to 5.0 × 10−21). The sentinel blood pressure SNPs are enriched for association with DNA methylation at multiple nearby CpG sites, suggesting that, at some of the loci identified, DNA methylation may lie on the regulatory pathway linking sequence variation to blood pressure. The sentinel SNPs at the 12 new loci point to genes involved in vascular smooth muscle (IGFBP3, KCNK3, PDE3A and PRDM6) and renal (ARHGAP24, OSR1, SLC22A7 and TBX2) function. The new and known genetic variants predict increased left ventricular mass, circulating levels of NT-proBNP, and cardiovascular and all-cause mortality (P = 0.04 to 8.6 × 10−6). Our results provide new evidence for the role of DNA methylation in blood pressure regulation. PMID:26390057
Directory of Open Access Journals (Sweden)
Jukka S Alasaari
Full Text Available Shift-working nurses are exposed to a stressful work environment, which puts them at an increased risk for burnout and depression. We explored the effect of environmental stress on serotonin transporter gene (SLC6A4 promoter methylation among nurses from high and low work stress environments.Using bisulfite sequencing, we investigated the methylation status of five CpG residues of a CpG-rich region in the promoter of SLC6A4 by comparing female shift working nurses from a high work stress environment (n = 24 to low work stress environment (n = 25. We also analyzed the association of 5-HTTLPR polymorphism at 5' end of SLC6A4. Work stress was assessed by the Karasek's Model and possible signs of burnout or depression were measured by the Maslach Burnout Index General Survey and Beck Depression Index. Methylation levels were assessed by bisulfite sequencing of DNA extracted from peripheral blood leucocytes. Restriction enzyme treatment followed by standard PCR was used to identify 5-HTTLPR genotypes.We found that nurses in the high stress environment had significantly lower promoter methylation levels at all five CpG residues compared to nurses in the low stress environment (p<0.01. There was no significant interaction of 5-HTTLPR genotype and work stress with methylation (p = 0.58. In unadjusted (bivariate analysis, burnout was not significantly associated to methylation levels. However, when mutually adjusted for both, burnout and work stress were significant contributors (p = 0.038 and p<0.0001 respectively to methylation levels.Our findings show that environmental stress is concurrent with decreased methylation of the SLC6A4 promoter. This may lead to increased transcriptional activity of the gene, increased reuptake of serotonin from synaptic clefts, and termination of the activity of serotonin. This could present a possible coping mechanism for environmental stress in humans that could eventually increase risk for disturbed functional
Directory of Open Access Journals (Sweden)
Jeong-Hyeon Choi
Full Text Available BACKGROUND: Follicular lymphoma (FL is a form of non-Hodgkin's lymphoma (NHL that arises from germinal center (GC B-cells. Despite the significant advances in immunotherapy, FL is still not curable. Beyond transcriptional profiling and genomics datasets, there currently is no epigenome-scale dataset or integrative biology approach that can adequately model this disease and therefore identify novel mechanisms and targets for successful prevention and treatment of FL. METHODOLOGY/PRINCIPAL FINDINGS: We performed methylation-enriched genome-wide bisulfite sequencing of FL cells and normal CD19(+ B-cells using 454 sequencing technology. The methylated DNA fragments were enriched with methyl-binding proteins, treated with bisulfite, and sequenced using the Roche-454 GS FLX sequencer. The total number of bases covered in the human genome was 18.2 and 49.3 million including 726,003 and 1.3 million CpGs in FL and CD19(+ B-cells, respectively. 11,971 and 7,882 methylated regions of interest (MRIs were identified respectively. The genome-wide distribution of these MRIs displayed significant differences between FL and normal B-cells. A reverse trend in the distribution of MRIs between the promoter and the gene body was observed in FL and CD19(+ B-cells. The MRIs identified in FL cells also correlated well with transcriptomic data and ChIP-on-Chip analyses of genome-wide histone modifications such as tri-methyl-H3K27, and tri-methyl-H3K4, indicating a concerted epigenetic alteration in FL cells. CONCLUSIONS/SIGNIFICANCE: This study is the first to provide a large scale and comprehensive analysis of the DNA methylation sequence composition and distribution in the FL epigenome. These integrated approaches have led to the discovery of novel and frequent targets of aberrant epigenetic alterations. The genome-wide bisulfite sequencing approach developed here can be a useful tool for profiling DNA methylation in clinical samples.
Directory of Open Access Journals (Sweden)
Xiaoguo Zheng
2017-12-01
Full Text Available DNA methylation is the major focus of studies on paternal epigenetic inheritance in mammals, but most previous studies about inheritable DNA methylation changes are passively induced by environmental factors. However, it is unclear whether the active changes mediated by variations in DNA methyltransferase activity are heritable. Here, we established human-derived DNMT3A (hDNMT3A transgenic rats to study the effect of hDNMT3A overexpression on the DNA methylation pattern of rat sperm and to investigate whether this actively altered DNA methylation status is inheritable. Our results revealed that hDNMT3A was overexpressed in the testis of transgenic rats and induced genome-wide alterations in the DNA methylation pattern of rat sperm. Among 5438 reliable loci identified with 64 primer-pair combinations using a methylation-sensitive amplification polymorphism method, 28.01% showed altered amplified band types. Among these amplicons altered loci, 68.42% showed an altered DNA methylation status in the offspring of transgenic rats compared with wild-type rats. Further analysis based on loci which had identical DNA methylation status in all three biological replicates revealed that overexpression of hDNMT3A in paternal testis induced hypermethylation in sperm of both genotype-negative and genotype-positive offspring. Among the differentially methylated loci, 34.26% occurred in both positive and negative offspring of transgenic rats, indicating intergenerational inheritance of active DNA methylation changes in the absence of hDNM3A transmission. Furthermore, 75.07% of the inheritable loci were hyper-methylated while the remaining were hypomethylated. Distribution analysis revealed that the DNA methylation variations mainly occurred in introns and intergenic regions. Functional analysis revealed that genes related to differentially methylated loci were involved in a wide range of functions. Finally, this study demonstrated that active DNA methylation
Impairment of sperm DNA methylation in male infertility: a meta-analytic study.
Santi, D; De Vincentis, S; Magnani, E; Spaggiari, G
2017-07-01
Considering the widespread use of assisted reproductive techniques (ART), DNA methylation of specific genes involved in spermatogenesis achieves increasingly clinical relevance, representing a possible explanation of increased incidence of syndromes related to genomic imprinting in medically assisted pregnancies. Several trials suggested a relationship between male sub-fertility and sperm DNA methylation, although its weight on seminal parameters alteration is still a matter of debate. To evaluate whether aberrant sperm DNA methylation of imprinted genes is associated with impaired sperm parameters. Meta-analysis of controlled clinical trials evaluating imprinted genes sperm DNA methylation comparing men with idiopathic infertility to fertile controls. Twenty-four studies were included, allowing a meta-analytic evaluation for H19, MEST, SNRPN, and LINE-1. When a high heterogeneity of the results was demonstrated, the random effect model was used. H19 methylation levels resulted significantly lower in 879 infertile compared with 562 fertile men (7.53%, 95% CI: 5.14-9.93%, p male infertility is associated with altered sperm methylation at H19, MEST, and SNRPN. Although its role in infertility remains unclear, sperm DNA methylation could be associated with the epigenetic risk in ART. In this setting, before proposing this analysis in clinical practice, an accurate identification of the most representative genes and a cost-effectiveness evaluation should be assessed in ad hoc prospective studies. © 2017 American Society of Andrology and European Academy of Andrology.
Thangaraju, Muthusamy; Karunakaran, Senthil K.; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D.; Ganapathy, Vadivel
2009-01-01
Background 3-Bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of ATP production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The present studies have uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. Methods Transport of 3-bromopyruvate via SLC5A8, a tumor suppressor and a Na+-coupled electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by FACS analysis and colony formation assay. Acetylation status of histone H4 was evaluated by Western blot. Results 3-Bromopyruvate is a transportable substrate for SLC5A8, with the transport process being Na+-coupled and electrogenic. MCF7 cells do not express SLC5A8 and are not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells undergo apoptosis in the presence of 3-bromopyruvate. This cell death is associated with inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identify HDAC1 and HDAC3 as the targets for 3-bromopyruvate. Conclusions 3-Bromopyruvate is transported into cells actively via the tumor suppressor SLC5A8 and the process is energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells leads to apoptosis, and the mechanism involves inhibition of HDAC1/HDAC3. PMID:19637353
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC455 (Link to dictyBase) - - - Contig-U16584-1 SLC455Z (Link... to Original site) - - SLC455Z 379 - - - - Show SLC455 Library SL (Link to library) Clone ID SLC455 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC455Q.Seq.d/ Representative seq. ID SLC45...5Z (Link to Original site) Representative DNA sequence >SLC455 (SLC455Q) /CSM/SL/SLC4-C/SLC455Q.Seq.d/ XXXXX...57 ) Dictyostelium discoideum slug cDNA, clone SLC469. 468 e-177 3 ( AU034549 ) Dictyostelium discoideum slug cDNA, clone SLC4
Thangaraju, Muthusamy; Karunakaran, Senthil K; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D; Ganapathy, Vadivel
2009-10-15
3-bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of adenosine triphosphate production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The current studies uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. The transport of 3-bromopyruvate by sodium-coupled monocarboxylate transporter SMCT1 (SLC5A8), a tumor suppressor and a sodium (Na+)-coupled, electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by fluorescence-activated cell-sorting analysis and colony-formation assay. The acetylation status of histone H4 was evaluated by Western blot analysis. 3-Bromopyruvate is a transportable substrate for SLC5A8, and that transport process is Na+-coupled and electrogenic. MCF7 cells did not express SLC5A8 and were not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells underwent apoptosis in the presence of 3-bromopyruvate. This cell death was associated with the inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identified HDAC1 and HDAC3 as the targets for 3-bromopyruvate. 3-Bromopyruvate was transported into cells actively through the tumor suppressor SLC5A8, and the process was energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells led to apoptosis, and the mechanism involved the inhibition of HDAC1/HDAC3. Copyright (c) 2009 American Cancer Society.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC433 (Link to dictyBase) - - - Contig-U16397-1 SLC433Z (Link... to Original site) - - SLC433Z 613 - - - - Show SLC433 Library SL (Link to library) Clone ID SLC433 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC433Q.Seq.d/ Representative seq. ID SLC43...3Z (Link to Original site) Representative DNA sequence >SLC433 (SLC433Q) /CSM/SL/SLC4-B/SLC433Q.Seq.d/ XXXXX...tyostelium discoideum slug cDNA, clone SLH872. 1134 0.0 1 ( AU034279 ) Dictyostelium discoideum slug cDNA, clone SLC4
Methyl-Analyzer--whole genome DNA methylation profiling.
Xin, Yurong; Ge, Yongchao; Haghighi, Fatemeh G
2011-08-15
Methyl-Analyzer is a python package that analyzes genome-wide DNA methylation data produced by the Methyl-MAPS (methylation mapping analysis by paired-end sequencing) method. Methyl-MAPS is an enzymatic-based method that uses both methylation-sensitive and -dependent enzymes covering >80% of CpG dinucleotides within mammalian genomes. It combines enzymatic-based approaches with high-throughput next-generation sequencing technology to provide whole genome DNA methylation profiles. Methyl-Analyzer processes and integrates sequencing reads from methylated and unmethylated compartments and estimates CpG methylation probabilities at single base resolution. Methyl-Analyzer is available at http://github.com/epigenomics/methylmaps. Sample dataset is available for download at http://epigenomicspub.columbia.edu/methylanalyzer_data.html. fgh3@columbia.edu Supplementary data are available at Bioinformatics online.
Kessels, Jana Elena; Wessels, Inga; Haase, Hajo; Rink, Lothar; Uciechowski, Peter
2016-09-01
The distribution of intracellular zinc, predominantly regulated through zinc transporters and zinc binding proteins, is required to support an efficient immune response. Epigenetic mechanisms such as DNA methylation are involved in the expression of these genes. In demethylation experiments using 5-Aza-2'-deoxycytidine (AZA) increased intracellular (after 24 and 48h) and total cellular zinc levels (after 48h) were observed in the myeloid cell line HL-60. To uncover the mechanisms that cause the disturbed zinc homeostasis after DNA demethylation, the expression of human zinc transporters and zinc binding proteins were investigated. Real time PCR analyses of 14 ZIP (solute-linked carrier (SLC) SLC39A; Zrt/IRT-like protein), and 9 ZnT (SLC30A) zinc transporters revealed significantly enhanced mRNA expression of the zinc importer ZIP1 after AZA treatment. Because ZIP1 protein was also enhanced after AZA treatment, ZIP1 up-regulation might be the mediator of enhanced intracellular zinc levels. The mRNA expression of ZIP14 was decreased, whereas zinc exporter ZnT3 mRNA was also significantly increased; which might be a cellular reaction to compensate elevated zinc levels. An enhanced but not significant chromatin accessibility of ZIP1 promoter region I was detected by chromatin accessibility by real-time PCR (CHART) assays after demethylation. Additionally, DNA demethylation resulted in increased mRNA accumulation of zinc binding proteins metallothionein (MT) and S100A8/S100A9 after 48h. MT mRNA was significantly enhanced after 24h of AZA treatment also suggesting a reaction of the cell to restore zinc homeostasis. These data indicate that DNA methylation is an important epigenetic mechanism affecting zinc binding proteins and transporters, and, therefore, regulating zinc homeostasis in myeloid cells. Copyright © 2016 Elsevier GmbH. All rights reserved.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4
Directory of Open Access Journals (Sweden)
Fumiharu Ohka
Full Text Available Gliomas are the most frequently occurring primary brain tumor in the central nervous system of adults. Glioblastoma multiformes (GBMs, WHO grade 4 have a dismal prognosis despite the use of the alkylating agent, temozolomide (TMZ, and even low grade gliomas (LGGs, WHO grade 2 eventually transform to malignant secondary GBMs. Although GBM patients benefit from promoter hypermethylation of the O(6-methylguanine-DNA methyltransferase (MGMT that is the main determinant of resistance to TMZ, recent studies suggested that MGMT promoter methylation is of prognostic as well as predictive significance for the efficacy of TMZ. Glioma-CpG island methylator phenotype (G-CIMP in the global genome was shown to be a significant predictor of improved survival in patients with GBM. Collectively, we hypothesized that MGMT promoter methylation might reflect global DNA methylation. Additionally in LGGs, the significance of MGMT promoter methylation is still undetermined. In the current study, we aimed to determine the correlation between clinical, genetic, and epigenetic profiles including LINE-1 and different cancer-related genes and the clinical outcome in newly diagnosed 57 LGG and 54 GBM patients. Here, we demonstrated that (1 IDH1/2 mutation is closely correlated with MGMT promoter methylation and 1p/19q codeletion in LGGs, (2 LINE-1 methylation levels in primary and secondary GBMs are lower than those in LGGs and normal brain tissues, (3 LINE-1 methylation is proportional to MGMT promoter methylation in gliomas, and (4 higher LINE-1 methylation is a favorable prognostic factor in primary GBMs, even compared to MGMT promoter methylation. As a global DNA methylation marker, LINE-1 may be a promising marker in gliomas.
Antagonism between DNA and H3K27 methylation at the imprinted Rasgrf1 locus
DEFF Research Database (Denmark)
Lindroth, Anders M; Park, Yoon Jung; McLean, Chelsea M
2008-01-01
At the imprinted Rasgrf1 locus in mouse, a cis-acting sequence controls DNA methylation at a differentially methylated domain (DMD). While characterizing epigenetic marks over the DMD, we observed that DNA and H3K27 trimethylation are mutually exclusive, with DNA and H3K27 methylation limited...... to the paternal and maternal sequences, respectively. The mutual exclusion arises because one mark prevents placement of the other. We demonstrated this in five ways: using 5-azacytidine treatments and mutations at the endogenous locus that disrupt DNA methylation; using a transgenic model in which the maternal...
Deep sequencing reveals distinct patterns of DNA methylation in prostate cancer.
Kim, Jung H; Dhanasekaran, Saravana M; Prensner, John R; Cao, Xuhong; Robinson, Daniel; Kalyana-Sundaram, Shanker; Huang, Christina; Shankar, Sunita; Jing, Xiaojun; Iyer, Matthew; Hu, Ming; Sam, Lee; Grasso, Catherine; Maher, Christopher A; Palanisamy, Nallasivam; Mehra, Rohit; Kominsky, Hal D; Siddiqui, Javed; Yu, Jindan; Qin, Zhaohui S; Chinnaiyan, Arul M
2011-07-01
Beginning with precursor lesions, aberrant DNA methylation marks the entire spectrum of prostate cancer progression. We mapped the global DNA methylation patterns in select prostate tissues and cell lines using MethylPlex-next-generation sequencing (M-NGS). Hidden Markov model-based next-generation sequence analysis identified ∼68,000 methylated regions per sample. While global CpG island (CGI) methylation was not differential between benign adjacent and cancer samples, overall promoter CGI methylation significantly increased from ~12.6% in benign samples to 19.3% and 21.8% in localized and metastatic cancer tissues, respectively (P-value prostate tissues, 2481 differentially methylated regions (DMRs) are cancer-specific, including numerous novel DMRs. A novel cancer-specific DMR in the WFDC2 promoter showed frequent methylation in cancer (17/22 tissues, 6/6 cell lines), but not in the benign tissues (0/10) and normal PrEC cells. Integration of LNCaP DNA methylation and H3K4me3 data suggested an epigenetic mechanism for alternate transcription start site utilization, and these modifications segregated into distinct regions when present on the same promoter. Finally, we observed differences in repeat element methylation, particularly LINE-1, between ERG gene fusion-positive and -negative cancers, and we confirmed this observation using pyrosequencing on a tissue panel. This comprehensive methylome map will further our understanding of epigenetic regulation in prostate cancer progression.
Zhang, Wei; Yan, Wei; You, Gan; Bao, Zhaoshi; Wang, Yongzhi; Liu, Yanwei; You, Yongping; Jiang, Tao
2013-01-01
To date, the aberrations in the DNA methylation patterns that are associated with different prognoses of G-CIMP- primary GBMs remain to be elucidated. Here, DNA methylation profiling of primary GBM tissues from 13 long-term survivors (LTS; overall survival ⩾18months) and 20 short-term survivors (STS; overall survival ⩽9months) was performed. Then G-CIMP+ samples were excluded. The differentially expressed CpG loci were identified between residual 18 STS and 9 LTS G-CIMP- samples. Methylation levels of 11 CpG loci (10genes) were statistically significantly lower, and 43 CpG loci (40genes) were statistically significantly higher in the tumor tissues of LTS than those of STS G-CIMP- samples (PCIMP- samples, 3 CpG loci localized in the promoter of ALDH1A3. Furthermore, using an independent validation cohort containing 37 primary GBM samples without IDH1 mutation and MGMT promoter methylation, the hypermethylation status of ALDH1A3 promoter predicted a better prognosis with an accompanied low expression of ALDH1A3 protein. Taken together, our results defined prognosis-related methylation signatures systematically for the first time in G-CIMP- primary GBMs. ALDH1A3 promoter methylation conferred a favorable prognosis in G-CIMP- primary GBMs. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
DNA Methylation Modulates Nociceptive Sensitization after Incision.
Directory of Open Access Journals (Sweden)
Yuan Sun
Full Text Available DNA methylation is a key epigenetic mechanism controlling DNA accessibility and gene expression. Blockade of DNA methylation can significantly affect pain behaviors implicated in neuropathic and inflammatory pain. However, the role of DNA methylation with regard to postoperative pain has not yet been explored. In this study we sought to investigate the role of DNA methylation in modulating incisional pain and identify possible targets under DNA methylation and contributing to incisional pain. DNA methyltranferase (DNMT inhibitor 5-Aza-2'-deoxycytidine significantly reduced incision-induced mechanical allodynia and thermal sensitivity. Aza-2'-deoxycytidine also reduced hindpaw swelling after incision, suggesting an anti-inflammatory effect. Global DNA methylation and DNMT3b expression were increased in skin after incision, but none of DNMT1, DNMT3a or DNMT3b was altered in spinal cord or DRG. The expression of proopiomelanocortin Pomc encoding β-endorphin and Oprm1 encoding the mu-opioid receptor were upregulated peripherally after incision; moreover, Oprm1 expression was further increased under DNMT inhibitor treatment. Finally, local peripheral injection of the opioid receptor antagonist naloxone significantly exacerbated incision-induced mechanical hypersensitivity. These results suggest that DNA methylation is functionally relevant to incisional nociceptive sensitization, and that mu-opioid receptor signaling might be one methylation regulated pathway controlling sensitization after incision.
Han, Yiwei; Yang, Zi; Ding, Xiaoyan; Yu, Huan; Yi, Yanhong
2015-10-01
By detecting the variation of long-chain 3-hydroxyacyl-CoA dehydrogenase (LCHAD) DNA methylation in preeclampsia-like mouse models generated by different ways, to explore the roles of multifactor and multiple pathways in preeclampsia pathogenesis on molecular basis. Established preeclampsia-like mouse models in different ways and divided into groups as follows: (1) Nw-nitro-L-arginine-methyl ester (L-NAME) group: wild-type pregnant mouse received subcutaneous injection of L-NAME; (2) lipopolysaccharide (LPS) group: wild-type pregnant mouse received intraperitoneal injection of LPS; (3) apolipoprotein C-III (ApoC3) group: ApoC3 transgenic pregnant mouse with dysregulated lipid metabolism received subcutaneous injection of L-NAME; (4) β2 glycoprotein I (β-2GPI) group: wild-type pregnant mouse received subcutaneous injection of β-2GPI. According to the first injection time (on day 3, 11, 16 respectively), the L-NAME, LPS and ApoC3 groups were further subdivided into: pre-implantation (PI) experimental stage, early gestation (EG) experimental stage, and late gestation (LG) experimental stage. β-2GPI group was only injected before implantation. LCHAD gene methylation levels in placental were detected in different experimental stage. Normal saline control groups were set within wild-type and ApoC3 transgenic pregnant mice simultaneously. (1) CG sites in LCHAD DNA: 45 CG sites were detected in the range of 728 bp before LCHAD gene transcription start site, the 5, 12, 13, 14, 15, 16, 19, 24, 25, 27, 28, 29, 30, 31, 32, 34, 35, 43 CG sites were complex sites which contained two or more CG sequences, others were single site which contained one CG sequence. The 3, 5, 6, 11, 13, 14, 18, 28 sites in L-NAME, LPS, ApoC3 and β-2GPI groups showed different high levels of methylation; the 16, 25, 31, 42, 44 sites showed different low levels of methylation; other 32 sites were unmethylated. (2) Comparison of LCHAD gene methylation between different groups: the methylation levels
DNA methylation analysis reveals distinct methylation signatures in pediatric germ cell tumors
International Nuclear Information System (INIS)
Amatruda, James F; Frazier, A Lindsay; Poynter, Jenny N; Ross, Julie A; Christensen, Brock; Fustino, Nicholas J; Chen, Kenneth S; Hooten, Anthony J; Nelson, Heather; Kuriger, Jacquelyn K; Rakheja, Dinesh
2013-01-01
Aberrant DNA methylation is a prominent feature of many cancers, and may be especially relevant in germ cell tumors (GCTs) due to the extensive epigenetic reprogramming that occurs in the germ line during normal development. We used the Illumina GoldenGate Cancer Methylation Panel to compare DNA methylation in the three main histologic subtypes of pediatric GCTs (germinoma, teratoma and yolk sac tumor (YST); N = 51) and used recursively partitioned mixture models (RPMM) to test associations between methylation pattern and tumor and demographic characteristics. We identified genes and pathways that were differentially methylated using generalized linear models and Ingenuity Pathway Analysis. We also measured global DNA methylation at LINE1 elements and evaluated methylation at selected imprinted loci using pyrosequencing. Methylation patterns differed by tumor histology, with 18/19 YSTs forming a distinct methylation class. Four pathways showed significant enrichment for YSTs, including a human embryonic stem cell pluripotency pathway. We identified 190 CpG loci with significant methylation differences in mature and immature teratomas (q < 0.05), including a number of CpGs in stem cell and pluripotency-related pathways. Both YST and germinoma showed significantly lower methylation at LINE1 elements compared with normal adjacent tissue while there was no difference between teratoma (mature and immature) and normal tissue. DNA methylation at imprinted loci differed significantly by tumor histology and location. Understanding methylation patterns may identify the developmental stage at which the GCT arose and the at-risk period when environmental exposures could be most harmful. Further, identification of relevant genetic pathways could lead to the development of new targets for therapy
Marzi, Sarah J; Sugden, Karen; Arseneault, Louise; Belsky, Daniel W; Burrage, Joe; Corcoran, David L; Danese, Andrea; Fisher, Helen L; Hannon, Eilis; Moffitt, Terrie E; Odgers, Candice L; Pariante, Carmine; Poulton, Richie; Williams, Benjamin S; Wong, Chloe C Y; Mill, Jonathan; Caspi, Avshalom
2018-01-12
DNA methylation has been proposed as an epigenetic mechanism by which early-life experiences become "embedded" in the genome and alter transcriptional processes to compromise health. The authors sought to investigate whether early-life victimization stress is associated with genome-wide DNA methylation. The authors tested the hypothesis that victimization is associated with DNA methylation in the Environmental Risk (E-Risk) Longitudinal Study, a nationally representative 1994-1995 birth cohort of 2,232 twins born in England and Wales and assessed at ages 5, 7, 10, 12, and 18 years. Multiple forms of victimization were ascertained in childhood and adolescence (including physical, sexual, and emotional abuse; neglect; exposure to intimate-partner violence; bullying; cyber-victimization; and crime). Epigenome-wide analyses of polyvictimization across childhood and adolescence revealed few significant associations with DNA methylation in peripheral blood at age 18, but these analyses were confounded by tobacco smoking and/or did not survive co-twin control tests. Secondary analyses of specific forms of victimization revealed sparse associations with DNA methylation that did not replicate across different operationalizations of the same putative victimization experience. Hypothesis-driven analyses of six candidate genes in the stress response (NR3C1, FKBP5, BDNF, AVP, CRHR1, SLC6A4) did not reveal predicted associations with DNA methylation in probes annotated to these genes. Findings from this epidemiological analysis of the epigenetic effects of early-life stress do not support the hypothesis of robust changes in DNA methylation in victimized young people. We need to come to terms with the possibility that epigenetic epidemiology is not yet well matched to experimental, nonhuman models in uncovering the biological embedding of stress.
Relationship between Gene Body DNA Methylation and Intragenic H3K9me3 and H3K36me3 Chromatin Marks
Hahn, Maria A.; Wu, Xiwei; Li, Arthur X.; Hahn, Torsten; Pfeifer, Gerd P.
2011-01-01
To elucidate the relationship between intragenic DNA methylation and chromatin marks, we performed epigenetic profiling of chromosome 19 in human bronchial epithelial cells (HBEC) and in the colorectal cancer cell line HCT116 as well as its counterpart with double knockout of DNMT1 and DNMT3B (HCT116-DKO). Analysis of H3K36me3 profiles indicated that this intragenic mark of active genes is associated with two categories of genes: (i) genes with low CpG density and H3K9me3 in the gene body or ...
DEFF Research Database (Denmark)
Williams, Kristine; Christensen, Jesper; Helin, Kristian
2012-01-01
DNA methylation is involved in key cellular processes, including X-chromosome inactivation, imprinting and transcriptional silencing of specific genes and repetitive elements. DNA methylation patterns are frequently perturbed in human diseases such as imprinting disorders and cancer. The recent...... discovery that the three members of the TET protein family can convert 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) has provided a potential mechanism leading to DNA demethylation. Moreover, the demonstration that TET2 is frequently mutated in haematopoietic tumours suggests that the TET...... proteins are important regulators of cellular identity. Here, we review the current knowledge regarding the function of the TET proteins, and discuss various mechanisms by which they contribute to transcriptional control. We propose that the TET proteins have an important role in regulating DNA methylation...
DNA damage, homology-directed repair, and DNA methylation.
Directory of Open Access Journals (Sweden)
Concetta Cuozzo
2007-07-01
Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.
Usability of human Infinium MethylationEPIC BeadChip for mouse DNA methylation studies.
Needhamsen, Maria; Ewing, Ewoud; Lund, Harald; Gomez-Cabrero, David; Harris, Robert Adam; Kular, Lara; Jagodic, Maja
2017-11-15
The advent of array-based genome-wide DNA methylation methods has enabled quantitative measurement of single CpG methylation status at relatively low cost and sample input. Whereas the use of Infinium Human Methylation BeadChips has shown great utility in clinical studies, no equivalent tool is available for rodent animal samples. We examined the feasibility of using the new Infinium MethylationEPIC BeadChip for studying DNA methylation in mouse. In silico, we identified 19,420 EPIC probes (referred as mEPIC probes), which align with a unique best alignment score to the bisulfite converted reference mouse genome mm10. Further annotation revealed that 85% of mEPIC probes overlapped with mm10.refSeq genes at different genomic features including promoters (TSS1500 and TSS200), 1st exons, 5'UTRs, 3'UTRs, CpG islands, shores, shelves, open seas and FANTOM5 enhancers. Hybridization of mouse samples to Infinium Human MethylationEPIC BeadChips showed successful measurement of mEPIC probes and reproducibility between inter-array biological replicates. Finally, we demonstrated the utility of mEPIC probes for data exploration such as hierarchical clustering. Given the absence of cost and labor convenient genome-wide technologies in the murine system, our findings show that the Infinium MethylationEPIC BeadChip platform is suitable for investigation of the mouse methylome. Furthermore, we provide the "mEPICmanifest" with genomic features, available to users of Infinium Human MethylationEPIC arrays for mouse samples.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL
Smith, Jennifer A; Zhao, Wei; Wang, Xu; Ratliff, Scott M; Mukherjee, Bhramar; Kardia, Sharon L R; Liu, Yongmei; Roux, Ava V Diez; Needham, Belinda L
2017-08-01
Living in a disadvantaged neighborhood is associated with poor health outcomes even after accounting for individual-level socioeconomic factors. The chronic stress of unfavorable neighborhood conditions may lead to dysregulation of the stress reactivity and inflammatory pathways, potentially mediated through epigenetic mechanisms such as DNA methylation. We used multi-level models to examine the relationship between 2 neighborhood conditions and methylation levels of 18 genes related to stress reactivity and inflammation in purified monocytes from 1,226 participants of the Multi-Ethnic Study of Atherosclerosis (MESA), a population-based sample of US adults. Neighborhood socioeconomic disadvantage, a summary of 16 census-based metrics, was associated with DNA methylation [False discovery rate (FDR) q-value ≤ 0.1] in 2 out of 7 stress-related genes evaluated (CRF, SLC6A4) and 2 out of 11 inflammation-related genes (F8, TLR1). Neighborhood social environment, a summary measure of aesthetic quality, safety, and social cohesion, was associated with methylation in 4 of the 7 stress-related genes (AVP, BDNF, FKBP5, SLC6A4) and 7 of the 11 inflammation-related genes (CCL1, CD1D, F8, KLRG1, NLRP12, SLAMF7, TLR1). High socioeconomic disadvantage and worse social environment were primarily associated with increased methylation. In 5 genes with significant associations between neighborhood and methylation (FKBP5, CD1D, F8, KLRG1, NLRP12), methylation was associated with gene expression of at least one transcript. These results demonstrate that multiple dimensions of neighborhood context may influence methylation levels and subsequent gene expression of stress- and inflammation-related genes, even after accounting for individual socioeconomic factors. Further elucidating the molecular mechanisms underlying these relationships will be important for understanding the etiology of health disparities.
Global DNA methylation analysis using methyl-sensitive amplification polymorphism (MSAP).
Yaish, Mahmoud W; Peng, Mingsheng; Rothstein, Steven J
2014-01-01
DNA methylation is a crucial epigenetic process which helps control gene transcription activity in eukaryotes. Information regarding the methylation status of a regulatory sequence of a particular gene provides important knowledge of this transcriptional control. DNA methylation can be detected using several methods, including sodium bisulfite sequencing and restriction digestion using methylation-sensitive endonucleases. Methyl-Sensitive Amplification Polymorphism (MSAP) is a technique used to study the global DNA methylation status of an organism and hence to distinguish between two individuals based on the DNA methylation status determined by the differential digestion pattern. Therefore, this technique is a useful method for DNA methylation mapping and positional cloning of differentially methylated genes. In this technique, genomic DNA is first digested with a methylation-sensitive restriction enzyme such as HpaII, and then the DNA fragments are ligated to adaptors in order to facilitate their amplification. Digestion using a methylation-insensitive isoschizomer of HpaII, MspI is used in a parallel digestion reaction as a loading control in the experiment. Subsequently, these fragments are selectively amplified by fluorescently labeled primers. PCR products from different individuals are compared, and once an interesting polymorphic locus is recognized, the desired DNA fragment can be isolated from a denaturing polyacrylamide gel, sequenced and identified based on DNA sequence similarity to other sequences available in the database. We will use analysis of met1, ddm1, and atmbd9 mutants and wild-type plants treated with a cytidine analogue, 5-azaC, or zebularine to demonstrate how to assess the genetic modulation of DNA methylation in Arabidopsis. It should be noted that despite the fact that MSAP is a reliable technique used to fish for polymorphic methylated loci, its power is limited to the restriction recognition sites of the enzymes used in the genomic
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC437 (Link to dictyBase) - - - Contig-U16397-1 SLC437Z (Link... to Original site) - - SLC437Z 622 - - - - Show SLC437 Library SL (Link to library) Clone ID SLC437 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC437Q.Seq.d/ Representative seq. ID SLC43...7Z (Link to Original site) Representative DNA sequence >SLC437 (SLC437Q) /CSM/SL/SLC4-B/SLC437Q.Seq.d/ XXXXX...scoideum slug cDNA, clone SLC437. 1158 0.0 1 ( AU033994 ) Dictyostelium discoideum slug cDNA, clone SLB708.
Epigenetic Variation in Monozygotic Twins: A Genome-Wide Analysis of DNA Methylation in Buccal Cells
Directory of Open Access Journals (Sweden)
Jenny van Dongen
2014-05-01
Full Text Available DNA methylation is one of the most extensively studied epigenetic marks in humans. Yet, it is largely unknown what causes variation in DNA methylation between individuals. The comparison of DNA methylation profiles of monozygotic (MZ twins offers a unique experimental design to examine the extent to which such variation is related to individual-specific environmental influences and stochastic events or to familial factors (DNA sequence and shared environment. We measured genome-wide DNA methylation in buccal samples from ten MZ pairs (age 8–19 using the Illumina 450k array and examined twin correlations for methylation level at 420,921 CpGs after QC. After selecting CpGs showing the most variation in the methylation level between subjects, the mean genome-wide correlation (rho was 0.54. The correlation was higher, on average, for CpGs within CpG islands (CGIs, compared to CGI shores, shelves and non-CGI regions, particularly at hypomethylated CpGs. This finding suggests that individual-specific environmental and stochastic influences account for more variation in DNA methylation in CpG-poor regions. Our findings also indicate that it is worthwhile to examine heritable and shared environmental influences on buccal DNA methylation in larger studies that also include dizygotic twins.
Evolution of DNA Methylation across Insects.
Bewick, Adam J; Vogel, Kevin J; Moore, Allen J; Schmitz, Robert J
2017-03-01
DNA methylation contributes to gene and transcriptional regulation in eukaryotes, and therefore has been hypothesized to facilitate the evolution of plastic traits such as sociality in insects. However, DNA methylation is sparsely studied in insects. Therefore, we documented patterns of DNA methylation across a wide diversity of insects. We predicted that underlying enzymatic machinery is concordant with patterns of DNA methylation. Finally, given the suggestion that DNA methylation facilitated social evolution in Hymenoptera, we tested the hypothesis that the DNA methylation system will be associated with presence/absence of sociality among other insect orders. We found DNA methylation to be widespread, detected in all orders examined except Diptera (flies). Whole genome bisulfite sequencing showed that orders differed in levels of DNA methylation. Hymenopteran (ants, bees, wasps and sawflies) had some of the lowest levels, including several potential losses. Blattodea (cockroaches and termites) show all possible patterns, including a potential loss of DNA methylation in a eusocial species whereas solitary species had the highest levels. Species with DNA methylation do not always possess the typical enzymatic machinery. We identified a gene duplication event in the maintenance DNA methyltransferase 1 (DNMT1) that is shared by some Hymenoptera, and paralogs have experienced divergent, nonneutral evolution. This diversity and nonneutral evolution of underlying machinery suggests alternative DNA methylation pathways may exist. Phylogenetically corrected comparisons revealed no evidence that supports evolutionary association between sociality and DNA methylation. Future functional studies will be required to advance our understanding of DNA methylation in insects. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Radiation effects on DNA methylation in mice
International Nuclear Information System (INIS)
Komura, J.; Kurishita, A.; Miyamura, Y.; Ono, T.; Tawa, R.; Sakurai, H.
1992-01-01
Effects of ionizing radiation on DNA methylation in liver, brain and spleen were examined by high performance liquid chromatography (HPLC). The total methylated cytosine level in the genome was reduced within 8 hours after 3.8 Gy of irradiation in liver of adult mice. But no appreciable effect was observed in brain and spleen. When mice were irradiated at newborn, liver DNA revealed no change in methylated cytosine level. Even though slight effects of radiation were detected in he methylation of the c-myc and c-fos genes, they were only temporary and no long-term effects were observed. These data suggest that the effect of radiation on DNA methylation in vivo is not prevailing a DNA damage, but rather influenced much through biological parameters. (author)
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC494 (Link to dictyBase) - - - Contig-U16260-1 SLC494Z (Link... to Original site) - - SLC494Z 451 - - - - Show SLC494 Library SL (Link to library) Clone ID SLC494 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC494Q.Seq.d/ Representative seq. ID SLC49...4Z (Link to Original site) Representative DNA sequence >SLC494 (SLC494Q) /CSM/SL/SLC4-D/SLC494Q.Seq.d/ XXXXX...a: 0.00 m3b: 0.00 m_ : 1.00 52.0 %: cytoplasmic 36.0 %: nuclear 8.0 %: cytoskeletal 4.0 %: mitochondrial >> prediction for SLC4
DNA methylation and memory formation.
Day, Jeremy J; Sweatt, J David
2010-11-01
Memory formation and storage require long-lasting changes in memory-related neuronal circuits. Recent evidence indicates that DNA methylation may serve as a contributing mechanism in memory formation and storage. These emerging findings suggest a role for an epigenetic mechanism in learning and long-term memory maintenance and raise apparent conundrums and questions. For example, it is unclear how DNA methylation might be reversed during the formation of a memory, how changes in DNA methylation alter neuronal function to promote memory formation, and how DNA methylation patterns differ between neuronal structures to enable both consolidation and storage of memories. Here we evaluate the existing evidence supporting a role for DNA methylation in memory, discuss how DNA methylation may affect genetic and neuronal function to contribute to behavior, propose several future directions for the emerging subfield of neuroepigenetics, and begin to address some of the broader implications of this work.
DNA methylation in metabolic disorders
DEFF Research Database (Denmark)
Barres, Romain; Zierath, Juleen R
2011-01-01
DNA methylation is a major epigenetic modification that controls gene expression in physiologic and pathologic states. Metabolic diseases such as diabetes and obesity are associated with profound alterations in gene expression that are caused by genetic and environmental factors. Recent reports...... have provided evidence that environmental factors at all ages could modify DNA methylation in somatic tissues, which suggests that DNA methylation is a more dynamic process than previously appreciated. Because of the importance of lifestyle factors in metabolic disorders, DNA methylation provides...... a mechanism by which environmental factors, including diet and exercise, can modify genetic predisposition to disease. This article considers the current evidence that defines a role for DNA methylation in metabolic disorders....
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC483 (Link to dictyBase) - - - Contig-U16486-1 SLC483F (Link to Original site) SLC4...83F 718 - - - - - - Show SLC483 Library SL (Link to library) Clone ID SLC483 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC483Q.Seq.d/ Representative seq. ID SLC48...3F (Link to Original site) Representative DNA sequence >SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ AAAAA...roducing significant alignments: (bits) Value SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ 1423 0.0 SLE651
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4
DNA methylation in human fibroblasts following DNA damage and repair
International Nuclear Information System (INIS)
Kastan, M.B.
1984-01-01
Methylation of deoxycytidine (dCyd) incorporated by DNA excision repair synthesis in human diploid fibroblasts following damage with ultraviolet radiation (UV), N-methyl-N-nitrosourea, or N-acetoxy-2-acetylaminofluorene was studied utilizing [6- 3 H]dCyd to label repaired DNA specifically and high performance liquid chromatographic analysis to quantify the percentage of deoxycytidine converted to 5-methyldeoxycytidine (m 5 dCyd). In confluent, nondividing cells, methylation in repair patches induced by all three agents is slow and incomplete. Whereas after DNA replication a level of 3.4% m 5 dCyd is reached in less than 2 hours, following UV-stimulated repair synthesis in confluent cells it takes about 3 days to reach a level of approx.2.0% m 5 dCyd in the repair patch. This undermethylation of repair patches occurs throughout the genome. In cells from cultures in logarithmic-phase growth, m 5 dCyd formation in UV-induced repair patches occurs faster and to a greater extent, reaching a level of approx.2.7% in 10-20 hours. Pre-existing hypomethylated repair patches in confluent cells are methylated further when the cells are stimulated to divide; however, the repair patch may still not be fully methylated before cell division occurs. Thus DNA damage and repair may lead to heritable loss of methylation at some sites. The distribution within chromatin of m 5 dCyd in repair patches was also investigated. Over a wide range of extents of digestion by staphylococcal nuclease or deoxyribonuclease I, the level of hypomethylation in repaired DNA in nuclease sensitive and resistant regions of chromatin was constant relative to the genomic level of methylation in these regions. Similar conclusions were reached in experiments with isolated mononucleosomes
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4
Cord blood buffy coat DNA methylation is comparable to whole cord blood methylation.
Dou, John; Schmidt, Rebecca J; Benke, Kelly S; Newschaffer, Craig; Hertz-Picciotto, Irva; Croen, Lisa A; Iosif, Ana-Maria; LaSalle, Janine M; Fallin, M Daniele; Bakulski, Kelly M
2018-01-01
Cord blood DNA methylation is associated with numerous health outcomes and environmental exposures. Whole cord blood DNA reflects all nucleated blood cell types, while centrifuging whole blood separates red blood cells, generating a white blood cell buffy coat. Both sample types are used in DNA methylation studies. Cell types have unique methylation patterns and processing can impact cell distributions, which may influence comparability. We evaluated differences in cell composition and DNA methylation between cord blood buffy coat and whole cord blood samples. Cord blood DNA methylation was measured with the Infinium EPIC BeadChip (Illumina) in eight individuals, each contributing buffy coat and whole blood samples. We analyzed principal components (PC) of methylation, performed hierarchical clustering, and computed correlations of mean-centered methylation between pairs. We conducted moderated t-tests on single sites and estimated cell composition. DNA methylation PCs were associated with individual (P PC1 = 1.4 × 10 -9 ; P PC2 = 2.9 × 10 -5 ; P PC3 = 3.8 × 10 -5 ; P PC4 = 4.2 × 10 -6 ; P PC5 = 9.9 × 10 -13 , P PC6 = 1.3 × 10 -11 ) and not with sample type (P PC1-6 >0.7). Samples hierarchically clustered by individual. Pearson correlations of mean-centered methylation between paired samples ranged from r = 0.66 to r = 0.87. No individual site significantly differed between buffy coat and whole cord blood when adjusting for multiple comparisons (five sites had unadjusted Pcoat and whole cord blood are much lower than inter-individual variation, demonstrating that both sample preparation types can be analytically combined and compared.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC480 (Link to dictyBase) - - - Contig-U13538-1 SLC480Z (Link... to Original site) - - SLC480Z 455 - - - - Show SLC480 Library SL (Link to library) Clone ID SLC480 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC480Q.Seq.d/ Representative seq. ID SLC48...0Z (Link to Original site) Representative DNA sequence >SLC480 (SLC480Q) /CSM/SL/SLC4-D/SLC480Q.Seq.d/ XXXXX...ial 8.0 %: peroxisomal >> prediction for SLC480 is nuc 5' end seq. ID - 5' end seq. - Length of 5' end seq. - 3' end seq. ID SLC4
Directory of Open Access Journals (Sweden)
Michele eRamsay
2015-03-01
Full Text Available Fetal alcohol syndrome (FAS is a devastating developmental disorder resulting from alcohol exposure during fetal development. It is a considerable public health problem worldwide and is characterised by central nervous system abnormalities, dysmorphic facial features and growth retardation. Imprinted genes are known to play an important role in growth and development and therefore four imprinting control regions (ICRs, H19 ICR, IG-DMR, CvDMR1 and PEG3 DMR were examined. It is proposed that DNA methylation changes may contribute to developmental abnormalities seen in FAS and which persist into adulthood. The participants included FAS children and controls from the Western and Northern Cape Provinces. DNA samples extracted from blood and buccal cells were bisulfite modified, the ICRs were amplified by PCR and pyrosequencing was used to derive a quantitative estimate of methylation at selected CpG dinucleotides: H19 ICR (6 CpG sites; 50 controls and 73 cases; KvDMR1 (7; 55 and 86; IG-DMR (10; 56 and 84; and PEG3 DMR (7; 50 and 79. The most profound effects of alcohol exposure are on neuronal development. In this study we report on epigenetic effects observed in blood which may not directly reflect tissue-specific alterations in the developing brain. After adjusting for age and sex (known confounders for DNA methylation, there was a significant difference at KvDMR1 and PEG, but not the H19 ICR, with only a small effect (0.84% lower in cases; p=0.035 at IG-DMR. The two maternally imprinted loci, KvDMR1 and PEG3 DMR, showed lower average locus-wide methylation in the FAS cases (1.49%; p<0.001 and 7.09%; p<0.001, respectively. The largest effect was at the PEG3 DMR though the functional impact is uncertain. This study supports the role of epigenetic modulation as a mechanism for the teratogenic effects of alcohol by altering the methylation profiles of imprinted loci in a locus-specific manner.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4
Directory of Open Access Journals (Sweden)
Pereira Fred A
2005-08-01
Full Text Available Abstract Background Cochlear outer hair cells change their length in response to variations in membrane potential. This capability, called electromotility, is believed to enable the sensitivity and frequency selectivity of the mammalian cochlea. Prestin is a transmembrane protein required for electromotility. Homozygous prestin knockout mice are profoundly hearing impaired. In humans, a single nucleotide change in SLC26A5, encoding prestin, has been reported in association with hearing loss. This DNA sequence variation, IVS2-2A>G, occurs in the exon 3 splice acceptor site and is expected to abolish splicing of exon 3. Methods To further explore the relationship between hearing loss and the IVS2-2A>G transition, and assess allele frequency, genomic DNA from hearing impaired and control subjects was analyzed by DNA sequencing. SLC26A5 genomic DNA sequences from human, chimp, rat, mouse, zebrafish and fruit fly were aligned and compared for evolutionary conservation of the exon 3 splice acceptor site. Alternative splice acceptor sites within intron 2 of human SLC26A5 were sought using a splice site prediction program from the Berkeley Drosophila Genome Project. Results The IVS2-2A>G variant was found in a heterozygous state in 4 of 74 hearing impaired subjects of Hispanic, Caucasian or uncertain ethnicity and 4 of 150 Hispanic or Caucasian controls (p = 0.45. The IVS2-2A>G variant was not found in 106 subjects of Asian or African American descent. No homozygous subjects were identified (n = 330. Sequence alignment of SLC26A5 orthologs demonstrated that the A nucleotide at position IVS2-2 is invariant among several eukaryotic species. Sequence analysis also revealed five potential alternative splice acceptor sites in intron 2 of human SLC26A5. Conclusion These data suggest that the IVS2-2A>G variant may not occur more frequently in hearing impaired subjects than in controls. The identification of five potential alternative splice acceptor sites in
Links between DNA methylation and nucleosome occupancy in the human genome.
Collings, Clayton K; Anderson, John N
2017-01-01
DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.
Schwartzman, Jacob; Mongoue-Tchokote, Solange; Gibbs, Angela; Gao, Lina; Corless, Christopher L; Jin, Jennifer; Zarour, Luai; Higano, Celestia; True, Lawrence D; Vessella, Robert L; Wilmot, Beth; Bottomly, Daniel; McWeeney, Shannon K; Bova, G Steven; Partin, Alan W; Mori, Motomi; Alumkal, Joshi
2011-10-01
DNA methylation of promoter regions is a common event in prostate cancer, one of the most common cancers in men worldwide. Because prior reports demonstrating that DNA methylation is important in prostate cancer studied a limited number of genes, we systematically quantified the DNA methylation status of 1505 CpG dinucleotides for 807 genes in 78 paraffin-embedded prostate cancer samples and three normal prostate samples. The ERG gene, commonly repressed in prostate cells in the absence of an oncogenic fusion to the TMPRSS2 gene, was one of the most commonly methylated genes, occurring in 74% of prostate cancer specimens. In an independent group of patient samples, we confirmed that ERG DNA methylation was common, occurring in 57% of specimens, and cancer-specific. The ERG promoter is marked by repressive chromatin marks mediated by polycomb proteins in both normal prostate cells and prostate cancer cells, which may explain ERG's predisposition to DNA methylation and the fact that tumors with ERG DNA methylation were more methylated, in general. These results demonstrate that bead arrays offer a high-throughput method to discover novel genes with promoter DNA methylation such as ERG, whose measurement may improve our ability to more accurately detect prostate cancer.
DNA methylation changes at infertility genes in newborn twins conceived by in vitro fertilisation.
Castillo-Fernandez, Juan E; Loke, Yuk Jing; Bass-Stringer, Sebastian; Gao, Fei; Xia, Yudong; Wu, Honglong; Lu, Hanlin; Liu, Yuan; Wang, Jun; Spector, Tim D; Saffery, Richard; Craig, Jeffrey M; Bell, Jordana T
2017-03-24
The association of in vitro fertilisation (IVF) and DNA methylation has been studied predominantly at regulatory regions of imprinted genes and at just thousands of the ~28 million CpG sites in the human genome. We investigated the links between IVF and DNA methylation patterns in whole cord blood cells (n = 98) and cord blood mononuclear cells (n = 82) from newborn twins using genome-wide methylated DNA immunoprecipitation coupled with deep sequencing. At a false discovery rate (FDR) of 5%, we identified one significant whole blood DNA methylation change linked to conception via IVF, which was located ~3 kb upstream of TNP1, a gene previously linked to male infertility. The 46 most strongly associated signals (FDR of 25%) included a second region in a gene also previously linked to infertility, C9orf3, suggesting that our findings may in part capture the effect of parental subfertility. Using twin modelling, we observed that individual-specific environmental factors appear to be the main overall contributors of methylation variability at the FDR 25% IVF-associated differentially methylated regions, although evidence for methylation heritability was also obtained at several of these regions. We replicated previous findings of differential methylation associated with IVF at the H19/IGF2 region in cord blood mononuclear cells, and we validated the signal at C9orf3 in monozygotic twins. We also explored the impact of intracytoplasmic sperm injection on the FDR 25% signals for potential effects specific to male or female infertility factors. To our knowledge, this is the most comprehensive study of DNA methylation profiles at birth and IVF conception to date, and our results show evidence for epigenetic modifications that may in part reflect parental subfertility.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4
Maternal Stress, Preterm Birth, and DNA Methylation at Imprint Regulatory Sequences in Humans
Directory of Open Access Journals (Sweden)
Adriana C. Vidal
2014-01-01
Full Text Available In infants exposed to maternal stress in utero, phenotypic plasticity through epigenetic events may mechanistically explain increased risk of preterm birth (PTB, which confers increased risk for neurodevelopmental disorders, cardiovascular disease, and cancers in adulthood. We examined associations between prenatal maternal stress and PTB, evaluating the role of DNA methylation at imprint regulatory regions. We enrolled women from prenatal clinics in Durham, NC. Stress was measured in 537 women at 12 weeks of gestation using the Perceived Stress Scale. DNA methylation at differentially methylated regions (DMRs associated with H19, IGF2, MEG3, MEST, SGCE/PEG10, PEG3, NNAT , and PLAGL1 was measured from peripheral and cord blood using bisulfite pyrosequencing in a sub-sample of 79 mother–-infant pairs. We examined associations between PTB and stress and evaluated differences in DNA methylation at each DMR by stress. Maternal stress was not associated with PTB (OR = 0.98; 95% CI, 0.40–-2.40; P = 0.96, after adjustment for maternal body mass index (BMI, income, and raised blood pressure. However, elevated stress was associated with higher infant DNA methylation at the MEST DMR (2.8% difference, P < 0.01 after adjusting for PTB. Maternal stress may be associated with epigenetic changes at MEST , a gene relevant to maternal care and obesity. Reduced prenatal stress may support the epigenomic profile of a healthy infant.
Aberrant DNA methylation in 5'regions of DNA methyltransferase genes in aborted bovine clones
Institute of Scientific and Technical Information of China (English)
2008-01-01
High rate of abortion and developmental abnormalities is thought to be closely associated with inefficient epigenetic reprogramming of the transplanted nuclei during bovine cloning.It is known that one of the important mechanisms for epigenetic reprogramming is DNA methylation.DNA methylation is established and maintained by DNA methyltransferases(DNMTs),therefore,it is postulated that the inefficient epigenetic reprogramming of transplanted nuclei may be due to abnormal expression of DNMTs.Since DNA methylation can strongly inhibit gene expression,aberrant DNA methylation of DNMT genes may disturb gene expression.But presently,it is not clear whether the methylation abnormality of DNMT genes is related to developmental failure of somatic cell nuclear transfer embryos.In our study,we analyzed methylation patterns of the 5' regions of four DNMT genes including Dnmt3a,Dnmt3b,Dnmtl and Dnmt2 in four aborted bovine clones.Using bisulfite sequencing method,we found that 3 out of 4 aborted bovine clones(AF1,AF2 and AF3)showed either hypermethylation or hypomethylation in the 5' regions of Dnmt3a and Dnmt3b.indicating that Dnmt3a and Dnmt3b genes are not properly reprogrammed.However,the individual AF4 exhibited similar methylation level and pattern to age-matched in vitro fertilized (IVF)fetuses.Besides,we found that tle 5'regions of Dnmtl and Dnmt2 were nearly completely unmethylated in all normal adults.IVF fetuses,sperm and aborted clones.Together,our results suggest that the aberrant methylation of Dnmt3a and Dnmt3b 5' regions is probably associated with the high abortion of bovine clones.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC469 (Link to dictyBase) - - - Contig-U16584-1 SLC469P (Link to Original site) SLC4...69F 676 SLC469Z 397 SLC469P 1073 - - Show SLC469 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC469Q.Seq.d/ Representative seq. ID SLC4...69P (Link to Original site) Representative DNA sequence >SLC469 (SLC469Q) /CSM/SL/SLC4-C/SLC4...sfflc sklvvik*ncynyp Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC469 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC452 (Link to dictyBase) - - - Contig-U08358-1 SLC452E (Link to Original site) SLC4...52F 537 SLC452Z 347 SLC452P 884 SLC452E 537 Show SLC452 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC452Q.Seq.d/ Representative seq. ID SLC4...52E (Link to Original site) Representative DNA sequence >SLC452 (SLC452Q) /CSM/SL/SLC4-C/SLC4...slvtpplffq*skk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC4
Peraza-Echeverria, S; Herrera-Valencia, V A.; Kay, A -J.
2001-07-01
The extent of DNA methylation polymorphisms was evaluated in micropropagated banana (Musa AAA cv. 'Grand Naine') derived from either the vegetative apex of the sucker or the floral apex of the male inflorescence using the methylation-sensitive amplification polymorphism (MSAP) technique. In all, 465 fragments, each representing a recognition site cleaved by either or both of the isoschizomers were amplified using eight combinations of primers. A total of 107 sites (23%) were found to be methylated at cytosine in the genome of micropropagated banana plants. In plants micropropagated from the male inflorescence explant 14 (3%) DNA methylation events were polymorphic, while plants micropropagated from the sucker explant produced 8 (1.7%) polymorphisms. No DNA methylation polymorphisms were detected in conventionally propagated banana plants. These results demonstrated the usefulness of MSAP to detect DNA methylation events in micropropagated banana plants and indicate that DNA methylation polymorphisms are associated with micropropagation.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC466 (Link to dictyBase) - - - Contig-U16381-1 SLC466Z (Link... to Original site) - - SLC466Z 427 - - - - Show SLC466 Library SL (Link to library) Clone ID SLC466 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC466Q.Seq.d/ Representative seq. ID SLC46...6Z (Link to Original site) Representative DNA sequence >SLC466 (SLC466Q) /CSM/SL/SLC4-C/SLC466Q.Seq.d/ XXXXX... AU034556 ) Dictyostelium discoideum slug cDNA, clone SLC466. 176 2e-77 2 ( AU033496 ) Dictyostelium discoid
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC461 (Link to dictyBase) - - - Contig-U16382-1 SLC461Z (Link... to Original site) - - SLC461Z 386 - - - - Show SLC461 Library SL (Link to library) Clone ID SLC461 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC461Q.Seq.d/ Representative seq. ID SLC46...1Z (Link to Original site) Representative DNA sequence >SLC461 (SLC461Q) /CSM/SL/SLC4-C/SLC461Q.Seq.d/ XXXXX...e-155 2 ( AU034553 ) Dictyostelium discoideum slug cDNA, clone SLC461. 531 e-155 2 ( AU052473 ) Dictyosteliu
DNA methylation analysis in rat kidney epithelial cells exposed to 3-MCPD and glycidol.
Senyildiz, Mine; Alpertunga, Buket; Ozden, Sibel
2017-10-01
3-Monochloropropane-1,2-diol (3-MCPD) is a well-known food processing contaminant that has been regarded as a rat carcinogen, which is known to induce Leydig-cell and mammary gland tumors in males, as well as kidney tumors in both genders. 3-MCPD is highly suspected to be a non-genotoxic carcinogen. 2,3-Epoxy-1-propanol (glycidol) can be formed via dehalogenation from 3-MCPD. We aimed to investigate the cytotoxic effects of 3-MCPD and glycidol, then to demonstrate the possible epigenetic mechanisms with global and gene-specific DNA methylation in rat kidney epithelial cells (NRK-52E). IC 50 value of 3-MCPD was determined as 48 mM and 41.39 mM, whereas IC 50 value of glycidol was 1.67 mM and 1.13 mM by MTT and NRU test, respectively. Decreased global DNA methylation at the concentrations of 100 μM and 1000 μM for 3-MCPD and 100 μM and 500 μM for glycidol were observed after 48 h exposure by using 5-methylcytosine (5-mC) ELISA kit. Methylation changes were detected in promoter regions of c-myc and Rassf1a in 3-MCPD and glycidol treated NRK-52E cells by using methylation-specific PCR (MSP), whereas changes on gene expression of c-myc and Rassf1a were observed by using real-time PCR. However, e-cadherin, p16, VHL and p15 genes were unmethylated in their CpG promoter regions in response to treatment with 3-MCPD and glycidol. Alterations in DNA methylation might be key events in the toxicity of 3-MCPD and glycidol.
Dietary and supplemental maternal methyl-group donor intake and cord blood DNA methylation.
Pauwels, Sara; Ghosh, Manosij; Duca, Radu Corneliu; Bekaert, Bram; Freson, Kathleen; Huybrechts, Inge; A S Langie, Sabine; Koppen, Gudrun; Devlieger, Roland; Godderis, Lode
2017-01-02
Maternal nutrition is critically involved in the development and health of the fetus. We evaluated maternal methyl-group donor intake through diet (methionine, betaine, choline, folate) and supplementation (folic acid) before and during pregnancy in relation to global DNA methylation and hydroxymethylation and gene specific (IGF2 DMR, DNMT1, LEP, RXRA) cord blood methylation. A total of 115 mother-infant pairs were enrolled in the MAternal Nutrition and Offspring's Epigenome (MANOE) study. The intake of methyl-group donors was assessed using a food-frequency questionnaire. LC-MS/MS and pyrosequencing were used to measure global and gene specific methylation, respectively. Dietary intake of methyl-groups before and during pregnancy was associated with changes in LEP, DNMT1, and RXRA cord blood methylation. Statistically significant higher cord blood LEP methylation was observed when mothers started folic acid supplementation more than 6 months before conception compared with 3-6 months before conception (34.6 ± 6.3% vs. 30.1 ± 3.6%, P = 0.011, LEP CpG1) or no folic acid used before conception (16.2 ± 4.4% vs. 13.9 ± 3%, P = 0.036 for LEP CpG3 and 24.5 ± 3.5% vs. 22.2 ± 3.5%, P = 0.045 for LEP mean CpG). Taking folic acid supplements during the entire pregnancy resulted in statistically significantly higher cord blood RXRA methylation as compared with stopping supplementation in the second trimester (12.3 ± 1.9% vs. 11.1 ± 2%, P = 0.008 for RXRA mean CpG). To conclude, long-term folic acid use before and during pregnancy was associated with higher LEP and RXRA cord blood methylation, respectively. To date, pregnant women are advised to take a folic acid supplement of 400 µg/day from 4 weeks before until 12 weeks of pregnancy. Our results suggest significant epigenetic modifications when taking a folic acid supplement beyond the current advice.
DNA methylation requires a DNMT1 ubiquitin interacting motif (UIM) and histone ubiquitination.
Qin, Weihua; Wolf, Patricia; Liu, Nan; Link, Stephanie; Smets, Martha; La Mastra, Federica; Forné, Ignasi; Pichler, Garwin; Hörl, David; Fellinger, Karin; Spada, Fabio; Bonapace, Ian Marc; Imhof, Axel; Harz, Hartmann; Leonhardt, Heinrich
2015-08-01
DNMT1 is recruited by PCNA and UHRF1 to maintain DNA methylation after replication. UHRF1 recognizes hemimethylated DNA substrates via the SRA domain, but also repressive H3K9me3 histone marks with its TTD. With systematic mutagenesis and functional assays, we could show that chromatin binding further involved UHRF1 PHD binding to unmodified H3R2. These complementation assays clearly demonstrated that the ubiquitin ligase activity of the UHRF1 RING domain is required for maintenance DNA methylation. Mass spectrometry of UHRF1-deficient cells revealed H3K18 as a novel ubiquitination target of UHRF1 in mammalian cells. With bioinformatics and mutational analyses, we identified a ubiquitin interacting motif (UIM) in the N-terminal regulatory domain of DNMT1 that binds to ubiquitinated H3 tails and is essential for DNA methylation in vivo. H3 ubiquitination and subsequent DNA methylation required UHRF1 PHD binding to H3R2. These results show the manifold regulatory mechanisms controlling DNMT1 activity that require the reading and writing of epigenetic marks by UHRF1 and illustrate the multifaceted interplay between DNA and histone modifications. The identification and functional characterization of the DNMT1 UIM suggests a novel regulatory principle and we speculate that histone H2AK119 ubiquitination might also lead to UIM-dependent recruitment of DNMT1 and DNA methylation beyond classic maintenance.
∆DNMT3B4-del Contributes to Aberrant DNA Methylation Patterns in Lung Tumorigenesis
Directory of Open Access Journals (Sweden)
Mark Z. Ma
2015-10-01
Full Text Available Aberrant DNA methylation is a hallmark of cancer but mechanisms contributing to the abnormality remain elusive. We have previously shown that ∆DNMT3B is the predominantly expressed form of DNMT3B. In this study, we found that most of the lung cancer cell lines tested predominantly expressed DNMT3B isoforms without exons 21, 22 or both 21 and 22 (a region corresponding to the enzymatic domain of DNMT3B termed DNMT3B/∆DNMT3B-del. In normal bronchial epithelial cells, DNMT3B/ΔDNMT3B and DNMT3B/∆DNMT3B-del displayed equal levels of expression. In contrast, in patients with non-small cell lung cancer NSCLC, 111 (93% of the 119 tumors predominantly expressed DNMT3B/ΔDNMT3B-del, including 47 (39% tumors with no detectable DNMT3B/∆DNMT3B. Using a transgenic mouse model, we further demonstrated the biological impact of ∆DNMT3B4-del, the ∆DNMT3B-del isoform most abundantly expressed in NSCLC, in global DNA methylation patterns and lung tumorigenesis. Expression of ∆DNMT3B4-del in the mouse lungs resulted in an increased global DNA hypomethylation, focal DNA hypermethylation, epithelial hyperplastia and tumor formation when challenged with a tobacco carcinogen. Our results demonstrate ∆DNMT3B4-del as a critical factor in developing aberrant DNA methylation patterns during lung tumorigenesis and suggest that ∆DNMT3B4-del may be a target for lung cancer prevention.
Directory of Open Access Journals (Sweden)
Guang Liu
2010-12-01
Full Text Available Many taxonomically diverse prokaryotes enzymatically modify their DNA by replacing a non-bridging oxygen with a sulfur atom at specific sequences. The biological implications of this DNA S-modification (phosphorothioation were unknown. We observed that simultaneous expression of the dndA-E gene cluster from Streptomyces lividans 66, which is responsible for the DNA S-modification, and the putative Streptomyces coelicolor A(32 Type IV methyl-dependent restriction endonuclease ScoA3McrA (Sco4631 leads to cell death in the same host. A His-tagged derivative of ScoA3McrA cleaved S-modified DNA and also Dcm-methylated DNA in vitro near the respective modification sites. Double-strand cleavage occurred 16-28 nucleotides away from the phosphorothioate links. DNase I footprinting demonstrated binding of ScoA3McrA to the Dcm methylation site, but no clear binding could be detected at the S-modified site under cleavage conditions. This is the first report of in vitro endonuclease activity of a McrA homologue and also the first demonstration of an enzyme that specifically cleaves S-modified DNA.
DNA replication origin function is promoted by H3K4 di-methylation in Saccharomyces cerevisiae.
Rizzardi, Lindsay F; Dorn, Elizabeth S; Strahl, Brian D; Cook, Jeanette Gowen
2012-10-01
DNA replication is a highly regulated process that is initiated from replication origins, but the elements of chromatin structure that contribute to origin activity have not been fully elucidated. To identify histone post-translational modifications important for DNA replication, we initiated a genetic screen to identify interactions between genes encoding chromatin-modifying enzymes and those encoding proteins required for origin function in the budding yeast Saccharomyces cerevisiae. We found that enzymes required for histone H3K4 methylation, both the histone methyltransferase Set1 and the E3 ubiquitin ligase Bre1, are required for robust growth of several hypomorphic replication mutants, including cdc6-1. Consistent with a role for these enzymes in DNA replication, we found that both Set1 and Bre1 are required for efficient minichromosome maintenance. These phenotypes are recapitulated in yeast strains bearing mutations in the histone substrates (H3K4 and H2BK123). Set1 functions as part of the COMPASS complex to mono-, di-, and tri-methylate H3K4. By analyzing strains lacking specific COMPASS complex members or containing H2B mutations that differentially affect H3K4 methylation states, we determined that these replication defects were due to loss of H3K4 di-methylation. Furthermore, histone H3K4 di-methylation is enriched at chromosomal origins. These data suggest that H3K4 di-methylation is necessary and sufficient for normal origin function. We propose that histone H3K4 di-methylation functions in concert with other histone post-translational modifications to support robust genome duplication.
In vivo control of CpG and non-CpG DNA methylation by DNA methyltransferases.
Directory of Open Access Journals (Sweden)
Julia Arand
2012-06-01
Full Text Available The enzymatic control of the setting and maintenance of symmetric and non-symmetric DNA methylation patterns in a particular genome context is not well understood. Here, we describe a comprehensive analysis of DNA methylation patterns generated by high resolution sequencing of hairpin-bisulfite amplicons of selected single copy genes and repetitive elements (LINE1, B1, IAP-LTR-retrotransposons, and major satellites. The analysis unambiguously identifies a substantial amount of regional incomplete methylation maintenance, i.e. hemimethylated CpG positions, with variant degrees among cell types. Moreover, non-CpG cytosine methylation is confined to ESCs and exclusively catalysed by Dnmt3a and Dnmt3b. This sequence position-, cell type-, and region-dependent non-CpG methylation is strongly linked to neighboring CpG methylation and requires the presence of Dnmt3L. The generation of a comprehensive data set of 146,000 CpG dyads was used to apply and develop parameter estimated hidden Markov models (HMM to calculate the relative contribution of DNA methyltransferases (Dnmts for de novo and maintenance DNA methylation. The comparative modelling included wild-type ESCs and mutant ESCs deficient for Dnmt1, Dnmt3a, Dnmt3b, or Dnmt3a/3b, respectively. The HMM analysis identifies a considerable de novo methylation activity for Dnmt1 at certain repetitive elements and single copy sequences. Dnmt3a and Dnmt3b contribute de novo function. However, both enzymes are also essential to maintain symmetrical CpG methylation at distinct repetitive and single copy sequences in ESCs.
Whole-genome methylation caller designed for methyl- DNA ...
African Journals Online (AJOL)
etchie
2013-02-20
Feb 20, 2013 ... Key words: Methyl-DNA immunoprecipitation, next-generation sequencing, Hidden ... its response to environmental cues. .... have a great potential to become the most cost-effective ... hg18 reference genome (set to 0 if not present in retrieved reads). ..... DNA methylation patterns and epigenetic memory.
Recognition of methylated DNA through methyl-CpG binding domain proteins
DEFF Research Database (Denmark)
Zou, Xueqing; Ma, Wen; Solov'yov, Ilia
2012-01-01
DNA methylation is a key regulatory control route in epigenetics, involving gene silencing and chromosome inactivation. It has been recognized that methyl-CpG binding domain (MBD) proteins play an important role in interpreting the genetic information encoded by methylated DNA (mDNA). Although...... the function of MBD proteins has attracted considerable attention and is well characterized, the mechanism underlying mDNA recognition by MBD proteins is still poorly understood. In this article, we demonstrate that the methyl-CpG dinucleotides are recognized at the MBD-mDNA interface by two MBD arginines...
Whole-genome methylation caller designed for methyl- DNA ...
African Journals Online (AJOL)
etchie
2013-02-20
Feb 20, 2013 ... Our method uses a single-CpG-resolution, whole-genome methylation ... Key words: Methyl-DNA immunoprecipitation, next-generation sequencing, ...... methylation is prevalent in embryonic stem cells andmaybe mediated.
miRNAting control of DNA methylation
Indian Academy of Sciences (India)
DNA methylation is a type of epigenetic modification where a methyl group is added to the cytosine or adenine residue of a given DNA sequence. It has been observed that DNA methylation is achieved by some collaborative agglomeration of certain proteins and non-coding RNAs. The assembly of IDN2 and its ...
miRNAting control of DNA methylation
Indian Academy of Sciences (India)
miRNAting control of DNA methylation. ASHWANI ... function and biological process ... Enrichment analysis of the genes methylated by DRM2 for molecular function and biological ... 39(3), June 2014, 365–380, © Indian Academy of Sciences.
Chen, Y; Feng, H; Chen, D; Abuduwaili, K; Li, X; Zhang, H
2018-01-01
The protective effects of folic acid on DNA damage and DNA methylation induced by N-methyl- N'-nitro- N-nitrosoguanidine (MNNG) in Kazakh esophageal epithelial cells were investigated using a 3 × 3 factorial design trial. The cells were cultured in vitro and exposed to media containing different concentrations of folic acid and MNNG, after which growth indices were detected. DNA damage levels were measured using comet assays, and genome-wide DNA methylation levels (MLs) were measured using high-performance liquid chromatography. The DNA methylation of methylenetetrahydrofolate reductase (MTHFR) and folate receptor- α (FR α) genes was detected by bisulfite sequencing polymerase chain reaction (PCR). The results showed significant increases in tail DNA concentration, tail length, and Olive tail moment ( p methylation frequencies of MTHFR and FR α genes. In particular, significant differences were observed in the promoter regions of both genes ( p methylation in Kazakh esophageal epithelial cells upon MNNG exposure. Thus, sufficient folic acid levels could play a protective role against the damage induced by this compound.
Survey of Differentially Methylated Promoters in Prostate Cancer Cell Lines
Directory of Open Access Journals (Sweden)
Yipeng Wang
2005-08-01
Full Text Available DNA methylation, copy number in the genomes of three immortalized prostate epithelial, five cancer cell lines (LNCaP, PC3, PC3M, PC3M-Pro4, PC3MLN4 were compared using a microarray-based technique. Genomic DNA is cut with a methylation-sensitive enzyme Hpall, followed by linker ligation, polymerase chain reaction (PCR amplification, labeling, hybridization to an array of promoter sequences. Only those parts of the genomic DNA that have unmethylated restriction sites within a few hundred base pairs generate PCR products detectable on an array. Of 2732 promoter sequences on a test array, 504 (18.5% showed differential hybridization between immortalized prostate epithelial, cancer cell lines. Among candidate hypermethylated genes in cancer-derived lines, there were eight (CD44, CDKN1A, ESR1, PLAU, RARB, SFN, TNFRSF6, TSPY previously observed in prostate cancer, 13 previously known methylation targets in other cancers (ARHI, bcl-2, BRCA1, CDKN2C, GADD45A, MTAP, PGR, SLC26A4, SPARC, SYK, TJP2, UCHL1, WIT-1. The majority of genes that appear to be both differentially methylated, differentially regulated between prostate epithelial, cancer cell lines are novel methylation targets, including PAK6, RAD50, TLX3, PIR51, MAP2K5, INSR, FBN1, GG2-1, representing a rich new source of candidate genes used to study the role of DNA methylation in prostate tumors.
MethylMix 2.0: an R package for identifying DNA methylation genes.
Cedoz, Pierre-Louis; Prunello, Marcos; Brennan, Kevin; Gevaert, Olivier
2018-04-14
DNA methylation is an important mechanism regulating gene transcription, and its role in carcinogenesis has been extensively studied. Hyper and hypomethylation of genes is a major mechanism of gene expression deregulation in a wide range of diseases. At the same time, high-throughput DNA methylation assays have been developed generating vast amounts of genome wide DNA methylation measurements. We developed MethylMix, an algorithm implemented in R to identify disease specific hyper and hypomethylated genes. Here we present a new version of MethylMix that automates the construction of DNA-methylation and gene expression datasets from The Cancer Genome Atlas (TCGA). More precisely, MethylMix 2.0 incorporates two major updates: the automated downloading of DNA methylation and gene expression datasets from TCGA and the automated preprocessing of such datasets: value imputation, batch correction and CpG sites clustering within each gene. The resulting datasets can subsequently be analyzed with MethylMix to identify transcriptionally predictive methylation states. We show that the Differential Methylation Values created by MethylMix can be used for cancer subtyping. olivier.gevaert@stanford.edu. https://bioconductor.org/packages/release/bioc/manuals/MethylMix/man/MethylMix.pdf. MethylMix 2.0 was implemented as an R package and is available in bioconductor.
Parodi, S; Balbi, C; Taningher, M; Pala, M; Russo, P; Abelmoschi, M L; Santi, L
1982-11-01
DNA damage induced in vivo by 3'-methyl-4-dimethylaminoazobenzene (3'CH3DAB) was investigated with 2 differently sensitive techniques: the alkaline elution assay and the viscometric measurement of DNA damage. 3'CH3DAB appeared to be falsely negative with the alkaline elution assay, whereas with the viscometric approach, which is about 30-50 times more sensitive, it appeared positive, and the DNA damage was dose-dependent.
Involvement of DNA methylation in memory processing in the honey bee.
Lockett, Gabrielle A; Helliwell, Paul; Maleszka, Ryszard
2010-08-23
DNA methylation, an important and evolutionarily conserved epigenetic mechanism, is implicated in learning and memory processes in vertebrates, but its role in behaviour in invertebrates is unknown. We examined the role of DNA methylation in memory in the honey bee using an appetitive Pavlovian olfactory discrimination task, and by assessing the expression of DNA methyltransferase3, a key driver of epigenetic reprogramming. Here we report that DNA methyltransferase inhibition reduces acquisition retention and alters the extinction depending on treatment time, and DNA methyltransferase3 is upregulated after training. Our findings add to the understanding of epigenetic mechanisms in learning and memory, extending known roles of DNA methylation to appetitive and extinction memory, and for the first time implicate DNA methylation in memory in invertebrates.
DNA methylation analysis from saliva samples for epidemiological studies.
Nishitani, Shota; Parets, Sasha E; Haas, Brian W; Smith, Alicia K
2018-06-18
Saliva is a non-invasive, easily accessible tissue, which is regularly collected in large epidemiological studies to examine genetic questions. Recently, it is becoming more common to use saliva to assess DNA methylation. However, DNA extracted from saliva is a mixture of both bacterial and human DNA derived from epithelial and immune cells in the mouth. Thus, there are unique challenges to using salivary DNA in methylation studies that can influence data quality. This study assesses: (1) quantification of human DNA after extraction; (2) delineation of human and bacterial DNA; (3) bisulfite conversion (BSC); (4) quantification of BSC DNA; (5) PCR amplification of BSC DNA from saliva and; (6) quantitation of DNA methylation with a targeted assay. The framework proposed will allow saliva samples to be more widely used in targeted epigenetic studies.
Global DNA methylation of ischemic stroke subtypes.
Directory of Open Access Journals (Sweden)
Carolina Soriano-Tárraga
Full Text Available Ischemic stroke (IS, a heterogeneous multifactorial disorder, is among the leading causes of mortality and long-term disability in the western world. Epidemiological data provides evidence for a genetic component to the disease, but its epigenetic involvement is still largely unknown. Epigenetic mechanisms, such as DNA methylation, change over time and may be associated with aging processes and with modulation of the risk of various pathologies, such as cardiovascular disease and stroke. We analyzed 2 independent cohorts of IS patients. Global DNA methylation was measured by luminometric methylation assay (LUMA of DNA blood samples. Univariate and multivariate regression analyses were used to assess the methylation differences between the 3 most common IS subtypes, large-artery atherosclerosis (LAA, small-artery disease (SAD, and cardio-aortic embolism (CE. A total of 485 IS patients from 2 independent hospital cohorts (n = 281 and n = 204 were included, distributed across 3 IS subtypes: LAA (78/281, 59/204, SAD (97/281, 53/204, and CE (106/281, 89/204. In univariate analyses, no statistical differences in LUMA levels were observed between the 3 etiologies in either cohort. Multivariate analysis, adjusted by age, sex, hyperlipidemia, and smoking habit, confirmed the lack of differences in methylation levels between the analyzed IS subtypes in both cohorts. Despite differences in pathogenesis, our results showed no global methylation differences between LAA, SAD, and CE subtypes of IS. Further work is required to establish whether the epigenetic mechanism of methylation might play a role in this complex disease.
DNA Methylation Biomarkers: Cancer and Beyond
Directory of Open Access Journals (Sweden)
Thomas Mikeska
2014-09-01
Full Text Available Biomarkers are naturally-occurring characteristics by which a particular pathological process or disease can be identified or monitored. They can reflect past environmental exposures, predict disease onset or course, or determine a patient’s response to therapy. Epigenetic changes are such characteristics, with most epigenetic biomarkers discovered to date based on the epigenetic mark of DNA methylation. Many tissue types are suitable for the discovery of DNA methylation biomarkers including cell-based samples such as blood and tumor material and cell-free DNA samples such as plasma. DNA methylation biomarkers with diagnostic, prognostic and predictive power are already in clinical trials or in a clinical setting for cancer. Outside cancer, strong evidence that complex disease originates in early life is opening up exciting new avenues for the detection of DNA methylation biomarkers for adverse early life environment and for estimation of future disease risk. However, there are a number of limitations to overcome before such biomarkers reach the clinic. Nevertheless, DNA methylation biomarkers have great potential to contribute to personalized medicine throughout life. We review the current state of play for DNA methylation biomarkers, discuss the barriers that must be crossed on the way to implementation in a clinical setting, and predict their future use for human disease.
Maternal intake of methyl-group donors affects DNA methylation of metabolic genes in infants.
Pauwels, Sara; Ghosh, Manosij; Duca, Radu Corneliu; Bekaert, Bram; Freson, Kathleen; Huybrechts, Inge; Langie, Sabine A S; Koppen, Gudrun; Devlieger, Roland; Godderis, Lode
2017-01-01
Maternal nutrition during pregnancy and infant nutrition in the early postnatal period (lactation) are critically involved in the development and health of the newborn infant. The Maternal Nutrition and Offspring's Epigenome (MANOE) study was set up to assess the effect of maternal methyl-group donor intake (choline, betaine, folate, methionine) on infant DNA methylation. Maternal intake of dietary methyl-group donors was assessed using a food-frequency questionnaire (FFQ). Before and during pregnancy, we evaluated maternal methyl-group donor intake through diet and supplementation (folic acid) in relation to gene-specific ( IGF2 DMR, DNMT1 , LEP , RXRA ) buccal epithelial cell DNA methylation in 6 months old infants ( n = 114) via pyrosequencing. In the early postnatal period, we determined the effect of maternal choline intake during lactation (in mothers who breast-fed for at least 3 months) on gene-specific buccal DNA methylation ( n = 65). Maternal dietary and supplemental intake of methyl-group donors (folate, betaine, folic acid), only in the periconception period, was associated with buccal cell DNA methylation in genes related to growth ( IGF2 DMR), metabolism ( RXRA ), and appetite control ( LEP ). A negative association was found between maternal folate and folic acid intake before pregnancy and infant LEP (slope = -1.233, 95% CI -2.342; -0.125, p = 0.0298) and IGF2 DMR methylation (slope = -0.706, 95% CI -1.242; -0.107, p = 0.0101), respectively. Positive associations were observed for maternal betaine (slope = 0.875, 95% CI 0.118; 1.633, p = 0.0241) and folate (slope = 0.685, 95% CI 0.245; 1.125, p = 0.0027) intake before pregnancy and RXRA methylation. Buccal DNMT1 methylation in the infant was negatively associated with maternal methyl-group donor intake in the first and second trimester of pregnancy and negatively in the third trimester. We found no clear association between maternal choline intake
Directory of Open Access Journals (Sweden)
Yangxing Zhao
Full Text Available PURPOSE: There is a need to supplement or supplant the conventional diagnostic tools, namely, cystoscopy and B-type ultrasound, for bladder cancer (BC. We aimed to identify novel DNA methylation markers for BC through genome-wide profiling of BC cell lines and subsequent methylation-specific PCR (MSP screening of clinical urine samples. EXPERIMENTAL DESIGN: The methyl-DNA binding domain (MBD capture technique, methylCap/seq, was performed to screen for specific hypermethylated CpG islands in two BC cell lines (5637 and T24. The top one hundred hypermethylated targets were sequentially screened by MSP in urine samples to gradually narrow the target number and optimize the composition of the diagnostic panel. The diagnostic performance of the obtained panel was evaluated in different clinical scenarios. RESULTS: A total of 1,627 hypermethylated promoter targets in the BC cell lines was identified by Illumina sequencing. The top 104 hypermethylated targets were reduced to eight genes (VAX1, KCNV1, ECEL1, TMEM26, TAL1, PROX1, SLC6A20, and LMX1A after the urine DNA screening in a small sample size of 8 normal control and 18 BC subjects. Validation in an independent sample of 212 BC patients enabled the optimization of five methylation targets, including VAX1, KCNV1, TAL1, PPOX1, and CFTR, which was obtained in our previous study, for BC diagnosis with a sensitivity and specificity of 88.68% and 87.25%, respectively. In addition, the methylation of VAX1 and LMX1A was found to be associated with BC recurrence. CONCLUSIONS: We identified a promising diagnostic marker panel for early non-invasive detection and subsequent BC surveillance.
DNA methylation in inflammatory genes among children with obstructive sleep apnea.
Kim, Jinkwan; Bhattacharjee, Rakesh; Khalyfa, Abdelnaby; Kheirandish-Gozal, Leila; Capdevila, Oscar Sans; Wang, Yang; Gozal, David
2012-02-01
Pediatric obstructive sleep apnea (OSA) leads to multiple end-organ morbidities that are mediated by the cumulative burden of oxidative stress and inflammation. Because not all children with OSA exhibit increased systemic inflammation, genetic and environmental factors may be affecting patterns of DNA methylation in genes subserving inflammatory functions. DNA from matched children with OSA with and without high levels of high-sensitivity C-reactive protein (hsCRP) were assessed for DNA methylation levels of 24 inflammatory-related genes. Primer-based polymerase chain reaction assays in a case-control setting involving 47 OSA cases and 31 control subjects were conducted to confirm the findings; hsCRP and myeloid-related protein (MRP) 8/14 levels were also assayed. Forkhead box P3 (FOXP3) and interferon regulatory factor 1 (IRF1) showed higher methylation in six children with OSA and high hsCRP levels compared with matched children with OSA and low hsCRP levels (P DNA methylation levels compared with children with OSA and low CRP levels and control subjects. IRF1 did not exhibit significant differences. FOXP3 DNA methylation levels correlated with hsCRP and MRP 8/14 levels and with apnea-hypopnea index (AHI), BMI z score, and apolipoprotein B levels. A stepwise multiple regression model showed that AHI was independently associated with FOXP3 DNA methylation levels (P gene, which regulates expression of T regulatory lymphocytes, is more likely to display increased methylation among children with OSA who exhibit increased systemic inflammatory responses. Thus, epigenetic modifications may constitute an important determinant of inflammatory phenotype in OSA, and FOXP3 DNA methylation levels may provide a potential biomarker for end-organ vulnerability.
Directory of Open Access Journals (Sweden)
Rachael M. Taylor
2018-02-01
Full Text Available Background: During the early postnatal period, the impact of nutrition on DNA methylation has not been well studied in humans. The aim was to quantify the relationship between one-carbon metabolism nutrient intake during the first three years of life and global DNA methylation levels at four years. Design: Childhood dietary intake was assessed using infant feeding questionnaires, food frequency questionnaires, 4-day weighed food records and 24-h food records. The dietary records were used to estimate the intake of methionine, folate, vitamins B2, B6 and B12 and choline. The accumulative nutrient intake specific rank from three months to three years of age was used for analysis. Global DNA methylation (%5-methyl cytosines (%5-mC was measured in buccal cells at four years of age, using an enzyme-linked immunosorbent assay (ELISA commercial kit. Linear regression models were used to quantify the statistical relationships. Results: Data were collected from 73 children recruited from the Women and their Children’s Health (WATCH study. No association was found between one-carbon metabolism nutrient intake and global DNA methylation levels (P > 0.05. Global DNA methylation levels in males were significantly higher than in females (median %5-mC: 1.82 vs. 1.03, males and females respectively, (P < 0.05. Conclusion: No association was found between the intake of one-carbon metabolism nutrients during the early postnatal period and global DNA methylation levels at age four years. Higher global DNA methylation levels in males warrants further investigation.
Taylor, Rachael M.; Smith, Roger; Collins, Clare E.; Mossman, David; Wong-Brown, Michelle W.; Chan, Eng-Cheng; Evans, Tiffany-Jane; Attia, John R.; Smith, Tenele; Butler, Trent
2018-01-01
Background: During the early postnatal period, the impact of nutrition on DNA methylation has not been well studied in humans. The aim was to quantify the relationship between one-carbon metabolism nutrient intake during the first three years of life and global DNA methylation levels at four years. Design: Childhood dietary intake was assessed using infant feeding questionnaires, food frequency questionnaires, 4-day weighed food records and 24-h food records. The dietary records were used to estimate the intake of methionine, folate, vitamins B2, B6 and B12 and choline. The accumulative nutrient intake specific rank from three months to three years of age was used for analysis. Global DNA methylation (%5-methyl cytosines (%5-mC)) was measured in buccal cells at four years of age, using an enzyme-linked immunosorbent assay (ELISA) commercial kit. Linear regression models were used to quantify the statistical relationships. Results: Data were collected from 73 children recruited from the Women and their Children’s Health (WATCH) study. No association was found between one-carbon metabolism nutrient intake and global DNA methylation levels (P 0.05). Global DNA methylation levels in males were significantly higher than in females (median %5-mC: 1.82 vs. 1.03, males and females respectively, (P 0.05)). Conclusion: No association was found between the intake of one-carbon metabolism nutrients during the early postnatal period and global DNA methylation levels at age four years. Higher global DNA methylation levels in males warrants further investigation. PMID:29495543
Differential DNA Methylation Analysis without a Reference Genome
Directory of Open Access Journals (Sweden)
Johanna Klughammer
2015-12-01
Full Text Available Genome-wide DNA methylation mapping uncovers epigenetic changes associated with animal development, environmental adaptation, and species evolution. To address the lack of high-throughput methods for DNA methylation analysis in non-model organisms, we developed an integrated approach for studying DNA methylation differences independent of a reference genome. Experimentally, our method relies on an optimized 96-well protocol for reduced representation bisulfite sequencing (RRBS, which we have validated in nine species (human, mouse, rat, cow, dog, chicken, carp, sea bass, and zebrafish. Bioinformatically, we developed the RefFreeDMA software to deduce ad hoc genomes directly from RRBS reads and to pinpoint differentially methylated regions between samples or groups of individuals (http://RefFreeDMA.computational-epigenetics.org. The identified regions are interpreted using motif enrichment analysis and/or cross-mapping to annotated genomes. We validated our method by reference-free analysis of cell-type-specific DNA methylation in the blood of human, cow, and carp. In summary, we present a cost-effective method for epigenome analysis in ecology and evolution, which enables epigenome-wide association studies in natural populations and species without a reference genome.
DNA methylation patterns in cord blood DNA and body size in childhood.
Directory of Open Access Journals (Sweden)
Caroline L Relton
Full Text Available Epigenetic markings acquired in early life may have phenotypic consequences later in development through their role in transcriptional regulation with relevance to the developmental origins of diseases including obesity. The goal of this study was to investigate whether DNA methylation levels at birth are associated with body size later in childhood.A study design involving two birth cohorts was used to conduct transcription profiling followed by DNA methylation analysis in peripheral blood. Gene expression analysis was undertaken in 24 individuals whose biological samples and clinical data were collected at a mean ± standard deviation (SD age of 12.35 (0.95 years, the upper and lower tertiles of body mass index (BMI were compared with a mean (SD BMI difference of 9.86 (2.37 kg/m(2. This generated a panel of differentially expressed genes for DNA methylation analysis which was then undertaken in cord blood DNA in 178 individuals with body composition data prospectively collected at a mean (SD age of 9.83 (0.23 years. Twenty-nine differentially expressed genes (>1.2-fold and p<10(-4 were analysed to determine DNA methylation levels at 1-3 sites per gene. Five genes were unmethylated and DNA methylation in the remaining 24 genes was analysed using linear regression with bootstrapping. Methylation in 9 of the 24 (37.5% genes studied was associated with at least one index of body composition (BMI, fat mass, lean mass, height at age 9 years, although only one of these associations remained after correction for multiple testing (ALPL with height, p(Corrected = 0.017.DNA methylation patterns in cord blood show some association with altered gene expression, body size and composition in childhood. The observed relationship is correlative and despite suggestion of a mechanistic epigenetic link between in utero life and later phenotype, further investigation is required to establish causality.
Densely ionizing radiation affects DNA methylation of selective LINE-1 elements
Energy Technology Data Exchange (ETDEWEB)
Prior, Sara; Miousse, Isabelle R. [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Nzabarushimana, Etienne [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Department of Bioinformatics, School of Informatics and Computing, Indiana University, Bloomington, IN 47405 (United States); Pathak, Rupak [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Skinner, Charles; Kutanzi, Kristy R. [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Allen, Antiño R. [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Raber, Jacob [Departments of Behavioral Neuroscience, Neurology, and Radiation Medicine, Division of Neuroscience, ONPRC, Oregon Health & Science University, Portland, OR 97239 (United States); Tackett, Alan J. [Department of Biochemistry, College of Medicine, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Hauer-Jensen, Martin [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Nelson, Gregory A. [Department of Basic Sciences, Division of Radiation Research, Loma Linda University, Loma Linda, CA 92350 (United States); and others
2016-10-15
Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. - Highlights: • DNA methylation of LINE-1 elements is dependent on their evolutionary age. • Densely ionizing radiation affects DNA methylation of selective LINE-1 elements. • Radiation-induced reactivation of LINE-1 is DNA methylation-independent. • Histone modifications dictate the transcriptional activity of LINE-1.
Densely ionizing radiation affects DNA methylation of selective LINE-1 elements
International Nuclear Information System (INIS)
Prior, Sara; Miousse, Isabelle R.; Nzabarushimana, Etienne; Pathak, Rupak; Skinner, Charles; Kutanzi, Kristy R.; Allen, Antiño R.; Raber, Jacob; Tackett, Alan J.; Hauer-Jensen, Martin; Nelson, Gregory A.
2016-01-01
Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. - Highlights: • DNA methylation of LINE-1 elements is dependent on their evolutionary age. • Densely ionizing radiation affects DNA methylation of selective LINE-1 elements. • Radiation-induced reactivation of LINE-1 is DNA methylation-independent. • Histone modifications dictate the transcriptional activity of LINE-1.
Cai, Yi; Tsai, Hsing-Chen; Yen, Ray-Whay Chiu; Zhang, Yang W; Kong, Xiangqian; Wang, Wei; Xia, Limin; Baylin, Stephen B
2017-04-01
Reversing DNA methylation abnormalities and associated gene silencing, through inhibiting DNA methyltransferases (DNMTs) is an important potential cancer therapy paradigm. Maximizing this potential requires defining precisely how these enzymes maintain genome-wide, cancer-specific DNA methylation. To date, there is incomplete understanding of precisely how the three DNMTs, 1, 3A, and 3B, interact for maintaining DNA methylation abnormalities in cancer. By combining genetic and shRNA depletion strategies, we define not only a dominant role for DNA methyltransferase 1 (DNMT1) but also distinct roles of 3A and 3B in genome-wide DNA methylation maintenance. Lowering DNMT1 below a threshold level is required for maximal loss of DNA methylation at all genomic regions, including gene body and enhancer regions, and for maximally reversing abnormal promoter DNA hypermethylation and associated gene silencing to reexpress key genes. It is difficult to reach this threshold with patient-tolerable doses of current DNMT inhibitors (DNMTIs). We show that new approaches, like decreasing the DNMT targeting protein, UHRF1, can augment the DNA demethylation capacities of existing DNA methylation inhibitors for fully realizing their therapeutic potential. © 2017 Cai et al.; Published by Cold Spring Harbor Laboratory Press.
Directory of Open Access Journals (Sweden)
Bernard F. Fuemmeler
2016-01-01
Full Text Available BACKGROUND DNA methylation of the differentially methylated regions (DMRs of imprinted genes is relevant to neurodevelopment. METHODS DNA methylation status of the DMRs of nine imprinted genes in umbilical cord blood leukocytes was analyzed in relation to infant behaviors and temperament (n = 158. RESULTS MEG3 DMR levels were positively associated with internalizing ( β = 0.15, P = 0.044 and surgency ( β = 0.19, P = 0.018 behaviors, after adjusting for birth weight, gender, gestational age at birth, maternal age at delivery, race/ethnicity, education level, smoking status, parity, and a history of anxiety or depression. Higher methylation levels at the intergenic MEG3-IG methylation regions were associated with surgency ( β = 0.28, P = 0.0003 and PEG3 was positively related to externalizing ( β = 0.20, P = 0.01 and negative affectivity ( β = 0.18, P = 0.02. CONCLUSION While the small sample size limits inference, these pilot data support gene-specific associations between epigenetic differences in regulatory regions of imprinted domains at birth and later infant temperament.
DNA methylation-based variation between human populations.
Kader, Farzeen; Ghai, Meenu
2017-02-01
Several studies have proved that DNA methylation affects regulation of gene expression and development. Epigenome-wide studies have reported variation in methylation patterns between populations, including Caucasians, non-Caucasians (Blacks), Hispanics, Arabs, and numerous populations of the African continent. Not only has DNA methylation differences shown to impact externally visible characteristics, but is also a potential biomarker for underlying racial health disparities between human populations. Ethnicity-related methylation differences set their mark during early embryonic development. Genetic variations, such as single-nucleotide polymorphisms and environmental factors, such as age, dietary folate, socioeconomic status, and smoking, impacts DNA methylation levels, which reciprocally impacts expression of phenotypes. Studies show that it is necessary to address these external influences when attempting to differentiate between populations since the relative impacts of these factors on the human methylome remain uncertain. The present review summarises several reported attempts to establish the contribution of differential DNA methylation to natural human variation, and shows that DNA methylation could represent new opportunities for risk stratification and prevention of several diseases amongst populations world-wide. Variation of methylation patterns between human populations is an exciting prospect which inspires further valuable research to apply the concept in routine medical and forensic casework. However, trans-generational inheritance needs to be quantified to decipher the proportion of variation contributed by DNA methylation. The future holds thorough evaluation of the epigenome to understand quantification, heritability, and the effect of DNA methylation on phenotypes. In addition, methylation profiling of the same ethnic groups across geographical locations will shed light on conserved methylation differences in populations.
Fisel, Pascale; Stühler, Viktoria; Bedke, Jens; Winter, Stefan; Rausch, Steffen; Hennenlotter, Jörg; Nies, Anne T; Stenzl, Arnulf; Scharpf, Marcus; Fend, Falko; Kruck, Stephan; Schwab, Matthias; Schaeffeler, Elke
2015-10-13
Cluster of differentiation 147 (CD147/BSG) is a transmembrane glycoprotein mediating oncogenic processes partly through its role as binding partner for monocarboxylate transporter MCT4/SLC16A3. As demonstrated for MCT4, CD147 is proposed to be associated with progression in clear cell renal cell carcinoma (ccRCC). In this study, we evaluated the prognostic relevance of CD147 in comparison to MCT4/SLC16A3 expression and DNA methylation. CD147 protein expression was assessed in two independent ccRCC-cohorts (n = 186, n = 59) by immunohistochemical staining of tissue microarrays and subsequent manual as well as automated software-supported scoring (Tissue Studio, Definien sAG). Epigenetic regulation of CD147 was investigated using RNAseq and DNA methylation data of The Cancer Genome Atlas. These results were validated in our cohort. Relevance of prognostic models for cancer-specific survival, comprising CD147 and MCT4 expression or SLC16A3 DNA methylation, was compared using chi-square statistics. CD147 protein expression generated with Tissue Studio correlated significantly with those from manual scoring (P CD147 in ccRCC. Association of CD147 expression with patient outcome differed between cohorts. DNA methylation in the CD147/BSG promoter was not associated with expression. Comparison of prognostic relevance of CD147/BSG and MCT4/SLC16A3, showed higher significance for MCT4 expression and superior prognostic power for DNA methylation at specific CpG-sites in the SLC16A3 promoter (e.g. CD147 protein: P = 0.7780,Harrell's c-index = 53.7% vs. DNA methylation: P = 0.0076, Harrell's c-index = 80.0%). Prognostic significance of CD147 protein expression could not surpass that of MCT4, especially of SLC16A3 DNA methylation, corroborating the role of MCT4 as prognostic biomarker for ccRCC.
DNA methylation abnormalities in congenital heart disease.
Serra-Juhé, Clara; Cuscó, Ivon; Homs, Aïda; Flores, Raquel; Torán, Núria; Pérez-Jurado, Luis A
2015-01-01
Congenital heart defects represent the most common malformation at birth, occurring also in ∼50% of individuals with Down syndrome. Congenital heart defects are thought to have multifactorial etiology, but the main causes are largely unknown. We have explored the global methylation profile of fetal heart DNA in comparison to blood DNA from control subjects: an absolute correlation with the type of tissue was detected. Pathway analysis revealed a significant enrichment of differential methylation at genes related to muscle contraction and cardiomyopathies in the developing heart DNA. We have also searched for abnormal methylation profiles on developing heart-tissue DNA of syndromic and non-syndromic congenital heart defects. On average, 3 regions with aberrant methylation were detected per sample and 18 regions were found differentially methylated between groups. Several epimutations were detected in candidate genes involved in growth regulation, apoptosis and folate pathway. A likely pathogenic hypermethylation of several intragenic sites at the MSX1 gene, involved in outflow tract morphogenesis, was found in a fetus with isolated heart malformation. In addition, hypermethylation of the GATA4 gene was present in fetuses with Down syndrome with or without congenital heart defects, as well as in fetuses with isolated heart malformations. Expression deregulation of the abnormally methylated genes was detected. Our data indicate that epigenetic alterations of relevant genes are present in developing heart DNA in fetuses with both isolated and syndromic heart malformations. These epimutations likely contribute to the pathogenesis of the malformation by cis-acting effects on gene expression.
Detection of methylated CDO1 in plasma of colorectal cancer; a PCR study.
Directory of Open Access Journals (Sweden)
Keishi Yamashita
Full Text Available BACKGROUND: Cysteine biology is important for the chemosensitivity of cancer cells. Our research has focused on the epigenetic silencing of cysteine dioxygenase type 1 (CDO1 in colorectal cancer (CRC. In this study, we describe detection of CDO1 methylation in the plasma of CRC patients using methylation specific PCR (Q-MSP and extensive analysis of the PCR reaction. METHODS: DNA was extracted from plasma, and analysed for methylation of the CDO1 gene using Q-MSP. The detection rate of CDO1 gene methylation was calculated and compared with that of diluted DNA extracted from "positive control" DLD1 cells. CDO1 gene methylation in the plasma of 40 CRC patients that were clinicopathologically analysed was then determined. RESULTS: (1 The cloned sequence analysis detected 93.3% methylation of the promoter CpG islands of the CDO1 gene of positive control DLD1 cells and 4.7% methylation of the negative control HepG2 CDO1 gene. (2 DLD1 CDO1 DNA could not be detected in this assay if the extracted DNA was diluted ∼1000 fold. The more DNA that was used for the PCR reaction, the more effectively it was amplified in Q-MSP. (3 By increasing the amount of DNA used, methylated CDO1 could be clearly detected in the plasma of 8 (20% of the CRC patients. However, the percentage of CRC patients detected by methylated CDO1 in plasma was lower than that detected by CEA (35.9% or CA19-9 (23.1% in preoperative serum. Combination of CEA/CA19-9 plus plasma methylated CDO1 could increase the rate of detection of curable CRC patients (39.3% as compared to CEA/CA19-9 (25%. CONCLUSION: We have described detection of CDO1 methylation in the plasma of CRC patients. Although CDO1 methylation was not detected as frequently as conventional tumor markers, analysis of plasma CDO1 methylation in combination with CEA/CA19-9 levels increases the detection rate of curable CRC patients.
Directory of Open Access Journals (Sweden)
Małgorzata Pokrywka
2014-11-01
Full Text Available The number of overweight and obese people is increasing at an alarming rate, especially in the developed and developing countries. Obesity is a major risk factor for diabetes, cardiovascular disease, and cancer, and in consequence for premature death. The development of obesity results from the interplay of both genetic and environmental factors, which include sedentary life style and abnormal eating habits. In the past few years a number of events accompanying obesity, affecting expression of genes which are not directly connected with the DNA base sequence (e.g. epigenetic changes, have been described. Epigenetic processes include DNA methylation, histone modifications such as acetylation, methylation, phosphorylation, ubiquitination, and sumoylation, as well as non-coding micro-RNA (miRNA synthesis. In this review, the known changes in the profile of DNA methylation as a factor affecting obesity and its complications are described.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC411 (Link to dictyBase) - - - Contig-U16272-1 SLC411Z (Link... to Original site) - - SLC411Z 486 - - - - Show SLC411 Library SL (Link to library) Clone ID SLC411 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC411Q.Seq.d/ Representative seq. ID SLC41...1Z (Link to Original site) Representative DNA sequence >SLC411 (SLC411Q) /CSM/SL/SLC4-A/SLC411Q.Seq.d/ XXXXX...vacuolar 4.0 %: peroxisomal >> prediction for SLC411 is nuc 5' end seq. ID - 5' e
Trichloroethylene-induced gene expression and DNA methylation changes in B6C3F1 mouse liver.
Directory of Open Access Journals (Sweden)
Yan Jiang
Full Text Available Trichloroethylene (TCE, widely used as an organic solvent in the industry, is a common contaminant in air, soil, and water. Chronic TCE exposure induced hepatocellular carcinoma in mice, and occupational exposure in humans was suggested to be associated with liver cancer. To understand the role of non-genotoxic mechanism(s for TCE action, we examined the gene expression and DNA methylation changes in the liver of B6C3F1 mice orally administered with TCE (0, 100, 500 and 1000 mg/kg b.w. per day for 5 days. After 5 days TCE treatment at a dose level of 1000 mg/kg b.w., a total of 431 differentially expressed genes were identified in mouse liver by microarray, of which 291 were up-regulated and 140 down-regulated. The expression changed genes were involved in key signal pathways including PPAR, proliferation, apoptosis and homologous recombination. Notably, the expression level of a number of vital genes involved in the regulation of DNA methylation, such as Utrf1, Tet2, DNMT1, DNMT3a and DNMT3b, were dysregulated. Although global DNA methylation change was not detected in the liver of mice exposed to TCE, the promoter regions of Cdkn1a and Ihh were found to be hypo- and hypermethylated respectively, which correlated negatively with their mRNA expression changes. Furthermore, the gene expression and DNA methylation changes induced by TCE were dose dependent. The overall data indicate that TCE exposure leads to aberrant DNA methylation changes, which might alter the expression of genes involved in the TCE-induced liver tumorgenesis.
Karimi, Mohsen; Vedin, Inger; Freund Levi, Yvonne; Basun, Hans; Faxén Irving, Gerd; Eriksdotter, Maria; Wahlund, Lars-Olof; Schultzberg, Marianne; Hjorth, Erik; Cederholm, Tommy; Palmblad, Jan
2017-10-01
Background: Dietary fish oils, rich in long-chain n-3 (ω-3) fatty acids (FAs) [e.g., docosahexaenoic acid (DHA, 22:6n-3) and eicosapentaenoic acid (EPA, 20:5n-3)], modulate inflammatory reactions through various mechanisms, including gene expression, which is measured as messenger RNA concentration. However, the effects of long-term treatment of humans with DHA and EPA on various epigenetic factors-such as DNA methylation, which controls messenger RNA generation-are poorly described. Objective: We wanted to determine the effects of 6 mo of dietary supplementation with an n-3 FA preparation rich in DHA on global DNA methylation of peripheral blood leukocytes (PBLs) and the relation to plasma EPA and DHA concentrations in Alzheimer disease (AD) patients. Design: In the present study, DNA methylation in four 5'-cytosine-phosphate-guanine-3' (CpG) sites of long interspersed nuclear element-1 repetitive sequences was assessed in a group of 63 patients (30 given the n-3 FA preparation and 33 given placebo) as an estimation of the global DNA methylation in blood cells. Patients originated from the randomized, double-blind, placebo-controlled OmegAD study, in which 174 AD patients received either 1.7 g DHA and 0.6 g EPA (the n-3 FA group) or placebo daily for 6 mo. Results: At 6 mo, the n-3 FA group displayed marked increases in DHA and EPA plasma concentrations (2.6- and 3.5-fold), as well as decreased methylation in 2 out of 4 CpG sites ( P DHA concentration, and were not related to apolipoprotein E-4 allele frequency. Conclusion: Supplementation with n-3 FA for 6 mo was associated with global DNA hypomethylation in PBLs. Our data may be of importance in measuring various effects of marine oils, including gene expression, in patients with AD and in other patients taking n-3 FA supplements. This trial was registered at clinicaltrials.gov as NCT00211159. © 2017 American Society for Nutrition.
Bisulfite sequencing reveals that Aspergillus flavus holds a hollow in DNA methylation.
Directory of Open Access Journals (Sweden)
Si-Yang Liu
Full Text Available Aspergillus flavus first gained scientific attention for its production of aflatoxin. The underlying regulation of aflatoxin biosynthesis has been serving as a theoretical model for biosynthesis of other microbial secondary metabolites. Nevertheless, for several decades, the DNA methylation status, one of the important epigenomic modifications involved in gene regulation, in A. flavus remains to be controversial. Here, we applied bisulfite sequencing in conjunction with a biological replicate strategy to investigate the DNA methylation profiling of A. flavus genome. Both the bisulfite sequencing data and the methylome comparisons with other fungi confirm that the DNA methylation level of this fungus is negligible. Further investigation into the DNA methyltransferase of Aspergillus uncovers its close relationship with RID-like enzymes as well as its divergence with the methyltransferase of species with validated DNA methylation. The lack of repeat contents of the A. flavus' genome and the high RIP-index of the small amount of remanent repeat potentially support our speculation that DNA methylation may be absent in A. flavus or that it may possess de novo DNA methylation which occurs very transiently during the obscure sexual stage of this fungal species. This work contributes to our understanding on the DNA methylation status of A. flavus, as well as reinforces our views on the DNA methylation in fungal species. In addition, our strategy of applying bisulfite sequencing to DNA methylation detection in species with low DNA methylation may serve as a reference for later scientific investigations in other hypomethylated species.
Directory of Open Access Journals (Sweden)
Tandi E. Matsha
2016-01-01
Full Text Available The aim of this study is to quantify global DNA methylation and investigate the relationship with diabetes status and polymorphisms in MTHFR C677T and NOS3 G894T genes in mixed ancestry subjects from South Africa. Global DNA methylation was measured, and MTHFR rs1801133 and NOS3 rs1799983 polymorphisms were genotyped using high throughput real-time polymerase chain reaction and direct DNA sequencing. Of the 564 participants, 158 (28% individuals had T2DM of which 97 (17.2% were screen-detected cases. Another 119 (21.1% had prediabetes, that is, impaired fasting glucose, impaired glucose tolerance, or the combination of both, and the remainder 287 (50.9% had normal glucose tolerance. Global DNA methylation was significantly higher in prediabetes and screen-detected diabetes than in normal glucose tolerance (both p≤0.033 and in screen-detected diabetes compared to known diabetes on treatment (p=0.019. There was no difference in global DNA methylation between known diabetes on treatment and normal glucose tolerance (p>0.999. In multivariable linear regression analysis, only NOS3 was associated with increasing global DNA methylation (β=0.943; 95% CI: 0.286 to 1.560. The association of global DNA methylation with screen-detected diabetes but not treated diabetes suggests that glucose control agents to some extent may be reversing DNA methylation. The association between NOS3 rs1799983 polymorphisms and DNA methylation suggests gene-epigenetic mechanisms through which vascular diabetes complications develop despite adequate metabolic control.
Mutize, Tinashe; Erasmus, Rajiv T.
2016-01-01
The aim of this study is to quantify global DNA methylation and investigate the relationship with diabetes status and polymorphisms in MTHFR C677T and NOS3 G894T genes in mixed ancestry subjects from South Africa. Global DNA methylation was measured, and MTHFR rs1801133 and NOS3 rs1799983 polymorphisms were genotyped using high throughput real-time polymerase chain reaction and direct DNA sequencing. Of the 564 participants, 158 (28%) individuals had T2DM of which 97 (17.2%) were screen-detected cases. Another 119 (21.1%) had prediabetes, that is, impaired fasting glucose, impaired glucose tolerance, or the combination of both, and the remainder 287 (50.9%) had normal glucose tolerance. Global DNA methylation was significantly higher in prediabetes and screen-detected diabetes than in normal glucose tolerance (both p ≤ 0.033) and in screen-detected diabetes compared to known diabetes on treatment (p = 0.019). There was no difference in global DNA methylation between known diabetes on treatment and normal glucose tolerance (p > 0.999). In multivariable linear regression analysis, only NOS3 was associated with increasing global DNA methylation (β = 0.943; 95% CI: 0.286 to 1.560). The association of global DNA methylation with screen-detected diabetes but not treated diabetes suggests that glucose control agents to some extent may be reversing DNA methylation. The association between NOS3 rs1799983 polymorphisms and DNA methylation suggests gene-epigenetic mechanisms through which vascular diabetes complications develop despite adequate metabolic control. PMID:27990443
Effects of temperature and relative humidity on DNA methylation.
Bind, Marie-Abele; Zanobetti, Antonella; Gasparrini, Antonio; Peters, Annette; Coull, Brent; Baccarelli, Andrea; Tarantini, Letizia; Koutrakis, Petros; Vokonas, Pantel; Schwartz, Joel
2014-07-01
Previous studies have found relationships between DNA methylation and various environmental contaminant exposures. Associations with weather have not been examined. Because temperature and humidity are related to mortality even on non-extreme days, we hypothesized that temperature and relative humidity may affect methylation. We repeatedly measured methylation on long interspersed nuclear elements (LINE-1), Alu, and 9 candidate genes in blood samples from 777 elderly men participating in the Normative Aging Study (1999-2009). We assessed whether ambient temperature and relative humidity are related to methylation on LINE-1 and Alu, as well as on genes controlling coagulation, inflammation, cortisol, DNA repair, and metabolic pathway. We examined intermediate-term associations of temperature, relative humidity, and their interaction with methylation, using distributed lag models. Temperature or relative humidity levels were associated with methylation on tissue factor (F3), intercellular adhesion molecule 1 (ICAM-1), toll-like receptor 2 (TRL-2), carnitine O-acetyltransferase (CRAT), interferon gamma (IFN-γ), inducible nitric oxide synthase (iNOS), and glucocorticoid receptor, LINE-1, and Alu. For instance, a 5°C increase in 3-week average temperature in ICAM-1 methylation was associated with a 9% increase (95% confidence interval: 3% to 15%), whereas a 10% increase in 3-week average relative humidity was associated with a 5% decrease (-8% to -1%). The relative humidity association with ICAM-1 methylation was stronger on hot days than mild days. DNA methylation in blood cells may reflect biological effects of temperature and relative humidity. Temperature and relative humidity may also interact to produce stronger effects.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC424 (Link to dictyBase) - G01086 DDB0231665 Contig-U08784-1 SLC4...24P (Link to Original site) SLC424F 169 SLC424Z 538 SLC424P 707 - - Show SLC424 Library SL (Link to library) Clone ID SLC4...ontig-U08784-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...24Q.Seq.d/ Representative seq. ID SLC424P (Link to Original site) Representative DNA sequence >SLC424 (SLC424Q) /CSM/SL/SLC4...-A/SLC424Q.Seq.d/ GGATATTATAATTTCAAATTAAGTTTTATAAATTTGAAATAATATTGAAAAAAAAAAAAA ATAAAAAA
Electronic transport in methylated fragments of DNA
Energy Technology Data Exchange (ETDEWEB)
Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L., E-mail: umbertofulco@gmail.com; Albuquerque, E. L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Freire, V. N. [Departamento de Física, Universidade Federal do Ceará, 60455-760 Fortaleza, CE (Brazil); Caetano, E. W. S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531 Fortaleza, CE (Brazil); Moura, F. A. B. F. de; Lyra, M. L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)
2015-11-16
We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.
Electronic transport in methylated fragments of DNA
International Nuclear Information System (INIS)
Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; Moura, F. A. B. F. de; Lyra, M. L.
2015-01-01
We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics
Wang, Dan; Zhao, Jieyu; Bai, Yan; Ao, You; Guo, Changhong
2017-08-10
Gametocidal (Gc) chromosomes can ensure their preferential transmission by killing the gametes without themselves through causing chromosome breakage and therefore have been exploited as an effective tool for genetic breeding. However, to date very little is known about the molecular mechanism of Gc action. In this study, we used methylation-sensitive amplified polymorphism (MSAP) technique to assess the extent and pattern of cytosine methylation alterations at the whole genome level between two lines of wheat Gc addition line and their common wheat parent. The results indicated that the overall levels of cytosine methylation of two studied Gc addition lines (CS-3C and CS-3C3C, 48.68% and 48.65%, respectively) were significantly increased when compared to common wheat CS (41.31%) and no matter fully methylated or hemimethylated rates enhanced in Gc addition lines. A set of 30 isolated fragments that showed different DNA methylation or demethylation patterns between the three lines were sequenced and the results indicated that 8 fragments showed significant homology to known sequences, of which three were homologous to MITE transposon (Miniature inverted-repeat transposable elements), LTR-retrotransposon WIS-1p and retrotransposon Gypsy , respectively. Overall, our results showed that DNA methylation could play a role in the Gc action.
Directory of Open Access Journals (Sweden)
Dan Wang
2017-08-01
Full Text Available Gametocidal (Gc chromosomes can ensure their preferential transmission by killing the gametes without themselves through causing chromosome breakage and therefore have been exploited as an effective tool for genetic breeding. However, to date very little is known about the molecular mechanism of Gc action. In this study, we used methylation-sensitive amplified polymorphism (MSAP technique to assess the extent and pattern of cytosine methylation alterations at the whole genome level between two lines of wheat Gc addition line and their common wheat parent. The results indicated that the overall levels of cytosine methylation of two studied Gc addition lines (CS–3C and CS–3C3C, 48.68% and 48.65%, respectively were significantly increased when compared to common wheat CS (41.31% and no matter fully methylated or hemimethylated rates enhanced in Gc addition lines. A set of 30 isolated fragments that showed different DNA methylation or demethylation patterns between the three lines were sequenced and the results indicated that 8 fragments showed significant homology to known sequences, of which three were homologous to MITE transposon (Miniature inverted–repeat transposable elements, LTR-retrotransposon WIS-1p and retrotransposon Gypsy, respectively. Overall, our results showed that DNA methylation could play a role in the Gc action.
Linkage of DNA Methylation Quantitative Trait Loci to Human Cancer Risk
Directory of Open Access Journals (Sweden)
Holger Heyn
2014-04-01
Full Text Available Epigenetic regulation and, in particular, DNA methylation have been linked to the underlying genetic sequence. DNA methylation quantitative trait loci (meQTL have been identified through significant associations between the genetic and epigenetic codes in physiological and pathological contexts. We propose that interrogating the interplay between polymorphic alleles and DNA methylation is a powerful method for improving our interpretation of risk alleles identified in genome-wide association studies that otherwise lack mechanistic explanation. We integrated patient cancer risk genotype data and genome-scale DNA methylation profiles of 3,649 primary human tumors, representing 13 solid cancer types. We provide a comprehensive meQTL catalog containing DNA methylation associations for 21% of interrogated cancer risk polymorphisms. Differentially methylated loci harbor previously reported and as-yet-unidentified cancer genes. We suggest that such regulation at the DNA level can provide a considerable amount of new information about the biology of cancer-risk alleles.
Exploring the roles of DNA methylation in the metal-reducing bacterium Shewanella oneidensis MR-1
Energy Technology Data Exchange (ETDEWEB)
Bendall, Matthew L. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Luong, Khai [Pacific Biosciences, Menlo Park, CA (United States); Wetmore, Kelly M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Blow, Matthew [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Korlach, Jonas [Pacific Biosciences, Menlo Park, CA (United States); Deutschbauer, Adam [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Malmstrom, Rex [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)
2013-08-30
We performed whole genome analyses of DNA methylation in Shewanella 17 oneidensis MR-1 to examine its possible role in regulating gene expression and 18 other cellular processes. Single-Molecule Real Time (SMRT) sequencing 19 revealed extensive methylation of adenine (N6mA) throughout the 20 genome. These methylated bases were located in five sequence motifs, 21 including three novel targets for Type I restriction/modification enzymes. The 22 sequence motifs targeted by putative methyltranferases were determined via 23 SMRT sequencing of gene knockout mutants. In addition, we found S. 24 oneidensis MR-1 cultures grown under various culture conditions displayed 25 different DNA methylation patterns. However, the small number of differentially 26 methylated sites could not be directly linked to the much larger number of 27 differentially expressed genes in these conditions, suggesting DNA methylation is 28 not a major regulator of gene expression in S. oneidensis MR-1. The enrichment 29 of methylated GATC motifs in the origin of replication indicate DNA methylation 30 may regulate genome replication in a manner similar to that seen in Escherichia 31 coli. Furthermore, comparative analyses suggest that many 32 Gammaproteobacteria, including all members of the Shewanellaceae family, may 33 also utilize DNA methylation to regulate genome replication.
DNA methylation profiling of embryonic stem cell differentiation into the three germ layers.
Isagawa, Takayuki; Nagae, Genta; Shiraki, Nobuaki; Fujita, Takanori; Sato, Noriko; Ishikawa, Shumpei; Kume, Shoen; Aburatani, Hiroyuki
2011-01-01
Embryogenesis is tightly regulated by multiple levels of epigenetic regulation such as DNA methylation, histone modification, and chromatin remodeling. DNA methylation patterns are erased in primordial germ cells and in the interval immediately following fertilization. Subsequent developmental reprogramming occurs by de novo methylation and demethylation. Variance in DNA methylation patterns between different cell types is not well understood. Here, using methylated DNA immunoprecipitation and tiling array technology, we have comprehensively analyzed DNA methylation patterns at proximal promoter regions in mouse embryonic stem (ES) cells, ES cell-derived early germ layers (ectoderm, endoderm and mesoderm) and four adult tissues (brain, liver, skeletal muscle and sperm). Most of the methylated regions are methylated across all three germ layers and in the three adult somatic tissues. This commonly methylated gene set is enriched in germ cell-associated genes that are generally transcriptionally inactive in somatic cells. We also compared DNA methylation patterns by global mapping of histone H3 lysine 4/27 trimethylation, and found that gain of DNA methylation correlates with loss of histone H3 lysine 4 trimethylation. Our combined findings indicate that differentiation of ES cells into the three germ layers is accompanied by an increased number of commonly methylated DNA regions and that these tissue-specific alterations in methylation occur for only a small number of genes. DNA methylation at the proximal promoter regions of commonly methylated genes thus appears to be an irreversible mark which functions to fix somatic lineage by repressing the transcription of germ cell-specific genes.
Quantification of 5-methyl-2'-deoxycytidine in the DNA.
Giel-Pietraszuk, Małgorzata; Insińska-Rak, Małgorzata; Golczak, Anna; Sikorski, Marek; Barciszewska, Mirosława; Barciszewski, Jan
2015-01-01
Methylation at position 5 of cytosine (Cyt) at the CpG sequences leading to formation of 5-methyl-cytosine (m(5)Cyt) is an important element of epigenetic regulation of gene expression. Modification of the normal methylation pattern, unique to each organism, leads to the development of pathological processes and diseases, including cancer. Therefore, quantification of the DNA methylation and analysis of changes in the methylation pattern is very important from a practical point of view and can be used for diagnostic purposes, as well as monitoring of the treatment progress. In this paper we present a new method for quantification of 5-methyl-2'deoxycytidine (m(5)C) in the DNA. The technique is based on conversion of m(5)C into fluorescent 3,N(4)-etheno-5-methyl-2'deoxycytidine (εm(5)C) and its identification by reversed-phase high-performance liquid chromatography (RP-HPLC). The assay was used to evaluate m(5)C concentration in DNA of calf thymus and peripheral blood of cows bred under different conditions. This approach can be applied for measuring of 5-methylcytosine in cellular DNA from different cells and tissues.
Huang, Tao; Zheng, Yan; Qi, Qibin; Xu, Min; Ley, Sylvia H; Li, Yanping; Kang, Jae H; Wiggs, Janey; Pasquale, Louis R; Chan, Andrew T; Rimm, Eric B; Hunter, David J; Manson, JoAnn E; Willett, Walter C; Hu, Frank B; Qi, Lu
2015-09-01
The first epigenome-wide association study of BMI identified DNA methylation at an HIF3A locus associated with BMI. We tested the hypothesis that DNA methylation variants are associated with BMI according to intake of B vitamins. In two large cohorts, we found significant interactions between the DNA methylation-associated HIF3A single nucleotide polymorphism (SNP) rs3826795 and intake of B vitamins on 10-year changes in BMI. The association between rs3826795 and BMI changes consistently increased across the tertiles of total vitamin B2 and B12 intake (all P for interaction vitamin B2 intake and -0.10 (SE 0.06), -0.01 (SE 0.06), and 0.10 (SE 0.07) within subgroups defined by increasing tertiles of total vitamin B12 intake. In two independent cohorts, a DNA methylation variant in HIF3A was associated with BMI changes through interactions with total or supplemental vitamin B2, vitamin B12, and folate. These findings suggest a potential causal relation between DNA methylation and adiposity. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.
PCFT/SLC46A1 promoter methylation and restoration of gene expression in human leukemia cells
International Nuclear Information System (INIS)
Gonen, Nitzan; Bram, Eran E.; Assaraf, Yehuda G.
2008-01-01
The proton-coupled folate transporter (PCFT/SLC46A1) displays optimal and prominent folate and antifolate transport activity at acidic pH in human carcinoma cells but poor activity in leukemia cells. Consistently herein, human leukemia cell lines expressed poor PCFT transcript levels, whereas various carcinoma cell lines showed substantial PCFT gene expression. We identified a CpG island with high density at nucleotides -200 through +100 and explored its role in PCFT promoter silencing. Leukemia cells with barely detectable PCFT transcripts consistently harbored 85-100% methylation of this CpG island, whereas no methylation was found in carcinoma cells. Treatment with 5-Aza-2'-deoxycytidine which induced demethylation but not with the histone deacetylase inhibitor trichostatin A, restored 50-fold PCFT expression only in leukemia cells. These findings constitute the first demonstration of the dominant epigenetic silencing of the PCFT gene in leukemia cells. The potential translational implications of the restoration of PCFT expression in chemotherapy of leukemia are discussed
Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma
Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.
2012-01-01
Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009
Funata, Sayaka; Matsusaka, Keisuke; Yamanaka, Ryota; Yamamoto, Shogo; Okabe, Atsushi; Fukuyo, Masaki; Aburatani, Hiroyuki; Fukayama, Masashi; Kaneda, Atsushi
2017-08-15
Aberrant DNA hypermethylation is a major epigenetic mechanism to inactivate tumor suppressor genes in cancer. Epstein-Barr virus positive gastric cancer is the most frequently hypermethylated tumor among human malignancies. Herein, we performed comprehensive analysis of epigenomic alteration during EBV infection, by Infinium HumanMethylation 450K BeadChip for DNA methylation and ChIP-sequencing for histone modification alteration during EBV infection into gastric cancer cell line MKN7. Among 7,775 genes with increased DNA methylation in promoter regions, roughly half were "DNA methylation-sensitive" genes, which acquired DNA methylation in the whole promoter regions and thus were repressed. These included anti-oncogenic genes, e.g. CDKN2A . The other half were "DNA methylation-resistant" genes, where DNA methylation is acquired in the surrounding of promoter regions, but unmethylated status is protected in the vicinity of transcription start site. These genes thereby retained gene expression, and included DNA repair genes. Histone modification was altered dynamically and coordinately with DNA methylation alteration. DNA methylation-sensitive genes significantly correlated with loss of H3K27me3 pre-marks or decrease of active histone marks, H3K4me3 and H3K27ac. Apoptosis-related genes were significantly enriched in these epigenetically repressed genes. Gain of active histone marks significantly correlated with DNA methylation-resistant genes. Genes related to mitotic cell cycle and DNA repair were significantly enriched in these epigenetically activated genes. Our data show that orchestrated epigenetic alterations are important in gene regulation during EBV infection, and histone modification status in promoter regions significantly associated with acquisition of de novo DNA methylation or protection of unmethylated status at transcription start site.
Defining Driver DNA Methylation Changes in Human Cancer
Directory of Open Access Journals (Sweden)
Gerd P. Pfeifer
2018-04-01
Full Text Available Human malignant tumors are characterized by pervasive changes in the patterns of DNA methylation. These changes include a globally hypomethylated tumor cell genome and the focal hypermethylation of numerous 5′-cytosine-phosphate-guanine-3′ (CpG islands, many of them associated with gene promoters. It has been challenging to link specific DNA methylation changes with tumorigenesis in a cause-and-effect relationship. Some evidence suggests that cancer-associated DNA hypomethylation may increase genomic instability. Promoter hypermethylation events can lead to silencing of genes functioning in pathways reflecting hallmarks of cancer, including DNA repair, cell cycle regulation, promotion of apoptosis or control of key tumor-relevant signaling networks. A convincing argument for a tumor-driving role of DNA methylation can be made when the same genes are also frequently mutated in cancer. Many of the most commonly hypermethylated genes encode developmental transcription factors, the methylation of which may lead to permanent gene silencing. Inactivation of such genes will deprive the cells in which the tumor may initiate from the option of undergoing or maintaining lineage differentiation and will lock them into a perpetuated stem cell-like state thus providing an additional window for cell transformation.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC402 (Link to dictyBase) - - - Contig-U16327-1 SLC402E (Link to Original site) SLC4...02F 661 SLC402Z 395 SLC402P 1056 SLC402E 674 Show SLC402 Library SL (Link to library) Clone ID SLC4...inal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC402Q.Seq.d/ Representative seq. ID SLC4...02E (Link to Original site) Representative DNA sequence >SLC402 (SLC402Q) /CSM/SL/SLC4-A/SLC4...lignments: (bits) Value SSC554 (SSC554Q) /CSM/SS/SSC5-C/SSC554Q.Seq.d/ 1128 0.0 SLC402 (SLC4
Prognostic DNA Methylation Markers for Prostate Cancer
Directory of Open Access Journals (Sweden)
Siri H. Strand
2014-09-01
Full Text Available Prostate cancer (PC is the most commonly diagnosed neoplasm and the third most common cause of cancer-related death amongst men in the Western world. PC is a clinically highly heterogeneous disease, and distinction between aggressive and indolent disease is a major challenge for the management of PC. Currently, no biomarkers or prognostic tools are able to accurately predict tumor progression at the time of diagnosis. Thus, improved biomarkers for PC prognosis are urgently needed. This review focuses on the prognostic potential of DNA methylation biomarkers for PC. Epigenetic changes are hallmarks of PC and associated with malignant initiation as well as tumor progression. Moreover, DNA methylation is the most frequently studied epigenetic alteration in PC, and the prognostic potential of DNA methylation markers for PC has been demonstrated in multiple studies. The most promising methylation marker candidates identified so far include PITX2, C1orf114 (CCDC181 and the GABRE~miR-452~miR-224 locus, in addition to the three-gene signature AOX1/C1orf114/HAPLN3. Several other biomarker candidates have also been investigated, but with less stringent clinical validation and/or conflicting evidence regarding their possible prognostic value available at this time. Here, we review the current evidence for the prognostic potential of DNA methylation markers in PC.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC420 (Link to dictyBase) - G01085 DDB0205634 Contig-U01169-1 | Contig-U15736-1 SLC4...20P (Link to Original site) SLC420F 333 SLC420Z 423 SLC420P 756 - - Show SLC420 Libra...ry SL (Link to library) Clone ID SLC420 (Link to dictyBase) Atlas ID - NBRP ID G01085 dictyBase ID DDB020563...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC420Q.Seq.d/ Representative seq. ID SLC420P (Link to Original site) R...epresentative DNA sequence >SLC420 (SLC420Q) /CSM/SL/SLC4-A/SLC420Q.Seq.d/ GCTAGCACACACATAAATAATACATACACACAT
Bodell, W J; Banerjee, M R
1976-01-01
We have measured DNA repair in mouse satellite and main band DNA as resolved by Ag+-Cs2SO4 centrifugation in response to treatment with the alkylating agents, methyl methanesulfonate, and N-methyl-N-nitrosourea. We find that there is a statistically significant lower incorporation of 3H-Tdr into the satellite DNA as compared to the main band at varying periods after treatment with the alkylating agents. This suggests a reduced repair activity in the satellite DNA. We have measured the extent of binding of 14C-methyl methanesulfonate to the satellite, and main band DNA, and no difference in binding was observed, indicating that the reduced repair activity of satellite DNA is not due to a difference in binding of alkylating agents. We believe that the reduced incorporation of 3H-Tdr into satellite DNA may be due to its location in the condensed chromatin fraction. PMID:184436
Altered DNA methylation associated with a translocation linked to major mental illness
McCartney, Daniel L; Walker, Rosie M; Morris, Stewart W; Anderson, Susan M; Duff, Barbara J; Marioni, Riccardo E; Millar, J Kirsty; McCarthy, Shane E; Ryan, Niamh M; Lawrie, Stephen M; Watson, Andrew R; Blackwood, Douglas H R; Thomson, Pippa A; McIntosh, Andrew M; McCombie, W Richard
2018-01-01
Recent work has highlighted a possible role for altered epigenetic modifications, including differential DNA methylation, in susceptibility to psychiatric illness. Here, we investigate blood-based DNA methylation in a large family where a balanced translocation between chromosomes 1 and 11 shows genome-wide significant linkage to psychiatric illness. Genome-wide DNA methylation was profiled in whole-blood-derived DNA from 41 individuals using the Infinium HumanMethylation450 BeadChip (Illumin...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC481 (Link to dictyBase) - - - Contig-U16358-1 SLC481Z (Link... to Original site) - - SLC481Z 393 - - - - Show SLC481 Library SL (Link to library) Clone ID SLC481 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC481Q.Seq.d/ Representative seq. ID SLC48...1Z (Link to Original site) Representative DNA sequence >SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ XXXXX...SL/SLG8-A/SLG820Q.Seq.d/ 708 0.0 SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ 708 0.0 SLC178 (SLC178Q) /CS
Transcription factors as readers and effectors of DNA methylation.
Zhu, Heng; Wang, Guohua; Qian, Jiang
2016-08-01
Recent technological advances have made it possible to decode DNA methylomes at single-base-pair resolution under various physiological conditions. Many aberrant or differentially methylated sites have been discovered, but the mechanisms by which changes in DNA methylation lead to observed phenotypes, such as cancer, remain elusive. The classical view of methylation-mediated protein-DNA interactions is that only proteins with a methyl-CpG binding domain (MBD) can interact with methylated DNA. However, evidence is emerging to suggest that transcription factors lacking a MBD can also interact with methylated DNA. The identification of these proteins and the elucidation of their characteristics and the biological consequences of methylation-dependent transcription factor-DNA interactions are important stepping stones towards a mechanistic understanding of methylation-mediated biological processes, which have crucial implications for human development and disease.
Quantitative DNA methylation analysis of candidate genes in cervical cancer.
Directory of Open Access Journals (Sweden)
Erin M Siegel
Full Text Available Aberrant DNA methylation has been observed in cervical cancer; however, most studies have used non-quantitative approaches to measure DNA methylation. The objective of this study was to quantify methylation within a select panel of genes previously identified as targets for epigenetic silencing in cervical cancer and to identify genes with elevated methylation that can distinguish cancer from normal cervical tissues. We identified 49 women with invasive squamous cell cancer of the cervix and 22 women with normal cytology specimens. Bisulfite-modified genomic DNA was amplified and quantitative pyrosequencing completed for 10 genes (APC, CCNA, CDH1, CDH13, WIF1, TIMP3, DAPK1, RARB, FHIT, and SLIT2. A Methylation Index was calculated as the mean percent methylation across all CpG sites analyzed per gene (~4-9 CpG site per sequence. A binary cut-point was defined at >15% methylation. Sensitivity, specificity and area under ROC curve (AUC of methylation in individual genes or a panel was examined. The median methylation index was significantly higher in cases compared to controls in 8 genes, whereas there was no difference in median methylation for 2 genes. Compared to HPV and age, the combination of DNA methylation level of DAPK1, SLIT2, WIF1 and RARB with HPV and age significantly improved the AUC from 0.79 to 0.99 (95% CI: 0.97-1.00, p-value = 0.003. Pyrosequencing analysis confirmed that several genes are common targets for aberrant methylation in cervical cancer and DNA methylation level of four genes appears to increase specificity to identify cancer compared to HPV detection alone. Alterations in DNA methylation of specific genes in cervical cancers, such as DAPK1, RARB, WIF1, and SLIT2, may also occur early in cervical carcinogenesis and should be evaluated.
Cystinuria Associated with Different SLC7A9 Gene Variants in the Cat.
Directory of Open Access Journals (Sweden)
Keijiro Mizukami
Full Text Available Cystinuria is a classical inborn error of metabolism characterized by a selective proximal renal tubular defect affecting cystine, ornithine, lysine, and arginine (COLA reabsorption, which can lead to uroliths and urinary obstruction. In humans, dogs and mice, cystinuria is caused by variants in one of two genes, SLC3A1 and SLC7A9, which encode the rBAT and bo,+AT subunits of the bo,+ basic amino acid transporter system, respectively. In this study, exons and flanking regions of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA of cats (Felis catus with COLAuria and cystine calculi. Relative to the Felis catus-6.2 reference genome sequence, DNA sequences from these affected cats revealed 3 unique homozygous SLC7A9 missense variants: one in exon 5 (p.Asp236Asn from a non-purpose-bred medium-haired cat, one in exon 7 (p.Val294Glu in a Maine Coon and a Sphinx cat, and one in exon 10 (p.Thr392Met from a non-purpose-bred long-haired cat. A genotyping assay subsequently identified another cystinuric domestic medium-haired cat that was homozygous for the variant originally identified in the purebred cats. These missense variants result in deleterious amino acid substitutions of highly conserved residues in the bo,+AT protein. A limited population survey supported that the variants found were likely causative. The remaining 2 sequenced domestic short-haired cats had a heterozygous variant at a splice donor site in intron 10 and a homozygous single nucleotide variant at a branchpoint in intron 11 of SLC7A9, respectively. This study identifies the first SLC7A9 variants causing feline cystinuria and reveals that, as in humans and dogs, this disease is genetically heterogeneous in cats.
Mozzillo, Enza; Melis, Daniela; Falco, Mariateresa; Fattorusso, Valentina; Taurisano, Roberta; Flanagan, Sarah E; Ellard, Sian; Franzese, Adriana
2013-08-01
Thiamine responsive megaloblastic anemia (TRMA) is an autosomal recessive disease caused by loss of function mutations in the SLC19A2 gene. TRMA is characterized by anemia, deafness, and diabetes. In some cases, optic atrophy or more rarely retinitis pigmentosa is noted. We now report two sisters, the eldest of which presented to a different hospital during childhood with sensorineural deafness, which was treated with a hearing prosthesis, insulin requiring diabetes, retinitis pigmentosa, optic atrophy, and macrocytic anemia. These features initially suggested a clinical diagnosis of Wolfram syndrome (WS). Therapy with thiamine was initiated which resulted in the resolution of the anemia. The younger sister, who was affected with sensorineural deafness, was referred to our hospital for non-autoimmune diabetes. She was found to have macrocytosis and ocular abnormalities. Because a diagnosis of TRMA was suspected, therapy with insulin and thiamine was started. Sequencing analysis of the SLC19A2 gene identified a compound heterozygous mutation p.Y81X/p.L457X (c.242insA/c.1370delT) in both sisters. Non-autoimmune diabetes associated with deafness and macrocytosis, without anemia, suggests a diagnosis of TRMA. Patients clinically diagnosed with WS with anemia and/or macrocytosis should be reevaluated for TRMA. © 2012 John Wiley & Sons A/S.
Variation in the DNA methylation pattern of expressed and nonexpressed genes in chicken.
Cooper, D N; Errington, L H; Clayton, R M
1983-01-01
Using methyl-sensitive and -insensitive restriction enzymes, Hpa II and Msp I, the methylation status of various chicken genes was examined in different tissues and developmental stages. Tissue-specific differences in methylation were found for the delta-crystallin, beta-tubulin, G3PDH, rDNA, and actin genes but not for the histone genes. Developmental decreases in methylation were noted for the delta-crystallin and actin genes in chicken kidney between embryo and adult. Since most of the sequences examined were housekeeping genes, transcriptional differences are apparently not a necessary accompaniment to changes in DNA methylation at the CpG sites examined. The only exception is sperm DNA where the delta-crystallin, beta-tubulin, and actin genes are highly methylated and almost certainly not transcribed. However the G3PDH genes are no more highly methylated in sperm than in other somatic tissues. Many sequences homologous to the rDNA and histone probes used are unmethylated in all tissues examined including sperm, but a methylated rDNA subfraction is more heavily methylated in sperm than in other tissues. We speculate as to the significance of these differences in sperm DNA methylation in the light of possible requirements for early gene activation and the probable deleterious mutagenic effects of heavy methylation within coding sequences.
Zebrafish embryos as a screen for DNA methylation modifications after compound exposure
Energy Technology Data Exchange (ETDEWEB)
Bouwmeester, Manon C.; Ruiter, Sander; Lommelaars, Tobias; Sippel, Josefine; Hodemaekers, Hennie M. [Center for Health Protection, National Institute for Public Health and the Environment (RIVM), PO Box 1, 3720 BA Bilthoven (Netherlands); Brandhof, Evert-Jan van den [Center for Environmental Quality, National Institute for Public Health and the Environment (RIVM), PO Box 1, 3720 BA Bilthoven (Netherlands); Pennings, Jeroen L.A. [Center for Health Protection, National Institute for Public Health and the Environment (RIVM), PO Box 1, 3720 BA Bilthoven (Netherlands); Kamstra, Jorke H. [Institute for Environmental Studies (IVM), VU University, De Boelelaan 1085, 1081 HV Amsterdam (Netherlands); Jelinek, Jaroslav [Fels Institute for Cancer Research and Molecular Biology, Temple University School of Medicine, Philadelphia, PA (United States); Issa, Jean-Pierre J. [Fels Institute for Cancer Research and Molecular Biology, Temple University School of Medicine, Philadelphia, PA (United States); Department of Leukemia, The University of Texas MD Anderson Cancer Center, Houston, TX (United States); Legler, Juliette [Institute for Environmental Studies (IVM), VU University, De Boelelaan 1085, 1081 HV Amsterdam (Netherlands); Ven, Leo T.M. van der, E-mail: leo.van.der.ven@rivm.nl [Center for Health Protection, National Institute for Public Health and the Environment (RIVM), PO Box 1, 3720 BA Bilthoven (Netherlands)
2016-01-15
Modified epigenetic programming early in life is proposed to underlie the development of an adverse adult phenotype, known as the Developmental Origins of Health and Disease (DOHaD) concept. Several environmental contaminants have been implicated as modifying factors of the developing epigenome. This underlines the need to investigate this newly recognized toxicological risk and systematically screen for the epigenome modifying potential of compounds. In this study, we examined the applicability of the zebrafish embryo as a screening model for DNA methylation modifications. Embryos were exposed from 0 to 72 h post fertilization (hpf) to bisphenol-A (BPA), diethylstilbestrol, 17α-ethynylestradiol, nickel, cadmium, tributyltin, arsenite, perfluoroctanoic acid, valproic acid, flusilazole, 5-azacytidine (5AC) in subtoxic concentrations. Both global and site-specific methylation was examined. Global methylation was only affected by 5AC. Genome wide locus-specific analysis was performed for BPA exposed embryos using Digital Restriction Enzyme Analysis of Methylation (DREAM), which showed minimal wide scale effects on the genome, whereas potential informative markers were not confirmed by pyrosequencing. Site-specific methylation was examined in the promoter regions of three selected genes vasa, vtg1 and cyp19a2, of which vasa (ddx4) was the most responsive. This analysis distinguished estrogenic compounds from metals by direction and sensitivity of the effect compared to embryotoxicity. In conclusion, the zebrafish embryo is a potential screening tool to examine DNA methylation modifications after xenobiotic exposure. The next step is to examine the adult phenotype of exposed embryos and to analyze molecular mechanisms that potentially link epigenetic effects and altered phenotypes, to support the DOHaD hypothesis. - Highlights: • Compound induced effects on DNA methylation in zebrafish embryos • Global methylation not an informative biomarker • Minimal genome
Zebrafish embryos as a screen for DNA methylation modifications after compound exposure
International Nuclear Information System (INIS)
Bouwmeester, Manon C.; Ruiter, Sander; Lommelaars, Tobias; Sippel, Josefine; Hodemaekers, Hennie M.; Brandhof, Evert-Jan van den; Pennings, Jeroen L.A.; Kamstra, Jorke H.; Jelinek, Jaroslav; Issa, Jean-Pierre J.; Legler, Juliette; Ven, Leo T.M. van der
2016-01-01
Modified epigenetic programming early in life is proposed to underlie the development of an adverse adult phenotype, known as the Developmental Origins of Health and Disease (DOHaD) concept. Several environmental contaminants have been implicated as modifying factors of the developing epigenome. This underlines the need to investigate this newly recognized toxicological risk and systematically screen for the epigenome modifying potential of compounds. In this study, we examined the applicability of the zebrafish embryo as a screening model for DNA methylation modifications. Embryos were exposed from 0 to 72 h post fertilization (hpf) to bisphenol-A (BPA), diethylstilbestrol, 17α-ethynylestradiol, nickel, cadmium, tributyltin, arsenite, perfluoroctanoic acid, valproic acid, flusilazole, 5-azacytidine (5AC) in subtoxic concentrations. Both global and site-specific methylation was examined. Global methylation was only affected by 5AC. Genome wide locus-specific analysis was performed for BPA exposed embryos using Digital Restriction Enzyme Analysis of Methylation (DREAM), which showed minimal wide scale effects on the genome, whereas potential informative markers were not confirmed by pyrosequencing. Site-specific methylation was examined in the promoter regions of three selected genes vasa, vtg1 and cyp19a2, of which vasa (ddx4) was the most responsive. This analysis distinguished estrogenic compounds from metals by direction and sensitivity of the effect compared to embryotoxicity. In conclusion, the zebrafish embryo is a potential screening tool to examine DNA methylation modifications after xenobiotic exposure. The next step is to examine the adult phenotype of exposed embryos and to analyze molecular mechanisms that potentially link epigenetic effects and altered phenotypes, to support the DOHaD hypothesis. - Highlights: • Compound induced effects on DNA methylation in zebrafish embryos • Global methylation not an informative biomarker • Minimal genome
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC442 (Link to dictyBase) - - - Contig-U16430-1 SLC442Z (Link... to Original site) - - SLC442Z 467 - - - - Show SLC442 Library SL (Link to library) Clone ID SLC442 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC442Q.Seq.d/ Representative seq. ID SLC44...2Z (Link to Original site) Representative DNA sequence >SLC442 (SLC442Q) /CSM/SL/SLC4-B/SLC442Q.Seq.d/ XXXXX... 4.0 %: extracellular, including cell wall 4.0 %: peroxisomal >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC478 (Link to dictyBase) - - - Contig-U16419-1 SLC478Z (Link... to Original site) - - SLC478Z 400 - - - - Show SLC478 Library SL (Link to library) Clone ID SLC478 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC478Q.Seq.d/ Representative seq. ID SLC47...8Z (Link to Original site) Representative DNA sequence >SLC478 (SLC478Q) /CSM/SL/SLC4-D/SLC478Q.Seq.d/ XXXXX... %: cytoplasmic 28.0 %: nuclear 24.0 %: mitochondrial 12.0 %: cytoskeletal >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC448 (Link to dictyBase) - - - Contig-U15118-1 SLC448E (Link... to Original site) - - - - - - SLC448E 245 Show SLC448 Library SL (Link to library) Clone ID SLC448 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC448Q.Seq.d/ Representative seq. ID SLC44...8E (Link to Original site) Representative DNA sequence >SLC448 (SLC448Q) /CSM/SL/SLC4-B/SLC448Q.Seq.d/ GGTAA... %: nuclear 12.0 %: mitochondrial 8.0 %: cytoskeletal 4.0 %: endoplasmic reticulum >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC456 (Link to dictyBase) - - - Contig-U16272-1 SLC456Z (Link... to Original site) - - SLC456Z 483 - - - - Show SLC456 Library SL (Link to library) Clone ID SLC456 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC456Q.Seq.d/ Representative seq. ID SLC45...6Z (Link to Original site) Representative DNA sequence >SLC456 (SLC456Q) /CSM/SL/SLC4-C/SLC456Q.Seq.d/ XXXXX...0 %: vacuolar 4.0 %: peroxisomal >> prediction for SLC456 is nuc 5' end seq. ID -
Obesity-related DNA methylation at imprinted genes in human sperm: Results from the TIEGER study.
Soubry, Adelheid; Guo, Lisa; Huang, Zhiqing; Hoyo, Cathrine; Romanus, Stephanie; Price, Thomas; Murphy, Susan K
2016-01-01
Epigenetic reprogramming in mammalian gametes resets methylation marks that regulate monoallelic expression of imprinted genes. In males, this involves erasure of the maternal methylation marks and establishment of paternal-specific methylation to appropriately guide normal development. The degree to which exogenous factors influence the fidelity of methylation reprogramming is unknown. We previously found an association between paternal obesity and altered DNA methylation in umbilical cord blood, suggesting that the father's endocrine, nutritional, or lifestyle status could potentiate intergenerational heritable epigenetic abnormalities. In these analyses, we examine the relationship between male overweight/obesity and DNA methylation status of imprinted gene regulatory regions in the gametes. Linear regression models were used to compare sperm DNA methylation percentages, quantified by bisulfite pyrosequencing, at 12 differentially methylated regions (DMRs) from 23 overweight/obese and 44 normal weight men. Our study population included 69 volunteers from The Influence of the Environment on Gametic Epigenetic Reprogramming (TIEGER) study, based in NC, USA. After adjusting for age and fertility patient status, semen from overweight or obese men had significantly lower methylation percentages at the MEG3 (β = -1.99; SE = 0.84; p = 0.02), NDN (β = -1.10; SE = 0.47; p = 0.02), SNRPN (β = -0.65; SE = 0.27; p = 0.02), and SGCE/PEG10 (β = -2.5; SE = 1.01; p = 0.01) DMRs. Our data further suggest a slight increase in DNA methylation at the MEG3-IG DMR (β = +1.22; SE = 0.59; p = 0.04) and H19 DMR (β = +1.37; SE = 0.62; p = 0.03) in sperm of overweight/obese men. Our data support that male overweight/obesity status is traceable in the sperm epigenome. Further research is needed to understand the effect of such changes and the point of origin of DNA methylation differences between lean and
Methylation of deoxycytidine incorporated by excision-repair synthesis of DNA
International Nuclear Information System (INIS)
Kastan, M.B.; Gowans, B.J.; Lieberman, M.W.
1982-01-01
Methylation of deoxycytidine incorporated by DNA excision-repair was studied in human diploid fibroblasts following damage with ultraviolet radiation, N-methyl-N-nitrosourea, or N-acetoxy-2-acetylaminofluorene. In confluent, nondividing cells, methylation in repair patches induced by all three agents is slow and incomplete. Whereas after DNA replication in logarithmic-phase cultures a steady state level of 3.4% 5-methylcytosine is reached in less than 2 hr after cells are labeled with 6- 3H-deoxycytidine, following ultraviolet-stimulated repair synthesis in confluent cells it takes about 3 days to reach a level of approximately 2.0% 5-methylcytosine in the repair patch. In cells from cultures in logarithmic-phase growth, 5-methylcytosine formation in ultraviolet-induced repair patches occurs faster and to a greater extent, reaching a level of approximately 2.7% in 10-20 hr. Preexisting hypomethylated repair patches in confluent cells are methylated further when the cells are stimulated to divide; however, the repair patch may still not be fully methylated before cell division occurs. Thus DNA damage and repair may lead to heritable loss of methylation at some sites
Aberrantly methylated DNA as a biomarker in breast cancer.
Kristiansen, Søren; Jørgensen, Lars M; Guldberg, Per; Sölétormos, György
2013-01-01
Aberrant DNA hypermethylation at gene promoters is a frequent event in human breast cancer. Recent genome-wide studies have identified hundreds of genes that exhibit differential methylation between breast cancer cells and normal breast tissue. Due to the tumor-specific nature of DNA hypermethylation events, their use as tumor biomarkers is usually not hampered by analytical signals from normal cells, which is a general problem for existing protein tumor markers used for clinical assessment of breast cancer. There is accumulating evidence that DNA-methylation changes in breast cancer patients occur early during tumorigenesis. This may open up for effective screening, and analysis of blood or nipple aspirate may later help in diagnosing breast cancer. As a more detailed molecular characterization of different types of breast cancer becomes available, the ability to divide patients into subgroups based on DNA biomarkers may improve prognosis. Serial monitoring of DNA-methylation markers in blood during treatment may be useful, particularly when the cancer burden is below the detection level for standard imaging techniques. Overall, aberrant DNA methylation has a great potential as a versatile biomarker tool for screening, diagnosis, prognosis and monitoring of breast cancer. Standardization of methods and biomarker panels will be required to fully exploit this clinical potential.
Disruption of Slc52a3 gene causes neonatal lethality with riboflavin deficiency in mice
Yoshimatsu, Hiroki; Yonezawa, Atsushi; Yamanishi, Kaori; Yao, Yoshiaki; Sugano, Kumiko; Nakagawa, Shunsaku; Imai, Satoshi; Omura, Tomohiro; Nakagawa, Takayuki; Yano, Ikuko; Masuda, Satohiro; Inui, Ken-ichi; Matsubara, Kazuo
2016-01-01
Homeostasis of riboflavin should be maintained by transporters. Previous in vitro studies have elucidated basic information about riboflavin transporter RFVT3 encoded by SLC52A3 gene. However, the contribution of RFVT3 to the maintenance of riboflavin homeostasis and the significance in vivo remain unclear. Here, we investigated the physiological role of RFVT3 using Slc52a3 knockout (Slc52a3−/−) mice. Most Slc52a3−/− mice died with hyperlipidemia and hypoglycemia within 48 hr after birth. The...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC429 (Link to dictyBase) - - - Contig-U09691-1 SLC429Z (Link... to Original site) - - SLC429Z 419 - - - - Show SLC429 Library SL (Link to library) Clone ID SLC429 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC429Q.Seq.d/ Representative seq. ID SLC42...9Z (Link to Original site) Representative DNA sequence >SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ XXXXX... significant alignments: (bits) Value SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ 708 0.0 SLC392 (SLC392Q
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC428 (Link to dictyBase) - - - Contig-U10963-1 SLC428P (Link to Original site) SLC4...28F 573 SLC428Z 307 SLC428P 880 - - Show SLC428 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC428Q.Seq.d/ Representative seq. ID SLC4...28P (Link to Original site) Representative DNA sequence >SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC4...nces producing significant alignments: (bits) Value SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC428Q.Seq.d/ 1526 0.0
Regulation and function of DNA methylation in plants and animals
He, Xinjian
2011-02-15
DNA methylation is an important epigenetic mark involved in diverse biological processes. In plants, DNA methylation can be established through the RNA-directed DNA methylation pathway, an RNA interference pathway for transcriptional gene silencing (TGS), which requires 24-nt small interfering RNAs. In mammals, de novo DNA methylation occurs primarily at two developmental stages: during early embryogenesis and during gametogenesis. While it is not clear whether establishment of DNA methylation patterns in mammals involves RNA interference in general, de novo DNA methylation and suppression of transposons in germ cells require 24-32-nt piwi-interacting small RNAs. DNA methylation status is dynamically regulated by DNA methylation and demethylation reactions. In plants, active DNA demethylation relies on the repressor of silencing 1 family of bifunctional DNA glycosylases, which remove the 5-methylcytosine base and then cleave the DNA backbone at the abasic site, initiating a base excision repair (BER) pathway. In animals, multiple mechanisms of active DNA demethylation have been proposed, including a deaminase- and DNA glycosylase-initiated BER pathway. New information concerning the effects of various histone modifications on the establishment and maintenance of DNA methylation has broadened our understanding of the regulation of DNA methylation. The function of DNA methylation in plants and animals is also discussed in this review. © 2011 IBCB, SIBS, CAS All rights reserved.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4
Law, Julie A.; Ausí n, Israel; Johnson, Lianna M.; Vashisht, Ajay A Amar; Zhu, Jian-Kang; Wohlschlegel, James A A.; Jacobsen, Steven E.
2010-01-01
DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.
Law, Julie A.
2010-05-01
DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC418 (Link to dictyBase) - G01921 DDB0191271 Contig-U15820-1 SLC4...18E (Link to Original site) SLC418F 604 SLC418Z 554 SLC418P 1158 SLC418E 1076 Show SLC418 Library SL (L...ink to library) Clone ID SLC418 (Link to dictyBase) Atlas ID - NBRP ID G01921 dictyBase ID DDB0191271 Link t...o Contig Contig-U15820-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...18Q.Seq.d/ Representative seq. ID SLC418E (Link to Original site) Representative DNA sequence >SLC418 (SLC4
Reduced DNA methylation of FKBP5 in Cushing's syndrome.
Resmini, Eugenia; Santos, Alicia; Aulinas, Anna; Webb, Susan M; Vives-Gilabert, Yolanda; Cox, Olivia; Wand, Gary; Lee, Richard S
2016-12-01
FKBP5 encodes a co-chaperone of HSP90 protein that regulates intracellular glucocorticoid receptor sensitivity. When it is bound to the glucocorticoid receptor complex, cortisol binds with lower affinity to glucocorticoid receptor. Cushing's syndrome is associated with memory deficits, smaller hippocampal volumes, and wide range of cognitive impairments. We aimed at evaluating blood DNA methylation of FKBP5 and its relationship with memory and hippocampal volumes in Cushing's syndrome patients. Polymorphism rs1360780 in FKBP5 has also been assessed to determine whether genetic variations can also govern CpG methylation. Thirty-two Cushing's syndrome patients and 32 matched controls underwent memory tests, 3-Tesla MRI of the brain, and DNA extraction from total leukocytes. DNA samples were bisulfite treated, PCR amplified, and pyrosequenced to assess a total of 41CpG-dinucleotides in the introns 1, 2, 5, and 7 of FKBP5. Significantly lower intronic FKBP5 DNA methylation in CS patients compared to controls was observed in ten CpG-dinucleotides. DNA methylation at these CpGs correlated with left and right HV (Intron-2-Region-2-CpG-3: LHV, r = 0.73, p = 0.02; RHV, r = 0.58, p = 0.03). Cured and active CS patients showed both lower methylation of intron 2 (92.37, 91.8, and 93.34 %, respectively, p = 0.03 for both) and of intron 7 (77.08, 73.74, and 79.71 %, respectively, p = 0.02 and p < 0.01) than controls. Twenty-two subjects had the CC genotype, 34 had the TC genotype, and eight had the TT genotype. Lower average DNA methylation in intron 7 was observed in the TT subjects compared to CC (72.5vs. 79.5 %, p = 0.02) and to TC (72.5 vs. 79.0 %, p = 0.03). Our data demonstrate, for the first time, a reduction of intronic DNA methylation of FKBP5 in CS patients.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC496 (Link to dictyBase) - - - - SLC496E (Link to Original site) - - - - - - SLC4...96E 443 Show SLC496 Library SL (Link to library) Clone ID SLC496 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...96Q.Seq.d/ Representative seq. ID SLC496E (Link to Original site) R...epresentative DNA sequence >SLC496 (SLC496Q) /CSM/SL/SLC4-D/SLC496Q.Seq.d/ AAGAAATTTGAATCACTCCAAATCATTATCCCA
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC449 (Link to dictyBase) - - - - SLC449Z (Link to Original site) - - SLC4...49Z 384 - - - - Show SLC449 Library SL (Link to library) Clone ID SLC449 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...49Q.Seq.d/ Representative seq. ID SLC449Z (Link to Original site) R...epresentative DNA sequence >SLC449 (SLC449Q) /CSM/SL/SLC4-C/SLC449Q.Seq.d/ XXXXXXXXXXGTAAAAAGGAACACCAAGCCACT
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC492 (Link to dictyBase) - - - Contig-U10734-1 | Contig-U12865-1 SLC4...92P (Link to Original site) SLC492F 645 SLC492Z 550 SLC492P 1195 - - Show SLC492 Library SL (Link to library) Clone ID SLC4...734-1 | Contig-U12865-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...92Q.Seq.d/ Representative seq. ID SLC492P (Link to Original site) Representative DNA sequence >SLC492 (SLC4...92Q) /CSM/SL/SLC4-D/SLC492Q.Seq.d/ AAAAAAAAAATATACAAATAATGAATAAATTTTTAGCTTTGTTATTTGTTTTAGCTTTGT
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA
Huh, Iksoo; Wu, Xin; Park, Taesung; Yi, Soojin V
2017-07-21
DNA methylation is one of the most extensively studied epigenetic modifications of genomic DNA. In recent years, sequencing of bisulfite-converted DNA, particularly via next-generation sequencing technologies, has become a widely popular method to study DNA methylation. This method can be readily applied to a variety of species, dramatically expanding the scope of DNA methylation studies beyond the traditionally studied human and mouse systems. In parallel to the increasing wealth of genomic methylation profiles, many statistical tools have been developed to detect differentially methylated loci (DMLs) or differentially methylated regions (DMRs) between biological conditions. We discuss and summarize several key properties of currently available tools to detect DMLs and DMRs from sequencing of bisulfite-converted DNA. However, the majority of the statistical tools developed for DML/DMR analyses have been validated using only mammalian data sets, and less priority has been placed on the analyses of invertebrate or plant DNA methylation data. We demonstrate that genomic methylation profiles of non-mammalian species are often highly distinct from those of mammalian species using examples of honey bees and humans. We then discuss how such differences in data properties may affect statistical analyses. Based on these differences, we provide three specific recommendations to improve the power and accuracy of DML and DMR analyses of invertebrate data when using currently available statistical tools. These considerations should facilitate systematic and robust analyses of DNA methylation from diverse species, thus advancing our understanding of DNA methylation. © The Author 2017. Published by Oxford University Press.
Epigenetics in Alzheimer's Disease: Perspective of DNA Methylation.
Qazi, Talal Jamil; Quan, Zhenzhen; Mir, Asif; Qing, Hong
2018-02-01
Research over the years has shown that causes of Alzheimer's disease are not well understood, but over the past years, the involvement of epigenetic mechanisms in the developing memory formation either under pathological or physiological conditions has become clear. The term epigenetics represents the heredity of changes in phenotype that are independent of altered DNA sequences. Different studies validated that cytosine methylation of genomic DNA decreases with age in different tissues of mammals, and therefore, the role of epigenetic factors in developing neurological disorders in aging has been under focus. In this review, we summarized and reviewed the involvement of different epigenetic mechanisms especially the DNA methylation in Alzheimer's disease (AD), late-onset Alzheimer's disease (LOAD), familial Alzheimer's disease (FAD), and autosomal dominant Alzheimer's disease (ADAD). Down to the minutest of details, we tried to discuss the methylation patterns like mitochondrial DNA methylation and ribosomal DNA (rDNA) methylation. Additionally, we mentioned some therapeutic approaches related to epigenetics, which could provide a potential cure for AD. Moreover, we reviewed some recent studies that validate DNA methylation as a potential biomarker and its role in AD. We hope that this review will provide new insights into the understanding of AD pathogenesis from the epigenetic perspective especially from the perspective of DNA methylation.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC495 (Link to dictyBase) - - - Contig-U03919-1 SLC495E (Link to Original site) SLC4...95F 337 SLC495Z 295 SLC495P 632 SLC495E 337 Show SLC495 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC495Q.Seq.d/ Representative seq. ID SLC4...95E (Link to Original site) Representative DNA sequence >SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC4...ficant alignments: (bits) Value SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC495Q.Seq.d/ 446 e-124 VSF494 (VSF494Q) /C
DNA methylation dynamics in muscle development and disease
Directory of Open Access Journals (Sweden)
Elvira eCarrio
2015-03-01
Full Text Available DNA methylation is an essential epigenetic modification for mammalian development and is crucial for the establishment and maintenance of cellular identity. Traditionally, DNA methylation has been considered as a permanent repressive epigenetic mark. However, the application of genome-wide approaches has allowed the analysis of DNA methylation in different genomic contexts revealing a more dynamic regulation than originally thought, since active DNA methylation and demethylation occur during cellular differentiation and tissue specification. Satellite cells are the primary stem cells in adult skeletal muscle and are responsible for postnatal muscle growth, hypertrophy, and muscle regeneration. This review outlines the published data regarding DNA methylation changes along the skeletal muscle program, in both physiological and pathological conditions, to better understand the epigenetic mechanisms that control myogenesis
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC444 (Link to dictyBase) - - - Contig-U16368-1 SLC444Z (Link... to Original site) - - SLC444Z 462 - - - - Show SLC444 Library SL (Link to library) Clone ID SLC444 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC444Q.Seq.d/ Representative seq. ID SLC44...4Z (Link to Original site) Representative DNA sequence >SLC444 (SLC444Q) /CSM/SL/SLC4-B/SLC444Q.Seq.d/ XXXXX...tochondrial 8.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: cytoplasmic >> prediction for SLC444 is mit 5' end seq
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC490 (Link to dictyBase) - - - Contig-U16444-1 SLC490Z (Link... to Original site) - - SLC490Z 427 - - - - Show SLC490 Library SL (Link to library) Clone ID SLC490 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC490Q.Seq.d/ Representative seq. ID SLC49...0Z (Link to Original site) Representative DNA sequence >SLC490 (SLC490Q) /CSM/SL/SLC4-D/SLC490Q.Seq.d/ XXXXX...itochondrial 24.0 %: cytoplasmic 24.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: plasma membrane 4.0 %: peroxisomal >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4
Comprehensive analysis of preeclampsia-associated DNA methylation in the placenta.
Directory of Open Access Journals (Sweden)
Tianjiao Chu
Full Text Available A small number of recent reports have suggested that altered placental DNA methylation may be associated with early onset preeclampsia. It is important that further studies be undertaken to confirm and develop these findings. We therefore undertook a systematic analysis of DNA methylation patterns in placental tissue from 24 women with preeclampsia and 24 with uncomplicated pregnancy outcome.We analyzed the DNA methylation status of approximately 27,000 CpG sites in placental tissues in a massively parallel fashion using an oligonucleotide microarray. Follow up analysis of DNA methylation at specific CpG loci was performed using the Epityper MassArray approach and high-throughput bisulfite sequencing.Preeclampsia-specific DNA methylation changes were identified in placental tissue samples irrespective of gestational age of delivery. In addition, we identified a group of CpG sites within specific gene sequences that were only altered in early onset-preeclampsia (EOPET although these DNA methylation changes did not correlate with altered mRNA transcription. We found evidence that fetal gender influences DNA methylation at autosomal loci but could find no clear association between DNA methylation and gestational age.Preeclampsia is associated with altered placental DNA methylation. Fetal gender should be carefully considered during the design of future studies in which placental DNA is analyzed at the level of DNA methylation. Further large-scale analyses of preeclampsia-associated DNA methylation are necessary.
Erturk, Filiz Aygun; Aydin, Murat; Sigmaz, Burcu; Taspinar, M Sinan; Arslan, Esra; Agar, Guleray; Yagci, Semra
2015-12-01
Arsenic is a well-known toxic substance on the living organisms. However, limited efforts have been made to study its DNA methylation, genomic instability, and long terminal repeat (LTR) retrotransposon polymorphism causing properties in different crops. In the present study, effects of As2O3 (arsenic trioxide) on LTR retrotransposon polymorphism and DNA methylation as well as DNA damage in Zea mays seedlings were investigated. The results showed that all of arsenic doses caused a decreasing genomic template stability (GTS) and an increasing Random Amplified Polymorphic DNAs (RAPDs) profile changes (DNA damage). In addition, increasing DNA methylation and LTR retrotransposon polymorphism characterized a model to explain the epigenetically changes in the gene expression were also found. The results of this experiment have clearly shown that arsenic has epigenetic effect as well as its genotoxic effect. Especially, the increasing of polymorphism of some LTR retrotransposon under arsenic stress may be a part of the defense system against the stress.
Pan, Gaofeng; Jiang, Limin; Tang, Jijun; Guo, Fei
2018-02-08
DNA methylation is an important biochemical process, and it has a close connection with many types of cancer. Research about DNA methylation can help us to understand the regulation mechanism and epigenetic reprogramming. Therefore, it becomes very important to recognize the methylation sites in the DNA sequence. In the past several decades, many computational methods-especially machine learning methods-have been developed since the high-throughout sequencing technology became widely used in research and industry. In order to accurately identify whether or not a nucleotide residue is methylated under the specific DNA sequence context, we propose a novel method that overcomes the shortcomings of previous methods for predicting methylation sites. We use k -gram, multivariate mutual information, discrete wavelet transform, and pseudo amino acid composition to extract features, and train a sparse Bayesian learning model to do DNA methylation prediction. Five criteria-area under the receiver operating characteristic curve (AUC), Matthew's correlation coefficient (MCC), accuracy (ACC), sensitivity (SN), and specificity-are used to evaluate the prediction results of our method. On the benchmark dataset, we could reach 0.8632 on AUC, 0.8017 on ACC, 0.5558 on MCC, and 0.7268 on SN. Additionally, the best results on two scBS-seq profiled mouse embryonic stem cells datasets were 0.8896 and 0.9511 by AUC, respectively. When compared with other outstanding methods, our method surpassed them on the accuracy of prediction. The improvement of AUC by our method compared to other methods was at least 0.0399 . For the convenience of other researchers, our code has been uploaded to a file hosting service, and can be downloaded from: https://figshare.com/s/0697b692d802861282d3.
Directory of Open Access Journals (Sweden)
Gaofeng Pan
2018-02-01
Full Text Available DNA methylation is an important biochemical process, and it has a close connection with many types of cancer. Research about DNA methylation can help us to understand the regulation mechanism and epigenetic reprogramming. Therefore, it becomes very important to recognize the methylation sites in the DNA sequence. In the past several decades, many computational methods—especially machine learning methods—have been developed since the high-throughout sequencing technology became widely used in research and industry. In order to accurately identify whether or not a nucleotide residue is methylated under the specific DNA sequence context, we propose a novel method that overcomes the shortcomings of previous methods for predicting methylation sites. We use k-gram, multivariate mutual information, discrete wavelet transform, and pseudo amino acid composition to extract features, and train a sparse Bayesian learning model to do DNA methylation prediction. Five criteria—area under the receiver operating characteristic curve (AUC, Matthew’s correlation coefficient (MCC, accuracy (ACC, sensitivity (SN, and specificity—are used to evaluate the prediction results of our method. On the benchmark dataset, we could reach 0.8632 on AUC, 0.8017 on ACC, 0.5558 on MCC, and 0.7268 on SN. Additionally, the best results on two scBS-seq profiled mouse embryonic stem cells datasets were 0.8896 and 0.9511 by AUC, respectively. When compared with other outstanding methods, our method surpassed them on the accuracy of prediction. The improvement of AUC by our method compared to other methods was at least 0.0399 . For the convenience of other researchers, our code has been uploaded to a file hosting service, and can be downloaded from: https://figshare.com/s/0697b692d802861282d3.
Implications of DNA Methylation in Parkinson’s Disease
Directory of Open Access Journals (Sweden)
Ernesto Miranda-Morales
2017-07-01
Full Text Available It has been 200 years since Parkinson’s disease (PD was first described, yet many aspects of its etiopathogenesis remain unclear. PD is a progressive and complex neurodegenerative disorder caused by genetic and environmental factors including aging, nutrition, pesticides and exposure to heavy metals. DNA methylation may be altered in response to some of these factors; therefore, it is proposed that epigenetic mechanisms, particularly DNA methylation, can have a fundamental role in gene–environment interactions that are related with PD. Epigenetic changes in PD-associated genes are now widely studied in different populations, to discover the mechanisms that contribute to disease development and identify novel biomarkers for early diagnosis and future pharmacological treatment. While initial studies sought to find associations between promoter DNA methylation and the regulation of associated genes in PD brain tissue, more recent studies have described concordant DNA methylation patterns between blood and brain tissue DNA. These data justify the use of peripheral blood samples instead of brain tissue for epigenetic studies. Here, we summarize the current data about DNA methylation changes in PD and discuss the potential of DNA methylation as a potential biomarker for PD. Additionally, we discuss environmental and nutritional factors that have been implicated in DNA methylation. Although the search for significant DNA methylation changes and gene expression analyses of PD-associated genes have yielded inconsistent and contradictory results, epigenetic modifications remain under investigation for their potential to reveal the link between environmental risk factors and the development of PD.
Directory of Open Access Journals (Sweden)
Mansour S Al-Moundhri
Full Text Available BACKGROUND: Epigenetics, particularly DNA methylation, has recently been elucidated as important in gastric cancer (GC initiation and progression. We investigated the clinical and prognostic importance of whole blood global and site-specific DNA methylation in GC. METHODS: Genomic DNA was extracted from the peripheral blood of 105 Omani GC patients at diagnosis. DNA methylation was quantified by pyrosequencing of global DNA and specific gene promoter regions at 5 CpG sites for CDH1, 7 CpG sites for p16, 4 CpG sites for p53, and 3 CpG sites for RUNX3. DNA methylation levels in patients were categorized into low, medium, and high tertiles. Associations between methylation level category and clinicopathological features were evaluated using χ(2 tests. Survival analyses were carried out using the Kaplan-Meier method and log rank test. A backward conditional Cox proportional hazards regression model was used to identify independent predictors of survival. RESULTS: Older GC patients had increased methylation levels at specific CpG sites within the CDH1, p53, and RUNX-3 promoters. Male gender was significantly associated with reduced global and increased site-specific DNA methylation levels in CDH1, p16, and p53 promoters. Global DNA low methylation level was associated with better survival on univariate analysis. Patients with high and medium methylation vs. low methylation levels across p16 promoter CpG sites, site 2 in particular, had better survival. Multivariate analysis showed that global DNA hypermethylation was a significant independent predictor of worse survival (hazard ratio (HR = 2.0, 95% CI: 1.1-3.8; p = 0.02 and high methylation mean values across p16 promoter sites 1-7 were associated with better survival with HR of 0.3 (95% CI, 0.1-0.8; p = 0.02 respectively. CONCLUSIONS: Analysis of global and site-specific DNA methylation in peripheral blood by pyrosequencing provides quantitative DNA methylation values that may serve as important
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4
DEFF Research Database (Denmark)
Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath
2007-01-01
Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC438 (Link to dictyBase) - - - Contig-U10771-1 SLC438Z (Link... to Original site) - - SLC438Z 549 - - - - Show SLC438 Library SL (Link to library) Clone ID SLC438 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC438Q.Seq.d/ Representative seq. ID SLC43...8Z (Link to Original site) Representative DNA sequence >SLC438 (SLC438Q) /CSM/SL/SLC4-B/SLC438Q.Seq.d/ XXXXX...es producing significant alignments: (bits) Value SSM825 (SSM825Q) /CSM/SS/SSM8-B/SSM825Q.Seq.d/ 948 0.0 SLC438 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA
Traumatic stress and accelerated DNA methylation age: A meta-analysis.
Wolf, Erika J; Maniates, Hannah; Nugent, Nicole; Maihofer, Adam X; Armstrong, Don; Ratanatharathorn, Andrew; Ashley-Koch, Allison E; Garrett, Melanie; Kimbrel, Nathan A; Lori, Adriana; Va Mid-Atlantic Mirecc Workgroup; Aiello, Allison E; Baker, Dewleen G; Beckham, Jean C; Boks, Marco P; Galea, Sandro; Geuze, Elbert; Hauser, Michael A; Kessler, Ronald C; Koenen, Karestan C; Miller, Mark W; Ressler, Kerry J; Risbrough, Victoria; Rutten, Bart P F; Stein, Murray B; Ursano, Robert J; Vermetten, Eric; Vinkers, Christiaan H; Uddin, Monica; Smith, Alicia K; Nievergelt, Caroline M; Logue, Mark W
2018-06-01
Recent studies examining the association between posttraumatic stress disorder (PTSD) and accelerated aging, as defined by DNA methylation-based estimates of cellular age that exceed chronological age, have yielded mixed results. We conducted a meta-analysis of trauma exposure and PTSD diagnosis and symptom severity in association with accelerated DNA methylation age using data from 9 cohorts contributing to the Psychiatric Genomics Consortium PTSD Epigenetics Workgroup (combined N = 2186). Associations between demographic and cellular variables and accelerated DNA methylation age were also examined, as was the moderating influence of demographic variables. Meta-analysis of regression coefficients from contributing cohorts revealed that childhood trauma exposure (when measured with the Childhood Trauma Questionnaire) and lifetime PTSD severity evidenced significant, albeit small, meta-analytic associations with accelerated DNA methylation age (ps = 0.028 and 0.016, respectively). Sex, CD4T cell proportions, and natural killer cell proportions were also significantly associated with accelerated DNA methylation age (all ps age. There was no evidence of moderation of the trauma or PTSD variables by demographic factors. Results suggest that traumatic stress is associated with advanced epigenetic age and raise the possibility that cells integral to immune system maintenance and responsivity play a role in this. This study highlights the need for additional research into the biological mechanisms linking traumatic stress to accelerated DNA methylation age and the importance of furthering our understanding of the neurobiological and health consequences of PTSD. Published by Elsevier Ltd.
DNA methylation of miRNA coding sequences putatively associated with childhood obesity.
Mansego, M L; Garcia-Lacarte, M; Milagro, F I; Marti, A; Martinez, J A
2017-02-01
Epigenetic mechanisms may be involved in obesity onset and its consequences. The aim of the present study was to evaluate whether DNA methylation status in microRNA (miRNA) coding regions is associated with childhood obesity. DNA isolated from white blood cells of 24 children (identification sample: 12 obese and 12 non-obese) from the Grupo Navarro de Obesidad Infantil study was hybridized in a 450 K methylation microarray. Several CpGs whose DNA methylation levels were statistically different between obese and non-obese were validated by MassArray® in 95 children (validation sample) from the same study. Microarray analysis identified 16 differentially methylated CpGs between both groups (6 hypermethylated and 10 hypomethylated). DNA methylation levels in miR-1203, miR-412 and miR-216A coding regions significantly correlated with body mass index standard deviation score (BMI-SDS) and explained up to 40% of the variation of BMI-SDS. The network analysis identified 19 well-defined obesity-relevant biological pathways from the KEGG database. MassArray® validation identified three regions located in or near miR-1203, miR-412 and miR-216A coding regions differentially methylated between obese and non-obese children. The current work identified three CpG sites located in coding regions of three miRNAs (miR-1203, miR-412 and miR-216A) that were differentially methylated between obese and non-obese children, suggesting a role of miRNA epigenetic regulation in childhood obesity. © 2016 World Obesity Federation.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4
DNA methyltransferase 1 mutations and mitochondrial pathology: is mtDNA methylated?
Directory of Open Access Journals (Sweden)
Alessandra eMaresca
2015-03-01
Full Text Available Autosomal dominant cerebellar ataxia, deafness and narcolepsy (ADCA-DN and Hereditary sensory neuropathy with dementia and hearing loss (HSN1E are two rare, overlapping neurodegenerative syndromes that have been recently linked to allelic dominant pathogenic mutations in the DNMT1 gene, coding for DNA (cytosine-5-methyltransferase 1. DNMT1 is the enzyme responsible for maintaining the nuclear genome methylation patterns during the DNA replication and repair, thus regulating gene expression. The mutations responsible for ADCA-DN and HSN1E affect the replication foci targeting sequence domain, which regulates DNMT1 binding to chromatin. DNMT1 dysfunction is anticipated to lead to a global alteration of the DNA methylation pattern with predictable downstream consequences on gene expression. Interestingly, ADCA-DN and HSN1E phenotypes share some clinical features typical of mitochondrial diseases, such as optic atrophy, peripheral neuropathy and deafness, and some biochemical evidence of mitochondrial dysfunction. The recent discovery of a mitochondrial isoform of DNMT1 and its proposed role in methylating mitochondrial DNA (mtDNA suggests that DNMT1 mutations may directly affect mtDNA and mitochondrial physiology. On the basis of this latter finding the link between DNMT1 abnormal activity and mitochondrial dysfunction in ADCA-DN and HSN1E appears intuitive, however mtDNA methylation remains highly debated. In the last years several groups demonstrated the presence of 5-methylcytosine in mtDNA by different approaches, but, on the other end, the opposite evidence that mtDNA is not methylated has also been published. Since over 1500 mitochondrial proteins are encoded by the nuclear genome, the altered methylation of these genes may well have a critical role in leading to the mitochondrial impairment observed in ADCA-DN and HSN1E. Thus, many open questions still remain unanswered, such as why mtDNA should be methylated, and how this process is
Valledor, Luis; Meijón, Mónica; Hasbún, Rodrigo; Jesús Cañal, Maria; Rodríguez, Roberto
2010-03-15
Needle differentiation is a very complex process associated with the formation of a mature photosynthetic organ. From meristem differentiation to leaf maturation, gene control must play an important role switching required genes on and off to define tissue functions, with the epigenetic code being one of the main regulation mechanisms. In this work, we examined the connections between the variation in the levels of some epigenetic players (DNA methylation, acetylated histone H4 and histone H3 methylation at Lys 4 and Lys 9) at work during needle maturation. Our results indicate that needle maturation, which is associated with a decrease in organogenic capability, is related to an increase in heterochromatin-related epigenetic markers (high DNA methylation and low acetylated histone H4 levels, and the presence of histone H3 methylated at lys 9). Immunohistochemical analyses also showed that the DNA methylation of palisade parenchyma cell layers during the transition from immature to mature scions is associated with the loss of the capacity to induce adventitious organs. Copyright 2009 Elsevier GmbH. All rights reserved.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2
Allele-Specific DNA Methylation Detection by Pyrosequencing®
DEFF Research Database (Denmark)
Kristensen, Lasse Sommer; Johansen, Jens Vilstrup; Grønbæk, Kirsten
2015-01-01
DNA methylation is an epigenetic modification that plays important roles in healthy as well as diseased cells, by influencing the transcription of genes. In spite the fact that human somatic cells are diploid, most of the currently available methods for the study of DNA methylation do not provide......-effective protocol for allele-specific DNA methylation detection based on Pyrosequencing(®) of methylation-specific PCR (MSP) products including a single nucleotide polymorphism (SNP) within the amplicon....
A nonparametric Bayesian approach for clustering bisulfate-based DNA methylation profiles.
Zhang, Lin; Meng, Jia; Liu, Hui; Huang, Yufei
2012-01-01
DNA methylation occurs in the context of a CpG dinucleotide. It is an important epigenetic modification, which can be inherited through cell division. The two major types of methylation include hypomethylation and hypermethylation. Unique methylation patterns have been shown to exist in diseases including various types of cancer. DNA methylation analysis promises to become a powerful tool in cancer diagnosis, treatment and prognostication. Large-scale methylation arrays are now available for studying methylation genome-wide. The Illumina methylation platform simultaneously measures cytosine methylation at more than 1500 CpG sites associated with over 800 cancer-related genes. Cluster analysis is often used to identify DNA methylation subgroups for prognosis and diagnosis. However, due to the unique non-Gaussian characteristics, traditional clustering methods may not be appropriate for DNA and methylation data, and the determination of optimal cluster number is still problematic. A Dirichlet process beta mixture model (DPBMM) is proposed that models the DNA methylation expressions as an infinite number of beta mixture distribution. The model allows automatic learning of the relevant parameters such as the cluster mixing proportion, the parameters of beta distribution for each cluster, and especially the number of potential clusters. Since the model is high dimensional and analytically intractable, we proposed a Gibbs sampling "no-gaps" solution for computing the posterior distributions, hence the estimates of the parameters. The proposed algorithm was tested on simulated data as well as methylation data from 55 Glioblastoma multiform (GBM) brain tissue samples. To reduce the computational burden due to the high data dimensionality, a dimension reduction method is adopted. The two GBM clusters yielded by DPBMM are based on data of different number of loci (P-value < 0.1), while hierarchical clustering cannot yield statistically significant clusters.
LENUS (Irish Health Repository)
Murphy, Therese M
2012-02-01
BACKGROUND: Suicidal behaviour is known to aggregate in families. Patients with psychiatric disorders are at higher risk for suicide attempts (SA), however protective and risk genetic variants for suicide appear to be independent of underlying psychiatric disorders. Here we investigate genetic variants in genes important for neurobiological pathways linked to suicidal behaviour and\\/or associated endophenotypes, for association with SA among patients with co-existing psychiatric illness. Selected gene-gene and gene-environment interactions were also tested. METHODS: DNA was obtained from bloods of 159 patients (76 suicide attempters and 83 non-attempters), who were profiled for DSM-IV Axis I psychiatric diagnosis. Twenty-eight single nucleotide polymorphisms (SNPs) from 18 candidate genes (COMT, 5-HT2A, 5-HT1A, 5-HTR1B, TPH1, MAO-A, TPH2, DBH, CNR1, BDNF, ABCG1, GABRA5, GABRG2, GABRB2, SLC1A2, SLC1A3, NTRK2, CRHR1) were genotyped. Genotyping was performed by KBioscience. Tests of association between genetic variants and SA were conducted using Chi squared and Armitage Trend tests. Binary logistical regression analyses were performed to evaluate the contribution of individual genetic variants to the prediction of SA, and to examine SNPs for potential gene-gene and gene-environment interactions. RESULTS: Our analysis identified 4 SNPs (rs4755404, rs2269272, rs6296 and rs1659400), which showed evidence of association with SA compared to a non-attempter control group. We provide evidence of a 3-locus gene-gene interaction, and a putative gene-environment interaction, whereby genetic variation at the NTRK2 locus may moderate the risk associated with history of childhood abuse. CONCLUSION: Preliminary findings suggest that allelic variability in SLC1A2\\/3, 5-HTR1B and NTRK2 may be relevant to the underlying diathesis for suicidal acts.
A DNA methylation-based definition of biologically distinct breast cancer subtypes.
Stefansson, Olafur A; Moran, Sebastian; Gomez, Antonio; Sayols, Sergi; Arribas-Jorba, Carlos; Sandoval, Juan; Hilmarsdottir, Holmfridur; Olafsdottir, Elinborg; Tryggvadottir, Laufey; Jonasson, Jon G; Eyfjord, Jorunn; Esteller, Manel
2015-03-01
In cancer, epigenetic states are deregulated and thought to be of significance in cancer development and progression. We explored DNA methylation-based signatures in association with breast cancer subtypes to assess their impact on clinical presentation and patient prognosis. DNA methylation was analyzed using Infinium 450K arrays in 40 tumors and 17 normal breast samples, together with DNA copy number changes and subtype-specific markers by tissue microarrays. The identified methylation signatures were validated against a cohort of 212 tumors annotated for breast cancer subtypes by the PAM50 method (The Cancer Genome Atlas). Selected markers were pyrosequenced in an independent validation cohort of 310 tumors and analyzed with respect to survival, clinical stage and grade. The results demonstrate that DNA methylation patterns linked to the luminal-B subtype are characterized by CpG island promoter methylation events. In contrast, a large fraction of basal-like tumors are characterized by hypomethylation events occurring within the gene body. Based on these hallmark signatures, we defined two DNA methylation-based subtypes, Epi-LumB and Epi-Basal, and show that they are associated with unfavorable clinical parameters and reduced survival. Our data show that distinct mechanisms leading to changes in CpG methylation states are operative in different breast cancer subtypes. Importantly, we show that a few selected proxy markers can be used to detect the distinct DNA methylation-based subtypes thereby providing valuable information on disease prognosis. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
DNA Methylation as a Biomarker for Preeclampsia
Energy Technology Data Exchange (ETDEWEB)
Anderson, Cindy M.; Ralph, Jody L.; Wright, Michelle L.; Linggi, Bryan E.; Ohm, Joyce E.
2014-10-01
Background: Preeclampsia contributes significantly to pregnancy-associated morbidity and mortality as well as future risk of cardiovascular disease in mother and offspring, and preeclampsia in offspring. The lack of reliable methods for early detection limits the opportunities for prevention, diagnosis, and timely treatment. Purpose: The purpose of this study was to explore distinct DNA methylation patterns associated with preeclampsia in both maternal cells and fetal-derived tissue that represent potential biomarkers to predict future preeclampsia and inheritance in children. Method: A convenience sample of nulliparous women (N = 55) in the first trimester of pregnancy was recruited for this prospective study. Genome-wide DNA methylation was quantified in first-trimester maternal peripheral white blood cells and placental chorionic tissue from normotensive women and those with preeclampsia (n = 6/group). Results: Late-onset preeclampsia developed in 12.7% of women. Significant differences in DNA methylation were identified in 207 individual linked cytosine and guanine (CpG) sites in maternal white blood cells collected in the first trimester (132 sites with gain and 75 sites with loss of methylation), which were common to approximately 75% of the differentially methylated CpG sites identified in chorionic tissue of fetal origin. Conclusion: This study is the first to identify maternal epigenetic targets and common targets in fetal-derived tissue that represent putative biomarkers for early detection and heritable risk of preeclampsia. Findings may pave the way for diagnosis of preeclampsia prior to its clinical presentation and acute damaging effects, and the potential for prevention of the detrimental long-term sequelae.
Oxidative Stress and DNA Methylation in Prostate Cancer
Directory of Open Access Journals (Sweden)
Krishna Vanaja Donkena
2010-01-01
Full Text Available The protective effects of fruits, vegetables, and other foods on prostate cancer may be due to their antioxidant properties. An imbalance in the oxidative stress/antioxidant status is observed in prostate cancer patients. Genome oxidative damage in prostate cancer patients is associated with higher lipid peroxidation and lower antioxidant levels. Oxygen radicals are associated with different steps of carcinogenesis, including structural DNA damage, epigenetic changes, and protein and lipid alterations. Epigenetics affects genetic regulation, cellular differentiation, embryology, aging, cancer, and other diseases. DNA methylation is perhaps the most extensively studied epigenetic modification, which plays an important role in the regulation of gene expression and chromatin architecture, in association with histone modification and other chromatin-associated proteins. This review will provide a broad overview of the interplay of oxidative stress and DNA methylation, DNA methylation changes in regulation of gene expression, lifestyle changes for prostate cancer prevention, DNA methylation as biomarkers for prostate cancer, methods for detection of methylation, and clinical application of DNA methylation inhibitors for epigenetic therapy.
Brown, William M
2015-12-01
Epigenetics is the study of processes--beyond DNA sequence alteration--producing heritable characteristics. For example, DNA methylation modifies gene expression without altering the nucleotide sequence. A well-studied DNA methylation-based phenomenon is genomic imprinting (ie, genotype-independent parent-of-origin effects). We aimed to elucidate: (1) the effect of exercise on DNA methylation and (2) the role of imprinted genes in skeletal muscle gene networks (ie, gene group functional profiling analyses). Gene ontology (ie, gene product elucidation)/meta-analysis. 26 skeletal muscle and 86 imprinted genes were subjected to g:Profiler ontology analysis. Meta-analysis assessed exercise-associated DNA methylation change. g:Profiler found four muscle gene networks with imprinted loci. Meta-analysis identified 16 articles (387 genes/1580 individuals) associated with exercise. Age, method, sample size, sex and tissue variation could elevate effect size bias. Only skeletal muscle gene networks including imprinted genes were reported. Exercise-associated effect sizes were calculated by gene. Age, method, sample size, sex and tissue variation were moderators. Six imprinted loci (RB1, MEG3, UBE3A, PLAGL1, SGCE, INS) were important for muscle gene networks, while meta-analysis uncovered five exercise-associated imprinted loci (KCNQ1, MEG3, GRB10, L3MBTL1, PLAGL1). DNA methylation decreased with exercise (60% of loci). Exercise-associated DNA methylation change was stronger among older people (ie, age accounted for 30% of the variation). Among older people, genes exhibiting DNA methylation decreases were part of a microRNA-regulated gene network functioning to suppress cancer. Imprinted genes were identified in skeletal muscle gene networks and exercise-associated DNA methylation change. Exercise-associated DNA methylation modification could rewind the 'epigenetic clock' as we age. CRD42014009800. Published by the BMJ Publishing Group Limited. For permission to use (where
Directory of Open Access Journals (Sweden)
Kum-Kang So
2018-02-01
Full Text Available Mutation in CpBck1, an ortholog of the cell wall integrity mitogen-activated protein kinase kinase kinase (MAPKKK of Saccharomyces cerevisiae, in the chestnut blight fungus Cryphonectria parasitica resulted in a sporadic sectorization as culture proceeded. The progeny from the sectored area maintained the characteristics of the sector, showing a massive morphogenetic change, including robust mycelial growth without differentiation. Epigenetic changes were investigated as the genetic mechanism underlying this sectorization. Quantification of DNA methylation and whole-genome bisulfite sequencing revealed genome-wide DNA methylation of the wild-type at each nucleotide level and changes in DNA methylation of the sectored progeny. Compared to the wild-type, the sectored progeny exhibited marked genome-wide DNA hypomethylation but increased methylation sites. Expression analysis of two DNA methyltransferases, including two representative types of DNA methyltransferase (DNMTase, demonstrated that both were significantly down-regulated in the sectored progeny. However, functional analysis using mutant phenotypes of corresponding DNMTases demonstrated that a mutant of CpDmt1, an ortholog of RID of Neurospora crassa, resulted in the sectored phenotype but the CpDmt2 mutant did not, suggesting that the genetic basis of fungal sectorization is more complex. The present study revealed that a mutation in a signaling pathway component resulted in sectorization accompanied with changes in genome-wide DNA methylation, which suggests that this signal transduction pathway is important for epigenetic control of sectorization via regulation of genes involved in DNA methylation.
Obesity-induced sperm DNA methylation changes at satellite repeats are reprogrammed in rat offspring
Directory of Open Access Journals (Sweden)
Neil A Youngson
2016-01-01
Full Text Available There is now strong evidence that the paternal contribution to offspring phenotype at fertilisation is more than just DNA. However, the identity and mechanisms of this nongenetic inheritance are poorly understood. One of the more important questions in this research area is: do changes in sperm DNA methylation have phenotypic consequences for offspring? We have previously reported that offspring of obese male rats have altered glucose metabolism compared with controls and that this effect was inherited through nongenetic means. Here, we describe investigations into sperm DNA methylation in a new cohort using the same protocol. Male rats on a high-fat diet were 30% heavier than control-fed males at the time of mating (16-19 weeks old, n = 14/14. A small (0.25% increase in total 5-methyl-2Ͳ-deoxycytidine was detected in obese rat spermatozoa by liquid chromatography tandem mass spectrometry. Examination of the repetitive fraction of the genome with methyl-CpG binding domain protein-enriched genome sequencing (MBD-Seq and pyrosequencing revealed that retrotransposon DNA methylation states in spermatozoa were not affected by obesity, but methylation at satellite repeats throughout the genome was increased. However, examination of muscle, liver, and spermatozoa from male 27-week-old offspring from obese and control fathers (both groups from n = 8 fathers revealed that normal DNA methylation levels were restored during offspring development. Furthermore, no changes were found in three genomic imprints in obese rat spermatozoa. Our findings have implications for transgenerational epigenetic reprogramming. They suggest that postfertilization mechanisms exist for normalising some environmentally-induced DNA methylation changes in sperm cells.
Infant sex-specific placental cadmium and DNA methylation associations
Energy Technology Data Exchange (ETDEWEB)
Mohanty, April F., E-mail: april.mohanty@va.gov [Cardiovascular Health Research Unit, University of Washington, 1730 Minor Ave, Seattle, WA 98101 (United States); Department of Epidemiology, School of Public Health, University of Washington, Seattle, WA (United States); Farin, Fred M., E-mail: freddy@u.washington.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way N.E., Suite #100, Seattle, WA 98105 (United States); Bammler, Theo K., E-mail: tbammler@u.washington.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way N.E., Suite #100, Seattle, WA 98105 (United States); MacDonald, James W., E-mail: jmacdon@uw.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way N.E., Suite #100, Seattle, WA 98105 (United States); Afsharinejad, Zahra, E-mail: zafshari@u.washington.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way N.E., Suite #100, Seattle, WA 98105 (United States); Burbacher, Thomas M., E-mail: tmb@uw.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, Box: 357234, 1705 N.E. Pacific Street, Seattle, WA 98195 (United States); Siscovick, David S., E-mail: dsiscovick@nyam.org [Cardiovascular Health Research Unit, University of Washington, 1730 Minor Ave, Seattle, WA 98101 (United States); Department of Epidemiology, School of Public Health, University of Washington, Seattle, WA (United States); Department of Medicine, University of Washington, Seattle, WA (United States); and others
2015-04-15
Background: Recent evidence suggests that maternal cadmium (Cd) burden and fetal growth associations may vary by fetal sex. However, mechanisms contributing to these differences are unknown. Objectives: Among 24 maternal-infant pairs, we investigated infant sex-specific associations between placental Cd and placental genome-wide DNA methylation. Methods: We used ANOVA models to examine sex-stratified associations of placental Cd (dichotomized into high/low Cd using sex-specific Cd median cutoffs) with DNA methylation at each cytosine-phosphate-guanine site or region. Statistical significance was defined using a false discovery rate cutoff (<0.10). Results: Medians of placental Cd among females and males were 5 and 2 ng/g, respectively. Among females, three sites (near ADP-ribosylation factor-like 9 (ARL9), siah E3 ubiquitin protein ligase family member 3 (SIAH3), and heparin sulfate (glucosamine) 3-O-sulfotransferase 4 (HS3ST4) and one region on chromosome 7 (including carnitine O-octanoyltransferase (CROT) and TP5S target 1 (TP53TG1)) were hypomethylated in high Cd placentas. Among males, high placental Cd was associated with methylation of three sites, two (hypomethylated) near MDS1 and EVI1 complex locus (MECOM) and one (hypermethylated) near spalt-like transcription factor 1 (SALL1), and two regions (both hypomethylated, one on chromosome 3 including MECOM and another on chromosome 8 including rho guanine nucleotide exchange factor (GEF) 10 (ARHGEF10). Differentially methylated sites were at or close to transcription start sites of genes involved in cell damage response (SIAH3, HS3ST4, TP53TG1) in females and cell differentiation, angiogenesis and organ development (MECOM, SALL1) in males. Conclusions: Our preliminary study supports infant sex-specific placental Cd-DNA methylation associations, possibly accounting for previously reported differences in Cd-fetal growth associations across fetal sex. Larger studies are needed to replicate and extend these
Infant sex-specific placental cadmium and DNA methylation associations
International Nuclear Information System (INIS)
Mohanty, April F.; Farin, Fred M.; Bammler, Theo K.; MacDonald, James W.; Afsharinejad, Zahra; Burbacher, Thomas M.; Siscovick, David S.
2015-01-01
Background: Recent evidence suggests that maternal cadmium (Cd) burden and fetal growth associations may vary by fetal sex. However, mechanisms contributing to these differences are unknown. Objectives: Among 24 maternal-infant pairs, we investigated infant sex-specific associations between placental Cd and placental genome-wide DNA methylation. Methods: We used ANOVA models to examine sex-stratified associations of placental Cd (dichotomized into high/low Cd using sex-specific Cd median cutoffs) with DNA methylation at each cytosine-phosphate-guanine site or region. Statistical significance was defined using a false discovery rate cutoff (<0.10). Results: Medians of placental Cd among females and males were 5 and 2 ng/g, respectively. Among females, three sites (near ADP-ribosylation factor-like 9 (ARL9), siah E3 ubiquitin protein ligase family member 3 (SIAH3), and heparin sulfate (glucosamine) 3-O-sulfotransferase 4 (HS3ST4) and one region on chromosome 7 (including carnitine O-octanoyltransferase (CROT) and TP5S target 1 (TP53TG1)) were hypomethylated in high Cd placentas. Among males, high placental Cd was associated with methylation of three sites, two (hypomethylated) near MDS1 and EVI1 complex locus (MECOM) and one (hypermethylated) near spalt-like transcription factor 1 (SALL1), and two regions (both hypomethylated, one on chromosome 3 including MECOM and another on chromosome 8 including rho guanine nucleotide exchange factor (GEF) 10 (ARHGEF10). Differentially methylated sites were at or close to transcription start sites of genes involved in cell damage response (SIAH3, HS3ST4, TP53TG1) in females and cell differentiation, angiogenesis and organ development (MECOM, SALL1) in males. Conclusions: Our preliminary study supports infant sex-specific placental Cd-DNA methylation associations, possibly accounting for previously reported differences in Cd-fetal growth associations across fetal sex. Larger studies are needed to replicate and extend these
Variants in SLC18A3, vesicular acetylcholine transporter, cause congenital myasthenic syndrome
O'Grady, Gina L.; Verschuuren, Corien; Yuen, Michaela; Webster, Richard; Menezes, Manoj; Fock, Johanna M.; Pride, Natalie; Best, Heather A.; Damm, Tatiana Benavides; Turner, Christian; Lek, Monkol; Engel, Andrew G.; North, Kathryn N.; Clarke, Nigel F.; MacArthur, Daniel G.; Kamsteeg, Erik-Jan; Cooper, Sandra T.
2016-01-01
Objective: To describe the clinical and genetic characteristics of presynaptic congenital myasthenic syndrome secondary to biallelic variants in SLC18A3. Methods: Individuals from 2 families were identified with biallelic variants in SLC18A3, the gene encoding the vesicular acetylcholine transporter
A panel of genes methylated with high frequency in colorectal cancer
International Nuclear Information System (INIS)
Mitchell, Susan M; Beetson, Iain; Rand, Keith N; McEvoy, Aidan; Thomas, Melissa L; Baker, Rohan T; Wattchow, David A; Young, Graeme P; Lockett, Trevor J; Pedersen, Susanne K; LaPointe, Lawrence C; Ross, Jason P; Molloy, Peter L; Drew, Horace R; Ho, Thu; Brown, Glenn S; Saunders, Neil FW; Duesing, Konsta R; Buckley, Michael J; Dunne, Rob
2014-01-01
(SOX21, SLC6A15, NPY, GRASP, ST8SIA1 and ZSCAN18) show very low methylation in non-neoplastic colorectal tissue and are candidate biomarkers for stool-based assays, while 11 genes (BCAT1, COL4A2, DLX5, FGF5, FOXF1, FOXI2, GRASP, IKZF1, IRF4, SDC2 and SOX21) have very low methylation in peripheral blood DNA and are suitable for further evaluation as blood-based diagnostic markers
Folate, colorectal cancer and the involvement of DNA methylation.
Williams, Elizabeth A
2012-11-01
Diet is a major factor in the aetiology of colorectal cancer (CRC). Epidemiological evidence suggests that folate confers a modest protection against CRC risk. However, the relationship is complex, and evidence from human intervention trials and animal studies suggests that a high-dose of folic acid supplementation may enhance the risk of colorectal carcinogenesis in certain circumstances. The molecular mechanisms underlying the apparent dual modulatory effect of folate on colorectal carcinogenesis are not fully understood. Folate is central to C1 metabolism and is needed for both DNA synthesis and DNA methylation, providing plausible biological mechanisms through which folate could modulate cancer risk. Aberrant DNA methylation is an early event in colorectal carcinogenesis and is typically associated with the transcriptional silencing of tumour suppressor genes. Folate is required for the production of S-adenosyl methionine, which serves as a methyl donor for DNA methylation events; thereby folate availability is proposed to modulate DNA methylation status. The evidence for an effect of folate on DNA methylation in the human colon is limited, but a modulation of DNA methylation in response to folate has been demonstrated. More research is required to clarify the optimum intake of folate for CRC prevention and to elucidate the effect of folate availability on DNA methylation and the associated impact on CRC biology.
Jenkins, Timothy G; Aston, Kenneth I; Pflueger, Christian; Cairns, Bradley R; Carrell, Douglas T
2014-07-01
Recent evidence demonstrates a role for paternal aging on offspring disease susceptibility. It is well established that various neuropsychiatric disorders (schizophrenia, autism, etc.), trinucleotide expansion associated diseases (myotonic dystrophy, Huntington's, etc.) and even some forms of cancer have increased incidence in the offspring of older fathers. Despite strong epidemiological evidence that these alterations are more common in offspring sired by older fathers, in most cases the mechanisms that drive these processes are unclear. However, it is commonly believed that epigenetics, and specifically DNA methylation alterations, likely play a role. In this study we have investigated the impact of aging on DNA methylation in mature human sperm. Using a methylation array approach we evaluated changes to sperm DNA methylation patterns in 17 fertile donors by comparing the sperm methylome of 2 samples collected from each individual 9-19 years apart. With this design we have identified 139 regions that are significantly and consistently hypomethylated with age and 8 regions that are significantly hypermethylated with age. A representative subset of these alterations have been confirmed in an independent cohort. A total of 117 genes are associated with these regions of methylation alterations (promoter or gene body). Intriguingly, a portion of the age-related changes in sperm DNA methylation are located at genes previously associated with schizophrenia and bipolar disorder. While our data does not establish a causative relationship, it does raise the possibility that the age-associated methylation of the candidate genes that we observe in sperm might contribute to the increased incidence of neuropsychiatric and other disorders in the offspring of older males. However, further study is required to determine whether, and to what extent, a causative relationship exists.
DNA Methylation: A Frontier in Tooth Organogenesis and Developmental Dental Defects.
Wan, Mian; Li, Hongyu; Zhou, Yachuan; Du, Wei; Xu, Xin; Ye, Ling; Zhou, Xuedong; Zheng, Liwei
2018-01-01
Tooth development relies on interactions between epithelial and mesenchymal tissues, which are controlled by sophisticated networks of conserved signaling. The signaling networks regulating odontogenesis have been well characterized, but the epigenetic mechanisms underlying remain to be elucidated. In this review, we describe current researches regarding the control of various genes expression by DNA methylation during odontogenesis, summarize genomic mapping of DNA methylation in various stages of tooth formation and diverse dental tissues by high-throughput approaches, and highlight the roles of DNA methylation in odontogenesis. Researches on mammals have revealed that the genomic methylation, which occurs on cytosine residues, regulates certain genes transcription. Consequently, DNA methylation plays a crucial role in spatiotemporal organization of signaling pathways, and is essential for organogenesis. Recently, mounting evidence proves that methylation of genomes contributes to the spatiotemporal gene dynamics during odontogenesis. With emerging new technologies of mapping cytosine modifications in global genome, investigators are seeking an overall view of DNA methylome dynamics that characterize genetic information to manifest across incredibly varied tooth development stages, dental tissues, and developmental dental defects. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Directory of Open Access Journals (Sweden)
Wang Jinkai
2012-08-01
Full Text Available Abstract Background The highly improved cognitive function is the most significant change in human evolutionary history. Recently, several large-scale studies reported the evolutionary roles of DNA methylation; however, the role of DNA methylation on brain evolution is largely unknown. Results To test if DNA methylation has contributed to the evolution of human brain, with the use of MeDIP-Chip and SEQUENOM MassARRAY, we conducted a genome-wide analysis to identify differentially methylated regions (DMRs in the brain between humans and rhesus macaques. We first identified a total of 150 candidate DMRs by the MeDIP-Chip method, among which 4 DMRs were confirmed by the MassARRAY analysis. All 4 DMRs are within or close to the CpG islands, and a MIR3 repeat element was identified in one DMR, but no repeat sequence was observed in the other 3 DMRs. For the 4 DMR genes, their proteins tend to be conserved and two genes have neural related functions. Bisulfite sequencing and phylogenetic comparison among human, chimpanzee, rhesus macaque and rat suggested several regions of lineage specific DNA methylation, including a human specific hypomethylated region in the promoter of K6IRS2 gene. Conclusions Our study provides a new angle of studying human brain evolution and understanding the evolutionary role of DNA methylation in the central nervous system. The results suggest that the patterns of DNA methylation in the brain are in general similar between humans and non-human primates, and only a few DMRs were identified.
Colorimetric determination of DNase I activity with a DNA-methyl green substrate.
Sinicropi, D; Baker, D L; Prince, W S; Shiffer, K; Shak, S
1994-11-01
A simple, high throughput, and precise assay was developed for quantification of deoxyribonuclease I (DNase; IUB 3.1.21.1) activity. The method was adapted from the procedure devised by Kurnick which employs a substrate comprised of highly polymerized native DNA complexed with methyl green. Hydrolysis of the DNA produced unbound methyl green and a decrease in the absorbance of the solution at 620 nm. By adjusting the time and temperature of the reaction, the assay permits quantification of DNase activity over a wide concentration range (0.4 to 8900 ng/ml). Samples and standards were added to the substrate in microtiter plates and were incubated for 1-24 h at 25-37 degrees C to achieve the desired assay range. The DNase activity of the samples was interpolated from a standard curve generated with Pulmozyme recombinant human deoxyribonuclease I (rhDNase). Interassay precision was less than 12% CV and recovery was within 100 +/- 11%. Activity determination by the DNA-methyl green method correlated well with that determined by the widely used "hyperchromicity" method originated by Kunitz, which is based on the increase in absorbance at 260 nm upon hydrolysis of DNA. The DNA-methyl green assay was simpler and more versatile than the hyperchromicity method and was used to characterize the activity of rhDNase and DNase isolated from human urine.
Quantitative analysis of DNA methylation in chronic lymphocytic leukemia patients.
Lyko, Frank; Stach, Dirk; Brenner, Axel; Stilgenbauer, Stephan; Döhner, Hartmut; Wirtz, Michaela; Wiessler, Manfred; Schmitz, Oliver J
2004-06-01
Changes in the genomic DNA methylation level have been found to be closely associated with tumorigenesis. In order to analyze the relation of aberrant DNA methylation to clinical and biological risk factors, we have determined the cytosine methylation level of 81 patients diagnosed with chronic lymphocytic leukemia (CLL). The analysis was based on DNA hydrolysis followed by derivatization of the 2'-desoxyribonucleoside-3'-monophosphates with BODIPY FL EDA. Derivatives were separated by micellar electrokinetic chromatography, and laser-induced fluorescence was used for detection. We analyzed potential correlations between DNA methylation levels and numerous patient parameters, including clinical observations and biological data. As a result, we observed a significant correlation with the immunoglobulin variable heavy chain gene (VH) mutation status. This factor has been repeatedly proposed as a reliable prognostic marker for CLL, which suggests that the methylation level might be a valuable factor in determining the prognostic outcome of CLL. We are now in the process of refining our method to broaden its application potential. In this context, we show here that the oxidation of the fluorescence marker in the samples and the evaporation of methanol in the electrolytes can be prevented by a film of paraffin oil. In summary, our results thus establish capillary electrophoresis as a valuable tool for analyzing the DNA methylation status of clinical samples.
Aberrant DNA Methylation: Implications in Racial Health Disparity.
Directory of Open Access Journals (Sweden)
Xuefeng Wang
Full Text Available Incidence and mortality rates of colorectal carcinoma (CRC are higher in African Americans (AAs than in Caucasian Americans (CAs. Deficient micronutrient intake due to dietary restrictions in racial/ethnic populations can alter genetic and molecular profiles leading to dysregulated methylation patterns and the inheritance of somatic to germline mutations.Total DNA and RNA samples of paired tumor and adjacent normal colon tissues were prepared from AA and CA CRC specimens. Reduced Representation Bisulfite Sequencing (RRBS and RNA sequencing were employed to evaluate total genome methylation of 5'-regulatory regions and dysregulation of gene expression, respectively. Robust analysis was conducted using a trimming-and-retrieving scheme for RRBS library mapping in conjunction with the BStool toolkit.DNA from the tumor of AA CRC patients, compared to adjacent normal tissues, contained 1,588 hypermethylated and 100 hypomethylated differentially methylated regions (DMRs. Whereas, 109 hypermethylated and 4 hypomethylated DMRs were observed in DNA from the tumor of CA CRC patients; representing a 14.6-fold and 25-fold change, respectively. Specifically; CHL1, 4 anti-inflammatory genes (i.e., NELL1, GDF1, ARHGEF4, and ITGA4, and 7 miRNAs (of which miR-9-3p and miR-124-3p have been implicated in CRC were hypermethylated in DNA samples from AA patients with CRC. From the same sample set, RNAseq analysis revealed 108 downregulated genes (including 14 ribosomal proteins and 34 upregulated genes (including POLR2B and CYP1B1 [targets of miR-124-3p] in AA patients with CRC versus CA patients.DNA methylation profile and/or products of its downstream targets could serve as biomarker(s addressing racial health disparity.
DNA methylation and healthy human aging.
Jones, Meaghan J; Goodman, Sarah J; Kobor, Michael S
2015-12-01
The process of aging results in a host of changes at the cellular and molecular levels, which include senescence, telomere shortening, and changes in gene expression. Epigenetic patterns also change over the lifespan, suggesting that epigenetic changes may constitute an important component of the aging process. The epigenetic mark that has been most highly studied is DNA methylation, the presence of methyl groups at CpG dinucleotides. These dinucleotides are often located near gene promoters and associate with gene expression levels. Early studies indicated that global levels of DNA methylation increase over the first few years of life and then decrease beginning in late adulthood. Recently, with the advent of microarray and next-generation sequencing technologies, increases in variability of DNA methylation with age have been observed, and a number of site-specific patterns have been identified. It has also been shown that certain CpG sites are highly associated with age, to the extent that prediction models using a small number of these sites can accurately predict the chronological age of the donor. Together, these observations point to the existence of two phenomena that both contribute to age-related DNA methylation changes: epigenetic drift and the epigenetic clock. In this review, we focus on healthy human aging throughout the lifetime and discuss the dynamics of DNA methylation as well as how interactions between the genome, environment, and the epigenome influence aging rates. We also discuss the impact of determining 'epigenetic age' for human health and outline some important caveats to existing and future studies. © 2015 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.
Relaxation of IGF2/H19 imprinting in Wilms tumour is associated with a switch in DNA methylation
Energy Technology Data Exchange (ETDEWEB)
Reeve, A.E.; Taniguchi, T.; Sullivan, M.J.; Ogawa, O. [Univ. of Otago, Dunedin (New Zealand)
1994-09-01
We and others have recently shown that the normal imprinting of the insulin-like growth factor 2 (IGF2) gene is disrupted in Wilms tumor. The process of relaxation of IGF2 imprinting leads to the activation of transcription of the normally silent maternally inherited IGF2 allele such that both alleles of the IGF2 gene are transcribed. Relaxation of IGF2 imprinting has also been detected as a constitutional event in patients with the Beckwith-Wiedemann syndrom and a patient with gigantism and Wilms tumor. We have now shown that in Wilms tumors in which imprinting is relaxed, IGF2 is transcribed from the maternal allele and there is a concomitant transcriptional inactivation of the H19 maternal allele. Furthermore, the patterns of methylation of the IGF2 and H19 gene are reversed on the maternal chromosome. Relaxation of imprinting in Wilms tumors appear, therefore, to be associated with a switch in gene expression and methylation at the IGF2/H19 locus. The data supports the notion of a disrupted IGF2/H19 imprinting switch in Wilms tumor.
DNA methylation regulates neurophysiological spatial representation in memory formation
Directory of Open Access Journals (Sweden)
Eric D. Roth
2015-04-01
Full Text Available Epigenetic mechanisms including altered DNA methylation are critical for altered gene transcription subserving synaptic plasticity and the retention of learned behavior. Here, we tested the idea that one role for activity-dependent altered DNA methylation is stabilization of cognition-associated hippocampal place cell firing in response to novel place learning. We observed that a behavioral protocol (spatial exploration of a novel environment known to induce hippocampal place cell remapping resulted in alterations of hippocampal Bdnf DNA methylation. Further studies using neurophysiological in vivo single-unit recordings revealed that pharmacological manipulations of DNA methylation decreased long-term but not short-term place field stability. Together, our data highlight a role for DNA methylation in regulating neurophysiological spatial representation and memory formation.
DNA methylation regulates neurophysiological spatial representation in memory formation.
Roth, Eric D; Roth, Tania L; Money, Kelli M; SenGupta, Sonda; Eason, Dawn E; Sweatt, J David
2015-04-01
Epigenetic mechanisms including altered DNA methylation are critical for altered gene transcription subserving synaptic plasticity and the retention of learned behavior. Here we tested the idea that one role for activity-dependent altered DNA methylation is stabilization of cognition-associated hippocampal place cell firing in response to novel place learning. We observed that a behavioral protocol (spatial exploration of a novel environment) known to induce hippocampal place cell remapping resulted in alterations of hippocampal Bdnf DNA methylation. Further studies using neurophysiological in vivo single unit recordings revealed that pharmacological manipulations of DNA methylation decreased long-term but not short-term place field stability. Together our data highlight a role for DNA methylation in regulating neurophysiological spatial representation and memory formation.
Evidence Suggesting Absence of Mitochondrial DNA Methylation
DEFF Research Database (Denmark)
Mechta, Mie; Ingerslev, Lars R; Fabre, Odile
2017-01-01
, 16S, ND5 and CYTB, suggesting that mtDNA supercoiled structure blocks the access to bisulfite conversion. Here, we identified an artifact of mtDNA bisulfite sequencing that can lead to an overestimation of mtDNA methylation levels. Our study supports that cytosine methylation is virtually absent...
Whole genome DNA methylation: beyond genes silencing
Tirado-Magallanes, Roberto; Rebbani, Khadija; Lim, Ricky; Pradhan, Sriharsa; Benoukraf, Touati
2016-01-01
The combination of DNA bisulfite treatment with high-throughput sequencing technologies has enabled investigation of genome-wide DNA methylation at near base pair level resolution, far beyond that of the kilobase-long canonical CpG islands that initially revealed the biological relevance of this covalent DNA modification. The latest high-resolution studies have revealed a role for very punctual DNA methylation in chromatin plasticity, gene regulation and splicing. Here, we aim to outline the ...
Methylation effect on the ohmic resistance of a poly-GC DNA-like chain
Energy Technology Data Exchange (ETDEWEB)
Moura, F.A.B.F. de, E-mail: fidelis@fis.ufal.br [Instituto de Física, Universidade Federal de Alagoas, Maceió AL 57072-970 (Brazil); Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, Maceió AL 57072-970 (Brazil); Almeida, M.L. de; Ourique, G.S.; Fulco, U.L.; Albuquerque, E.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil)
2016-10-14
We determine, by using a tight-binding model Hamiltonian, the characteristic current–voltage (IxV) curves of a 5-methylated cytosine single strand poly-GC DNA-like finite segment, considering the methyl groups attached laterally to a random fraction of the cytosine basis. Striking, we found that the methylation significantly impacts the ohmic resistance (R) of the DNA-like segments, indicating that measurements of R can be used as a biosensor tool to probe the presence of anomalous methylation. - Highlights: • Ohmic resistance of finite segments of poly-CG DNA-like segments. • Possibility for the development of biosensor devices. • Methylation effect and electronic transport in DNA-like segments.
Li, Yong
2017-11-03
The symbiotic relationship between cnidarians and dinoflagellates is the cornerstone of coral reef ecosystems. Although research is focusing on the molecular mechanisms underlying this symbiosis, the role of epigenetic mechanisms, which have been implicated in transcriptional regulation and acclimation to environmental change, is unknown. To assess the role of DNA methylation in the cnidarian-dinoflagellate symbiosis, we analyzed genome-wide CpG methylation, histone associations, and transcriptomic states of symbiotic and aposymbiotic anemones in the model system Aiptasia. We find methylated genes are marked by histone H3K36me3 and show significant reduction of spurious transcription and transcriptional noise, revealing a role of DNA methylation in the maintenance of transcriptional homeostasis. Changes in DNA methylation and expression show enrichment for symbiosis-related processes such as immunity, apoptosis, phagocytosis recognition and phagosome formation, and unveil intricate interactions between the underlying pathways. Our results demonstrate that DNA methylation provides an epigenetic mechanism of transcriptional homeostasis during symbiosis.
Li, Yong; Liew, Yi Jin; Cui, Guoxin; Cziesielski, Maha J; Zahran, Noura Ibrahim Omar; Michell, Craig T; Voolstra, Christian R.; Aranda, Manuel
2017-01-01
The symbiotic relationship between cnidarians and dinoflagellates is the cornerstone of coral reef ecosystems. Although research is focusing on the molecular mechanisms underlying this symbiosis, the role of epigenetic mechanisms, which have been implicated in transcriptional regulation and acclimation to environmental change, is unknown. To assess the role of DNA methylation in the cnidarian-dinoflagellate symbiosis, we analyzed genome-wide CpG methylation, histone associations, and transcriptomic states of symbiotic and aposymbiotic anemones in the model system Aiptasia. We find methylated genes are marked by histone H3K36me3 and show significant reduction of spurious transcription and transcriptional noise, revealing a role of DNA methylation in the maintenance of transcriptional homeostasis. Changes in DNA methylation and expression show enrichment for symbiosis-related processes such as immunity, apoptosis, phagocytosis recognition and phagosome formation, and unveil intricate interactions between the underlying pathways. Our results demonstrate that DNA methylation provides an epigenetic mechanism of transcriptional homeostasis during symbiosis.
Methylated DNA Immunoprecipitation Analysis of Mammalian Endogenous Retroviruses.
Rebollo, Rita; Mager, Dixie L
2016-01-01
Endogenous retroviruses are repetitive sequences found abundantly in mammalian genomes which are capable of modulating host gene expression. Nevertheless, most endogenous retrovirus copies are under tight epigenetic control via histone-repressive modifications and DNA methylation. Here we describe a common method used in our laboratory to detect, quantify, and compare mammalian endogenous retrovirus DNA methylation. More specifically we describe methylated DNA immunoprecipitation (MeDIP) followed by quantitative PCR.
Maternal Methyl-Group Donor Intake and Global DNA (HydroxyMethylation before and during Pregnancy
Directory of Open Access Journals (Sweden)
Sara Pauwels
2016-08-01
Full Text Available It is still unclear to which extent methyl-group intake during pregnancy can affect maternal global DNA (hydroxylmethylation. Pregnancy methylation profiling and its link with methyl-group intake in a healthy population could enhance our understanding of the development of pregnancy related disorders. One hundred forty-eight women were enrolled in the MANOE (MAternal Nutrition and Offspring’s Epigenome study. Thiry-four women were enrolled before pregnancy and 116 during the first trimester of pregnancy. Global DNA (hydroxymethylation in blood using LC-MS/MS and dietary methyl-group intake (methionine, folate, betaine, and choline using a food-frequency questionnaire were estimated pre-pregnancy, during each trimester, and at delivery. Global DNA (hydroxymethylation levels were highest pre-pregnancy and at weeks 18–22 of pregnancy. We observed a positive relation between folic acid and global DNA methylation (p = 0.04 and hydroxymethylation (p = 0.04. A high intake of methionine pre-pregnancy and in the first trimester showed lower (hydroxymethylation percentage in weeks 11–13 and weeks 18–22, respectively. Choline and betaine intake in the first weeks was negatively associated with hydroxymethylation. Women with a high intake of these three methyl groups in the second and third trimester showed higher hyrdoxymethylation/methylation levels in the third trimester. To conclude, a time trend in DNA (hydroxymethylation was found and women with higher methyl-group intake showed higher methylation in the third trimester, and not in earlier phases of pregnancy.
Genetic and DNA methylation changes in cotton (Gossypium genotypes and tissues.
Directory of Open Access Journals (Sweden)
Kenji Osabe
Full Text Available In plants, epigenetic regulation is important in normal development and in modulating some agronomic traits. The potential contribution of DNA methylation mediated gene regulation to phenotypic diversity and development in cotton was investigated between cotton genotypes and various tissues. DNA methylation diversity, genetic diversity, and changes in methylation context were investigated using methylation-sensitive amplified polymorphism (MSAP assays including a methylation insensitive enzyme (BsiSI, and the total DNA methylation level was measured by high-performance liquid chromatography (HPLC. DNA methylation diversity was greater than the genetic diversity in the selected cotton genotypes and significantly different levels of DNA methylation were identified between tissues, including fibre. The higher DNA methylation diversity (CHG methylation being more diverse than CG methylation in cotton genotypes suggest epigenetic regulation may be important for cotton, and the change in DNA methylation between fibre and other tissues hints that some genes may be epigenetically regulated for fibre development. The novel approach using BsiSI allowed direct comparison between genetic and epigenetic diversity, and also measured CC methylation level that cannot be detected by conventional MSAP.
Genetic and DNA methylation changes in cotton (Gossypium) genotypes and tissues.
Osabe, Kenji; Clement, Jenny D; Bedon, Frank; Pettolino, Filomena A; Ziolkowski, Lisa; Llewellyn, Danny J; Finnegan, E Jean; Wilson, Iain W
2014-01-01
In plants, epigenetic regulation is important in normal development and in modulating some agronomic traits. The potential contribution of DNA methylation mediated gene regulation to phenotypic diversity and development in cotton was investigated between cotton genotypes and various tissues. DNA methylation diversity, genetic diversity, and changes in methylation context were investigated using methylation-sensitive amplified polymorphism (MSAP) assays including a methylation insensitive enzyme (BsiSI), and the total DNA methylation level was measured by high-performance liquid chromatography (HPLC). DNA methylation diversity was greater than the genetic diversity in the selected cotton genotypes and significantly different levels of DNA methylation were identified between tissues, including fibre. The higher DNA methylation diversity (CHG methylation being more diverse than CG methylation) in cotton genotypes suggest epigenetic regulation may be important for cotton, and the change in DNA methylation between fibre and other tissues hints that some genes may be epigenetically regulated for fibre development. The novel approach using BsiSI allowed direct comparison between genetic and epigenetic diversity, and also measured CC methylation level that cannot be detected by conventional MSAP.
ROLE OF DNA METHYLATION AS A DIAGNOSTIC BIOMARKER OF SPORADIC BREAST CANCER
Directory of Open Access Journals (Sweden)
Wirsma Arif Harahap
2017-02-01
Full Text Available The initiation and progression of breast cancer have been recognized for many years to be secondary to the accumulation of genetic mutations which lead to aberrant cellular function. Genetic mutations, either inherited or sporadic, may result in the activation of oncogenes and the inactivation of tumor suppressor genes. The more recent discovery that reversible alterations in histone proteins and deoxyribonucleic acid (DNA can also lead to tumorigenesis has introduced a novel term to the field of cancer research: epigenetics. Epigenetics refers to the study of heritable changes in gene regulation that do not involve a change in the DNA sequence. The most often studied in epigenetics of breast cancer is DNA methylation. That a promoter methylation result in transcription blockade supports the notion that cellular inhibition takes place. Compared to normal tissues, hypermethylation occurs from double to triple in cancerous ones. DNA methylation plays a crucial role in oncogenesis and is one of the hallmarks of cancer. Detection of aberrantly methylated CpG islands in promoter region of several genes in DNA sample derived from nipple aspirates, serum, or cancer tissue associated with down regulation of expression or loss of function of these genes has been associated with early stages of breast cancer, where hypermethylation of CpG island points to poorer prognosis in breast cancer. DNA methylation has been identified as signature for TNBC. Methylation of BRCA1 gene is frequently demonstrated in young, estrogen receptor-negative breast cancer patients. Methylation of specific genes is known to differ across race and socioeconomic status. BRCA1 methylation in premenopausal women with sporadic breast cancer in West Sumatra region has been higher than in Western women. DNA methylation may be used to enhance current breast cancer classification. There is such a distinction between methylation and gene expression profiles of breast cancer that not
Directory of Open Access Journals (Sweden)
Wu Bailin
2008-11-01
Full Text Available Abstract Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135 were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43 of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135 of the patients with hearing loss. Together with GJB2 (23/135, SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the
Dai, Pu; Yuan, Yongyi; Huang, Deliang; Zhu, Xiuhui; Yu, Fei; Kang, Dongyang; Yuan, Huijun; Wu, Bailin; Han, Dongyi; Wong, Lee-Jun C
2008-01-01
Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135) were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43) of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135) of the patients with hearing loss. Together with GJB2 (23/135), SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the temporal bone CT scan to
Directory of Open Access Journals (Sweden)
Timothy G Jenkins
2014-07-01
Full Text Available Recent evidence demonstrates a role for paternal aging on offspring disease susceptibility. It is well established that various neuropsychiatric disorders (schizophrenia, autism, etc., trinucleotide expansion associated diseases (myotonic dystrophy, Huntington's, etc. and even some forms of cancer have increased incidence in the offspring of older fathers. Despite strong epidemiological evidence that these alterations are more common in offspring sired by older fathers, in most cases the mechanisms that drive these processes are unclear. However, it is commonly believed that epigenetics, and specifically DNA methylation alterations, likely play a role. In this study we have investigated the impact of aging on DNA methylation in mature human sperm. Using a methylation array approach we evaluated changes to sperm DNA methylation patterns in 17 fertile donors by comparing the sperm methylome of 2 samples collected from each individual 9-19 years apart. With this design we have identified 139 regions that are significantly and consistently hypomethylated with age and 8 regions that are significantly hypermethylated with age. A representative subset of these alterations have been confirmed in an independent cohort. A total of 117 genes are associated with these regions of methylation alterations (promoter or gene body. Intriguingly, a portion of the age-related changes in sperm DNA methylation are located at genes previously associated with schizophrenia and bipolar disorder. While our data does not establish a causative relationship, it does raise the possibility that the age-associated methylation of the candidate genes that we observe in sperm might contribute to the increased incidence of neuropsychiatric and other disorders in the offspring of older males. However, further study is required to determine whether, and to what extent, a causative relationship exists.
Martin, Lee J; Wong, Margaret
2013-10-01
Amyotrophic lateral sclerosis (ALS) is the third most common adult-onset neurodegenerative disease. A diagnosis is fatal owing to degeneration of motor neurons in brain and spinal cord that control swallowing, breathing, and movement. ALS can be inherited, but most cases are not associated with a family history of the disease. The mechanisms causing motor neuron death in ALS are still unknown. Given the suspected complex interplay between multiple genes, the environment, metabolism, and lifestyle in the pathogenesis of ALS, we have hypothesized that the mechanisms of disease in ALS involve epigenetic contributions that can drive motor neuron degeneration. DNA methylation is an epigenetic mechanism for gene regulation engaged by DNA methyltransferase (Dnmt)-catalyzed methyl group transfer to carbon-5 in cytosine residues in gene regulatory promoter and nonpromoter regions. Recent genome-wide analyses have found differential gene methylation in human ALS. Neuropathologic assessments have revealed that motor neurons in human ALS show significant abnormalities in Dnmt1, Dnmt3a, and 5-methylcytosine. Similar changes are seen in mice with motor neuron degeneration, and Dnmt3a was found abundantly at synapses and in mitochondria. During apoptosis of cultured motor neuron-like cells, Dnmt1 and Dnmt3a protein levels increase, and 5-methylcytosine accumulates. Enforced expression of Dnmt3a, but not Dnmt1, induces degeneration of cultured neurons. Truncation mutation of the Dnmt3a catalytic domain and Dnmt3a RNAi blocks apoptosis of cultured neurons. Inhibition of Dnmt catalytic activity with small molecules RG108 and procainamide protects motor neurons from excessive DNA methylation and apoptosis in cell culture and in a mouse model of ALS. Thus, motor neurons can engage epigenetic mechanisms to cause their degeneration, involving Dnmts and increased DNA methylation. Aberrant DNA methylation in vulnerable cells is a new direction for discovering mechanisms of ALS
Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando
2014-01-01
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081
International Nuclear Information System (INIS)
Klajic, Jovana; Tost, Jörg; Kristensen, Vessela N; Fleischer, Thomas; Dejeux, Emelyne; Edvardsen, Hege; Warnberg, Fredrik; Bukholm, Ida; Lønning, Per Eystein; Solvang, Hiroko; Børresen-Dale, Anne-Lise
2013-01-01
Aberrant DNA methylation of regulatory genes has frequently been found in human breast cancers and correlated to clinical outcome. In the present study we investigate stage specific changes in the DNA methylation patterns in order to identify valuable markers to understand how these changes affect breast cancer progression. Quantitative DNA methylation analyses of 12 candidate genes ABCB1, BRCCA1, CDKN2A, ESR1, GSTP1, IGF2, MGMT, HMLH1, PPP2R2B, PTEN, RASSF1A and FOXC1 was performed by pyrosequencing a series of 238 breast cancer tissue samples from DCIS to invasive tumors stage I to IV. Significant differences in methylation levels between the DCIS and invasive stage II tumors were observed for six genes RASSF1A, CDKN2A, MGMT, ABCB1, GSTP1 and FOXC1. RASSF1A, ABCB1 and GSTP1 showed significantly higher methylation levels in late stage compared to the early stage breast carcinoma. Z-score analysis revealed significantly lower methylation levels in DCIS and stage I tumors compared with stage II, III and IV tumors. Methylation levels of PTEN, PPP2R2B, FOXC1, ABCB1 and BRCA1 were lower in tumors harboring TP53 mutations then in tumors with wild type TP53. Z-score analysis showed that TP53 mutated tumors had significantly lower overall methylation levels compared to tumors with wild type TP53. Methylation levels of RASSF1A, PPP2R2B, GSTP1 and FOXC1 were higher in ER positive vs. ER negative tumors and methylation levels of PTEN and CDKN2A were higher in HER2 positive vs. HER2 negative tumors. Z-score analysis also showed that HER2 positive tumors had significantly higher z-scores of methylation compared to the HER2 negative tumors. Univariate survival analysis identifies methylation status of PPP2R2B as significant predictor of overall survival and breast cancer specific survival. In the present study we report that the level of aberrant DNA methylation is higher in late stage compared with early stage of invasive breast cancers and DCIS for genes mentioned above
Schwalbe, E C; Hicks, D; Rafiee, G; Bashton, M; Gohlke, H; Enshaei, A; Potluri, S; Matthiesen, J; Mather, M; Taleongpong, P; Chaston, R; Silmon, A; Curtis, A; Lindsey, J C; Crosier, S; Smith, A J; Goschzik, T; Doz, F; Rutkowski, S; Lannering, B; Pietsch, T; Bailey, S; Williamson, D; Clifford, S C
2017-10-18
Rapid and reliable detection of disease-associated DNA methylation patterns has major potential to advance molecular diagnostics and underpin research investigations. We describe the development and validation of minimal methylation classifier (MIMIC), combining CpG signature design from genome-wide datasets, multiplex-PCR and detection by single-base extension and MALDI-TOF mass spectrometry, in a novel method to assess multi-locus DNA methylation profiles within routine clinically-applicable assays. We illustrate the application of MIMIC to successfully identify the methylation-dependent diagnostic molecular subgroups of medulloblastoma (the most common malignant childhood brain tumour), using scant/low-quality samples remaining from the most recently completed pan-European medulloblastoma clinical trial, refractory to analysis by conventional genome-wide DNA methylation analysis. Using this approach, we identify critical DNA methylation patterns from previously inaccessible cohorts, and reveal novel survival differences between the medulloblastoma disease subgroups with significant potential for clinical exploitation.
Modeling spatiotemporal dynamics of DNA methylation
DEFF Research Database (Denmark)
Lövkvist, Cecilia Elisabet
into how epigenetic marks are distributed in the human genome. In the first part of the thesis, we investigate DNA methylation and maintenance of methylation patterns throughout cell division. We argue that collaborative models, those where the methylation of CpG sites depends on the methylation status...... into the game more explicitly in another type of model that speaks out the duality of the two aspects. Using statistical analysis of experimental data, this thesis further explores a link between DNA methylation and nucleosome occupancy. By comparing the patterns on promoters to regions with similar Cp...... division. The patterns of epigentic marks depend on enzymes that ensure their maintenance and introduction. Using theoretical models, this thesis proposes new mechanisms for how enzymes operate to maintain patterns of epigenetic marks. Through analysis of experimental data this work gives new insight...
Genomic DNA methylation-demethylation during aging and reinvigoration of Pinus radiata.
Fraga, Mario F; Rodríguez, Roberto; Cañal, Maria Jesús
2002-08-01
In animals, DNA methylation is related to gene silencing during ontogenic development. Little is known about DNA methylation in plants, although occasional changes in the DNA methylation state of specific gene promoters have been reported in angiosperms during some developmental processes. We found large differences in the extent of DNA methylation between meristematic areas of juvenile and mature Pinus radiata D. Don. trees, whereas differences in the extent of DNA methylation between differentiated tissues of juvenile and mature trees were small. In meristematic areas, there was a gradual decrease in extent of DNA methylation as the degree of reinvigoration increased. The observed changes in extent of DNA methylation during aging and reinvigoration indicate that reinvigoration could be a consequence of epigenetic modifications opposite in direction to those that occur during aging.
McCarthy, David; Pulverer, Walter; Weinhaeusel, Andreas; Diago, Oscar R; Hogan, Daniel J; Ostertag, Derek; Hanna, Michelle M
2016-06-01
Development of a sensitive method for DNA methylation profiling and associated mutation detection in clinical samples. Formalin-fixed and paraffin-embedded tumors received by clinical laboratories often contain insufficient DNA for analysis with bisulfite or methylation sensitive restriction enzymes-based methods. To increase sensitivity, methyl-CpG DNA capture and Coupled Abscription PCR Signaling detection were combined in a new assay, MethylMeter(®). Gliomas were analyzed for MGMT methylation, glioma CpG island methylator phenotype and IDH1 R132H. MethylMeter had 100% assay success rate measuring all five biomarkers in formalin-fixed and paraffin-embedded tissue. MGMT methylation results were supported by survival and mRNA expression data. MethylMeter is a sensitive and quantitative method for multitarget DNA methylation profiling and associated mutation detection. The MethylMeter-based GliomaSTRAT assay measures methylation of four targets and one mutation to simultaneously grade gliomas and predict their response to temozolomide. This information is clinically valuable in management of gliomas.
Directory of Open Access Journals (Sweden)
Woonsu Kim
2018-01-01
Full Text Available Objective DNA methylation plays a major role in regulating the expression of genes related to traits of economic interest (e.g., weight gain in livestock animals. This study characterized and investigated the functional inferences of genome-wide DNA methylome in the loin (longissimus dorsi muscle (LDM of swine. Methods A total of 8.99 Gb methylated DNA immunoprecipitation sequence data were obtained from LDM samples of eight Duroc pigs (four pairs of littermates. The reference pig genome was annotated with 78.5% of the raw reads. A total of 33,506 putative methylated regions (PMR were identified from methylated regions that overlapped at least two samples. Results Of these, only 3.1% were commonly observed in all eight samples. DNA methylation patterns between two littermates were as diverse as between unrelated individuals (p = 0.47, indicating that maternal genetic effects have little influence on the variation in DNA methylation of porcine LDM. The highest density of PMR was observed on chromosome 10. A major proportion (47.7% of PMR was present in the repeat regions, followed by introns (21.5%. The highest conservation of PMR was found in CpG islands (12.1%. These results show an important role for DNA methylation in species- and tissue-specific regulation of gene expression. PMR were also significantly related to muscular cell development, cell-cell communication, cellular integrity and transport, and nutrient metabolism. Conclusion This study indicated the biased distribution and functional role of DNA methylation in gene expression of porcine LDM. DNA methylation was related to cell development, cell-cell communication, cellular integrity and transport, and nutrient metabolism (e.g., insulin signaling pathways. Nutritional and environmental management may have a significant impact on the variation in DNA methylation of porcine LDM.
Slc3a2 Mediates Branched-Chain Amino-Acid-Dependent Maintenance of Regulatory T Cells
Directory of Open Access Journals (Sweden)
Kayo Ikeda
2017-11-01
Full Text Available Summary: Foxp3+ regulatory T (Treg cells, which suppress immune responses, are highly proliferative in vivo. However, it remains unclear how the active replication of Treg cells is maintained in vivo. Here, we show that branched-chain amino acids (BCAAs, including isoleucine, are required for maintenance of the proliferative state of Treg cells via the amino acid transporter Slc3a2-dependent metabolic reprogramming. Mice fed BCAA-reduced diets showed decreased numbers of Foxp3+ Treg cells with defective in vivo proliferative capacity. Mice lacking Slc3a2 specifically in Foxp3+ Treg cells showed impaired in vivo replication and decreased numbers of Treg cells. Slc3a2-deficient Treg cells showed impaired isoleucine-induced activation of the mTORC1 pathway and an altered metabolic state. Slc3a2 mutant mice did not show an isoleucine-induced increase of Treg cells in vivo and exhibited multi-organ inflammation. Taken together, these findings demonstrate that BCAA controls Treg cell maintenance via Slc3a2-dependent metabolic regulation. : Treg cells regulate excess immune responses and are highly proliferative in vivo. Ikeda et al. find that branched-chain amino acids (BCAAs are essentially required to maintain expansion and the suppressive capacity of Treg cells via Slc3a2 and mTORC1. Keywords: Treg cells, amino acids, immunometabolism, immune regulation, transporter
Wang, Wensheng; Zhao, Xiuqin; Pan, Yajiao; Zhu, Linghua; Fu, Binying; Li, Zhikang
2011-09-20
DNA methylation, one of the most important epigenetic phenomena, plays a vital role in tuning gene expression during plant development as well as in response to environmental stimuli. In the present study, a methylation-sensitive amplified polymorphism (MSAP) analysis was performed to profile DNA methylation changes in two contrasting rice genotypes under salt stress. Consistent with visibly different phenotypes in response to salt stress, epigenetic markers classified as stable inter-cultivar DNA methylation differences were determined between salt-tolerant FL478 and salt-sensitive IR29. In addition, most tissue-specific DNA methylation loci were conserved, while many of the growth stage-dependent DNA methylation loci were dynamic between the two genotypes. Strikingly, salt stress induced a decrease in DNA methylation specifically in roots at the seedling stage that was more profound in IR29 than in the FL478. This result may indicate that demethylation of genes is an active epigenetic response to salt stress in roots at the seedling stage, and helps to further elucidate the implications of DNA methylation in crop growth and development. Copyright © 2011. Published by Elsevier Ltd.
Methylation changes of H19 gene in sperms of X-irradiated mouse and maintenance in offspring
International Nuclear Information System (INIS)
Zhu Bin; Huang Xinghua; Chen Jindong; Lu Yachao; Chen Ying; Zhao Jingyong
2006-01-01
The nature of imprinting is just differential methylation of imprinted genes. Unlike the non-imprinted genes, the methylation pattern of imprinted genes established during the period of gametogenesis remains unchangeable after fertilization and during embryo development. It implies that gametogenesis is the key stage for methylation pattern of imprinted genes. The imprinting interfered by exogenous factors during this stage could be inherited to offspring and cause genetic effect. Now many studies have proved that ionizing irradiation could disturb DNA methylation. Here we choose BALB/c mice as a research model and X-ray as interfering source to further clarify it. We discovered that the whole-body irradiation of X-ray to male BALB/c mice could influence the methylation pattern of H 19 gene in sperms, which resulted in some cytosines of partial CpG islands in the imprinting control region could not transform to methylated cytosines. Furthermore, by copulating the interfered male mice with normal female, we analyzed the promoter methylation pattern of H 19 in offspring fetal liver and compared the same to the pattern of male parent in sperms. We found that the majority of methylation changes in offspring liver were related to the ones in their parent sperms. Our data proved that the changes of the H 19 gene methylation pattern interfered by X-ray irradiation could be transmitted and maintained in First-generation offspring
Constitutional and somatic methylation status of DMRH19 and KvDMR in Wilms tumor patients
Directory of Open Access Journals (Sweden)
Leila C.A. Cardoso
2012-01-01
Full Text Available The most frequent epigenetic alterations in Wilms tumor (WT occur at WT2, assigned to 11p15. WT2 consists of two domains: telomeric domain 1 (DMRH19 that contains the IGF2 gene and an imprinted maternally expressed transcript (H19 and centromeric domain 2 (KvDMR that contains the genes KCNQ1, KCNQ1OT1 and CDKN1C. In this work, we used pyrosequencing and MS-MLPA to compare the methylation patterns of DMRH19/KvDMR in blood and tumor samples from 40 WT patients. Normal constitutional KvDMR methylation indicated that most of the epigenetic alterations in WT occur at DMRH19. Constitutional DMRH19 hypermethylation (HM DMRH19 was observed in two patients with Beckwith-Wiedemann syndrome. Pyrosequencing and MS-MLPA showed HM DMRH19 in 28/34 tumor samples: 16/34 with isolated HM DMRH19 and 12/34 with concomitant HM DMRH19 and KvDMR hypomethylation, indicating paternal uniparental disomy. With the exception of one blood sample, the MS-MLPA and pyrosequencing findings were concordant. Diffuse or focal anaplasia was present in five tumor samples and was associated with isolated somatic HM DMRH19 in four of them. Constitutional 11p15 methylation abnormalities were present in 5% of the samples and somatic abnormalities in the majority of tumors. Combined analysis of DMRH19/KvDMR by pyrosequencing and MS-MLPA is beneficial for characterizing epigenetic anomalies in WT, and MS-MLPA is useful and reliable for estimation of DNA methylation in a clinical setting.
Heterogeneity in white blood cells has potential to confound DNA methylation measurements.
Directory of Open Access Journals (Sweden)
Bjorn T Adalsteinsson
Full Text Available Epigenetic studies are commonly conducted on DNA from tissue samples. However, tissues are ensembles of cells that may each have their own epigenetic profile, and therefore inter-individual cellular heterogeneity may compromise these studies. Here, we explore the potential for such confounding on DNA methylation measurement outcomes when using DNA from whole blood. DNA methylation was measured using pyrosequencing-based methodology in whole blood (n = 50-179 and in two white blood cell fractions (n = 20, isolated using density gradient centrifugation, in four CGIs (CpG Islands located in genes HHEX (10 CpG sites assayed, KCNJ11 (8 CpGs, KCNQ1 (4 CpGs and PM20D1 (7 CpGs. Cellular heterogeneity (variation in proportional white blood cell counts of neutrophils, lymphocytes, monocytes, eosinophils and basophils, counted by an automated cell counter explained up to 40% (p<0.0001 of the inter-individual variation in whole blood DNA methylation levels in the HHEX CGI, but not a significant proportion of the variation in the other three CGIs tested. DNA methylation levels in the two cell fractions, polymorphonuclear and mononuclear cells, differed significantly in the HHEX CGI; specifically the average absolute difference ranged between 3.4-15.7 percentage points per CpG site. In the other three CGIs tested, methylation levels in the two fractions did not differ significantly, and/or the difference was more moderate. In the examined CGIs, methylation levels were highly correlated between cell fractions. In summary, our analysis detects region-specific differential DNA methylation between white blood cell subtypes, which can confound the outcome of whole blood DNA methylation measurements. Finally, by demonstrating the high correlation between methylation levels in cell fractions, our results suggest a possibility to use a proportional number of a single white blood cell type to correct for this confounding effect in analyses.
CaMV-35S promoter sequence-specific DNA methylation in lettuce.
Okumura, Azusa; Shimada, Asahi; Yamasaki, Satoshi; Horino, Takuya; Iwata, Yuji; Koizumi, Nozomu; Nishihara, Masahiro; Mishiba, Kei-ichiro
2016-01-01
We found 35S promoter sequence-specific DNA methylation in lettuce. Additionally, transgenic lettuce plants having a modified 35S promoter lost methylation, suggesting the modified sequence is subjected to the methylation machinery. We previously reported that cauliflower mosaic virus 35S promoter-specific DNA methylation in transgenic gentian (Gentiana triflora × G. scabra) plants occurs irrespective of the copy number and the genomic location of T-DNA, and causes strong gene silencing. To confirm whether 35S-specific methylation can occur in other plant species, transgenic lettuce (Lactuca sativa L.) plants with a single copy of the 35S promoter-driven sGFP gene were produced and analyzed. Among 10 lines of transgenic plants, 3, 4, and 3 lines showed strong, weak, and no expression of sGFP mRNA, respectively. Bisulfite genomic sequencing of the 35S promoter region showed hypermethylation at CpG and CpWpG (where W is A or T) sites in 9 of 10 lines. Gentian-type de novo methylation pattern, consisting of methylated cytosines at CpHpH (where H is A, C, or T) sites, was also observed in the transgenic lettuce lines, suggesting that lettuce and gentian share similar methylation machinery. Four of five transgenic lettuce lines having a single copy of a modified 35S promoter, which was modified in the proposed core target of de novo methylation in gentian, exhibited 35S hypomethylation, indicating that the modified sequence may be the target of the 35S-specific methylation machinery.
Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando
2014-11-28
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Sina, Abu Ali Ibn; Foster, Matthew Thomas; Korbie, Darren; Carrascosa, Laura G; Shiddiky, Muhammad J A; Gao, Jing; Dey, Shuvashis; Trau, Matt
2017-10-07
We report a new multiplexed strategy for the electrochemical detection of regional DNA methylation across multiple regions. Using the sequence dependent affinity of bisulfite treated DNA towards gold surfaces, the method integrates the high sensitivity of a micro-fabricated multiplex device comprising a microarray of gold electrodes, with the powerful multiplexing capability of multiplex-PCR. The synergy of this combination enables the monitoring of the methylation changes across several genomic regions simultaneously from as low as 500 pg μl -1 of DNA with no sequencing requirement.
Epigenetic regulation during fetal femur development: DNA methylation matters.
Directory of Open Access Journals (Sweden)
María C de Andrés
Full Text Available Epigenetic modifications are heritable changes in gene expression without changes in DNA sequence. DNA methylation has been implicated in the control of several cellular processes including differentiation, gene regulation, development, genomic imprinting and X-chromosome inactivation. Methylated cytosine residues at CpG dinucleotides are commonly associated with gene repression; conversely, strategic loss of methylation during development could lead to activation of lineage-specific genes. Evidence is emerging that bone development and growth are programmed; although, interestingly, bone is constantly remodelled throughout life. Using human embryonic stem cells, human fetal bone cells (HFBCs, adult chondrocytes and STRO-1(+ marrow stromal cells from human bone marrow, we have examined a spectrum of developmental stages of femur development and the role of DNA methylation therein. Using pyrosequencing methodology we analysed the status of methylation of genes implicated in bone biology; furthermore, we correlated these methylation levels with gene expression levels using qRT-PCR and protein distribution during fetal development evaluated using immunohistochemistry. We found that during fetal femur development DNA methylation inversely correlates with expression of genes including iNOS (NOS2 and COL9A1, but not catabolic genes including MMP13 and IL1B. Furthermore, significant demethylation was evident in the osteocalcin promoter between the fetal and adult developmental stages. Increased TET1 expression and decreased expression of DNA (cytosine-5--methyltransferase 1 (DNMT1 in adult chondrocytes compared to HFBCs could contribute to the loss of methylation observed during fetal development. HFBC multipotency confirms these cells to be an ideal developmental system for investigation of DNA methylation regulation. In conclusion, these findings demonstrate the role of epigenetic regulation, specifically DNA methylation, in bone development
Genome-Wide DNA Methylation Profiles of Phlegm-Dampness Constitution
Directory of Open Access Journals (Sweden)
Haiqiang Yao
2018-03-01
Full Text Available Background/Aims: Metabolic diseases are leading health concerns in today’s global society. In traditional Chinese medicine (TCM, one body type studied is the phlegm-dampness constitution (PC, which predisposes individuals to complex metabolic disorders. Genomic studies have revealed the potential metabolic disorders and the molecular features of PC. The role of epigenetics in the regulation of PC, however, is unknown. Methods: We analyzed a genome-wide DNA methylation in 12 volunteers using Illumina Infinium Human Methylation450 BeadChip on peripheral blood mononuclear cells (PBMCs. Eight volunteers had PC and 4 had balanced constitutions. Results: Methylation data indicated a genome-scale hyper-methylation pattern in PC. We located 288 differentially methylated probes (DMPs. A total of 256 genes were mapped, and some of these were metabolic-related. SQSTM1, DLGAP2 and DAB1 indicated diabetes mellitus; HOXC4 and SMPD3, obesity; and GRWD1 and ATP10A, insulin resistance. According to Ingenuity Pathway Analysis (IPA, differentially methylated genes were abundant in multiple metabolic pathways. Conclusion: Our results suggest the potential risk for metabolic disorders in individuals with PC. We also explain the clinical characteristics of PC with DNA methylation features.
Shen, M L; He, Z N; Zhang, X; Duan, H W; Niu, Y; Bin, P; Ye, M; Meng, T; Dai, Y F; Yu, S F; Chen, W; Zheng, Y X
2017-06-06
Objective: To investigate the association between etheno-DNA adduct and the promoter of DNA methylation levels of cyclin dependent kinase inhibitor 2A (P16), Ras association domain family 1 (RASSF1A) and O-6-methylguanine-DNA methyltransferase (MGMT) in workers with occupational exposure to diesel engine exhaust (DEE). Methods: We recruited 124 diesel engine testing workers as DEE exposure group and 112 water pump operator in the same area as control group in Henan province in 2012 using cluster sampling. The demographic data were obtained by questionnaire survey; urine after work and venous blood samples were collected from each subject. The urinary etheno-DNA adducts were detected using UPLC-MS/MS, including 1,N6-etheno-2'-deoxyadenosine (εdA) and 3,N4-etheno-2'-deoxycytidine(εdC). The DNA methylation levels of P16, RASSF1A, and MGMT were evaluated using bisulfite-pyrosequencing assay. The percentage of methylation was expressed as the 5-methylcytosine (5mC) over the sum of cytosines (%5mC). Spearman correlation and multiple linear regression were applied to analyze the association between etheno-DNA adducts and DNA methylation of P16, RASSF1A, and MGMT. Results: The median ( P (25)- P (75)) of urinary εdA level was 230.00 (98.04-470.91) pmol/g creatinine in DEE exposure group, and 102.10 (49.95-194.48) creatinine in control group. The level of εdA was higher in DEE exposure group than control group ( P 0.05) . Multiple linear regression confirmed the negative correlation between εdA and DNA methylation levels of P16, RASSF1A, and MGMT in non-smoking group (β (95 %CI ) was -0.068 (-0.132--0.003), -0.082 (-0.159--0.004) and -0.048 (-0.090--0.007), P values were 0.039, 0.039 and 0.024, respectively). Moreover, εdC was negative associated with DNA methylation level of MGMT in non-smoking group (β (95 %CI ) was -0.094 (-0.179--0.008), P= 0.032). Conclusion: DEE exposure could induce the increased of εdA and decreased of DNA methylation levels of P16, RASSF1A
Kotnik, Barbara Faganel; Jazbec, Janez; Grabar, Petra Bohanec; Rodriguez-Antona, Cristina
2017-01-01
Abstract Background We investigated the clinical relevance of SLC 19A1 genetic variability for high dose methotrexate (HD-MTX) related toxicities in children and adolescents with acute lymphoblastic leukaemia (ALL) and non Hodgkin malignant lymphoma (NHML). Patients and methods Eighty-eight children and adolescents with ALL/NHML were investigated for the influence of SLC 19A1 single nucleotide polymorphisms (SNPs) and haplotypes on HD-MTX induced toxicities. Results Patients with rs2838958 TT genotype had higher probability for mucositis development as compared to carriers of at least one rs2838958 C allele (OR 0.226 (0.071–0.725), p < 0.009). Haplotype TGTTCCG (H4) statistically significantly reduced the risk for the occurrence of adverse events during treatment with HD-MTX (OR 0.143 (0.023–0.852), p = 0.030). Conclusions SLC 19A1 SNP and haplotype analysis could provide additional information in a personalized HD-MTX therapy for children with ALL/NHML in order to achieve better treatment outcome. However further studies are needed to validate the results. PMID:29333125
The role of cytosine methylation on charge transport through a DNA strand
Energy Technology Data Exchange (ETDEWEB)
Qi, Jianqing, E-mail: jqqi@uw.edu; Anantram, M. P., E-mail: anantmp@uw.edu [Department of Electrical Engineering, University of Washington, Seattle, Washington 98195-2500 (United States); Govind, Niranjan, E-mail: niri.govind@pnnl.gov [William R. Wiley Environmental Molecular Sciences Laboratory, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)
2015-09-07
Cytosine methylation has been found to play a crucial role in various biological processes, including a number of human diseases. The detection of this small modification remains challenging. In this work, we computationally explore the possibility of detecting methylated DNA strands through direct electrical conductance measurements. Using density functional theory and the Landauer-Büttiker method, we study the electronic properties and charge transport through an eight base-pair methylated DNA strand and its native counterpart. We first analyze the effect of cytosine methylation on the tight-binding parameters of two DNA strands and then model the transmission of the electrons and conductance through the strands both with and without decoherence. We find that the main difference of the tight-binding parameters between the native DNA and the methylated DNA lies in the on-site energies of (methylated) cytosine bases. The intra- and inter-strand hopping integrals between two nearest neighboring guanine base and (methylated) cytosine base also change with the addition of the methyl groups. Our calculations show that in the phase-coherent limit, the transmission of the methylated strand is close to the native strand when the energy is nearby the highest occupied molecular orbital level and larger than the native strand by 5 times in the bandgap. The trend in transmission also holds in the presence of the decoherence with the same rate. The lower conductance for the methylated strand in the experiment is suggested to be caused by the more stable structure due to the introduction of the methyl groups. We also study the role of the exchange-correlation functional and the effect of contact coupling by choosing coupling strengths ranging from weak to strong coupling limit.
Information Thermodynamics of Cytosine DNA Methylation.
Directory of Open Access Journals (Sweden)
Robersy Sanchez
Full Text Available Cytosine DNA methylation (CDM is a stable epigenetic modification to the genome and a widespread regulatory process in living organisms that involves multicomponent molecular machines. Genome-wide cytosine methylation patterning participates in the epigenetic reprogramming of a cell, suggesting that the biological information contained within methylation positions may be amenable to decoding. Adaptation to a new cellular or organismal environment also implies the potential for genome-wide redistribution of CDM changes that will ensure the stability of DNA molecules. This raises the question of whether or not we would be able to sort out the regulatory methylation signals from the CDM background ("noise" induced by thermal fluctuations. Here, we propose a novel statistical and information thermodynamic description of the CDM changes to address the last question. The physical basis of our statistical mechanical model was evaluated in two respects: 1 the adherence to Landauer's principle, according to which molecular machines must dissipate a minimum energy ε = kBT ln2 at each logic operation, where kB is the Boltzmann constant, and T is the absolute temperature and 2 whether or not the binary stretch of methylation marks on the DNA molecule comprise a language of sorts, properly constrained by thermodynamic principles. The study was performed for genome-wide methylation data from 152 ecotypes and 40 trans-generational variations of Arabidopsis thaliana and 93 human tissues. The DNA persistence length, a basic mechanical property altered by CDM, was estimated with values from 39 to 66.9 nm. Classical methylome analysis can be retrieved by applying information thermodynamic modelling, which is able to discriminate signal from noise. Our finding suggests that the CDM signal comprises a language scheme properly constrained by molecular thermodynamic principles, which is part of an epigenomic communication system that obeys the same thermodynamic
Directory of Open Access Journals (Sweden)
Robinson Claire M
2012-08-01
Full Text Available Abstract Background Pulmonary fibrosis is a debilitating and lethal disease with no effective treatment options. Understanding the pathological processes at play will direct the application of novel therapeutic avenues. Hypoxia has been implicated in the pathogenesis of pulmonary fibrosis yet the precise mechanism by which it contributes to disease progression remains to be fully elucidated. It has been shown that chronic hypoxia can alter DNA methylation patterns in tumour-derived cell lines. This epigenetic alteration can induce changes in cellular phenotype with promoter methylation being associated with gene silencing. Of particular relevance to idiopathic pulmonary fibrosis (IPF is the observation that Thy-1 promoter methylation is associated with a myofibroblast phenotype where loss of Thy-1 occurs alongside increased alpha smooth muscle actin (α-SMA expression. The initial aim of this study was to determine whether hypoxia regulates DNA methylation in normal human lung fibroblasts (CCD19Lu. As it has been reported that hypoxia suppresses Thy-1 expression during lung development we also studied the effect of hypoxia on Thy-1 promoter methylation and gene expression. Methods CCD19Lu were grown for up to 8 days in hypoxia and assessed for global changes in DNA methylation using flow cytometry. Real-time PCR was used to quantify expression of Thy-1, α-SMA, collagen I and III. Genomic DNA was bisulphite treated and methylation specific PCR (MSPCR was used to examine the methylation status of the Thy-1 promoter. Results Significant global hypermethylation was detected in hypoxic fibroblasts relative to normoxic controls and was accompanied by increased expression of myofibroblast markers. Thy-1 mRNA expression was suppressed in hypoxic cells, which was restored with the demethylating agent 5-aza-2′-deoxycytidine. MSPCR revealed that Thy-1 became methylated following fibroblast exposure to 1% O2. Conclusion These data suggest that global and
Evaluating genome-wide DNA methylation changes in mice by Methylation Specific Digital Karyotyping
Directory of Open Access Journals (Sweden)
Maruoka Shuichiro
2008-12-01
Full Text Available Abstract Background The study of genome-wide DNA methylation changes has become more accessible with the development of various array-based technologies though when studying species other than human the choice of applications are limited and not always within reach. In this study, we adapted and tested the applicability of Methylation Specific Digital Karyotyping (MSDK, a non-array based method, for the prospective analysis of epigenetic changes after perinatal nutritional modifications in a mouse model of allergic airway disease. MSDK is a sequenced based method that allows a comprehensive and unbiased methylation profiling. The method generates 21 base pairs long sequence tags derived from specific locations in the genome. The resulting tag frequencies determine in a quantitative manner the methylation level of the corresponding loci. Results Genomic DNA from whole lung was isolated and subjected to MSDK analysis using the methylation-sensitive enzyme Not I as the mapping enzyme and Nla III as the fragmenting enzyme. In a pair wise comparison of the generated mouse MSDK libraries we identified 158 loci that are significantly differentially methylated (P-value = 0.05 after perinatal dietary changes in our mouse model. Quantitative methylation specific PCR and sequence analysis of bisulfate modified genomic DNA confirmed changes in methylation at specific loci. Differences in genomic MSDK tag counts for a selected set of genes, correlated well with changes in transcription levels as measured by real-time PCR. Furthermore serial analysis of gene expression profiling demonstrated a dramatic difference in expressed transcripts in mice exposed to perinatal nutritional changes. Conclusion The genome-wide methylation survey applied in this study allowed for an unbiased methylation profiling revealing subtle changes in DNA methylation in mice maternally exposed to dietary changes in methyl-donor content. The MSDK method is applicable for mouse models
Effect of DNA methylation profile on OATP3A1 and OATP4A1 transcript levels in colorectal cancer.
Rawłuszko-Wieczorek, Agnieszka Anna; Horst, Nikodem; Horbacka, Karolina; Bandura, Artur Szymon; Świderska, Monika; Krokowicz, Piotr; Jagodziński, Paweł Piotr
2015-08-01
Epidemiological studies indicate that 17β-estradiol (E2) prevents colorectal cancer (CRC). Organic anion transporting polypeptides (OATPs) are involved in the cellular uptake of various endogenous and exogenous substrates, including hormone conjugates. Because transfer of estrone sulfate (E1-S) can contribute to intra-tissue conversion of estrone to the biologically active form -E2, it is evident that the expression patterns of OATPs may be relevant to the analysis of CRC incidence and therapy. We therefore evaluated DNA methylation and transcript levels of two members of the OATP family, OATP3A1 and OATP4A1, that may be involved in E1-S transport in colorectal cancer patients. We detected a significant reduction in OATP3A1 and a significant increase in OATP4A1 mRNA levels in cancerous tissue, compared with histopathologically unchanged tissue (n=103). Moreover, we observed DNA hypermethylation in the OATP3A1 promoter region in a small subset of CRC patients and in HCT116 and Caco-2 colorectal cancer cell lines. We also observed increased OATP3A1 transcript following treatment with 5-aza-2-deoxycytidine and sodium butyrate. The OATP4A1 promoter region was hypomethylated in analyzed tissues and CRC cell lines and was not affected by these treatments. Our results suggest a potential mechanism for OATP3A1 downregulation that involves DNA methylation during colorectal carcinogenesis. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Genome-wide DNA methylation analysis in jejunum of Sus scrofa with intrauterine growth restriction.
Hu, Yue; Hu, Liang; Gong, Desheng; Lu, Hanlin; Xuan, Yue; Wang, Ru; Wu, De; Chen, Daiwen; Zhang, Keying; Gao, Fei; Che, Lianqiang
2018-02-01
Intrauterine growth restriction (IUGR) may elicit a series of postnatal body developmental and metabolic diseases due to their impaired growth and development in the mammalian embryo/fetus during pregnancy. In the present study, we hypothesized that IUGR may lead to abnormally regulated DNA methylation in the intestine, causing intestinal dysfunctions. We applied reduced representation bisulfite sequencing (RRBS) technology to study the jejunum tissues from four newborn IUGR piglets and their normal body weight (NBW) littermates. The results revealed extensively regional DNA methylation changes between IUGR/NBW pairs from different gilts, affecting dozens of genes. Hiseq-based bisulfite sequencing PCR (Hiseq-BSP) was used for validations of 19 genes with epigenetic abnormality, confirming three genes (AIFM1, MTMR1, and TWIST2) in extra samples. Furthermore, integrated analysis of these 19 genes with proteome data indicated that there were three main genes (BCAP31, IRAK1, and AIFM1) interacting with important immunity- or metabolism-related proteins, which could explain the potential intestinal dysfunctions of IUGR piglets. We conclude that IUGR can lead to disparate DNA methylation in the intestine and these changes may affect several important biological processes such as cell apoptosis, cell differentiation, and immunity, which provides more clues linking IUGR and its long-term complications.
Forensic DNA methylation profiling from evidence material for investigative leads
Lee, Hwan Young; Lee, Soong Deok; Shin, Kyoung-Jin
2016-01-01
DNA methylation is emerging as an attractive marker providing investigative leads to solve crimes in forensic genetics. The identification of body fluids that utilizes tissue-specific DNA methylation can contribute to solving crimes by predicting activity related to the evidence material. The age estimation based on DNA methylation is expected to reduce the number of potential suspects, when the DNA profile from the evidence does not match with any known person, including those stored in the forensic database. Moreover, the variation in DNA implicates environmental exposure, such as cigarette smoking and alcohol consumption, thereby suggesting the possibility to be used as a marker for predicting the lifestyle of potential suspect. In this review, we describe recent advances in our understanding of DNA methylation variations and the utility of DNA methylation as a forensic marker for advanced investigative leads from evidence materials. [BMB Reports 2016; 49(7): 359-369] PMID:27099236
Ma, Tiangang; Qu, Danhua; Yan, Bingdi; Zhang, Qinghua; Ren, Jin; Hu, Yanbing
2018-01-01
A mutation in the IIb sodium phosphate transporter SLC34A2 gene has recently been described in pulmonary alveolar microlithiasis (PAM) patients. Experiments in this study were aimed at confirming the role of the gene product in PAM by comparing phosphorylated products in extracellular fluid of alveolar epithelial cells overexpressing the SLC34A2 gene or its mutated version. Eukaryotic expression vectors were constructed and transfected into A549 human alveolar epithelial cells. There were three groups of cells including those transfected with empty vector plasmid pcDNA3.1(+) (plasmid control group), those transfected with normal SLC34A2 gene expressed from pcDNA3.1 (normal control group), and those transfected with a version of the PAM SLC34A2 gene linked to the pcDNA3.1(+) (PAM group). Transfection efficiencies were detected by reverse transcription-polymerase chain reaction (RT-PCR). At 48 h after transfection, the concentration of inorganic phosphorus in the culture medium was detected using an automatic biochemical analyzer. Our results showed the concentration of inorganic phosphorus in the supernatant of the normal control group was significantly lower than that in the plasmid control and PAM groups (PPAM group was significantly lower than that in the plasmid control group (PPAM patients, given that the function of the phosphate transporter seems to be affected and it is conceivable that it would lead to extracellular fluid alterations in vivo .
De novo DNA methylation during monkey pre-implantation embryogenesis.
Gao, Fei; Niu, Yuyu; Sun, Yi Eve; Lu, Hanlin; Chen, Yongchang; Li, Siguang; Kang, Yu; Luo, Yuping; Si, Chenyang; Yu, Juehua; Li, Chang; Sun, Nianqin; Si, Wei; Wang, Hong; Ji, Weizhi; Tan, Tao
2017-04-01
Critical epigenetic regulation of primate embryogenesis entails DNA methylome changes. Here we report genome-wide composition, patterning, and stage-specific dynamics of DNA methylation in pre-implantation rhesus monkey embryos as well as male and female gametes studied using an optimized tagmentation-based whole-genome bisulfite sequencing method. We show that upon fertilization, both paternal and maternal genomes undergo active DNA demethylation, and genome-wide de novo DNA methylation is also initiated in the same period. By the 8-cell stage, remethylation becomes more pronounced than demethylation, resulting in an increase in global DNA methylation. Promoters of genes associated with oxidative phosphorylation are preferentially remethylated at the 8-cell stage, suggesting that this mode of energy metabolism may not be favored. Unlike in rodents, X chromosome inactivation is not observed during monkey pre-implantation development. Our study provides the first comprehensive illustration of the 'wax and wane' phases of DNA methylation dynamics. Most importantly, our DNA methyltransferase loss-of-function analysis indicates that DNA methylation influences early monkey embryogenesis.
Diagnostic markers of urothelial cancer based on DNA methylation analysis
International Nuclear Information System (INIS)
Chihara, Yoshitomo; Hirao, Yoshihiko; Kanai, Yae; Fujimoto, Hiroyuki; Sugano, Kokichi; Kawashima, Kiyotaka; Liang, Gangning; Jones, Peter A; Fujimoto, Kiyohide; Kuniyasu, Hiroki
2013-01-01
Early detection and risk assessment are crucial for treating urothelial cancer (UC), which is characterized by a high recurrence rate, and necessitates frequent and invasive monitoring. We aimed to establish diagnostic markers for UC based on DNA methylation. In this multi-center study, three independent sample sets were prepared. First, DNA methylation levels at CpG loci were measured in the training sets (tumor samples from 91 UC patients, corresponding normal-appearing tissue from these patients, and 12 normal tissues from age-matched bladder cancer-free patients) using the Illumina Golden Gate methylation assay to identify differentially methylated loci. Next, these methylated loci were validated by quantitative DNA methylation by pyrosequencing, using another cohort of tissue samples (Tissue validation set). Lastly, methylation of these markers was analyzed in the independent urine samples (Urine validation set). ROC analysis was performed to evaluate the diagnostic accuracy of these 12 selected markers. Of the 1303 CpG sites, 158 were hyper ethylated and 356 were hypo ethylated in tumor tissues compared to normal tissues. In the panel analysis, 12 loci showed remarkable alterations between tumor and normal samples, with 94.3% sensitivity and 97.8% specificity. Similarly, corresponding normal tissue could be distinguished from normal tissues with 76.0% sensitivity and 100% specificity. Furthermore, the diagnostic accuracy for UC of these markers determined in urine samples was high, with 100% sensitivity and 100% specificity. Based on these preliminary findings, diagnostic markers based on differential DNA methylation at specific loci can be useful for non-invasive and reliable detection of UC and epigenetic field defect
RNA-directed DNA methylation: Mechanisms and functions
Mahfouz, Magdy M.
2010-07-01
Epigenetic RNA based gene silencing mechanisms play a major role in genome stability and control of gene expression. Transcriptional gene silencing via RNA-directed DNA methylation (RdDM) guides the epigenetic regulation of the genome in response to disease states, growth, developmental and stress signals. RdDM machinery is composed of proteins that produce and modify 24-nt- long siRNAs, recruit the RdDM complex to genomic targets, methylate DNA and remodel chromatin. The final DNA methylation pattern is determined by either DNA methyltransferase alone or by the combined action of DNA methyltransferases and demethylases. The dynamic interaction between RdDM and demethylases may render the plant epigenome plastic to growth, developmental, and environmental cues. The epigenome plasticity may allow the plant genome to assume many epigenomes and to have the right epigenome at the right time in response to intracellular or extracellular stimuli. This review discusses recent advances in RdDM research and considers future perspectives.
Heterogeneity of DNA methylation in multifocal prostate cancer.
Serenaite, Inga; Daniunaite, Kristina; Jankevicius, Feliksas; Laurinavicius, Arvydas; Petroska, Donatas; Lazutka, Juozas R; Jarmalaite, Sonata
2015-01-01
Most prostate cancer (PCa) cases are multifocal, and separate foci display histological and molecular heterogeneity. DNA hypermethylation is a frequent alteration in PCa, but interfocal heterogeneity of these changes has not been extensively investigated. Ten pairs of foci from multifocal PCa and 15 benign prostatic hyperplasia (BPH) samples were obtained from prostatectomy specimens, resulting altogether in 35 samples. Methylation-specific PCR (MSP) was used to evaluate methylation status of nine tumor suppressor genes (TSGs), and a set of selected TSGs was quantitatively analyzed for methylation intensity by pyrosequencing. Promoter sequences of the RASSF1 and ESR1 genes were methylated in all paired PCa foci, and frequent (≥75 %) DNA methylation was detected in RARB, GSTP1, and ABCB1 genes. MSP revealed different methylation status of at least one gene in separate foci in 8 out of 10 multifocal tumors. The mean methylation level of ESR1, GSTP1, RASSF1, and RARB differed between the paired foci of all PCa cases. The intensity of DNA methylation in these TSGs was significantly higher in PCa cases than in BPH (p epigenetic profile of recurrent tumors can be inferred from our data.
High-resolution analysis of cytosine methylation in ancient DNA.
Directory of Open Access Journals (Sweden)
Bastien Llamas
Full Text Available Epigenetic changes to gene expression can result in heritable phenotypic characteristics that are not encoded in the DNA itself, but rather by biochemical modifications to the DNA or associated chromatin proteins. Interposed between genes and environment, these epigenetic modifications can be influenced by environmental factors to affect phenotype for multiple generations. This raises the possibility that epigenetic states provide a substrate for natural selection, with the potential to participate in the rapid adaptation of species to changes in environment. Any direct test of this hypothesis would require the ability to measure epigenetic states over evolutionary timescales. Here we describe the first single-base resolution of cytosine methylation patterns in an ancient mammalian genome, by bisulphite allelic sequencing of loci from late Pleistocene Bison priscus remains. Retrotransposons and the differentially methylated regions of imprinted loci displayed methylation patterns identical to those derived from fresh bovine tissue, indicating that methylation patterns are preserved in the ancient DNA. Our findings establish the biochemical stability of methylated cytosines over extensive time frames, and provide the first direct evidence that cytosine methylation patterns are retained in DNA from ancient specimens. The ability to resolve cytosine methylation in ancient DNA provides a powerful means to study the role of epigenetics in evolution.
Genome-Wide Expression of MicroRNAs Is Regulated by DNA Methylation in Hepatocarcinogenesis
Directory of Open Access Journals (Sweden)
Jing Shen
2015-01-01
Full Text Available Background. Previous studies, including ours, have examined the regulation of microRNAs (miRNAs by DNA methylation, but whether this regulation occurs at a genome-wide level in hepatocellular carcinoma (HCC is unclear. Subjects/Methods. Using a two-phase study design, we conducted genome-wide screening for DNA methylation and miRNA expression to explore the potential role of methylation alterations in miRNAs regulation. Results. We found that expressions of 25 miRNAs were statistically significantly different between tumor and nontumor tissues and perfectly differentiated HCC tumor from nontumor. Six miRNAs were overexpressed, and 19 were repressed in tumors. Among 133 miRNAs with inverse correlations between methylation and expression, 8 miRNAs (6% showed statistically significant differences in expression between tumor and nontumor tissues. Six miRNAs were validated in 56 additional paired HCC tissues, and significant inverse correlations were observed for miR-125b and miR-199a, which is consistent with the inactive chromatin pattern found in HepG2 cells. Conclusion. These data suggest that the expressions of miR-125b and miR-199a are dramatically regulated by DNA hypermethylation that plays a key role in hepatocarcinogenesis.
Transcription and chromatin determinants of de novo DNA methylation timing in oocytes.
Gahurova, Lenka; Tomizawa, Shin-Ichi; Smallwood, Sébastien A; Stewart-Morgan, Kathleen R; Saadeh, Heba; Kim, Jeesun; Andrews, Simon R; Chen, Taiping; Kelsey, Gavin
2017-01-01
Gametogenesis in mammals entails profound re-patterning of the epigenome. In the female germline, DNA methylation is acquired late in oogenesis from an essentially unmethylated baseline and is established largely as a consequence of transcription events. Molecular and functional studies have shown that imprinted genes become methylated at different times during oocyte growth; however, little is known about the kinetics of methylation gain genome wide and the reasons for asynchrony in methylation at imprinted loci. Given the predominant role of transcription, we sought to investigate whether transcription timing is rate limiting for de novo methylation and determines the asynchrony of methylation events. Therefore, we generated genome-wide methylation and transcriptome maps of size-selected, growing oocytes to capture the onset and progression of methylation. We find that most sequence elements, including most classes of transposable elements, acquire methylation at similar rates overall. However, methylation of CpG islands (CGIs) is delayed compared with the genome average and there are reproducible differences amongst CGIs in onset of methylation. Although more highly transcribed genes acquire methylation earlier, the major transitions in the oocyte transcriptome occur well before the de novo methylation phase, indicating that transcription is generally not rate limiting in conferring permissiveness to DNA methylation. Instead, CGI methylation timing negatively correlates with enrichment for histone 3 lysine 4 (H3K4) methylation and dependence on the H3K4 demethylases KDM1A and KDM1B, implicating chromatin remodelling as a major determinant of methylation timing. We also identified differential enrichment of transcription factor binding motifs in CGIs acquiring methylation early or late in oocyte growth. By combining these parameters into multiple regression models, we were able to account for about a fifth of the variation in methylation timing of CGIs. Finally
Deletion of Slc26a1 and Slc26a7 Delays Enamel Mineralization in Mice
Directory of Open Access Journals (Sweden)
Kaifeng Yin
2017-05-01
Full Text Available Amelogenesis features two major developmental stages—secretory and maturation. During maturation stage, hydroxyapatite deposition and matrix turnover require delicate pH regulatory mechanisms mediated by multiple ion transporters. Several members of the Slc26 gene family (Slc26a1, Slc26a3, Slc26a4, Slc26a6, and Slc26a7, which exhibit bicarbonate transport activities, have been suggested by previous studies to be involved in maturation-stage amelogenesis, especially the key process of pH regulation. However, details regarding the functional role of these genes in enamel formation are yet to be clarified, as none of the separate mutant animal lines demonstrates any discernible enamel defects. Continuing with our previous investigation of Slc26a1−/− and Slc26a7−/− animal models, we generated a double-mutant animal line with the absence of both Slc26a1 and Slc26a7. We showed in the present study that the double-mutant enamel density was significantly lower in the regions that represent late maturation-, maturation- and secretory-stage enamel development in wild-type mandibular incisors. However, the “maturation” and “secretory” enamel microstructures in double-mutant animals resembled those observed in wild-type secretory and/or pre-secretory stages. Elemental composition analysis revealed a lack of mineral deposition and an accumulation of carbon and chloride in double-mutant enamel. Deletion of Slc26a1 and Slc26a7 did not affect the stage-specific morphology of the enamel organ. Finally, compensatory expression of pH regulator genes and ion transporters was detected in maturation-stage enamel organs of double-mutant animals when compared to wild-type. Combined with the findings from our previous study, these data indicate the involvement of SLC26A1and SLC26A7 as key ion transporters in the pH regulatory network during enamel maturation.
Maréchal, Alexandre; Li, Ju-Mei; Ji, Xiao Ye; Wu, Ching-Shyi; Yazinski, Stephanie A; Nguyen, Hai Dang; Liu, Shizhou; Jiménez, Amanda E; Jin, Jianping; Zou, Lee
2014-01-23
PRP19 is a ubiquitin ligase involved in pre-mRNA splicing and the DNA damage response (DDR). Although the role for PRP19 in splicing is well characterized, its role in the DDR remains elusive. Through a proteomic screen for proteins that interact with RPA-coated single-stranded DNA (RPA-ssDNA), we identified PRP19 as a sensor of DNA damage. PRP19 directly binds RPA and localizes to DNA damage sites via RPA, promoting RPA ubiquitylation in a DNA-damage-induced manner. PRP19 facilitates the accumulation of ATRIP, the regulatory partner of the ataxia telangiectasia mutated and Rad3-related (ATR) kinase, at DNA damage sites. Depletion of PRP19 compromised the phosphorylation of ATR substrates, recovery of stalled replication forks, and progression of replication forks on damaged DNA. Importantly, PRP19 mutants that cannot bind RPA or function as an E3 ligase failed to support the ATR response, revealing that PRP19 drives ATR activation by acting as an RPA-ssDNA-sensing ubiquitin ligase during the DDR. Copyright © 2014 Elsevier Inc. All rights reserved.
Zheng, Zhimin
2010-01-06
RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.
Zinellu, Angelo; Sotgiu, Elisabetta; Fois, Alessandro G; Zinellu, Elisabetta; Sotgia, Salvatore; Ena, Sara; Mangoni, Arduino A; Carru, Ciriaco; Pirina, Pietro
2017-10-01
Alterations in global DNA methylation have been associated with oxidative stress (OS). Since chronic obstructive pulmonary disease (COPD) is characterized by increased oxidative stress we aimed to evaluate the levels of global DNA methylation in this patient group. We assessed methylcytosine (mCyt) levels in DNA from blood collected in 43 COPD patients (29 with mild and 14 with moderate disease) and 43 age- and sex-matched healthy controls. DNA methylation was significantly lower in COPD patients vs. controls (4.20 ± 0.18% mCyt vs. 4.29 ± 0.18% mCyt, p = 0.02). Furthermore, DNA methylation in COPD patients with moderate disease was significantly lower than that in patients with mild disease (4.14 ± 0.15% mCyt vs. 4.23 ± 0.19% mCyt, p COPD (crude OR = 0.06, 95% CI 0.00 to 0.67, p = 0.023). This relationship remained significant after adjusting for several confounders (OR 0.03, 95% CI 0.00 to 0.67; p = 0.028). Receiver operating characteristics (ROC) curve analysis demonstrated the area under the curve of mCyt was 0.646, with 46.6% sensitivity and 79.1% specificity for presence of COPD. There were no significant correlations between methylation and OS indices. The presence and severity of COPD is associated with progressively lower DNA methylation in blood. However, this epigenetic alteration seems independent of oxidative stress. Copyright © 2017 Elsevier Ltd. All rights reserved.
Hydroxylation of methylated DNA by TET1 in chondrocyte differentiation of C3H10T1/2 cells
Directory of Open Access Journals (Sweden)
Ryo Ito
2016-03-01
Full Text Available DNA methylation is closely involved in the regulation of cellular differentiation, including chondrogenic differentiation of mesenchymal stem cells. Recent studies showed that Ten–eleven translocation (TET family proteins converted 5-methylcytosine (5mC to 5-hydroxymethylcytosine, 5-formylcytosine and 5carboxylcytosine by oxidation. These reactions constitute potential mechanisms for active demethylation of methylated DNA. However, the relationship between the DNA methylation patterns and the effects of TET family proteins in chondrocyte differentiation is still unclear. In this study, we showed that DNA hydroxylation of 5mC was increased during chondrocytic differentiation of C3H10T1/2 cells and that the expression of Tet1 was particularly enhanced. Moreover, knockdown experiments revealed that the downregulation of Tet1 expression caused decreases in chondrogenesis markers such as type 2 and type 10 collagens. Furthermore, we found that TET proteins had a site preference for hydroxylation of 5mC on the Insulin-like growth factor 1 (Igf1 promoter in chondrocytes. Taken together, we showed that the expression of Tet1 was specifically facilitated in chondrocyte differentiation and Tet1 can regulate chondrocyte marker gene expression presumably through its hydroxylation activity for DNA.
The evolution of CHROMOMETHYLASES and gene body DNA methylation in plants.
Bewick, Adam J; Niederhuth, Chad E; Ji, Lexiang; Rohr, Nicholas A; Griffin, Patrick T; Leebens-Mack, Jim; Schmitz, Robert J
2017-05-01
The evolution of gene body methylation (gbM), its origins, and its functional consequences are poorly understood. By pairing the largest collection of transcriptomes (>1000) and methylomes (77) across Viridiplantae, we provide novel insights into the evolution of gbM and its relationship to CHROMOMETHYLASE (CMT) proteins. CMTs are evolutionary conserved DNA methyltransferases in Viridiplantae. Duplication events gave rise to what are now referred to as CMT1, 2 and 3. Independent losses of CMT1, 2, and 3 in eudicots, CMT2 and ZMET in monocots and monocots/commelinids, variation in copy number, and non-neutral evolution suggests overlapping or fluid functional evolution of this gene family. DNA methylation within genes is widespread and is found in all major taxonomic groups of Viridiplantae investigated. Genes enriched with methylated CGs (mCG) were also identified in species sister to angiosperms. The proportion of genes and DNA methylation patterns associated with gbM are restricted to angiosperms with a functional CMT3 or ortholog. However, mCG-enriched genes in the gymnosperm Pinus taeda shared some similarities with gbM genes in Amborella trichopoda. Additionally, gymnosperms and ferns share a CMT homolog closely related to CMT2 and 3. Hence, the dependency of gbM on a CMT most likely extends to all angiosperms and possibly gymnosperms and ferns. The resulting gene family phylogeny of CMT transcripts from the most diverse sampling of plants to date redefines our understanding of CMT evolution and its evolutionary consequences on DNA methylation. Future, functional tests of homologous and paralogous CMTs will uncover novel roles and consequences to the epigenome.
Lu, Z Z; Yan, L; Zhang, H; Li, M J; Zhang, X H; Zhao, X X
2016-06-23
To investigate the effect and mechanism of mifepristone on the migration of human endometrial carcinoma cells. A human endometrial carcinoma cell line, Ishikawa cells, was cultured in vitro and treated with mifepristone at different concentrations. Wound healing assay was applied to detect the migration of Ishikawa cells. RT-PCR and methylation-specific PCR (MSP) were used to detect the levels of H19 mRNA and its DNA methylation. Western-blot was used to detect the expressions of HMGA2 and epithelial to mesenchymal transition (EMT) related proteins. When treated with different concentrations of mifepristone for 48 hours, the width of scratch of the the control group, the 5 mg/L and the 10 mg/L mifepristone treatment groups were (4.18±0.07)mm, (4.68±0.07)mm, and(4.99±0.07)mm, respectively (Pendometrial carcinoma cells partially through methylation-induced of transcriptional inhibition of H19, which results in the down-regulation of HMGA2 and vimentin and upregulation of E-cadherin.
Directory of Open Access Journals (Sweden)
Thanh Theresa Dinh
2014-07-01
Full Text Available RNA-directed DNA methylation (RdDM and histone H3 lysine 9 dimethylation (H3K9me2 are related transcriptional silencing mechanisms that target transposable elements (TEs and repeats to maintain genome stability in plants. RdDM is mediated by small and long noncoding RNAs produced by the plant-specific RNA polymerases Pol IV and Pol V, respectively. Through a chemical genetics screen with a luciferase-based DNA methylation reporter, LUCL, we found that camptothecin, a compound with anti-cancer properties that targets DNA topoisomerase 1α (TOP1α was able to de-repress LUCL by reducing its DNA methylation and H3K9me2 levels. Further studies with Arabidopsis top1α mutants showed that TOP1α silences endogenous RdDM loci by facilitating the production of Pol V-dependent long non-coding RNAs, AGONAUTE4 recruitment and H3K9me2 deposition at TEs and repeats. This study assigned a new role in epigenetic silencing to an enzyme that affects DNA topology.
Comparison of methods for quantification of global DNA methylation in human cells and tissues.
Directory of Open Access Journals (Sweden)
Sofia Lisanti
Full Text Available DNA methylation is a key epigenetic modification which, in mammals, occurs mainly at CpG dinucleotides. Most of the CpG methylation in the genome is found in repetitive regions, rich in dormant transposons and endogenous retroviruses. Global DNA hypomethylation, which is a common feature of several conditions such as ageing and cancer, can cause the undesirable activation of dormant repeat elements and lead to altered expression of associated genes. DNA hypomethylation can cause genomic instability and may contribute to mutations and chromosomal recombinations. Various approaches for quantification of global DNA methylation are widely used. Several of these approaches measure a surrogate for total genomic methyl cytosine and there is uncertainty about the comparability of these methods. Here we have applied 3 different approaches (luminometric methylation assay, pyrosequencing of the methylation status of the Alu repeat element and of the LINE1 repeat element for estimating global DNA methylation in the same human cell and tissue samples and have compared these estimates with the "gold standard" of methyl cytosine quantification by HPLC. Next to HPLC, the LINE1 approach shows the smallest variation between samples, followed by Alu. Pearson correlations and Bland-Altman analyses confirmed that global DNA methylation estimates obtained via the LINE1 approach corresponded best with HPLC-based measurements. Although, we did not find compelling evidence that the gold standard measurement by HPLC could be substituted with confidence by any of the surrogate assays for detecting global DNA methylation investigated here, the LINE1 assay seems likely to be an acceptable surrogate in many cases.
As a sequel of our investigations on the impact of epigenome in inducing fetal alcohol spectrum disorder (FASD) phenotypes in Japanese rice fish, we investigated on several DNA methylation machinery genes including DNA methyl transferase 3ba (dnmt3ba) and methyl binding proteins (MBPs), namely, mbdl...
Epigenetic Variation in Monozygotic Twins: A Genome-Wide Analysis of DNA Methylation in Buccal Cells
van Dongen, J.; Ehli, E.A.; Slieker, R.C.; Bartels, M.; Weber, Z.M.; Davies, G.E.; Slagboom, P.E.; Heijmans, B.T.; Boomsma, D.I.
2014-01-01
DNA methylation is one of the most extensively studied epigenetic marks in humans. Yet, it is largely unknown what causes variation in DNA methylation between individuals. The comparison of DNA methylation profiles of monozygotic (MZ) twins offers a unique experimental design to examine the extent
Genome-wide association between DNA methylation and alternative splicing in an invertebrate
Directory of Open Access Journals (Sweden)
Flores Kevin
2012-09-01
Full Text Available Abstract Background Gene bodies are the most evolutionarily conserved targets of DNA methylation in eukaryotes. However, the regulatory functions of gene body DNA methylation remain largely unknown. DNA methylation in insects appears to be primarily confined to exons. Two recent studies in Apis mellifera (honeybee and Nasonia vitripennis (jewel wasp analyzed transcription and DNA methylation data for one gene in each species to demonstrate that exon-specific DNA methylation may be associated with alternative splicing events. In this study we investigated the relationship between DNA methylation, alternative splicing, and cross-species gene conservation on a genome-wide scale using genome-wide transcription and DNA methylation data. Results We generated RNA deep sequencing data (RNA-seq to measure genome-wide mRNA expression at the exon- and gene-level. We produced a de novo transcriptome from this RNA-seq data and computationally predicted splice variants for the honeybee genome. We found that exons that are included in transcription are higher methylated than exons that are skipped during transcription. We detected enrichment for alternative splicing among methylated genes compared to unmethylated genes using fisher’s exact test. We performed a statistical analysis to reveal that the presence of DNA methylation or alternative splicing are both factors associated with a longer gene length and a greater number of exons in genes. In concordance with this observation, a conservation analysis using BLAST revealed that each of these factors is also associated with higher cross-species gene conservation. Conclusions This study constitutes the first genome-wide analysis exhibiting a positive relationship between exon-level DNA methylation and mRNA expression in the honeybee. Our finding that methylated genes are enriched for alternative splicing suggests that, in invertebrates, exon-level DNA methylation may play a role in the construction of splice
Directory of Open Access Journals (Sweden)
Sahar Houshdaran
2007-12-01
Full Text Available Male-factor infertility is a common condition, and etiology is unknown for a high proportion of cases. Abnormal epigenetic programming of the germline is proposed as a possible mechanism compromising spermatogenesis of some men currently diagnosed with idiopathic infertility. During germ cell maturation and gametogenesis, cells of the germ line undergo extensive epigenetic reprogramming. This process involves widespread erasure of somatic-like patterns of DNA methylation followed by establishment of sex-specific patterns by de novo DNA methylation. Incomplete reprogramming of the male germ line could, in theory, result in both altered sperm DNA methylation and compromised spermatogenesis.We determined concentration, motility and morphology of sperm in semen samples collected by male members of couples attending an infertility clinic. Using MethyLight and Illumina assays we measured methylation of DNA isolated from purified sperm from the same samples. Methylation at numerous sequences was elevated in DNA from poor quality sperm.This is the first report of a broad epigenetic defect associated with abnormal semen parameters. Our results suggest that the underlying mechanism for these epigenetic changes may be improper erasure of DNA methylation during epigenetic reprogramming of the male germ line.
Tobacco smoking leads to extensive genome-wide changes in DNA methylation.
Directory of Open Access Journals (Sweden)
Sonja Zeilinger
Full Text Available Environmental factors such as tobacco smoking may have long-lasting effects on DNA methylation patterns, which might lead to changes in gene expression and in a broader context to the development or progression of various diseases. We conducted an epigenome-wide association study (EWAs comparing current, former and never smokers from 1793 participants of the population-based KORA F4 panel, with replication in 479 participants from the KORA F3 panel, carried out by the 450K BeadChip with genomic DNA obtained from whole blood. We observed wide-spread differences in the degree of site-specific methylation (with p-values ranging from 9.31E-08 to 2.54E-182 as a function of tobacco smoking in each of the 22 autosomes, with the percent of variance explained by smoking ranging from 1.31 to 41.02. Depending on cessation time and pack-years, methylation levels in former smokers were found to be close to the ones seen in never smokers. In addition, methylation-specific protein binding patterns were observed for cg05575921 within AHRR, which had the highest level of detectable changes in DNA methylation associated with tobacco smoking (-24.40% methylation; p = 2.54E-182, suggesting a regulatory role for gene expression. The results of our study confirm the broad effect of tobacco smoking on the human organism, but also show that quitting tobacco smoking presumably allows regaining the DNA methylation state of never smokers.
Tobacco smoking leads to extensive genome-wide changes in DNA methylation.
Zeilinger, Sonja; Kühnel, Brigitte; Klopp, Norman; Baurecht, Hansjörg; Kleinschmidt, Anja; Gieger, Christian; Weidinger, Stephan; Lattka, Eva; Adamski, Jerzy; Peters, Annette; Strauch, Konstantin; Waldenberger, Melanie; Illig, Thomas
2013-01-01
Environmental factors such as tobacco smoking may have long-lasting effects on DNA methylation patterns, which might lead to changes in gene expression and in a broader context to the development or progression of various diseases. We conducted an epigenome-wide association study (EWAs) comparing current, former and never smokers from 1793 participants of the population-based KORA F4 panel, with replication in 479 participants from the KORA F3 panel, carried out by the 450K BeadChip with genomic DNA obtained from whole blood. We observed wide-spread differences in the degree of site-specific methylation (with p-values ranging from 9.31E-08 to 2.54E-182) as a function of tobacco smoking in each of the 22 autosomes, with the percent of variance explained by smoking ranging from 1.31 to 41.02. Depending on cessation time and pack-years, methylation levels in former smokers were found to be close to the ones seen in never smokers. In addition, methylation-specific protein binding patterns were observed for cg05575921 within AHRR, which had the highest level of detectable changes in DNA methylation associated with tobacco smoking (-24.40% methylation; p = 2.54E-182), suggesting a regulatory role for gene expression. The results of our study confirm the broad effect of tobacco smoking on the human organism, but also show that quitting tobacco smoking presumably allows regaining the DNA methylation state of never smokers.
Sun, Yanyan; Zhang, Yanli; Wang, Ziyu; Song, Yang; Wang, Feng
2013-01-01
Background Somatic cell nuclear transfer (SCNT) is a promising technique to produce transgenic cloned mammalian, including transgenic goats which may produce Human Lactoferrin (hLF). However, success percentage of SCNT is low, because of gestational and neonatal failure of transgenic embryos. According to the studies on cattle and mice, DNA methylation of some imprinted genes, which plays a vital role in the reprogramming of embryo in NT maybe an underlying mechanism. Methodology/Principal Findings Fibroblast cells were derived from the ear of a two-month-old goat. The vector expressing hLF was constructed and transfected into fibroblasts. G418 selection, EGFP expression, PCR, and cell cycle distribution were applied sequentially to select transgenic cells clones. After NT and embryo transfer, five transgenic cloned goats were obtained from 240 cloned transgenic embryos. These transgenic goats were identified by 8 microsatellites genotyping and southern blot. Of the five transgenic goats, 3 were lived after birth, while 2 were dead during gestation. We compared differential methylation regions (DMR) pattern of two paternally imprinted genes (H19 and IGF2R) of the ear tissues from the lived transgenic goats, dead transgenic goats, and control goats from natural reproduction. Hyper-methylation pattern appeared in cloned aborted goats, while methylation status was relatively normal in cloned lived goats compared with normal goats. Conclusions/Significance In this study, we generated five hLF transgenic cloned goats by SCNT. This is the first time the DNA methylation of lived and dead transgenic cloned goats was compared. The results demonstrated that the methylation status of DMRs of H19 and IGF2R were different in lived and dead transgenic goats and therefore this may be potentially used to assess the reprogramming status of transgenic cloned goats. Understanding the pattern of gene imprinting may be useful to improve cloning techniques in future. PMID:24204972
Metabolism of 19-methyl-substituted steroids by human placental aromatase
International Nuclear Information System (INIS)
Beusen, D.D.; Carrell, H.L.; Covey, D.F.
1987-01-01
The 19-methyl analogues of androstenedione and its aromatization intermediates (19-hydroxyandrostenedione and 19-oxoandrostenedione) were evaluated as substrates of microsomal aromatase in order to determine the effect of a 19-alkyl substituent on the enzyme's regiospecificity. Neither the androstenedione analog [10-ethylestr-4-ene-3,17-dione (1c) nor the 19-oxoandrostenedione analog [10-acetylestr-4-ene-3,17-dione (3c)] was converted to estrogens or oxygenated metabolites by placental microsomes. In contrast, both analogues of 19-hydroxyandrostenedione [10-[(1S)-1-hydroxyethyl] extr-4-ene-3,17-dione (2c) and 10-[(1R)-1-hydroxyethyl]estr-4-ene-3,17-dione (2e)] were converted to the intermediate analog 3c in a process requiring O 2 and either NADH or NADPH. No change in enzyme regiospecificity was detected. The absolute configuration of 2e was determined by X-ray crystallography. Experiments with 18 O 2 established that 3c generated from 2c retained little 18 O ( 18 O (≅ 70%). All four 19-methyl steroids elicited type I difference spectra from placental microsomes in addition to acting as competitive inhibitors of aromatase. Pretreatment of microsomes with 4-hydroxyandrostenedione (a suicide inactivator of aromatase) abolished the metabolism of 2c and 2e to 3c, as well as the type I difference spectrum elicited by 2c and 2e. The failure of 2c, 2e, and 3c to undergo aromatization was rationalized in the context of a mechanistic proposal for the third oxygenation of aromatase requiring hydrogen abstraction at C 1 of 19,19-dihydroxyandrostenedione, homolytic cleavage of the C 10 -C 19 bond, and oxygen rebound at C 19
Directory of Open Access Journals (Sweden)
Tanapat Pangeson
2017-11-01
Full Text Available In the wild-type allele, DNA methylation levels of 10 consecutive CpG sites adjacent to the upstream 5′-breakpoint of α-thalassemia Southeast Asian (SEA deletion are not different between placenta and leukocytes. However, no previous study has reported the map of DNA methylation in the SEA allele. This report aims to show that the SEA mutation is associated with DNA methylation changes, resulting in differential methylation between placenta and leukocytes. Methylation-sensitive high-resolution analysis was used to compare DNA methylation among placenta, leukocytes, and unmethylated control DNA. The result indicates that the DNA methylation between placenta and leukocyte DNA is different and shows that the CpG status of both is not fully unmethylated. Mapping of individual CpG sites was performed by targeted bisulfite sequencing. The DNA methylation level of the 10 consecutive CpG sites was different between placenta and leukocyte DNA. When the 10th CpG of the mutation allele was considered as a hallmark for comparing DNA methylation level, it was totally different from the unmethylated 10th CpG of the wild-type allele. Finally, the distinct DNA methylation patterns between both DNA were extracted. In total, 24 patterns were found in leukocyte samples and 9 patterns were found in placenta samples. This report shows that the large deletion is associated with DNA methylation change. In further studies for clinical application, the distinct DNA methylation pattern might be a potential marker for detecting cell-free fetal DNA.
Release of 3-methyladenine from linker and core DNA of chromatin by a purified DNA glycosylase
International Nuclear Information System (INIS)
Heller, E.P.; Goldthwait, D.A.
1983-01-01
Oligonucleosomes were isolated from [ 14 C]thymidine-labeled HeLa cells by digestion of the nuclei with micrococcal nuclease and were then alkylated with [ 3 H]methylnitrosourea. Nucleosome core particles were also prepared by further digestion of the oligonucleosomes. The distribution of 3 H-labeled methyl groups in the linker versus the core DNA was established by a determination of 3 H: 14 C ratios in oligonucleosome and core DNA. The ratios in the core DNA of 145 and 165 base pair DNA fragments were 5.2 and 5.4, respectively, while the ratio in the oligonucleosomal DNA was 8.2. Assuming an equal mixture (as determined) of 145 and 165 base pair fragments of DNA in the 185 base pair repeat, the relative concentration of 3 H methyl groups in the linker versus the core DNA was 4.2. Thus, 45% of the 3 H methyl groups were in the linker DNA, and 55% were in the core DNA. Some shielding of the DNA was evident during alkylation. The concentrations of alkyl groups on the linker and core DNA were 67 and 12% of that found on free DNA alkylated under comparable conditions. No evidence for preferential shielding of the major or minor groove was observed. The purified 3-methyladenine DNA glycosylase I of Escherichia coli released approximately 37% of the 3-methyladenine from the linker DNA and 13% from the core DNA. The limited enzymatic removal of 3-methyladenine in vitro compared to the efficient removal in vivo suggests that conformational changes of the oligonucleosome and core structure must occur for total repair
Methylation sensitive amplified polymorphism (MSAP) reveals that ...
African Journals Online (AJOL)
ajl yemi
2011-12-19
Dec 19, 2011 ... Key words: Salt stress, alkali stress, Gossypium hirsutum L., DNA methylation, methylation sensitive amplified polymorphism (MSAP). INTRODUCTION. DNA methylation is one of the key epigenetic mecha- nisms among eukaryotes that can modulate gene expression without the changes of DNA sequence.
Loss of maintenance DNA methylation results in abnormal DNA origin firing during DNA replication.
Haruta, Mayumi; Shimada, Midori; Nishiyama, Atsuya; Johmura, Yoshikazu; Le Tallec, Benoît; Debatisse, Michelle; Nakanishi, Makoto
2016-01-22
The mammalian maintenance methyltransferase DNMT1 [DNA (cytosine-5-)-methyltransferase 1] mediates the inheritance of the DNA methylation pattern during replication. Previous studies have shown that depletion of DNMT1 causes a severe growth defect and apoptosis in differentiated cells. However, the detailed mechanisms behind this phenomenon remain poorly understood. Here we show that conditional ablation of Dnmt1 in murine embryonic fibroblasts (MEFs) resulted in an aberrant DNA replication program showing an accumulation of late-S phase replication and causing severely defective growth. Furthermore, we found that the catalytic activity and replication focus targeting sequence of DNMT1 are required for a proper DNA replication program. Taken together, our findings suggest that the maintenance of DNA methylation by DNMT1 plays a critical role in proper regulation of DNA replication in mammalian cells. Copyright © 2015 Elsevier Inc. All rights reserved.
Global DNA methylation responses to low dose radiation exposure
International Nuclear Information System (INIS)
Newman, M.R.; Ormsby, R.J.; Blyth, B.J.; Sykes, P.J.; Bezak, E.
2011-01-01
Full text: High radiation doses cause breaks in the DNA which are considered the critical lesions in initiation of radiation-induced cancer. However, at very low radiation doses relevant for the general public, the induction of such breaks will be rare, and other changes to the DNA such as DNA methylation which affects gene expression may playa role in radiation responses. We are studying global DNA methylation after low dose radiation exposure to determine if low dose radiation has short- and/or long-term effects on chromatin structure. We developed a sensitive high resolution melt assay to measure the levels of DNA methylation across the mouse genome by analysing a stretch of DNA sequence within Long Interspersed Nuclear Elements-I (LINE I) that comprise a very large proportion of the mouse and human genomes. Our initial results suggest no significant short-term or longterm) changes in global NA methylation after low dose whole-body X-radiation of 10 J1Gyor 10 mGy, with a significant transient increase in NA methylation observed I day after a high dose of I Gy. If the low radiation doses tested are inducing changes in bal DNA methylation, these would appear to be smaller than the variation observed between the sexes and following the general stress of the sham-irradiation procedure itself. This research was funded by the Low Dose Radiation Research Program, Biological and Environmental Research, US DOE, Grant DE-FG02-05ER64104 and MN is the recipient of the FMCF/BHP Dose Radiation Research Scholarship.
Sina, Abu Ali Ibn; Howell, Sidney; Carrascosa, Laura G; Rauf, Sakandar; Shiddiky, Muhammad J A; Trau, Matt
2014-11-07
We report a simple electrochemical method referred to as "eMethylsorb" for the detection of DNA methylation. The method relies on the base dependent affinity interaction of DNA with gold. The methylation status of DNA is quantified by monitoring the electrochemical current as a function of the relative adsorption level of bisulphite treated DNA samples onto a bare gold electrode. This method can successfully distinguish methylated and unmethylated epigenotypes at single CpG resolution.
Analysis of DNA methylation in various swine tissues.
Directory of Open Access Journals (Sweden)
Chun Yang
Full Text Available DNA methylation is known to play an important role in regulating gene expression during biological development and tissue differentiation in eukaryotes. In this study, we used the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP method to assess the extent and pattern of cytosine methylation in muscle, heart, liver, spleen, lung, kidney and stomach from the swine strain Laiwu, and we also examined specific methylation patterns in the seven tissues. In total, 96,371 fragments, each representing a recognition site cleaved by either or both EcoRI + HpaII and EcoRI + MspI, the HpaII and MspI are isoschizomeric enzymes, were amplified using 16 pairs of selective primers. A total of 50,094 sites were found to be methylated at cytosines in seven tissues. The incidence of DNA methylation was approximately 53.99% in muscle, 51.24% in the heart, 50.18% in the liver, 53.31% in the spleen, 51.97% in the lung, 51.15% in the kidney and 53.39% in the stomach, as revealed by the incidence of differential digestion. Additionally, differences in DNA methylation levels imply that such variations may be related to specific gene expression during tissue differentiation, growth and development. Three types of bands were generated in the F-MSAP profile, the total numbers of these three types of bands in the seven tissues were 46,277, 24,801 and 25,293, respectively.In addition, different methylation patterns were observed in seven tissues from pig, and almost all of the methylation patterns detected by F-MSAP could be confirmed by Southern analysis using the isolated amplified fragments as probes. The results clearly demonstrated that the F-MSAP technique can be adapted for use in large-scale DNA methylation detection in the pig genome.
A combined HM-PCR/SNuPE method for high sensitive detection of rare DNA methylation
Directory of Open Access Journals (Sweden)
Tierling Sascha
2010-06-01
Full Text Available Abstract Background DNA methylation changes are widely used as early molecular markers in cancer detection. Sensitive detection and classification of rare methylation changes in DNA extracted from circulating body fluids or complex tissue samples is crucial for the understanding of tumor etiology, clinical diagnosis and treatment. In this paper, we describe a combined method to monitor the presence of methylated tumor DNA in an excess of unmethylated background DNA of non-tumorous cells. The method combines heavy methyl-PCR, which favors preferential amplification of methylated marker sequence from bisulfite-treated DNA with a methylation-specific single nucleotide primer extension monitored by ion-pair, reversed-phase, high-performance liquid chromatography separation. Results This combined method allows detection of 14 pg (that is, four to five genomic copies of methylated chromosomal DNA in a 2000-fold excess (that is, 50 ng of unmethylated chromosomal background, with an analytical sensitivity of > 90%. We outline a detailed protocol for the combined assay on two examples of known cancer markers (SEPT9 and TMEFF2 and discuss general aspects of assay design and data interpretation. Finally, we provide an application example for rapid testing on tumor methylation in plasma DNA derived from a small cohort of patients with colorectal cancer. Conclusion The method allows unambiguous detection of rare DNA methylation, for example in body fluid or DNA isolates from cells or tissues, with very high sensitivity and accuracy. The application combines standard technologies and can easily be adapted to any target region of interest. It does not require costly reagents and can be used for routine screening of many samples.
The multi-domain protein Np95 connects DNA methylation and histone modification.
Rottach, Andrea; Frauer, Carina; Pichler, Garwin; Bonapace, Ian Marc; Spada, Fabio; Leonhardt, Heinrich
2010-04-01
DNA methylation and histone modifications play a central role in the epigenetic regulation of gene expression and cell differentiation. Recently, Np95 (also known as UHRF1 or ICBP90) has been found to interact with Dnmt1 and to bind hemimethylated DNA, indicating together with genetic studies a central role in the maintenance of DNA methylation. Using in vitro binding assays we observed a weak preference of Np95 and its SRA (SET- and Ring-associated) domain for hemimethylated CpG sites. However, the binding kinetics of Np95 in living cells was not affected by the complete loss of genomic methylation. Investigating further links with heterochromatin, we could show that Np95 preferentially binds histone H3 N-terminal tails with trimethylated (H3K9me3) but not acetylated lysine 9 via a tandem Tudor domain. This domain contains three highly conserved aromatic amino acids that form an aromatic cage similar to the one binding H3K9me3 in the chromodomain of HP1ss. Mutations targeting the aromatic cage of the Np95 tandem Tudor domain (Y188A and Y191A) abolished specific H3 histone tail binding. These multiple interactions of the multi-domain protein Np95 with hemimethylated DNA and repressive histone marks as well as with DNA and histone methyltransferases integrate the two major epigenetic silencing pathways.
Rathore, Mangal S; Jha, Bhavanath
2016-03-01
The present investigation aimed to evaluate the degree and pattern of DNA methylation using methylation-sensitive AFLP (MS-AFLP) markers in genetically stable in vitro regenerates of Jatropha curcas L.. The genetically stable in vitro regenerates were raised through direct organogenesis via enhanced axillary shoot bud proliferation (Protocol-1) and in vitro-derived leaf regeneration (Protocol-2). Ten selective combinations of MS-AFLP primers produced 462 and 477 MS-AFLP bands in Protocol-1 (P-1) and Protocol-2 (P-2) regenerates, respectively. In P-1 regenerates, 15.8-31.17 % DNA was found methylated with an average of 25.24 %. In P-2 regenerates, 15.93-32.7 % DNA was found methylated with an average of 24.11 %. Using MS-AFLP in P-1 and P-2 regenerates, 11.52-25.53 % and 13.33-25.47 % polymorphism in methylated DNA was reported, respectively. Compared to the mother plant, P-1 regenerates showed hyper-methylation while P-2 showed hypo-methylation. The results clearly indicated alternation in degree and pattern of DNA methylation; hence, epigenetic instability in the genetically stable in vitro regenerates of J. curcas, developed so far using two different regeneration systems and explants of two different origins. The homologous nucleotide fragments in genomes of P-1 and P-2 regenerates showing methylation re-patterning might be involved in immediate adaptive responses and developmental processes through differential regulation of transcriptome under in vitro conditions.
Nissen, Judith Becker; Hansen, Christine Søholm; Starnawska, Anna; Mattheisen, Manuel; Børglum, Anders Dupont; Buttenschøn, Henriette Nørmølle; Hollegaard, Mads
2016-01-01
Obsessive-compulsive disorder (OCD) is a neuropsychiatric disorder. Non-genetic factors and their interaction with genes have attracted increasing attention. Epigenetics is regarded an important interface between environmental signals and activation/repression of genomic responses. Epigenetic mechanisms have not previously been examined in OCD in children and adolescents. The aim of the present study was to examine the DNA methylation profile of selected genes in blood spots from neonates later diagnosed with OCD and in the same children/adolescents at the time of diagnosis compared with age- and sex-matched controls. Furthermore, we wanted to characterize the association of the differential methylation profiles with the severity of OCD and treatment outcome. Dried and new blood spot samples were obtained from 21 female children/adolescents with verified OCD and 12 female controls. The differential methylation was analyzed using a linear model and the correlation with the severity of OCD and treatment outcome was analyzed using the Pearson correlation. We evaluated selected Illumina Infinium HumanMethylation450 BeadChip probes within and up to 100,000 bp up- and downstream of 14 genes previously associated with OCD (SLC1A1, SLC25A12, GABBR1, GAD1, DLGAP1, MOG, BDNF, OLIG2, NTRK2 and 3, ESR1, SL6A4, TPH2, and COMT). The study found no significantly differential methylation. However, preliminary support for a difference was found for the gamma-aminobutyric acid (GABA) B receptor 1 (cg10234998, cg17099072) in blood samples at birth and for the estrogen receptor 1 (ESR1) (cg10939667), the myelin oligodendrocyte glycoprotein (MOG) (cg16650906), and the brain-derived neurotrophic factor (BDNF) (cg14080521) in blood samples at the time of diagnosis. Preliminary support for an association was observed between the methylation profiles of GABBR1 and MOG and baseline severity, treatment effect, and responder status; and between the methylation profile of ESR1 and baseline
Circulating DNA and its methylation level in inflammatory bowel disease and related colon cancer.
Bai, Xuming; Zhu, Yaqun; Pu, Wangyang; Xiao, Li; Li, Kai; Xing, Chungen; Jin, Yong
2015-01-01
Both of chronic inflammation and abnormal immune in inflammatory bowel disease can induce colon cancer. Previous research showed that cell apoptosis and necrosis become the main source of circulating DNA in the peripheral blood during tumorigenesis that reduced along with methylation degree. However, its role in the process of colitis transforming to colon cancer is not clarified. Drinking 3% DSS was used to establish colitis model, while 3% dextran sodium sulfate (DSS) combined with azo oxidation methane (AOM) intraperitoneal injection was applied to establish colitis related colon cancer model. Circulating DNA and its methylation level in peripheral blood were tested. Morphology observation, HE staining, and p53 and β-catenin expression detection confirmed that drinking 3% DSS and 3% DSS combined with AOM intraperitoneal injection can successfully establish colitis and colitis associated colorectal cancer models. Circulating DNA level in colitis and colon cancer mice increased by gradient compared with control, while significant difference was observed between each other. Circulating DNA methylation level decreased obviously in colitis and colon cancer, and significant difference was observed between each other. Abnormal protein expression, circulating DNA and its methylation level in ulcerative colitis associated colorectal tissues change in gradient, suggesting that circulating DNA and its methylation level can be treated as new markers for colitis cancer transformation that has certain significance to explore the mechanism of human ulcerative colitis canceration.
Berry, Robert J.; Hao, Ling; Li, Zhu; Maneval, David; Yang, Thomas P.; Rasmussen, Sonja A.; Yang, Quanhe; Zhu, Jiang-Hui; Hu, Dale J.; Bailey, Lynn B.
2011-01-01
Folate is a source of one-carbons necessary for DNA methylation, a critical epigenetic modification necessary for genomic structure and function. The use of supplemental folic acid is widespread however; the potential influence on DNA methylation is unclear. We measured global DNA methylation using DNA extracted from samples from a population-based, double-blind randomized trial of folic acid supplementation (100, 400, 4000 µg per day) taken for 6 months; including a 3 month post-supplementation sample. We observed no changes in global DNA methylation in response to up to 4,000 µg/day for 6 months supplementation in DNA extracted from uncoagulated blood (approximates circulating blood). However, when DNA methylation was determined in coagulated samples from the same individuals at the same time, significant time, dose, and MTHFR genotype-dependent changes were observed. The baseline level of DNA methylation was the same for uncoagulated and coagulated samples; marked differences between sample types were observed only after intervention. In DNA from coagulated blood, DNA methylation decreased (−14%; Pmethylation decreased an additional 23% (Pmethylation of ≥25% (vs. methylation between DNA extracted from coagulated and uncoagulated samples in response to folic acid supplementation is an important finding for evaluating use of folic acid and investigating the potential effects of folic acid supplementation on coagulation. PMID:22163281
Directory of Open Access Journals (Sweden)
Hsiu-Huei Peng
2012-09-01
Conclusion: In conclusion, human amniotic fluid mesenchymal stem cells contain a unique epigenetic signature during in vitro cell culture. H19 and KCNQ1OT1 possessed a substantial degree of hypermethylation status, and variable DNA methylation patterns of SNRPN was observed during in vitro cell culture of human amniotic fluid mesenchymal stem cells. Our results urge further understanding of epigenetic status of human amniotic fluid mesenchymal stem cells before it is applied in cell replacement therapy.
International Nuclear Information System (INIS)
Rawluszko, Agnieszka A; Bujnicka, Katarzyna E; Horbacka, Karolina; Krokowicz, Piotr; Jagodziński, Paweł P
2013-01-01
Colorectal cancer (CRC) is one of the most common and comprehensively studied malignancies. Hypoxic conditions during formation of CRC may support the development of more aggressive cancers. Hypoxia inducible factor (HIF), a major player in cancerous tissue adaptation to hypoxia, is negatively regulated by the family of prolyl hydroxylase enzymes (PHD1, PHD2, PHD3) and asparaginyl hydroxylase, called factor inhibiting HIF (FIH). PHD1, PHD2, PHD3 and FIH gene expression was evaluated using quantitative RT-PCR and western blotting in primary colonic adenocarcinoma and adjacent histopathologically unchanged colonic mucosa from patients who underwent radical surgical resection of the colon (n = 90), and the same methods were used for assessment of PHD3 gene expression in HCT116 and DLD-1 CRC cell lines. DNA methylation levels of the CpG island in the promoter regulatory region of PHD1, PHD2, PHD3 and FIH were assessed using bisulfite DNA sequencing and high resolution melting analysis (HRM) for patients and HRM analysis for CRC cell lines. We found significantly lower levels of PHD1, PHD2 and PHD3 transcripts (p = 0.00026; p < 0.00001; p < 0.00001) and proteins (p = 0.004164; p = 0.0071; p < 0.00001) in primary cancerous than in histopathologically unchanged tissues. Despite this, we did not observe statistically significant differences in FIH transcript levels between cancerous and histopathologically unchanged colorectal tissue, but we found a significantly increased level of FIH protein in CRC (p = 0.0169). The reduced PHD3 expression was correlated with significantly increased DNA methylation in the CpG island of the PHD3 promoter regulatory region (p < 0.0001). We did not observe DNA methylation in the CpG island of the PHD1, PHD2 or FIH promoter in cancerous and histopathologically unchanged colorectal tissue. We also showed that 5-Aza-2’-deoxycytidine induced DNA demethylation leading to increased PHD3 transcript and protein level in HCT116 cells. We
Varshney, Dhaval; Vavrova-Anderson, Jana; Oler, Andrew J.; Cowling, Victoria H.; Cairns, Bradley R.; White, Robert J.
2015-01-01
Short interspersed nuclear elements (SINEs), such as Alu, spread by retrotransposition, which requires their transcripts to be copied into DNA and then inserted into new chromosomal sites. This can lead to genetic damage through insertional mutagenesis and chromosomal rearrangements between non-allelic SINEs at distinct loci. SINE DNA is heavily methylated and this was thought to suppress its accessibility and transcription, thereby protecting against retrotransposition. Here we provide several lines of evidence that methylated SINE DNA is occupied by RNA polymerase III, including the use of high-throughput bisulphite sequencing of ChIP DNA. We find that loss of DNA methylation has little effect on accessibility of SINEs to transcription machinery or their expression in vivo. In contrast, a histone methyltransferase inhibitor selectively promotes SINE expression and occupancy by RNA polymerase III. The data suggest that methylation of histones rather than DNA plays a dominant role in suppressing SINE transcription. PMID:25798578
Current trends in electrochemical sensing and biosensing of DNA methylation.
Krejcova, Ludmila; Richtera, Lukas; Hynek, David; Labuda, Jan; Adam, Vojtech
2017-11-15
DNA methylation plays an important role in physiological and pathological processes. Several genetic diseases and most malignancies tend to be associated with aberrant DNA methylation. Among other analytical methods, electrochemical approaches have been successfully employed for characterisation of DNA methylation patterns that are essential for the diagnosis and treatment of particular diseases. This article discusses current trends in the electrochemical sensing and biosensing of DNA methylation. Particularly, it provides an overview of applied electrode materials, electrode modifications and biorecognition elements applications with an emphasis on strategies that form the core DNA methylation detection approaches. The three main strategies as (i) bisulfite treatment, (ii) cleavage by restriction endonucleases, and (iii) immuno/affinity reaction were described in greater detail. Additionally, the availability of the reviewed platforms for early cancer diagnosis and the approval of methylation inhibitors for anticancer therapy were discussed. Copyright © 2017 Elsevier B.V. All rights reserved.
DNA methylation-histone modification relationships across the desmin locus in human primary cells
Directory of Open Access Journals (Sweden)
Clelland Gayle K
2009-05-01
Full Text Available Abstract Background We present here an extensive epigenetic analysis of a 500 kb region, which encompasses the human desmin gene (DES and its 5' locus control region (LCR, the only muscle-specific transcriptional regulatory element of this type described to date. These data complement and extend Encyclopaedia of DNA Elements (ENCODE studies on region ENr133. We analysed histone modifications and underlying DNA methylation patterns in physiologically relevant DES expressing (myoblast/myotube and non-expressing (peripheral blood mononuclear primary human cells. Results We found that in expressing myoblast/myotube but not peripheral blood mononuclear cell (PBMC cultures, histone H4 acetylation displays a broadly distributed enrichment across a gene rich 200 kb region whereas H3 acetylation localizes at the transcriptional start site (TSS of genes. We show that the DES LCR and TSS of DES are enriched with hyperacetylated domains of acetylated histone H3, with H3 lysine 4 di- and tri-methylation (H3K4me2 and me3 exhibiting a different distribution pattern across this locus. The CpG island that extends into the first intron of DES is methylation-free regardless of the gene's expression status and in non-expressing PBMCs is marked with histone H3 lysine 27 tri-methylation (H3K27me3. Conclusion Overall, our results constitute the first study correlating patterns of histone modifications and underlying DNA methylation of a muscle-specific LCR and its associated downstream gene region whilst additionally placing this within a much broader genomic context. Our results clearly show that there are distinct patterns of histone H3 and H4 acetylation and H3 methylation at the DES LCR, promoter and intragenic region. In addition, the presence of H3K27me3 at the DES methylation-free CpG only in non-expressing PBMCs may serve to silence this gene in non-muscle tissues. Generally, our work demonstrates the importance of using multiple, physiologically relevant
International Nuclear Information System (INIS)
Wurdeman, R.L.; Gold, B.
1988-01-01
DNA alkylation by N-alkyl-N-nitrosoureas is generally accepted to be responsible for their mutagenic, carcinogenic, and antineoplastic activities. The exact nature of the ultimate alkylating intermediate is still controversial, with a variety of species having been nominated. The sequence specificity for DNA alkylation by simple N-alkyl-N-nitrosoureas has not been reported, although such information is basic in understanding the specific point mutations induced by these compounds in oncogene targets. These two points are addressed by using N-methyl-N-nitrosourea methylation of a 576 base-pair 32 P-end-labeled DNA restriction fragment and high-resolution polyacrylamide sequencing gels. This method provides information on the formation of N 7 -methylguanine, by the generation of single-strand breaks upon exposure to piperidine
DNA Methylation and Temperature Stress in an Antarctic Polychaete, Spiophanes tcherniai
Directory of Open Access Journals (Sweden)
Adam G. Marsh
2014-05-01
Full Text Available Epigenetic modifications of DNA and histones are a primary mechanism by which gene expression activities may be modified in response to environmental stimuli. Here we characterize patterns of methyl-cytosine composition in the marine polychaete emph{Spiophanes tcherniai} from McMurdo Sound, Antarctica. We cultured adult worms at two temperatures, -1.5 C (ambient control and +4 C (warm treatment, for four weeks. We observed a rapid capacity for emph{S. tcherniai} organismal respiration rates and underlying catalytic rates of citrate synthase to acclimate at +4 C and return to control levels. We profiled changes in the methylation states of CpG sites in these treatments using an NGS strategy to computationally reconstruct and quantify methylation status across the genome. In our analysis we recovered 120,000 CpG sites in assembled contigs from both treatments. Of those, we were able to align 28,000 CpG sites in common between the two sample groups. In comparing these aligned sites between treatments, only 3,000 (11% evidenced a change in methylation state, but over 85% of changes involved a gain of a 5-methyl group on a CpG site (net increase in methyation. The ability to score CpG sites as partially methylated among gDNA copies in a sample opens up a new avenue for assessing DNA methylation responses to changing environments. By quantitatively distinguishing a ``mixed'' population of copies of one CpG site, we can begin to identify dynamic, non-binary, continuous-response reactions in DNA methylation intensity or density that previously may have been overlooked as noise.
Phosphate-methylated DNA aimed at HIV-1 RNA loops and integrated DNA inhibits viral infectivity
Buck, H. M.; Koole, L. H.; van Genderen, M. H.; Smit, L.; Geelen, J. L.; Jurriaans, S.; Goudsmit, J.
1990-01-01
Phosphate-methylated DNA hybridizes strongly and specifically to natural DNA and RNA. Hybridization to single-stranded and double-stranded DNA leads to site-selective blocking of replication and transcription. Phosphate-methylated DNA was used to interrupt the life cycle of the human
Bröer, Angelika; Juelich, Torsten; Vanslambrouck, Jessica M; Tietze, Nadine; Solomon, Peter S; Holst, Jeff; Bailey, Charles G; Rasko, John E J; Bröer, Stefan
2011-07-29
Amino acid uptake in the intestine and kidney is mediated by a variety of amino acid transporters. To understand the role of epithelial neutral amino acid uptake in whole body homeostasis, we analyzed mice lacking the apical broad-spectrum neutral (0) amino acid transporter B(0)AT1 (Slc6a19). A general neutral aminoaciduria was observed similar to human Hartnup disorder which is caused by mutations in SLC6A19. Na(+)-dependent uptake of neutral amino acids into the intestine and renal brush-border membrane vesicles was abolished. No compensatory increase of peptide transport or other neutral amino acid transporters was detected. Mice lacking B(0)AT1 showed a reduced body weight. When adapted to a standard 20% protein diet, B(0)AT1-deficient mice lost body weight rapidly on diets containing 6 or 40% protein. Secretion of insulin in response to food ingestion after fasting was blunted. In the intestine, amino acid signaling to the mammalian target of rapamycin (mTOR) pathway was reduced, whereas the GCN2/ATF4 stress response pathway was activated, indicating amino acid deprivation in epithelial cells. The results demonstrate that epithelial amino acid uptake is essential for optimal growth and body weight regulation.
Directory of Open Access Journals (Sweden)
Carroll Bernie
2010-03-01
Full Text Available Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII. The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Results Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90% were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8% and the lowest in fibroblastic DNA (92.3%, P ≤ 0.05. Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P ≤ 0.05. Conclusions The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic
A unique regulatory phase of DNA methylation in the early mammalian embryo
Smith, Zachary D.; Chan, Michelle M.; Mikkelsen, Tarjei S.; Gu, Hongcang; Gnirke, Andreas; Regev, Aviv; Meissner, Alexander
2012-01-01
Summary DNA methylation is highly dynamic during mammalian embryogenesis. It is broadly accepted that the paternal genome is actively depleted of 5-methyl cytosine at fertilization, followed by passive loss that reaches a minimum at the blastocyst stage. However, this model is based on limited data, and to date no base-resolution maps exist to support and refine it. Here, we generated genome-scale DNA methylation maps in mouse gametes and through post-implantation embryogenesis. We find that ...
Uchida, Yasuo; Ito, Katsuaki; Ohtsuki, Sumio; Kubo, Yoshiyuki; Suzuki, Takashi; Terasaki, Tetsuya
2015-07-01
The purpose of this study was to clarify the expression of Na(+) -dependent multivitamin transporter (SLC5A6/SMVT) and its contribution to the supply of biotin and pantothenic acid to the human brain via the blood-brain barrier. DNA microarray and immunohistochemical analyses confirmed that SLC5A6 is expressed in microvessels of human brain. The absolute expression levels of SLC5A6 protein in isolated human and monkey brain microvessels were 1.19 and 0.597 fmol/μg protein, respectively, as determined by a quantitative targeted absolute proteomics technique. Using an antibody-free method established by Kubo et al. (2015), we found that SLC5A6 was preferentially localized at the luminal membrane of brain capillary endothelium. Knock-down analysis using SLC5A6 siRNA showed that SLC5A6 accounts for 88.7% and 98.6% of total [(3) H]biotin and [(3) H]pantothenic acid uptakes, respectively, by human cerebral microvascular endothelial cell line hCMEC/D3. SLC5A6-mediated transport in hCMEC/D3 was markedly inhibited not only by biotin and pantothenic acid, but also by prostaglandin E2, lipoic acid, docosahexaenoic acid, indomethacin, ketoprofen, diclofenac, ibuprofen, phenylbutazone, and flurbiprofen. This study is the first to confirm expression of SLC5A6 in human brain microvessels and to provide evidence that SLC5A6 is a major contributor to luminal uptake of biotin and pantothenic acid at the human blood-brain barrier. In humans, it was unclear (not concluded) about what transport system at the blood-brain barrier (BBB) is responsible for the brain uptakes of two vitamins, biotin and pantothenic acid, which are necessary for brain proper function. This study clarified for the first time that the solute carrier 5A6/Na(+) -dependent multivitamin transporter SLC5A6/SMVT is responsible for the supplies of biotin and pantothenic acid into brain across the BBB in humans. DHA, docosahexaenoic acid; NSAID, non-steroidal anti-inflammatory drug; PGE2, prostaglandin E2. © 2015
Potential of DNA methylation in rectal cancer as diagnostic and prognostic biomarkers
Exner, Ruth; Pulverer, Walter; Diem, Martina; Spaller, Lisa; Woltering, Laura; Schreiber, Martin; Wolf, Brigitte; Sonntagbauer, Markus; Schröder, Fabian; Stift, Judith; Wrba, Fritz; Bergmann, Michael; Weinhäusel, Andreas; Egger, Gerda
2015-01-01
Background: Aberrant DNA methylation is more prominent in proximal compared with distal colorectal cancers. Although a number of methylation markers were identified for colon cancer, yet few are available for rectal cancer. Methods: DNA methylation differences were assessed by a targeted DNA microarray for 360 marker candidates between 22 fresh frozen rectal tumour samples and 8 controls and validated by microfluidic high-throughput and methylation-sensitive qPCR in fresh frozen and formalin-fixed paraffin-embedded (FFPE) samples, respectively. The CpG island methylator phenotype (CIMP) was assessed by MethyLight in FFPE material from 78 patients with pT2 and pT3 rectal adenocarcinoma. Results: We identified and confirmed two novel three-gene signatures in fresh frozen samples that can distinguish tumours from adjacent tissue as well as from blood with a high sensitivity and specificity of up to 1 and an AUC of 1. In addition, methylation of individual CIMP markers was associated with specific clinical parameters such as tumour stage, therapy or patients' age. Methylation of CDKN2A was a negative prognostic factor for overall survival of patients. Conclusions: The newly defined methylation markers will be suitable for early disease detection and monitoring of rectal cancer. PMID:26335606
Characterization of Dnmt1 Binding and DNA Methylation on Nucleosomes and Nucleosomal Arrays.
Directory of Open Access Journals (Sweden)
Anna Schrader
Full Text Available The packaging of DNA into nucleosomes and the organisation into higher order structures of chromatin limits the access of sequence specific DNA binding factors to DNA. In cells, DNA methylation is preferentially occuring in the linker region of nucleosomes, suggesting a structural impact of chromatin on DNA methylation. These observations raise the question whether DNA methyltransferases are capable to recognize the nucleosomal substrates and to modify the packaged DNA. Here, we performed a detailed analysis of nucleosome binding and nucleosomal DNA methylation by the maintenance DNA methyltransferase Dnmt1. Our binding studies show that Dnmt1 has a DNA length sensing activity, binding cooperatively to DNA, and requiring a minimal DNA length of 20 bp. Dnmt1 needs linker DNA to bind to nucleosomes and most efficiently recognizes nucleosomes with symmetric DNA linkers. Footprinting experiments reveal that Dnmt1 binds to both DNA linkers exiting the nucleosome core. The binding pattern correlates with the efficient methylation of DNA linkers. However, the enzyme lacks the ability to methylate nucleosomal CpG sites on mononucleosomes and nucleosomal arrays, unless chromatin remodeling enzymes create a dynamic chromatin state. In addition, our results show that Dnmt1 functionally interacts with specific chromatin remodeling enzymes to enable complete methylation of hemi-methylated DNA in chromatin.
Identifying DNA Methylation Biomarkers for Non-Endoscopic Detection of Barrett’s Esophagus
Moinova, Helen R.; LaFramboise, Thomas; Lutterbaugh, James D.; Chandar, Apoorva Krishna; Dumot, John; Faulx, Ashley; Brock, Wendy; De la Cruz Cabrera, Omar; Guda, Kishore; Barnholtz-Sloan, Jill S.; Iyer, Prasad G.; Canto, Marcia I.; Wang, Jean S.; Shaheen, Nicholas J.; Thota, Prashanti N.; Willis, Joseph E.; Chak, Amitabh; Markowitz, Sanford D.
2018-01-01
We report a biomarker-based non-endoscopic method for detecting Barrett’s esophagus (BE), based on detecting methylated DNAs retrieved via a swallowable balloon-based esophageal sampling device. BE is the precursor of, and a major recognized risk factor for, developing esophageal adenocarcinoma (EAC). Endoscopy, the current standard for BE detection, is not cost-effective for population screening. We performed genome-wide screening to ascertain regions targeted for recurrent aberrant cytosine methylation in BE, identifying high-frequency methylation within the CCNA1 locus. We tested CCNA1 DNA methylation as a BE biomarker in cytology brushings of the distal esophagus from 173 individuals with or without BE. CCNA1 DNA methylation demonstrated an area under the curve (AUC)=0.95 for discriminating BE-related metaplasia and neoplasia cases versus normal individuals, performing identically to methylation of VIM DNA, an established BE biomarker. When combined, the resulting two biomarker panel was 95% sensitive and 91% specific. These results were replicated in an independent validation cohort of 149 individuals, who were assayed using the same cutoff values for test positivity established in the training population. To progress toward non-endoscopic esophageal screening, we engineered a well-tolerated, swallowable, encapsulated balloon device able to selectively sample the distal esophagus within 5 minutes. In balloon samples from 86 individuals, tests of CCNA1 plus VIM DNA methylation detected BE metaplasia with 90.3% sensitivity and 91.7% specificity. Combining the balloon sampling device with molecular assays of CCNA1 plus VIM DNA methylation enables an efficient, well-tolerated, sensitive, and specific method of screening at-risk populations for BE. PMID:29343623
Energy Technology Data Exchange (ETDEWEB)
Lacks, S.; Greenberg, B.
1977-01-01
Restriction endonucleases Dpn I and Dpn II are produced by two distinct strains of Diplococcus pneumoniae. The two enzymes show complementary specificity with respect to methylation of sites in DNA. From the identity of its cleavage site with that of Mbo I, it appears that Dpn II cleaves at the unmodified sequence 5'-G-A-T-C-3'. Dpn I cleaves at the same sequence when the adenine residue is methylated. Both enzymes produce only double-strand breaks in susceptible DNA. Their susceptibility to Dpn I and not Dpn II shows that essentially all the G-A-T-C sequences are methylated in DNA from the pneumococcal strain that produces Dpn II as well as in DNA from Hemophilus influenzae and Escherichia coli. In the dam-3 mutant of E. coli none of these sequences appear to be methylated. Residual adenine methylation in the dam-3 mutant DNA most likely occurs at different sites. Different but characteristic degrees of methylation at G-A-T-C sites are found in the DNA of bacterial viruses grown in E. coli. DNAs from mammalian cells and viruses are not methylated at this sequence. Mitochondrial DNA from Paramecium aurelia is not methylated, but a small proportion of G-A-T-C sequences in the macronuclear DNA of this eukaryote appear to be methylated. Possible roles of sequence-specific methylation in the accommodation of plasmids, in the replication of DNA, in the regulation of gene function and in the restriction of viral infection are discussed.
Differential DNA Methylation in Relation to Age and Health Risks of Obesity
Directory of Open Access Journals (Sweden)
María Luisa Mansego
2015-07-01
Full Text Available The aim of this study was to evaluate whether genome-wide levels of DNA methylation are associated with age and the health risks of obesity (HRO; defined according to BMI categories as “Low HRO” (overweight and class 1 obesity versus “High HRO” (class 2 and class 3 obesity. Anthropometric measurements were assessed in a subsample of 48 volunteers from the Metabolic Syndrome Reduction in Navarra (RESMENA study and 24 women from another independent study, Effects of Lipoic Acid and Eicosapentaenoic Acid in Human Obesity (OBEPALIP study. In the pooled population; the methylation levels of 55 CpG sites were significantly associated with age after Benjamini-Hochberg correction. In addition, DNA methylation of three CpG sites located in ELOVL2; HOXC4 and PI4KB were further negatively associated with their mRNA levels. Although no differentially methylated CpG sites were identified in relation to HRO after multiple testing correction; several nominally significant CpG sites were identified in genes related to insulin signaling; energy and lipid metabolism. Moreover, statistically significant associations between BMI or mRNA levels and two HRO-related CpG sites located in GPR133 and ITGB5 are reported. As a conclusion, these findings from two Spanish cohorts add knowledge about the important role of DNA methylation in the age-related regulation of gene expression. In addition; a relevant influence of age on DNA methylation in white blood cells was found, as well as, on a trend level, novel associations between DNA methylation and obesity.
Pros and cons of methylation-based enrichment methods for ancient DNA
Seguin-Orlando, Andaine; Gamba, Cristina; Sarkissian, Clio Der; Ermini, Luca; Louvel, Guillaume; Boulygina, Eugenia; Sokolov, Alexey; Nedoluzhko, Artem; Lorenzen, Eline D.; Lopez, Patricio; McDonald, H. Gregory; Scott, Eric; Tikhonov, Alexei; Stafford,, Thomas W.; Alfarhan, Ahmed H.; Alquraishi, Saleh A.; Al-Rasheid, Khaled A. S.; Shapiro, Beth; Willerslev, Eske; Prokhortchouk, Egor; Orlando, Ludovic
2015-01-01
The recent discovery that DNA methylation survives in fossil material provides an opportunity for novel molecular approaches in palaeogenomics. Here, we apply to ancient DNA extracts the probe-independent Methylated Binding Domains (MBD)-based enrichment method, which targets DNA molecules containing methylated CpGs. Using remains of a Palaeo-Eskimo Saqqaq individual, woolly mammoths, polar bears and two equine species, we confirm that DNA methylation survives in a variety of tissues, environmental contexts and over a large temporal range (4,000 to over 45,000 years before present). MBD enrichment, however, appears principally biased towards the recovery of CpG-rich and long DNA templates and is limited by the fast post-mortem cytosine deamination rates of methylated epialleles. This method, thus, appears only appropriate for the analysis of ancient methylomes from very well preserved samples, where both DNA fragmentation and deamination have been limited. This work represents an essential step toward the characterization of ancient methylation signatures, which will help understanding the role of epigenetic changes in past environmental and cultural transitions. PMID:26134828
Common DNA methylation alterations in multiple brain regions in autism.
Ladd-Acosta, C; Hansen, K D; Briem, E; Fallin, M D; Kaufmann, W E; Feinberg, A P
2014-08-01
Autism spectrum disorders (ASD) are increasingly common neurodevelopmental disorders defined clinically by a triad of features including impairment in social interaction, impairment in communication in social situations and restricted and repetitive patterns of behavior and interests, with considerable phenotypic heterogeneity among individuals. Although heritability estimates for ASD are high, conventional genetic-based efforts to identify genes involved in ASD have yielded only few reproducible candidate genes that account for only a small proportion of ASDs. There is mounting evidence to suggest environmental and epigenetic factors play a stronger role in the etiology of ASD than previously thought. To begin to understand the contribution of epigenetics to ASD, we have examined DNA methylation (DNAm) in a pilot study of postmortem brain tissue from 19 autism cases and 21 unrelated controls, among three brain regions including dorsolateral prefrontal cortex, temporal cortex and cerebellum. We measured over 485,000 CpG loci across a diverse set of functionally relevant genomic regions using the Infinium HumanMethylation450 BeadChip and identified four genome-wide significant differentially methylated regions (DMRs) using a bump hunting approach and a permutation-based multiple testing correction method. We replicated 3/4 DMRs identified in our genome-wide screen in a different set of samples and across different brain regions. The DMRs identified in this study represent suggestive evidence for commonly altered methylation sites in ASD and provide several promising new candidate genes.
Neuronal DNA Methylation Profiling of Blast-Related Traumatic Brain Injury.
Haghighi, Fatemeh; Ge, Yongchao; Chen, Sean; Xin, Yurong; Umali, Michelle U; De Gasperi, Rita; Gama Sosa, Miguel A; Ahlers, Stephen T; Elder, Gregory A
2015-08-15
Long-term molecular changes in the brain resulting from blast exposure may be mediated by epigenetic changes, such as deoxyribonucleic acid (DNA) methylation, that regulate gene expression. Aberrant regulation of gene expression is associated with behavioral abnormalities, where DNA methylation bridges environmental signals to sustained changes in gene expression. We assessed DNA methylation changes in the brains of rats exposed to three 74.5 kPa blast overpressure events, conditions that have been associated with long-term anxiogenic manifestations weeks or months following the initial exposures. Rat frontal cortex eight months post-exposure was used for cell sorting of whole brain tissue into neurons and glia. We interrogated DNA methylation profiles in these cells using Expanded Reduced Representation Bisulfite Sequencing. We obtained data for millions of cytosines, showing distinct methylation profiles for neurons and glia and an increase in global methylation in neuronal versus glial cells (pDNA methylation perturbations in blast overpressure-exposed animals, compared with sham blast controls, within 458 and 379 genes in neurons and glia, respectively. Differentially methylated neuronal genes showed enrichment in cell death and survival and nervous system development and function, including genes involved in transforming growth factor β and nitric oxide signaling. Functional validation via gene expression analysis of 30 differentially methylated neuronal and glial genes showed a 1.2 fold change in gene expression of the serotonin N-acetyltransferase gene (Aanat) in blast animals (pDNA methylation induced in response to multiple blast overpressure exposures. In particular, increased methylation and decreased gene expression were observed in the Aanat gene, which is involved in converting serotonin to the circadian hormone melatonin and is implicated in sleep disturbance and depression associated with traumatic brain injury.
Directory of Open Access Journals (Sweden)
Yongmei Zhang
Full Text Available The persistence of hepatitis B virus (HBV infection is maintained by the nuclear viral covalently closed circular DNA (cccDNA, which serves as transcription template for viral mRNAs. Previous studies suggested that cccDNA contains methylation-prone CpG islands, and that the minichromosome structure of cccDNA is epigenetically regulated by DNA methylation. However, the regulatory effect of each CpG island methylation on cccDNA activity remains elusive. In the present study, we analyzed the distribution of CpG methylation within cccDNA in patient samples and investigated the impact of CpG island methylation on cccDNA-driven virus replication. Our study revealed the following observations: 1 Bisulfite sequencing of cccDNA from chronic hepatitis B patients indicated that CpG island I was seldom methylated, 2 CpG island II methylation was correlated to the low level of serum HBV DNA in patients, and in vitro methylation studies confirmed that CpG island II methylation markedly reduced cccDNA transcription and subsequent viral core DNA replication, 3 CpG island III methylation was associated with low serum HBsAg titers, and 4 Furthermore, we found that HBV genotype, HBeAg positivity, and patient age and liver fibrosis stage were also relevant to cccDNA CpG methylation status. Therefore, we clearly demonstrated that the status of cccDNA methylation is connected to the biological behavior of HBV. Taken together, our study provides a complete profile of CpG island methylation within HBV cccDNA and new insights for the function of CpG methylation in regulating HBV cccDNA transcription.
Directory of Open Access Journals (Sweden)
Iwasaki Motoki
2012-07-01
Full Text Available Abstract Background Although global hypomethylation of leukocyte DNA has been associated with an increased risk of several sites of cancer, including breast cancer, determinants of global methylation level among healthy individuals remain largely unexplored. Here, we examined whether postmenopausal endogenous sex hormones were associated with the global methylation level of leukocyte DNA. Methods A cross-sectional study was conducted using the control group of a breast cancer case–control study in Nagano, Japan. Subjects were postmenopausal women aged 55 years or over who provided blood samples. We measured global methylation level of peripheral blood leukocyte DNA by luminometric methylation assay; estradiol, estrone, androstenedione, dehydroepiandrosterone sulfate, testosterone and free testosterone by radioimmunoassay; bioavailable estradiol by the ammonium sulfate precipitation method; and sex-hormone binding globulin by immunoradiometric assay. A linear trend of association between methylation and hormone levels was evaluated by regression coefficients in a multivariable liner regression model. A total of 185 women were included in the analyses. Results Mean global methylation level (standard deviation was 70.3% (3.1 and range was from 60.3% to 79.2%. Global methylation level decreased 0.27% per quartile category for estradiol and 0.39% per quartile category for estrone while it increased 0.41% per quartile category for bioavailable estradiol. However, we found no statistically significant association of any sex hormone level measured in the present study with global methylation level of leukocyte DNA. Conclusions Our findings suggest that endogenous sex hormones are not major determinants of the global methylation level of leukocyte DNA.
Kalmár, Alexandra; Péterfia, Bálint; Hollósi, Péter; Wichmann, Barnabás; Bodor, András; Patai, Árpád V; Schöller, Andrea; Krenács, Tibor; Tulassay, Zsolt; Molnár, Béla
2015-09-01
We aimed to test the applicability of formalin-fixed and paraffin-embedded (FFPE) tissue samples for gene specific DNA methylation analysis after using two commercially available DNA isolation kits. Genomic DNA was isolated from 5 colorectal adenocarcinomas and 5 normal adjacent tissues from "recent", collected within 6 months, and "archived", collected more than 5 years ago, FFPE tissues using either High Pure FFPET DNA Isolation kit or QIAamp DNA FFPE Tissue kit. DNA methylation analysis of MAL, SFRP1 and SFRP2 genes, known to be hypermethylated in CRC, was performed using methylation-sensitive high resolution melting (MS-HRM) analysis and sequencing. QIAamp (Q) method resulted in slightly higher recovery in archived (HP: 1.22 ± 3.18 μg DNA; Q: 3.00 ± 4.04 μg DNA) and significantly (p < 0.05) higher recovery in recent samples compared to High Pure method (HP) (HP: 4.10 ± 2.91 μg DNA; Q: 11.51 ± 7.50 μg DNA). Both OD260/280 and OD260/230 ratios were lower, but still high in the High Pure isolated archived and recent samples compared to those isolated with QIAamp. Identical DNA methylation patterns were detected for all 3 genes tested by MS-HRM with both isolation kits in the recent group. However, despite of higher DNA recovery in QIAamp slightly more reproducible methylation results were obtained from High Pure isolated archived samples. Sequencing confirmed DNA hypermethylation in CRCs. In conclusion, reproducible DNA methylation patterns were obtained from recent samples using both isolation kits. However, long term storage may affect the reliability of the results leading to moderate differences between the efficiency of isolation kits.
Decreased miR-106a inhibits glioma cell glucose uptake and proliferation by targeting SLC2A3 in GBM.
Dai, Dong-Wei; Lu, Qiong; Wang, Lai-Xing; Zhao, Wen-Yuan; Cao, Yi-Qun; Li, Ya-Nan; Han, Guo-Sheng; Liu, Jian-Min; Yue, Zhi-Jian
2013-10-14
MiR-106a is frequently down-regulated in various types of human cancer. However the underlying mechanism of miR-106a involved in glioma remains elusive. The association of miR-106a with glioma grade and patient survival was analyzed. The biological function and target of miR-106a were determined by bioinformatic analysis and cell experiments (Western blot, luciferase reporter, cell cycle, ntracellular ATP production and glucose uptake assay). Finally, rescue expression of its target SLC2A3 was used to test the role of SLC2A3 in miR-106a-mediated cell glycolysis and proliferation. Here we showed that miR-106a was a tumor suppressor miRNA was involved in GBM cell glucose uptake and proliferation. Decreased miR-106a in GBM tissues and conferred a poor survival of GBM patients. SLC2A3 was identified as a core target of miR-106a in GBM cells. Inhibition of SLC2A3 by miR-106a attenuated cell proliferation and inhibited glucose uptake. In addition, for each biological process we identified ontology-associated transcripts that significantly correlated with SLC2A3 expression. Finally, the expression of SLC2A3 largely abrogated miR-106a-mediated cell proliferation and glucose uptake in GBM cells. Taken together, miR-106a and SLC2A3 could be potential therapeutic approaches for GBM.
Boulet, Aren; Vest, Katherine E; Maynard, Margaret K; Gammon, Micah G; Russell, Antoinette C; Mathews, Alexander T; Cole, Shelbie E; Zhu, Xinyu; Phillips, Casey B; Kwong, Jennifer Q; Dodani, Sheel C; Leary, Scot C; Cobine, Paul A
2018-02-09
Copper is required for the activity of cytochrome c oxidase (COX), the terminal electron-accepting complex of the mitochondrial respiratory chain. The likely source of copper used for COX biogenesis is a labile pool found in the mitochondrial matrix. In mammals, the proteins that transport copper across the inner mitochondrial membrane remain unknown. We previously reported that the mitochondrial carrier family protein Pic2 in budding yeast is a copper importer. The closest Pic2 ortholog in mammalian cells is the mitochondrial phosphate carrier SLC25A3. Here, to investigate whether SLC25A3 also transports copper, we manipulated its expression in several murine and human cell lines. SLC25A3 knockdown or deletion consistently resulted in an isolated COX deficiency in these cells, and copper addition to the culture medium suppressed these biochemical defects. Consistent with a conserved role for SLC25A3 in copper transport, its heterologous expression in yeast complemented copper-specific defects observed upon deletion of PIC2 Additionally, assays in Lactococcus lactis and in reconstituted liposomes directly demonstrated that SLC25A3 functions as a copper transporter. Taken together, these data indicate that SLC25A3 can transport copper both in vitro and in vivo . © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Ogino, S; Cantor, M; Kawasaki, T; Brahmandam, M; Kirkner, G J; Weisenberger, D J; Campan, M; Laird, P W; Loda, M; Fuchs, C S
2006-07-01
The concept of CpG island methylator phenotype (CIMP) is not universally accepted. Even if specific clinicopathological features have been associated with CIMP, investigators often failed to demonstrate a bimodal distribution of the number of methylated markers, which would suggest CIMP as a distinct subtype of colorectal cancer. Previous studies primarily used methylation specific polymerase chain reaction which might detect biologically insignificant low levels of methylation. To demonstrate a distinct genetic profile of CIMP colorectal cancer using quantitative DNA methylation analysis that can distinguish high from low levels of DNA methylation. We developed quantitative real time polymerase chain reaction (MethyLight) assays and measured DNA methylation (percentage of methylated reference) of five carefully selected loci (promoters of CACNA1G, CDKN2A (p16), CRABP1, MLH1, and NEUROG1) in 460 colorectal cancers from large prospective cohorts. There was a clear bimodal distribution of 80 microsatellite instability-high (MSI-H) tumours according to the number of methylated promoters, with no tumours showing 3/5 methylated loci. Thus we defined CIMP as having >or=4/5 methylated loci, and 17% (78) of the 460 tumours were classified as CIMP. CIMP was significantly associated with female sex, MSI, BRAF mutations, and wild-type KRAS. Both CIMP MSI-H tumours and CIMP microsatellite stable (MSS) tumours showed much higher frequencies of BRAF mutations (63% and 54%) than non-CIMP counterparts (non-CIMP MSI-H (0%, pCIMP MSS tumours (6.6%, pCIMP is best characterised by quantitative DNA methylation analysis. CIMP is a distinct epigenotype of colorectal cancer and may be less frequent than previously reported.
DNA Methylation: An Epigenetic Risk Factor in Preterm Birth
Menon, Ramkumar; Conneely, Karen N.; Smith, Alicia K.
2012-01-01
Spontaneous preterm birth (PTB; birth prior to 37 weeks of gestation) is a complex phenotype with multiple risk factors that complicate our understanding of its etiology. A number of recent studies have supported the hypothesis that epigenetic modifications such as DNA methylation induced by pregnancy-related risk factors may influence the risk of PTB or result in changes that predispose a neonate to adult-onset diseases. The critical role of timing of gene expression in the etiology of PTB makes it a highly relevant disorder in which to examine the potential role of epigenetic changes. Because changes in DNA methylation patterns can result in long-term consequences, it is of critical interest to identify the epigenetic patterns associated with adverse pregnancy outcomes. This review examines the potential role of DNA methylation as a risk factor for PTB and discusses several issues and limitations that should be considered when planning DNA methylation studies. PMID:22228737
The multi-domain protein Np95 connects DNA methylation and histone modification
Rottach, Andrea; Frauer, Carina; Pichler, Garwin; Bonapace, Ian Marc; Spada, Fabio; Leonhardt, Heinrich
2010-01-01
DNA methylation and histone modifications play a central role in the epigenetic regulation of gene expression and cell differentiation. Recently, Np95 (also known as UHRF1 or ICBP90) has been found to interact with Dnmt1 and to bind hemimethylated DNA, indicating together with genetic studies a central role in the maintenance of DNA methylation. Using in vitro binding assays we observed a weak preference of Np95 and its SRA (SET- and Ring-associated) domain for hemimethylated CpG sites. However, the binding kinetics of Np95 in living cells was not affected by the complete loss of genomic methylation. Investigating further links with heterochromatin, we could show that Np95 preferentially binds histone H3 N-terminal tails with trimethylated (H3K9me3) but not acetylated lysine 9 via a tandem Tudor domain. This domain contains three highly conserved aromatic amino acids that form an aromatic cage similar to the one binding H3K9me3 in the chromodomain of HP1ß. Mutations targeting the aromatic cage of the Np95 tandem Tudor domain (Y188A and Y191A) abolished specific H3 histone tail binding. These multiple interactions of the multi-domain protein Np95 with hemimethylated DNA and repressive histone marks as well as with DNA and histone methyltransferases integrate the two major epigenetic silencing pathways. PMID:20026581
Loss of maintenance DNA methylation results in abnormal DNA origin firing during DNA replication
Energy Technology Data Exchange (ETDEWEB)
Haruta, Mayumi [Department of Cell Biology, Graduate School of Medical Sciences, Nagoya City University, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan); Shimada, Midori, E-mail: midorism@med.nagoya-cu.ac.jp [Department of Cell Biology, Graduate School of Medical Sciences, Nagoya City University, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan); Nishiyama, Atsuya; Johmura, Yoshikazu [Department of Cell Biology, Graduate School of Medical Sciences, Nagoya City University, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan); Le Tallec, Benoît; Debatisse, Michelle [Institut Curie, Centre de Recherche, 26 rue d’Ulm, CNRS UMR 3244, 75248 ParisCedex 05 (France); Nakanishi, Makoto, E-mail: mkt-naka@med.nagoya-cu.ac.jp [Department of Cell Biology, Graduate School of Medical Sciences, Nagoya City University, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan)
2016-01-22
The mammalian maintenance methyltransferase DNMT1 [DNA (cytosine-5-)-methyltransferase 1] mediates the inheritance of the DNA methylation pattern during replication. Previous studies have shown that depletion of DNMT1 causes a severe growth defect and apoptosis in differentiated cells. However, the detailed mechanisms behind this phenomenon remain poorly understood. Here we show that conditional ablation of Dnmt1 in murine embryonic fibroblasts (MEFs) resulted in an aberrant DNA replication program showing an accumulation of late-S phase replication and causing severely defective growth. Furthermore, we found that the catalytic activity and replication focus targeting sequence of DNMT1 are required for a proper DNA replication program. Taken together, our findings suggest that the maintenance of DNA methylation by DNMT1 plays a critical role in proper regulation of DNA replication in mammalian cells. - Highlights: • DNMT1 depletion results in an abnormal DNA replication program. • Aberrant DNA replication is independent of the DNA damage checkpoint in DNMT1cKO. • DNMT1 catalytic activity and RFT domain are required for proper DNA replication. • DNMT1 catalytic activity and RFT domain are required for cell proliferation.
Loss of maintenance DNA methylation results in abnormal DNA origin firing during DNA replication
International Nuclear Information System (INIS)
Haruta, Mayumi; Shimada, Midori; Nishiyama, Atsuya; Johmura, Yoshikazu; Le Tallec, Benoît; Debatisse, Michelle; Nakanishi, Makoto
2016-01-01
The mammalian maintenance methyltransferase DNMT1 [DNA (cytosine-5-)-methyltransferase 1] mediates the inheritance of the DNA methylation pattern during replication. Previous studies have shown that depletion of DNMT1 causes a severe growth defect and apoptosis in differentiated cells. However, the detailed mechanisms behind this phenomenon remain poorly understood. Here we show that conditional ablation of Dnmt1 in murine embryonic fibroblasts (MEFs) resulted in an aberrant DNA replication program showing an accumulation of late-S phase replication and causing severely defective growth. Furthermore, we found that the catalytic activity and replication focus targeting sequence of DNMT1 are required for a proper DNA replication program. Taken together, our findings suggest that the maintenance of DNA methylation by DNMT1 plays a critical role in proper regulation of DNA replication in mammalian cells. - Highlights: • DNMT1 depletion results in an abnormal DNA replication program. • Aberrant DNA replication is independent of the DNA damage checkpoint in DNMT1cKO. • DNMT1 catalytic activity and RFT domain are required for proper DNA replication. • DNMT1 catalytic activity and RFT domain are required for cell proliferation.
Crescenti, Anna; Solà, Rosa; Valls, Rosa M; Caimari, Antoni; Del Bas, Josep M; Anguera, Anna; Anglés, Neus; Arola, Lluís
2013-01-01
DNA methylation regulates gene expression and can be modified by different bioactive compounds in foods, such as polyphenols. Cocoa is a rich source of polyphenols, but its role in DNA methylation is still unknown. The objective was to assess the effect of cocoa consumption on DNA methylation and to determine whether the enzymes involved in the DNA methylation process participate in the mechanisms by which cocoa exerts these effects in humans. The global DNA methylation levels in the peripheral blood were evaluated in 214 volunteers who were pre-hypertensive, stage-1 hypertensive or hypercholesterolemic. The volunteers were divided into two groups: 110 subjects who consumed cocoa (6 g/d) for two weeks and 104 control subjects. In addition, the peripheral blood mononuclear cells (PBMCs) from six subjects were treated with a cocoa extract to analyze the mRNA levels of the DNA methyltransferases (DNMTs), methylenetetrahydrofolate reductase (MTHFR), and methionine synthase reductase (MTRR) genes. Cocoa consumption significantly reduced the DNA methylation levels (2.991±0.366 vs. 3.909±0.380, pcocoa effects on DNA methylation and three polymorphisms located in the MTHFR, MTRR, and DNMT3B genes. Furthermore, in PBMCs, the cocoa extract significantly lowered the mRNA levels of the DNMTs, MTHFR, and MTRR. Our study demonstrates for the first time that the consumption of cocoa decreases the global DNA methylation of peripheral leukocytes in humans with cardiovascular risk factors. In vitro experiments with PBMCs suggest that cocoa may exert this effect partially via the down-regulation of DNMTs, MTHFR and MTRR, which are key genes involved in this epigenetic process. Clinicaltrials.govNCT00511420 and NCT00502047.
LINE-1 methylation levels in leukocyte DNA and risk of renal cell cancer.
Directory of Open Access Journals (Sweden)
Linda M Liao
Full Text Available Leukocyte global DNA methylation levels are currently being considered as biomarkers of cancer susceptibility and have been associated with risk of several cancers. In this study, we aimed to examine the association between long interspersed nuclear elements (LINE-1 methylation levels, as a biomarker of global DNA methylation in blood cell DNA, and renal cell cancer risk.LINE-1 methylation of bisulfite-converted genomic DNA isolated from leukocytes was quantified by pyrosequencing measured in triplicate, and averaged across 4 CpG sites. A total of 328 RCC cases and 654 controls frequency-matched(2∶1 on age(±5years, sex and study center, from a large case-control study conducted in Central and Eastern Europe were evaluated.LINE-1 methylation levels were significantly higher in RCC cases with a median of 81.97% (interquartile range[IQR]: 80.84-83.47 compared to 81.67% (IQR: 80.35-83.03 among controls (p = 0.003, Wilcoxon. Compared to the lowest LINE-1 methylation quartile(Q1, the adjusted ORs for increasing methylation quartiles were as follows: OR(Q2 = 1.84(1.20-2.81, OR(Q3 = 1.72(1.11-2.65 and OR(Q4 = 2.06(1.34-3.17, with a p-trend = 0.004. The association was stronger among current smokers (p-trend<0.001 than former or never smokers (p-interaction = 0.03. To eliminate the possibility of selection bias among controls, the relationship between LINE-1 methylation and smoking was evaluated and confirmed in a case-only analysis, as well.Higher levels of LINE-1 methylation appear to be positively associated with RCC risk, particularly among current smokers. Further investigations using both post- and pre-diagnostic genomic DNA is warranted to confirm findings and will be necessary to determine whether the observed differences occur prior to, or as a result of carcinogenesis.
Yegnasubramanian, Srinivasan; Lin, Xiaohui; Haffner, Michael C; DeMarzo, Angelo M; Nelson, William G
2006-02-09
Hypermethylation of CpG island (CGI) sequences is a nearly universal somatic genome alteration in cancer. Rapid and sensitive detection of DNA hypermethylation would aid in cancer diagnosis and risk stratification. We present a novel technique, called COMPARE-MS, that can rapidly and quantitatively detect CGI hypermethylation with high sensitivity and specificity in hundreds of samples simultaneously. To quantitate CGI hypermethylation, COMPARE-MS uses real-time PCR of DNA that was first digested by methylation-sensitive restriction enzymes and then precipitated by methyl-binding domain polypeptides immobilized on a magnetic solid matrix. We show that COMPARE-MS could detect five genome equivalents of methylated CGIs in a 1000- to 10,000-fold excess of unmethylated DNA. COMPARE-MS was used to rapidly quantitate hypermethylation at multiple CGIs in >155 prostate tissues, including benign and malignant prostate specimens, and prostate cell lines. This analysis showed that GSTP1, MDR1 and PTGS2 CGI hypermethylation as determined by COMPARE-MS could differentiate between malignant and benign prostate with sensitivities >95% and specificities approaching 100%. This novel technology could significantly improve our ability to detect CGI hypermethylation.
What do unicellular organisms teach us about DNA methylation?
Harony, Hala; Ankri, Serge
2008-05-01
DNA methylation is an epigenetic hallmark that has been studied intensively in mammals and plants. However, knowledge of this phenomenon in unicellular organisms is scanty. Examining epigenetic regulation, and more specifically DNA methylation, in these organisms represents a unique opportunity to better understand their biology. The determination of their methylation status is often complicated by the presence of several differentiation stages in their life cycle. This article focuses on some recent advances that have revealed the unexpected nature of the epigenetic determinants present in protozoa. The role of the enigmatic DNA methyltransferase Dnmt2 in unicellular organisms is discussed.
OCD candidate gene SLC1A1/EAAT3 impacts basal ganglia-mediated activity and stereotypic behavior.
Zike, Isaac D; Chohan, Muhammad O; Kopelman, Jared M; Krasnow, Emily N; Flicker, Daniel; Nautiyal, Katherine M; Bubser, Michael; Kellendonk, Christoph; Jones, Carrie K; Stanwood, Gregg; Tanaka, Kenji Fransis; Moore, Holly; Ahmari, Susanne E; Veenstra-VanderWeele, Jeremy
2017-05-30
Obsessive-compulsive disorder (OCD) is a chronic, disabling condition with inadequate treatment options that leave most patients with substantial residual symptoms. Structural, neurochemical, and behavioral findings point to a significant role for basal ganglia circuits and for the glutamate system in OCD. Genetic linkage and association studies in OCD point to SLC1A1 , which encodes the neuronal glutamate/aspartate/cysteine transporter excitatory amino acid transporter 3 (EAAT3)/excitatory amino acid transporter 1 (EAAC1). However, no previous studies have investigated EAAT3 in basal ganglia circuits or in relation to OCD-related behavior. Here, we report a model of Slc1a1 loss based on an excisable STOP cassette that yields successful ablation of EAAT3 expression and function. Using amphetamine as a probe, we found that EAAT3 loss prevents expected increases in ( i ) locomotor activity, ( ii ) stereotypy, and ( iii ) immediate early gene induction in the dorsal striatum following amphetamine administration. Further, Slc1a1 -STOP mice showed diminished grooming in an SKF-38393 challenge experiment, a pharmacologic model of OCD-like grooming behavior. This reduced grooming is accompanied by reduced dopamine D 1 receptor binding in the dorsal striatum of Slc1a1 -STOP mice. Slc1a1 -STOP mice also exhibit reduced extracellular dopamine concentrations in the dorsal striatum both at baseline and following amphetamine challenge. Viral-mediated restoration of Slc1a1 /EAAT3 expression in the midbrain but not in the striatum results in partial rescue of amphetamine-induced locomotion and stereotypy in Slc1a1 -STOP mice, consistent with an impact of EAAT3 loss on presynaptic dopaminergic function. Collectively, these findings indicate that the most consistently associated OCD candidate gene impacts basal ganglia-dependent repetitive behaviors.
Saunderson, Emily A.; Spiers, Helen; Gutierrez-Mecinas, Maria; Trollope, Alexandra F.; Shaikh, Abeera; Mill, Jonathan; Reul, Johannes M. H. M.
2016-01-01
Stressful events evoke long-term changes in behavioral responses; however, the underlying mechanisms in the brain are not well understood. Previous work has shown that epigenetic changes and immediate-early gene (IEG) induction in stress-activated dentate gyrus (DG) granule neurons play a crucial role in these behavioral responses. Here, we show that an acute stressful challenge [i.e., forced swimming (FS)] results in DNA demethylation at specific CpG (5′-cytosine–phosphate–guanine-3′) sites close to the c-Fos (FBJ murine osteosarcoma viral oncogene homolog) transcriptional start site and within the gene promoter region of Egr-1 (early growth response protein 1) specifically in the DG. Administration of the (endogenous) methyl donor S-adenosyl methionine (SAM) did not affect CpG methylation and IEG gene expression at baseline. However, administration of SAM before the FS challenge resulted in an enhanced CpG methylation at the IEG loci and suppression of IEG induction specifically in the DG and an impaired behavioral immobility response 24 h later. The stressor also specifically increased the expression of the de novo DNA methyltransferase Dnmt3a [DNA (cytosine-5-)-methyltransferase 3 alpha] in this hippocampus region. Moreover, stress resulted in an increased association of Dnmt3a enzyme with the affected CpG loci within the IEG genes. No effects of SAM were observed on stress-evoked histone modifications, including H3S10p-K14ac (histone H3, phosphorylated serine 10 and acetylated lysine-14), H3K4me3 (histone H3, trimethylated lysine-4), H3K9me3 (histone H3, trimethylated lysine-9), and H3K27me3 (histone H3, trimethylated lysine-27). We conclude that the DNA methylation status of IEGs plays a crucial role in FS-induced IEG induction in DG granule neurons and associated behavioral responses. In addition, the concentration of available methyl donor, possibly in conjunction with Dnmt3a, is critical for the responsiveness of dentate neurons to environmental
Directory of Open Access Journals (Sweden)
Fabian R. Reimold
2015-06-01
Full Text Available Congenital chloride diarrhea is an autosomal recessive disease caused by mutations in the intestinal lumenal membrane Cl-/HCO3- exchanger, SLC26A3.We report here the novel SLC26A3 mutation G393W in a Mexican child, the first such report in a patient from Central America. SLC26A3 G393W expression in Xenopus oocytes exhibits a mild hypomorphic phenotype, with normal surface expression and moderately reduced anion transport function. However, expression of HA-SLC26A3 in HEK-293 cells reveals intracellular retention and greatly decreased steady-state levels of the mutant polypeptide, in contrast to peripheral membrane expression of the wildtype protein. Whereas wildtype HA-SLC26A3 is apically localized in polarized monolayers of filter-grown MDCK cells and Caco2 cells, mutant HA-SLC26A3 G393W exhibits decreased total polypeptide abundance, with reduced or absent surface expression and sparse punctate (or absent intracellular distribution. The WT protein is similarly localized in LLCPK1 cells, but the mutant fails to accumulate to detectable levels. We conclude that the chloride-losing diarrhea phenotype associated with homozygous expression of SLC26A3 G393W likely reflects lack of apical surface expression in enterocytes, secondary to combined abnormalities in polypeptide trafficking and stability. Future progress in development of general or target-specific folding chaperonins and correctors may hold promise for pharmacological rescue of this and similar genetic defects in membrane protein targeting.
Canovas, Sebastian; Ross, Pablo J; Kelsey, Gavin; Coy, Pilar
2017-11-01
DNA methylation can be considered a component of epigenetic memory with a critical role during embryo development, and which undergoes dramatic reprogramming after fertilization. Though it has been a focus of research for many years, the reprogramming mechanism is still not fully understood. Recent results suggest that absence of maintenance at DNA replication is a major factor, and that there is an unexpected role for TET3-mediated oxidation of 5mC to 5hmC in guarding against de novo methylation. Base-resolution and genome-wide profiling methods are enabling more comprehensive assessments of the extent to which ART might impair DNA methylation reprogramming, and which sequence elements are most vulnerable. Indeed, as we also review here, studies showing the effect of culture media, ovarian stimulation or embryo transfer on the methylation pattern of embryos emphasize the need to face ART-associated defects and search for strategies to mitigate adverse effects on the health of ART-derived children. © 2017 WILEY Periodicals, Inc.
DNA Methylation program in normal and alcohol-induced thinning cortex.
Öztürk, Nail Can; Resendiz, Marisol; Öztürk, Hakan; Zhou, Feng C
2017-05-01
While cerebral underdevelopment is a hallmark of fetal alcohol spectrum disorders (FASD), the mechanism(s) guiding the broad cortical neurodevelopmental deficits are not clear. DNA methylation is known to regulate early development and tissue specification through gene regulation. Here, we examined DNA methylation in the onset of alcohol-induced cortical thinning in a mouse model of FASD. C57BL/6 (B6) mice were administered a 4% alcohol (v/v) liquid diet from embryonic (E) days 7-16, and their embryos were harvested at E17, along with isocaloric liquid diet and lab chow controls. Cortical neuroanatomy, neural phenotypes, and epigenetic markers of methylation were assessed using immunohistochemistry, Western blot, and methyl-DNA assays. We report that cortical thickness, neuroepithelial proliferation, and neuronal migration and maturity were found to be deterred by alcohol at E17. Simultaneously, DNA methylation, including 5-methylcytosine (5mC) and 5-hydroxcylmethylcytosine (5hmC), which progresses as an intrinsic program guiding normal embryonic cortical development, was severely affected by in utero alcohol exposure. The intricate relationship between cortical thinning and this DNA methylation program disruption is detailed and illustrated. DNA methylation, dynamic across the multiple cortical layers during the late embryonic stage, is highly disrupted by fetal alcohol exposure; this disruption occurs in tandem with characteristic developmental abnormalities, ranging from structural to molecular. Finally, our findings point to a significant question for future exploration: whether epigenetics guides neurodevelopment or whether developmental conditions dictate epigenetic dynamics in the context of alcohol-induced cortical teratogenesis. Copyright © 2017 Elsevier Inc. All rights reserved.
Avramidou, Evangelia V; Doulis, Andreas G; Aravanopoulos, Filippos A
2015-05-15
Genetic inheritance and epigenetic inheritance are significant determinants of plant evolution, adaptation and plasticity. We studied inheritance of restriction site polymorphisms by the f-AFLP method and epigenetic DNA cytosine methylation inheritance by the f-MSAP technique. The study involved parents and 190 progeny of a Cupressus sempervirens L. full-sib family. Results from AFLP genetic data revealed that 71.8% of the fragments studied are under Mendelian genetic control, whereas faithful Mendelian inheritance for the MSAP fragments was low (4.29%). Further, MSAP fragment analysis showed that total methylation presented a mean of 28.2%, which was higher than the midparent value, while maternal inheritance was higher (5.65%) than paternal (3.01%). Interestingly de novo methylation in the progeny was high (19.65%) compared to parental methylation. Genetic and epigenetic distances for parents and offspring were not correlated (R(2)=0.0005). Furthermore, we studied correlation of total relative methylation and CG methylation with growth (height, diameter). We found CG/CNG methylation (N: A, C, T) to be positively correlated with height and diameter, while total relative methylation and CG methylation were positively correlated with height. Results are discussed in light of further research needed and of their potential application in breeding. Copyright © 2015 Elsevier B.V. All rights reserved.
Genome-wide DNA methylation patterns and transcription analysis in sheep muscle.
Directory of Open Access Journals (Sweden)
Christine Couldrey
Full Text Available DNA methylation plays a central role in regulating many aspects of growth and development in mammals through regulating gene expression. The development of next generation sequencing technologies have paved the way for genome-wide, high resolution analysis of DNA methylation landscapes using methodology known as reduced representation bisulfite sequencing (RRBS. While RRBS has proven to be effective in understanding DNA methylation landscapes in humans, mice, and rats, to date, few studies have utilised this powerful method for investigating DNA methylation in agricultural animals. Here we describe the utilisation of RRBS to investigate DNA methylation in sheep Longissimus dorsi muscles. RRBS analysis of ∼1% of the genome from Longissimus dorsi muscles provided data of suitably high precision and accuracy for DNA methylation analysis, at all levels of resolution from genome-wide to individual nucleotides. Combining RRBS data with mRNAseq data allowed the sheep Longissimus dorsi muscle methylome to be compared with methylomes from other species. While some species differences were identified, many similarities were observed between DNA methylation patterns in sheep and other more commonly studied species. The RRBS data presented here highlights the complexity of epigenetic regulation of genes. However, the similarities observed across species are promising, in that knowledge gained from epigenetic studies in human and mice may be applied, with caution, to agricultural species. The ability to accurately measure DNA methylation in agricultural animals will contribute an additional layer of information to the genetic analyses currently being used to maximise production gains in these species.
DNMT1-interacting RNAs block gene specific DNA methylation
Di Ruscio, Annalisa; Ebralidze, Alexander K.; Benoukraf, Touati; Amabile, Giovanni; Goff, Loyal A.; Terragni, Joylon; Figueroa, Maria Eugenia; De Figureido Pontes, Lorena Lobo; Alberich-Jorda, Meritxell; Zhang, Pu; Wu, Mengchu; D’Alò, Francesco; Melnick, Ari; Leone, Giuseppe; Ebralidze, Konstantin K.; Pradhan, Sriharsa; Rinn, John L.; Tenen, Daniel G.
2013-01-01
Summary DNA methylation was described almost a century ago. However, the rules governing its establishment and maintenance remain elusive. Here, we present data demonstrating that active transcription regulates levels of genomic methylation. We identified a novel RNA arising from the CEBPA gene locus critical in regulating the local DNA methylation profile. This RNA binds to DNMT1 and prevents CEBPA gene locus methylation. Deep sequencing of transcripts associated with DNMT1 combined with genome-scale methylation and expression profiling extended the generality of this finding to numerous gene loci. Collectively, these results delineate the nature of DNMT1-RNA interactions and suggest strategies for gene selective demethylation of therapeutic targets in disease. PMID:24107992
Directory of Open Access Journals (Sweden)
Nahid Turan
2010-07-01
Full Text Available Epidemiological studies have reported a higher incidence of rare disorders involving imprinted genes among children conceived using assisted reproductive technology (ART, suggesting that ART procedures may be disruptive to imprinted gene methylation patterns. We examined intra- and inter-individual variation in DNA methylation at the differentially methylated regions (DMRs of the IGF2/H19 and IGF2R loci in a population of children conceived in vitro or in vivo. We found substantial variation in allele-specific methylation at both loci in both groups. Aberrant methylation of the maternal IGF2/H19 DMR was more common in the in vitro group, and the overall variance was also significantly greater in the in vitro group. We estimated the number of trophoblast stem cells in each group based on approximation of the variance of the binomial distribution of IGF2/H19 methylation ratios, as well as the distribution of X chromosome inactivation scores in placenta. Both of these independent measures indicated that placentas of the in vitro group were derived from fewer stem cells than the in vivo conceived group. Both IGF2 and H19 mRNAs were significantly lower in placenta from the in vitro group. Although average birth weight was lower in the in vitro group, we found no correlation between birth weight and IGF2 or IGF2R transcript levels or the ratio of IGF2/IGF2R transcript levels. Our results show that in vitro conception is associated with aberrant methylation patterns at the IGF2/H19 locus. However, very little of the inter- or intra-individual variation in H19 or IGF2 mRNA levels can be explained by differences in maternal DMR DNA methylation, in contrast to the expectations of current transcriptional imprinting models. Extraembryonic tissues of embryos cultured in vitro appear to be derived from fewer trophoblast stem cells. It is possible that this developmental difference has an effect on placental and fetal growth.
Genome-Wide Prediction of DNA Methylation Using DNA Composition and Sequence Complexity in Human.
Wu, Chengchao; Yao, Shixin; Li, Xinghao; Chen, Chujia; Hu, Xuehai
2017-02-16
DNA methylation plays a significant role in transcriptional regulation by repressing activity. Change of the DNA methylation level is an important factor affecting the expression of target genes and downstream phenotypes. Because current experimental technologies can only assay a small proportion of CpG sites in the human genome, it is urgent to develop reliable computational models for predicting genome-wide DNA methylation. Here, we proposed a novel algorithm that accurately extracted sequence complexity features (seven features) and developed a support-vector-machine-based prediction model with integration of the reported DNA composition features (trinucleotide frequency and GC content, 65 features) by utilizing the methylation profiles of embryonic stem cells in human. The prediction results from 22 human chromosomes with size-varied windows showed that the 600-bp window achieved the best average accuracy of 94.7%. Moreover, comparisons with two existing methods further showed the superiority of our model, and cross-species predictions on mouse data also demonstrated that our model has certain generalization ability. Finally, a statistical test of the experimental data and the predicted data on functional regions annotated by ChromHMM found that six out of 10 regions were consistent, which implies reliable prediction of unassayed CpG sites. Accordingly, we believe that our novel model will be useful and reliable in predicting DNA methylation.
Namba-Fukuyo, Hiroe; Funata, Sayaka; Matsusaka, Keisuke; Fukuyo, Masaki; Rahmutulla, Bahityar; Mano, Yasunobu; Fukayama, Masashi; Aburatani, Hiroyuki; Kaneda, Atsushi
2016-12-06
Extensive DNA methylation is observed in gastric cancer with Epstein-Barr virus (EBV) infection, and EBV infection is the cause to induce this extensive hypermethylaton phenotype in gastric epithelial cells. However, some 5' regions of genes do not undergo de novo methylation, despite the induction of methylation in surrounding regions, suggesting the existence of a resistance factor against DNA methylation acquisition. We conducted an RNA-seq analysis of gastric epithelial cells with and without EBV infection and found that TET family genes, especially TET2, were repressed by EBV infection at both mRNA and protein levels. TET2 was found to be downregulated by EBV transcripts, e.g. BARF0 and LMP2A, and also by seven human miRNAs targeting TET2, e.g., miR-93 and miR-29a, which were upregulated by EBV infection, and transfection of which into gastric cells repressed TET2. Hydroxymethylation target genes by TET2 were detected by hydroxymethylated DNA immunoprecipitation sequencing (hMeDIP-seq) with and without TET2 overexpression, and overlapped significantly with methylation target genes in EBV-infected cells. When TET2 was knocked down by shRNA, EBV infection induced de novo methylation more severely, including even higher methylation in methylation-acquired promoters or de novo methylation acquisition in methylation-protected promoters, leading to gene repression. TET2 knockdown alone without EBV infection did not induce de novo DNA methylation. These data suggested that TET2 functions as a resistance factor against DNA methylation in gastric epithelial cells and repression of TET2 contributes to DNA methylation acquisition during EBV infection.
Keller, Thomas E; Han, Priscilla; Yi, Soojin V
2016-04-01
Genomes of invertebrates and vertebrates exhibit highly divergent patterns of DNA methylation. Invertebrate genomes tend to be sparsely methylated, and DNA methylation is mostly targeted to a subset of transcription units (gene bodies). In a drastic contrast, vertebrate genomes are generally globally and heavily methylated, punctuated by the limited local hypo-methylation of putative regulatory regions such as promoters. These genomic differences also translate into functional differences in DNA methylation and gene regulation. Although promoter DNA methylation is an important regulatory component of vertebrate gene expression, its role in invertebrate gene regulation has been little explored. Instead, gene body DNA methylation is associated with expression of invertebrate genes. However, the evolutionary steps leading to the differentiation of invertebrate and vertebrate genomic DNA methylation remain unresolved. Here we analyzed experimentally determined DNA methylation maps of several species across the invertebrate-vertebrate boundary, to elucidate how vertebrate gene methylation has evolved. We show that, in contrast to the prevailing idea, a substantial number of promoters in an invertebrate basal chordate Ciona intestinalis are methylated. Moreover, gene expression data indicate significant, epigenomic context-dependent associations between promoter methylation and expression in C. intestinalis. However, there is no evidence that promoter methylation in invertebrate chordate has been evolutionarily maintained across the invertebrate-vertebrate boundary. Rather, body-methylated invertebrate genes preferentially obtain hypo-methylated promoters among vertebrates. Conversely, promoter methylation is preferentially found in lineage- and tissue-specific vertebrate genes. These results provide important insights into the evolutionary origin of epigenetic regulation of vertebrate gene expression. © The Author(s) 2015. Published by Oxford University Press on behalf
Directory of Open Access Journals (Sweden)
Anna Crescenti
Full Text Available DNA methylation regulates gene expression and can be modified by different bioactive compounds in foods, such as polyphenols. Cocoa is a rich source of polyphenols, but its role in DNA methylation is still unknown. The objective was to assess the effect of cocoa consumption on DNA methylation and to determine whether the enzymes involved in the DNA methylation process participate in the mechanisms by which cocoa exerts these effects in humans. The global DNA methylation levels in the peripheral blood were evaluated in 214 volunteers who were pre-hypertensive, stage-1 hypertensive or hypercholesterolemic. The volunteers were divided into two groups: 110 subjects who consumed cocoa (6 g/d for two weeks and 104 control subjects. In addition, the peripheral blood mononuclear cells (PBMCs from six subjects were treated with a cocoa extract to analyze the mRNA levels of the DNA methyltransferases (DNMTs, methylenetetrahydrofolate reductase (MTHFR, and methionine synthase reductase (MTRR genes. Cocoa consumption significantly reduced the DNA methylation levels (2.991±0.366 vs. 3.909±0.380, p<0.001. Additionally, we found an association between the cocoa effects on DNA methylation and three polymorphisms located in the MTHFR, MTRR, and DNMT3B genes. Furthermore, in PBMCs, the cocoa extract significantly lowered the mRNA levels of the DNMTs, MTHFR, and MTRR. Our study demonstrates for the first time that the consumption of cocoa decreases the global DNA methylation of peripheral leukocytes in humans with cardiovascular risk factors. In vitro experiments with PBMCs suggest that cocoa may exert this effect partially via the down-regulation of DNMTs, MTHFR and MTRR, which are key genes involved in this epigenetic process.Clinicaltrials.govNCT00511420 and NCT00502047.
Directory of Open Access Journals (Sweden)
Gavery Mackenzie R
2010-08-01
Full Text Available Abstract Background DNA methylation is an epigenetic mechanism with important regulatory functions in animals. While the mechanism itself is evolutionarily ancient, the distribution and function of DNA methylation is diverse both within and among phylogenetic groups. Although DNA methylation has been well studied in mammals, there are limited data on invertebrates, particularly molluscs. Here we characterize the distribution and investigate potential functions of DNA methylation in the Pacific oyster (Crassostrea gigas. Results Methylation sensitive PCR and bisulfite sequencing PCR approaches were used to identify CpG methylation in C. gigas genes and demonstrated that this species possesses intragenic methylation. In silico analysis of CpGo/e ratios in publicly available sequence data suggests that DNA methylation is a common feature of the C. gigas genome, and that specific functional categories of genes have significantly different levels of methylation. Conclusions The Pacific oyster genome displays intragenic DNA methylation and contains genes necessary for DNA methylation in animals. Results of this investigation suggest that DNA methylation has regulatory functions in Crassostrea gigas, particularly in gene families that have inducible expression, including those involved in stress and environmental responses.
DEFF Research Database (Denmark)
Frederiksen, Hanne; Frandsen, Henrik Lauritz; Pfau, W.
2004-01-01
2-Amino-3-methyl-9H-pyrido[2,3-b]indole (MeAalphaC) and 2-amino-3-methyl-9H-pyrido[2,3-b]indole (AalphaC) are mutagenic and carcinogenic heterocyclic amines formed during ordinary cooking. MeAalphaC and AalphaC are activated to mutagenic metabolites by cytochrome P450-mediated N-oxidation...... by reaction of the parent amines with acetylated guanine N3-oxide. N-2-OH-MeAalphaC and N-2-OH-AalphaC reacted with calf thymus DNA after addition of acetic anhydride. P-32-postlabelling analysis of modified DNA showed one major adduct co-migrating with N-2-(3',5'-diphospho-2'-deoxyguanosin-8-yl...
Directory of Open Access Journals (Sweden)
Xiang Gao
Full Text Available Salinity is a widespread environmental problem limiting productivity and growth of plants. Halophytes which can adapt and resist certain salt stress have various mechanisms to defend the higher salinity and alkalinity, and epigenetic mechanisms especially DNA methylation may play important roles in plant adaptability and plasticity. In this study, we aimed to investigate the different influences of various single salts (NaCl, Na2SO4, NaHCO3, Na2CO3 and their mixed salts on halophyte Chloris. virgata from the DNA methylation prospective, and discover the underlying relationships between specific DNA methylation variations and specific cations/anions through the methylation-sensitive amplification polymorphism analysis. The results showed that the effects on DNA methylation variations of single salts were ranked as follows: Na2CO3> NaHCO3> Na2SO4> NaCl, and their mixed salts exerted tissue-specific effects on C. virgata seedlings. Eight types of DNA methylation variations were detected and defined in C. virgata according to the specific cations/anions existed in stressful solutions; in addition, mix-specific and higher pH-specific bands were the main type in leaves and roots independently. These findings suggested that mixed salts were not the simple combination of single salts. Furthermore, not only single salts but also mixed salts showed tissue-specific and cations/anions-specific DNA methylation variations.
Gao, Xiang; Cao, Donghui; Liu, Jie; Wang, Xiaoping; Geng, Shujuan; Liu, Bao; Shi, Decheng
2013-01-01
Salinity is a widespread environmental problem limiting productivity and growth of plants. Halophytes which can adapt and resist certain salt stress have various mechanisms to defend the higher salinity and alkalinity, and epigenetic mechanisms especially DNA methylation may play important roles in plant adaptability and plasticity. In this study, we aimed to investigate the different influences of various single salts (NaCl, Na2SO4, NaHCO3, Na2CO3) and their mixed salts on halophyte Chloris. virgata from the DNA methylation prospective, and discover the underlying relationships between specific DNA methylation variations and specific cations/anions through the methylation-sensitive amplification polymorphism analysis. The results showed that the effects on DNA methylation variations of single salts were ranked as follows: Na2CO3> NaHCO3> Na2SO4> NaCl, and their mixed salts exerted tissue-specific effects on C. virgata seedlings. Eight types of DNA methylation variations were detected and defined in C. virgata according to the specific cations/anions existed in stressful solutions; in addition, mix-specific and higher pH-specific bands were the main type in leaves and roots independently. These findings suggested that mixed salts were not the simple combination of single salts. Furthermore, not only single salts but also mixed salts showed tissue-specific and cations/anions-specific DNA methylation variations.
Udhayabanu, Tamilarasan; Subramanian, Veedamali S; Teafatiller, Trevor; Gowda, Vykuntaraju K; Raghavan, Varun S; Varalakshmi, Perumal; Said, Hamid M; Ashokkumar, Balasubramaniem
2016-11-01
Brown-Vialetto-Van Laere Syndrome (BVVLS), a rare neurological disorder characterized by bulbar palsies and sensorineural deafness, is mainly associated with defective riboflavin transporters encoded by the SLC52A2 and SLC52A3 genes. Here we present a 16-year-old BVVLS patient belonging to a five generation consanguineous family from Indian ethnicity with two homozygous missense mutations viz., c.421C>A [p.P141T] in SLC52A2 and c.62A>G [p.N21S] in SLC52A3. Functional characterization based on 3 H-riboflavin uptake assay and live-cell confocal imaging revealed that the effect of mutation c.421C>A [p.P141T] identified in SLC52A2 had a slight reduction in riboflavin uptake; on the other hand, the c.62A>G [p.N21S] identified in SLC52A3 showed a drastic reduction in riboflavin uptake, which appeared to be due to impaired trafficking and membrane targeting of the hRFVT-3 protein. This is the first report presenting mutations in both riboflavin transporters hRFVT-2 and hRFVT-3 in the same BVVLS patient. Also, c.62A>G [p.N21S] in SLC52A3 appears to contribute more to the disease phenotype in this patient than c.421C>A [p.P141T] in SLC52A2. Copyright © 2016 Elsevier B.V. All rights reserved.
A robust internal control for high-precision DNA methylation analyses by droplet digital PCR.
Pharo, Heidi D; Andresen, Kim; Berg, Kaja C G; Lothe, Ragnhild A; Jeanmougin, Marine; Lind, Guro E
2018-01-01
Droplet digital PCR (ddPCR) allows absolute quantification of nucleic acids and has potential for improved non-invasive detection of DNA methylation. For increased precision of the methylation analysis, we aimed to develop a robust internal control for use in methylation-specific ddPCR. Two control design approaches were tested: (a) targeting a genomic region shared across members of a gene family and (b) combining multiple assays targeting different pericentromeric loci on different chromosomes. Through analyses of 34 colorectal cancer cell lines, the performance of the control assay candidates was optimized and evaluated, both individually and in various combinations, using the QX200™ droplet digital PCR platform (Bio-Rad). The best-performing control was tested in combination with assays targeting methylated CDO1 , SEPT9 , and VIM . A 4Plex panel consisting of EPHA3 , KBTBD4 , PLEKHF1 , and SYT10 was identified as the best-performing control. The use of the 4Plex for normalization reduced the variability in methylation values, corrected for differences in template amount, and diminished the effect of chromosomal aberrations. Positive Droplet Calling (PoDCall), an R-based algorithm for standardized threshold determination, was developed, ensuring consistency of the ddPCR results. Implementation of a robust internal control, i.e., the 4Plex, and an algorithm for automated threshold determination, PoDCall, in methylation-specific ddPCR increase the precision of DNA methylation analysis.
Potential of DNA methylation in rectal cancer as diagnostic and prognostic biomarkers
Exner, Ruth; Pulverer, Walter; Diem, Martina; Spaller, Lisa; Woltering, Laura; Schreiber, Martin; Wolf, Brigitte; Sonntagbauer, Markus; Schr?der, Fabian; Stift, Judith; Wrba, Fritz; Bergmann, Michael; Weinh?usel, Andreas; Egger, Gerda
2015-01-01
Background: Aberrant DNA methylation is more prominent in proximal compared with distal colorectal cancers. Although a number of methylation markers were identified for colon cancer, yet few are available for rectal cancer. Methods: DNA methylation differences were assessed by a targeted DNA microarray for 360 marker candidates between 22 fresh frozen rectal tumour samples and 8 controls and validated by microfluidic high-throughput and methylation-sensitive qPCR in fresh frozen and formalin-...
[Novel Approaches in DNA Methylation Studies - MS-HRM Analysis and Electrochemistry].
Bartošík, M; Ondroušková, E
Cytosine methylation in DNA is an epigenetic mechanism regulating gene expression and plays a vital role in cell differentiation or proliferation. Tumor cells often exhibit aberrant DNA methylation, e.g. hypermethylation of tumor suppressor gene promoters. New methods, capable of determining methylation status of specific DNA sequences, are thus being developed. Among them, MS-HRM (methylation-specific high resolution melting) and electrochemistry offer relatively inexpensive instrumentation, fast assay times and possibility of screening multiple samples/DNA regions simultaneously. MS-HRM is due to its sensitivity and simplicity an interesting alternative to already established techniques, including methylation-specific PCR or bisulfite sequencing. Electrochemistry, when combined with suitable electroactive labels and electrode surfaces, has been applied in several unique strategies for discrimination of cytosines and methylcytosines. Both techniques were successfully tested in analysis of DNA methylation within promoters of important tumor suppressor genes and could thus help in achieving more precise diagnostics and prognostics of cancer. Aberrant methylation of promoters has already been described in hundreds of genes associated with tumorigenesis and could serve as important biomarker if new methods applicable into clinical practice are sufficiently advanced.Key words: DNA methylation - 5-methylcytosine - HRM analysis - melting temperature - DNA duplex - electrochemistry - nucleic acid hybridizationThis work was supported by MEYS - NPS I - LO1413.The authors declare they have no potential conflicts of interest concerning drugs, products, or services used in the study.The Editorial Board declares that the manuscript met the ICMJE recommendation for biomedical papers.Submitted: 6. 5. 2016Accepted: 16. 5. 2016.
Detection of parvovirus B19 DNA in blood: Viruses or DNA remnants?
Molenaar-de Backer, M W A; Russcher, A; Kroes, A C M; Koppelman, M H G M; Lanfermeijer, M; Zaaijer, H L
2016-11-01
Parvovirus B19 (B19V) DNA can be detected in blood over a long period after acute infection. Several reports associate the presence of B19V DNA with disease, irrespective of timing of the initial B19V infection. This study aims to analyze the properties of B19V DNA in blood, differentiating between bare, non-infectious strands of DNA and B19V DNA in viable virions. Ten blood donors with asymptomatic acute B19V infection were followed and sampled up to 22 months after infection. The samples were treated with and without an endonuclease and tested for B19V DNA, to distinguish between DNA in virions and naked DNA. In the acute phase of infection, high levels of B19V DNA were detected, concurrent with B19V IgM antibodies. B19V DNA apparently was encapsidated, as indicated by resistance to endonuclease degradation. Subsequently, B19V DNA remained detectable for more than one year in all donors at low levels (<10 5 IU/mL). Approximately 150days after infection B19V DNA became degradable by an endonuclease, indicating that this concerned naked DNA. In some donors a second endonuclease-resistant peak occurred. Detection of B19V DNA in blood by PCR does not necessarily imply that B19V replication takes place and that infectious B19V virions are present. We propose that remnant B19V DNA strands can be released from tissues without active replication. This finding urges to reconsider an assumed role of B19V infection mainly based on B19V DNA detection in blood, a much debated subject in clinical syndromes such as myocarditis and arthritis. Copyright © 2016 Elsevier B.V. All rights reserved.
Martin, Elizabeth M; Fry, Rebecca C
2018-04-01
DNA methylation is the most well studied of the epigenetic regulators in relation to environmental exposures. To date, numerous studies have detailed the manner by which DNA methylation is influenced by the environment, resulting in altered global and gene-specific DNA methylation. These studies have focused on prenatal, early-life, and adult exposure scenarios. The present review summarizes currently available literature that demonstrates a relationship between DNA methylation and environmental exposures. It includes studies on aflatoxin B 1 , air pollution, arsenic, bisphenol A, cadmium, chromium, lead, mercury, polycyclic aromatic hydrocarbons, persistent organic pollutants, tobacco smoke, and nutritional factors. It also addresses gaps in the literature and future directions for research. These gaps include studies of mixtures, sexual dimorphisms with respect to environmentally associated methylation changes, tissue specificity, and temporal stability of the methylation marks.
Variation in DNA Methylation Patterns is More Common among Maize Inbreds than among Tissues
Directory of Open Access Journals (Sweden)
Steven R. Eichten
2013-07-01
Full Text Available Chromatin modifications, such as DNA methylation, can provide heritable, epigenetic regulation of gene expression in the absence of genetic changes. A role for DNA methylation in meiotically stable marking of repetitive elements and other sequences has been demonstrated in plants. Methylation of DNA is also proposed to play a role in development through providing a mitotic memory of gene expression states established during cellular differentiation. We sought to clarify the relative levels of DNA methylation variation among different genotypes and tissues in maize ( L.. We have assessed genomewide DNA methylation patterns in leaf, immature tassel, embryo, and endosperm tissues of two inbred maize lines: B73 and Mo17. There are hundreds of regions of differential methylation present between the two genotypes. In general, the same regions exhibit differential methylation between B73 and Mo17 in each of the tissues that were surveyed. In contrast, there are few examples of tissue-specific DNA methylation variation. Only a subset of regions with tissue-specific variation in DNA methylation show similar patterns in both genotypes of maize and even fewer are associated with altered gene expression levels among the tissues. Our data indicates a limited impact of DNA methylation on developmental gene regulation within maize.
Directory of Open Access Journals (Sweden)
Cátia Lira do Amaral
2014-01-01
Full Text Available Dietary factors modulate gene expression and are able to alter epigenetic signatures in peripheral blood mononuclear cells (PBMC. However, there are limited studies about the effects of omega-3 polyunsaturated fatty acids (n-3 PUFA on the epigenetic mechanisms that regulate gene expression. This research investigates the effects of n-3-rich fish oil supplementation on DNA methylation profile of several genes whose expression has been reported to be downregulated by n-3 PUFA in PBMC: CD36, FFAR3, CD14, PDK4, and FADS1. Young overweight women were supplemented with fish oil or control in a randomized 8-week intervention trial following a balanced diet with 30% energy restriction. Fatty acid receptor CD36 decreased DNA methylation at CpG +477 due to energy restriction. Hypocaloric diet-induced weight loss also reduced the methylation percentages of CpG sites located in CD14, PDK4, and FADS1. The methylation patterns of these genes were only slightly affected by the fish oil supplementation, being the most relevant to the attenuation of the weight loss-induced decrease in CD36 methylation after adjusting by baseline body weight. These results suggest that the n-3 PUFA-induced changes in the expression of these genes in PBMC are not mediated by DNA methylation, although other epigenetic mechanisms cannot be discarded.
Yokoyama, Amy S; Dunaway, Keith; Rutkowsky, Jennifer; Rutledge, John C; Milenkovic, Dragan
2018-02-21
In our previous work in mice, we have shown that chronic consumption of a Western diet (WD; 42% kcal fat, 0.2% total cholesterol and 34% sucrose) is correlated with impaired cognitive function. Cognitive decline has also been associated with alterations in DNA methylation. Additionally, although there have been many studies analyzing the effect of maternal consumption of a WD on DNA methylation in the offspring, few studies have analyzed how an individual's consumption of a WD can impact his/her DNA methylation. Since the frontal cortex is involved in the regulation of cognitive function and is often affected in cases of cognitive decline, this study aimed to examine how chronic consumption of a WD affects DNA methylation in the frontal cortex of mice. Eight-week-old male mice were fed either a control diet (CD) or a WD for 12 weeks, after which time alterations in DNA methylation were analyzed. Assessment of global DNA methylation in the frontal cortex using dot blot analysis revealed that there was a decrease in global DNA methylation in the WD-fed mice compared with the CD-fed mice. Bioinformatic analysis identified several networks and pathways containing genes displaying differential methylation, particularly those involved in metabolism, cell adhesion and cytoskeleton integrity, inflammation and neurological function. In conclusion, the results from this study suggest that consumption of a WD alters DNA methylation in the frontal cortex of mice and could provide one of the mechanisms by which consumption of a WD impairs cognitive function.
Energy Technology Data Exchange (ETDEWEB)
Peng, Jamy C.; Karpen, Gary H.
2006-06-15
In order to identify regulators of nuclear organization, Drosophila mutants in the Su(var)3-9 histone H3K9 methyltransferase, RNAi pathway components, and other regulators of heterochromatin-mediated gene silencing were examined for altered nucleoli and positioning of repeated DNAs. Animals lacking components of the H3K9 methylation and RNAi pathways contained disorganized nucleoli, ribosomal DNA (rDNA) and satellite DNAs. The levels of H3K9 dimethylation (H3K9me2) in chromatin associated with repeated DNAs decreased dramatically in Su(var)3-9 and dcr-2 (dicer-2) mutant tissues compared to wild type. We also observed a substantial increase in extrachromosomal repeated DNAs in mutant tissues. The disorganized nucleolus phenotype depends on the presence of Ligase 4 (Lig4), and ecc DNA formation is not induced by removal of cohesin. We conclude that H3K9 methylation of rDNA and satellites, maintained by Su(var)3-9, HP1, and the RNAi pathway, is necessary for the structural stability of repeated DNAs, which is mediated through suppression of non-homologous end joining (NHEJ). These results suggest a mechanism for how local chromatin structure can regulate genome stability, and the organization of chromosomal elements and nuclear organelles.
Äijö, Tarmo; Yue, Xiaojing; Rao, Anjana; Lähdesmäki, Harri
2016-09-01
5-methylcytosine (5mC) is a widely studied epigenetic modification of DNA. The ten-eleven translocation (TET) dioxygenases oxidize 5mC into oxidized methylcytosines (oxi-mCs): 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC). DNA methylation modifications have multiple functions. For example, 5mC is shown to be associated with diseases and oxi-mC species are reported to have a role in active DNA demethylation through 5mC oxidation and DNA repair, among others, but the detailed mechanisms are poorly understood. Bisulphite sequencing and its various derivatives can be used to gain information about all methylation modifications at single nucleotide resolution. Analysis of bisulphite based sequencing data is complicated due to the convoluted read-outs and experiment-specific variation in biochemistry. Moreover, statistical analysis is often complicated by various confounding effects. How to analyse 5mC and oxi-mC data sets with arbitrary and complex experimental designs is an open and important problem. We propose the first method to quantify oxi-mC species with arbitrary covariate structures from bisulphite based sequencing data. Our probabilistic modeling framework combines a previously proposed hierarchical generative model for oxi-mC-seq data and a general linear model component to account for confounding effects. We show that our method provides accurate methylation level estimates and accurate detection of differential methylation when compared with existing methods. Analysis of novel and published data gave insights into to the demethylation of the forkhead box P3 (Foxp3) locus during the induced T regulatory cell differentiation. We also demonstrate how our covariate model accurately predicts methylation levels of the Foxp3 locus. Collectively, LuxGLM method improves the analysis of DNA methylation modifications, particularly for oxi-mC species. An implementation of the proposed method is available under MIT license at https
Potential epigenetic biomarkers of obesity-related insulin resistance in human whole-blood.
Day, Samantha E; Coletta, Richard L; Kim, Joon Young; Garcia, Luis A; Campbell, Latoya E; Benjamin, Tonya R; Roust, Lori R; De Filippis, Elena A; Mandarino, Lawrence J; Coletta, Dawn K
2017-04-03
Obesity can increase the risk of complex metabolic diseases, including insulin resistance. Moreover, obesity can be caused by environmental and genetic factors. However, the epigenetic mechanisms of obesity are not well defined. Therefore, the identification of novel epigenetic biomarkers of obesity allows for a more complete understanding of the disease and its underlying insulin resistance. The aim of our study was to identify DNA methylation changes in whole-blood that were strongly associated with obesity and insulin resistance. Whole-blood was obtained from lean (n = 10; BMI = 23.6 ± 0.7 kg/m 2 ) and obese (n = 10; BMI = 34.4 ± 1.3 kg/m 2 ) participants in combination with euglycemic hyperinsulinemic clamps to assess insulin sensitivity. We performed reduced representation bisulfite sequencing on genomic DNA isolated from the blood. We identified 49 differentially methylated cytosines (DMCs; q obese compared with lean participants. We identified 2 sites (Chr.21:46,957,981 and Chr.21:46,957,915) in the 5' untranslated region of solute carrier family 19 member 1 (SLC19A1) with decreased methylation in obese participants (lean 0.73 ± 0.11 vs. obese 0.09 ± 0.05; lean 0.68 ± 0.10 vs. obese 0.09 ± 0.05, respectively). These 2 DMCs identified by obesity were also significantly predicted by insulin sensitivity (r = 0.68, P = 0.003; r = 0.66; P = 0.004). In addition, we performed a differentially methylated region (DMR) analysis and demonstrated a decrease in methylation of Chr.21:46,957,915-46,958,001 in SLC19A1 of -34.9% (70.4% lean vs. 35.5% obese). The decrease in whole-blood SLC19A1 methylation in our obese participants was similar to the change observed in skeletal muscle (Chr.21:46,957,981, lean 0.70 ± 0.09 vs. obese 0.31 ± 0.11 and Chr.21:46,957,915, lean 0.72 ± 0.11 vs. obese 0.31 ± 0.13). Pyrosequencing analysis further demonstrated a decrease in methylation at Chr.21:46,957,915 in both whole-blood (lean 0.71 ± 0.10 vs. obese 0.18 ± 0
Structural insight into maintenance methylation by mouse DNA methyltransferase 1 (Dnmt1)
Takeshita, Kohei; Suetake, Isao; Yamashita, Eiki; Suga, Michihiro; Narita, Hirotaka; Nakagawa, Atsushi; Tajima, Shoji
2011-01-01
Methylation of cytosine in DNA plays a crucial role in development through inheritable gene silencing. The DNA methyltransferase Dnmt1 is responsible for the propagation of methylation patterns to the next generation via its preferential methylation of hemimethylated CpG sites in the genome; however, how Dnmt1 maintains methylation patterns is not fully understood. Here we report the crystal structure of the large fragment (291–1620) of mouse Dnmt1 and its complexes with cofactor S-adenosyl-L-methionine and its product S-adenosyl-L-homocystein. Notably, in the absence of DNA, the N-terminal domain responsible for targeting Dnmt1 to replication foci is inserted into the DNA-binding pocket, indicating that this domain must be removed for methylation to occur. Upon binding of S-adenosyl-L-methionine, the catalytic cysteine residue undergoes a conformation transition to a catalytically competent position. For the recognition of hemimethylated DNA, Dnmt1 is expected to utilize a target recognition domain that overhangs the putative DNA-binding pocket. Taking into considerations the recent report of a shorter fragment structure of Dnmt1 that the CXXC motif positions itself in the catalytic pocket and prevents aberrant de novo methylation, we propose that maintenance methylation is a multistep process accompanied by structural changes. PMID:21518897
Absolute quantification of DNA methylation using microfluidic chip-based digital PCR.
Wu, Zhenhua; Bai, Yanan; Cheng, Zule; Liu, Fangming; Wang, Ping; Yang, Dawei; Li, Gang; Jin, Qinghui; Mao, Hongju; Zhao, Jianlong
2017-10-15
Hypermethylation of CpG islands in the promoter region of many tumor suppressor genes downregulates their expression and in a result promotes tumorigenesis. Therefore, detection of DNA methylation status is a convenient diagnostic tool for cancer detection. Here, we reported a novel method for the integrative detection of methylation by the microfluidic chip-based digital PCR. This method relies on methylation-sensitive restriction enzyme HpaII, which cleaves the unmethylated DNA strands while keeping the methylated ones intact. After HpaII treatment, the DNA methylation level is determined quantitatively by the microfluidic chip-based digital PCR with the lower limit of detection equal to 0.52%. To validate the applicability of this method, promoter methylation of two tumor suppressor genes (PCDHGB6 and HOXA9) was tested in 10 samples of early stage lung adenocarcinoma and their adjacent non-tumorous tissues. The consistency was observed in the analysis of these samples using our method and a conventional bisulfite pyrosequencing. Combining high sensitivity and low cost, the microfluidic chip-based digital PCR method might provide a promising alternative for the detection of DNA methylation and early diagnosis of epigenetics-related diseases. Copyright © 2017 Elsevier B.V. All rights reserved.
Aberrant DNA methylation associated with Alzheimer's disease in the superior temporal gyrus.
Gao, Zhan; Fu, Hong-Juan; Zhao, Li-Bo; Sun, Zhuo-Yan; Yang, Yu-Fei; Zhu, Hong-Yan
2018-01-01
Abnormal DNA methylation patterns have been demonstrated to be associated with the pathogenesis of Alzheimer's disease (AD). The present study aimed to identify differential methylation in the superior temporal gyrus (STG) of patients with late-onset AD based on epigenome-wide DNA methylation data by bioinformatics analysis. The genome-wide DNA methylation data in the STG region of 34 patients with late-onset AD and 34 controls without dementia were recruited from the Gene Expression Omnibus database. Through systemic quality control, differentially methylated CpG sites were determined by the Student's t-test and mean methylation value differences between the two conditions. Hierarchical clustering analysis was applied to assess the classification performance of differentially methylated CpGs. Functional analysis was performed to investigate the biological functions of the genes associated with differentially methylated CpGs. A total of 17,895 differentially methylated CpG sites were initially identified, including 11,822 hypermethylated CpGs and 6,073 hypomethylated CpGs. Further analysis examined 2,211 differentially methylated CpGs (covering 1,991 genes). AD subjects demonstrated distinctive DNA methylation patterns when compared with the controls, with a classification accuracy value of 1. Hypermethylation was mainly detected for genes regulating the cell cycle progression, whereas hypomethylation was observed in genes involved in transcription factor binding. The present study demonstrated widespread and distinctive DNA methylation alterations in late-onset AD. Identification of AD-associated epigenetic biomarkers may allow for the development of novel diagnostic and therapeutic targets.
Directory of Open Access Journals (Sweden)
Dimos Gaidatzis
2014-02-01
Full Text Available For the most part metazoan genomes are highly methylated and harbor only small regions with low or absent methylation. In contrast, partially methylated domains (PMDs, recently discovered in a variety of cell lines and tissues, do not fit this paradigm as they show partial methylation for large portions (20%-40% of the genome. While in PMDs methylation levels are reduced on average, we found that at single CpG resolution, they show extensive variability along the genome outside of CpG islands and DNase I hypersensitive sites (DHS. Methylation levels range from 0% to 100% in a roughly uniform fashion with only little similarity between neighboring CpGs. A comparison of various PMD-containing methylomes showed that these seemingly disordered states of methylation are strongly conserved across cell types for virtually every PMD. Comparative sequence analysis suggests that DNA sequence is a major determinant of these methylation states. This is further substantiated by a purely sequence based model which can predict 31% (R(2 of the variation in methylation. The model revealed CpG density as the main driving feature promoting methylation, opposite to what has been shown for CpG islands, followed by various dinucleotides immediately flanking the CpG and a minor contribution from sequence preferences reflecting nucleosome positioning. Taken together we provide a reinterpretation for the nucleotide-specific methylation levels observed in PMDs, demonstrate their conservation across tissues and suggest that they are mainly determined by specific DNA sequence features.
Šerý, Omar; Paclt, Ivo; Drtílková, Ivana; Theiner, Pavel; Kopečková, Marta; Zvolský, Petr; Balcar, Vladimir J
2015-06-11
ADHD and alcoholism are psychiatric diseases with pathophysiology related to dopamine system. DAT1 belongs to the SLC6 family of transporters and is involved in the regulation of extracellular dopamine levels. A 40 bp variable number tandem repeat (VNTR) polymorphism in the 3'-untranslated region of DAT1/SLC6A3 gene was previously reported to be associated with various phenotypes involving disturbed regulation of dopaminergic neurotransmission. A total of 1312 subjects were included and genotyped for 40 bp VNTR polymorphism of DAT1/SLC6A3 gene in this study (441 alcoholics, 400 non-alcoholic controls, 218 ADHD children and 253 non ADHD children). Using miRBase software, we have performed a computer analysis of VNTR part of DAT1 gene for presence of miRNA binding sites. We have found significant relationships between ADHD and the 40 bp VNTR polymorphisms of DAT1/SLC6A3 gene (P VNTR polymorphism of DAT1/SLC6A3 gene has been detected. We have found an association between 40 bp VNTR polymorphism of DAT1/SLC6A3 gene and ADHD in the Czech population; in a broad agreement with studies in other population samples. Furthermore, we detected rare genotypes 8/10, 7/10 and 10/11 present in ADHD boys only and identified miRNAs that should be looked at as potential novel targets in the research on ADHD.
Shiwa, Yuh; Hachiya, Tsuyoshi; Furukawa, Ryohei; Ohmomo, Hideki; Ono, Kanako; Kudo, Hisaaki; Hata, Jun; Hozawa, Atsushi; Iwasaki, Motoki; Matsuda, Koichi; Minegishi, Naoko; Satoh, Mamoru; Tanno, Kozo; Yamaji, Taiki; Wakai, Kenji; Hitomi, Jiro; Kiyohara, Yutaka; Kubo, Michiaki; Tanaka, Hideo; Tsugane, Shoichiro; Yamamoto, Masayuki; Sobue, Kenji; Shimizu, Atsushi
2016-01-01
Differences in DNA collection protocols may be a potential confounder in epigenome-wide association studies (EWAS) using a large number of blood specimens from multiple biobanks and/or cohorts. Here we show that pre-analytical procedures involved in DNA collection can induce systematic bias in the DNA methylation profiles of blood cells that can be adjusted by cell-type composition variables. In Experiment 1, whole blood from 16 volunteers was collected to examine the effect of a 24 h storage period at 4°C on DNA methylation profiles as measured using the Infinium HumanMethylation450 BeadChip array. Our statistical analysis showed that the P-value distribution of more than 450,000 CpG sites was similar to the theoretical distribution (in quantile-quantile plot, λ = 1.03) when comparing two control replicates, which was remarkably deviated from the theoretical distribution (λ = 1.50) when comparing control and storage conditions. We then considered cell-type composition as a possible cause of the observed bias in DNA methylation profiles and found that the bias associated with the cold storage condition was largely decreased (λ adjusted = 1.14) by taking into account a cell-type composition variable. As such, we compared four respective sample collection protocols used in large-scale Japanese biobanks or cohorts as well as two control replicates. Systematic biases in DNA methylation profiles were observed between control and three of four protocols without adjustment of cell-type composition (λ = 1.12-1.45) and no remarkable biases were seen after adjusting for cell-type composition in all four protocols (λ adjusted = 1.00-1.17). These results revealed important implications for comparing DNA methylation profiles between blood specimens from different sources and may lead to discovery of disease-associated DNA methylation markers and the development of DNA methylation profile-based predictive risk models.
Directory of Open Access Journals (Sweden)
Yuh Shiwa
Full Text Available Differences in DNA collection protocols may be a potential confounder in epigenome-wide association studies (EWAS using a large number of blood specimens from multiple biobanks and/or cohorts. Here we show that pre-analytical procedures involved in DNA collection can induce systematic bias in the DNA methylation profiles of blood cells that can be adjusted by cell-type composition variables. In Experiment 1, whole blood from 16 volunteers was collected to examine the effect of a 24 h storage period at 4°C on DNA methylation profiles as measured using the Infinium HumanMethylation450 BeadChip array. Our statistical analysis showed that the P-value distribution of more than 450,000 CpG sites was similar to the theoretical distribution (in quantile-quantile plot, λ = 1.03 when comparing two control replicates, which was remarkably deviated from the theoretical distribution (λ = 1.50 when comparing control and storage conditions. We then considered cell-type composition as a possible cause of the observed bias in DNA methylation profiles and found that the bias associated with the cold storage condition was largely decreased (λ adjusted = 1.14 by taking into account a cell-type composition variable. As such, we compared four respective sample collection protocols used in large-scale Japanese biobanks or cohorts as well as two control replicates. Systematic biases in DNA methylation profiles were observed between control and three of four protocols without adjustment of cell-type composition (λ = 1.12-1.45 and no remarkable biases were seen after adjusting for cell-type composition in all four protocols (λ adjusted = 1.00-1.17. These results revealed important implications for comparing DNA methylation profiles between blood specimens from different sources and may lead to discovery of disease-associated DNA methylation markers and the development of DNA methylation profile-based predictive risk models.
TET1 and hydroxymethylcytosine in transcription and DNA methylation fidelity
DEFF Research Database (Denmark)
Williams, Kristine; Christensen, Jesper; Pedersen, Marianne Terndrup
2011-01-01
a role in transcriptional repression. TET1 binds a significant proportion of Polycomb group target genes. Furthermore, TET1 associates and colocalizes with the SIN3A co-repressor complex. We propose that TET1 fine-tunes transcription, opposes aberrant DNA methylation at CpG-rich sequences and thereby...... throughout the genome of embryonic stem cells, with the majority of binding sites located at transcription start sites (TSSs) of CpG-rich promoters and within genes. The hmC modification is found in gene bodies and in contrast to mC is also enriched at CpG-rich TSSs. We provide evidence further that TET1 has...... contributes to the regulation of DNA methylation fidelity....
Influence of prenatal arsenic exposure and newborn sex on global methylation of cord blood DNA.
Directory of Open Access Journals (Sweden)
J Richard Pilsner
Full Text Available BACKGROUND: An emerging body of evidence indicates that early-life arsenic (As exposure may influence the trajectory of health outcomes later in life. However, the mechanisms underlying these observations are unknown. OBJECTIVE: The objective of this study was to investigate the influence of prenatal As exposure on global methylation of cord blood DNA in a study of mother/newborn pairs in Matlab, Bangladesh. DESIGN: Maternal and cord blood DNA were available from a convenience sample of 101 mother/newborn pairs. Measures of As exposure included maternal urinary As (uAs, maternal blood As (mbAs and cord blood As (cbAs. Several measures of global DNA methylation were assessed, including the [3H]-methyl-incorporation assay and three Pyrosequencing assays: Alu, LINE-1 and LUMA. RESULTS: In the total sample, increasing quartiles of maternal uAs were associated with an increase in covariate-adjusted means of newborn global DNA methylation as measured by the [3H]-methyl-incorporation assay (quartile 1 (Q1 and Q2 vs. Q4; p = 0.06 and 0.04, respectively. Sex-specific linear regression analyses, while not reaching significance level of 0.05, indicated that the associations between As exposures and Alu, LINE-1 and LUMA were positive among male newborns (N = 58 but negative among female newborns (N = 43; tests for sex differences were borderline significant for the association of cbAs and mbAs with Alu (p = 0.05 and 0.09, respectively and for the association between maternal uAs and LINE-1 (p = 0.07. Sex-specific correlations between maternal urinary creatinine and newborn methyl-incorporation, Alu and LINE-1 were also evident (p<0.05. CONCLUSIONS: These results suggest that prenatal As exposure is associated with global DNA methylation in cord blood DNA, possibly in a sex-specific manner. Arsenic-induced epigenetic modifications in utero may potentially influence disease outcomes later in life. Additional studies are needed to confirm
Energy Technology Data Exchange (ETDEWEB)
Gelernter, J.; Kruger, S.D.; Pakstis, A.J. [Yale Univ., New Haven, CT (United States)]|[West Haven Veterans Affairs Medical Center, CT (United States)] [and others
1995-12-10
The dopamine transporter, the molecule responsible for presynaptic reuptake of dopamine and a major site of action of psychostimulant drugs, including cocaine, is encoded by locus SLC6A3 (alias DAT1). The protein`s actions and DAT`s specific localization to dopaminergic neurons make it a candidate gene for several psychiatric illnesses. SLC6A3 has been mapped to distal chromosome 5p, using physical methods. Genetic linkage methods were used to place SLC6A3 in the genetic linkage map. Four extended pedigrees (one of which overlaps with CEPH) were typed. Linkage with Tourette syndrome (TS) was also examined. SLC6A3 showed close linkage with several markers previously mapped to distal chromosome 5p, including D5S11 (Z{sub max} = 16.0, {theta}{sub M} = {theta}{sub F} = 0.03, results from four families) and D5S678 (Z{sub max} = 7.84, {theta}{sub M} = {theta}{sub F} = 0, results from two families). Observed crossovers established that SLC6A3 is a distal marker close to D5S10 and D5S678, but these three distal markers could not be ordered. Linkage between TS and SLC6A3 could be excluded independently in two branches of a large kindred segregating TS; the lod score in a third family was also negative, but not significant. Cumulative results show a lod score of -6.2 at {theta} = 0 and of -3.9 at {theta} = 0.05 (dominant model, narrow disease definition). SLC6A3 thus maps to distal chromosome 5p by linkage analysis, in agreement with previous physical mapping data. A mutation at SLC6A3 is not causative for TS in the two large families that generated significant negative lod scores (if the parameters of our analyses were correct) and is unlikely to be causative in the family that generated a negative lod score that did not reach significance. These results do not exclude a role for the dopamine transporter in influencing risk for TS in combination with other loci. 23 refs., 1 fig., 2 tabs.
MIRA: An R package for DNA methylation-based inference of regulatory activity.
Lawson, John T; Tomazou, Eleni M; Bock, Christoph; Sheffield, Nathan C
2018-03-01
DNA methylation contains information about the regulatory state of the cell. MIRA aggregates genome-scale DNA methylation data into a DNA methylation profile for independent region sets with shared biological annotation. Using this profile, MIRA infers and scores the collective regulatory activity for each region set. MIRA facilitates regulatory analysis in situations where classical regulatory assays would be difficult and allows public sources of open chromatin and protein binding regions to be leveraged for novel insight into the regulatory state of DNA methylation datasets. R package available on Bioconductor: http://bioconductor.org/packages/release/bioc/html/MIRA.html. nsheffield@virginia.edu.
Sha, A H; Lin, X H; Huang, J B; Zhang, D P
2005-07-01
DNA methylation is known to play an important role in the regulation of gene expression in eukaryotes. The rice cultivar Wase Aikoku 3 becomes resistant to the blight pathogen Xanthomonas oryzae pv. oryzae at the adult stage. Using methylation-sensitive amplified polymorphism (MSAP) analysis, we compared the patterns of cytosine methylation in seedlings and adult plants of the rice cultivar Wase Aikoku 3 that had been inoculated with the pathogen Xanthomonas oryzae pv. oryzae, subjected to mock inoculation or left untreated. In all, 2000 DNA fragments, each representing a recognition site cleaved by either or both of two isoschizomers, were amplified using 60 pairs of selective primers. A total of 380 sites were found to be methylated. Of these, 45 showed differential cytosine methylation among the seedlings and adult plants subjected to different treatments, and overall levels of methylation were higher in adult plants than in seedlings. All polymorphic fragments were sequenced, and six showed homology to genes that code for products of known function. Northern analysis of three fragments indicated that their expression varied with methylation pattern, with hypermethylation being correlated with repression of transcription, as expected. The results suggest that significant differences in cytosine methylation exist between seedlings and adult plants, and that hypermethylation or hypomethylation of specific genes may be involved in the development of adult plant resistance (APR) in rice plants.
DNA methylation levels associated with race and childhood asthma severity.
Chan, Marcia A; Ciaccio, Christina E; Gigliotti, Nicole M; Rezaiekhaligh, Mo; Siedlik, Jacob A; Kennedy, Kevin; Barnes, Charles S
2017-10-01
Asthma is a common chronic childhood disease worldwide. Socioeconomic status, genetic predisposition and environmental factors contribute to its incidence and severity. A disproportionate number of children with asthma are economically disadvantaged and live in substandard housing with potential indoor environmental exposures such as cockroaches, dust mites, rodents and molds. These exposures may manifest through epigenetic mechanisms that can lead to changes in relevant gene expression. We examined the association of global DNA methylation levels with socioeconomic status, asthma severity and race/ethnicity. We measured global DNA methylation in peripheral blood of children with asthma enrolled in the Kansas City Safe and Healthy Homes Program. Inclusion criteria included residing in the same home for a minimum of 4 days per week and total family income of less than 80% of the Kansas City median family income. DNA methylation levels were quantified by an immunoassay that assessed the percentage of 5-methylcytosine. Our results indicate that overall, African American children had higher levels of global DNA methylation than children of other races/ethnicities (p = 0.029). This difference was more pronounced when socioeconomic status and asthma severity were coupled with race/ethnicity (p = 0.042) where low-income, African American children with persistent asthma had significantly elevated methylation levels relative to other races/ethnicities in the same context (p = 0.006, Hedges g = 1.14). Our study demonstrates a significant interaction effect among global DNA methylation levels, asthma severity, race/ethnicity, and socioeconomic status.
Martin, Christiana; Cho, Young-Eun; Kim, Hyungsuk; Yun, Sijung; Kanefsky, Rebekah; Lee, Hyunhwa; Mysliwiec, Vincent; Cashion, Ann; Gill, Jessica
2018-05-01
Military personnel experience posttraumatic stress disorder (PTSD), which is associated with differential DNA methylation across the whole genome. However, the relationship between these DNA methylation patterns and clinically relevant increases in PTSD severity is not yet clearly understood. The purpose of this study was to identify differences in DNA methylation associated with PTSD symptoms and investigate DNA methylation changes related to increases in the severity of PTSD in military personnel. In this pilot study, a cross-sectional comparison was made between military personnel with PTSD (n = 8) and combat-matched controls without PTSD (n = 6). Symptom measures were obtained, and genome-wide DNA methylation was measured using methylated DNA immunoprecipitation (MeDIP-seq) from whole blood samples at baseline and 3 months later. A longitudinal comparison measured DNA methylation changes in military personnel with clinically relevant increases in PTSD symptoms between time points (PTSD onset) and compared methylation patterns to controls with no clinical changes in PTSD. In military personnel with elevated PTSD symptoms 3 months following baseline, 119 genes exhibited reduced methylation and 8 genes exhibited increased methylation. Genes with reduced methylation in the PTSD-onset group relate to the canonical pathways of netrin signaling, Wnt/Ca + pathway, and axonal guidance signaling. These gene pathways relate to neurological disorders, and the current findings suggest that these epigenetic changes potentially relate to PTSD symptomology. This study provides some novel insights into the role of epigenetic changes in PTSD symptoms and the progression of PTSD symptoms in military personnel.
Cao, Yi
2015-09-01
Environmental pollution is one of the main causes of human cancer. Exposures to environmental carcinogens result in genetic and epigenetic alterations which induce cell transformation. Epigenetic changes caused by environmental pollution play important roles in the development and progression of environmental pollution-related cancers. Studies on DNA methylation are among the earliest and most conducted epigenetic research linked to cancer. In this review, the roles of DNA methylation in carcinogenesis and their significance in clinical medicine were summarized, and the effects of environmental pollutants, particularly air pollutants, on DNA methylation were introduced. Furthermore, prospective applications of DNA methylation to environmental pollution detection and cancer prevention were discussed.
Tang, Xiao-Mei; Tao, Xiang; Wang, Yan; Ma, Dong-Wei; Li, Dan; Yang, Hong; Ma, Xin-Rong
2014-12-01
Perennial ryegrass (Lolium perenne), an excellent grass for forage and turf, is widespread in temperate regions. Drought is an important factor that limits its growth, distribution, and yield. DNA methylation affects gene expression and plays an important role in adaptation to adverse environments. In this study, the DNA methylation changes in perennial ryegrass under drought stress were assessed using methylation-sensitive amplified polymorphism (MSAP). After 15 days of drought stress treatment, the plant height was less than half of the control, and the leaves were smaller and darker. Genome-wide, a total of 652 CCGG sites were detected by MSAP. The total methylation level was 57.67 and 47.39 % in the control and drought treatment, respectively, indicating a decrease of 10.28 % due to drought exposure. Fifteen differentially displayed DNA fragments in MSAP profiles were cloned for sequencing analysis. The results showed that most of the genes involved in stress responses. The relative expression levels revealed that three demethylated fragments were up-regulated. The expression of a predicted retrotransposon increased significantly, changing from hypermethylation to non-methylation. Although the extent of methylation in two other genes decreased, the sites of methylation remained, and the expression increased only slightly. All of these results suggested that drought stress decreased the total DNA methylation level in perennial ryegrass and demethylation up-regulated related gene expressions and that the extent of methylation was negatively correlated with expression. Overall, the induced epigenetic changes in genome probably are an important regulatory mechanism for acclimating perennial ryegrass to drought and possibly other environmental stresses.
DNA Methylation Landscapes of Human Fetal Development
Slieker, Roderick C.; Roost, Matthias S.; van Iperen, Liesbeth; Suchiman, H. Eka D; Tobi, Elmar W.; Carlotti, Françoise; de Koning, Eelco J P; Slagboom, P. Eline; Heijmans, Bastiaan T.; Chuva de Sousa Lopes, Susana M.
2015-01-01
Remodelling the methylome is a hallmark of mammalian development and cell differentiation. However, current knowledge of DNA methylation dynamics in human tissue specification and organ development largely stems from the extrapolation of studies in vitro and animal models. Here, we report on the DNA
Li, Huiqi; Hedmer, Maria; Wojdacz, Tomasz; Hossain, Mohammad Bakhtiar; Lindh, Christian H; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin
2015-10-01
Evidence suggests that exposure to welding fumes is a risk factor for lung cancer. We examined relationships between low-to-moderate occupational exposure to particles from welding fumes and cancer-related biomarkers for oxidative stress, changes in telomere length, and alterations in DNA methylation. We enrolled 101 welders and 127 controls (all currently nonsmoking men) from southern Sweden. We performed personal sampling of respirable dust and measured 8-oxodG concentrations in urine using a simplified liquid chromatography tandem mass spectrometry method. Telomere length in peripheral blood was measured by quantitative polymerase chain reaction. Methylation status of 10 tumor suppressor genes was determined by methylation-sensitive high-resolution melting analysis. All analyses were adjusted for age, body mass index, previous smoking, passive smoking, current residence, and wood burning stove/boiler at home. Welders were exposed to respirable dust at 1.2 mg/m(3) (standard deviation, 3.3 mg/m(3); range, 0.1-19.3), whereas control exposures did not exceed 0.1 mg/m(3) (P < 0.001). Welders and controls did not differ in 8-oxodG levels (β = 1.2, P = 0.17) or relative telomere length (β = -0.053, P = 0.083) in adjusted models. Welders showed higher probability of adenomatous polyposis coli (APC) methylation in the unadjusted model (odds ratio = 14, P = 0.014), but this was not significant in the fully adjusted model (P = 0.052). Every working year as a welder was associated with 0.0066 units shorter telomeres (95% confidence interval -0.013 to -0.00053, P = 0.033). Although there were no clear associations between concentrations of respirable dust and the biomarkers, there were modest signs of associations between oxidative stress, telomere alterations, DNA methylation, and occupational exposure to low-to-moderate levels of particles. © 2015 Wiley Periodicals, Inc.
The Effect of Metabolic and Bariatric Surgery on DNA Methylation Patterns.
Morcillo, Sonsoles; Macías-González, Manuel; Tinahones, Francisco J
2017-08-30
Metabolic and bariatric surgery (MBS) is considered to be the most effective treatment for obesity. Not only due to the significant weight reduction but also because of the many health benefits associated with it. In the last 5 years, several studies have suggested that epigenetic modifications could be involved in the mechanisms underlying the response to bariatric surgery. In this review, we will compile the different studies (2012-2017) concerning the effect of this surgical procedure on DNA methylation patterns (the most studied epigenetic marker) and its association with metabolic improvement. This is an emerging area, and currently, there are not many studies in the literature. The aim is to show what has been done so far and what the future direction in this emerging area might be. Recent findings have shown how metabolic and bariatric surgery modifies the DNA methylation profile of the specific genes associated with the pathophysiology of the disease. The studies were performed in morbidly obese subjects, mainly in women, with the aim of reducing weight and improving the obesity-associated comorbidities. DNA methylation has been measured both in specific tissue and in peripheral blood samples. In general, studies about site-specific DNA methylation have shown a change in the methylation profile after surgery, whereas the studies analyzing global DNA methylation are not so conclusive. Summing up, metabolic and bariatric surgery can modify the DNA methylation profile of different genes and contributes to the metabolic health benefits that are often seen after metabolic and bariatric surgery. Although there are still many issues to be resolved, the capacity to revert the DNA methylation profile of specific sites opens a window for searching for target markers to treat obesity-related comorbidities.
Annotating the genome by DNA methylation.
Cedar, Howard; Razin, Aharon
2017-01-01
DNA methylation plays a prominent role in setting up and stabilizing the molecular design of gene regulation and by understanding this process one gains profound insight into the underlying biology of mammals. In this article, we trace the discoveries that provided the foundations of this field, starting with the mapping of methyl groups in the genome and the experiments that helped clarify how methylation patterns are maintained through cell division. We then address the basic relationship between methyl groups and gene repression, as well as the molecular rules involved in controlling this process during development in vivo. Finally, we describe ongoing work aimed at defining the role of this modification in disease and deciphering how it may serve as a mechanism for sensing the environment.
Directory of Open Access Journals (Sweden)
Koramannil Radha Saradalekshmi
Full Text Available DNA methylation has been implicated in the etiopathology of various complex disorders. DNA methyltransferases are involved in maintaining and establishing new methylation patterns. The aim of the present study was to investigate the inherent genetic variations within DNA methyltransferase genes in predisposing to susceptibility to schizophrenia. We screened for polymorphisms in DNA methyltransferases, DNMT1, DNMT3A, DNMT3B and DNMT3L in 330 schizophrenia patients and 302 healthy controls for association with Schizophrenia in south Indian population. These polymorphisms were also tested for subgroup analysis with patient's gender, age of onset and family history. DNMT1 rs2114724 (genotype P = .004, allele P = 0.022 and rs2228611 (genotype P = 0.004, allele P = 0.022 were found to be significantly associated at genotypic and allelic level with Schizophrenia in South Indian population. DNMT3B rs2424932 genotype (P = 0.023 and allele (P = 0.0063 increased the risk of developing schizophrenia in males but not in females. DNMT3B rs1569686 (genotype P = 0.027, allele P = 0.033 was found to be associated with early onset of schizophrenia and also with family history and early onset (genotype P = 0.009. DNMT3L rs2070565 (genotype P = 0.007, allele P = 0.0026 confers an increased risk of developing schizophrenia at an early age in individuals with family history. In-silico prediction indicated functional relevance of these SNPs in regulating the gene. These observations might be crucial in addressing and understanding the genetic control of methylation level differences from ethnic viewpoint. Functional significance of genotype variations within the DNMTs indeed suggest that the genetic nature of methyltransferases should be considered while addressing epigenetic events mediated by methylation in Schizophrenia.
Saffhill, R; Abbott, P J
1978-01-01
The alternating co-polymer has been methylated with either N methyl-N-nitrosourea (MNU) or dimethyl sulphate (DMS) and the levels of the various methylated thymidines (O2-methylthymidine, 3-methylthymidine and O4-methylthymidine) measured. MNU produced all three compounds whereas DMS only produced 3-methylthymidine and O2-methylthymidine at detectable levels. These results have been combined with our earlier results concerning the misincorporation of dGMP with E. coli DNA polymerase using MNU-methylated poly(dA-dT). These results indicate that O2-methylthymidine does not miscode during DNA synthesis. PMID:353735
Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.
Directory of Open Access Journals (Sweden)
Andrea Fuso
Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.
Saenz-de-Juano, M D; Billooye, K; Smitz, J; Anckaert, E
2016-06-01
Does in vitro follicle culture (IFC) have an effect on maintenance of imprinted DNA methylation in preimplantation mouse embryos? We report similar alterations in the methylation pattern of H19 imprinted maternally expressed transcript (H19), small nuclear ribonucleoprotein polypeptide N (Snrpn) and mesoderm specific transcript (Mest) imprinted genes in mouse blastocysts obtained after ovulation induction and IFC. Furthermore, we observed no differences in the gene expression of maternal effect proteins related with imprinting maintenance between superovulated in vivo grown or IFC oocytes. Assisted reproductive technology is associated with adverse post-natal outcomes such as increased risk of premature birth, altered birthweight, congenital anomalies and genomic imprinting syndromes in human and in animal models. Previous studies have shown that ovulation induction allowed normal imprinting establishment in mouse oocytes, but interfered with imprinting maintenance during preimplantation . Normal imprinting establishment was also observed in mouse oocytes derived from a standardized IFC from the early pre-antral follicle stage. The methylation profiles of differentially methylated regions (DMRs) of three key imprinted genes (H19, Snrpn and Mest) were compared at hatched blastocyst stage between embryos obtained from IFC or superovulated oocytes, each subjected to IVF and preimplantation in vitro culture (IVC); in non-manipulated in vivo produced late blastocyst (control) and in in vivo produced 2-cell embryos that were in vitro cultured until the hatched blastocyst stage (to assess the effect of IVC). Two different mice strains (Mus musculus C57BL/6J X CBA/Ca and Mus musculus B6 (CAST7)) were used to discriminate between maternal and paternal alleles of imprinted genes. Additionally, a limiting-dilution bisulfite-sequencing technique was carried out on individual embryos in order to avoid amplification bias. To assess whether IFC and ovulation induction
Directory of Open Access Journals (Sweden)
Angelo Zinellu
2017-01-01
Full Text Available Alterations in global DNA methylation are implicated in various pathophysiological processes. The development of simple and quick, yet robust, methods to assess DNA methylation is required to facilitate its measurement and interpretation in clinical practice. We describe a highly sensitive and reproducible capillary electrophoresis method with UV detection for the separation and detection of cytosine and methylcytosine, after formic acid hydrolysis of DNA extracted from human whole blood. Hydrolysed samples were dried and resuspended with water and directly injected into the capillary without sample derivatization procedures. The use of a run buffer containing 50 mmol/L BIS-TRIS propane (BTP phosphate buffer at pH 3.25 and 60 mmol/L sodium acetate buffer at pH 3.60 (4 : 1, v/v allowed full analyte identification within 11 min. Precision tests indicated an elevated reproducibility with an interassay CV of 1.98% when starting from 2 μg of the extracted DNA. The method was successfully tested by measuring the DNA methylation degree both in healthy volunteers and in reference calf thymus DNA.
Mammen, Cherry; Rupps, Rosemarie; Trnka, Peter; Boerkoel, Cornelius F
2012-02-01
We report a 5-year-old boy with thiazide-resistant Bartter syndrome. This is highly unusual since thiazide hypersensitivity is a common diagnostic finding in Bartter syndrome patients. Subsequent molecular testing identified compound heterozygosity for two novel mutations in KCNJ1, (c.556A > G and c.683G > A) which is associated with Bartter syndrome, and a paternally inherited polymorphism in SLC12A3 (c.791G > C). Mutations in SLC12A3 cause the thiazide-resistant tubulopathy Gitelman syndrome. Based on published studies of this polymorphism in SLC12A3 and the features of the proband's father, we postulate that this polymorphism modifies the phenotype of Bartter syndrome in the proband to thiazide resistance. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
Effect of DNA methylation on identification of aggressive prostate cancer.
Alumkal, Joshi J; Zhang, Zhe; Humphreys, Elizabeth B; Bennett, Christina; Mangold, Leslie A; Carducci, Michael A; Partin, Alan W; Garrett-Mayer, Elizabeth; DeMarzo, Angelo M; Herman, James G
2008-12-01
Biochemical (prostate-specific antigen) recurrence of prostate cancer after radical prostatectomy remains a major problem. Better biomarkers are needed to identify high-risk patients. DNA methylation of promoter regions leads to gene silencing in many cancers. In this study, we assessed the effect of DNA methylation on the identification of recurrent prostate cancer. We studied the methylation status of 15 pre-specified genes using methylation-specific polymerase chain reaction on tissue samples from 151 patients with localized prostate cancer and at least 5 years of follow-up after prostatectomy. On multivariate logistic regression analysis, a high Gleason score and involvement of the capsule, lymph nodes, seminal vesicles, or surgical margin were associated with an increased risk of biochemical recurrence. Methylation of CDH13 by itself (odds ratio 5.50, 95% confidence interval [CI] 1.34 to 22.67; P = 0.02) or combined with methylation of ASC (odds ratio 5.64, 95% CI 1.47 to 21.7; P = 0.01) was also associated with an increased risk of biochemical recurrence. The presence of methylation of ASC and/or CDH13 yielded a sensitivity of 72.3% (95% CI 57% to 84.4%) and negative predictive value of 79% (95% CI 66.8% to 88.3%), similar to the weighted risk of recurrence (determined from the lymph node status, seminal vesicle status, surgical margin status, and postoperative Gleason score), a powerful clinicopathologic prognostic score. However, 34% (95% CI 21% to 49%) of the patients with recurrence were identified by the methylation profile of ASC and CDH13 rather than the weighted risk of recurrence. The results of our study have shown that methylation of CDH13 alone or combined with methylation of ASC is independently associated with an increased risk of biochemical recurrence after radical prostatectomy even considering the weighted risk of recurrence score. These findings should be validated in an independent, larger cohort of patients with prostate cancer who have
Expression of RFC/SLC19A1 is associated with tumor type in bladder cancer patients.
Directory of Open Access Journals (Sweden)
Alyaa M Abdel-Haleem
Full Text Available Urinary bladder cancer (UBC ranks ninth in worldwide cancer. In Egypt, the pattern of bladder cancer is unique in that both the transitional and squamous cell types prevail. Despite much research on the topic, it is still difficult to predict tumor progression, optimal therapy and clinical outcome. The reduced folate carrier (RFC/SLC19A1 is the major transport system for folates in mammalian cells and tissues. RFC is also the primary means of cellular uptake for antifolate cancer chemotherapeutic drugs, however, membrane transport of antifolates by RFC is considered as limiting to antitumor activity. The purpose of this study was to compare the mRNA expression level of RFC/SLC19A1 in urothelial and non-urothelial variants of bladder carcinomas. Quantification of RFC mRNA in the mucosa of 41 untreated bladder cancer patients was performed using RT-qPCR. RFC mRNA steady-state levels were ∼9-fold higher (N = 39; P<0.0001 in bladder tumor specimens relative to normal bladder mRNA. RFC upregulation was strongly correlated with tumor type (urothelial vs. non-urothelial; p<0.05 where median RFC mRNA expression was significantly (p<0.05 higher in the urothelial (∼14-fold compared to the non-urothelial (∼4-fold variant. This may account for the variation in response to antifolate-containing regimens used in the treatment of either type. RFC mRNA levels were not associated with tumor grade (I, II and III or stage (muscle-invasive vs. non-muscle invasive implying that RFC cannot be used for prognostic purposes in bladder carcinomas and its increased expression is an early event in human bladder tumors pathogenesis. Further, RFC can be considered as a potential marker for predicting response to antifolate chemotherapy in urothelial carcinomas.
Altered DNA methylation: a secondary mechanism involved in carcinogenesis.
Goodman, Jay I; Watson, Rebecca E
2002-01-01
This review focuses on the role that DNA methylation plays in the regulation of normal and aberrant gene expression and on how, in a hypothesis-driven fashion, altered DNA methylation may be viewed as a secondary mechanism involved in carcinogenesis. Research aimed at discerning the mechanisms by which chemicals can transform normal cells into frank carcinomas has both theoretical and practical implications. Through an increased understanding of the mechanisms by which chemicals affect the carcinogenic process, we learn more about basic biology while, at the same time, providing the type of information required to make more rational safety assessment decisions concerning their actual potential to cause cancer under particular conditions of exposure. One key question is: does the mechanism of action of the chemical in question involve a secondary mechanism and, if so, what dose may be below its threshold?
DNA methylation alteration is a major consequence of genome doubling in autotetraploid Brassica rapa
Directory of Open Access Journals (Sweden)
Xu Yanhao
2017-01-01
Full Text Available Polyploids are typically classified as autopolyploids or allopolyploids based on the origin of their chromosome sets. Autopolyploidy is much more common than traditionally believed. Allopolyploidization, accompanied by genomic and transcriptomic changes, has been well investigated. In this study, genetic, DNA methylation and gene expression changes in autotetraploid Brassica rapa were investigated. No genetic alteration was detected using an amplified fragment length polymorphism (AFLP approach. Using a cDNA-AFLP approach, approximately 0.58% of fragments showed changes in gene expression in autotetraploid B. rapa. The methylation-sensitive amplification polymorphism (MSAP analysis showed that approximately 1.7% of the fragments underwent DNA methylation changes upon genome doubling, with hypermethylation and demethylation changes equally affected. Fragments displaying changes in gene expression and methylation status were isolated and then sequenced and characterized, respectively. This study showed that variation in cytosine methylation is a major consequence of genome doubling in autotetraploid Brassica rapa.
Directory of Open Access Journals (Sweden)
De Marzo Angelo M
2011-06-01
Full Text Available Abstract Background DNA methylation has been linked to genome regulation and dysregulation in health and disease respectively, and methods for characterizing genomic DNA methylation patterns are rapidly emerging. We have developed/refined methods for enrichment of methylated genomic fragments using the methyl-binding domain of the human MBD2 protein (MBD2-MBD followed by analysis with high-density tiling microarrays. This MBD-chip approach was used to characterize DNA methylation patterns across all non-repetitive sequences of human chromosomes 21 and 22 at high-resolution in normal and malignant prostate cells. Results Examining this data using computational methods that were designed specifically for DNA methylation tiling array data revealed widespread methylation of both gene promoter and non-promoter regions in cancer and normal cells. In addition to identifying several novel cancer hypermethylated 5' gene upstream regions that mediated epigenetic gene silencing, we also found several hypermethylated 3' gene downstream, intragenic and intergenic regions. The hypermethylated intragenic regions were highly enriched for overlap with intron-exon boundaries, suggesting a possible role in regulation of alternative transcriptional start sites, exon usage and/or splicing. The hypermethylated intergenic regions showed significant enrichment for conservation across vertebrate species. A sampling of these newly identified promoter (ADAMTS1 and SCARF2 genes and non-promoter (downstream or within DSCR9, C21orf57 and HLCS genes hypermethylated regions were effective in distinguishing malignant from normal prostate tissues and/or cell lines. Conclusions Comparison of chromosome-wide DNA methylation patterns in normal and malignant prostate cells revealed significant methylation of gene-proximal and conserved intergenic sequences. Such analyses can be easily extended for genome-wide methylation analysis in health and disease.
Pheiffer, Carmen; Humphries, Stephen E.; Gamieldien, Junaid; Erasmus, Rajiv T.
2016-01-01
Aims. To conduct a genome-wide DNA methylation in individuals with type 2 diabetes, individuals with prediabetes, and control mixed ancestry individuals from South Africa. Methods. We used peripheral blood to perform genome-wide DNA methylation analysis in 3 individuals with screen detected diabetes, 3 individuals with prediabetes, and 3 individuals with normoglycaemia from the Bellville South Community, Cape Town, South Africa, who were age-, gender-, body mass index-, and duration of residency-matched. Methylated DNA immunoprecipitation (MeDIP) was performed by Arraystar Inc. (Rockville, MD, USA). Results. Hypermethylated DMRs were 1160 (81.97%) and 124 (43.20%), respectively, in individuals with diabetes and prediabetes when both were compared to subjects with normoglycaemia. Our data shows that genes related to the immune system, signal transduction, glucose transport, and pancreas development have altered DNA methylation in subjects with prediabetes and diabetes. Pathway analysis based on the functional analysis mapping of genes to KEGG pathways suggested that the linoleic acid metabolism and arachidonic acid metabolism pathways are hypomethylated in prediabetes and diabetes. Conclusions. Our study suggests that epigenetic changes are likely to be an early process that occurs before the onset of overt diabetes. Detailed analysis of DMRs that shows gradual methylation differences from control versus prediabetes to prediabetes versus diabetes in a larger sample size is required to confirm these findings. PMID:27555869
A high-throughput and sensitive method to measure Global DNA Methylation: Application in Lung Cancer
Directory of Open Access Journals (Sweden)
Mamaev Sergey
2008-08-01
Full Text Available Abstract Background Genome-wide changes in DNA methylation are an epigenetic phenomenon that can lead to the development of disease. The study of global DNA methylation utilizes technology that requires both expensive equipment and highly specialized skill sets. Methods We have designed and developed an assay, CpGlobal, which is easy-to-use, does not utilize PCR, radioactivity and expensive equipment. CpGlobal utilizes methyl-sensitive restriction enzymes, HRP Neutravidin to detect the biotinylated nucleotides incorporated in an end-fill reaction and a luminometer to measure the chemiluminescence. The assay shows high accuracy and reproducibility in measuring global DNA methylation. Furthermore, CpGlobal correlates significantly with High Performance Capillary Electrophoresis (HPCE, a gold standard technology. We have applied the technology to understand the role of global DNA methylation in the natural history of lung cancer. World-wide, it is the leading cause of death attributed to any cancer. The survival rate is 15% over 5 years due to the lack of any clinical symptoms until the disease has progressed to a stage where cure is limited. Results Through the use of cell lines and paired normal/tumor samples from patients with non-small cell lung cancer (NSCLC we show that global DNA hypomethylation is highly associated with the progression of the tumor. In addition, the results provide the first indication that the normal part of the lung from a cancer patient has already experienced a loss of methylation compared to a normal individual. Conclusion By detecting these changes in global DNA methylation, CpGlobal may have a role as a barometer for the onset and development of lung cancer.
Effect of different light quality on DNA methylation variation for brown ...
African Journals Online (AJOL)
DNA methylation plays an important role in regulating gene expression during plant development. We studied the effects of different light quality on DNA methylation patterns of brown cotton (Gossypium hirstum) by using the methylation sensitive amplified polymorphism (MSAP). We selected 66 pairs of MSAP selective ...
The orphan nuclear receptor GCNF recruits DNA methyltransferase for Oct-3/4 silencing
International Nuclear Information System (INIS)
Sato, Noriko; Kondo, Mitsumasa; Arai, Ken-ichi
2006-01-01
Somatic DNA methylation patterns are determined in part by the de novo methylation that occurs after early embryonic demethylation. Oct-3/4, a pluripotency gene, is unmethylated in the blastocyst, but undergoes de novo methylation and silencing during gastrulation. Here we show that the transcriptional repressor GCNF recruits DNA methyltransferase to the Oct-3/4 promoter and facilitates its methylation. Although acetylation of histone H3 at lysine 9 (K9) and/or 14 (K14) and methylation of H3 at lysine 4 (K4) decrease during this period, as do Oct-3/4 transcript levels, H3K9 and H3K27 methylation levels remain constant, indicating that DNA methylation does not require repressive histone modifications. We found that GCNF interacts directly with Dnmt3 molecule(s) and verified that this interaction induces the methylation of the Oct-3/4 promoter. Our finding suggests a model in which differentiation-induced GCNF recruits de novo DNA methyltransferase and facilitates the silencing of a pluripotency gene
Methylated DNA for monitoring tumor growth and regression
DEFF Research Database (Denmark)
Kristiansen, Søren; Nielsen, Dorte; Söletormos, Georg
2014-01-01
Abstract A wide range of protein cancer biomarkers is currently recommended in international guidelines for monitoring the growth and regression of solid tumors. However, a number of these markers are also present in low concentrations in blood obtained from healthy individuals and from patients...... of gene promoters. Because tumor cells naturally secrete DNA and upon cell death leak DNA, modified methylated DNA can be detected in blood, urine, sputum and other body fluids. At present international guidelines do not include recommendations for monitoring modified methylated DNA. The low level...... of evidence can partly be explained by incomplete collection of serial blood samples, by analytical challenges, and by lack of knowledge of how monitoring studies should be designed and how serial marker data obtained from individual patients should be interpreted. Here, we review the clinical validity...
Variation of global DNA methylation levels with age and in autistic children.
Tsang, Shui-Ying; Ahmad, Tanveer; Mat, Flora W K; Zhao, Cunyou; Xiao, Shifu; Xia, Kun; Xue, Hong
2016-09-23
The change in epigenetic signatures, in particular DNA methylation, has been proposed as risk markers for various age-related diseases. However, the course of variation in methylation levels with age, the difference in methylation between genders, and methylation-disease association at the whole genome level is unclear. In the present study, genome-wide methylation levels in DNA extracted from peripheral blood for 2116 healthy Chinese in the 2-97 age range and 280 autistic trios were examined using the fluorescence polarization-based genome-wide DNA methylation quantification method developed by us. Genome-wide or global DNA methylation levels proceeded through multiple phases of variation with age, consisting of a steady increase from age 2 to 25 (r = 0.382) and another rise from age 41 to 55 to reach a peak level of ~80 % (r = 0.265), followed by a sharp decrease to ~40 % in the mid-1970s (age 56 to 75; r = -0.395) and leveling off thereafter. Significant gender effect in methylation levels was observed only for the 41-55 age group in which methylation in females was significantly higher than in males (p = 0.010). In addition, global methylation level was significantly higher in autistic children than in age-matched healthy children (p < 0.001). The multiphasic nature of changes in global methylation levels with age was delineated, and investigation into the factors underlying this profile will be essential to a proper understanding of the aging process. Furthermore, this first report of global hypermethylation in autistic children also illustrates the importance of age-matched controls in characterization of disease-associated variations in DNA methylation.
Directory of Open Access Journals (Sweden)
Monica D Nye
Full Text Available Cytology-based screening for invasive cervical cancer (ICC lacks sensitivity and specificity to discriminate between cervical intraepithelial neoplasia (CIN likely to persist or progress from cases likely to resolve. Genome-wide approaches have been used to identify DNA methylation marks associated with CIN persistence or progression. However, associations between DNA methylation marks and CIN or ICC remain weak and inconsistent. Between 2008-2009, we conducted a hospital-based, case-control study among 213 Tanzania women with CIN 1/2/3 or ICC. We collected questionnaire data, biopsies, peripheral blood, cervical scrapes, Human papillomavirus (HPV and HIV-1 infection status. We assessed PEG3 methylation status by bisulfite pyrosequencing. Multinomial logistic regression was used to estimate odds ratios (OR and confidence intervals (CI 95% for associations between PEG3 methylation status and CIN or ICC. After adjusting for age, gravidity, hormonal contraceptive use and HPV infection, a 5% increase in PEG3 DNA methylation was associated with increased risk for ICC (OR = 1.6; 95% CI 1.2-2.1. HPV infection was associated with a higher risk of CIN1-3 (OR = 15.7; 95% CI 5.7-48.6 and ICC (OR = 29.5, 95% CI 6.3-38.4. Infection with high risk HPV was correlated with mean PEG3 differentially methylated regions (DMRs methylation (r = 0.34 p<0.0001, while the correlation with low risk HPV infection was weaker (r = 0.16 p = 0.047. Although small sample size limits inference, these data support that PEG3 methylation status has potential as a molecular target for inclusion in CIN screening to improve prediction of progression. Impact statement: We present the first evidence that aberrant methylation of the PEG3 DMR is an important co-factor in the development of Invasive cervical carcinoma (ICC, especially among women infected with high risk HPV. Our results show that a five percent increase in DNA methylation of PEG3 is associated with
To What Extent Does DNA Methylation Affect Phenotypic Variation in Cattle?
Directory of Open Access Journals (Sweden)
Stephanie McKAY
2015-07-01
Full Text Available DNA methylation is an environmentally influenced epigenetic modification that regulates gene transcription and has the potential to influence variation in economically important phenotypes in agricultural species. We have utilized a novel approach to evaluate the relationship between genetic and epigenetic variation and downstream phenotypes. To begin with, we have integrated RNA-Seq and methyl binding domain sequencing (MBD-Seq data in order to determine the extent to which DNA methylation affects phenotypic variation in economically important traits of cattle. MBD-Seq is a technique that involves the sample enrichment of methylated genomic regions followed by their next-generation sequencing. This study utilized Illumina next generation sequencing technology to perform both RNA-Seq and MBD-Seq. NextGENe software (SoftGenetics, State College, PA was employed for quality trimming and aligning the sequence reads to the UMD3.1 bovine reference genome, generating counts of matched reads and methylated peak identification. Subsequently, we identified and quantified genome-wide methylated regions and characterized the extent of differential methylation and differential expression between two groups of animals with extreme phenotypes. The program edgeR from the R software package (version 3.0.1 was employed for identifying differentially methylated regions and regions of differential expression. Finally, Partial Correlation with Information Theory (PCIT was performed to identify transcripts and methylation events that exhibit differential hubbing. A differential hub is defined as a gene network hub that is more highly connected in one treatment group than the other. This analysis produced every possible pair-wise interaction that subsequently enabled us to look at network interactions of how methylation affects expression. (co-expression, co-methylation, methylation x expression. Genomic regions of interest derived from this analysis were then aligned
Tea and coffee consumption in relation to DNA methylation in four European cohorts.
Ek, Weronica E; Tobi, Elmar W; Ahsan, Muhammad; Lampa, Erik; Ponzi, Erica; Kyrtopoulos, Soterios A; Georgiadis, Panagiotis; Lumey, L H; Heijmans, Bastiaan T; Botsivali, Maria; Bergdahl, Ingvar A; Karlsson, Torgny; Rask-Andersen, Mathias; Palli, Domenico; Ingelsson, Erik; Hedman, Åsa K; Nilsson, Lena M; Vineis, Paolo; Lind, Lars; Flanagan, James M; Johansson, Åsa
2017-08-15
Lifestyle factors, such as food choices and exposure to chemicals, can alter DNA methylation and lead to changes in gene activity. Two such exposures with pharmacologically active components are coffee and tea consumption. Both coffee and tea have been suggested to play an important role in modulating disease-risk in humans by suppressing tumour progression, decreasing inflammation and influencing estrogen metabolism. These mechanisms may be mediated by changes in DNA methylation. To investigate if DNA methylation in blood is associated with coffee and tea consumption, we performed a genome-wide DNA methylation study for coffee and tea consumption in four European cohorts (N = 3,096). DNA methylation was measured from whole blood at 421,695 CpG sites distributed throughout the genome and analysed in men and women both separately and together in each cohort. Meta-analyses of the results and additional regional-level analyses were performed. After adjusting for multiple testing, the meta-analysis revealed that two individual CpG-sites, mapping to DNAJC16 and TTC17, were differentially methylated in relation to tea consumption in women. No individual sites were associated with men or with the sex-combined analysis for tea or coffee. The regional analysis revealed that 28 regions were differentially methylated in relation to tea consumption in women. These regions contained genes known to interact with estradiol metabolism and cancer. No significant regions were found in the sex-combined and male-only analysis for either tea or coffee consumption. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Kotnik Barbara Faganel
2017-09-01
Full Text Available We investigated the clinical relevance of SLC 19A1 genetic variability for high dose methotrexate (HD-MTX related toxicities in children and adolescents with acute lymphoblastic leukaemia (ALL and non Hodgkin malignant lymphoma (NHML.
Directory of Open Access Journals (Sweden)
Michelle R Newman
Full Text Available The low dose radioadaptive response has been shown to be protective against high doses of radiation as well as aging-induced genomic instability. We hypothesised that a single whole-body exposure of low dose radiation would induce a radioadaptive response thereby reducing or abrogating aging-related changes in repeat element DNA methylation in mice. Following sham or 10 mGy X-irradiation, serial peripheral blood sampling was performed and differences in Long Interspersed Nucleic Element 1 (L1, B1 and Intracisternal-A-Particle (IAP repeat element methylation between samples were assessed using high resolution melt analysis of PCR amplicons. By 420 days post-irradiation, neither radiation- or aging-related changes in the methylation of peripheral blood, spleen or liver L1, B1 and IAP elements were observed. Analysis of the spleen and liver tissues of cohorts of untreated aging mice showed that the 17-19 month age group exhibited higher repeat element methylation than younger or older mice, with no overall decline in methylation detected with age. This is the first temporal analysis of the effect of low dose radiation on repeat element methylation in mouse peripheral blood and the first to examine the long term effect of this dose on repeat element methylation in a radiosensitive tissue (spleen and a tissue fundamental to the aging process (liver. Our data indicate that the methylation of murine DNA repeat elements can fluctuate with age, but unlike human studies, do not demonstrate an overall aging-related decline. Furthermore, our results indicate that a low dose of ionising radiation does not induce detectable changes to murine repeat element DNA methylation in the tissues and at the time-points examined in this study. This radiation dose is relevant to human diagnostic radiation exposures and suggests that a dose of 10 mGy X-rays, unlike high dose radiation, does not cause significant short or long term changes to repeat element or global DNA
Effect of nickel chloride on Arabidopsis genomic DNA and methylation of 18S rDNA
Directory of Open Access Journals (Sweden)
Zhongai Li
2015-01-01
Conclusions: NiCl2 application caused variation of DNA methylation of the Arabidopsis genomic and offspring's. NiCl2 also resulted in nucleolar injury and deformity of root tip cells. The methylation rate of 18S rDNA also changed by adding NiCl2.
Genome-wide signatures of differential DNA methylation in pediatric acute lymphoblastic leukemia
DEFF Research Database (Denmark)
Nordlund, Jessica; Bäcklin, Christofer L; Wahlberg, Per
2013-01-01
BACKGROUND: Although aberrant DNA methylation has been observed previously in acute lymphoblastic leukemia (ALL), the patterns of differential methylation have not been comprehensively determined in all subtypes of ALL on a genome-wide scale. The relationship between DNA methylation, cytogenetic...... background, drug resistance and relapse in ALL is poorly understood. RESULTS: We surveyed the DNA methylation levels of 435,941 CpG sites in samples from 764 children at diagnosis of ALL and from 27 children at relapse. This survey uncovered four characteristic methylation signatures. First, compared...... cells at relapse, compared with matched samples at diagnosis. Analysis of relapse-free survival identified CpG sites with subtype-specific differential methylation that divided the patients into different risk groups, depending on their methylation status. CONCLUSIONS: Our results suggest an important...
Methylation patterns of repetitive DNA sequences in germ cells of Mus musculus.
Sanford, J; Forrester, L; Chapman, V; Chandley, A; Hastie, N
1984-03-26
The major and the minor satellite sequences of Mus musculus were undermethylated in both sperm and oocyte DNAs relative to the amount of undermethylation observed in adult somatic tissue DNA. This hypomethylation was specific for satellite sequences in sperm DNA. Dispersed repetitive and low copy sequences show a high degree of methylation in sperm DNA; however, a dispersed repetitive sequence was undermethylated in oocyte DNA. This finding suggests a difference in the amount of total genomic DNA methylation between sperm and oocyte DNA. The methylation levels of the minor satellite sequences did not change during spermiogenesis, and were not associated with the onset of meiosis or a specific stage in sperm development.
van der Wijst, Monique G. P.; van Tilburg, Amanda Y.; Ruiters, Marcel H. J.; Rots, Marianne G.
2017-01-01
Like the nucleus, mitochondria contain their own DNA and recent reports provide accumulating evidence that also the mitochondrial DNA (mtDNA) is subjective to DNA methylation. This evidence includes the demonstration of mitochondria-localised DNA methyltransferases and demethylases, and the
Walker, Rosie May; Christoforou, Andrea Nikie; McCartney, Daniel L; Morris, Stewart W; Kennedy, Nicholas A; Morten, Peter; Anderson, Susan Maguire; Torrance, Helen Scott; Macdonald, Alix; Sussmann, Jessika Elizabeth; Whalley, Heather Clare; Blackwood, Douglas H R; McIntosh, Andrew Mark; Porteous, David John; Evans, Kathryn Louise
2016-01-01
Bipolar disorder (BD) is a severe, familial psychiatric condition. Progress in understanding the aetiology of BD has been hampered by substantial phenotypic and genetic heterogeneity. We sought to mitigate these confounders by studying a multi-generational family multiply affected by BD and major depressive disorder (MDD), who carry an illness-linked haplotype on chromosome 4p. Within a family, aetiological heterogeneity is likely to be reduced, thus conferring greater power to detect illness-related changes. As accumulating evidence suggests that altered DNA methylation confers risk for BD and MDD, we compared genome-wide methylation between (i) affected carriers of the linked haplotype (ALH) and married-in controls (MIs), (ii) well unaffected haplotype carriers (ULH) and MI, (iii) ALH and ULH and (iv) all haplotype carriers (LH) and MI. Nominally significant differences in DNA methylation were observed in all comparisons, with differences withstanding correction for multiple testing when the ALH or LH group was compared to the MIs. In both comparisons, we observed increased methylation at a locus in FANCI, which was accompanied by increased FANCI expression in the ALH group. FANCI is part of the Fanconi anaemia complementation (FANC) gene family, which are mutated in Fanconi anaemia and participate in DNA repair. Interestingly, several FANC genes have been implicated in psychiatric disorders. Regional analyses of methylation differences identified loci implicated in psychiatric illness by genome-wide association studies, including CACNB2 and the major histocompatibility complex. Gene ontology analysis revealed enrichment for methylation differences in neurologically relevant genes. Our results highlight altered DNA methylation as a potential mechanism by which the linked haplotype might confer risk for mood disorders. Differences in the phenotypic outcome of haplotype carriers might, in part, arise from additional changes in DNA methylation that converge on
Directory of Open Access Journals (Sweden)
Nikul Patel
2012-01-01
Full Text Available The role of aberrant DNA methylation in Ewing sarcoma is not completely understood. The methylation status of 503 genes in 52 formalin-fixed paraffin-embedded EWS tumors and 3 EWS cell lines was compared to human mesenchymal stem cell primary cultures (hMSCs using bead chip methylation analysis. Relative expression of methylated genes was assessed in 5-Aza-2-deoxycytidine-(5-AZA-treated EWS cell lines and in a cohort of primary EWS samples and hMSCs by gene expression and quantitative RT-PCR. 129 genes demonstrated statistically significant hypermethylation in EWS tumors compared to hMSCs. Thirty-six genes were profoundly methylated in EWS and unmethylated in hMSCs. 5-AZA treatment of EWS cell lines resulted in upregulation of expression of hundreds of genes including 162 that were increased by at least 2-fold. The expression of 19 of 36 candidate hypermethylated genes was increased following 5-AZA. Analysis of gene expression from an independent cohort of tumors confirmed decreased expression of six of nineteen hypermethylated genes (AXL, COL1A1, CYP1B1, LYN, SERPINE1, and VCAN. Comparing gene expression and DNA methylation analyses proved to be an effective way to identify genes epigenetically regulated in EWS. Further investigation is ongoing to elucidate the role of these epigenetic alterations in EWS pathogenesis.
Suicidal function of DNA methylation in age-related genome disintegration.
Mazin, Alexander L
2009-10-01
This article is dedicated to the 60th anniversary of 5-methylcytosine discovery in DNA. Cytosine methylation can affect genetic and epigenetic processes, works as a part of the genome-defense system and has mutagenic activity; however, the biological functions of this enzymatic modification are not well understood. This review will put forward the hypothesis that the host-defense role of DNA methylation in silencing and mutational destroying of retroviruses and other intragenomic parasites was extended during evolution to most host genes that have to be inactivated in differentiated somatic cells, where it acquired a new function in age-related self-destruction of the genome. The proposed model considers DNA methylation as the generator of 5mC>T transitions that induce 40-70% of all spontaneous somatic mutations of the multiple classes at CpG and CpNpG sites and flanking nucleotides in the p53, FIX, hprt, gpt human genes and some transgenes. The accumulation of 5mC-dependent mutations explains: global changes in the structure of the vertebrate genome throughout evolution; the loss of most 5mC from the DNA of various species over their lifespan and the Hayflick limit of normal cells; the polymorphism of methylation sites, including asymmetric mCpNpN sites; cyclical changes of methylation and demethylation in genes. The suicidal function of methylation may be a special genetic mechanism for increasing DNA damage and the programmed genome disintegration responsible for cell apoptosis and organism aging and death.
Androgen receptor function links human sexual dimorphism to DNA methylation.
Directory of Open Access Journals (Sweden)
Ole Ammerpohl
Full Text Available Sex differences are well known to be determinants of development, health and disease. Epigenetic mechanisms are also known to differ between men and women through X-inactivation in females. We hypothesized that epigenetic sex differences may also result from sex hormone functions, in particular from long-lasting androgen programming. We aimed at investigating whether inactivation of the androgen receptor, the key regulator of normal male sex development, is associated with differences of the patterns of DNA methylation marks in genital tissues. To this end, we performed large scale array-based analysis of gene methylation profiles on genomic DNA from labioscrotal skin fibroblasts of 8 males and 26 individuals with androgen insensitivity syndrome (AIS due to inactivating androgen receptor gene mutations. By this approach we identified differential methylation of 167 CpG loci representing 162 unique human genes. These were significantly enriched for androgen target genes and low CpG content promoter genes. Additional 75 genes showed a significant increase of heterogeneity of methylation in AIS compared to a high homogeneity in normal male controls. Our data show that normal and aberrant androgen receptor function is associated with distinct patterns of DNA-methylation marks in genital tissues. These findings support the concept that transcription factor binding to the DNA has an impact on the shape of the DNA methylome. These data which derived from a rare human model suggest that androgen programming of methylation marks contributes to sexual dimorphism in the human which might have considerable impact on the manifestation of sex-associated phenotypes and diseases.
Yamamoto, F; Yamamoto, M
2004-07-01
We previously developed a PCR-based DNA fingerprinting technique named the Methylation Sensitive (MS)-AFLP method, which permits comparative genome-wide scanning of methylation status with a manageable number of fingerprinting experiments. The technique uses the methylation sensitive restriction enzyme NotI in the context of the existing Amplified Fragment Length Polymorphism (AFLP) method. Here we report the successful conversion of this gel electrophoresis-based DNA fingerprinting technique into a DNA microarray hybridization technique (DNA Microarray MS-AFLP). By performing a total of 30 (15 x 2 reciprocal labeling) DNA Microarray MS-AFLP hybridization experiments on genomic DNA from two breast and three prostate cancer cell lines in all pairwise combinations, and Southern hybridization experiments using more than 100 different probes, we have demonstrated that the DNA Microarray MS-AFLP is a reliable method for genetic and epigenetic analyses. No statistically significant differences were observed in the number of differences between the breast-prostate hybridization experiments and the breast-breast or prostate-prostate comparisons.
Directory of Open Access Journals (Sweden)
Xiaoguo Zheng
Full Text Available Adverse environmental conditions have large impacts on plant growth and crop production. One of the crucial mechanisms that plants use in variable and stressful natural environments is gene expression modulation through epigenetic modification. In this study, two rice varieties with different drought resistance levels were cultivated under drought stress from tilling stage to seed filling stage for six successive generations. The variations in DNA methylation of the original generation (G0 and the sixth generation (G6 of these two varieties in normal condition (CK and under drought stress (DT at seedling stage were assessed by using Methylation Sensitive Amplification Polymorphism (MSAP method. The results revealed that drought stress had a cumulative effect on the DNA methylation pattern of both varieties, but these two varieties had different responses to drought stress in DNA methylation. The DNA methylation levels of II-32B (sensitive and Huhan-3 (resistant were around 39% and 32%, respectively. Genome-wide DNA methylation variations among generations or treatments accounted for around 13.1% of total MSAP loci in II-32B, but was only approximately 1.3% in Huhan-3. In II-32B, 27.6% of total differentially methylated loci (DML were directly induced by drought stress and 3.2% of total DML stably transmitted their changed DNA methylation status to the next generation. In Huhan-3, the numbers were 48.8% and 29.8%, respectively. Therefore, entrainment had greater effect on Huhan-3 than on II-32B. Sequence analysis revealed that the DML were widely distributed on all 12 rice chromosomes and that it mainly occurred on the gene's promoter and exon region. Some genes with DML respond to environmental stresses. The inheritance of epigenetic variations induced by drought stress may provide a new way to develop drought resistant rice varieties.
Directory of Open Access Journals (Sweden)
Yokoyama Seiya
2012-02-01
Full Text Available Abstract Background Methylation of CpG sites in genomic DNA plays an important role in gene regulation and especially in gene silencing. We have reported mechanisms of epigenetic regulation for expression of mucins, which are markers of malignancy potential and early detection of human neoplasms. Epigenetic changes in promoter regions appear to be the first step in expression of mucins. Thus, detection of promoter methylation status is important for early diagnosis of cancer, monitoring of tumor behavior, and evaluating the response of tumors to targeted therapy. However, conventional analytical methods for DNA methylation require a large amount of DNA and have low sensitivity. Methods Here, we report a modified version of the bisulfite-DGGE (denaturing gradient gel electrophoresis using a nested PCR approach. We designated this method as methylation specific electrophoresis (MSE. The MSE method is comprised of the following steps: (a bisulfite treatment of genomic DNA, (b amplification of the target DNA by a nested PCR approach and (c applying to DGGE. To examine whether the MSE method is able to analyze DNA methylation of mucin genes in various samples, we apply it to DNA obtained from state cell lines, ethanol-fixed colonic crypts and human pancreatic juices. Result The MSE method greatly decreases the amount of input DNA. The lower detection limit for distinguishing different methylation status is Conclusions The MSE method can provide a qualitative information of methylated sequence profile. The MSE method allows sensitive and specific analysis of the DNA methylation pattern of almost any block of multiple CpG sites. The MSE method can be applied to analysis of DNA methylation status in many different clinical samples, and this may facilitate identification of new risk markers.
Non-Steroidal Anti-Inflammatory Drug Use and Genomic DNA Methylation in Blood.
Directory of Open Access Journals (Sweden)
Lauren E Wilson
Full Text Available Non-steroidal anti-inflammatory drug (NSAID use is associated with decreased risk of some cancers. NSAID use modulates the epigenetic profile of normal colonic epithelium and may reduce risk of colon cancer through this pathway; however, the effect of NSAID use on the DNA methylation profile of other tissues including whole blood has not yet been examined.Using the Sister Study cohort, we examined the association between NSAID usage and whole genome methylation patterns in blood DNA. Blood DNA methylation status across 27,589 CpG sites was evaluated for 871 women using the Illumina Infinium HumanMethylation27 Beadchip, and in a non-overlapping replication sample of 187 women at 485,512 CpG sites using the Infinium HumanMethylation450 Beadchip. We identified a number of CpG sites that were differentially methylated in regular, long-term users of NSAIDs in the discovery group, but none of these sites were statistically significant in our replication group.We found no replicable methylation differences in blood related to NSAID usage. If NSAID use does effect blood DNA methylation patterns, differences are likely small.
DNA methylation modifications associated with chronic fatigue syndrome.
Directory of Open Access Journals (Sweden)
Wilfred C de Vega
Full Text Available Chronic Fatigue Syndrome (CFS, also known as myalgic encephalomyelitis, is a complex multifactorial disease that is characterized by the persistent presence of fatigue and other particular symptoms for a minimum of 6 months. Symptoms fail to dissipate after sufficient rest and have major effects on the daily functioning of CFS sufferers. CFS is a multi-system disease with a heterogeneous patient population showing a wide variety of functional disabilities and its biological basis remains poorly understood. Stable alterations in gene function in the immune system have been reported in several studies of CFS. Epigenetic modifications have been implicated in long-term effects on gene function, however, to our knowledge, genome-wide epigenetic modifications associated with CFS have not been explored. We examined the DNA methylome in peripheral blood mononuclear cells isolated from CFS patients and healthy controls using the Illumina HumanMethylation450 BeadChip array, controlling for invariant probes and probes overlapping polymorphic sequences. Gene ontology (GO and network analysis of differentially methylated genes was performed to determine potential biological pathways showing changes in DNA methylation in CFS. We found an increased abundance of differentially methylated genes related to the immune response, cellular metabolism, and kinase activity. Genes associated with immune cell regulation, the largest coordinated enrichment of differentially methylated pathways, showed hypomethylation within promoters and other gene regulatory elements in CFS. These data are consistent with evidence of multisystem dysregulation in CFS and implicate the involvement of DNA modifications in CFS pathology.
Human Parvovirus B19 Utilizes Cellular DNA Replication Machinery for Viral DNA Replication.
Zou, Wei; Wang, Zekun; Xiong, Min; Chen, Aaron Yun; Xu, Peng; Ganaie, Safder S; Badawi, Yomna; Kleiboeker, Steve; Nishimune, Hiroshi; Ye, Shui Qing; Qiu, Jianming
2018-03-01
Human parvovirus B19 (B19V) infection of human erythroid progenitor cells (EPCs) induces a DNA damage response and cell cycle arrest at late S phase, which facilitates viral DNA replication. However, it is not clear exactly which cellular factors are employed by this single-stranded DNA virus. Here, we used microarrays to systematically analyze the dynamic transcriptome of EPCs infected with B19V. We found that DNA metabolism, DNA replication, DNA repair, DNA damage response, cell cycle, and cell cycle arrest pathways were significantly regulated after B19V infection. Confocal microscopy analyses revealed that most cellular DNA replication proteins were recruited to the centers of viral DNA replication, but not the DNA repair DNA polymerases. Our results suggest that DNA replication polymerase δ and polymerase α are responsible for B19V DNA replication by knocking down its expression in EPCs. We further showed that although RPA32 is essential for B19V DNA replication and the phosphorylated forms of RPA32 colocalized with the replicating viral genomes, RPA32 phosphorylation was not necessary for B19V DNA replication. Thus, this report provides evidence that B19V uses the cellular DNA replication machinery for viral DNA replication. IMPORTANCE Human parvovirus B19 (B19V) infection can cause transient aplastic crisis, persistent viremia, and pure red cell aplasia. In fetuses, B19V infection can result in nonimmune hydrops fetalis and fetal death. These clinical manifestations of B19V infection are a direct outcome of the death of human erythroid progenitors that host B19V replication. B19V infection induces a DNA damage response that is important for cell cycle arrest at late S phase. Here, we analyzed dynamic changes in cellular gene expression and found that DNA metabolic processes are tightly regulated during B19V infection. Although genes involved in cellular DNA replication were downregulated overall, the cellular DNA replication machinery was tightly
Using a medium-throughput comet assay to evaluate the global DNA methylation status of single cells
Lewies, Angélique; Van Dyk, Etresia; Wentzel, Johannes F.; Pretorius, Pieter J.
2014-01-01
The comet assay is a simple and cost effective technique, commonly used to analyze and quantify DNA damage in individual cells. The versatility of the comet assay allows introduction of various modifications to the basic technique. The difference in the methylation sensitivity of the isoschizomeric restriction enzymes HpaII and MspI are used to demonstrate the ability of the comet assay to measure the global DNA methylation level of individual cells when using cell cultures. In the experiments described here, a medium-throughput comet assay and methylation sensitive comet assay are combined to produce a methylation sensitive medium-throughput comet assay to measure changes in the global DNA methylation pattern in individual cells under various growth conditions. PMID:25071840
Zhang, Ruijie; Lv, Wenhua; Luan, Meiwei; Zheng, Jiajia; Shi, Miao; Zhu, Hongjie; Li, Jin; Lv, Hongchao; Zhang, Mingming; Shang, Zhenwei; Duan, Lian; Jiang, Yongshuai
2015-11-24
Different human genes often exhibit different degrees of stability in their DNA methylation levels between tissues, samples or cell types. This may be related to the evolution of human genome. Thus, we compared the evolutionary conservation between two types of genes: genes with stable DNA methylation levels (SM genes) and genes with fluctuant DNA methylation levels (FM genes). For long-term evolutionary characteristics between species, we compared the percentage of the orthologous genes, evolutionary rate dn/ds and protein sequence identity. We found that the SM genes had greater percentages of the orthologous genes, lower dn/ds, and higher protein sequence identities in all the 21 species. These results indicated that the SM genes were more evolutionarily conserved than the FM genes. For short-term evolutionary characteristics among human populations, we compared the single nucleotide polymorphism (SNP) density, and the linkage disequilibrium (LD) degree in HapMap populations and 1000 genomes project populations. We observed that the SM genes had lower SNP densities, and higher degrees of LD in all the 11 HapMap populations and 13 1000 genomes project populations. These results mean that the SM genes had more stable chromosome genetic structures, and were more conserved than the FM genes.
Age-associated decrease in global DNA methylation in patients with major depression
Directory of Open Access Journals (Sweden)
Tseng PT
2014-11-01
Full Text Available Ping-Tao Tseng,1,2,* Pao-Yen Lin,1,3,* Yu Lee,1 Chi-Fa Hung,1 For-Wey Lung,4,5 Cheng-Sheng Chen,6,7 Mian-Yoon Chong1 1Department of Psychiatry, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Kaohsiung, Taiwan; 2Department of Psychiatry, Tsyr-Huey Mental Hospital, Kaohsiung Jen-Ai’s Home, Taiwan; 3Center for Translational Research in Biomedical Sciences, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung, Taiwan; 4Taipei City Psychiatric Center, Taipei City Hospital, Taipei, Taiwan; 5Graduate Institute of Medical Science, National Defense Medical Center, Taipei, Taiwan; 6Department of Psychiatry, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan; 7Department of Psychiatry, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan *These authors contributed equally to this work Background: Evidence has supported a role of DNA methylation in the pathophysiology of mood disorders. The purpose of the current study is to examine 5-methylcytosine (5-mc and 5-hydroxymethylcytosine (5-hmc levels in patients with major depressive disorder (MDD at different disease states.Methods: Forty-nine patients with MDD and 25 healthy control subjects were included. The severity in the disease was assessed by using the 17-item Hamilton Rating Scale of Depression (HAM-D (HAM-D ≥19 for severe MDD and HAM-D ≤7 for remitted MDD. The 5-mc and 5-hmc levels in leukocyte DNA were measured using an enzyme-linked immunosorbent assay-based method.Results: We found a significant decrease in 5-hmc and trends of decreasing 5-mc levels in patients with severe MDD compared to healthy controls (P=0.059 for 5-mc and P=0.013 for 5-hmc. The decrease in the level exists only in the older age group (P=0.035 for 5-mc and P=0.002 for 5-hmc but not in the younger age group (P=0.077 for 5-mc and P=0.620 for 5-hmc. In addition, the 5-mc level was found to be inversely correlated with disease severity (P=0.011.Conclusion: Our
Plasma Membrane Na+-Coupled Citrate Transporter (SLC13A5 and Neonatal Epileptic Encephalopathy
Directory of Open Access Journals (Sweden)
Yangzom D. Bhutia
2017-02-01
Full Text Available SLC13A5 is a Na+-coupled transporter for citrate that is expressed in the plasma membrane of specific cell types in the liver, testis, and brain. It is an electrogenic transporter with a Na+:citrate3− stoichiometry of 4:1. In humans, the Michaelis constant for SLC13A5 to transport citrate is ~600 μM, which is physiologically relevant given that the normal concentration of citrate in plasma is in the range of 150–200 μM. Li+ stimulates the transport function of human SLC13A5 at concentrations that are in the therapeutic range in patients on lithium therapy. Human SLC13A5 differs from rodent Slc13a5 in two important aspects: the affinity of the human transporter for citrate is ~30-fold less than that of the rodent transporter, thus making human SLC13A5 a low-affinity/high-capacity transporter and the rodent Slc13a5 a high-affinity/low-capacity transporter. In the liver, SLC13A5 is expressed exclusively in the sinusoidal membrane of the hepatocytes, where it plays a role in the uptake of circulating citrate from the sinusoidal blood for metabolic use. In the testis, the transporter is expressed only in spermatozoa, which is also only in the mid piece where mitochondria are located; the likely function of the transporter in spermatozoa is to mediate the uptake of citrate present at high levels in the seminal fluid for subsequent metabolism in the sperm mitochondria to generate biological energy, thereby supporting sperm motility. In the brain, the transporter is expressed mostly in neurons. As astrocytes secrete citrate into extracellular medium, the potential function of SLC13A5 in neurons is to mediate the uptake of circulating citrate and astrocyte-released citrate for subsequent metabolism. Slc13a5-knockout mice have been generated; these mice do not have any overt phenotype but are resistant to experimentally induced metabolic syndrome. Recently however, loss-of-function mutations in human SLC13A5 have been found to cause severe epilepsy
Shivakumar, L.; Shivaprasad, K.; Revanasiddappa, Hosakere D.
2013-04-01
Newly synthesized ligand [2-((3-(benzyloxy)pyridin-2-ylimino)methyl)phenol] (Bpmp) react with manganese(II) to form mononuclear complexes [Mn(phen)(Bpmp)(CH3COO)(H2O)]·4H2O (1), (phen = 1,10-phenanthroline) and [Mn(Bpmp)2(CH3COO)(H2O)]·5H2O (2). These complexes were characterized by elemental analysis, IR, 1H NMR, Mass, UV-vis spectral studies. Molar conductance and thermogravimetric analysis of these complexes were also recorded. The in vitro SOD mimic activity of Mn(III) complexes were carried out and obtained with good result. The DNA-binding properties of the complexes 1 and 2 were investigated by UV-spectroscopy, fluorescence spectroscopy and viscosity measurements. The spectral results suggest that the complexes 1 and 2 can bind to Calf thymus DNA by intercalation mode. The cleavage properties of these complexes with super coiled pUC19 have been studied using the gel electrophoresis method, wherein both complexes 1 and 2 displayed chemical nuclease activity in the absence and presence of H2O2via an oxidative mechanism. All the complexes inhibit the growth of both Gram positive and Gram negative bacteria to competent level. The MIC was determined by microtiter method.
Directory of Open Access Journals (Sweden)
Xiao-guo ZHENG
2014-09-01
Full Text Available Recent studies revealed that DNA methylation plays an important role in plant growth and development. In this study, a water-saving and drought-resistant rice variety Huhan 3 was subjected to drought stress from tillering to grain-filling stages in six successive growth cycles. The variations in DNA methylation pattern between the original generation (G0 and the sixth generation (G6 were analyzed by using methylation sensitive amplification polymorphism method. The results revealed that the methylated loci accounted for 34.3% to 34.8% of the total loci. Among these methylated loci, 83.1% to 84.8% were full- and hyper-methylated and 15.2% to 16.9% were hemi-methylated. The DNA methylation level decreased from the three-leaf to four-leaf stages in Huhan 3. Differentially methylated loci (DML between generations or/and between different developmental stages accounted for 4.0% of the total loci, most of which were only related to plant development (57.9%. Compared to G0, the DNA methylation pattern of G6 changed after drought domestication, at the three-leaf stage, de-methylation accounting for 59.1%, while at the four-leaf stage, re-methylation for 47.9%. Genome-wide alternations of DNA methylation were observed between the two seedling stages, and DML mainly occurred on the gene's promoter and exon region. The genes related to DML involved in a wide range of functional biology and participated in many important biological processes.
Yang, Jin-Lan; Liu, Li-Wang; Gong, Yi-Qin; Huang, Dan-Qiong; Wang, Feng; He, Ling-Li
2007-06-01
The level of cytosine methylation induced by cadmium in radish (Raphanus sativus L.) genome was analysed using the technique of methylation-sensitive amplified polymorphism (MSAP). The MSAP ratios in radish seedling exposed to cadmium chloride at the concentration of 50, 250 and 500 mg/L were 37%, 43% and 51%, respectively, and the control was 34%; the full methylation levels (C(m)CGG in double strands) were at 23%, 25% and 27%, respectively, while the control was 22%. The level of increase in MSAP and full methylation indicated that de novo methylation occurred in some 5'-CCGG sites under Cd stress. There was significant positive correlation between increase of total DNA methylation level and CdCl(2) concentration. Four types of MSAP patterns: de novo methylation, de-methylation, atypical pattern and no changes of methylation pattern were identified among CdCl(2) treatments and the control. DNA methylation alteration in plants treated with CdCl(2) was mainly through de novo methylation.
Corruption of the intra-gene DNA methylation architecture is a hallmark of cancer.
Bartlett, Thomas E; Zaikin, Alexey; Olhede, Sofia C; West, James; Teschendorff, Andrew E; Widschwendter, Martin
2013-01-01
Epigenetic processes--including DNA methylation--are increasingly seen as having a fundamental role in chronic diseases like cancer. It is well known that methylation levels at particular genes or loci differ between normal and diseased tissue. Here we investigate whether the intra-gene methylation architecture is corrupted in cancer and whether the variability of levels of methylation of individual CpGs within a defined gene is able to discriminate cancerous from normal tissue, and is associated with heterogeneous tumour phenotype, as defined by gene expression. We analysed 270985 CpGs annotated to 18272 genes, in 3284 cancerous and 681 normal samples, corresponding to 14 different cancer types. In doing so, we found novel differences in intra-gene methylation pattern across phenotypes, particularly in those genes which are crucial for stem cell biology; our measures of intra-gene methylation architecture are a better determinant of phenotype than measures based on mean methylation level alone (K-S test [Formula: see text] in all 14 diseases tested). These per-gene methylation measures also represent a considerable reduction in complexity, compared to conventional per-CpG beta-values. Our findings strongly support the view that intra-gene methylation architecture has great clinical potential for the development of DNA-based cancer biomarkers.
DNA methyl transferases are differentially expressed in the human anterior eye segment.
Bonnin, Nicolas; Belville, Corinne; Chiambaretta, Frédéric; Sapin, Vincent; Blanchon, Loïc
2014-08-01
DNA methylation is an epigenetic mark involved in the control of genes expression. Abnormal epigenetic events have been reported in human pathologies but weakly documented in eye diseases. The purpose of this study was to establish DNMT mRNA and protein expression levels in the anterior eye segment tissues and their related (primary or immortalized) cell cultures as a first step towards future in vivo and in vitro methylomic studies. Total mRNA was extracted from human cornea, conjunctiva, anterior lens capsule, trabeculum and related cell cultures (cornea epithelial, trabecular meshwork, keratocytes for primary cells; and HCE, Chang, B-3 for immortalized cells). cDNA was quantified by real-time PCR using specific primers for DNMT1, 2, 3A, 3B and 3L. Immunolocalization assays were carried out on human cornea using specific primary antibodies for DNMT1, 2 and 3A, 3B and 3L. All DNMT transcripts were detected in human cornea, conjunctiva, anterior lens capsule, trabeculum and related cells but showed statistically different expression patterns between tissues and cells. DNMT2 protein presented a specific and singular expression pattern in corneal endothelium. This study produced the first inventory of the expression patterns of DNMTs in human adult anterior eye segment. Our research highlights that DNA methylation cannot be ruled out as a way to bring new insights into well-known ocular diseases. In addition, future DNA methylation studies using various cells as experimental models need to be conducted with attention to approach the results analysis from a global tissue perspective. © 2014 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.
Tian, Ying; Arai, Eri; Gotoh, Masahiro; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Kanai, Yae
2014-10-20
The CpG island methylator phenotype (CIMP) of clear cell renal cell carcinomas (ccRCCs) is characterized by accumulation of DNA methylation at CpG islands and poorer patient outcome. The aim of this study was to establish criteria for prognostication of patients with ccRCCs using the ccRCC-specific CIMP marker genes. DNA methylation levels at 299 CpG sites in the 14 CIMP marker genes were evaluated quantitatively in tissue specimens of 88 CIMP-negative and 14 CIMP-positive ccRCCs in a learning cohort using the MassARRAY system. An additional 100 ccRCCs were also analyzed as a validation cohort. Receiver operating characteristic curve analysis showed that area under the curve values for the 23 CpG units including the 32 CpG sites in the 7 CIMP-marker genes, i.e. FAM150A, ZNF540, ZNF671, ZNF154, PRAC, TRH and SLC13A5, for discrimination of CIMP-positive from CIMP-negative ccRCCs were larger than 0.95. Criteria combining the 23 CpG units discriminated CIMP-positive from CIMP-negative ccRCCs with 100% sensitivity and specificity in the learning cohort. Cancer-free and overall survival rates of patients with CIMP-positive ccRCCs diagnosed using the criteria combining the 23 CpG units in a validation cohort were significantly lower than those of patients with CIMP-negative ccRCCs (P = 1.41 × 10-5 and 2.43 × 10-13, respectively). Patients with CIMP-positive ccRCCs in the validation cohort had a higher likelihood of disease-related death (hazard ratio, 75.8; 95% confidence interval, 7.81 to 735; P = 1.89 × 10-4) than those with CIMP-negative ccRCCs. The established criteria are able to reproducibly diagnose CIMP-positive ccRCCs and may be useful for personalized medicine for patients with ccRCCs.
Identification and Characterization of uvrA, a DNA Repair Gene of Deinococcus radiodurans
1996-01-01
alkylating agents , such as methyl-N-nitro~N~nitrosoguanidine(MNNG), N-methyl-N~ nitrosourea (MNU), and to a lesser extent methyl methanesulfonate (MMS...6,4) Photoproduct 17 c. Thymine Glycols and Cross-links 17 3. Ionizing Radiation Damage " 17 4. Chemical Damage 20 a. Alkylating Agents .20 b. Cross...Examples of base damage induced by ionizing radiation 19 6. Nucleotide centers in DNA that are most reactive to alkylating agents 21 7. Schematic
FXR silencing in human colon cancer by DNA methylation and KRAS signaling.
Bailey, Ann M; Zhan, Le; Maru, Dipen; Shureiqi, Imad; Pickering, Curtis R; Kiriakova, Galina; Izzo, Julie; He, Nan; Wei, Caimiao; Baladandayuthapani, Veerabhadran; Liang, Han; Kopetz, Scott; Powis, Garth; Guo, Grace L
2014-01-01
Farnesoid X receptor (FXR) is a bile acid nuclear receptor described through mouse knockout studies as a tumor suppressor for the development of colon adenocarcinomas. This study investigates the regulation of FXR in the development of human colon cancer. We used immunohistochemistry of FXR in normal tissue (n = 238), polyps (n = 32), and adenocarcinomas, staged I-IV (n = 43, 39, 68, and 9), of the colon; RT-quantitative PCR, reverse-phase protein array, and Western blot analysis in 15 colon cancer cell lines; NR1H4 promoter methylation and mRNA expression in colon cancer samples from The Cancer Genome Atlas; DNA methyltransferase inhibition; methyl-DNA immunoprecipitation (MeDIP); bisulfite sequencing; and V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) knockdown assessment to investigate FXR regulation in colon cancer development. Immunohistochemistry and quantitative RT-PCR revealed that expression and function of FXR was reduced in precancerous lesions and silenced in a majority of stage I-IV tumors. FXR expression negatively correlated with phosphatidylinositol-4, 5-bisphosphate 3 kinase signaling and the epithelial-to-mesenchymal transition. The NR1H4 promoter is methylated in ~12% colon cancer The Cancer Genome Atlas samples, and methylation patterns segregate with tumor subtypes. Inhibition of DNA methylation and KRAS silencing both increased FXR expression. FXR expression is decreased early in human colon cancer progression, and both DNA methylation and KRAS signaling may be contributing factors to FXR silencing. FXR potentially suppresses epithelial-to-mesenchymal transition and other oncogenic signaling cascades, and restoration of FXR activity, by blocking silencing mechanisms or increasing residual FXR activity, represents promising therapeutic options for the treatment of colon cancer.
Identification of body fluid-specific DNA methylation markers for use in forensic science.
Park, Jong-Lyul; Kwon, Oh-Hyung; Kim, Jong Hwan; Yoo, Hyang-Sook; Lee, Han-Chul; Woo, Kwang-Man; Kim, Seon-Young; Lee, Seung-Hwan; Kim, Yong Sung
2014-11-01
DNA methylation, which occurs at the 5'-position of the cytosine in CpG dinucleotides, has great potential for forensic identification of body fluids, because tissue-specific patterns of DNA methylation have been demonstrated, and DNA is less prone to degradation than proteins or RNA. Previous studies have reported several body fluid-specific DNA methylation markers, but DNA methylation differences are sometimes low in saliva and vaginal secretions. Moreover, specific DNA methylation markers in four types of body fluids (blood, saliva, semen, and vaginal secretions) have not been investigated with genome-wide profiling. Here, we investigated novel DNA methylation markers for identification of body fluids for use in forensic science using the Illumina HumanMethylation 450K bead array, which contains over 450,000 CpG sites. Using methylome data from 16 samples of blood, saliva, semen, and vaginal secretions, we first selected 2986 hypermethylated or hypomethylated regions that were specific for each type of body fluid. We then selected eight CpG sites as novel, forensically relevant DNA methylation markers: cg06379435 and cg08792630 for blood, cg26107890 and cg20691722 for saliva, cg23521140 and cg17610929 for semen, and cg01774894 and cg14991487 for vaginal secretions. These eight selected markers were evaluated in 80 body fluid samples using pyrosequencing, and all showed high sensitivity and specificity for identification of the target body fluid. We suggest that these eight DNA methylation markers may be good candidates for developing an effective molecular assay for identification of body fluids in forensic science. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
DNA methylation in states of cell physiology and pathology.
Directory of Open Access Journals (Sweden)
Lech Chyczewski
2007-10-01
Full Text Available DNA methylation is one of epigenetic mechanisms regulating gene expression. The methylation pattern is determined during embryogenesis and passed over to differentiating cells and tissues. In a normal cell, a significant degree of methylation is characteristic for extragenic DNA (cytosine within the CG dinucleotide while CpG islands located in gene promoters are unmethylated, except for inactive genes of the X chromosome and the genes subjected to genomic imprinting. The changes in the methylation pattern, which may appear as the organism age and in early stages of cancerogenesis, may lead to the silencing of over ninety endogenic genes. It has been found, that these disorders consist not only of the methylation of CpG islands, which are normally unmethylated, but also of the methylation of other dinucleotides, e.g. CpA. Such methylation has been observed in non-small cell lung cancer, in three regions of the exon 5 of the p53 gene (so-called "non-CpG" methylation. The knowledge of a normal methylation process and its aberrations appeared to be useful while searching for new markers enabling an early detection of cancer. With the application of the Real-Time PCR technique (using primers for methylated and unmethylated sequences five new genes which are potential biomarkers of lung cancer have been presented.
Dobrowolski, S F; Lyons-Weiler, J; Spridik, K; Vockley, J; Skvorak, K; Biery, A
2016-09-01
Phenylalanine hydroxylase deficient phenylketonuria (PKU) is the paradigm for a treatable inborn error of metabolism where maintaining plasma phenylalanine (Phe) in the therapeutic range relates to improved clinical outcomes. While Phe is the presumed intoxicating analyte causal in neurologic damage, the mechanism(s) of Phe toxicity has remained elusive. Altered DNA methylation is a recognized response associated with exposure to numerous small molecule toxic agents. Paralleling this effect, we hypothesized that chronic Phe over-exposure in the brain would lead to aberrant DNA methylation with secondary influence upon gene regulation that would ultimately contribute to PKU neuropathology. The PAH(enu2) mouse models human PKU with intrinsic hyperphenylalaninemia, abnormal response to Phe challenge, and neurologic deficit. To examine this hypothesis, we assessed DNA methylation patterns in brain tissues using methylated DNA immunoprecipitation and paired end sequencing in adult PAH(enu2) animals maintained under either continuous dietary Phe restriction or chronic hyperphenylalaninemia. Heterozygous PAH(enu2/WT) litter mates served as controls for normal Phe exposure. Extensive repatterning of DNA methylation was observed in brain tissue of hyperphenylalaninemic animals while Phe restricted animals displayed an attenuated pattern of aberrant DNA methylation. Affected gene coding regions displayed aberrant hypermethylation and hypomethylation. Gene body methylation of noncoding RNA genes was observed and among these microRNA genes were prominent. Of particular note, observed only in hyperphenylalaninemic animals, was hypomethylation of miRNA genes within the imprinted Dlk1-Dio3 locus on chromosome 12. Aberrant methylation of microRNA genes influenced their expression which has secondary effects upon the expression of targeted protein coding genes. Differential hypermethylation of gene promoters was exclusive to hyperphenylalaninemic PAH(enu2) animals. Genes with
Höglund, P; Sormaala, M; Haila, S; Socha, J; Rajaram, U; Scheurlen, W; Sinaasappel, M; de Jonge, H; Holmberg, C; Yoshikawa, H; Kere, J
2001-09-01
Congenital chloride diarrhea (CLD) is an autosomal recessive disorder characterized by defective intestinal electrolyte absorption, resulting in voluminous osmotic diarrhea with high chloride content. A variety of mutations in the solute carrier family 26, member 3 gene (SLC26A3, previously known as CLD or DRA) are responsible for the disease. Since the identification of the SLC26A3 gene and the determination of its genomic structure, altogether three founder and 17 private mutations have been characterized within miscellaneous ethnic groups. We screened for mutations in seven unrelated families with CLD. The diagnoses were confirmed by fecal chloride measurements. The combined PCR-SSCP and sequencing analyses revealed altogether seven novel mutations including two missense mutations (S206P, D468V), two splicing defects (IVS12-1G>C, IVS13-2delA), one nonsense mutation (Q436X), one insertion/deletion mutation (2104-2105delGGins29-bp), and an intragenic deletion of SLC26A3 exons 7 and 8. Two previously identified mutations were also found. This is the first report of rearrangement mutations in SLC26A3. Molecular features predisposing SLC26A3 for the two rearrangements may include repetitive elements and palindromic-like sequences. The increasingly wide diversity of SLC26A3 mutations suggests that mutations in the SLC26A3 gene may not be rare events. Copyright 2001 Wiley-Liss, Inc.
Metformin regulates global DNA methylation via mitochondrial one-carbon metabolism.
Cuyàs, E; Fernández-Arroyo, S; Verdura, S; García, R Á-F; Stursa, J; Werner, L; Blanco-González, E; Montes-Bayón, M; Joven, J; Viollet, B; Neuzil, J; Menendez, J A
2018-02-15
The anti-diabetic biguanide metformin may exert health-promoting effects via metabolic regulation of the epigenome. Here we show that metformin promotes global DNA methylation in non-cancerous, cancer-prone and metastatic cancer cells by decreasing S-adenosylhomocysteine (SAH), a strong feedback inhibitor of S-adenosylmethionine (SAM)-dependent DNA methyltransferases, while promoting the accumulation of SAM, the universal methyl donor for cellular methylation. Using metformin and a mitochondria/complex I (mCI)-targeted analog of metformin (norMitoMet) in experimental pairs of wild-type and AMP-activated protein kinase (AMPK)-, serine hydroxymethyltransferase 2 (SHMT2)- and mCI-null cells, we provide evidence that metformin increases the SAM:SAH ratio-related methylation capacity by targeting the coupling between serine mitochondrial one-carbon flux and CI activity. By increasing the contribution of one-carbon units to the SAM from folate stores while decreasing SAH in response to AMPK-sensed energetic crisis, metformin can operate as a metabolo-epigenetic regulator capable of reprogramming one of the key conduits linking cellular metabolism to the DNA methylation machinery.
Methylated DNMT1 and E2F1 are targeted for proteolysis by L3MBTL3 and CRL4DCAF5 ubiquitin ligase.
Leng, Feng; Yu, Jiekai; Zhang, Chunxiao; Alejo, Salvador; Hoang, Nam; Sun, Hong; Lu, Fei; Zhang, Hui
2018-04-24
Many non-histone proteins are lysine methylated and a novel function of this modification is to trigger the proteolysis of methylated proteins. Here, we report that the methylated lysine 142 of DNMT1, a major DNA methyltransferase that preserves epigenetic inheritance of DNA methylation patterns during DNA replication, is demethylated by LSD1. A novel methyl-binding protein, L3MBTL3, binds the K142-methylated DNMT1 and recruits a novel CRL4 DCAF5 ubiquitin ligase to degrade DNMT1. Both LSD1 and PHF20L1 act primarily in S phase to prevent DNMT1 degradation by L3MBTL3-CRL4 DCAF5 . Mouse L3MBTL3/MBT-1 deletion causes accumulation of DNMT1 protein, increased genomic DNA methylation, and late embryonic lethality. DNMT1 contains a consensus methylation motif shared by many non-histone proteins including E2F1, a key transcription factor for S phase. We show that the methylation-dependent E2F1 degradation is also controlled by L3MBTL3-CRL4 DCAF5 . Our studies elucidate for the first time a novel mechanism by which the stability of many methylated non-histone proteins are regulated.
Reference Materials for Calibration of Analytical Biases in Quantification of DNA Methylation.
Yu, Hannah; Hahn, Yoonsoo; Yang, Inchul
2015-01-01
Most contemporary methods for the quantification of DNA methylation employ bisulfite conversion and PCR amplification. However, many reports have indicated that bisulfite-mediated PCR methodologies can result in inaccurate measurements of DNA methylation owing to amplification biases. To calibrate analytical biases in quantification of gene methylation, especially those that arise during PCR, we utilized reference materials that represent exact bisulfite-converted sequences with 0% and 100% methylation status of specific genes. After determining relative quantities using qPCR, pairs of plasmids were gravimetrically mixed to generate working standards with predefined DNA methylation levels at 10% intervals in terms of mole fractions. The working standards were used as controls to optimize the experimental conditions and also as calibration standards in melting-based and sequencing-based analyses of DNA methylation. Use of the reference materials enabled precise characterization and proper calibration of various biases during PCR and subsequent methylation measurement processes, resulting in accurate measurements.
Lawley, P. D.; Orr, D. J.; Shah, S. A.; Farmer, P. B.; Jarman, M.
1973-01-01
1. DNA was treated with N-methyl-N-nitrosourea at pH7–8, 37°C, degraded to yield 3- and 7-methylpurines and deoxyribonucleosides and the reaction products were separated by chromatography on ion-exchange resins. The following methods for identification and determination of products were used: with unlabelled N-methyl-N-nitrosourea, u.v. absorption; use of methyl-14C-labelled N-methyl-N-nitrosourea and use of [14C]thymine-labelled DNA. 2. The synthesis of O4-methylthymidine and its identification by u.v. and mass spectroscopy are reported. 3. 3-Methylthymidine and O4-methylthymidine were found as methylation products from N-methyl-N-nitrosourea with thymidine and with DNA, in relatively small yields. Unidentified products containing thymine were found in enzymic digests of N-methyl-N-nitrosourea-treated DNA, which may be phosphotriesters. 4. The possible role of formation of methylthymines in mutagenesis by N-methyl-N-nitrosourea is discussed. PMID:4798180
DNA methylation profiles of ovarian epithelial carcinoma tumors and cell lines.
Directory of Open Access Journals (Sweden)
Sahar Houshdaran
2010-02-01
Full Text Available Epithelial ovarian carcinoma is a significant cause of cancer mortality in women worldwide and in the United States. Epithelial ovarian cancer comprises several histological subtypes, each with distinct clinical and molecular characteristics. The natural history of this heterogeneous disease, including the cell types of origin, is poorly understood. This study applied recently developed methods for high-throughput DNA methylation profiling to characterize ovarian cancer cell lines and tumors, including representatives of three major histologies.We obtained DNA methylation profiles of 1,505 CpG sites (808 genes in 27 primary epithelial ovarian tumors and 15 ovarian cancer cell lines. We found that the DNA methylation profiles of ovarian cancer cell lines were markedly different from those of primary ovarian tumors. Aggregate DNA methylation levels of the assayed CpG sites tended to be higher in ovarian cancer cell lines relative to ovarian tumors. Within the primary tumors, those of the same histological type were more alike in their methylation profiles than those of different subtypes. Supervised analyses identified 90 CpG sites (68 genes that exhibited 'subtype-specific' DNA methylation patterns (FDR<1% among the tumors. In ovarian cancer cell lines, we estimated that for at least 27% of analyzed autosomal CpG sites, increases in methylation were accompanied by decreases in transcription of the associated gene.The significant difference in DNA methylation profiles between ovarian cancer cell lines and tumors underscores the need to be cautious in using cell lines as tumor models for molecular studies of ovarian cancer and other cancers. Similarly, the distinct methylation profiles of the different histological types of ovarian tumors reinforces the need to treat the different histologies of ovarian cancer as different diseases, both clinically and in biomarker studies. These data provide a useful resource for future studies, including those of
Inhibitors of GLUT/SLC2A Enhance the Action of BCNU and Temozolomide against High-Grade Gliomas
Directory of Open Access Journals (Sweden)
Alberto Azzalin
2017-04-01
Full Text Available Glucose transport across glioblastoma membranes plays a crucial role in maintaining the enhanced glycolysis typical of high-grade gliomas and glioblastoma. We tested the ability of two inhibitors of the glucose transporters GLUT/SLC2A superfamily, indinavir (IDV and ritonavir (RTV, and of one inhibitor of the Na/glucose antiporter type 2 (SGLT2/SLC5A2 superfamily, phlorizin (PHZ, in decreasing glucose consumption and cell proliferation of human and murine glioblastoma cells. We found in vitro that RTV, active on at least three different GLUT/SLC2A transporters, was more effective than IDV, a specific inhibitor of GLUT4/SLC2A4, both in decreasing glucose consumption and lactate production and in inhibiting growth of U87MG and Hu197 human glioblastoma cell lines and primary cultures of human glioblastoma. PHZ was inactive on the same cells. Similar results were obtained when cells were grown in adherence or as 3D multicellular tumor spheroids. RTV treatment but not IDV treatment induced AMP-activated protein kinase (AMPKα phosphorylation that paralleled the decrease in glycolytic activity and cell growth. IDV, but not RTV, induced an increase in GLUT1/SLC2A1 whose activity could compensate for the inhibition of GLUT4/SLC2A4 by IDV. RTV and IDV pass poorly the blood brain barrier and are unlikely to reach sufficient liquoral concentrations in vivo to inhibit glioblastoma growth as single agents. Isobologram analysis of the association of RTV or IDV and 1,3-bis(2-chloroethyl-1-nitrosourea (BCNU or 4-methyl-5-oxo-2,3,4,6,8-pentazabicyclo[4.3.0]nona-2,7,9-triene-9-carboxamide (TMZ indicated synergy only with RTV on inhibition of glioblastoma cells. Finally, we tested in vivo the combination of RTV and BCNU on established GL261 tumors. This drug combination increased the overall survival and allowed a five-fold reduction in the dose of BCNU.
Energy Technology Data Exchange (ETDEWEB)
Itoh, Hiroaki [Department of Epidemiology and Environmental Health, Juntendo University Faculty of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113–8421 Japan (Japan); Iwasaki, Motoki, E-mail: moiwasak@ncc.go.jp [Epidemiology Division, Research Center for Cancer Prevention and Screening, National Cancer Center, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104–0045 Japan (Japan); Kasuga, Yoshio [Department of Surgery, Nagano Matsushiro General Hospital, 183 Matsushiro, Matsushiro-cho, Nagano City, Nagano Prefecture 381–1231 Japan (Japan); Yokoyama, Shiro; Onuma, Hiroshi [Department of Breast and Thyroid Surgery, Nagano Red Cross Hospital, 5-22-1 Wakasato, Nagano City, Nagano Prefecture 380–8582 Japan (Japan); Nishimura, Hideki [Department of Respiratory Surgery and Breast Surgery, Nagano Municipal Hospital, 1333–1 Tomitake, Nagano City, Nagano Prefecture 381–8551 Japan (Japan); Kusama, Ritsu [Department of Surgery, Hokushin General Hospital, 1-5-63 Nishi, Nakano City, Nagano Prefecture 383–8505 Japan (Japan); Yoshida, Teruhiko [Division of Genetics, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104–0045 Japan (Japan); Yokoyama, Kazuhito [Department of Epidemiology and Environmental Health, Juntendo University Faculty of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113–8421 Japan (Japan); Tsugane, Shoichiro [Dierctor Research Center for Cancer Prevention and Screening, National Cancer Center, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104–0045 Japan (Japan)
2014-08-15
While the global methylation level of leukocyte DNA may be a suitable biomarker for cancer risk, the level may be influenced by multiple factors, both environmental and host-related, one of which is exposure to environmental pollutants. To date, three epidemiologic studies have examined associations between serum organochlorine levels and global DNA methylation level, but their findings are not fully consistent, and the associations thus require confirmation in other well-characterized populations. We tested the association between organochlorine exposure and the global DNA methylation level of leukocytes in Japanese women. We conducted a cross-sectional study using the control group of a breast cancer case–control study in Japan. Subjects were 403 Japanese women who provided blood samples. Serum polychlorinated biphenyls (PCBs) and nine pesticide-related organochlorines were measured by gas chromatography isotope-dilution high-resolution mass spectrometry. Further, global methylation level of peripheral leukocyte DNA among 399 women was measured by luminometric methylation assay. Linear trends in the association between methylation and quartile levels of organochlorines were evaluated by regression coefficients in a multivariable linear regression model. We found significant inverse associations between the global methylation level in leukocyte DNA and many of the organochlorine levels measured. Global methylation level was significantly decreased by 0.33–0.83% per quartile category for serum o,p′-dichlorodiphenyltrichloroethane (o,p′-DDT), p,p′-DDT, p,p′-dichlorodiphenyldichloroethylene, trans-nonachlor, oxychlordane, hexachlorobenzene, β-hexachlorocyclohexane, PCB17, PCB52/69, PCB74, PCB114, and PCB183. Serum organochlorine levels were inversely associated with the global methylation level of leukocyte DNA in a relatively large sample of Japanese women. - Highlights: • Many serum organochlorine pesticides were inversely associated with the global
Directory of Open Access Journals (Sweden)
Guillem Portella
Full Text Available Cytosine methylation is one of the most important epigenetic marks that regulate the process of gene expression. Here, we have examined the effect of epigenetic DNA methylation on nucleosomal stability using molecular dynamics simulations and elastic deformation models. We found that methylation of CpG steps destabilizes nucleosomes, especially when these are placed in sites where the DNA minor groove faces the histone core. The larger stiffness of methylated CpG steps is a crucial factor behind the decrease in nucleosome stability. Methylation changes the positioning and phasing of the nucleosomal DNA, altering the accessibility of DNA to regulatory proteins, and accordingly gene functionality. Our theoretical calculations highlight a simple physical-based explanation on the foundations of epigenetic signaling.
Movahedi, Ali; Zhang, Jiaxin; Sun, Weibo; Mohammadi, Kourosh; Almasi Zadeh Yaghuti, Amir; Wei, Hui; Wu, Xiaolong; Yin, Tongming; Zhuge, Qiang
2018-06-01
Epigenetic modification by DNA methylation is necessary for all cellular processes, including genetic expression events, DNA repair, genomic imprinting and regulation of tissue development. It occurs almost exclusively at the C5 position of symmetric CpG and asymmetric CpHpG and CpHpH sites in genomic DNA. The RNA-directed DNA methylation (RDM1) gene is crucial for heterochromatin and DNA methylation. We overexpressed PtRDM1 gene from Populus trichocarpa to amplify transcripts of orthologous RDM1 in 'Nanlin895' (P. deltoides × P. euramericana 'Nanlin895'). This overexpression resulted in increasing RDM1 transcript levels: by ∼150% at 0 mM NaCl treatment and by ∼300% at 60 mM NaCl treatment compared to WT (control) poplars. Genomic cytosine methylation was monitored within 5.8S rDNA and histone H3 loci by bisulfite sequencing. In total, transgenic poplars revealed more DNA methylation than WT plants. In our results, roots revealed more methylated CG contexts than stems and leaves whereas, histone H3 presented more DNA methylation than 5.8S rDNA in both WT and transgenic poplars. The NaCl stresses enhanced more DNA methylation in transgenic poplars than WT plants through histone H3 and 5.8 rDNA loci. Also, the overexpression of PtRDM1 resulted in hyper-methylation, which affected plant phenotype. Transgenic poplars revealed significantly more regeneration of roots than WT poplars via NaCl treatments. Our results proved that RDM1 protein enhanced the DNA methylation by chromatin remodeling (e.g. histone H3) more than repetitive DNA sequences (e.g. 5.8S rDNA). Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Shui, Irene M; Wong, Chao-Jen; Zhao, Shanshan; Kolb, Suzanne; Ebot, Ericka M; Geybels, Milan S; Rubicz, Rohina; Wright, Jonathan L; Lin, Daniel W; Klotzle, Brandy; Bibikova, Marina; Fan, Jian-Bing; Ostrander, Elaine A; Feng, Ziding; Stanford, Janet L
2016-07-15
DNA methylation has been hypothesized as a mechanism for explaining the association between smoking and adverse prostate cancer (PCa) outcomes. This study was aimed at assessing whether smoking is associated with prostate tumor DNA methylation and whether these alterations may explain in part the association of smoking with PCa recurrence and mortality. A total of 523 men had radical prostatectomy as their primary treatment, detailed smoking history data, long-term follow-up for PCa outcomes, and tumor tissue profiled for DNA methylation. Ninety percent of the men also had matched tumor gene expression data. A methylome-wide analysis was conducted to identify differentially methylated regions (DMRs) by smoking status. To select potential functionally relevant DMRs, their correlation with the messenger RNA (mRNA) expression of corresponding genes was evaluated. Finally, a smoking-related methylation score based on the top-ranked DMRs was created to assess its association with PCa outcomes. Forty DMRs were associated with smoking status, and 10 of these were strongly correlated with mRNA expression (aldehyde oxidase 1 [AOX1], claudin 5 [CLDN5], early B-cell factor 1 [EBF1], homeobox A7 [HOXA7], lectin galactoside-binding soluble 3 [LGALS3], microtubule-associated protein τ [MAPT], protocadherin γ A [PCDHGA]/protocadherin γ B [PCDHGB], paraoxonase 3 [PON3], synaptonemal complex protein 2 like [SYCP2L], and zinc finger and SCAN domain containing 12 [ZSCAN12]). Men who were in the highest tertile for the smoking-methylation score derived from these DMRs had a higher risk of recurrence (odds ratio [OR], 2.29; 95% confidence interval [CI], 1.42-3.72) and lethal disease (OR, 4.21; 95% CI, 1.65-11.78) in comparison with men in the lower 2 tertiles. This integrative molecular epidemiology study supports the hypothesis that smoking-associated tumor DNA methylation changes may explain at least part of the association between smoking and adverse PCa outcomes. Future studies
Directory of Open Access Journals (Sweden)
Eric J Chater-Diehl
Full Text Available The molecular basis of Fetal Alcohol Spectrum Disorders (FASD is poorly understood; however, epigenetic and gene expression changes have been implicated. We have developed a mouse model of FASD characterized by learning and memory impairment and persistent gene expression changes. Epigenetic marks may maintain expression changes over a mouse's lifetime, an area few have explored. Here, mice were injected with saline or ethanol on postnatal days four and seven. At 70 days of age gene expression microarray, methylated DNA immunoprecipitation microarray, H3K4me3 and H3K27me3 chromatin immunoprecipitation microarray were performed. Following extensive pathway analysis of the affected genes, we identified the top affected gene expression pathway as "Free radical scavenging". We confirmed six of these changes by droplet digital PCR including the caspase Casp3 and Wnt transcription factor Tcf7l2. The top pathway for all methylation-affected genes was "Peroxisome biogenesis"; we confirmed differential DNA methylation in the Acca1 thiolase promoter. Altered methylation and gene expression in oxidative stress pathways in the adult hippocampus suggests a novel interface between epigenetic and oxidative stress mechanisms in FASD.
Chater-Diehl, Eric J; Laufer, Benjamin I; Castellani, Christina A; Alberry, Bonnie L; Singh, Shiva M
2016-01-01
The molecular basis of Fetal Alcohol Spectrum Disorders (FASD) is poorly understood; however, epigenetic and gene expression changes have been implicated. We have developed a mouse model of FASD characterized by learning and memory impairment and persistent gene expression changes. Epigenetic marks may maintain expression changes over a mouse's lifetime, an area few have explored. Here, mice were injected with saline or ethanol on postnatal days four and seven. At 70 days of age gene expression microarray, methylated DNA immunoprecipitation microarray, H3K4me3 and H3K27me3 chromatin immunoprecipitation microarray were performed. Following extensive pathway analysis of the affected genes, we identified the top affected gene expression pathway as "Free radical scavenging". We confirmed six of these changes by droplet digital PCR including the caspase Casp3 and Wnt transcription factor Tcf7l2. The top pathway for all methylation-affected genes was "Peroxisome biogenesis"; we confirmed differential DNA methylation in the Acca1 thiolase promoter. Altered methylation and gene expression in oxidative stress pathways in the adult hippocampus suggests a novel interface between epigenetic and oxidative stress mechanisms in FASD.
Extensive genetic and DNA methylation variation contribute to heterosis in triploid loquat hybrids.
Liu, Chao; Wang, Mingbo; Wang, Lingli; Guo, Qigao; Liang, Guolu
2018-04-24
We aim to overcome the unclear origin of the loquat and elucidate the heterosis mechanism of the triploid loquat. Here we investigated the genetic and epigenetic variations between the triploid plant and its parental lines using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplified fragment length polymorphism (MSAP) analyses. We show that in addition to genetic variations, extensive DNA methylation variation occurred during the formation process of triploid loquat, with the triploid hybrid having increased DNA methylation compared to the parents. Furthermore, a correlation existed between genetic variation and DNA methylation remodeling, suggesting that genome instability may lead to DNA methylation variation or vice versa. Sequence analysis of the MSAP bands revealed that over 53% of them overlap with protein-coding genes, which may indicate a functional role of the differential DNA methylation in gene regulation and hence heterosis phenotypes. Consistent with this, the genetic and epigenetic alterations were associated closely to the heterosis phenotypes of triploid loquat, and this association varied for different traits. Our results suggested that the formation of triploid is accompanied by extensive genetic and DNA methylation variation, and these changes contribute to the heterosis phenotypes of the triploid loquats from the two cross lines.
Ancestry dependent DNA methylation and influence of maternal nutrition.
Directory of Open Access Journals (Sweden)
Khyobeni Mozhui
Full Text Available There is extensive variation in DNA methylation between individuals and ethnic groups. These differences arise from a combination of genetic and non-genetic influences and potential modifiers include nutritional cues, early life experience, and social and physical environments. Here we compare genome-wide DNA methylation in neonatal cord blood from African American (AA; N = 112 and European American (EA; N = 91 participants of the CANDLE Study (Conditions Affecting Neurocognitive Development and Learning in Early Childhood. Our goal is to determine if there are replicable ancestry-specific methylation patterns that may implicate risk factors for diseases that have differential prevalence between populations. To identify the most robust ancestry-specific CpG sites, we replicate our results in lymphoblastoid cell lines from Yoruba African and CEPH European panels of HapMap. We also evaluate the influence of maternal nutrition--specifically, plasma levels of vitamin D and folate during pregnancy--on methylation in newborns. We define stable ancestry-dependent methylation of genes that include tumor suppressors and cell cycle regulators (e.g., APC, BRCA1, MCC. Overall, there is lower global methylation in African ancestral groups. Plasma levels of 25-hydroxy vitamin D are also considerably lower among AA mothers and about 60% of AA and 40% of EA mothers have concentrations below 20 ng/ml. Using a weighted correlation analysis, we define a network of CpG sites that is jointly modulated by ancestry and maternal vitamin D. Our results show that differences in DNA methylation patterns are remarkably stable and maternal micronutrients can exert an influence on the child epigenome.
Directory of Open Access Journals (Sweden)
Huizi Lei
Full Text Available BACKGROUND AIMS: Gastric cancer is the most frequent gastrointestinal tumor in adults and is the most lethal form of human cancer. Despite of the improvements in treatments, the underlying mechanism of gastric carcinogenesis is not well known. To define novel modulators that regulate susceptibility to tumorgenesis, we focused on miR-219-2-3p. METHODS: Quantitative RT-PCR was employed to investigate the level of miR-219-2-3p in gastric cancer (GC tissues (n = 113 and their matched adjacent normal tissues (n = 113. In vitro cell proliferation, apoptosis assays, cell migration, and invasion assays were performed to elucidate biological effects of miR-219-2-3p. Since silencing of miRNA by promoter CpG island methylation may be an important mechanism in tumorgenesis, GC cells were treated with 5-aza-2'-deoxycytidine and trichostatin A, and expression changes of miR-219-2-3p were subsequently examined by quantitative RT-PCR. Finally, the methylation status of CpG island upstream of miR-219-2-3p was analyzed by methylation-specific PCR in GC tissues (n = 22. RESULTS: miR-219-2-3p was down-regulated in GC and cell lines. In addition, the experiments documented the lower expression of miR-219-2-3p in GC specimens with higher grade and later stage tumors. Meanwhile, miR-219-2-3p exerted antiproliferative, proapoptotic, and antimetastatic roles and reduced levels of p-ERK1/2 in GC cells. Furthermore, 5-aza-2'-deoxycytidine and trichostatin A increased the expression (~2 fold of miR-219-2-3p in GC cells. By methylation-specific PCR, DNA methylation in the upstream region of miR-219-2-3p was detected in both adjacent normal tissues and cancer tissues. As expected, the methylation level was considerably higher in the miR-219-2-3p down-regulated group than up-regulated group. CONCLUSIONS: miR-219-2-3p is potentially involved in gastric cancer progression and metastasis by regulating ERK1/2-related signal pathways, which may provide a novel therapeutic strategy
Directory of Open Access Journals (Sweden)
Jean-François Gautier
Full Text Available Fetal exposure to hyperglycemia impacts negatively kidney development and function.Our objective was to determine whether fetal exposure to moderate hyperglycemia is associated with epigenetic alterations in DNA methylation in peripheral blood cells and whether those alterations are related to impaired kidney function in adult offspring.Twenty nine adult, non-diabetic offspring of mothers with type 1 diabetes (T1D (case group were matched with 28 offspring of T1D fathers (control group for the study of their leukocyte genome-wide DNA methylation profile (27,578 CpG sites, Human Methylation 27 BeadChip, Illumina Infinium. In a subset of 19 cases and 18 controls, we assessed renal vascular development by measuring Glomerular Filtration Rate (GFR and Effective Renal Plasma Flow (ERPF at baseline and during vasodilatation produced by amino acid infusion.Globally, DNA was under-methylated in cases vs. controls. Among the 87 CpG sites differently methylated, 74 sites were less methylated and 13 sites more methylated in cases vs. controls. None of these CpG sites were located on a gene known to be directly involved in kidney development and/or function. However, the gene encoding DNA methyltransferase 1 (DNMT1--a key enzyme involved in gene expression during early development--was under-methylated in cases. The average methylation of the 74 under-methylated sites differently correlated with GFR in cases and controls.Alterations in methylation profile imprinted by the hyperglycemic milieu of T1D mothers during fetal development may impact kidney function in adult offspring. The involved pathways seem to be a nonspecific imprinting process rather than specific to kidney development or function.
De Grandis, Elisa; Stagnaro, Michela; Biancheri, Roberta; Giannotta, Melania; Gobbi, Giuseppe; Traverso, Monica; Veneselli, Edvige; Zara, Federico
2013-07-01
Alternating hemiplegia of childhood is a rare, predominantly sporadic disorder. Diagnosis is clinical, and little is known about genetics. Glucose transporter 1 deficiency syndrome shares with alternating hemiplegia of childhood paroxysmal and nonparoxysmal symptoms. The aim of the study was to investigate glucose transporter 1 mutations in 30 Italian patients. Genetic material was analyzed by DNA amplification and glucose transporter 1 region sequencing. Mutational analysis findings of the SLC2A1 gene were negative in all patients. The pattern of movement disorders was reviewed. Interictal dystonia and multiple paroxysmal events were typical of alternating hemiplegia of childhood. In conclusion, alternating hemiplegia of childhood is a heterogeneous clinical condition, and although glucose transporter 1 deficiency can represent an undiagnosed cause of this disorder, mutational analysis is not routinely recommended. Alternatively, a careful clinical analysis and the 3-O-methyl-D-glucose uptake test can allow prompt identification of a subgroup of patients with alternating hemiplegia of childhood treatable with a ketogenic diet.
MethBank 3.0: a database of DNA methylomes across a variety of species.
Li, Rujiao; Liang, Fang; Li, Mengwei; Zou, Dong; Sun, Shixiang; Zhao, Yongbing; Zhao, Wenming; Bao, Yiming; Xiao, Jingfa; Zhang, Zhang
2018-01-04
MethBank (http://bigd.big.ac.cn/methbank) is a database that integrates high-quality DNA methylomes across a variety of species and provides an interactive browser for visualization of methylation data. Here, we present an updated implementation of MethBank (version 3.0) by incorporating more DNA methylomes from multiple species and equipping with more enhanced functionalities for data annotation and more friendly web interfaces for data presentation, search and visualization. MethBank 3.0 features large-scale integration of high-quality methylomes, involving 34 consensus reference methylomes derived from a large number of human samples, 336 single-base resolution methylomes from different developmental stages and/or tissues of five plants, and 18 single-base resolution methylomes from gametes and early embryos at multiple stages of two animals. Additionally, it is enhanced by improving the functionalities for data annotation, which accordingly enables systematic identification of methylation sites closely associated with age, sites with constant methylation levels across different ages, differentially methylated promoters, age-specific differentially methylated cytosines/regions, and methylated CpG islands. Moreover, MethBank provides tools to estimate human methylation age online and to identify differentially methylated promoters, respectively. Taken together, MethBank is upgraded with significant improvements and advances over the previous version, which is of great help for deciphering DNA methylation regulatory mechanisms for epigenetic studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Kimberly D Siegmund
Full Text Available The role of DNA cytosine methylation, an epigenetic regulator of chromatin structure and function, during normal and pathological brain development and aging remains unclear. Here, we examined by MethyLight PCR the DNA methylation status at 50 loci, encompassing primarily 5' CpG islands of genes related to CNS growth and development, in temporal neocortex of 125 subjects ranging in age from 17 weeks of gestation to 104 years old. Two psychiatric disease cohorts--defined by chronic neurodegeneration (Alzheimer's or lack thereof (schizophrenia--were included. A robust and progressive rise in DNA methylation levels across the lifespan was observed for 8/50 loci (GABRA2, GAD1, HOXA1, NEUROD1, NEUROD2, PGR, STK11, SYK typically in conjunction with declining levels of the corresponding mRNAs. Another 16 loci were defined by a sharp rise in DNA methylation levels within the first few months or years after birth. Disease-associated changes were limited to 2/50 loci in the Alzheimer's cohort, which appeared to reflect an acceleration of the age-related change in normal brain. Additionally, methylation studies on sorted nuclei provided evidence for bidirectional methylation events in cortical neurons during the transition from childhood to advanced age, as reflected by significant increases at 3, and a decrease at 1 of 10 loci. Furthermore, the DNMT3a de novo DNA methyl-transferase was expressed across all ages, including a subset of neurons residing in layers III and V of the mature cortex. Therefore, DNA methylation is dynamically regulated in the human cerebral cortex throughout the lifespan, involves differentiated neurons, and affects a substantial portion of genes predominantly by an age-related increase.
Peng, Chong; Sui, Zhenghong; Zhou, Wei; Hu, Yiyi; Mi, Ping; Jiang, Minjie; Li, Xiaodong; Ruan, Xudong
2018-06-01
Gracilariopsis lemaneiformis is an economically important agarophyte, which contains high quality gel and shows a high growth rate. Wild population of G. lemaneiformis displayed resident divergence, though with a low genetic diversity as was revealed by amplified fragment length polymorphism (AFLP) and simple sequence repeat (SSR) analyses. In addition, different strains of G. lemaneiformis are diverse in morphology. The highly inconsistence between genetic background and physiological characteristics recommends strongly to the regulation at epigenetic level. In this study, the DNA methylation change in G. lemaneiformis among different generation branches and under different temperature stresses was assessed using methylation sensitive amplified polymorphism (MSAP) technique. It was shown that DNA methylation level among different generation branches was diverse. The full and total methylated DNA level was the lowest in the second generation branch and the highest in the third generation. The total methylation level was 61.11%, 60.88% and 64.12% at 15°C, 22°C and 26°C, respectively. Compared with the control group (22°C), the fully methylated and totally methylated ratios were increased in both experiment groups (15°C and 26°C). All of the cytosine methylation/demethylation transform (CMDT) was further analyzed. High temperature treatment could induce more CMDT than low temperature treatment did.
Effects of TET2 mutations on DNA methylation in chronic myelomonocytic leukemia
TET2 enzymatically converts 5-methyl-cytosine to 5-hydroxymethyl-cytosine, possibly leading to loss of DNA methylation. TET2 mutations are common in myeloid leukemia and were proposed to contribute to leukemogenesis through DNA methylation. To expand on this concept, we studied chronic myelomonocyti...
Friso, Simonetta; Choi, Sang-Woon; Girelli, Domenico; Mason, Joel B.; Dolnikowski, Gregory G.; Bagley, Pamela J.; Olivieri, Oliviero; Jacques, Paul F.; Rosenberg, Irwin H.; Corrocher, Roberto; Selhub, Jacob
2002-01-01
DNA methylation, an essential epigenetic feature of DNA that modulates gene expression and genomic integrity, is catalyzed by methyltransferases that use the universal methyl donor S-adenosyl-l-methionine. Methylenetetrahydrofolate reductase (MTHFR) catalyzes the synthesis of 5-methyltetrahydrofolate (5-methylTHF), the methyl donor for synthesis of methionine from homocysteine and precursor of S-adenosyl-l-methionine. In the present study we sought to determine the effect of folate status on genomic DNA methylation with an emphasis on the interaction with the common C677T mutation in the MTHFR gene. A liquid chromatography/MS method for the analysis of nucleotide bases was used to assess genomic DNA methylation in peripheral blood mononuclear cell DNA from 105 subjects homozygous for this mutation (T/T) and 187 homozygous for the wild-type (C/C) MTHFR genotype. The results show that genomic DNA methylation directly correlates with folate status and inversely with plasma homocysteine (tHcy) levels (P < 0.01). T/T genotypes had a diminished level of DNA methylation compared with those with the C/C wild-type (32.23 vs.62.24 ng 5-methylcytosine/μg DNA, P < 0.0001). When analyzed according to folate status, however, only the T/T subjects with low levels of folate accounted for the diminished DNA methylation (P < 0.0001). Moreover, in T/T subjects DNA methylation status correlated with the methylated proportion of red blood cell folate and was inversely related to the formylated proportion of red blood cell folates (P < 0.03) that is known to be solely represented in those individuals. These results indicate that the MTHFR C677T polymorphism influences DNA methylation status through an interaction with folate status. PMID:11929966
Zhao, Ye; Chen, Muyan; Storey, Kenneth B; Sun, Lina; Yang, Hongsheng
2015-03-01
DNA methylation plays an important role in regulating transcriptional change in response to environmental stimuli. In the present study, DNA methylation levels of tissues of the sea cucumber Apostichopus japonicus were analyzed by the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) technique over three stages of the aestivation cycle. Overall, a total of 26,963 fragments were amplified including 9112 methylated fragments among four sea cucumber tissues using 18 pairs of selective primers. Results indicated an average DNA methylation level of 33.79% for A. japonicus. The incidence of DNA methylation was different across tissue types in the non-aestivation stage: intestine (30.16%), respiratory tree (27.61%), muscle (27.94%) and body wall (56.25%). Our results show that hypermethylation accompanied deep-aestivation in A. japonicus, which suggests that DNA methylation may have an important role in regulating global transcriptional suppression during aestivation. Further analysis indicated that the main DNA modification sites were focused on intestine and respiratory tree tissues and that full-methylation but not hemi-methylation levels exhibited significant increases in the deep-aestivation stage. Copyright © 2014 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Yokoyama, Seiya; Yonezawa, Suguru; Kitamoto, Sho; Yamada, Norishige; Houjou, Izumi; Sugai, Tamotsu; Nakamura, Shin-ichi; Arisaka, Yoshifumi; Takaori, Kyoichi; Higashi, Michiyo
2012-01-01
Methylation of CpG sites in genomic DNA plays an important role in gene regulation and especially in gene silencing. We have reported mechanisms of epigenetic regulation for expression of mucins, which are markers of malignancy potential and early detection of human neoplasms. Epigenetic changes in promoter regions appear to be the first step in expression of mucins. Thus, detection of promoter methylation status is important for early diagnosis of cancer, monitoring of tumor behavior, and evaluating the response of tumors to targeted therapy. However, conventional analytical methods for DNA methylation require a large amount of DNA and have low sensitivity. Here, we report a modified version of the bisulfite-DGGE (denaturing gradient gel electrophoresis) using a nested PCR approach. We designated this method as methylation specific electrophoresis (MSE). The MSE method is comprised of the following steps: (a) bisulfite treatment of genomic DNA, (b) amplification of the target DNA by a nested PCR approach and (c) applying to DGGE. To examine whether the MSE method is able to analyze DNA methylation of mucin genes in various samples, we apply it to DNA obtained from state cell lines, ethanol-fixed colonic crypts and human pancreatic juices. The MSE method greatly decreases the amount of input DNA. The lower detection limit for distinguishing different methylation status is < 0.1% and the detectable minimum amount of DNA is 20 pg, which can be obtained from only a few cells. We also show that MSE can be used for analysis of challenging samples such as human isolated colonic crypts or human pancreatic juices, from which only a small amount of DNA can be extracted. The MSE method can provide a qualitative information of methylated sequence profile. The MSE method allows sensitive and specific analysis of the DNA methylation pattern of almost any block of multiple CpG sites. The MSE method can be applied to analysis of DNA methylation status in many different clinical
Yanokura, Megumi; Banno, Kouji; Adachi, Masataka; Aoki, Daisuke; Abe, Kuniya
2017-01-01
Aberrant DNA methylation is widely observed in many cancers. Concurrent DNA methylation of multiple genes occurs in endometrial cancer and is referred to as the CpG island methylator phenotype (CIMP). However, the features and causes of CIMP-positive endometrial cancer are not well understood. To investigate DNA methylation features characteristic to CIMP-positive endometrial cancer, we first classified samples from 25 patients with endometrial cancer based on the methylation status of three ...
Inácio, Vera; Barros, Pedro M; Costa, Augusta; Roussado, Cristóvão; Gonçalves, Elsa; Costa, Rita; Graça, José; Oliveira, M Margarida; Morais-Cecílio, Leonor
2017-01-01
DNA methylation is thought to influence Quercus suber cork quality, which is the main constraint for its economic valorisation. However, a deep knowledge of the cytosine methylation patterns disclosing the epigenetic variability of trees with different cork quality types is totally missing. This study investigates the hypothesis that variations in DNA methylation contribute to differences in cork cellular characteristics directly related to original or traumatic phellogen activity. We used MSAPs (Methylation Sensitive Amplified Polymorphism) to assess DNA methylation patterns of cork and leaf tissues of Q. suber adult trees growing in three cork oak stands. The relationship between the detected polymorphisms and the diversity of cork quality traits was explored by a marker-trait analysis focusing on the most relevant quality characteristics. Populations differed widely in cork quality, but only slightly in degree of epigenetic differentiation. Four MSAP markers (1.3% of the total) were significantly associated with the most noteworthy quality traits: wood inclusions (nails) and porosity. This evidence supports the potential role of cytosine methylation in the modulation of differential phellogen activity either involved in localized cell death or in pore production, resulting in different cork qualities. Although, the underlying basis of the methylation polymorphism of loci affecting cork quality traits remain unclear, the disclosure of markers statistically associated with cork quality strengthens the potential role of DNA methylation in the regulation of these traits, namely at the phellogen level.
Keil, Kimberly P; Vezina, Chad M
2015-01-01
Prostate development, benign hyperplasia and cancer involve androgen and growth factor signaling as well as stromal-epithelial interactions. We review how DNA methylation influences these and related processes in other organ systems such as how proliferation is restricted to specific cell populations during defined temporal windows, how androgens elicit their actions and how cells establish, maintain and remodel DNA methylation in a time and cell specific fashion. We also discuss mechanisms by which hormones and endocrine disrupting chemicals reprogram DNA methylation in the prostate and elsewhere and examine evidence for a reawakening of developmental epigenetic pathways as drivers of prostate cancer and benign prostate hyperplasia.
Directory of Open Access Journals (Sweden)
Frederica Perera
Full Text Available In a longitudinal cohort of approximately 700 children in New York City, the prevalence of asthma (>25% is among the highest in the US. This high risk may in part be caused by transplacental exposure to traffic-related polycyclic aromatic hydrocarbons (PAHs but biomarkers informative of PAH-asthma relationships is lacking. We here hypothesized that epigenetic marks associated with transplacental PAH exposure and/or childhood asthma risk could be identified in fetal tissues. Mothers completed personal prenatal air monitoring for PAH exposure determination. Methylation sensitive restriction fingerprinting was used to analyze umbilical cord white blood cell (UCWBC DNA of 20 cohort children. Over 30 DNA sequences were identified whose methylation status was dependent on the level of maternal PAH exposure. Six sequences were found to be homologous to known genes having one or more 5'-CpG island(s (5'-CGI. Of these, acyl-CoA synthetase long-chain family member 3 (ACSL3 exhibited the highest concordance between the extent of methylation of its 5'-CGI in UCWBCs and the level of gene expression in matched fetal placental tissues in the initial 20 cohort children. ACSL3 was therefore chosen for further investigation in a larger sample of 56 cohort children. Methylation of the ACSL3 5'-CGI was found to be significantly associated with maternal airborne PAH exposure exceeding 2.41 ng/m(3 (OR = 13.8; p<0.001; sensitivity = 75%; specificity = 82% and with a parental report of asthma symptoms in children prior to age 5 (OR = 3.9; p<0.05. Thus, if validated, methylated ACSL3 5'CGI in UCWBC DNA may be a surrogate endpoint for transplacental PAH exposure and/or a potential biomarker for environmentally-related asthma. This exploratory report provides a new blueprint for the discovery of epigenetic biomarkers relevant to other exposure assessments and/or investigations of exposure-disease relationships in birth cohorts. The results support the emerging theory of
Patterns of DNA methylation in the normal colon vary by anatomical location, gender, and age
Kaz, Andrew M; Wong, Chao-Jen; Dzieciatkowski, Slavomir; Luo, Yanxin; Schoen, Robert E; Grady, William M
2014-01-01
Alterations in DNA methylation have been proposed to create a field cancerization state in the colon, where molecular alterations that predispose cells to transformation occur in histologically normal tissue. However, our understanding of the role of DNA methylation in field cancerization is limited by an incomplete characterization of the methylation state of the normal colon. In order to determine the colon’s normal methylation state, we extracted DNA from normal colon biopsies from the rectum, sigmoid, transverse, and ascending colon and assessed the methylation status of the DNA by pyrosequencing candidate loci as well as with HumanMethylation450 arrays. We found that methylation levels of repetitive elements LINE-1 and SAT-α showed minimal variability throughout the colon in contrast to other loci. Promoter methylation of EVL was highest in the rectum and progressively lower in the proximal segments, whereas ESR1 methylation was higher in older individuals. Genome-wide methylation analysis of normal DNA revealed 8388, 82, and 93 differentially methylated loci that distinguished right from left colon, males from females, and older vs. younger individuals, respectively. Although variability in methylation between biopsies and among different colon segments was minimal for repetitive elements, analyses of specific cancer-related genes as well as a genome-wide methylation analysis demonstrated differential methylation based on colon location, individual age, and gender. These studies advance our knowledge regarding the variation of DNA methylation in the normal colon, a prerequisite for future studies aimed at understanding methylation differences indicative of a colon field effect. PMID:24413027
Directory of Open Access Journals (Sweden)
Sunee Chansangpetch
2018-01-01
Full Text Available Background/Aims. Epigenetic mechanisms via DNA methylation may be related to glaucoma pathogenesis. This study aimed to determine the global DNA methylation level of the trabeculectomy specimens among patients with different types of glaucoma and normal subjects. Methods. Trabeculectomy sections from 16 primary open-angle glaucoma (POAG, 12 primary angle-closure glaucoma (PACG, 16 secondary glaucoma patients, and 10 normal controls were assessed for DNA methylation using combined-bisulfite restriction analysis. The percentage of global methylation level of the interspersed repetitive sequences for LINE-1, Alu, HERV-E, and HERV-K were compared between the 4 groups. Results. There were no significant differences in the methylation for LINE-1 and HERV-E between patients and normal controls. For the Alu marker, the methylation was significantly lower in all types of glaucoma patients compared to controls (POAG 52.19% versus control 52.83%, p=0.021; PACG 51.50% versus control, p=0.005; secondary glaucoma 51.95% versus control, p=0.014, whereas the methylation level of HERV-K was statistically higher in POAG patients compared to controls (POAG 49.22% versus control 48.09%, p=0.017. Conclusions. The trabeculectomy sections had relative DNA hypomethylation of Alu in all glaucoma subtypes and relative DNA hypermethylation of HERV-K in POAG patients. These methylation changes may lead to the fibrotic phenotype in the trabecular meshwork.
Nie, Y C; Yu, L J; Guan, H; Zhao, Y; Rong, H B; Jiang, B W; Zhang, T
2017-06-01
As an important part of epigenetic marker, DNA methylation involves in the gene regulation and attracts a wide spread attention in biological auxology, geratology and oncology fields. In forensic science, because of the relative stable, heritable, abundant, and age-related characteristics, DNA methylation is considered to be a useful complement to the classic genetic markers for age-prediction, tissue-identification, and monozygotic twins' discrimination. Various methods for DNA methylation detection have been validated based on methylation sensitive restriction endonuclease, bisulfite modification and methylation-CpG binding protein. In recent years, it is reported that the third generation sequencing method can be used to detect DNA methylation. This paper aims to make a review on the detection method of DNA methylation and its applications in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine.
Differential DNA methylation patterns define status epilepticus and epileptic tolerance.
Miller-Delaney, Suzanne F C; Das, Sudipto; Sano, Takanori; Jimenez-Mateos, Eva M; Bryan, Kenneth; Buckley, Patrick G; Stallings, Raymond L; Henshall, David C
2012-02-01
Prolonged seizures (status epilepticus) produce pathophysiological changes in the hippocampus that are associated with large-scale, wide-ranging changes in gene expression. Epileptic tolerance is an endogenous program of cell protection that can be activated in the brain by previous exposure to a non-harmful seizure episode before status epilepticus. A major transcriptional feature of tolerance is gene downregulation. Here, through methylation analysis of 34,143 discrete loci representing all annotated CpG islands and promoter regions in the mouse genome, we report the genome-wide DNA methylation changes in the hippocampus after status epilepticus and epileptic tolerance in adult mice. A total of 321 genes showed altered DNA methylation after status epilepticus alone or status epilepticus that followed seizure preconditioning, with >90% of the promoters of these genes undergoing hypomethylation. These profiles included genes not previously associated with epilepsy, such as the polycomb gene Phc2. Differential methylation events generally occurred throughout the genome without bias for a particular chromosomal region, with the exception of a small region of chromosome 4, which was significantly overrepresented with genes hypomethylated after status epilepticus. Surprisingly, only few genes displayed differential hypermethylation in epileptic tolerance. Nevertheless, gene ontology analysis emphasized the majority of differential methylation events between the groups occurred in genes associated with nuclear functions, such as DNA binding and transcriptional regulation. The present study reports select, genome-wide DNA methylation changes after status epilepticus and in epileptic tolerance, which may contribute to regulating the gene expression environment of the seizure-damaged hippocampus.
Directory of Open Access Journals (Sweden)
Danay Baker-Andresen
2015-10-01
Full Text Available Continued vulnerability to relapse during abstinence is a characteristic of cocaine addiction and suggests that drug-induced neuroadaptations persist during abstinence. However, the precise cellular and molecular attributes of these adaptations remain equivocal. One possibility is that cocaine self-administration leads to enduring changes in DNA methylation. To address this possibility, we isolated neurons from medial prefrontal cortex and performed high throughput DNA sequencing to examine changes in DNA methylation following cocaine self-administration. Twenty-nine genomic regions became persistently differentially methylated during cocaine self-administration, and an additional 28 regions became selectively differentially methylated during abstinence. Altered DNA methylation was associated with isoform-specific changes in the expression of co-localizing genes. These results provide the first neuron-specific, genome-wide profile of changes in DNA methylation induced by cocaine self-administration and protracted abstinence. Moreover, our findings suggest that altered DNA methylation facilitates long-term behavioral adaptation in a manner that extends beyond the perpetuation of altered transcriptional states.
Honda, Shinji; Bicocca, Vincent T.; Gessaman, Jordan D.; Rountree, Michael R.; Yokoyama, Ayumi; Yu, Eun Y.; Selker, Jeanne M. L.; Selker, Eric U.
2016-01-01
DNA methylation, heterochromatin protein 1 (HP1), histone H3 lysine 9 (H3K9) methylation, histone deacetylation, and highly repeated sequences are prototypical heterochromatic features, but their interrelationships are not fully understood. Prior work showed that H3K9 methylation directs DNA methylation and histone deacetylation via HP1 in Neurospora crassa and that the histone deacetylase complex HCHC is required for proper DNA methylation. The complex consists of the chromodomain proteins HP1 and chromodomain protein 2 (CDP-2), the histone deacetylase HDA-1, and the AT-hook motif protein CDP-2/HDA-1–associated protein (CHAP). We show that the complex is required for proper chromosome segregation, dissect its function, and characterize interactions among its components. Our analyses revealed the existence of an HP1-based DNA methylation pathway independent of its chromodomain. The pathway partially depends on CHAP but not on the CDP-2 chromodomain. CDP-2 serves as a bridge between the recognition of H3K9 trimethylation (H3K9me3) by HP1 and the histone deacetylase activity of HDA-1. CHAP is also critical for HDA-1 localization to heterochromatin. Specifically, the CHAP zinc finger interacts directly with the HDA-1 argonaute-binding protein 2 (Arb2) domain, and the CHAP AT-hook motifs recognize heterochromatic regions by binding to AT-rich DNA. Our data shed light on the interrelationships among the prototypical heterochromatic features and support a model in which dual recognition by the HP1 chromodomain and the CHAP AT-hooks are required for proper heterochromatin formation. PMID:27681634
Xu, Jiawei; Bao, Xiao; Peng, Zhaofeng; Wang, Linlin; Du, Linqing; Niu, Wenbin; Sun, Yingpu
2016-05-10
Polycystic ovary syndrome (PCOS) affects approximately 7% of the reproductive-age women. A growing body of evidence indicated that epigenetic mechanisms contributed to the development of PCOS. The role of DNA modification in human PCOS ovary granulosa cell is still unknown in PCOS progression. Global DNA methylation and hydroxymethylation were detected between PCOS' and controls' granulosa cell. Genome-wide DNA methylation was profiled to investigate the putative function of DNA methylaiton. Selected genes expressions were analyzed between PCOS' and controls' granulosa cell. Our results showed that the granulosa cell global DNA methylation of PCOS patients was significant higher than the controls'. The global DNA hydroxymethylation showed low level and no statistical difference between PCOS and control. 6936 differentially methylated CpG sites were identified between control and PCOS-obesity. 12245 differential methylated CpG sites were detected between control and PCOS-nonobesity group. 5202 methylated CpG sites were significantly differential between PCOS-obesity and PCOS-nonobesity group. Our results showed that DNA methylation not hydroxymethylation altered genome-wide in PCOS granulosa cell. The different methylation genes were enriched in development protein, transcription factor activity, alternative splicing, sequence-specific DNA binding and embryonic morphogenesis. YWHAQ, NCF2, DHRS9 and SCNA were up-regulation in PCOS-obesity patients with no significance different between control and PCOS-nonobesity patients, which may be activated by lower DNA methylaiton. Global and genome-wide DNA methylation alteration may contribute to different genes expression and PCOS clinical pathology.
Wiestler, Benedikt; Capper, David; Sill, Martin; Jones, David T W; Hovestadt, Volker; Sturm, Dominik; Koelsche, Christian; Bertoni, Anna; Schweizer, Leonille; Korshunov, Andrey; Weiß, Elisa K; Schliesser, Maximilian G; Radbruch, Alexander; Herold-Mende, Christel; Roth, Patrick; Unterberg, Andreas; Hartmann, Christian; Pietsch, Torsten; Reifenberger, Guido; Lichter, Peter; Radlwimmer, Bernhard; Platten, Michael; Pfister, Stefan M; von Deimling, Andreas; Weller, Michael; Wick, Wolfgang
2014-10-01
The outcome of patients with anaplastic gliomas varies considerably. Whether a molecular classification of anaplastic gliomas based on large-scale genomic or epigenomic analyses is superior to histopathology for reflecting distinct biological groups, predicting outcomes and guiding therapy decisions has yet to be determined. Epigenome-wide DNA methylation analysis, using a platform which also allows the detection of copy-number aberrations, was performed in a cohort of 228 patients with anaplastic gliomas (astrocytomas, oligoastrocytomas, and oligodendrogliomas), including 115 patients of the NOA-04 trial. We further compared these tumors with a group of 55 glioblastomas. Unsupervised clustering of DNA methylation patterns revealed two main groups correlated with IDH status: CpG island methylator phenotype (CIMP) positive (77.5 %) or negative (22.5 %). CIMP(pos) (IDH mutant) tumors showed a further separation based on copy-number status of chromosome arms 1p and 19q. CIMP(neg) (IDH wild type) tumors showed hallmark copy-number alterations of glioblastomas, and clustered together with CIMP(neg) glioblastomas without forming separate groups based on WHO grade. Notably, there was no molecular evidence for a distinct biological entity representing anaplastic oligoastrocytoma. Tumor classification based on CIMP and 1p/19q status was significantly associated with survival, allowing a better prediction of outcome than the current histopathological classification: patients with CIMP(pos) tumors with 1p/19q codeletion (CIMP-codel) had the best prognosis, followed by patients with CIMP(pos) tumors but intact 1p/19q status (CIMP-non-codel). Patients with CIMP(neg) anaplastic gliomas (GBM-like) had the worst prognosis. Collectively, our data suggest that anaplastic gliomas can be grouped by IDH and 1p/19q status into three molecular groups that show clear links to underlying biology and a significant association with clinical outcome in a prospective trial cohort.
Association of season of birth with DNA methylation and allergic disease
Lockett, G. A.; Soto-Ramirez, N.; Ray, M. A.; Everson, T. M.; Xu, C-J.; Patil, V. K.; Terry, W.; Kaushal, A.; Rezwan, F. I.; Ewart, S. L.; Gehring, U.; Postma, D. S.; Koppelman, G. H.; Arshad, S. H.; Zhang, H.; Karmaus, W.; Holloway, J. W.
Background Season of birth influences allergy risk; however, the biological mechanisms underlying this observation are unclear. The environment affects DNA methylation, with potentially long-lasting effects on gene expression and disease. This study examined whether DNA methylation could underlie
Genome-wide DNA methylation profiling in cultured eutopic and ectopic endometrial stromal cells.
Directory of Open Access Journals (Sweden)
Yoshiaki Yamagata
Full Text Available The objective of this study was to characterize the genome-wide DNA methylation profiles of isolated endometrial stromal cells obtained from eutopic endometria with (euESCa and without endometriosis (euESCb and ovarian endometrial cysts (choESC. Three samples were analyzed in each group. The infinium methylation array identified more hypermethylated and hypomethylated CpGs in choESC than in euESCa, and only a few genes were methylated differently in euESCa and euESCb. A functional analysis revealed that signal transduction, developmental processes, immunity, etc. were different in choESC and euESCa. A clustering analysis and a principal component analysis performed based on the methylation levels segregated choESC from euESC, while euESCa and euESCb were identical. A transcriptome analysis was then conducted and the results were compared with those of the DNA methylation analysis. Interestingly, the hierarchical clustering and principal component analyses showed that choESC were segregated from euESCa and euESCb in the DNA methylation analysis, while no segregation was recognized in the transcriptome analysis. The mRNA expression levels of the epigenetic modification enzymes, including DNA methyltransferases, obtained from the specimens were not significantly different between the groups. Some of the differentially methylated and/or expressed genes (NR5A1, STAR, STRA6 and HSD17B2, which are related with steroidogenesis, were validated by independent methods in a larger number of samples. Our findings indicate that different DNA methylation profiles exist in ectopic ESC, highlighting the benefits of genome wide DNA methylation analyses over transcriptome analyses in clarifying the development and characterization of endometriosis.
Boyko, Alex; Kovalchuk, Igor
2010-01-01
Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.
Wijenayake, Sanoji; Storey, Kenneth B
2016-04-01
Oxygen deprivation is a lethal stress that only a few animals can tolerate for extended periods. This study focuses on analyzing the role of DNA methylation in aiding natural anoxia tolerance in a champion vertebrate anaerobe, the red-eared slider turtle (Trachemys scripta elegans). We examined the relative expression and total enzymatic activity of four DNA methyltransferases (DNMT1, DNMT2, DNMT3a and DNMT3b), two methyl-binding domain proteins (MBD1 and MBD2), and relative genomic levels of 5-methylcytosine under control, 5 h anoxic, and 20 h anoxic conditions in liver, heart, and white skeletal muscle (n = 4, p < 0.05). In liver, protein expression of DNMT1, DNMT2, MBD1, and MBD2 rose significantly by two- to fourfold after 5 h anoxic submergence compared to normoxic-control conditions. In heart, 5 h anoxia submergence resulted in a 1.4-fold increase in DNMT3a levels and a significant decrease in MBD1 and MBD2 levels to ~30 % of control values. In white muscle, DNMT3a and DNMT3b increased threefold and MBD1 levels increased by 50 % in response to 5 h anoxia. Total DNMT activity rose by 0.6-2.0-fold in liver and white muscle and likewise global 5mC levels significantly increased in liver and white muscle under 5 and 20 h anoxia. The results demonstrate an overall increase in DNA methylation, DNMT protein expression and enzymatic activity in response to 5 and 20 h anoxia in liver and white muscle indicating a potential downregulation of gene expression via this epigenetic mechanism during oxygen deprivation.
Bardhan, Kankana; Paschall, Amy V; Yang, Dafeng; Chen, May R; Simon, Priscilla S; Bhutia, Yangzom D; Martin, Pamela M; Thangaraju, Muthusamy; Browning, Darren D; Ganapathy, Vadivel; Heaton, Christopher M; Gu, Keni; Lee, Jeffrey R; Liu, Kebin
2015-07-01
Short-chain fatty acids, metabolites produced by colonic microbiota from fermentation of dietary fiber, act as anti-inflammatory agents in the intestinal tract to suppress proinflammatory diseases. GPR109A is the receptor for short-chain fatty acids. The functions of GPR109A have been the subject of extensive studies; however, the molecular mechanisms underlying GPR109A expression is largely unknown. We show that GPR109A is highly expressed in normal human colon tissues, but is silenced in human colon carcinoma cells. The GPR109A promoter DNA is methylated in human colon carcinoma. Strikingly, we observed that IFNγ, a cytokine secreted by activated T cells, activates GPR109A transcription without altering its promoter DNA methylation. Colon carcinoma grows significantly faster in IFNγ-deficient mice than in wild-type mice in an orthotopic colon cancer mouse model. A positive correlation was observed between GPR109A protein level and tumor-infiltrating T cells in human colon carcinoma specimens, and IFNγ expression level is higher in human colon carcinoma tissues than in normal colon tissues. We further demonstrated that IFNγ rapidly activates pSTAT1 that binds to the promoter of p300 to activate its transcription. p300 then binds to the GPR109A promoter to induce H3K18 hyperacetylation, resulting in chromatin remodeling in the methylated GPR109A promoter. The IFNγ-activated pSTAT1 then directly binds to the methylated but hyperacetylated GPR109 promoter to activate its transcription. Overall, our data indicate that GPR109A acts as a tumor suppressor in colon cancer, and the host immune system might use IFNγ to counteract DNA methylation-mediated GPR109A silencing as a mechanism to suppress tumor development. ©2015 American Association for Cancer Research.
Bardhan, Kankana; Paschall, Amy V.; Yang, Dafeng; Chen, May R.; Simon, Priscilla S.; Bhutia, Yangzom; Martin, Pamela M.; Thangaraju, Muthusamy; Browning, Darren D.; Ganapathy, Vadivel; Heaton, Christopher M.; Gu, Keni; Lee, Jeffrey R.; Liu, Kebin
2015-01-01
Short-chain fatty acids, metabolites produced by colonic microbiota from fermentation of dietary fiber, act as anti-inflammatory agents in the intestinal tract to suppress proinflammatory diseases. GPR109A is the receptor for short-chain fatty acids. The functions of GPR109A has been the subject of extensive studies, however, the molecular mechanisms underlying GPR109A expression is largely unknown. We show that GPR109A is highly expressed in normal human colon tissues, but is silenced in human colon carcinoma cells. The GPR109A promoter DNA is methylated in human colon carcinoma. Strikingly, we observed that IFNγ, a cytokine secreted by activated T cells, activates GPR109A transcription without altering its promoter DNA methylation. Colon carcinoma grows significantly faster in IFNγ-deficient mice than in wildtype mice in an orthotopic colon cancer mouse model. A positive correlation was observed between GPR109A protein level and tumor-infiltrating T cells in human colon carcinoma specimens, and IFNγ expression level is higher in human colon carcinoma tissues than in normal colon tissues. We further demonstrated that IFNγ rapidly activates pSTAT1 that binds to the promoter of p300 to activate its transcription. p300 then binds to the GPR109A promoters to induce H3K18 hyperacetylation, resulting in chromatin remodeling in the methylated GPR109A promoter. The IFNγ-activated pSTAT1 then directly binds to the methylated but hyperacetylated GPR109 promoters to activate its transcription. Overall, our data indicate that GPR109A acts as a tumor suppressor in colon cancer and the host immune system might use IFNγ to counteract DNA methylation-mediated GPR109A silencing as a mechanism to suppress tumor development. PMID:25735954