Metformin Is a Substrate and Inhibitor of the Human Thiamine Transporter, THTR-2 (SLC19A3).

Science.gov (United States)

Liang, Xiaomin; Chien, Huan-Chieh; Yee, Sook Wah; Giacomini, Marilyn M; Chen, Eugene C; Piao, Meiling; Hao, Jia; Twelves, Jolyn; Lepist, Eve-Irene; Ray, Adrian S; Giacomini, Kathleen M

2015-12-07

The biguanide metformin is widely used as first-line therapy for the treatment of type 2 diabetes. Predominately a cation at physiological pH's, metformin is transported by membrane transporters, which play major roles in its absorption and disposition. Recently, our laboratory demonstrated that organic cation transporter 1, OCT1, the major hepatic uptake transporter for metformin, was also the primary hepatic uptake transporter for thiamine, vitamin B1. In this study, we tested the reverse, i.e., that metformin is a substrate of thiamine transporters (THTR-1, SLC19A2, and THTR-2, SLC19A3). Our study demonstrated that human THTR-2 (hTHTR-2), SLC19A3, which is highly expressed in the small intestine, but not hTHTR-1, transports metformin (Km = 1.15 ± 0.2 mM) and other cationic compounds (MPP(+) and famotidine). The uptake mechanism for hTHTR-2 was pH and electrochemical gradient sensitive. Furthermore, metformin as well as other drugs including phenformin, chloroquine, verapamil, famotidine, and amprolium inhibited hTHTR-2 mediated uptake of both thiamine and metformin. Species differences in the substrate specificity of THTR-2 between human and mouse orthologues were observed. Taken together, our data suggest that hTHTR-2 may play a role in the intestinal absorption and tissue distribution of metformin and other organic cations and that the transporter may be a target for drug-drug and drug-nutrient interactions.

SLC3A1 and SLC7A9 mutations in autosomal recessive or dominant canine cystinuria: a new classification system.

Science.gov (United States)

Brons, A-K; Henthorn, P S; Raj, K; Fitzgerald, C A; Liu, J; Sewell, A C; Giger, U

2013-01-01

Cystinuria, one of the first recognized inborn errors of metabolism, has been reported in many dog breeds. To determine urinary cystine concentrations, inheritance, and mutations in the SLC3A1 and SLC7A9 genes associated with cystinuria in 3 breeds. Mixed and purebred Labrador Retrievers (n = 6), Australian Cattle Dogs (6), Miniature Pinschers (4), and 1 mixed breed dog with cystine urolithiasis, relatives and control dogs. Urinary cystinuria and aminoaciduria was assessed and exons of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA. In each breed, male and female dogs, independent of neuter status, were found to form calculi. A frameshift mutation in SLC3A1 (c.350delG) resulting in a premature stop codon was identified in autosomal-recessive (AR) cystinuria in Labrador Retrievers and mixed breed dogs. A 6 bp deletion (c.1095_1100del) removing 2 threonines in SLC3A1 was found in autosomal-dominant (AD) cystinuria with a more severe phenotype in homozygous than in heterozygous Australian Cattle Dogs. A missense mutation in SLC7A9 (c.964G>A) was discovered in AD cystinuria in Miniature Pinschers with only heterozygous affected dogs observed to date. Breed-specific DNA tests were developed, but the prevalence of each mutation remains unknown. These studies describe the first AD inheritance and the first putative SLC7A9 mutation to cause cystinuria in dogs and expand our understanding of this phenotypically and genetically heterogeneous disease, leading to a new classification system for canine cystinuria and better therapeutic management and genetic control in these breeds. Copyright © 2013 by the American College of Veterinary Internal Medicine.

Regulation of DNA Methylation Patterns by CK2-Mediated Phosphorylation of Dnmt3a

Directory of Open Access Journals (Sweden)

Rachel Deplus

2014-08-01

Full Text Available DNA methylation is a central epigenetic modification that is established by de novo DNA methyltransferases. The mechanisms underlying the generation of genomic methylation patterns are still poorly understood. Using mass spectrometry and a phosphospecific Dnmt3a antibody, we demonstrate that CK2 phosphorylates endogenous Dnmt3a at two key residues located near its PWWP domain, thereby downregulating the ability of Dnmt3a to methylate DNA. Genome-wide DNA methylation analysis shows that CK2 primarily modulates CpG methylation of several repeats, most notably of Alu SINEs. This modulation can be directly attributed to CK2-mediated phosphorylation of Dnmt3a. We also find that CK2-mediated phosphorylation is required for localization of Dnmt3a to heterochromatin. By revealing phosphorylation as a mode of regulation of de novo DNA methyltransferase function and by uncovering a mechanism for the regulation of methylation at repetitive elements, our results shed light on the origin of DNA methylation patterns.

Neuropathological characteristics of the brain in two patients with SLC19A3 mutations related to the biotin-thiamine-responsive basal ganglia disease

Directory of Open Access Journals (Sweden)

Maciej Pronicki

2017-06-01

Full Text Available Biotin-thiamine-responsive basal ganglia disease is a severe form of a rare neurogenetic disorder caused by pathogenic molecular variants in the thiamine transporter gene. Nowadays, a potentially effective treatment is known, therefore the early diagnosis is mandatory. The aim of the paper was to assess the contribution of neuropathological and magnetic resonance imaging (MRI studies to a proper diagnosis. We present the brain study of two Polish patients with SLC19A3 mutations, including (1 an infant with an intriguing “walnut” appearance of the brain autopsied many years before the discovery of the SLC19A3 defect, and (2 a one-year-old patient with clinical features of Leigh syndrome. In patient 2, biotin/thiamine responsiveness was not tested at the time of diagnosis and causal treatment started with one-year delay. The central nervous system lesions found in the patients displayed almost clearly a specific pattern for SLC19A3 defect, as previously proposed in diagnostic criteria. Our study presents a detailed description of neuropathological and MRI findings of both patients. We confirm that the autopsy and/or MRI of the brain is sufficient to qualify a patient with an unknown neuropathological disorder directly for SLC19A3 mutations testing and a prompt trial of specific treatment.

Stress, burnout and depression: A systematic review on DNA methylation mechanisms.

Science.gov (United States)

Bakusic, Jelena; Schaufeli, Wilmar; Claes, Stephan; Godderis, Lode

2017-01-01

Despite that burnout presents a serious burden for modern society, there are no diagnostic criteria. Additional difficulty is the differential diagnosis with depression. Consequently, there is a need to dispose of a burnout biomarker. Epigenetic studies suggest that DNA methylation is a possible mediator linking individual response to stress and psychopathology and could be considered as a potential biomarker of stress-related mental disorders. Thus, the aim of this review is to provide an overview of DNA methylation mechanisms in stress, burnout and depression. In addition to state-of-the-art overview, the goal of this review is to provide a scientific base for burnout biomarker research. We performed a systematic literature search and identified 25 pertinent articles. Among these, 15 focused on depression, 7 on chronic stress and only 3 on work stress/burnout. Three epigenome-wide studies were identified and the majority of studies used the candidate-gene approach, assessing 12 different genes. The glucocorticoid receptor gene (NR3C1) displayed different methylation patterns in chronic stress and depression. The serotonin transporter gene (SLC6A4) methylation was similarly affected in stress, depression and burnout. Work-related stress and depressive symptoms were associated with different methylation patterns of the brain derived neurotrophic factor gene (BDNF) in the same human sample. The tyrosine hydroxylase (TH) methylation was correlated with work stress in a single study. Additional, thoroughly designed longitudinal studies are necessary for revealing the cause-effect relationship of work stress, epigenetics and burnout, including its overlap with depression. Copyright © 2016 Elsevier Inc. All rights reserved.

Lysine methyltransferase G9a is not required for DNMT3A/3B anchoring to methylated nucleosomes and maintenance of DNA methylation in somatic cells

Directory of Open Access Journals (Sweden)

Sharma Shikhar

2012-01-01

Full Text Available Abstract Background DNA methylation, histone modifications and nucleosome occupancy act in concert for regulation of gene expression patterns in mammalian cells. Recently, G9a, a H3K9 methyltransferase, has been shown to play a role in establishment of DNA methylation at embryonic gene targets in ES cells through recruitment of de novo DNMT3A/3B enzymes. However, whether G9a plays a similar role in maintenance of DNA methylation in somatic cells is still unclear. Results Here we show that G9a is not essential for maintenance of DNA methylation in somatic cells. Knockdown of G9a has no measurable effect on DNA methylation levels at G9a-target loci. DNMT3A/3B remain stably anchored to nucleosomes containing methylated DNA even in the absence of G9a, ensuring faithful propagation of methylated states in cooperation with DNMT1 through somatic divisions. Moreover, G9a also associates with nucleosomes in a DNMT3A/3B and DNA methylation-independent manner. However, G9a knockdown synergizes with pharmacologic inhibition of DNMTs resulting in increased hypomethylation and inhibition of cell proliferation. Conclusions Taken together, these data suggest that G9a is not involved in maintenance of DNA methylation in somatic cells but might play a role in re-initiation of de novo methylation after treatment with hypomethylating drugs, thus serving as a potential target for combinatorial treatments strategies involving DNMTs inhibitors.

SLC5A8 gene, a transporter of butyrate: a gut flora metabolite, is frequently methylated in African American colon adenomas.

Directory of Open Access Journals (Sweden)

Hassan Brim

Full Text Available Colon cancer is one of the leading causes of cancer related deaths. Its impact on African Americans (AAs is higher than in the general population both in the incidence and mortality from the disease. Colon cancer aggressiveness in AAs as well as non-frequent check-ups and follow up in this population have been proposed as ways to explain the observed discrepancies. These facts made the detection of early carcinogenesis markers in this population a priority.Here, we analyzed 50 colon adenomas from AA patients for both microsatellite instability (MSI and the methylation status of SLC5A8 gene. This gene's product is involved in the transport of butyrate that has anti-proliferative properties through its effects on histone acetylation and gene expression. A proteomic analysis to check the expressed histones in adenoma and normal tissues was also performed.The analyzed samples displayed 82% (n = 41 methylation level of SLC5A8 gene in adenomas. The MSI-H (high adenoma were about 18% (n = 9 while the rest were mostly MSS (microsatellite stable with few MSI-L (Low. No association was found between SLC5A8 methylation and the MSI status. Also, there was no association between SLC5A8 methylation and the sex and age of the patients. However, there were more right sided adenomas with SLC5A8 methylation than the left sided ones. The proteomic analysis revealed distinct histone expression profiles between normal and adenoma tissues.SLC5A8 is highly methylated in AA colon adenomas which points to its potential use as a marker for early detection. The MSI rate is similar to that found in colon cancer tumors in AAs. These findings suggest that both processes stem from the same epigenetic and genetic events occurring at an early stage in colon carcinogenesis in AAs.

DNA methylation of the gonadal aromatase (cyp19a promoter is involved in temperature-dependent sex ratio shifts in the European sea bass.

Directory of Open Access Journals (Sweden)

Laia Navarro-Martín

2011-12-01

Full Text Available Sex ratio shifts in response to temperature are common in fish and reptiles. However, the mechanism linking temperature during early development and sex ratios has remained elusive. We show in the European sea bass (sb, a fish in which temperature effects on sex ratios are maximal before the gonads form, that juvenile males have double the DNA methylation levels of females in the promoter of gonadal aromatase (cyp19a, the enzyme that converts androgens into estrogens. Exposure to high temperature increased the cyp19a promoter methylation levels of females, indicating that induced-masculinization involves DNA methylation-mediated control of aromatase gene expression, with an observed inverse relationship between methylation levels and expression. Although different CpGs within the sb cyp19a promoter exhibited different sensitivity to temperature, we show that the increased methylation of the sb cyp19a promoter, which occurs in the gonads but not in the brain, is not a generalized effect of temperature. Importantly, these effects were also observed in sexually undifferentiated fish and were not altered by estrogen treatment. Thus, methylation of the sb cyp19a promoter is the cause of the lower expression of cyp19a in temperature-masculinized fish. In vitro, induced methylation of the sb cyp19a promoter suppressed the ability of SF-1 and Foxl2 to stimulate transcription. Finally, a CpG differentially methylated by temperature and adjacent to a Sox transcription factor binding site is conserved across species. Thus, DNA methylation of the aromatase promoter may be an essential component of the long-sought-after mechanism connecting environmental temperature and sex ratios in vertebrate species with temperature-dependent sex determination.

Methylation of DNA Ligase 1 by G9a/GLP Recruits UHRF1 to Replicating DNA and Regulates DNA Methylation.

Science.gov (United States)

Ferry, Laure; Fournier, Alexandra; Tsusaka, Takeshi; Adelmant, Guillaume; Shimazu, Tadahiro; Matano, Shohei; Kirsh, Olivier; Amouroux, Rachel; Dohmae, Naoshi; Suzuki, Takehiro; Filion, Guillaume J; Deng, Wen; de Dieuleveult, Maud; Fritsch, Lauriane; Kudithipudi, Srikanth; Jeltsch, Albert; Leonhardt, Heinrich; Hajkova, Petra; Marto, Jarrod A; Arita, Kyohei; Shinkai, Yoichi; Defossez, Pierre-Antoine

2017-08-17

DNA methylation is an essential epigenetic mark in mammals that has to be re-established after each round of DNA replication. The protein UHRF1 is essential for this process; it has been proposed that the protein targets newly replicated DNA by cooperatively binding hemi-methylated DNA and H3K9me2/3, but this model leaves a number of questions unanswered. Here, we present evidence for a direct recruitment of UHRF1 by the replication machinery via DNA ligase 1 (LIG1). A histone H3K9-like mimic within LIG1 is methylated by G9a and GLP and, compared with H3K9me2/3, more avidly binds UHRF1. Interaction with methylated LIG1 promotes the recruitment of UHRF1 to DNA replication sites and is required for DNA methylation maintenance. These results further elucidate the function of UHRF1, identify a non-histone target of G9a and GLP, and provide an example of a histone mimic that coordinates DNA replication and DNA methylation maintenance. Copyright © 2017 Elsevier Inc. All rights reserved.

A Study of Single Nucleotide Polymorphisms of the SLC19A1/RFC1 Gene in Subjects with Autism Spectrum Disorder

Directory of Open Access Journals (Sweden)

Naila Al Mahmuda

2016-05-01

Full Text Available Autism Spectrum Disorder (ASD is a group of neurodevelopmental disorders with complex genetic etiology. Recent studies have indicated that children with ASD may have altered folate or methionine metabolism, suggesting that the folate–methionine cycle may play a key role in the etiology of ASD. SLC19A1, also referred to as reduced folate carrier 1 (RFC1, is a member of the solute carrier group of transporters and is one of the key enzymes in the folate metabolism pathway. Findings from multiple genomic screens suggest the presence of an autism susceptibility locus on chromosome 21q22.3, which includes SLC19A1. Therefore, we performed a case-control study in a Japanese population. In this study, DNA samples obtained from 147 ASD patients at the Kanazawa University Hospital in Japan and 150 unrelated healthy Japanese volunteers were examined by the sequence-specific primer-polymerase chain reaction method pooled with fluorescence correlation spectroscopy. p < 0.05 was considered to represent a statistically significant outcome. Of 13 single nucleotide polymorphisms (SNPs examined, a significant p-value was obtained for AA genotype of one SNP (rs1023159, OR = 0.39, 95% CI = 0.16–0.91, p = 0.0394; Fisher’s exact test. Despite some conflicting results, our findings supported a role for the polymorphism rs1023159 of the SLC19A1 gene, alone or in combination, as a risk factor for ASD. However, the findings were not consistent after multiple testing corrections. In conclusion, although our results supported a role of the SLC19A1 gene in the etiology of ASD, it was not a significant risk factor for the ASD samples analyzed in this study.

DNA Methylation as a Biomarker for Body Fluid Identification

Directory of Open Access Journals (Sweden)

Rania Gomaa

2017-12-01

Full Text Available Currently, available identification techniques for forensic samples are either enzyme or protein based, which can be subjected to degradation, thus limiting its storage potentials. Epigenetic changes arising due to DNA methylation and histone acetylation can be used for body fluid identification. Markers DACT1, USP49, ZC3H12D, FGF7, cg23521140, cg17610929, chromosome 4 (25287119–25287254, chromosome 11 (72085678–72085798, 57171095–57171236, 1493401–1493538, and chromosome 19 (47395505–47395651 are currently being used for semen identification. Markers cg26107890, cg20691722, cg01774894 and cg14991487 are used to differentiate saliva and vaginal secretions from other body fluids. However, such markers show overlapping methylation pattern. This review article aimed to highlight the feasibility of using DNA methylation of certain genetic markers in body fluid identification and its implications for forensic investigations. The reviewed articles have employed molecular genetics techniques such as Bisulfite sequencing PCR (BSP, methylation specific PCR (MSP, Pyrosequencing, Combined Bisulfite Restriction Analysis (COBRA, Methylation-sensitive Single Nucleotide Primer Extension (SNuPE, and Multiplex SNaPshot Microarray. Bioinformatics software such as MATLAB and BiQ Analyzer has been used. Biological fluids have different methylation patterns and thus, this difference can be used to identify the nature of the biological fluid found at the crime scene. Using DNA methylation to identify the body fluids gives accurate results without consumption of the trace evidence and requires a minute amount of DNA for analysis. Recent studies have incorporated next-generation sequencing aiming to find out more reliable markers that can differentiate between different body fluids. Nonetheless, new DNA methylation markers are yet to be discovered to accurately differentiate between saliva and vaginal secretions with high confidence. Epigenetic changes are

Interaction between the SLC19A1 gene and maternal first trimester fever on offspring neural tube defects.

Science.gov (United States)

Pei, Lijun; Zhu, Huiping; Ye, Rongwei; Wu, Jilei; Liu, Jianmeng; Ren, Aiguo; Li, Zhiwen; Zheng, Xiaoying

2015-01-01

Many studies have indicated that the reduced folate carrier gene (SLC19A1) is associated with an increased risk of neural tube defects (NTDs). However, the interaction between the SLC19A1 gene variant and maternal fever exposure and NTD risk remains unknown. The aim of this study was to investigate whether the risk for NTDs was influenced by the interactions between the SLC19A1 (rs1051266) variant and maternal first trimester fever. We investigated the potential interaction between maternal first trimester fever and maternal or offspring SLC19A1 polymorphism through a population-based case-control study. One hundred and four nuclear families with NTDs and 100 control families with nonmal newborns were included in the study. SLC19A1 polymorphism was determined using polymerase chain reaction-restricted fragment length polymorphism. Mothers who had the GG/GA genotype and first trimester fever had an elevated risk of NTDs (adjusted odds ratio, 11.73; 95% confidence interval, 3.02-45.58) as compared to absence of maternal first trimester fever and AA genotype after adjusting for maternal education, paternal education, and age, and had a significant interactive coefficient (γ = 3.17) between maternal GG/GA genotype and first trimester fever. However, there was no interaction between offspring's GG/GA genotype and maternal first trimester fever (the interactive coefficient γ = 0.97) after adjusting for confounding factors. Our findings suggested that the risk of NTDs was potentially influenced by a gene-environment interaction between maternal SLC19A1 rs1051266 GG/GA genotype and first trimester fever. Maternal GG/GA genotype may strengthen the effect of maternal fever exposure on NTD risk in this Chinese population. © 2014 Wiley Periodicals, Inc.

DNA methylation and gene expression of HIF3A

DEFF Research Database (Denmark)

Main, Ailsa Maria; Gillberg, Linn; Jacobsen, Anna Louisa

2016-01-01

from 48 families, from whom we had SAT and muscle biopsies. DNA methylation of four CpG sites in the HIF3A promoter was analyzed in the blood and SAT by pyrosequencing, and HIF3A gene expression was analyzed in SAT and muscle by qPCR. An index of whole-body insulin sensitivity was estimated from oral...... individuals, and whether HIF3A gene expression in SAT and skeletal muscle biopsies showed associations with BMI and insulin resistance. Furthermore, we aimed to investigate gender specificity and heritability of these traits. METHODS: We studied 137 first-degree relatives of type 2 diabetes (T2D) patients...... glucose tolerance tests. RESULTS: BMI was associated with HIF3A methylation at one CpG site in the blood, and there was a positive association between the blood and SAT methylation levels at a different CpG site within the individuals. The SAT methylation level did not correlate with HIF3A gene expression...

DNA methylation results depend on DNA integrity – role of post mortem interval

Directory of Open Access Journals (Sweden)

Mathias eRhein

2015-05-01

Full Text Available Major questions of neurological and psychiatric mechanisms involve the brain functions on a molecular level and cannot be easily addressed due to limitations in access to tissue samples. Post mortem studies are able to partly bridge the gap between brain tissue research retrieved from animal trials and the information derived from peripheral analysis (e.g. measurements in blood cells in patients. Here, we wanted to know how fast DNA degradation is progressing under controlled conditions in order to define thresholds for tissue quality to be used in respective trials. Our focus was on the applicability of partly degraded samples for bisulfite sequencing and the determination of simple means to define cut-off values.After opening the brain cavity, we kept two consecutive pig skulls at ambient temperature (19-21°C and removed cortex tissue up to a post mortem interval (PMI of 120h. We calculated the percentage of degradation on DNA gel electrophoresis of brain DNA to estimate quality and relate this estimation spectrum to the quality of human post-mortem control samples. Functional DNA quality was investigated by bisulfite sequencing of two functionally relevant genes for either the serotonin receptor 5 (SLC6A4 or aldehyde dehydrogenase 2 (ALDH2.Testing our approach in a heterogeneous collective of human blood and brain samples, we demonstrate integrity of measurement quality below the threshold of 72h PMI.While sequencing technically worked for all timepoints irrespective of conceivable DNA degradation, there is a good correlation between variance of methylation to degradation levels documented in the gel (R2=0.4311, p=0.0392 for advancing post mortem intervals (PMI. This otherwise elusive phenomenon is an important prerequisite for the interpretation and evaluation of samples prior to in-depth processing via an affordable and easy assay to estimate identical sample quality and thereby comparable methylation measurements.

Trans-ancestry genome-wide association study identifies 12 genetic loci influencing blood pressure and implicates a role for DNA methylation

Science.gov (United States)

Drong, Alexander W; Abbott, James; Wahl, Simone; Tan, Sian-Tsung; Scott, William R; Campanella, Gianluca; Chadeau-Hyam, Marc; Afzal, Uzma; Ahluwalia, Tarunveer S; Bonder, Marc Jan; Chen, Peng; Dehghan, Abbas; Edwards, Todd L; Esko, Tõnu; Go, Min Jin; Harris, Sarah E; Hartiala, Jaana; Kasela, Silva; Kasturiratne, Anuradhani; Khor, Chiea-Chuen; Kleber, Marcus E; Li, Huaixing; Yu Mok, Zuan; Nakatochi, Masahiro; Sapari, Nur Sabrina; Saxena, Richa; Stewart, Alexandre F R; Stolk, Lisette; Tabara, Yasuharu; Teh, Ai Ling; Wu, Ying; Wu, Jer-Yuarn; Zhang, Yi; Aits, Imke; Da Silva Couto Alves, Alexessander; Das, Shikta; Dorajoo, Rajkumar; Hopewell, Jemma C; Kim, Yun Kyoung; Koivula, Robert W; Luan, Jian’an; Lyytikäinen, Leo-Pekka; Nguyen, Quang N; Pereira, Mark A; Postmus, Iris; Raitakari, Olli T; Bryan, Molly Scannell; Scott, Robert A; Sorice, Rossella; Tragante, Vinicius; Traglia, Michela; White, Jon; Yamamoto, Ken; Zhang, Yonghong; Adair, Linda S; Ahmed, Alauddin; Akiyama, Koichi; Asif, Rasheed; Aung, Tin; Barroso, Inês; Bjonnes, Andrew; Braun, Timothy R; Cai, Hui; Chang, Li-Ching; Chen, Chien-Hsiun; Cheng, Ching-Yu; Chong, Yap-Seng; Collins, Rory; Courtney, Regina; Davies, Gail; Delgado, Graciela; Do, Loi D; Doevendans, Pieter A; Gansevoort, Ron T; Gao, Yu-Tang; Grammer, Tanja B; Grarup, Niels; Grewal, Jagvir; Gu, Dongfeng; Wander, Gurpreet S; Hartikainen, Anna-Liisa; Hazen, Stanley L; He, Jing; Heng, Chew-Kiat; Hixson, James E; Hofman, Albert; Hsu, Chris; Huang, Wei; Husemoen, Lise L N; Hwang, Joo-Yeon; Ichihara, Sahoko; Igase, Michiya; Isono, Masato; Justesen, Johanne M; Katsuya, Tomohiro; Kibriya, Muhammad G; Kim, Young Jin; Kishimoto, Miyako; Koh, Woon-Puay; Kohara, Katsuhiko; Kumari, Meena; Kwek, Kenneth; Lee, Nanette R; Lee, Jeannette; Liao, Jiemin; Lieb, Wolfgang; Liewald, David C M; Matsubara, Tatsuaki; Matsushita, Yumi; Meitinger, Thomas; Mihailov, Evelin; Milani, Lili; Mills, Rebecca; Mononen, Nina; Müller-Nurasyid, Martina; Nabika, Toru; Nakashima, Eitaro; Ng, Hong Kiat; Nikus, Kjell; Nutile, Teresa; Ohkubo, Takayoshi; Ohnaka, Keizo; Parish, Sarah; Paternoster, Lavinia; Peng, Hao; Peters, Annette; Pham, Son T; Pinidiyapathirage, Mohitha J; Rahman, Mahfuzar; Rakugi, Hiromi; Rolandsson, Olov; Ann Rozario, Michelle; Ruggiero, Daniela; Sala, Cinzia F; Sarju, Ralhan; Shimokawa, Kazuro; Snieder, Harold; Sparsø, Thomas; Spiering, Wilko; Starr, John M; Stott, David J; Stram, Daniel O; Sugiyama, Takao; Szymczak, Silke; Tang, W H Wilson; Tong, Lin; Trompet, Stella; Turjanmaa, Väinö; Ueshima, Hirotsugu; Uitterlinden, André G; Umemura, Satoshi; Vaarasmaki, Marja; van Dam, Rob M; van Gilst, Wiek H; van Veldhuisen, Dirk J; Viikari, Jorma S; Waldenberger, Melanie; Wang, Yiqin; Wang, Aili; Wilson, Rory; Wong, Tien-Yin; Xiang, Yong-Bing; Yamaguchi, Shuhei; Ye, Xingwang; Young, Robin D; Young, Terri L; Yuan, Jian-Min; Zhou, Xueya; Asselbergs, Folkert W; Ciullo, Marina; Clarke, Robert; Deloukas, Panos; Franke, Andre; Franks, Paul W; Franks, Steve; Friedlander, Yechiel; Gross, Myron D; Guo, Zhirong; Hansen, Torben; Jarvelin, Marjo-Riitta; Jørgensen, Torben; Jukema, J Wouter; kähönen, Mika; Kajio, Hiroshi; Kivimaki, Mika; Lee, Jong-Young; Lehtimäki, Terho; Linneberg, Allan; Miki, Tetsuro; Pedersen, Oluf; Samani, Nilesh J; Sørensen, Thorkild I A; Takayanagi, Ryoichi; Toniolo, Daniela; Ahsan, Habibul; Allayee, Hooman; Chen, Yuan-Tsong; Danesh, John; Deary, Ian J; Franco, Oscar H; Franke, Lude; Heijman, Bastiaan T; Holbrook, Joanna D; Isaacs, Aaron; Kim, Bong-Jo; Lin, Xu; Liu, Jianjun; März, Winfried; Metspalu, Andres; Mohlke, Karen L; Sanghera, Dharambir K; Shu, Xiao-Ou; van Meurs, Joyce B J; Vithana, Eranga; Wickremasinghe, Ananda R; Wijmenga, Cisca; Wolffenbuttel, Bruce H W; Yokota, Mitsuhiro; Zheng, Wei; Zhu, Dingliang; Vineis, Paolo; Kyrtopoulos, Soterios A; Kleinjans, Jos C S; McCarthy, Mark I; Soong, Richie; Gieger, Christian; Scott, James

2016-01-01

We carried out a trans-ancestry genome-wide association and replication study of blood pressure phenotypes among up to 320,251 individuals of East Asian, European and South Asian ancestry. We find genetic variants at 12 new loci to be associated with blood pressure (P = 3.9 × 10−11 to 5.0 × 10−21). The sentinel blood pressure SNPs are enriched for association with DNA methylation at multiple nearby CpG sites, suggesting that, at some of the loci identified, DNA methylation may lie on the regulatory pathway linking sequence variation to blood pressure. The sentinel SNPs at the 12 new loci point to genes involved in vascular smooth muscle (IGFBP3, KCNK3, PDE3A and PRDM6) and renal (ARHGAP24, OSR1, SLC22A7 and TBX2) function. The new and known genetic variants predict increased left ventricular mass, circulating levels of NT-proBNP, and cardiovascular and all-cause mortality (P = 0.04 to 8.6 × 10−6). Our results provide new evidence for the role of DNA methylation in blood pressure regulation. PMID:26390057

Environmental stress affects DNA methylation of a CpG rich promoter region of serotonin transporter gene in a nurse cohort.

Directory of Open Access Journals (Sweden)

Jukka S Alasaari

Full Text Available Shift-working nurses are exposed to a stressful work environment, which puts them at an increased risk for burnout and depression. We explored the effect of environmental stress on serotonin transporter gene (SLC6A4 promoter methylation among nurses from high and low work stress environments.Using bisulfite sequencing, we investigated the methylation status of five CpG residues of a CpG-rich region in the promoter of SLC6A4 by comparing female shift working nurses from a high work stress environment (n = 24 to low work stress environment (n = 25. We also analyzed the association of 5-HTTLPR polymorphism at 5' end of SLC6A4. Work stress was assessed by the Karasek's Model and possible signs of burnout or depression were measured by the Maslach Burnout Index General Survey and Beck Depression Index. Methylation levels were assessed by bisulfite sequencing of DNA extracted from peripheral blood leucocytes. Restriction enzyme treatment followed by standard PCR was used to identify 5-HTTLPR genotypes.We found that nurses in the high stress environment had significantly lower promoter methylation levels at all five CpG residues compared to nurses in the low stress environment (p<0.01. There was no significant interaction of 5-HTTLPR genotype and work stress with methylation (p = 0.58. In unadjusted (bivariate analysis, burnout was not significantly associated to methylation levels. However, when mutually adjusted for both, burnout and work stress were significant contributors (p = 0.038 and p<0.0001 respectively to methylation levels.Our findings show that environmental stress is concurrent with decreased methylation of the SLC6A4 promoter. This may lead to increased transcriptional activity of the gene, increased reuptake of serotonin from synaptic clefts, and termination of the activity of serotonin. This could present a possible coping mechanism for environmental stress in humans that could eventually increase risk for disturbed functional

Genome-wide DNA methylation maps in follicular lymphoma cells determined by methylation-enriched bisulfite sequencing.

Directory of Open Access Journals (Sweden)

Jeong-Hyeon Choi

Full Text Available BACKGROUND: Follicular lymphoma (FL is a form of non-Hodgkin's lymphoma (NHL that arises from germinal center (GC B-cells. Despite the significant advances in immunotherapy, FL is still not curable. Beyond transcriptional profiling and genomics datasets, there currently is no epigenome-scale dataset or integrative biology approach that can adequately model this disease and therefore identify novel mechanisms and targets for successful prevention and treatment of FL. METHODOLOGY/PRINCIPAL FINDINGS: We performed methylation-enriched genome-wide bisulfite sequencing of FL cells and normal CD19(+ B-cells using 454 sequencing technology. The methylated DNA fragments were enriched with methyl-binding proteins, treated with bisulfite, and sequenced using the Roche-454 GS FLX sequencer. The total number of bases covered in the human genome was 18.2 and 49.3 million including 726,003 and 1.3 million CpGs in FL and CD19(+ B-cells, respectively. 11,971 and 7,882 methylated regions of interest (MRIs were identified respectively. The genome-wide distribution of these MRIs displayed significant differences between FL and normal B-cells. A reverse trend in the distribution of MRIs between the promoter and the gene body was observed in FL and CD19(+ B-cells. The MRIs identified in FL cells also correlated well with transcriptomic data and ChIP-on-Chip analyses of genome-wide histone modifications such as tri-methyl-H3K27, and tri-methyl-H3K4, indicating a concerted epigenetic alteration in FL cells. CONCLUSIONS/SIGNIFICANCE: This study is the first to provide a large scale and comprehensive analysis of the DNA methylation sequence composition and distribution in the FL epigenome. These integrated approaches have led to the discovery of novel and frequent targets of aberrant epigenetic alterations. The genome-wide bisulfite sequencing approach developed here can be a useful tool for profiling DNA methylation in clinical samples.

Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm

Directory of Open Access Journals (Sweden)

Xiaoguo Zheng

2017-12-01

Full Text Available DNA methylation is the major focus of studies on paternal epigenetic inheritance in mammals, but most previous studies about inheritable DNA methylation changes are passively induced by environmental factors. However, it is unclear whether the active changes mediated by variations in DNA methyltransferase activity are heritable. Here, we established human-derived DNMT3A (hDNMT3A transgenic rats to study the effect of hDNMT3A overexpression on the DNA methylation pattern of rat sperm and to investigate whether this actively altered DNA methylation status is inheritable. Our results revealed that hDNMT3A was overexpressed in the testis of transgenic rats and induced genome-wide alterations in the DNA methylation pattern of rat sperm. Among 5438 reliable loci identified with 64 primer-pair combinations using a methylation-sensitive amplification polymorphism method, 28.01% showed altered amplified band types. Among these amplicons altered loci, 68.42% showed an altered DNA methylation status in the offspring of transgenic rats compared with wild-type rats. Further analysis based on loci which had identical DNA methylation status in all three biological replicates revealed that overexpression of hDNMT3A in paternal testis induced hypermethylation in sperm of both genotype-negative and genotype-positive offspring. Among the differentially methylated loci, 34.26% occurred in both positive and negative offspring of transgenic rats, indicating intergenerational inheritance of active DNA methylation changes in the absence of hDNM3A transmission. Furthermore, 75.07% of the inheritable loci were hyper-methylated while the remaining were hypomethylated. Distribution analysis revealed that the DNA methylation variations mainly occurred in introns and intergenic regions. Functional analysis revealed that genes related to differentially methylated loci were involved in a wide range of functions. Finally, this study demonstrated that active DNA methylation

Impairment of sperm DNA methylation in male infertility: a meta-analytic study.

Science.gov (United States)

Santi, D; De Vincentis, S; Magnani, E; Spaggiari, G

2017-07-01

Considering the widespread use of assisted reproductive techniques (ART), DNA methylation of specific genes involved in spermatogenesis achieves increasingly clinical relevance, representing a possible explanation of increased incidence of syndromes related to genomic imprinting in medically assisted pregnancies. Several trials suggested a relationship between male sub-fertility and sperm DNA methylation, although its weight on seminal parameters alteration is still a matter of debate. To evaluate whether aberrant sperm DNA methylation of imprinted genes is associated with impaired sperm parameters. Meta-analysis of controlled clinical trials evaluating imprinted genes sperm DNA methylation comparing men with idiopathic infertility to fertile controls. Twenty-four studies were included, allowing a meta-analytic evaluation for H19, MEST, SNRPN, and LINE-1. When a high heterogeneity of the results was demonstrated, the random effect model was used. H19 methylation levels resulted significantly lower in 879 infertile compared with 562 fertile men (7.53%, 95% CI: 5.14-9.93%, p male infertility is associated with altered sperm methylation at H19, MEST, and SNRPN. Although its role in infertility remains unclear, sperm DNA methylation could be associated with the epigenetic risk in ART. In this setting, before proposing this analysis in clinical practice, an accurate identification of the most representative genes and a cost-effectiveness evaluation should be assessed in ad hoc prospective studies. © 2017 American Society of Andrology and European Academy of Andrology.

Transport via SLC5A8 with Subsequent Inhibition of Histone Deacetylases HDAC1 and HDAC3 Underlies the Antitumor Activity of 3-Bromopyruvate

Science.gov (United States)

Thangaraju, Muthusamy; Karunakaran, Senthil K.; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D.; Ganapathy, Vadivel

2009-01-01

Background 3-Bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of ATP production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The present studies have uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. Methods Transport of 3-bromopyruvate via SLC5A8, a tumor suppressor and a Na+-coupled electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by FACS analysis and colony formation assay. Acetylation status of histone H4 was evaluated by Western blot. Results 3-Bromopyruvate is a transportable substrate for SLC5A8, with the transport process being Na+-coupled and electrogenic. MCF7 cells do not express SLC5A8 and are not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells undergo apoptosis in the presence of 3-bromopyruvate. This cell death is associated with inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identify HDAC1 and HDAC3 as the targets for 3-bromopyruvate. Conclusions 3-Bromopyruvate is transported into cells actively via the tumor suppressor SLC5A8 and the process is energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells leads to apoptosis, and the mechanism involves inhibition of HDAC1/HDAC3. PMID:19637353

Dicty_cDB: SLC455 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC455 (Link to dictyBase) - - - Contig-U16584-1 SLC455Z (Link... to Original site) - - SLC455Z 379 - - - - Show SLC455 Library SL (Link to library) Clone ID SLC455 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC455Q.Seq.d/ Representative seq. ID SLC45...5Z (Link to Original site) Representative DNA sequence >SLC455 (SLC455Q) /CSM/SL/SLC4-C/SLC455Q.Seq.d/ XXXXX...57 ) Dictyostelium discoideum slug cDNA, clone SLC469. 468 e-177 3 ( AU034549 ) Dictyostelium discoideum slug cDNA, clone SLC4

Transport by SLC5A8 with subsequent inhibition of histone deacetylase 1 (HDAC1) and HDAC3 underlies the antitumor activity of 3-bromopyruvate.

Science.gov (United States)

Thangaraju, Muthusamy; Karunakaran, Senthil K; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D; Ganapathy, Vadivel

2009-10-15

3-bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of adenosine triphosphate production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The current studies uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. The transport of 3-bromopyruvate by sodium-coupled monocarboxylate transporter SMCT1 (SLC5A8), a tumor suppressor and a sodium (Na+)-coupled, electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by fluorescence-activated cell-sorting analysis and colony-formation assay. The acetylation status of histone H4 was evaluated by Western blot analysis. 3-Bromopyruvate is a transportable substrate for SLC5A8, and that transport process is Na+-coupled and electrogenic. MCF7 cells did not express SLC5A8 and were not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells underwent apoptosis in the presence of 3-bromopyruvate. This cell death was associated with the inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identified HDAC1 and HDAC3 as the targets for 3-bromopyruvate. 3-Bromopyruvate was transported into cells actively through the tumor suppressor SLC5A8, and the process was energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells led to apoptosis, and the mechanism involved the inhibition of HDAC1/HDAC3. Copyright (c) 2009 American Cancer Society.

Dicty_cDB: SLC433 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC433 (Link to dictyBase) - - - Contig-U16397-1 SLC433Z (Link... to Original site) - - SLC433Z 613 - - - - Show SLC433 Library SL (Link to library) Clone ID SLC433 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC433Q.Seq.d/ Representative seq. ID SLC43...3Z (Link to Original site) Representative DNA sequence >SLC433 (SLC433Q) /CSM/SL/SLC4-B/SLC433Q.Seq.d/ XXXXX...tyostelium discoideum slug cDNA, clone SLH872. 1134 0.0 1 ( AU034279 ) Dictyostelium discoideum slug cDNA, clone SLC4

Methyl-Analyzer--whole genome DNA methylation profiling.

Science.gov (United States)

Xin, Yurong; Ge, Yongchao; Haghighi, Fatemeh G

2011-08-15

Methyl-Analyzer is a python package that analyzes genome-wide DNA methylation data produced by the Methyl-MAPS (methylation mapping analysis by paired-end sequencing) method. Methyl-MAPS is an enzymatic-based method that uses both methylation-sensitive and -dependent enzymes covering >80% of CpG dinucleotides within mammalian genomes. It combines enzymatic-based approaches with high-throughput next-generation sequencing technology to provide whole genome DNA methylation profiles. Methyl-Analyzer processes and integrates sequencing reads from methylated and unmethylated compartments and estimates CpG methylation probabilities at single base resolution. Methyl-Analyzer is available at http://github.com/epigenomics/methylmaps. Sample dataset is available for download at http://epigenomicspub.columbia.edu/methylanalyzer_data.html. fgh3@columbia.edu Supplementary data are available at Bioinformatics online.

Influence of DNA-methylation on zinc homeostasis in myeloid cells: Regulation of zinc transporters and zinc binding proteins.

Science.gov (United States)

Kessels, Jana Elena; Wessels, Inga; Haase, Hajo; Rink, Lothar; Uciechowski, Peter

2016-09-01

The distribution of intracellular zinc, predominantly regulated through zinc transporters and zinc binding proteins, is required to support an efficient immune response. Epigenetic mechanisms such as DNA methylation are involved in the expression of these genes. In demethylation experiments using 5-Aza-2'-deoxycytidine (AZA) increased intracellular (after 24 and 48h) and total cellular zinc levels (after 48h) were observed in the myeloid cell line HL-60. To uncover the mechanisms that cause the disturbed zinc homeostasis after DNA demethylation, the expression of human zinc transporters and zinc binding proteins were investigated. Real time PCR analyses of 14 ZIP (solute-linked carrier (SLC) SLC39A; Zrt/IRT-like protein), and 9 ZnT (SLC30A) zinc transporters revealed significantly enhanced mRNA expression of the zinc importer ZIP1 after AZA treatment. Because ZIP1 protein was also enhanced after AZA treatment, ZIP1 up-regulation might be the mediator of enhanced intracellular zinc levels. The mRNA expression of ZIP14 was decreased, whereas zinc exporter ZnT3 mRNA was also significantly increased; which might be a cellular reaction to compensate elevated zinc levels. An enhanced but not significant chromatin accessibility of ZIP1 promoter region I was detected by chromatin accessibility by real-time PCR (CHART) assays after demethylation. Additionally, DNA demethylation resulted in increased mRNA accumulation of zinc binding proteins metallothionein (MT) and S100A8/S100A9 after 48h. MT mRNA was significantly enhanced after 24h of AZA treatment also suggesting a reaction of the cell to restore zinc homeostasis. These data indicate that DNA methylation is an important epigenetic mechanism affecting zinc binding proteins and transporters, and, therefore, regulating zinc homeostasis in myeloid cells. Copyright © 2016 Elsevier GmbH. All rights reserved.

Dicty_cDB: SLC473 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4

The global DNA methylation surrogate LINE-1 methylation is correlated with MGMT promoter methylation and is a better prognostic factor for glioma.

Directory of Open Access Journals (Sweden)

Fumiharu Ohka

Full Text Available Gliomas are the most frequently occurring primary brain tumor in the central nervous system of adults. Glioblastoma multiformes (GBMs, WHO grade 4 have a dismal prognosis despite the use of the alkylating agent, temozolomide (TMZ, and even low grade gliomas (LGGs, WHO grade 2 eventually transform to malignant secondary GBMs. Although GBM patients benefit from promoter hypermethylation of the O(6-methylguanine-DNA methyltransferase (MGMT that is the main determinant of resistance to TMZ, recent studies suggested that MGMT promoter methylation is of prognostic as well as predictive significance for the efficacy of TMZ. Glioma-CpG island methylator phenotype (G-CIMP in the global genome was shown to be a significant predictor of improved survival in patients with GBM. Collectively, we hypothesized that MGMT promoter methylation might reflect global DNA methylation. Additionally in LGGs, the significance of MGMT promoter methylation is still undetermined. In the current study, we aimed to determine the correlation between clinical, genetic, and epigenetic profiles including LINE-1 and different cancer-related genes and the clinical outcome in newly diagnosed 57 LGG and 54 GBM patients. Here, we demonstrated that (1 IDH1/2 mutation is closely correlated with MGMT promoter methylation and 1p/19q codeletion in LGGs, (2 LINE-1 methylation levels in primary and secondary GBMs are lower than those in LGGs and normal brain tissues, (3 LINE-1 methylation is proportional to MGMT promoter methylation in gliomas, and (4 higher LINE-1 methylation is a favorable prognostic factor in primary GBMs, even compared to MGMT promoter methylation. As a global DNA methylation marker, LINE-1 may be a promising marker in gliomas.

Antagonism between DNA and H3K27 methylation at the imprinted Rasgrf1 locus

DEFF Research Database (Denmark)

Lindroth, Anders M; Park, Yoon Jung; McLean, Chelsea M

2008-01-01

At the imprinted Rasgrf1 locus in mouse, a cis-acting sequence controls DNA methylation at a differentially methylated domain (DMD). While characterizing epigenetic marks over the DMD, we observed that DNA and H3K27 trimethylation are mutually exclusive, with DNA and H3K27 methylation limited...... to the paternal and maternal sequences, respectively. The mutual exclusion arises because one mark prevents placement of the other. We demonstrated this in five ways: using 5-azacytidine treatments and mutations at the endogenous locus that disrupt DNA methylation; using a transgenic model in which the maternal...

Deep sequencing reveals distinct patterns of DNA methylation in prostate cancer.

Science.gov (United States)

Kim, Jung H; Dhanasekaran, Saravana M; Prensner, John R; Cao, Xuhong; Robinson, Daniel; Kalyana-Sundaram, Shanker; Huang, Christina; Shankar, Sunita; Jing, Xiaojun; Iyer, Matthew; Hu, Ming; Sam, Lee; Grasso, Catherine; Maher, Christopher A; Palanisamy, Nallasivam; Mehra, Rohit; Kominsky, Hal D; Siddiqui, Javed; Yu, Jindan; Qin, Zhaohui S; Chinnaiyan, Arul M

2011-07-01

Beginning with precursor lesions, aberrant DNA methylation marks the entire spectrum of prostate cancer progression. We mapped the global DNA methylation patterns in select prostate tissues and cell lines using MethylPlex-next-generation sequencing (M-NGS). Hidden Markov model-based next-generation sequence analysis identified ∼68,000 methylated regions per sample. While global CpG island (CGI) methylation was not differential between benign adjacent and cancer samples, overall promoter CGI methylation significantly increased from ~12.6% in benign samples to 19.3% and 21.8% in localized and metastatic cancer tissues, respectively (P-value prostate tissues, 2481 differentially methylated regions (DMRs) are cancer-specific, including numerous novel DMRs. A novel cancer-specific DMR in the WFDC2 promoter showed frequent methylation in cancer (17/22 tissues, 6/6 cell lines), but not in the benign tissues (0/10) and normal PrEC cells. Integration of LNCaP DNA methylation and H3K4me3 data suggested an epigenetic mechanism for alternate transcription start site utilization, and these modifications segregated into distinct regions when present on the same promoter. Finally, we observed differences in repeat element methylation, particularly LINE-1, between ERG gene fusion-positive and -negative cancers, and we confirmed this observation using pyrosequencing on a tissue panel. This comprehensive methylome map will further our understanding of epigenetic regulation in prostate cancer progression.

Genome-wide DNA methylation profiling identifies ALDH1A3 promoter methylation as a prognostic predictor in G-CIMP- primary glioblastoma.

Science.gov (United States)

Zhang, Wei; Yan, Wei; You, Gan; Bao, Zhaoshi; Wang, Yongzhi; Liu, Yanwei; You, Yongping; Jiang, Tao

2013-01-01

To date, the aberrations in the DNA methylation patterns that are associated with different prognoses of G-CIMP- primary GBMs remain to be elucidated. Here, DNA methylation profiling of primary GBM tissues from 13 long-term survivors (LTS; overall survival ⩾18months) and 20 short-term survivors (STS; overall survival ⩽9months) was performed. Then G-CIMP+ samples were excluded. The differentially expressed CpG loci were identified between residual 18 STS and 9 LTS G-CIMP- samples. Methylation levels of 11 CpG loci (10genes) were statistically significantly lower, and 43 CpG loci (40genes) were statistically significantly higher in the tumor tissues of LTS than those of STS G-CIMP- samples (PCIMP- samples, 3 CpG loci localized in the promoter of ALDH1A3. Furthermore, using an independent validation cohort containing 37 primary GBM samples without IDH1 mutation and MGMT promoter methylation, the hypermethylation status of ALDH1A3 promoter predicted a better prognosis with an accompanied low expression of ALDH1A3 protein. Taken together, our results defined prognosis-related methylation signatures systematically for the first time in G-CIMP- primary GBMs. ALDH1A3 promoter methylation conferred a favorable prognosis in G-CIMP- primary GBMs. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

DNA Methylation Modulates Nociceptive Sensitization after Incision.

Directory of Open Access Journals (Sweden)

Yuan Sun

Full Text Available DNA methylation is a key epigenetic mechanism controlling DNA accessibility and gene expression. Blockade of DNA methylation can significantly affect pain behaviors implicated in neuropathic and inflammatory pain. However, the role of DNA methylation with regard to postoperative pain has not yet been explored. In this study we sought to investigate the role of DNA methylation in modulating incisional pain and identify possible targets under DNA methylation and contributing to incisional pain. DNA methyltranferase (DNMT inhibitor 5-Aza-2'-deoxycytidine significantly reduced incision-induced mechanical allodynia and thermal sensitivity. Aza-2'-deoxycytidine also reduced hindpaw swelling after incision, suggesting an anti-inflammatory effect. Global DNA methylation and DNMT3b expression were increased in skin after incision, but none of DNMT1, DNMT3a or DNMT3b was altered in spinal cord or DRG. The expression of proopiomelanocortin Pomc encoding β-endorphin and Oprm1 encoding the mu-opioid receptor were upregulated peripherally after incision; moreover, Oprm1 expression was further increased under DNMT inhibitor treatment. Finally, local peripheral injection of the opioid receptor antagonist naloxone significantly exacerbated incision-induced mechanical hypersensitivity. These results suggest that DNA methylation is functionally relevant to incisional nociceptive sensitization, and that mu-opioid receptor signaling might be one methylation regulated pathway controlling sensitization after incision.

[Variation of long-chain 3-hydroxyacyl-CoA dehydrogenase DNA methylation in placenta of different preeclampsia-like mouse models].

Science.gov (United States)

Han, Yiwei; Yang, Zi; Ding, Xiaoyan; Yu, Huan; Yi, Yanhong

2015-10-01

By detecting the variation of long-chain 3-hydroxyacyl-CoA dehydrogenase (LCHAD) DNA methylation in preeclampsia-like mouse models generated by different ways, to explore the roles of multifactor and multiple pathways in preeclampsia pathogenesis on molecular basis. Established preeclampsia-like mouse models in different ways and divided into groups as follows: (1) Nw-nitro-L-arginine-methyl ester (L-NAME) group: wild-type pregnant mouse received subcutaneous injection of L-NAME; (2) lipopolysaccharide (LPS) group: wild-type pregnant mouse received intraperitoneal injection of LPS; (3) apolipoprotein C-III (ApoC3) group: ApoC3 transgenic pregnant mouse with dysregulated lipid metabolism received subcutaneous injection of L-NAME; (4) β2 glycoprotein I (β-2GPI) group: wild-type pregnant mouse received subcutaneous injection of β-2GPI. According to the first injection time (on day 3, 11, 16 respectively), the L-NAME, LPS and ApoC3 groups were further subdivided into: pre-implantation (PI) experimental stage, early gestation (EG) experimental stage, and late gestation (LG) experimental stage. β-2GPI group was only injected before implantation. LCHAD gene methylation levels in placental were detected in different experimental stage. Normal saline control groups were set within wild-type and ApoC3 transgenic pregnant mice simultaneously. (1) CG sites in LCHAD DNA: 45 CG sites were detected in the range of 728 bp before LCHAD gene transcription start site, the 5, 12, 13, 14, 15, 16, 19, 24, 25, 27, 28, 29, 30, 31, 32, 34, 35, 43 CG sites were complex sites which contained two or more CG sequences, others were single site which contained one CG sequence. The 3, 5, 6, 11, 13, 14, 18, 28 sites in L-NAME, LPS, ApoC3 and β-2GPI groups showed different high levels of methylation; the 16, 25, 31, 42, 44 sites showed different low levels of methylation; other 32 sites were unmethylated. (2) Comparison of LCHAD gene methylation between different groups: the methylation levels

DNA methylation analysis reveals distinct methylation signatures in pediatric germ cell tumors

International Nuclear Information System (INIS)

Amatruda, James F; Frazier, A Lindsay; Poynter, Jenny N; Ross, Julie A; Christensen, Brock; Fustino, Nicholas J; Chen, Kenneth S; Hooten, Anthony J; Nelson, Heather; Kuriger, Jacquelyn K; Rakheja, Dinesh

2013-01-01

Aberrant DNA methylation is a prominent feature of many cancers, and may be especially relevant in germ cell tumors (GCTs) due to the extensive epigenetic reprogramming that occurs in the germ line during normal development. We used the Illumina GoldenGate Cancer Methylation Panel to compare DNA methylation in the three main histologic subtypes of pediatric GCTs (germinoma, teratoma and yolk sac tumor (YST); N = 51) and used recursively partitioned mixture models (RPMM) to test associations between methylation pattern and tumor and demographic characteristics. We identified genes and pathways that were differentially methylated using generalized linear models and Ingenuity Pathway Analysis. We also measured global DNA methylation at LINE1 elements and evaluated methylation at selected imprinted loci using pyrosequencing. Methylation patterns differed by tumor histology, with 18/19 YSTs forming a distinct methylation class. Four pathways showed significant enrichment for YSTs, including a human embryonic stem cell pluripotency pathway. We identified 190 CpG loci with significant methylation differences in mature and immature teratomas (q < 0.05), including a number of CpGs in stem cell and pluripotency-related pathways. Both YST and germinoma showed significantly lower methylation at LINE1 elements compared with normal adjacent tissue while there was no difference between teratoma (mature and immature) and normal tissue. DNA methylation at imprinted loci differed significantly by tumor histology and location. Understanding methylation patterns may identify the developmental stage at which the GCT arose and the at-risk period when environmental exposures could be most harmful. Further, identification of relevant genetic pathways could lead to the development of new targets for therapy

Analysis of DNA Methylation in Young People: Limited Evidence for an Association Between Victimization Stress and Epigenetic Variation in Blood.

Science.gov (United States)

Marzi, Sarah J; Sugden, Karen; Arseneault, Louise; Belsky, Daniel W; Burrage, Joe; Corcoran, David L; Danese, Andrea; Fisher, Helen L; Hannon, Eilis; Moffitt, Terrie E; Odgers, Candice L; Pariante, Carmine; Poulton, Richie; Williams, Benjamin S; Wong, Chloe C Y; Mill, Jonathan; Caspi, Avshalom

2018-01-12

DNA methylation has been proposed as an epigenetic mechanism by which early-life experiences become "embedded" in the genome and alter transcriptional processes to compromise health. The authors sought to investigate whether early-life victimization stress is associated with genome-wide DNA methylation. The authors tested the hypothesis that victimization is associated with DNA methylation in the Environmental Risk (E-Risk) Longitudinal Study, a nationally representative 1994-1995 birth cohort of 2,232 twins born in England and Wales and assessed at ages 5, 7, 10, 12, and 18 years. Multiple forms of victimization were ascertained in childhood and adolescence (including physical, sexual, and emotional abuse; neglect; exposure to intimate-partner violence; bullying; cyber-victimization; and crime). Epigenome-wide analyses of polyvictimization across childhood and adolescence revealed few significant associations with DNA methylation in peripheral blood at age 18, but these analyses were confounded by tobacco smoking and/or did not survive co-twin control tests. Secondary analyses of specific forms of victimization revealed sparse associations with DNA methylation that did not replicate across different operationalizations of the same putative victimization experience. Hypothesis-driven analyses of six candidate genes in the stress response (NR3C1, FKBP5, BDNF, AVP, CRHR1, SLC6A4) did not reveal predicted associations with DNA methylation in probes annotated to these genes. Findings from this epidemiological analysis of the epigenetic effects of early-life stress do not support the hypothesis of robust changes in DNA methylation in victimized young people. We need to come to terms with the possibility that epigenetic epidemiology is not yet well matched to experimental, nonhuman models in uncovering the biological embedding of stress.

Relationship between Gene Body DNA Methylation and Intragenic H3K9me3 and H3K36me3 Chromatin Marks

OpenAIRE

Hahn, Maria A.; Wu, Xiwei; Li, Arthur X.; Hahn, Torsten; Pfeifer, Gerd P.

2011-01-01

To elucidate the relationship between intragenic DNA methylation and chromatin marks, we performed epigenetic profiling of chromosome 19 in human bronchial epithelial cells (HBEC) and in the colorectal cancer cell line HCT116 as well as its counterpart with double knockout of DNMT1 and DNMT3B (HCT116-DKO). Analysis of H3K36me3 profiles indicated that this intragenic mark of active genes is associated with two categories of genes: (i) genes with low CpG density and H3K9me3 in the gene body or ...

DNA methylation

DEFF Research Database (Denmark)

Williams, Kristine; Christensen, Jesper; Helin, Kristian

2012-01-01

DNA methylation is involved in key cellular processes, including X-chromosome inactivation, imprinting and transcriptional silencing of specific genes and repetitive elements. DNA methylation patterns are frequently perturbed in human diseases such as imprinting disorders and cancer. The recent...... discovery that the three members of the TET protein family can convert 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) has provided a potential mechanism leading to DNA demethylation. Moreover, the demonstration that TET2 is frequently mutated in haematopoietic tumours suggests that the TET...... proteins are important regulators of cellular identity. Here, we review the current knowledge regarding the function of the TET proteins, and discuss various mechanisms by which they contribute to transcriptional control. We propose that the TET proteins have an important role in regulating DNA methylation...

DNA damage, homology-directed repair, and DNA methylation.

Directory of Open Access Journals (Sweden)

Concetta Cuozzo

2007-07-01

Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.

Usability of human Infinium MethylationEPIC BeadChip for mouse DNA methylation studies.

Science.gov (United States)

Needhamsen, Maria; Ewing, Ewoud; Lund, Harald; Gomez-Cabrero, David; Harris, Robert Adam; Kular, Lara; Jagodic, Maja

2017-11-15

The advent of array-based genome-wide DNA methylation methods has enabled quantitative measurement of single CpG methylation status at relatively low cost and sample input. Whereas the use of Infinium Human Methylation BeadChips has shown great utility in clinical studies, no equivalent tool is available for rodent animal samples. We examined the feasibility of using the new Infinium MethylationEPIC BeadChip for studying DNA methylation in mouse. In silico, we identified 19,420 EPIC probes (referred as mEPIC probes), which align with a unique best alignment score to the bisulfite converted reference mouse genome mm10. Further annotation revealed that 85% of mEPIC probes overlapped with mm10.refSeq genes at different genomic features including promoters (TSS1500 and TSS200), 1st exons, 5'UTRs, 3'UTRs, CpG islands, shores, shelves, open seas and FANTOM5 enhancers. Hybridization of mouse samples to Infinium Human MethylationEPIC BeadChips showed successful measurement of mEPIC probes and reproducibility between inter-array biological replicates. Finally, we demonstrated the utility of mEPIC probes for data exploration such as hierarchical clustering. Given the absence of cost and labor convenient genome-wide technologies in the murine system, our findings show that the Infinium MethylationEPIC BeadChip platform is suitable for investigation of the mouse methylome. Furthermore, we provide the "mEPICmanifest" with genomic features, available to users of Infinium Human MethylationEPIC arrays for mouse samples.

Dicty_cDB: SLC403 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL

Neighborhood characteristics influence DNA methylation of genes involved in stress response and inflammation: The Multi-Ethnic Study of Atherosclerosis.

Science.gov (United States)

Smith, Jennifer A; Zhao, Wei; Wang, Xu; Ratliff, Scott M; Mukherjee, Bhramar; Kardia, Sharon L R; Liu, Yongmei; Roux, Ava V Diez; Needham, Belinda L

2017-08-01

Living in a disadvantaged neighborhood is associated with poor health outcomes even after accounting for individual-level socioeconomic factors. The chronic stress of unfavorable neighborhood conditions may lead to dysregulation of the stress reactivity and inflammatory pathways, potentially mediated through epigenetic mechanisms such as DNA methylation. We used multi-level models to examine the relationship between 2 neighborhood conditions and methylation levels of 18 genes related to stress reactivity and inflammation in purified monocytes from 1,226 participants of the Multi-Ethnic Study of Atherosclerosis (MESA), a population-based sample of US adults. Neighborhood socioeconomic disadvantage, a summary of 16 census-based metrics, was associated with DNA methylation [False discovery rate (FDR) q-value ≤ 0.1] in 2 out of 7 stress-related genes evaluated (CRF, SLC6A4) and 2 out of 11 inflammation-related genes (F8, TLR1). Neighborhood social environment, a summary measure of aesthetic quality, safety, and social cohesion, was associated with methylation in 4 of the 7 stress-related genes (AVP, BDNF, FKBP5, SLC6A4) and 7 of the 11 inflammation-related genes (CCL1, CD1D, F8, KLRG1, NLRP12, SLAMF7, TLR1). High socioeconomic disadvantage and worse social environment were primarily associated with increased methylation. In 5 genes with significant associations between neighborhood and methylation (FKBP5, CD1D, F8, KLRG1, NLRP12), methylation was associated with gene expression of at least one transcript. These results demonstrate that multiple dimensions of neighborhood context may influence methylation levels and subsequent gene expression of stress- and inflammation-related genes, even after accounting for individual socioeconomic factors. Further elucidating the molecular mechanisms underlying these relationships will be important for understanding the etiology of health disparities.

Global DNA methylation analysis using methyl-sensitive amplification polymorphism (MSAP).

Science.gov (United States)

Yaish, Mahmoud W; Peng, Mingsheng; Rothstein, Steven J

2014-01-01

DNA methylation is a crucial epigenetic process which helps control gene transcription activity in eukaryotes. Information regarding the methylation status of a regulatory sequence of a particular gene provides important knowledge of this transcriptional control. DNA methylation can be detected using several methods, including sodium bisulfite sequencing and restriction digestion using methylation-sensitive endonucleases. Methyl-Sensitive Amplification Polymorphism (MSAP) is a technique used to study the global DNA methylation status of an organism and hence to distinguish between two individuals based on the DNA methylation status determined by the differential digestion pattern. Therefore, this technique is a useful method for DNA methylation mapping and positional cloning of differentially methylated genes. In this technique, genomic DNA is first digested with a methylation-sensitive restriction enzyme such as HpaII, and then the DNA fragments are ligated to adaptors in order to facilitate their amplification. Digestion using a methylation-insensitive isoschizomer of HpaII, MspI is used in a parallel digestion reaction as a loading control in the experiment. Subsequently, these fragments are selectively amplified by fluorescently labeled primers. PCR products from different individuals are compared, and once an interesting polymorphic locus is recognized, the desired DNA fragment can be isolated from a denaturing polyacrylamide gel, sequenced and identified based on DNA sequence similarity to other sequences available in the database. We will use analysis of met1, ddm1, and atmbd9 mutants and wild-type plants treated with a cytidine analogue, 5-azaC, or zebularine to demonstrate how to assess the genetic modulation of DNA methylation in Arabidopsis. It should be noted that despite the fact that MSAP is a reliable technique used to fish for polymorphic methylated loci, its power is limited to the restriction recognition sites of the enzymes used in the genomic

Dicty_cDB: SLC437 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC437 (Link to dictyBase) - - - Contig-U16397-1 SLC437Z (Link... to Original site) - - SLC437Z 622 - - - - Show SLC437 Library SL (Link to library) Clone ID SLC437 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC437Q.Seq.d/ Representative seq. ID SLC43...7Z (Link to Original site) Representative DNA sequence >SLC437 (SLC437Q) /CSM/SL/SLC4-B/SLC437Q.Seq.d/ XXXXX...scoideum slug cDNA, clone SLC437. 1158 0.0 1 ( AU033994 ) Dictyostelium discoideum slug cDNA, clone SLB708.

Epigenetic Variation in Monozygotic Twins: A Genome-Wide Analysis of DNA Methylation in Buccal Cells

Directory of Open Access Journals (Sweden)

Jenny van Dongen

2014-05-01

Full Text Available DNA methylation is one of the most extensively studied epigenetic marks in humans. Yet, it is largely unknown what causes variation in DNA methylation between individuals. The comparison of DNA methylation profiles of monozygotic (MZ twins offers a unique experimental design to examine the extent to which such variation is related to individual-specific environmental influences and stochastic events or to familial factors (DNA sequence and shared environment. We measured genome-wide DNA methylation in buccal samples from ten MZ pairs (age 8–19 using the Illumina 450k array and examined twin correlations for methylation level at 420,921 CpGs after QC. After selecting CpGs showing the most variation in the methylation level between subjects, the mean genome-wide correlation (rho was 0.54. The correlation was higher, on average, for CpGs within CpG islands (CGIs, compared to CGI shores, shelves and non-CGI regions, particularly at hypomethylated CpGs. This finding suggests that individual-specific environmental and stochastic influences account for more variation in DNA methylation in CpG-poor regions. Our findings also indicate that it is worthwhile to examine heritable and shared environmental influences on buccal DNA methylation in larger studies that also include dizygotic twins.

Evolution of DNA Methylation across Insects.

Science.gov (United States)

Bewick, Adam J; Vogel, Kevin J; Moore, Allen J; Schmitz, Robert J

2017-03-01

DNA methylation contributes to gene and transcriptional regulation in eukaryotes, and therefore has been hypothesized to facilitate the evolution of plastic traits such as sociality in insects. However, DNA methylation is sparsely studied in insects. Therefore, we documented patterns of DNA methylation across a wide diversity of insects. We predicted that underlying enzymatic machinery is concordant with patterns of DNA methylation. Finally, given the suggestion that DNA methylation facilitated social evolution in Hymenoptera, we tested the hypothesis that the DNA methylation system will be associated with presence/absence of sociality among other insect orders. We found DNA methylation to be widespread, detected in all orders examined except Diptera (flies). Whole genome bisulfite sequencing showed that orders differed in levels of DNA methylation. Hymenopteran (ants, bees, wasps and sawflies) had some of the lowest levels, including several potential losses. Blattodea (cockroaches and termites) show all possible patterns, including a potential loss of DNA methylation in a eusocial species whereas solitary species had the highest levels. Species with DNA methylation do not always possess the typical enzymatic machinery. We identified a gene duplication event in the maintenance DNA methyltransferase 1 (DNMT1) that is shared by some Hymenoptera, and paralogs have experienced divergent, nonneutral evolution. This diversity and nonneutral evolution of underlying machinery suggests alternative DNA methylation pathways may exist. Phylogenetically corrected comparisons revealed no evidence that supports evolutionary association between sociality and DNA methylation. Future functional studies will be required to advance our understanding of DNA methylation in insects. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Radiation effects on DNA methylation in mice

International Nuclear Information System (INIS)

Komura, J.; Kurishita, A.; Miyamura, Y.; Ono, T.; Tawa, R.; Sakurai, H.

1992-01-01

Effects of ionizing radiation on DNA methylation in liver, brain and spleen were examined by high performance liquid chromatography (HPLC). The total methylated cytosine level in the genome was reduced within 8 hours after 3.8 Gy of irradiation in liver of adult mice. But no appreciable effect was observed in brain and spleen. When mice were irradiated at newborn, liver DNA revealed no change in methylated cytosine level. Even though slight effects of radiation were detected in he methylation of the c-myc and c-fos genes, they were only temporary and no long-term effects were observed. These data suggest that the effect of radiation on DNA methylation in vivo is not prevailing a DNA damage, but rather influenced much through biological parameters. (author)

Dicty_cDB: SLC494 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC494 (Link to dictyBase) - - - Contig-U16260-1 SLC494Z (Link... to Original site) - - SLC494Z 451 - - - - Show SLC494 Library SL (Link to library) Clone ID SLC494 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC494Q.Seq.d/ Representative seq. ID SLC49...4Z (Link to Original site) Representative DNA sequence >SLC494 (SLC494Q) /CSM/SL/SLC4-D/SLC494Q.Seq.d/ XXXXX...a: 0.00 m3b: 0.00 m_ : 1.00 52.0 %: cytoplasmic 36.0 %: nuclear 8.0 %: cytoskeletal 4.0 %: mitochondrial >> prediction for SLC4

DNA methylation and memory formation.

Science.gov (United States)

Day, Jeremy J; Sweatt, J David

2010-11-01

Memory formation and storage require long-lasting changes in memory-related neuronal circuits. Recent evidence indicates that DNA methylation may serve as a contributing mechanism in memory formation and storage. These emerging findings suggest a role for an epigenetic mechanism in learning and long-term memory maintenance and raise apparent conundrums and questions. For example, it is unclear how DNA methylation might be reversed during the formation of a memory, how changes in DNA methylation alter neuronal function to promote memory formation, and how DNA methylation patterns differ between neuronal structures to enable both consolidation and storage of memories. Here we evaluate the existing evidence supporting a role for DNA methylation in memory, discuss how DNA methylation may affect genetic and neuronal function to contribute to behavior, propose several future directions for the emerging subfield of neuroepigenetics, and begin to address some of the broader implications of this work.

DNA methylation in metabolic disorders

DEFF Research Database (Denmark)

Barres, Romain; Zierath, Juleen R

2011-01-01

DNA methylation is a major epigenetic modification that controls gene expression in physiologic and pathologic states. Metabolic diseases such as diabetes and obesity are associated with profound alterations in gene expression that are caused by genetic and environmental factors. Recent reports...... have provided evidence that environmental factors at all ages could modify DNA methylation in somatic tissues, which suggests that DNA methylation is a more dynamic process than previously appreciated. Because of the importance of lifestyle factors in metabolic disorders, DNA methylation provides...... a mechanism by which environmental factors, including diet and exercise, can modify genetic predisposition to disease. This article considers the current evidence that defines a role for DNA methylation in metabolic disorders....

Dicty_cDB: SLC483 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC483 (Link to dictyBase) - - - Contig-U16486-1 SLC483F (Link to Original site) SLC4...83F 718 - - - - - - Show SLC483 Library SL (Link to library) Clone ID SLC483 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC483Q.Seq.d/ Representative seq. ID SLC48...3F (Link to Original site) Representative DNA sequence >SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ AAAAA...roducing significant alignments: (bits) Value SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ 1423 0.0 SLE651

Dicty_cDB: SLC413 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4

Dicty_cDB: SLC404 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4

DNA methylation in human fibroblasts following DNA damage and repair

International Nuclear Information System (INIS)

Kastan, M.B.

1984-01-01

Methylation of deoxycytidine (dCyd) incorporated by DNA excision repair synthesis in human diploid fibroblasts following damage with ultraviolet radiation (UV), N-methyl-N-nitrosourea, or N-acetoxy-2-acetylaminofluorene was studied utilizing [6- 3 H]dCyd to label repaired DNA specifically and high performance liquid chromatographic analysis to quantify the percentage of deoxycytidine converted to 5-methyldeoxycytidine (m 5 dCyd). In confluent, nondividing cells, methylation in repair patches induced by all three agents is slow and incomplete. Whereas after DNA replication a level of 3.4% m 5 dCyd is reached in less than 2 hours, following UV-stimulated repair synthesis in confluent cells it takes about 3 days to reach a level of approx.2.0% m 5 dCyd in the repair patch. This undermethylation of repair patches occurs throughout the genome. In cells from cultures in logarithmic-phase growth, m 5 dCyd formation in UV-induced repair patches occurs faster and to a greater extent, reaching a level of approx.2.7% in 10-20 hours. Pre-existing hypomethylated repair patches in confluent cells are methylated further when the cells are stimulated to divide; however, the repair patch may still not be fully methylated before cell division occurs. Thus DNA damage and repair may lead to heritable loss of methylation at some sites. The distribution within chromatin of m 5 dCyd in repair patches was also investigated. Over a wide range of extents of digestion by staphylococcal nuclease or deoxyribonuclease I, the level of hypomethylation in repaired DNA in nuclease sensitive and resistant regions of chromatin was constant relative to the genomic level of methylation in these regions. Similar conclusions were reached in experiments with isolated mononucleosomes

Dicty_cDB: SLC415 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4

Cord blood buffy coat DNA methylation is comparable to whole cord blood methylation.

Science.gov (United States)

Dou, John; Schmidt, Rebecca J; Benke, Kelly S; Newschaffer, Craig; Hertz-Picciotto, Irva; Croen, Lisa A; Iosif, Ana-Maria; LaSalle, Janine M; Fallin, M Daniele; Bakulski, Kelly M

2018-01-01

Cord blood DNA methylation is associated with numerous health outcomes and environmental exposures. Whole cord blood DNA reflects all nucleated blood cell types, while centrifuging whole blood separates red blood cells, generating a white blood cell buffy coat. Both sample types are used in DNA methylation studies. Cell types have unique methylation patterns and processing can impact cell distributions, which may influence comparability. We evaluated differences in cell composition and DNA methylation between cord blood buffy coat and whole cord blood samples. Cord blood DNA methylation was measured with the Infinium EPIC BeadChip (Illumina) in eight individuals, each contributing buffy coat and whole blood samples. We analyzed principal components (PC) of methylation, performed hierarchical clustering, and computed correlations of mean-centered methylation between pairs. We conducted moderated t-tests on single sites and estimated cell composition. DNA methylation PCs were associated with individual (P PC1 = 1.4 × 10 -9 ; P PC2 = 2.9 × 10 -5 ; P PC3 = 3.8 × 10 -5 ; P PC4 = 4.2 × 10 -6 ; P PC5 = 9.9 × 10 -13 , P PC6 = 1.3 × 10 -11 ) and not with sample type (P PC1-6 >0.7). Samples hierarchically clustered by individual. Pearson correlations of mean-centered methylation between paired samples ranged from r = 0.66 to r = 0.87. No individual site significantly differed between buffy coat and whole cord blood when adjusting for multiple comparisons (five sites had unadjusted Pcoat and whole cord blood are much lower than inter-individual variation, demonstrating that both sample preparation types can be analytically combined and compared.

Dicty_cDB: SLC407 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4

Dicty_cDB: SLC480 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC480 (Link to dictyBase) - - - Contig-U13538-1 SLC480Z (Link... to Original site) - - SLC480Z 455 - - - - Show SLC480 Library SL (Link to library) Clone ID SLC480 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC480Q.Seq.d/ Representative seq. ID SLC48...0Z (Link to Original site) Representative DNA sequence >SLC480 (SLC480Q) /CSM/SL/SLC4-D/SLC480Q.Seq.d/ XXXXX...ial 8.0 %: peroxisomal >> prediction for SLC480 is nuc 5' end seq. ID - 5' end seq. - Length of 5' end seq. - 3' end seq. ID SLC4

Reduced DNA methylation at the PEG3 DMR and KvDMR1 loci in children exposed to alcohol in utero: A South African Fetal Alcohol Syndrome cohort study

Directory of Open Access Journals (Sweden)

Michele eRamsay

2015-03-01

Full Text Available Fetal alcohol syndrome (FAS is a devastating developmental disorder resulting from alcohol exposure during fetal development. It is a considerable public health problem worldwide and is characterised by central nervous system abnormalities, dysmorphic facial features and growth retardation. Imprinted genes are known to play an important role in growth and development and therefore four imprinting control regions (ICRs, H19 ICR, IG-DMR, CvDMR1 and PEG3 DMR were examined. It is proposed that DNA methylation changes may contribute to developmental abnormalities seen in FAS and which persist into adulthood. The participants included FAS children and controls from the Western and Northern Cape Provinces. DNA samples extracted from blood and buccal cells were bisulfite modified, the ICRs were amplified by PCR and pyrosequencing was used to derive a quantitative estimate of methylation at selected CpG dinucleotides: H19 ICR (6 CpG sites; 50 controls and 73 cases; KvDMR1 (7; 55 and 86; IG-DMR (10; 56 and 84; and PEG3 DMR (7; 50 and 79. The most profound effects of alcohol exposure are on neuronal development. In this study we report on epigenetic effects observed in blood which may not directly reflect tissue-specific alterations in the developing brain. After adjusting for age and sex (known confounders for DNA methylation, there was a significant difference at KvDMR1 and PEG, but not the H19 ICR, with only a small effect (0.84% lower in cases; p=0.035 at IG-DMR. The two maternally imprinted loci, KvDMR1 and PEG3 DMR, showed lower average locus-wide methylation in the FAS cases (1.49%; p<0.001 and 7.09%; p<0.001, respectively. The largest effect was at the PEG3 DMR though the functional impact is uncertain. This study supports the role of epigenetic modulation as a mechanism for the teratogenic effects of alcohol by altering the methylation profiles of imprinted loci in a locus-specific manner.

Dicty_cDB: SLC487 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4

High frequency of the IVS2-2A>G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss

Directory of Open Access Journals (Sweden)

Pereira Fred A

2005-08-01

Full Text Available Abstract Background Cochlear outer hair cells change their length in response to variations in membrane potential. This capability, called electromotility, is believed to enable the sensitivity and frequency selectivity of the mammalian cochlea. Prestin is a transmembrane protein required for electromotility. Homozygous prestin knockout mice are profoundly hearing impaired. In humans, a single nucleotide change in SLC26A5, encoding prestin, has been reported in association with hearing loss. This DNA sequence variation, IVS2-2A>G, occurs in the exon 3 splice acceptor site and is expected to abolish splicing of exon 3. Methods To further explore the relationship between hearing loss and the IVS2-2A>G transition, and assess allele frequency, genomic DNA from hearing impaired and control subjects was analyzed by DNA sequencing. SLC26A5 genomic DNA sequences from human, chimp, rat, mouse, zebrafish and fruit fly were aligned and compared for evolutionary conservation of the exon 3 splice acceptor site. Alternative splice acceptor sites within intron 2 of human SLC26A5 were sought using a splice site prediction program from the Berkeley Drosophila Genome Project. Results The IVS2-2A>G variant was found in a heterozygous state in 4 of 74 hearing impaired subjects of Hispanic, Caucasian or uncertain ethnicity and 4 of 150 Hispanic or Caucasian controls (p = 0.45. The IVS2-2A>G variant was not found in 106 subjects of Asian or African American descent. No homozygous subjects were identified (n = 330. Sequence alignment of SLC26A5 orthologs demonstrated that the A nucleotide at position IVS2-2 is invariant among several eukaryotic species. Sequence analysis also revealed five potential alternative splice acceptor sites in intron 2 of human SLC26A5. Conclusion These data suggest that the IVS2-2A>G variant may not occur more frequently in hearing impaired subjects than in controls. The identification of five potential alternative splice acceptor sites in

Links between DNA methylation and nucleosome occupancy in the human genome.

Science.gov (United States)

Collings, Clayton K; Anderson, John N

2017-01-01

DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.

A DNA methylation microarray-based study identifies ERG as a gene commonly methylated in prostate cancer.

Science.gov (United States)

Schwartzman, Jacob; Mongoue-Tchokote, Solange; Gibbs, Angela; Gao, Lina; Corless, Christopher L; Jin, Jennifer; Zarour, Luai; Higano, Celestia; True, Lawrence D; Vessella, Robert L; Wilmot, Beth; Bottomly, Daniel; McWeeney, Shannon K; Bova, G Steven; Partin, Alan W; Mori, Motomi; Alumkal, Joshi

2011-10-01

DNA methylation of promoter regions is a common event in prostate cancer, one of the most common cancers in men worldwide. Because prior reports demonstrating that DNA methylation is important in prostate cancer studied a limited number of genes, we systematically quantified the DNA methylation status of 1505 CpG dinucleotides for 807 genes in 78 paraffin-embedded prostate cancer samples and three normal prostate samples. The ERG gene, commonly repressed in prostate cells in the absence of an oncogenic fusion to the TMPRSS2 gene, was one of the most commonly methylated genes, occurring in 74% of prostate cancer specimens. In an independent group of patient samples, we confirmed that ERG DNA methylation was common, occurring in 57% of specimens, and cancer-specific. The ERG promoter is marked by repressive chromatin marks mediated by polycomb proteins in both normal prostate cells and prostate cancer cells, which may explain ERG's predisposition to DNA methylation and the fact that tumors with ERG DNA methylation were more methylated, in general. These results demonstrate that bead arrays offer a high-throughput method to discover novel genes with promoter DNA methylation such as ERG, whose measurement may improve our ability to more accurately detect prostate cancer.

DNA methylation changes at infertility genes in newborn twins conceived by in vitro fertilisation.

Science.gov (United States)

Castillo-Fernandez, Juan E; Loke, Yuk Jing; Bass-Stringer, Sebastian; Gao, Fei; Xia, Yudong; Wu, Honglong; Lu, Hanlin; Liu, Yuan; Wang, Jun; Spector, Tim D; Saffery, Richard; Craig, Jeffrey M; Bell, Jordana T

2017-03-24

The association of in vitro fertilisation (IVF) and DNA methylation has been studied predominantly at regulatory regions of imprinted genes and at just thousands of the ~28 million CpG sites in the human genome. We investigated the links between IVF and DNA methylation patterns in whole cord blood cells (n = 98) and cord blood mononuclear cells (n = 82) from newborn twins using genome-wide methylated DNA immunoprecipitation coupled with deep sequencing. At a false discovery rate (FDR) of 5%, we identified one significant whole blood DNA methylation change linked to conception via IVF, which was located ~3 kb upstream of TNP1, a gene previously linked to male infertility. The 46 most strongly associated signals (FDR of 25%) included a second region in a gene also previously linked to infertility, C9orf3, suggesting that our findings may in part capture the effect of parental subfertility. Using twin modelling, we observed that individual-specific environmental factors appear to be the main overall contributors of methylation variability at the FDR 25% IVF-associated differentially methylated regions, although evidence for methylation heritability was also obtained at several of these regions. We replicated previous findings of differential methylation associated with IVF at the H19/IGF2 region in cord blood mononuclear cells, and we validated the signal at C9orf3 in monozygotic twins. We also explored the impact of intracytoplasmic sperm injection on the FDR 25% signals for potential effects specific to male or female infertility factors. To our knowledge, this is the most comprehensive study of DNA methylation profiles at birth and IVF conception to date, and our results show evidence for epigenetic modifications that may in part reflect parental subfertility.

Dicty_cDB: SLC443 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4

Maternal Stress, Preterm Birth, and DNA Methylation at Imprint Regulatory Sequences in Humans

Directory of Open Access Journals (Sweden)

Adriana C. Vidal

2014-01-01

Full Text Available In infants exposed to maternal stress in utero, phenotypic plasticity through epigenetic events may mechanistically explain increased risk of preterm birth (PTB, which confers increased risk for neurodevelopmental disorders, cardiovascular disease, and cancers in adulthood. We examined associations between prenatal maternal stress and PTB, evaluating the role of DNA methylation at imprint regulatory regions. We enrolled women from prenatal clinics in Durham, NC. Stress was measured in 537 women at 12 weeks of gestation using the Perceived Stress Scale. DNA methylation at differentially methylated regions (DMRs associated with H19, IGF2, MEG3, MEST, SGCE/PEG10, PEG3, NNAT , and PLAGL1 was measured from peripheral and cord blood using bisulfite pyrosequencing in a sub-sample of 79 mother–-infant pairs. We examined associations between PTB and stress and evaluated differences in DNA methylation at each DMR by stress. Maternal stress was not associated with PTB (OR = 0.98; 95% CI, 0.40–-2.40; P = 0.96, after adjustment for maternal body mass index (BMI, income, and raised blood pressure. However, elevated stress was associated with higher infant DNA methylation at the MEST DMR (2.8% difference, P < 0.01 after adjusting for PTB. Maternal stress may be associated with epigenetic changes at MEST , a gene relevant to maternal care and obesity. Reduced prenatal stress may support the epigenomic profile of a healthy infant.

Aberrant DNA methylation in 5'regions of DNA methyltransferase genes in aborted bovine clones

Institute of Scientific and Technical Information of China (English)

2008-01-01

High rate of abortion and developmental abnormalities is thought to be closely associated with inefficient epigenetic reprogramming of the transplanted nuclei during bovine cloning.It is known that one of the important mechanisms for epigenetic reprogramming is DNA methylation.DNA methylation is established and maintained by DNA methyltransferases(DNMTs),therefore,it is postulated that the inefficient epigenetic reprogramming of transplanted nuclei may be due to abnormal expression of DNMTs.Since DNA methylation can strongly inhibit gene expression,aberrant DNA methylation of DNMT genes may disturb gene expression.But presently,it is not clear whether the methylation abnormality of DNMT genes is related to developmental failure of somatic cell nuclear transfer embryos.In our study,we analyzed methylation patterns of the 5' regions of four DNMT genes including Dnmt3a,Dnmt3b,Dnmtl and Dnmt2 in four aborted bovine clones.Using bisulfite sequencing method,we found that 3 out of 4 aborted bovine clones(AF1,AF2 and AF3)showed either hypermethylation or hypomethylation in the 5' regions of Dnmt3a and Dnmt3b.indicating that Dnmt3a and Dnmt3b genes are not properly reprogrammed.However,the individual AF4 exhibited similar methylation level and pattern to age-matched in vitro fertilized (IVF)fetuses.Besides,we found that tle 5'regions of Dnmtl and Dnmt2 were nearly completely unmethylated in all normal adults.IVF fetuses,sperm and aborted clones.Together,our results suggest that the aberrant methylation of Dnmt3a and Dnmt3b 5' regions is probably associated with the high abortion of bovine clones.

Dicty_cDB: SLC431 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4

Dicty_cDB: SLC464 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4

Dicty_cDB: SLC477 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4

Dicty_cDB: SLC434 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4

Dicty_cDB: SLC469 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC469 (Link to dictyBase) - - - Contig-U16584-1 SLC469P (Link to Original site) SLC4...69F 676 SLC469Z 397 SLC469P 1073 - - Show SLC469 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC469Q.Seq.d/ Representative seq. ID SLC4...69P (Link to Original site) Representative DNA sequence >SLC469 (SLC469Q) /CSM/SL/SLC4-C/SLC4...sfflc sklvvik*ncynyp Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC469 (SLC4

Dicty_cDB: SLC452 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC452 (Link to dictyBase) - - - Contig-U08358-1 SLC452E (Link to Original site) SLC4...52F 537 SLC452Z 347 SLC452P 884 SLC452E 537 Show SLC452 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC452Q.Seq.d/ Representative seq. ID SLC4...52E (Link to Original site) Representative DNA sequence >SLC452 (SLC452Q) /CSM/SL/SLC4-C/SLC4...slvtpplffq*skk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC4

Detection of DNA methylation changes in micropropagated banana plants using methylation-sensitive amplification polymorphism (MSAP).

Science.gov (United States)

Peraza-Echeverria, S; Herrera-Valencia, V A.; Kay, A -J.

2001-07-01

The extent of DNA methylation polymorphisms was evaluated in micropropagated banana (Musa AAA cv. 'Grand Naine') derived from either the vegetative apex of the sucker or the floral apex of the male inflorescence using the methylation-sensitive amplification polymorphism (MSAP) technique. In all, 465 fragments, each representing a recognition site cleaved by either or both of the isoschizomers were amplified using eight combinations of primers. A total of 107 sites (23%) were found to be methylated at cytosine in the genome of micropropagated banana plants. In plants micropropagated from the male inflorescence explant 14 (3%) DNA methylation events were polymorphic, while plants micropropagated from the sucker explant produced 8 (1.7%) polymorphisms. No DNA methylation polymorphisms were detected in conventionally propagated banana plants. These results demonstrated the usefulness of MSAP to detect DNA methylation events in micropropagated banana plants and indicate that DNA methylation polymorphisms are associated with micropropagation.

Dicty_cDB: SLC466 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC466 (Link to dictyBase) - - - Contig-U16381-1 SLC466Z (Link... to Original site) - - SLC466Z 427 - - - - Show SLC466 Library SL (Link to library) Clone ID SLC466 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC466Q.Seq.d/ Representative seq. ID SLC46...6Z (Link to Original site) Representative DNA sequence >SLC466 (SLC466Q) /CSM/SL/SLC4-C/SLC466Q.Seq.d/ XXXXX... AU034556 ) Dictyostelium discoideum slug cDNA, clone SLC466. 176 2e-77 2 ( AU033496 ) Dictyostelium discoid

Dicty_cDB: SLC461 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC461 (Link to dictyBase) - - - Contig-U16382-1 SLC461Z (Link... to Original site) - - SLC461Z 386 - - - - Show SLC461 Library SL (Link to library) Clone ID SLC461 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC461Q.Seq.d/ Representative seq. ID SLC46...1Z (Link to Original site) Representative DNA sequence >SLC461 (SLC461Q) /CSM/SL/SLC4-C/SLC461Q.Seq.d/ XXXXX...e-155 2 ( AU034553 ) Dictyostelium discoideum slug cDNA, clone SLC461. 531 e-155 2 ( AU052473 ) Dictyosteliu

DNA methylation analysis in rat kidney epithelial cells exposed to 3-MCPD and glycidol.

Science.gov (United States)

Senyildiz, Mine; Alpertunga, Buket; Ozden, Sibel

2017-10-01

3-Monochloropropane-1,2-diol (3-MCPD) is a well-known food processing contaminant that has been regarded as a rat carcinogen, which is known to induce Leydig-cell and mammary gland tumors in males, as well as kidney tumors in both genders. 3-MCPD is highly suspected to be a non-genotoxic carcinogen. 2,3-Epoxy-1-propanol (glycidol) can be formed via dehalogenation from 3-MCPD. We aimed to investigate the cytotoxic effects of 3-MCPD and glycidol, then to demonstrate the possible epigenetic mechanisms with global and gene-specific DNA methylation in rat kidney epithelial cells (NRK-52E). IC 50 value of 3-MCPD was determined as 48 mM and 41.39 mM, whereas IC 50 value of glycidol was 1.67 mM and 1.13 mM by MTT and NRU test, respectively. Decreased global DNA methylation at the concentrations of 100 μM and 1000 μM for 3-MCPD and 100 μM and 500 μM for glycidol were observed after 48 h exposure by using 5-methylcytosine (5-mC) ELISA kit. Methylation changes were detected in promoter regions of c-myc and Rassf1a in 3-MCPD and glycidol treated NRK-52E cells by using methylation-specific PCR (MSP), whereas changes on gene expression of c-myc and Rassf1a were observed by using real-time PCR. However, e-cadherin, p16, VHL and p15 genes were unmethylated in their CpG promoter regions in response to treatment with 3-MCPD and glycidol. Alterations in DNA methylation might be key events in the toxicity of 3-MCPD and glycidol.

Dietary and supplemental maternal methyl-group donor intake and cord blood DNA methylation.

Science.gov (United States)

Pauwels, Sara; Ghosh, Manosij; Duca, Radu Corneliu; Bekaert, Bram; Freson, Kathleen; Huybrechts, Inge; A S Langie, Sabine; Koppen, Gudrun; Devlieger, Roland; Godderis, Lode

2017-01-02

Maternal nutrition is critically involved in the development and health of the fetus. We evaluated maternal methyl-group donor intake through diet (methionine, betaine, choline, folate) and supplementation (folic acid) before and during pregnancy in relation to global DNA methylation and hydroxymethylation and gene specific (IGF2 DMR, DNMT1, LEP, RXRA) cord blood methylation. A total of 115 mother-infant pairs were enrolled in the MAternal Nutrition and Offspring's Epigenome (MANOE) study. The intake of methyl-group donors was assessed using a food-frequency questionnaire. LC-MS/MS and pyrosequencing were used to measure global and gene specific methylation, respectively. Dietary intake of methyl-groups before and during pregnancy was associated with changes in LEP, DNMT1, and RXRA cord blood methylation. Statistically significant higher cord blood LEP methylation was observed when mothers started folic acid supplementation more than 6 months before conception compared with 3-6 months before conception (34.6 ± 6.3% vs. 30.1 ± 3.6%, P = 0.011, LEP CpG1) or no folic acid used before conception (16.2 ± 4.4% vs. 13.9 ± 3%, P = 0.036 for LEP CpG3 and 24.5 ± 3.5% vs. 22.2 ± 3.5%, P = 0.045 for LEP mean CpG). Taking folic acid supplements during the entire pregnancy resulted in statistically significantly higher cord blood RXRA methylation as compared with stopping supplementation in the second trimester (12.3 ± 1.9% vs. 11.1 ± 2%, P = 0.008 for RXRA mean CpG). To conclude, long-term folic acid use before and during pregnancy was associated with higher LEP and RXRA cord blood methylation, respectively. To date, pregnant women are advised to take a folic acid supplement of 400 µg/day from 4 weeks before until 12 weeks of pregnancy. Our results suggest significant epigenetic modifications when taking a folic acid supplement beyond the current advice.

DNA methylation requires a DNMT1 ubiquitin interacting motif (UIM) and histone ubiquitination.

Science.gov (United States)

Qin, Weihua; Wolf, Patricia; Liu, Nan; Link, Stephanie; Smets, Martha; La Mastra, Federica; Forné, Ignasi; Pichler, Garwin; Hörl, David; Fellinger, Karin; Spada, Fabio; Bonapace, Ian Marc; Imhof, Axel; Harz, Hartmann; Leonhardt, Heinrich

2015-08-01

DNMT1 is recruited by PCNA and UHRF1 to maintain DNA methylation after replication. UHRF1 recognizes hemimethylated DNA substrates via the SRA domain, but also repressive H3K9me3 histone marks with its TTD. With systematic mutagenesis and functional assays, we could show that chromatin binding further involved UHRF1 PHD binding to unmodified H3R2. These complementation assays clearly demonstrated that the ubiquitin ligase activity of the UHRF1 RING domain is required for maintenance DNA methylation. Mass spectrometry of UHRF1-deficient cells revealed H3K18 as a novel ubiquitination target of UHRF1 in mammalian cells. With bioinformatics and mutational analyses, we identified a ubiquitin interacting motif (UIM) in the N-terminal regulatory domain of DNMT1 that binds to ubiquitinated H3 tails and is essential for DNA methylation in vivo. H3 ubiquitination and subsequent DNA methylation required UHRF1 PHD binding to H3R2. These results show the manifold regulatory mechanisms controlling DNMT1 activity that require the reading and writing of epigenetic marks by UHRF1 and illustrate the multifaceted interplay between DNA and histone modifications. The identification and functional characterization of the DNMT1 UIM suggests a novel regulatory principle and we speculate that histone H2AK119 ubiquitination might also lead to UIM-dependent recruitment of DNMT1 and DNA methylation beyond classic maintenance.

∆DNMT3B4-del Contributes to Aberrant DNA Methylation Patterns in Lung Tumorigenesis

Directory of Open Access Journals (Sweden)

Mark Z. Ma

2015-10-01

Full Text Available Aberrant DNA methylation is a hallmark of cancer but mechanisms contributing to the abnormality remain elusive. We have previously shown that ∆DNMT3B is the predominantly expressed form of DNMT3B. In this study, we found that most of the lung cancer cell lines tested predominantly expressed DNMT3B isoforms without exons 21, 22 or both 21 and 22 (a region corresponding to the enzymatic domain of DNMT3B termed DNMT3B/∆DNMT3B-del. In normal bronchial epithelial cells, DNMT3B/ΔDNMT3B and DNMT3B/∆DNMT3B-del displayed equal levels of expression. In contrast, in patients with non-small cell lung cancer NSCLC, 111 (93% of the 119 tumors predominantly expressed DNMT3B/ΔDNMT3B-del, including 47 (39% tumors with no detectable DNMT3B/∆DNMT3B. Using a transgenic mouse model, we further demonstrated the biological impact of ∆DNMT3B4-del, the ∆DNMT3B-del isoform most abundantly expressed in NSCLC, in global DNA methylation patterns and lung tumorigenesis. Expression of ∆DNMT3B4-del in the mouse lungs resulted in an increased global DNA hypomethylation, focal DNA hypermethylation, epithelial hyperplastia and tumor formation when challenged with a tobacco carcinogen. Our results demonstrate ∆DNMT3B4-del as a critical factor in developing aberrant DNA methylation patterns during lung tumorigenesis and suggest that ∆DNMT3B4-del may be a target for lung cancer prevention.

Cleavage of phosphorothioated DNA and methylated DNA by the type IV restriction endonuclease ScoMcrA.

Directory of Open Access Journals (Sweden)

Guang Liu

2010-12-01

Full Text Available Many taxonomically diverse prokaryotes enzymatically modify their DNA by replacing a non-bridging oxygen with a sulfur atom at specific sequences. The biological implications of this DNA S-modification (phosphorothioation were unknown. We observed that simultaneous expression of the dndA-E gene cluster from Streptomyces lividans 66, which is responsible for the DNA S-modification, and the putative Streptomyces coelicolor A(32 Type IV methyl-dependent restriction endonuclease ScoA3McrA (Sco4631 leads to cell death in the same host. A His-tagged derivative of ScoA3McrA cleaved S-modified DNA and also Dcm-methylated DNA in vitro near the respective modification sites. Double-strand cleavage occurred 16-28 nucleotides away from the phosphorothioate links. DNase I footprinting demonstrated binding of ScoA3McrA to the Dcm methylation site, but no clear binding could be detected at the S-modified site under cleavage conditions. This is the first report of in vitro endonuclease activity of a McrA homologue and also the first demonstration of an enzyme that specifically cleaves S-modified DNA.

DNA replication origin function is promoted by H3K4 di-methylation in Saccharomyces cerevisiae.

Science.gov (United States)

Rizzardi, Lindsay F; Dorn, Elizabeth S; Strahl, Brian D; Cook, Jeanette Gowen

2012-10-01

DNA replication is a highly regulated process that is initiated from replication origins, but the elements of chromatin structure that contribute to origin activity have not been fully elucidated. To identify histone post-translational modifications important for DNA replication, we initiated a genetic screen to identify interactions between genes encoding chromatin-modifying enzymes and those encoding proteins required for origin function in the budding yeast Saccharomyces cerevisiae. We found that enzymes required for histone H3K4 methylation, both the histone methyltransferase Set1 and the E3 ubiquitin ligase Bre1, are required for robust growth of several hypomorphic replication mutants, including cdc6-1. Consistent with a role for these enzymes in DNA replication, we found that both Set1 and Bre1 are required for efficient minichromosome maintenance. These phenotypes are recapitulated in yeast strains bearing mutations in the histone substrates (H3K4 and H2BK123). Set1 functions as part of the COMPASS complex to mono-, di-, and tri-methylate H3K4. By analyzing strains lacking specific COMPASS complex members or containing H2B mutations that differentially affect H3K4 methylation states, we determined that these replication defects were due to loss of H3K4 di-methylation. Furthermore, histone H3K4 di-methylation is enriched at chromosomal origins. These data suggest that H3K4 di-methylation is necessary and sufficient for normal origin function. We propose that histone H3K4 di-methylation functions in concert with other histone post-translational modifications to support robust genome duplication.

In vivo control of CpG and non-CpG DNA methylation by DNA methyltransferases.

Directory of Open Access Journals (Sweden)

Julia Arand

2012-06-01

Full Text Available The enzymatic control of the setting and maintenance of symmetric and non-symmetric DNA methylation patterns in a particular genome context is not well understood. Here, we describe a comprehensive analysis of DNA methylation patterns generated by high resolution sequencing of hairpin-bisulfite amplicons of selected single copy genes and repetitive elements (LINE1, B1, IAP-LTR-retrotransposons, and major satellites. The analysis unambiguously identifies a substantial amount of regional incomplete methylation maintenance, i.e. hemimethylated CpG positions, with variant degrees among cell types. Moreover, non-CpG cytosine methylation is confined to ESCs and exclusively catalysed by Dnmt3a and Dnmt3b. This sequence position-, cell type-, and region-dependent non-CpG methylation is strongly linked to neighboring CpG methylation and requires the presence of Dnmt3L. The generation of a comprehensive data set of 146,000 CpG dyads was used to apply and develop parameter estimated hidden Markov models (HMM to calculate the relative contribution of DNA methyltransferases (Dnmts for de novo and maintenance DNA methylation. The comparative modelling included wild-type ESCs and mutant ESCs deficient for Dnmt1, Dnmt3a, Dnmt3b, or Dnmt3a/3b, respectively. The HMM analysis identifies a considerable de novo methylation activity for Dnmt1 at certain repetitive elements and single copy sequences. Dnmt3a and Dnmt3b contribute de novo function. However, both enzymes are also essential to maintain symmetrical CpG methylation at distinct repetitive and single copy sequences in ESCs.

Whole-genome methylation caller designed for methyl- DNA ...

African Journals Online (AJOL)

etchie

2013-02-20

Feb 20, 2013 ... Key words: Methyl-DNA immunoprecipitation, next-generation sequencing, Hidden ... its response to environmental cues. .... have a great potential to become the most cost-effective ... hg18 reference genome (set to 0 if not present in retrieved reads). ..... DNA methylation patterns and epigenetic memory.

Recognition of methylated DNA through methyl-CpG binding domain proteins

DEFF Research Database (Denmark)

Zou, Xueqing; Ma, Wen; Solov'yov, Ilia

2012-01-01

DNA methylation is a key regulatory control route in epigenetics, involving gene silencing and chromosome inactivation. It has been recognized that methyl-CpG binding domain (MBD) proteins play an important role in interpreting the genetic information encoded by methylated DNA (mDNA). Although...... the function of MBD proteins has attracted considerable attention and is well characterized, the mechanism underlying mDNA recognition by MBD proteins is still poorly understood. In this article, we demonstrate that the methyl-CpG dinucleotides are recognized at the MBD-mDNA interface by two MBD arginines...

Whole-genome methylation caller designed for methyl- DNA ...

African Journals Online (AJOL)

etchie

2013-02-20

Feb 20, 2013 ... Our method uses a single-CpG-resolution, whole-genome methylation ... Key words: Methyl-DNA immunoprecipitation, next-generation sequencing, ...... methylation is prevalent in embryonic stem cells andmaybe mediated.

miRNAting control of DNA methylation

Indian Academy of Sciences (India)

DNA methylation is a type of epigenetic modification where a methyl group is added to the cytosine or adenine residue of a given DNA sequence. It has been observed that DNA methylation is achieved by some collaborative agglomeration of certain proteins and non-coding RNAs. The assembly of IDN2 and its ...

miRNAting control of DNA methylation

Indian Academy of Sciences (India)

miRNAting control of DNA methylation. ASHWANI ... function and biological process ... Enrichment analysis of the genes methylated by DRM2 for molecular function and biological ... 39(3), June 2014, 365–380, © Indian Academy of Sciences.

Protective effects of folic acid on DNA damage and DNA methylation levels induced by N-methyl- N'-nitro- N-nitrosoguanidine in Kazakh esophageal epithelial cells.

Science.gov (United States)

Chen, Y; Feng, H; Chen, D; Abuduwaili, K; Li, X; Zhang, H

2018-01-01

The protective effects of folic acid on DNA damage and DNA methylation induced by N-methyl- N'-nitro- N-nitrosoguanidine (MNNG) in Kazakh esophageal epithelial cells were investigated using a 3 × 3 factorial design trial. The cells were cultured in vitro and exposed to media containing different concentrations of folic acid and MNNG, after which growth indices were detected. DNA damage levels were measured using comet assays, and genome-wide DNA methylation levels (MLs) were measured using high-performance liquid chromatography. The DNA methylation of methylenetetrahydrofolate reductase (MTHFR) and folate receptor- α (FR α) genes was detected by bisulfite sequencing polymerase chain reaction (PCR). The results showed significant increases in tail DNA concentration, tail length, and Olive tail moment ( p methylation frequencies of MTHFR and FR α genes. In particular, significant differences were observed in the promoter regions of both genes ( p methylation in Kazakh esophageal epithelial cells upon MNNG exposure. Thus, sufficient folic acid levels could play a protective role against the damage induced by this compound.

Survey of Differentially Methylated Promoters in Prostate Cancer Cell Lines

Directory of Open Access Journals (Sweden)

Yipeng Wang

2005-08-01

Full Text Available DNA methylation, copy number in the genomes of three immortalized prostate epithelial, five cancer cell lines (LNCaP, PC3, PC3M, PC3M-Pro4, PC3MLN4 were compared using a microarray-based technique. Genomic DNA is cut with a methylation-sensitive enzyme Hpall, followed by linker ligation, polymerase chain reaction (PCR amplification, labeling, hybridization to an array of promoter sequences. Only those parts of the genomic DNA that have unmethylated restriction sites within a few hundred base pairs generate PCR products detectable on an array. Of 2732 promoter sequences on a test array, 504 (18.5% showed differential hybridization between immortalized prostate epithelial, cancer cell lines. Among candidate hypermethylated genes in cancer-derived lines, there were eight (CD44, CDKN1A, ESR1, PLAU, RARB, SFN, TNFRSF6, TSPY previously observed in prostate cancer, 13 previously known methylation targets in other cancers (ARHI, bcl-2, BRCA1, CDKN2C, GADD45A, MTAP, PGR, SLC26A4, SPARC, SYK, TJP2, UCHL1, WIT-1. The majority of genes that appear to be both differentially methylated, differentially regulated between prostate epithelial, cancer cell lines are novel methylation targets, including PAK6, RAD50, TLX3, PIR51, MAP2K5, INSR, FBN1, GG2-1, representing a rich new source of candidate genes used to study the role of DNA methylation in prostate tumors.

MethylMix 2.0: an R package for identifying DNA methylation genes.

Science.gov (United States)

Cedoz, Pierre-Louis; Prunello, Marcos; Brennan, Kevin; Gevaert, Olivier

2018-04-14

DNA methylation is an important mechanism regulating gene transcription, and its role in carcinogenesis has been extensively studied. Hyper and hypomethylation of genes is a major mechanism of gene expression deregulation in a wide range of diseases. At the same time, high-throughput DNA methylation assays have been developed generating vast amounts of genome wide DNA methylation measurements. We developed MethylMix, an algorithm implemented in R to identify disease specific hyper and hypomethylated genes. Here we present a new version of MethylMix that automates the construction of DNA-methylation and gene expression datasets from The Cancer Genome Atlas (TCGA). More precisely, MethylMix 2.0 incorporates two major updates: the automated downloading of DNA methylation and gene expression datasets from TCGA and the automated preprocessing of such datasets: value imputation, batch correction and CpG sites clustering within each gene. The resulting datasets can subsequently be analyzed with MethylMix to identify transcriptionally predictive methylation states. We show that the Differential Methylation Values created by MethylMix can be used for cancer subtyping. olivier.gevaert@stanford.edu. https://bioconductor.org/packages/release/bioc/manuals/MethylMix/man/MethylMix.pdf. MethylMix 2.0 was implemented as an R package and is available in bioconductor.

Decreased viscosity of rat-liver DNA treated by 3'-methyl-4-dimethylaminoazobenzene, detected with a new viscometric approach.

Science.gov (United States)

Parodi, S; Balbi, C; Taningher, M; Pala, M; Russo, P; Abelmoschi, M L; Santi, L

1982-11-01

DNA damage induced in vivo by 3'-methyl-4-dimethylaminoazobenzene (3'CH3DAB) was investigated with 2 differently sensitive techniques: the alkaline elution assay and the viscometric measurement of DNA damage. 3'CH3DAB appeared to be falsely negative with the alkaline elution assay, whereas with the viscometric approach, which is about 30-50 times more sensitive, it appeared positive, and the DNA damage was dose-dependent.

Involvement of DNA methylation in memory processing in the honey bee.

Science.gov (United States)

Lockett, Gabrielle A; Helliwell, Paul; Maleszka, Ryszard

2010-08-23

DNA methylation, an important and evolutionarily conserved epigenetic mechanism, is implicated in learning and memory processes in vertebrates, but its role in behaviour in invertebrates is unknown. We examined the role of DNA methylation in memory in the honey bee using an appetitive Pavlovian olfactory discrimination task, and by assessing the expression of DNA methyltransferase3, a key driver of epigenetic reprogramming. Here we report that DNA methyltransferase inhibition reduces acquisition retention and alters the extinction depending on treatment time, and DNA methyltransferase3 is upregulated after training. Our findings add to the understanding of epigenetic mechanisms in learning and memory, extending known roles of DNA methylation to appetitive and extinction memory, and for the first time implicate DNA methylation in memory in invertebrates.

DNA methylation analysis from saliva samples for epidemiological studies.

Science.gov (United States)

Nishitani, Shota; Parets, Sasha E; Haas, Brian W; Smith, Alicia K

2018-06-18

Saliva is a non-invasive, easily accessible tissue, which is regularly collected in large epidemiological studies to examine genetic questions. Recently, it is becoming more common to use saliva to assess DNA methylation. However, DNA extracted from saliva is a mixture of both bacterial and human DNA derived from epithelial and immune cells in the mouth. Thus, there are unique challenges to using salivary DNA in methylation studies that can influence data quality. This study assesses: (1) quantification of human DNA after extraction; (2) delineation of human and bacterial DNA; (3) bisulfite conversion (BSC); (4) quantification of BSC DNA; (5) PCR amplification of BSC DNA from saliva and; (6) quantitation of DNA methylation with a targeted assay. The framework proposed will allow saliva samples to be more widely used in targeted epigenetic studies.

Global DNA methylation of ischemic stroke subtypes.

Directory of Open Access Journals (Sweden)

Carolina Soriano-Tárraga

Full Text Available Ischemic stroke (IS, a heterogeneous multifactorial disorder, is among the leading causes of mortality and long-term disability in the western world. Epidemiological data provides evidence for a genetic component to the disease, but its epigenetic involvement is still largely unknown. Epigenetic mechanisms, such as DNA methylation, change over time and may be associated with aging processes and with modulation of the risk of various pathologies, such as cardiovascular disease and stroke. We analyzed 2 independent cohorts of IS patients. Global DNA methylation was measured by luminometric methylation assay (LUMA of DNA blood samples. Univariate and multivariate regression analyses were used to assess the methylation differences between the 3 most common IS subtypes, large-artery atherosclerosis (LAA, small-artery disease (SAD, and cardio-aortic embolism (CE. A total of 485 IS patients from 2 independent hospital cohorts (n = 281 and n = 204 were included, distributed across 3 IS subtypes: LAA (78/281, 59/204, SAD (97/281, 53/204, and CE (106/281, 89/204. In univariate analyses, no statistical differences in LUMA levels were observed between the 3 etiologies in either cohort. Multivariate analysis, adjusted by age, sex, hyperlipidemia, and smoking habit, confirmed the lack of differences in methylation levels between the analyzed IS subtypes in both cohorts. Despite differences in pathogenesis, our results showed no global methylation differences between LAA, SAD, and CE subtypes of IS. Further work is required to establish whether the epigenetic mechanism of methylation might play a role in this complex disease.

DNA Methylation Biomarkers: Cancer and Beyond

Directory of Open Access Journals (Sweden)

Thomas Mikeska

2014-09-01

Full Text Available Biomarkers are naturally-occurring characteristics by which a particular pathological process or disease can be identified or monitored. They can reflect past environmental exposures, predict disease onset or course, or determine a patient’s response to therapy. Epigenetic changes are such characteristics, with most epigenetic biomarkers discovered to date based on the epigenetic mark of DNA methylation. Many tissue types are suitable for the discovery of DNA methylation biomarkers including cell-based samples such as blood and tumor material and cell-free DNA samples such as plasma. DNA methylation biomarkers with diagnostic, prognostic and predictive power are already in clinical trials or in a clinical setting for cancer. Outside cancer, strong evidence that complex disease originates in early life is opening up exciting new avenues for the detection of DNA methylation biomarkers for adverse early life environment and for estimation of future disease risk. However, there are a number of limitations to overcome before such biomarkers reach the clinic. Nevertheless, DNA methylation biomarkers have great potential to contribute to personalized medicine throughout life. We review the current state of play for DNA methylation biomarkers, discuss the barriers that must be crossed on the way to implementation in a clinical setting, and predict their future use for human disease.

Maternal intake of methyl-group donors affects DNA methylation of metabolic genes in infants.

Science.gov (United States)

Pauwels, Sara; Ghosh, Manosij; Duca, Radu Corneliu; Bekaert, Bram; Freson, Kathleen; Huybrechts, Inge; Langie, Sabine A S; Koppen, Gudrun; Devlieger, Roland; Godderis, Lode

2017-01-01

Maternal nutrition during pregnancy and infant nutrition in the early postnatal period (lactation) are critically involved in the development and health of the newborn infant. The Maternal Nutrition and Offspring's Epigenome (MANOE) study was set up to assess the effect of maternal methyl-group donor intake (choline, betaine, folate, methionine) on infant DNA methylation. Maternal intake of dietary methyl-group donors was assessed using a food-frequency questionnaire (FFQ). Before and during pregnancy, we evaluated maternal methyl-group donor intake through diet and supplementation (folic acid) in relation to gene-specific ( IGF2 DMR, DNMT1 , LEP , RXRA ) buccal epithelial cell DNA methylation in 6 months old infants ( n  = 114) via pyrosequencing. In the early postnatal period, we determined the effect of maternal choline intake during lactation (in mothers who breast-fed for at least 3 months) on gene-specific buccal DNA methylation ( n  = 65). Maternal dietary and supplemental intake of methyl-group donors (folate, betaine, folic acid), only in the periconception period, was associated with buccal cell DNA methylation in genes related to growth ( IGF2 DMR), metabolism ( RXRA ), and appetite control ( LEP ). A negative association was found between maternal folate and folic acid intake before pregnancy and infant LEP (slope = -1.233, 95% CI -2.342; -0.125, p  = 0.0298) and IGF2 DMR methylation (slope = -0.706, 95% CI -1.242; -0.107, p  = 0.0101), respectively. Positive associations were observed for maternal betaine (slope = 0.875, 95% CI 0.118; 1.633, p  = 0.0241) and folate (slope = 0.685, 95% CI 0.245; 1.125, p  = 0.0027) intake before pregnancy and RXRA methylation. Buccal DNMT1 methylation in the infant was negatively associated with maternal methyl-group donor intake in the first and second trimester of pregnancy and negatively in the third trimester. We found no clear association between maternal choline intake

Methylcap-seq reveals novel DNA methylation markers for the diagnosis and recurrence prediction of bladder cancer in a Chinese population.

Directory of Open Access Journals (Sweden)

Yangxing Zhao

Full Text Available PURPOSE: There is a need to supplement or supplant the conventional diagnostic tools, namely, cystoscopy and B-type ultrasound, for bladder cancer (BC. We aimed to identify novel DNA methylation markers for BC through genome-wide profiling of BC cell lines and subsequent methylation-specific PCR (MSP screening of clinical urine samples. EXPERIMENTAL DESIGN: The methyl-DNA binding domain (MBD capture technique, methylCap/seq, was performed to screen for specific hypermethylated CpG islands in two BC cell lines (5637 and T24. The top one hundred hypermethylated targets were sequentially screened by MSP in urine samples to gradually narrow the target number and optimize the composition of the diagnostic panel. The diagnostic performance of the obtained panel was evaluated in different clinical scenarios. RESULTS: A total of 1,627 hypermethylated promoter targets in the BC cell lines was identified by Illumina sequencing. The top 104 hypermethylated targets were reduced to eight genes (VAX1, KCNV1, ECEL1, TMEM26, TAL1, PROX1, SLC6A20, and LMX1A after the urine DNA screening in a small sample size of 8 normal control and 18 BC subjects. Validation in an independent sample of 212 BC patients enabled the optimization of five methylation targets, including VAX1, KCNV1, TAL1, PPOX1, and CFTR, which was obtained in our previous study, for BC diagnosis with a sensitivity and specificity of 88.68% and 87.25%, respectively. In addition, the methylation of VAX1 and LMX1A was found to be associated with BC recurrence. CONCLUSIONS: We identified a promising diagnostic marker panel for early non-invasive detection and subsequent BC surveillance.

DNA methylation in inflammatory genes among children with obstructive sleep apnea.

Science.gov (United States)

Kim, Jinkwan; Bhattacharjee, Rakesh; Khalyfa, Abdelnaby; Kheirandish-Gozal, Leila; Capdevila, Oscar Sans; Wang, Yang; Gozal, David

2012-02-01

Pediatric obstructive sleep apnea (OSA) leads to multiple end-organ morbidities that are mediated by the cumulative burden of oxidative stress and inflammation. Because not all children with OSA exhibit increased systemic inflammation, genetic and environmental factors may be affecting patterns of DNA methylation in genes subserving inflammatory functions. DNA from matched children with OSA with and without high levels of high-sensitivity C-reactive protein (hsCRP) were assessed for DNA methylation levels of 24 inflammatory-related genes. Primer-based polymerase chain reaction assays in a case-control setting involving 47 OSA cases and 31 control subjects were conducted to confirm the findings; hsCRP and myeloid-related protein (MRP) 8/14 levels were also assayed. Forkhead box P3 (FOXP3) and interferon regulatory factor 1 (IRF1) showed higher methylation in six children with OSA and high hsCRP levels compared with matched children with OSA and low hsCRP levels (P DNA methylation levels compared with children with OSA and low CRP levels and control subjects. IRF1 did not exhibit significant differences. FOXP3 DNA methylation levels correlated with hsCRP and MRP 8/14 levels and with apnea-hypopnea index (AHI), BMI z score, and apolipoprotein B levels. A stepwise multiple regression model showed that AHI was independently associated with FOXP3 DNA methylation levels (P gene, which regulates expression of T regulatory lymphocytes, is more likely to display increased methylation among children with OSA who exhibit increased systemic inflammatory responses. Thus, epigenetic modifications may constitute an important determinant of inflammatory phenotype in OSA, and FOXP3 DNA methylation levels may provide a potential biomarker for end-organ vulnerability.

Methyl-Donor and Cofactor Nutrient Intakes in the First 2–3 Years and Global DNA Methylation at Age 4: A Prospective Cohort Study

Directory of Open Access Journals (Sweden)

Rachael M. Taylor

2018-02-01

Full Text Available Background: During the early postnatal period, the impact of nutrition on DNA methylation has not been well studied in humans. The aim was to quantify the relationship between one-carbon metabolism nutrient intake during the first three years of life and global DNA methylation levels at four years. Design: Childhood dietary intake was assessed using infant feeding questionnaires, food frequency questionnaires, 4-day weighed food records and 24-h food records. The dietary records were used to estimate the intake of methionine, folate, vitamins B2, B6 and B12 and choline. The accumulative nutrient intake specific rank from three months to three years of age was used for analysis. Global DNA methylation (%5-methyl cytosines (%5-mC was measured in buccal cells at four years of age, using an enzyme-linked immunosorbent assay (ELISA commercial kit. Linear regression models were used to quantify the statistical relationships. Results: Data were collected from 73 children recruited from the Women and their Children’s Health (WATCH study. No association was found between one-carbon metabolism nutrient intake and global DNA methylation levels (P > 0.05. Global DNA methylation levels in males were significantly higher than in females (median %5-mC: 1.82 vs. 1.03, males and females respectively, (P < 0.05. Conclusion: No association was found between the intake of one-carbon metabolism nutrients during the early postnatal period and global DNA methylation levels at age four years. Higher global DNA methylation levels in males warrants further investigation.

Methyl-Donor and Cofactor Nutrient Intakes in the First 2–3 Years and Global DNA Methylation at Age 4: A Prospective Cohort Study

Science.gov (United States)

Taylor, Rachael M.; Smith, Roger; Collins, Clare E.; Mossman, David; Wong-Brown, Michelle W.; Chan, Eng-Cheng; Evans, Tiffany-Jane; Attia, John R.; Smith, Tenele; Butler, Trent

2018-01-01

Background: During the early postnatal period, the impact of nutrition on DNA methylation has not been well studied in humans. The aim was to quantify the relationship between one-carbon metabolism nutrient intake during the first three years of life and global DNA methylation levels at four years. Design: Childhood dietary intake was assessed using infant feeding questionnaires, food frequency questionnaires, 4-day weighed food records and 24-h food records. The dietary records were used to estimate the intake of methionine, folate, vitamins B2, B6 and B12 and choline. The accumulative nutrient intake specific rank from three months to three years of age was used for analysis. Global DNA methylation (%5-methyl cytosines (%5-mC)) was measured in buccal cells at four years of age, using an enzyme-linked immunosorbent assay (ELISA) commercial kit. Linear regression models were used to quantify the statistical relationships. Results: Data were collected from 73 children recruited from the Women and their Children’s Health (WATCH) study. No association was found between one-carbon metabolism nutrient intake and global DNA methylation levels (P 0.05). Global DNA methylation levels in males were significantly higher than in females (median %5-mC: 1.82 vs. 1.03, males and females respectively, (P 0.05)). Conclusion: No association was found between the intake of one-carbon metabolism nutrients during the early postnatal period and global DNA methylation levels at age four years. Higher global DNA methylation levels in males warrants further investigation. PMID:29495543

Differential DNA Methylation Analysis without a Reference Genome

Directory of Open Access Journals (Sweden)

Johanna Klughammer

2015-12-01

Full Text Available Genome-wide DNA methylation mapping uncovers epigenetic changes associated with animal development, environmental adaptation, and species evolution. To address the lack of high-throughput methods for DNA methylation analysis in non-model organisms, we developed an integrated approach for studying DNA methylation differences independent of a reference genome. Experimentally, our method relies on an optimized 96-well protocol for reduced representation bisulfite sequencing (RRBS, which we have validated in nine species (human, mouse, rat, cow, dog, chicken, carp, sea bass, and zebrafish. Bioinformatically, we developed the RefFreeDMA software to deduce ad hoc genomes directly from RRBS reads and to pinpoint differentially methylated regions between samples or groups of individuals (http://RefFreeDMA.computational-epigenetics.org. The identified regions are interpreted using motif enrichment analysis and/or cross-mapping to annotated genomes. We validated our method by reference-free analysis of cell-type-specific DNA methylation in the blood of human, cow, and carp. In summary, we present a cost-effective method for epigenome analysis in ecology and evolution, which enables epigenome-wide association studies in natural populations and species without a reference genome.

DNA methylation patterns in cord blood DNA and body size in childhood.

Directory of Open Access Journals (Sweden)

Caroline L Relton

Full Text Available Epigenetic markings acquired in early life may have phenotypic consequences later in development through their role in transcriptional regulation with relevance to the developmental origins of diseases including obesity. The goal of this study was to investigate whether DNA methylation levels at birth are associated with body size later in childhood.A study design involving two birth cohorts was used to conduct transcription profiling followed by DNA methylation analysis in peripheral blood. Gene expression analysis was undertaken in 24 individuals whose biological samples and clinical data were collected at a mean ± standard deviation (SD age of 12.35 (0.95 years, the upper and lower tertiles of body mass index (BMI were compared with a mean (SD BMI difference of 9.86 (2.37 kg/m(2. This generated a panel of differentially expressed genes for DNA methylation analysis which was then undertaken in cord blood DNA in 178 individuals with body composition data prospectively collected at a mean (SD age of 9.83 (0.23 years. Twenty-nine differentially expressed genes (>1.2-fold and p<10(-4 were analysed to determine DNA methylation levels at 1-3 sites per gene. Five genes were unmethylated and DNA methylation in the remaining 24 genes was analysed using linear regression with bootstrapping. Methylation in 9 of the 24 (37.5% genes studied was associated with at least one index of body composition (BMI, fat mass, lean mass, height at age 9 years, although only one of these associations remained after correction for multiple testing (ALPL with height, p(Corrected = 0.017.DNA methylation patterns in cord blood show some association with altered gene expression, body size and composition in childhood. The observed relationship is correlative and despite suggestion of a mechanistic epigenetic link between in utero life and later phenotype, further investigation is required to establish causality.

Densely ionizing radiation affects DNA methylation of selective LINE-1 elements

Energy Technology Data Exchange (ETDEWEB)

Prior, Sara; Miousse, Isabelle R. [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Nzabarushimana, Etienne [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Department of Bioinformatics, School of Informatics and Computing, Indiana University, Bloomington, IN 47405 (United States); Pathak, Rupak [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Skinner, Charles; Kutanzi, Kristy R. [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Allen, Antiño R. [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Raber, Jacob [Departments of Behavioral Neuroscience, Neurology, and Radiation Medicine, Division of Neuroscience, ONPRC, Oregon Health & Science University, Portland, OR 97239 (United States); Tackett, Alan J. [Department of Biochemistry, College of Medicine, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Hauer-Jensen, Martin [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Nelson, Gregory A. [Department of Basic Sciences, Division of Radiation Research, Loma Linda University, Loma Linda, CA 92350 (United States); and others

2016-10-15

Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. - Highlights: • DNA methylation of LINE-1 elements is dependent on their evolutionary age. • Densely ionizing radiation affects DNA methylation of selective LINE-1 elements. • Radiation-induced reactivation of LINE-1 is DNA methylation-independent. • Histone modifications dictate the transcriptional activity of LINE-1.

Densely ionizing radiation affects DNA methylation of selective LINE-1 elements

International Nuclear Information System (INIS)

Prior, Sara; Miousse, Isabelle R.; Nzabarushimana, Etienne; Pathak, Rupak; Skinner, Charles; Kutanzi, Kristy R.; Allen, Antiño R.; Raber, Jacob; Tackett, Alan J.; Hauer-Jensen, Martin; Nelson, Gregory A.

2016-01-01

Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. - Highlights: • DNA methylation of LINE-1 elements is dependent on their evolutionary age. • Densely ionizing radiation affects DNA methylation of selective LINE-1 elements. • Radiation-induced reactivation of LINE-1 is DNA methylation-independent. • Histone modifications dictate the transcriptional activity of LINE-1.

Critical threshold levels of DNA methyltransferase 1 are required to maintain DNA methylation across the genome in human cancer cells.

Science.gov (United States)

Cai, Yi; Tsai, Hsing-Chen; Yen, Ray-Whay Chiu; Zhang, Yang W; Kong, Xiangqian; Wang, Wei; Xia, Limin; Baylin, Stephen B

2017-04-01

Reversing DNA methylation abnormalities and associated gene silencing, through inhibiting DNA methyltransferases (DNMTs) is an important potential cancer therapy paradigm. Maximizing this potential requires defining precisely how these enzymes maintain genome-wide, cancer-specific DNA methylation. To date, there is incomplete understanding of precisely how the three DNMTs, 1, 3A, and 3B, interact for maintaining DNA methylation abnormalities in cancer. By combining genetic and shRNA depletion strategies, we define not only a dominant role for DNA methyltransferase 1 (DNMT1) but also distinct roles of 3A and 3B in genome-wide DNA methylation maintenance. Lowering DNMT1 below a threshold level is required for maximal loss of DNA methylation at all genomic regions, including gene body and enhancer regions, and for maximally reversing abnormal promoter DNA hypermethylation and associated gene silencing to reexpress key genes. It is difficult to reach this threshold with patient-tolerable doses of current DNMT inhibitors (DNMTIs). We show that new approaches, like decreasing the DNMT targeting protein, UHRF1, can augment the DNA demethylation capacities of existing DNA methylation inhibitors for fully realizing their therapeutic potential. © 2017 Cai et al.; Published by Cold Spring Harbor Laboratory Press.

DNA Methylation of Regulatory Regions of Imprinted Genes at Birth and Its Relation to Infant Temperament

Directory of Open Access Journals (Sweden)

Bernard F. Fuemmeler

2016-01-01

Full Text Available BACKGROUND DNA methylation of the differentially methylated regions (DMRs of imprinted genes is relevant to neurodevelopment. METHODS DNA methylation status of the DMRs of nine imprinted genes in umbilical cord blood leukocytes was analyzed in relation to infant behaviors and temperament (n = 158. RESULTS MEG3 DMR levels were positively associated with internalizing ( β = 0.15, P = 0.044 and surgency ( β = 0.19, P = 0.018 behaviors, after adjusting for birth weight, gender, gestational age at birth, maternal age at delivery, race/ethnicity, education level, smoking status, parity, and a history of anxiety or depression. Higher methylation levels at the intergenic MEG3-IG methylation regions were associated with surgency ( β = 0.28, P = 0.0003 and PEG3 was positively related to externalizing ( β = 0.20, P = 0.01 and negative affectivity ( β = 0.18, P = 0.02. CONCLUSION While the small sample size limits inference, these pilot data support gene-specific associations between epigenetic differences in regulatory regions of imprinted domains at birth and later infant temperament.

DNA methylation-based variation between human populations.

Science.gov (United States)

Kader, Farzeen; Ghai, Meenu

2017-02-01

Several studies have proved that DNA methylation affects regulation of gene expression and development. Epigenome-wide studies have reported variation in methylation patterns between populations, including Caucasians, non-Caucasians (Blacks), Hispanics, Arabs, and numerous populations of the African continent. Not only has DNA methylation differences shown to impact externally visible characteristics, but is also a potential biomarker for underlying racial health disparities between human populations. Ethnicity-related methylation differences set their mark during early embryonic development. Genetic variations, such as single-nucleotide polymorphisms and environmental factors, such as age, dietary folate, socioeconomic status, and smoking, impacts DNA methylation levels, which reciprocally impacts expression of phenotypes. Studies show that it is necessary to address these external influences when attempting to differentiate between populations since the relative impacts of these factors on the human methylome remain uncertain. The present review summarises several reported attempts to establish the contribution of differential DNA methylation to natural human variation, and shows that DNA methylation could represent new opportunities for risk stratification and prevention of several diseases amongst populations world-wide. Variation of methylation patterns between human populations is an exciting prospect which inspires further valuable research to apply the concept in routine medical and forensic casework. However, trans-generational inheritance needs to be quantified to decipher the proportion of variation contributed by DNA methylation. The future holds thorough evaluation of the epigenome to understand quantification, heritability, and the effect of DNA methylation on phenotypes. In addition, methylation profiling of the same ethnic groups across geographical locations will shed light on conserved methylation differences in populations.

MCT4 surpasses the prognostic relevance of the ancillary protein CD147 in clear cell renal cell carcinoma.

Science.gov (United States)

Fisel, Pascale; Stühler, Viktoria; Bedke, Jens; Winter, Stefan; Rausch, Steffen; Hennenlotter, Jörg; Nies, Anne T; Stenzl, Arnulf; Scharpf, Marcus; Fend, Falko; Kruck, Stephan; Schwab, Matthias; Schaeffeler, Elke

2015-10-13

Cluster of differentiation 147 (CD147/BSG) is a transmembrane glycoprotein mediating oncogenic processes partly through its role as binding partner for monocarboxylate transporter MCT4/SLC16A3. As demonstrated for MCT4, CD147 is proposed to be associated with progression in clear cell renal cell carcinoma (ccRCC). In this study, we evaluated the prognostic relevance of CD147 in comparison to MCT4/SLC16A3 expression and DNA methylation. CD147 protein expression was assessed in two independent ccRCC-cohorts (n = 186, n = 59) by immunohistochemical staining of tissue microarrays and subsequent manual as well as automated software-supported scoring (Tissue Studio, Definien sAG). Epigenetic regulation of CD147 was investigated using RNAseq and DNA methylation data of The Cancer Genome Atlas. These results were validated in our cohort. Relevance of prognostic models for cancer-specific survival, comprising CD147 and MCT4 expression or SLC16A3 DNA methylation, was compared using chi-square statistics. CD147 protein expression generated with Tissue Studio correlated significantly with those from manual scoring (P CD147 in ccRCC. Association of CD147 expression with patient outcome differed between cohorts. DNA methylation in the CD147/BSG promoter was not associated with expression. Comparison of prognostic relevance of CD147/BSG and MCT4/SLC16A3, showed higher significance for MCT4 expression and superior prognostic power for DNA methylation at specific CpG-sites in the SLC16A3 promoter (e.g. CD147 protein: P = 0.7780,Harrell's c-index = 53.7% vs. DNA methylation: P = 0.0076, Harrell's c-index = 80.0%). Prognostic significance of CD147 protein expression could not surpass that of MCT4, especially of SLC16A3 DNA methylation, corroborating the role of MCT4 as prognostic biomarker for ccRCC.

DNA methylation abnormalities in congenital heart disease.

Science.gov (United States)

Serra-Juhé, Clara; Cuscó, Ivon; Homs, Aïda; Flores, Raquel; Torán, Núria; Pérez-Jurado, Luis A

2015-01-01

Congenital heart defects represent the most common malformation at birth, occurring also in ∼50% of individuals with Down syndrome. Congenital heart defects are thought to have multifactorial etiology, but the main causes are largely unknown. We have explored the global methylation profile of fetal heart DNA in comparison to blood DNA from control subjects: an absolute correlation with the type of tissue was detected. Pathway analysis revealed a significant enrichment of differential methylation at genes related to muscle contraction and cardiomyopathies in the developing heart DNA. We have also searched for abnormal methylation profiles on developing heart-tissue DNA of syndromic and non-syndromic congenital heart defects. On average, 3 regions with aberrant methylation were detected per sample and 18 regions were found differentially methylated between groups. Several epimutations were detected in candidate genes involved in growth regulation, apoptosis and folate pathway. A likely pathogenic hypermethylation of several intragenic sites at the MSX1 gene, involved in outflow tract morphogenesis, was found in a fetus with isolated heart malformation. In addition, hypermethylation of the GATA4 gene was present in fetuses with Down syndrome with or without congenital heart defects, as well as in fetuses with isolated heart malformations. Expression deregulation of the abnormally methylated genes was detected. Our data indicate that epigenetic alterations of relevant genes are present in developing heart DNA in fetuses with both isolated and syndromic heart malformations. These epimutations likely contribute to the pathogenesis of the malformation by cis-acting effects on gene expression.

Detection of methylated CDO1 in plasma of colorectal cancer; a PCR study.

Directory of Open Access Journals (Sweden)

Keishi Yamashita

Full Text Available BACKGROUND: Cysteine biology is important for the chemosensitivity of cancer cells. Our research has focused on the epigenetic silencing of cysteine dioxygenase type 1 (CDO1 in colorectal cancer (CRC. In this study, we describe detection of CDO1 methylation in the plasma of CRC patients using methylation specific PCR (Q-MSP and extensive analysis of the PCR reaction. METHODS: DNA was extracted from plasma, and analysed for methylation of the CDO1 gene using Q-MSP. The detection rate of CDO1 gene methylation was calculated and compared with that of diluted DNA extracted from "positive control" DLD1 cells. CDO1 gene methylation in the plasma of 40 CRC patients that were clinicopathologically analysed was then determined. RESULTS: (1 The cloned sequence analysis detected 93.3% methylation of the promoter CpG islands of the CDO1 gene of positive control DLD1 cells and 4.7% methylation of the negative control HepG2 CDO1 gene. (2 DLD1 CDO1 DNA could not be detected in this assay if the extracted DNA was diluted ∼1000 fold. The more DNA that was used for the PCR reaction, the more effectively it was amplified in Q-MSP. (3 By increasing the amount of DNA used, methylated CDO1 could be clearly detected in the plasma of 8 (20% of the CRC patients. However, the percentage of CRC patients detected by methylated CDO1 in plasma was lower than that detected by CEA (35.9% or CA19-9 (23.1% in preoperative serum. Combination of CEA/CA19-9 plus plasma methylated CDO1 could increase the rate of detection of curable CRC patients (39.3% as compared to CEA/CA19-9 (25%. CONCLUSION: We have described detection of CDO1 methylation in the plasma of CRC patients. Although CDO1 methylation was not detected as frequently as conventional tumor markers, analysis of plasma CDO1 methylation in combination with CEA/CA19-9 levels increases the detection rate of curable CRC patients.

DNA methylation in obesity

Directory of Open Access Journals (Sweden)

Małgorzata Pokrywka

2014-11-01

Full Text Available The number of overweight and obese people is increasing at an alarming rate, especially in the developed and developing countries. Obesity is a major risk factor for diabetes, cardiovascular disease, and cancer, and in consequence for premature death. The development of obesity results from the interplay of both genetic and environmental factors, which include sedentary life style and abnormal eating habits. In the past few years a number of events accompanying obesity, affecting expression of genes which are not directly connected with the DNA base sequence (e.g. epigenetic changes, have been described. Epigenetic processes include DNA methylation, histone modifications such as acetylation, methylation, phosphorylation, ubiquitination, and sumoylation, as well as non-coding micro-RNA (miRNA synthesis. In this review, the known changes in the profile of DNA methylation as a factor affecting obesity and its complications are described.

Dicty_cDB: SLC411 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC411 (Link to dictyBase) - - - Contig-U16272-1 SLC411Z (Link... to Original site) - - SLC411Z 486 - - - - Show SLC411 Library SL (Link to library) Clone ID SLC411 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC411Q.Seq.d/ Representative seq. ID SLC41...1Z (Link to Original site) Representative DNA sequence >SLC411 (SLC411Q) /CSM/SL/SLC4-A/SLC411Q.Seq.d/ XXXXX...vacuolar 4.0 %: peroxisomal >> prediction for SLC411 is nuc 5' end seq. ID - 5' e

Trichloroethylene-induced gene expression and DNA methylation changes in B6C3F1 mouse liver.

Directory of Open Access Journals (Sweden)

Yan Jiang

Full Text Available Trichloroethylene (TCE, widely used as an organic solvent in the industry, is a common contaminant in air, soil, and water. Chronic TCE exposure induced hepatocellular carcinoma in mice, and occupational exposure in humans was suggested to be associated with liver cancer. To understand the role of non-genotoxic mechanism(s for TCE action, we examined the gene expression and DNA methylation changes in the liver of B6C3F1 mice orally administered with TCE (0, 100, 500 and 1000 mg/kg b.w. per day for 5 days. After 5 days TCE treatment at a dose level of 1000 mg/kg b.w., a total of 431 differentially expressed genes were identified in mouse liver by microarray, of which 291 were up-regulated and 140 down-regulated. The expression changed genes were involved in key signal pathways including PPAR, proliferation, apoptosis and homologous recombination. Notably, the expression level of a number of vital genes involved in the regulation of DNA methylation, such as Utrf1, Tet2, DNMT1, DNMT3a and DNMT3b, were dysregulated. Although global DNA methylation change was not detected in the liver of mice exposed to TCE, the promoter regions of Cdkn1a and Ihh were found to be hypo- and hypermethylated respectively, which correlated negatively with their mRNA expression changes. Furthermore, the gene expression and DNA methylation changes induced by TCE were dose dependent. The overall data indicate that TCE exposure leads to aberrant DNA methylation changes, which might alter the expression of genes involved in the TCE-induced liver tumorgenesis.

DHA-rich n-3 fatty acid supplementation decreases DNA methylation in blood leukocytes: the OmegAD study.

Science.gov (United States)

Karimi, Mohsen; Vedin, Inger; Freund Levi, Yvonne; Basun, Hans; Faxén Irving, Gerd; Eriksdotter, Maria; Wahlund, Lars-Olof; Schultzberg, Marianne; Hjorth, Erik; Cederholm, Tommy; Palmblad, Jan

2017-10-01

Background: Dietary fish oils, rich in long-chain n-3 (ω-3) fatty acids (FAs) [e.g., docosahexaenoic acid (DHA, 22:6n-3) and eicosapentaenoic acid (EPA, 20:5n-3)], modulate inflammatory reactions through various mechanisms, including gene expression, which is measured as messenger RNA concentration. However, the effects of long-term treatment of humans with DHA and EPA on various epigenetic factors-such as DNA methylation, which controls messenger RNA generation-are poorly described. Objective: We wanted to determine the effects of 6 mo of dietary supplementation with an n-3 FA preparation rich in DHA on global DNA methylation of peripheral blood leukocytes (PBLs) and the relation to plasma EPA and DHA concentrations in Alzheimer disease (AD) patients. Design: In the present study, DNA methylation in four 5'-cytosine-phosphate-guanine-3' (CpG) sites of long interspersed nuclear element-1 repetitive sequences was assessed in a group of 63 patients (30 given the n-3 FA preparation and 33 given placebo) as an estimation of the global DNA methylation in blood cells. Patients originated from the randomized, double-blind, placebo-controlled OmegAD study, in which 174 AD patients received either 1.7 g DHA and 0.6 g EPA (the n-3 FA group) or placebo daily for 6 mo. Results: At 6 mo, the n-3 FA group displayed marked increases in DHA and EPA plasma concentrations (2.6- and 3.5-fold), as well as decreased methylation in 2 out of 4 CpG sites ( P DHA concentration, and were not related to apolipoprotein E-4 allele frequency. Conclusion: Supplementation with n-3 FA for 6 mo was associated with global DNA hypomethylation in PBLs. Our data may be of importance in measuring various effects of marine oils, including gene expression, in patients with AD and in other patients taking n-3 FA supplements. This trial was registered at clinicaltrials.gov as NCT00211159. © 2017 American Society for Nutrition.

Bisulfite sequencing reveals that Aspergillus flavus holds a hollow in DNA methylation.

Directory of Open Access Journals (Sweden)

Si-Yang Liu

Full Text Available Aspergillus flavus first gained scientific attention for its production of aflatoxin. The underlying regulation of aflatoxin biosynthesis has been serving as a theoretical model for biosynthesis of other microbial secondary metabolites. Nevertheless, for several decades, the DNA methylation status, one of the important epigenomic modifications involved in gene regulation, in A. flavus remains to be controversial. Here, we applied bisulfite sequencing in conjunction with a biological replicate strategy to investigate the DNA methylation profiling of A. flavus genome. Both the bisulfite sequencing data and the methylome comparisons with other fungi confirm that the DNA methylation level of this fungus is negligible. Further investigation into the DNA methyltransferase of Aspergillus uncovers its close relationship with RID-like enzymes as well as its divergence with the methyltransferase of species with validated DNA methylation. The lack of repeat contents of the A. flavus' genome and the high RIP-index of the small amount of remanent repeat potentially support our speculation that DNA methylation may be absent in A. flavus or that it may possess de novo DNA methylation which occurs very transiently during the obscure sexual stage of this fungal species. This work contributes to our understanding on the DNA methylation status of A. flavus, as well as reinforces our views on the DNA methylation in fungal species. In addition, our strategy of applying bisulfite sequencing to DNA methylation detection in species with low DNA methylation may serve as a reference for later scientific investigations in other hypomethylated species.

Glucose Tolerance, MTHFR C677T and NOS3 G894T Polymorphisms, and Global DNA Methylation in Mixed Ancestry African Individuals

Directory of Open Access Journals (Sweden)

Tandi E. Matsha

2016-01-01

Full Text Available The aim of this study is to quantify global DNA methylation and investigate the relationship with diabetes status and polymorphisms in MTHFR C677T and NOS3 G894T genes in mixed ancestry subjects from South Africa. Global DNA methylation was measured, and MTHFR rs1801133 and NOS3 rs1799983 polymorphisms were genotyped using high throughput real-time polymerase chain reaction and direct DNA sequencing. Of the 564 participants, 158 (28% individuals had T2DM of which 97 (17.2% were screen-detected cases. Another 119 (21.1% had prediabetes, that is, impaired fasting glucose, impaired glucose tolerance, or the combination of both, and the remainder 287 (50.9% had normal glucose tolerance. Global DNA methylation was significantly higher in prediabetes and screen-detected diabetes than in normal glucose tolerance (both p≤0.033 and in screen-detected diabetes compared to known diabetes on treatment (p=0.019. There was no difference in global DNA methylation between known diabetes on treatment and normal glucose tolerance (p>0.999. In multivariable linear regression analysis, only NOS3 was associated with increasing global DNA methylation (β=0.943; 95% CI: 0.286 to 1.560. The association of global DNA methylation with screen-detected diabetes but not treated diabetes suggests that glucose control agents to some extent may be reversing DNA methylation. The association between NOS3 rs1799983 polymorphisms and DNA methylation suggests gene-epigenetic mechanisms through which vascular diabetes complications develop despite adequate metabolic control.

Glucose Tolerance, MTHFR C677T and NOS3 G894T Polymorphisms, and Global DNA Methylation in Mixed Ancestry African Individuals

Science.gov (United States)

Mutize, Tinashe; Erasmus, Rajiv T.

2016-01-01

The aim of this study is to quantify global DNA methylation and investigate the relationship with diabetes status and polymorphisms in MTHFR C677T and NOS3 G894T genes in mixed ancestry subjects from South Africa. Global DNA methylation was measured, and MTHFR rs1801133 and NOS3 rs1799983 polymorphisms were genotyped using high throughput real-time polymerase chain reaction and direct DNA sequencing. Of the 564 participants, 158 (28%) individuals had T2DM of which 97 (17.2%) were screen-detected cases. Another 119 (21.1%) had prediabetes, that is, impaired fasting glucose, impaired glucose tolerance, or the combination of both, and the remainder 287 (50.9%) had normal glucose tolerance. Global DNA methylation was significantly higher in prediabetes and screen-detected diabetes than in normal glucose tolerance (both p ≤ 0.033) and in screen-detected diabetes compared to known diabetes on treatment (p = 0.019). There was no difference in global DNA methylation between known diabetes on treatment and normal glucose tolerance (p > 0.999). In multivariable linear regression analysis, only NOS3 was associated with increasing global DNA methylation (β = 0.943; 95% CI: 0.286 to 1.560). The association of global DNA methylation with screen-detected diabetes but not treated diabetes suggests that glucose control agents to some extent may be reversing DNA methylation. The association between NOS3 rs1799983 polymorphisms and DNA methylation suggests gene-epigenetic mechanisms through which vascular diabetes complications develop despite adequate metabolic control. PMID:27990443

Effects of temperature and relative humidity on DNA methylation.

Science.gov (United States)

Bind, Marie-Abele; Zanobetti, Antonella; Gasparrini, Antonio; Peters, Annette; Coull, Brent; Baccarelli, Andrea; Tarantini, Letizia; Koutrakis, Petros; Vokonas, Pantel; Schwartz, Joel

2014-07-01

Previous studies have found relationships between DNA methylation and various environmental contaminant exposures. Associations with weather have not been examined. Because temperature and humidity are related to mortality even on non-extreme days, we hypothesized that temperature and relative humidity may affect methylation. We repeatedly measured methylation on long interspersed nuclear elements (LINE-1), Alu, and 9 candidate genes in blood samples from 777 elderly men participating in the Normative Aging Study (1999-2009). We assessed whether ambient temperature and relative humidity are related to methylation on LINE-1 and Alu, as well as on genes controlling coagulation, inflammation, cortisol, DNA repair, and metabolic pathway. We examined intermediate-term associations of temperature, relative humidity, and their interaction with methylation, using distributed lag models. Temperature or relative humidity levels were associated with methylation on tissue factor (F3), intercellular adhesion molecule 1 (ICAM-1), toll-like receptor 2 (TRL-2), carnitine O-acetyltransferase (CRAT), interferon gamma (IFN-γ), inducible nitric oxide synthase (iNOS), and glucocorticoid receptor, LINE-1, and Alu. For instance, a 5°C increase in 3-week average temperature in ICAM-1 methylation was associated with a 9% increase (95% confidence interval: 3% to 15%), whereas a 10% increase in 3-week average relative humidity was associated with a 5% decrease (-8% to -1%). The relative humidity association with ICAM-1 methylation was stronger on hot days than mild days. DNA methylation in blood cells may reflect biological effects of temperature and relative humidity. Temperature and relative humidity may also interact to produce stronger effects.

Dicty_cDB: SLC405 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT

Dicty_cDB: SLC424 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC424 (Link to dictyBase) - G01086 DDB0231665 Contig-U08784-1 SLC4...24P (Link to Original site) SLC424F 169 SLC424Z 538 SLC424P 707 - - Show SLC424 Library SL (Link to library) Clone ID SLC4...ontig-U08784-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...24Q.Seq.d/ Representative seq. ID SLC424P (Link to Original site) Representative DNA sequence >SLC424 (SLC424Q) /CSM/SL/SLC4...-A/SLC424Q.Seq.d/ GGATATTATAATTTCAAATTAAGTTTTATAAATTTGAAATAATATTGAAAAAAAAAAAAA ATAAAAAA

Electronic transport in methylated fragments of DNA

Energy Technology Data Exchange (ETDEWEB)

Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L., E-mail: umbertofulco@gmail.com; Albuquerque, E. L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Freire, V. N. [Departamento de Física, Universidade Federal do Ceará, 60455-760 Fortaleza, CE (Brazil); Caetano, E. W. S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531 Fortaleza, CE (Brazil); Moura, F. A. B. F. de; Lyra, M. L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

2015-11-16

We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

Electronic transport in methylated fragments of DNA

International Nuclear Information System (INIS)

Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; Moura, F. A. B. F. de; Lyra, M. L.

2015-01-01

We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics

The Variation Analysis of DNA Methylation in Wheat Carrying Gametocidal Chromosome 3C from Aegilops triuncialis.

Science.gov (United States)

Wang, Dan; Zhao, Jieyu; Bai, Yan; Ao, You; Guo, Changhong

2017-08-10

Gametocidal (Gc) chromosomes can ensure their preferential transmission by killing the gametes without themselves through causing chromosome breakage and therefore have been exploited as an effective tool for genetic breeding. However, to date very little is known about the molecular mechanism of Gc action. In this study, we used methylation-sensitive amplified polymorphism (MSAP) technique to assess the extent and pattern of cytosine methylation alterations at the whole genome level between two lines of wheat Gc addition line and their common wheat parent. The results indicated that the overall levels of cytosine methylation of two studied Gc addition lines (CS-3C and CS-3C3C, 48.68% and 48.65%, respectively) were significantly increased when compared to common wheat CS (41.31%) and no matter fully methylated or hemimethylated rates enhanced in Gc addition lines. A set of 30 isolated fragments that showed different DNA methylation or demethylation patterns between the three lines were sequenced and the results indicated that 8 fragments showed significant homology to known sequences, of which three were homologous to MITE transposon (Miniature inverted-repeat transposable elements), LTR-retrotransposon WIS-1p and retrotransposon Gypsy , respectively. Overall, our results showed that DNA methylation could play a role in the Gc action.

The Variation Analysis of DNA Methylation in Wheat Carrying Gametocidal Chromosome 3C from Aegilops triuncialis

Directory of Open Access Journals (Sweden)

Dan Wang

2017-08-01

Full Text Available Gametocidal (Gc chromosomes can ensure their preferential transmission by killing the gametes without themselves through causing chromosome breakage and therefore have been exploited as an effective tool for genetic breeding. However, to date very little is known about the molecular mechanism of Gc action. In this study, we used methylation-sensitive amplified polymorphism (MSAP technique to assess the extent and pattern of cytosine methylation alterations at the whole genome level between two lines of wheat Gc addition line and their common wheat parent. The results indicated that the overall levels of cytosine methylation of two studied Gc addition lines (CS–3C and CS–3C3C, 48.68% and 48.65%, respectively were significantly increased when compared to common wheat CS (41.31% and no matter fully methylated or hemimethylated rates enhanced in Gc addition lines. A set of 30 isolated fragments that showed different DNA methylation or demethylation patterns between the three lines were sequenced and the results indicated that 8 fragments showed significant homology to known sequences, of which three were homologous to MITE transposon (Miniature inverted–repeat transposable elements, LTR-retrotransposon WIS-1p and retrotransposon Gypsy, respectively. Overall, our results showed that DNA methylation could play a role in the Gc action.

Linkage of DNA Methylation Quantitative Trait Loci to Human Cancer Risk

Directory of Open Access Journals (Sweden)

Holger Heyn

2014-04-01

Full Text Available Epigenetic regulation and, in particular, DNA methylation have been linked to the underlying genetic sequence. DNA methylation quantitative trait loci (meQTL have been identified through significant associations between the genetic and epigenetic codes in physiological and pathological contexts. We propose that interrogating the interplay between polymorphic alleles and DNA methylation is a powerful method for improving our interpretation of risk alleles identified in genome-wide association studies that otherwise lack mechanistic explanation. We integrated patient cancer risk genotype data and genome-scale DNA methylation profiles of 3,649 primary human tumors, representing 13 solid cancer types. We provide a comprehensive meQTL catalog containing DNA methylation associations for 21% of interrogated cancer risk polymorphisms. Differentially methylated loci harbor previously reported and as-yet-unidentified cancer genes. We suggest that such regulation at the DNA level can provide a considerable amount of new information about the biology of cancer-risk alleles.

Exploring the roles of DNA methylation in the metal-reducing bacterium Shewanella oneidensis MR-1

Energy Technology Data Exchange (ETDEWEB)

Bendall, Matthew L. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Luong, Khai [Pacific Biosciences, Menlo Park, CA (United States); Wetmore, Kelly M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Blow, Matthew [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Korlach, Jonas [Pacific Biosciences, Menlo Park, CA (United States); Deutschbauer, Adam [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Malmstrom, Rex [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

2013-08-30

We performed whole genome analyses of DNA methylation in Shewanella 17 oneidensis MR-1 to examine its possible role in regulating gene expression and 18 other cellular processes. Single-Molecule Real Time (SMRT) sequencing 19 revealed extensive methylation of adenine (N6mA) throughout the 20 genome. These methylated bases were located in five sequence motifs, 21 including three novel targets for Type I restriction/modification enzymes. The 22 sequence motifs targeted by putative methyltranferases were determined via 23 SMRT sequencing of gene knockout mutants. In addition, we found S. 24 oneidensis MR-1 cultures grown under various culture conditions displayed 25 different DNA methylation patterns. However, the small number of differentially 26 methylated sites could not be directly linked to the much larger number of 27 differentially expressed genes in these conditions, suggesting DNA methylation is 28 not a major regulator of gene expression in S. oneidensis MR-1. The enrichment 29 of methylated GATC motifs in the origin of replication indicate DNA methylation 30 may regulate genome replication in a manner similar to that seen in Escherichia 31 coli. Furthermore, comparative analyses suggest that many 32 Gammaproteobacteria, including all members of the Shewanellaceae family, may 33 also utilize DNA methylation to regulate genome replication.

DNA methylation profiling of embryonic stem cell differentiation into the three germ layers.

Science.gov (United States)

Isagawa, Takayuki; Nagae, Genta; Shiraki, Nobuaki; Fujita, Takanori; Sato, Noriko; Ishikawa, Shumpei; Kume, Shoen; Aburatani, Hiroyuki

2011-01-01

Embryogenesis is tightly regulated by multiple levels of epigenetic regulation such as DNA methylation, histone modification, and chromatin remodeling. DNA methylation patterns are erased in primordial germ cells and in the interval immediately following fertilization. Subsequent developmental reprogramming occurs by de novo methylation and demethylation. Variance in DNA methylation patterns between different cell types is not well understood. Here, using methylated DNA immunoprecipitation and tiling array technology, we have comprehensively analyzed DNA methylation patterns at proximal promoter regions in mouse embryonic stem (ES) cells, ES cell-derived early germ layers (ectoderm, endoderm and mesoderm) and four adult tissues (brain, liver, skeletal muscle and sperm). Most of the methylated regions are methylated across all three germ layers and in the three adult somatic tissues. This commonly methylated gene set is enriched in germ cell-associated genes that are generally transcriptionally inactive in somatic cells. We also compared DNA methylation patterns by global mapping of histone H3 lysine 4/27 trimethylation, and found that gain of DNA methylation correlates with loss of histone H3 lysine 4 trimethylation. Our combined findings indicate that differentiation of ES cells into the three germ layers is accompanied by an increased number of commonly methylated DNA regions and that these tissue-specific alterations in methylation occur for only a small number of genes. DNA methylation at the proximal promoter regions of commonly methylated genes thus appears to be an irreversible mark which functions to fix somatic lineage by repressing the transcription of germ cell-specific genes.

Quantification of 5-methyl-2'-deoxycytidine in the DNA.

Science.gov (United States)

Giel-Pietraszuk, Małgorzata; Insińska-Rak, Małgorzata; Golczak, Anna; Sikorski, Marek; Barciszewska, Mirosława; Barciszewski, Jan

2015-01-01

Methylation at position 5 of cytosine (Cyt) at the CpG sequences leading to formation of 5-methyl-cytosine (m(5)Cyt) is an important element of epigenetic regulation of gene expression. Modification of the normal methylation pattern, unique to each organism, leads to the development of pathological processes and diseases, including cancer. Therefore, quantification of the DNA methylation and analysis of changes in the methylation pattern is very important from a practical point of view and can be used for diagnostic purposes, as well as monitoring of the treatment progress. In this paper we present a new method for quantification of 5-methyl-2'deoxycytidine (m(5)C) in the DNA. The technique is based on conversion of m(5)C into fluorescent 3,N(4)-etheno-5-methyl-2'deoxycytidine (εm(5)C) and its identification by reversed-phase high-performance liquid chromatography (RP-HPLC). The assay was used to evaluate m(5)C concentration in DNA of calf thymus and peripheral blood of cows bred under different conditions. This approach can be applied for measuring of 5-methylcytosine in cellular DNA from different cells and tissues.

DNA Methylation Variants at HIF3A Locus, B-Vitamin Intake, and Long-term Weight Change: Gene-Diet Interactions in Two U.S. Cohorts.

Science.gov (United States)

Huang, Tao; Zheng, Yan; Qi, Qibin; Xu, Min; Ley, Sylvia H; Li, Yanping; Kang, Jae H; Wiggs, Janey; Pasquale, Louis R; Chan, Andrew T; Rimm, Eric B; Hunter, David J; Manson, JoAnn E; Willett, Walter C; Hu, Frank B; Qi, Lu

2015-09-01

The first epigenome-wide association study of BMI identified DNA methylation at an HIF3A locus associated with BMI. We tested the hypothesis that DNA methylation variants are associated with BMI according to intake of B vitamins. In two large cohorts, we found significant interactions between the DNA methylation-associated HIF3A single nucleotide polymorphism (SNP) rs3826795 and intake of B vitamins on 10-year changes in BMI. The association between rs3826795 and BMI changes consistently increased across the tertiles of total vitamin B2 and B12 intake (all P for interaction vitamin B2 intake and -0.10 (SE 0.06), -0.01 (SE 0.06), and 0.10 (SE 0.07) within subgroups defined by increasing tertiles of total vitamin B12 intake. In two independent cohorts, a DNA methylation variant in HIF3A was associated with BMI changes through interactions with total or supplemental vitamin B2, vitamin B12, and folate. These findings suggest a potential causal relation between DNA methylation and adiposity. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

PCFT/SLC46A1 promoter methylation and restoration of gene expression in human leukemia cells

International Nuclear Information System (INIS)

Gonen, Nitzan; Bram, Eran E.; Assaraf, Yehuda G.

2008-01-01

The proton-coupled folate transporter (PCFT/SLC46A1) displays optimal and prominent folate and antifolate transport activity at acidic pH in human carcinoma cells but poor activity in leukemia cells. Consistently herein, human leukemia cell lines expressed poor PCFT transcript levels, whereas various carcinoma cell lines showed substantial PCFT gene expression. We identified a CpG island with high density at nucleotides -200 through +100 and explored its role in PCFT promoter silencing. Leukemia cells with barely detectable PCFT transcripts consistently harbored 85-100% methylation of this CpG island, whereas no methylation was found in carcinoma cells. Treatment with 5-Aza-2'-deoxycytidine which induced demethylation but not with the histone deacetylase inhibitor trichostatin A, restored 50-fold PCFT expression only in leukemia cells. These findings constitute the first demonstration of the dominant epigenetic silencing of the PCFT gene in leukemia cells. The potential translational implications of the restoration of PCFT expression in chemotherapy of leukemia are discussed

Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma

Science.gov (United States)

Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.

2012-01-01

Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009

Histone modification alteration coordinated with acquisition of promoter DNA methylation during Epstein-Barr virus infection.

Science.gov (United States)

Funata, Sayaka; Matsusaka, Keisuke; Yamanaka, Ryota; Yamamoto, Shogo; Okabe, Atsushi; Fukuyo, Masaki; Aburatani, Hiroyuki; Fukayama, Masashi; Kaneda, Atsushi

2017-08-15

Aberrant DNA hypermethylation is a major epigenetic mechanism to inactivate tumor suppressor genes in cancer. Epstein-Barr virus positive gastric cancer is the most frequently hypermethylated tumor among human malignancies. Herein, we performed comprehensive analysis of epigenomic alteration during EBV infection, by Infinium HumanMethylation 450K BeadChip for DNA methylation and ChIP-sequencing for histone modification alteration during EBV infection into gastric cancer cell line MKN7. Among 7,775 genes with increased DNA methylation in promoter regions, roughly half were "DNA methylation-sensitive" genes, which acquired DNA methylation in the whole promoter regions and thus were repressed. These included anti-oncogenic genes, e.g. CDKN2A . The other half were "DNA methylation-resistant" genes, where DNA methylation is acquired in the surrounding of promoter regions, but unmethylated status is protected in the vicinity of transcription start site. These genes thereby retained gene expression, and included DNA repair genes. Histone modification was altered dynamically and coordinately with DNA methylation alteration. DNA methylation-sensitive genes significantly correlated with loss of H3K27me3 pre-marks or decrease of active histone marks, H3K4me3 and H3K27ac. Apoptosis-related genes were significantly enriched in these epigenetically repressed genes. Gain of active histone marks significantly correlated with DNA methylation-resistant genes. Genes related to mitotic cell cycle and DNA repair were significantly enriched in these epigenetically activated genes. Our data show that orchestrated epigenetic alterations are important in gene regulation during EBV infection, and histone modification status in promoter regions significantly associated with acquisition of de novo DNA methylation or protection of unmethylated status at transcription start site.

Defining Driver DNA Methylation Changes in Human Cancer

Directory of Open Access Journals (Sweden)

Gerd P. Pfeifer

2018-04-01

Full Text Available Human malignant tumors are characterized by pervasive changes in the patterns of DNA methylation. These changes include a globally hypomethylated tumor cell genome and the focal hypermethylation of numerous 5′-cytosine-phosphate-guanine-3′ (CpG islands, many of them associated with gene promoters. It has been challenging to link specific DNA methylation changes with tumorigenesis in a cause-and-effect relationship. Some evidence suggests that cancer-associated DNA hypomethylation may increase genomic instability. Promoter hypermethylation events can lead to silencing of genes functioning in pathways reflecting hallmarks of cancer, including DNA repair, cell cycle regulation, promotion of apoptosis or control of key tumor-relevant signaling networks. A convincing argument for a tumor-driving role of DNA methylation can be made when the same genes are also frequently mutated in cancer. Many of the most commonly hypermethylated genes encode developmental transcription factors, the methylation of which may lead to permanent gene silencing. Inactivation of such genes will deprive the cells in which the tumor may initiate from the option of undergoing or maintaining lineage differentiation and will lock them into a perpetuated stem cell-like state thus providing an additional window for cell transformation.

Dicty_cDB: SLC435 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4

Dicty_cDB: SLC402 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC402 (Link to dictyBase) - - - Contig-U16327-1 SLC402E (Link to Original site) SLC4...02F 661 SLC402Z 395 SLC402P 1056 SLC402E 674 Show SLC402 Library SL (Link to library) Clone ID SLC4...inal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC402Q.Seq.d/ Representative seq. ID SLC4...02E (Link to Original site) Representative DNA sequence >SLC402 (SLC402Q) /CSM/SL/SLC4-A/SLC4...lignments: (bits) Value SSC554 (SSC554Q) /CSM/SS/SSC5-C/SSC554Q.Seq.d/ 1128 0.0 SLC402 (SLC4

Prognostic DNA Methylation Markers for Prostate Cancer

Directory of Open Access Journals (Sweden)

Siri H. Strand

2014-09-01

Full Text Available Prostate cancer (PC is the most commonly diagnosed neoplasm and the third most common cause of cancer-related death amongst men in the Western world. PC is a clinically highly heterogeneous disease, and distinction between aggressive and indolent disease is a major challenge for the management of PC. Currently, no biomarkers or prognostic tools are able to accurately predict tumor progression at the time of diagnosis. Thus, improved biomarkers for PC prognosis are urgently needed. This review focuses on the prognostic potential of DNA methylation biomarkers for PC. Epigenetic changes are hallmarks of PC and associated with malignant initiation as well as tumor progression. Moreover, DNA methylation is the most frequently studied epigenetic alteration in PC, and the prognostic potential of DNA methylation markers for PC has been demonstrated in multiple studies. The most promising methylation marker candidates identified so far include PITX2, C1orf114 (CCDC181 and the GABRE~miR-452~miR-224 locus, in addition to the three-gene signature AOX1/C1orf114/HAPLN3. Several other biomarker candidates have also been investigated, but with less stringent clinical validation and/or conflicting evidence regarding their possible prognostic value available at this time. Here, we review the current evidence for the prognostic potential of DNA methylation markers in PC.

Dicty_cDB: SLC420 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC420 (Link to dictyBase) - G01085 DDB0205634 Contig-U01169-1 | Contig-U15736-1 SLC4...20P (Link to Original site) SLC420F 333 SLC420Z 423 SLC420P 756 - - Show SLC420 Libra...ry SL (Link to library) Clone ID SLC420 (Link to dictyBase) Atlas ID - NBRP ID G01085 dictyBase ID DDB020563...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC420Q.Seq.d/ Representative seq. ID SLC420P (Link to Original site) R...epresentative DNA sequence >SLC420 (SLC420Q) /CSM/SL/SLC4-A/SLC420Q.Seq.d/ GCTAGCACACACATAAATAATACATACACACAT

Reduced DNA repair in mouse satellite DNA after treatment with methylmethanesulfonate, and N-methyl-N-nitrosourea.

Science.gov (United States)

Bodell, W J; Banerjee, M R

1976-01-01

We have measured DNA repair in mouse satellite and main band DNA as resolved by Ag+-Cs2SO4 centrifugation in response to treatment with the alkylating agents, methyl methanesulfonate, and N-methyl-N-nitrosourea. We find that there is a statistically significant lower incorporation of 3H-Tdr into the satellite DNA as compared to the main band at varying periods after treatment with the alkylating agents. This suggests a reduced repair activity in the satellite DNA. We have measured the extent of binding of 14C-methyl methanesulfonate to the satellite, and main band DNA, and no difference in binding was observed, indicating that the reduced repair activity of satellite DNA is not due to a difference in binding of alkylating agents. We believe that the reduced incorporation of 3H-Tdr into satellite DNA may be due to its location in the condensed chromatin fraction. PMID:184436

Altered DNA methylation associated with a translocation linked to major mental illness

OpenAIRE

McCartney, Daniel L; Walker, Rosie M; Morris, Stewart W; Anderson, Susan M; Duff, Barbara J; Marioni, Riccardo E; Millar, J Kirsty; McCarthy, Shane E; Ryan, Niamh M; Lawrie, Stephen M; Watson, Andrew R; Blackwood, Douglas H R; Thomson, Pippa A; McIntosh, Andrew M; McCombie, W Richard

2018-01-01

Recent work has highlighted a possible role for altered epigenetic modifications, including differential DNA methylation, in susceptibility to psychiatric illness. Here, we investigate blood-based DNA methylation in a large family where a balanced translocation between chromosomes 1 and 11 shows genome-wide significant linkage to psychiatric illness. Genome-wide DNA methylation was profiled in whole-blood-derived DNA from 41 individuals using the Infinium HumanMethylation450 BeadChip (Illumin...

Dicty_cDB: SLC481 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC481 (Link to dictyBase) - - - Contig-U16358-1 SLC481Z (Link... to Original site) - - SLC481Z 393 - - - - Show SLC481 Library SL (Link to library) Clone ID SLC481 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC481Q.Seq.d/ Representative seq. ID SLC48...1Z (Link to Original site) Representative DNA sequence >SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ XXXXX...SL/SLG8-A/SLG820Q.Seq.d/ 708 0.0 SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ 708 0.0 SLC178 (SLC178Q) /CS

Transcription factors as readers and effectors of DNA methylation.

Science.gov (United States)

Zhu, Heng; Wang, Guohua; Qian, Jiang

2016-08-01

Recent technological advances have made it possible to decode DNA methylomes at single-base-pair resolution under various physiological conditions. Many aberrant or differentially methylated sites have been discovered, but the mechanisms by which changes in DNA methylation lead to observed phenotypes, such as cancer, remain elusive. The classical view of methylation-mediated protein-DNA interactions is that only proteins with a methyl-CpG binding domain (MBD) can interact with methylated DNA. However, evidence is emerging to suggest that transcription factors lacking a MBD can also interact with methylated DNA. The identification of these proteins and the elucidation of their characteristics and the biological consequences of methylation-dependent transcription factor-DNA interactions are important stepping stones towards a mechanistic understanding of methylation-mediated biological processes, which have crucial implications for human development and disease.

Quantitative DNA methylation analysis of candidate genes in cervical cancer.

Directory of Open Access Journals (Sweden)

Erin M Siegel

Full Text Available Aberrant DNA methylation has been observed in cervical cancer; however, most studies have used non-quantitative approaches to measure DNA methylation. The objective of this study was to quantify methylation within a select panel of genes previously identified as targets for epigenetic silencing in cervical cancer and to identify genes with elevated methylation that can distinguish cancer from normal cervical tissues. We identified 49 women with invasive squamous cell cancer of the cervix and 22 women with normal cytology specimens. Bisulfite-modified genomic DNA was amplified and quantitative pyrosequencing completed for 10 genes (APC, CCNA, CDH1, CDH13, WIF1, TIMP3, DAPK1, RARB, FHIT, and SLIT2. A Methylation Index was calculated as the mean percent methylation across all CpG sites analyzed per gene (~4-9 CpG site per sequence. A binary cut-point was defined at >15% methylation. Sensitivity, specificity and area under ROC curve (AUC of methylation in individual genes or a panel was examined. The median methylation index was significantly higher in cases compared to controls in 8 genes, whereas there was no difference in median methylation for 2 genes. Compared to HPV and age, the combination of DNA methylation level of DAPK1, SLIT2, WIF1 and RARB with HPV and age significantly improved the AUC from 0.79 to 0.99 (95% CI: 0.97-1.00, p-value = 0.003. Pyrosequencing analysis confirmed that several genes are common targets for aberrant methylation in cervical cancer and DNA methylation level of four genes appears to increase specificity to identify cancer compared to HPV detection alone. Alterations in DNA methylation of specific genes in cervical cancers, such as DAPK1, RARB, WIF1, and SLIT2, may also occur early in cervical carcinogenesis and should be evaluated.

Cystinuria Associated with Different SLC7A9 Gene Variants in the Cat.

Directory of Open Access Journals (Sweden)

Keijiro Mizukami

Full Text Available Cystinuria is a classical inborn error of metabolism characterized by a selective proximal renal tubular defect affecting cystine, ornithine, lysine, and arginine (COLA reabsorption, which can lead to uroliths and urinary obstruction. In humans, dogs and mice, cystinuria is caused by variants in one of two genes, SLC3A1 and SLC7A9, which encode the rBAT and bo,+AT subunits of the bo,+ basic amino acid transporter system, respectively. In this study, exons and flanking regions of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA of cats (Felis catus with COLAuria and cystine calculi. Relative to the Felis catus-6.2 reference genome sequence, DNA sequences from these affected cats revealed 3 unique homozygous SLC7A9 missense variants: one in exon 5 (p.Asp236Asn from a non-purpose-bred medium-haired cat, one in exon 7 (p.Val294Glu in a Maine Coon and a Sphinx cat, and one in exon 10 (p.Thr392Met from a non-purpose-bred long-haired cat. A genotyping assay subsequently identified another cystinuric domestic medium-haired cat that was homozygous for the variant originally identified in the purebred cats. These missense variants result in deleterious amino acid substitutions of highly conserved residues in the bo,+AT protein. A limited population survey supported that the variants found were likely causative. The remaining 2 sequenced domestic short-haired cats had a heterozygous variant at a splice donor site in intron 10 and a homozygous single nucleotide variant at a branchpoint in intron 11 of SLC7A9, respectively. This study identifies the first SLC7A9 variants causing feline cystinuria and reveals that, as in humans and dogs, this disease is genetically heterogeneous in cats.

Thiamine responsive megaloblastic anemia: a novel SLC19A2 compound heterozygous mutation in two siblings.

Science.gov (United States)

Mozzillo, Enza; Melis, Daniela; Falco, Mariateresa; Fattorusso, Valentina; Taurisano, Roberta; Flanagan, Sarah E; Ellard, Sian; Franzese, Adriana

2013-08-01

Thiamine responsive megaloblastic anemia (TRMA) is an autosomal recessive disease caused by loss of function mutations in the SLC19A2 gene. TRMA is characterized by anemia, deafness, and diabetes. In some cases, optic atrophy or more rarely retinitis pigmentosa is noted. We now report two sisters, the eldest of which presented to a different hospital during childhood with sensorineural deafness, which was treated with a hearing prosthesis, insulin requiring diabetes, retinitis pigmentosa, optic atrophy, and macrocytic anemia. These features initially suggested a clinical diagnosis of Wolfram syndrome (WS). Therapy with thiamine was initiated which resulted in the resolution of the anemia. The younger sister, who was affected with sensorineural deafness, was referred to our hospital for non-autoimmune diabetes. She was found to have macrocytosis and ocular abnormalities. Because a diagnosis of TRMA was suspected, therapy with insulin and thiamine was started. Sequencing analysis of the SLC19A2 gene identified a compound heterozygous mutation p.Y81X/p.L457X (c.242insA/c.1370delT) in both sisters. Non-autoimmune diabetes associated with deafness and macrocytosis, without anemia, suggests a diagnosis of TRMA. Patients clinically diagnosed with WS with anemia and/or macrocytosis should be reevaluated for TRMA. © 2012 John Wiley & Sons A/S.

Variation in the DNA methylation pattern of expressed and nonexpressed genes in chicken.

Science.gov (United States)

Cooper, D N; Errington, L H; Clayton, R M

1983-01-01

Using methyl-sensitive and -insensitive restriction enzymes, Hpa II and Msp I, the methylation status of various chicken genes was examined in different tissues and developmental stages. Tissue-specific differences in methylation were found for the delta-crystallin, beta-tubulin, G3PDH, rDNA, and actin genes but not for the histone genes. Developmental decreases in methylation were noted for the delta-crystallin and actin genes in chicken kidney between embryo and adult. Since most of the sequences examined were housekeeping genes, transcriptional differences are apparently not a necessary accompaniment to changes in DNA methylation at the CpG sites examined. The only exception is sperm DNA where the delta-crystallin, beta-tubulin, and actin genes are highly methylated and almost certainly not transcribed. However the G3PDH genes are no more highly methylated in sperm than in other somatic tissues. Many sequences homologous to the rDNA and histone probes used are unmethylated in all tissues examined including sperm, but a methylated rDNA subfraction is more heavily methylated in sperm than in other tissues. We speculate as to the significance of these differences in sperm DNA methylation in the light of possible requirements for early gene activation and the probable deleterious mutagenic effects of heavy methylation within coding sequences.

Zebrafish embryos as a screen for DNA methylation modifications after compound exposure

Energy Technology Data Exchange (ETDEWEB)

Bouwmeester, Manon C.; Ruiter, Sander; Lommelaars, Tobias; Sippel, Josefine; Hodemaekers, Hennie M. [Center for Health Protection, National Institute for Public Health and the Environment (RIVM), PO Box 1, 3720 BA Bilthoven (Netherlands); Brandhof, Evert-Jan van den [Center for Environmental Quality, National Institute for Public Health and the Environment (RIVM), PO Box 1, 3720 BA Bilthoven (Netherlands); Pennings, Jeroen L.A. [Center for Health Protection, National Institute for Public Health and the Environment (RIVM), PO Box 1, 3720 BA Bilthoven (Netherlands); Kamstra, Jorke H. [Institute for Environmental Studies (IVM), VU University, De Boelelaan 1085, 1081 HV Amsterdam (Netherlands); Jelinek, Jaroslav [Fels Institute for Cancer Research and Molecular Biology, Temple University School of Medicine, Philadelphia, PA (United States); Issa, Jean-Pierre J. [Fels Institute for Cancer Research and Molecular Biology, Temple University School of Medicine, Philadelphia, PA (United States); Department of Leukemia, The University of Texas MD Anderson Cancer Center, Houston, TX (United States); Legler, Juliette [Institute for Environmental Studies (IVM), VU University, De Boelelaan 1085, 1081 HV Amsterdam (Netherlands); Ven, Leo T.M. van der, E-mail: leo.van.der.ven@rivm.nl [Center for Health Protection, National Institute for Public Health and the Environment (RIVM), PO Box 1, 3720 BA Bilthoven (Netherlands)

2016-01-15

Modified epigenetic programming early in life is proposed to underlie the development of an adverse adult phenotype, known as the Developmental Origins of Health and Disease (DOHaD) concept. Several environmental contaminants have been implicated as modifying factors of the developing epigenome. This underlines the need to investigate this newly recognized toxicological risk and systematically screen for the epigenome modifying potential of compounds. In this study, we examined the applicability of the zebrafish embryo as a screening model for DNA methylation modifications. Embryos were exposed from 0 to 72 h post fertilization (hpf) to bisphenol-A (BPA), diethylstilbestrol, 17α-ethynylestradiol, nickel, cadmium, tributyltin, arsenite, perfluoroctanoic acid, valproic acid, flusilazole, 5-azacytidine (5AC) in subtoxic concentrations. Both global and site-specific methylation was examined. Global methylation was only affected by 5AC. Genome wide locus-specific analysis was performed for BPA exposed embryos using Digital Restriction Enzyme Analysis of Methylation (DREAM), which showed minimal wide scale effects on the genome, whereas potential informative markers were not confirmed by pyrosequencing. Site-specific methylation was examined in the promoter regions of three selected genes vasa, vtg1 and cyp19a2, of which vasa (ddx4) was the most responsive. This analysis distinguished estrogenic compounds from metals by direction and sensitivity of the effect compared to embryotoxicity. In conclusion, the zebrafish embryo is a potential screening tool to examine DNA methylation modifications after xenobiotic exposure. The next step is to examine the adult phenotype of exposed embryos and to analyze molecular mechanisms that potentially link epigenetic effects and altered phenotypes, to support the DOHaD hypothesis. - Highlights: • Compound induced effects on DNA methylation in zebrafish embryos • Global methylation not an informative biomarker • Minimal genome

Zebrafish embryos as a screen for DNA methylation modifications after compound exposure

International Nuclear Information System (INIS)

Bouwmeester, Manon C.; Ruiter, Sander; Lommelaars, Tobias; Sippel, Josefine; Hodemaekers, Hennie M.; Brandhof, Evert-Jan van den; Pennings, Jeroen L.A.; Kamstra, Jorke H.; Jelinek, Jaroslav; Issa, Jean-Pierre J.; Legler, Juliette; Ven, Leo T.M. van der

2016-01-01

Modified epigenetic programming early in life is proposed to underlie the development of an adverse adult phenotype, known as the Developmental Origins of Health and Disease (DOHaD) concept. Several environmental contaminants have been implicated as modifying factors of the developing epigenome. This underlines the need to investigate this newly recognized toxicological risk and systematically screen for the epigenome modifying potential of compounds. In this study, we examined the applicability of the zebrafish embryo as a screening model for DNA methylation modifications. Embryos were exposed from 0 to 72 h post fertilization (hpf) to bisphenol-A (BPA), diethylstilbestrol, 17α-ethynylestradiol, nickel, cadmium, tributyltin, arsenite, perfluoroctanoic acid, valproic acid, flusilazole, 5-azacytidine (5AC) in subtoxic concentrations. Both global and site-specific methylation was examined. Global methylation was only affected by 5AC. Genome wide locus-specific analysis was performed for BPA exposed embryos using Digital Restriction Enzyme Analysis of Methylation (DREAM), which showed minimal wide scale effects on the genome, whereas potential informative markers were not confirmed by pyrosequencing. Site-specific methylation was examined in the promoter regions of three selected genes vasa, vtg1 and cyp19a2, of which vasa (ddx4) was the most responsive. This analysis distinguished estrogenic compounds from metals by direction and sensitivity of the effect compared to embryotoxicity. In conclusion, the zebrafish embryo is a potential screening tool to examine DNA methylation modifications after xenobiotic exposure. The next step is to examine the adult phenotype of exposed embryos and to analyze molecular mechanisms that potentially link epigenetic effects and altered phenotypes, to support the DOHaD hypothesis. - Highlights: • Compound induced effects on DNA methylation in zebrafish embryos • Global methylation not an informative biomarker • Minimal genome

Dicty_cDB: SLC458 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743

Dicty_cDB: SLC451 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4

Dicty_cDB: SLC474 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se

Dicty_cDB: SLC425 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4

Dicty_cDB: SLC419 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4

Dicty_cDB: SLC409 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4

Dicty_cDB: SLC485 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4

Dicty_cDB: SLC442 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC442 (Link to dictyBase) - - - Contig-U16430-1 SLC442Z (Link... to Original site) - - SLC442Z 467 - - - - Show SLC442 Library SL (Link to library) Clone ID SLC442 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC442Q.Seq.d/ Representative seq. ID SLC44...2Z (Link to Original site) Representative DNA sequence >SLC442 (SLC442Q) /CSM/SL/SLC4-B/SLC442Q.Seq.d/ XXXXX... 4.0 %: extracellular, including cell wall 4.0 %: peroxisomal >> prediction for SLC4

Dicty_cDB: SLC478 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC478 (Link to dictyBase) - - - Contig-U16419-1 SLC478Z (Link... to Original site) - - SLC478Z 400 - - - - Show SLC478 Library SL (Link to library) Clone ID SLC478 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC478Q.Seq.d/ Representative seq. ID SLC47...8Z (Link to Original site) Representative DNA sequence >SLC478 (SLC478Q) /CSM/SL/SLC4-D/SLC478Q.Seq.d/ XXXXX... %: cytoplasmic 28.0 %: nuclear 24.0 %: mitochondrial 12.0 %: cytoskeletal >> prediction for SLC4

Dicty_cDB: SLC448 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC448 (Link to dictyBase) - - - Contig-U15118-1 SLC448E (Link... to Original site) - - - - - - SLC448E 245 Show SLC448 Library SL (Link to library) Clone ID SLC448 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC448Q.Seq.d/ Representative seq. ID SLC44...8E (Link to Original site) Representative DNA sequence >SLC448 (SLC448Q) /CSM/SL/SLC4-B/SLC448Q.Seq.d/ GGTAA... %: nuclear 12.0 %: mitochondrial 8.0 %: cytoskeletal 4.0 %: endoplasmic reticulum >> prediction for SLC4

Dicty_cDB: SLC456 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC456 (Link to dictyBase) - - - Contig-U16272-1 SLC456Z (Link... to Original site) - - SLC456Z 483 - - - - Show SLC456 Library SL (Link to library) Clone ID SLC456 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC456Q.Seq.d/ Representative seq. ID SLC45...6Z (Link to Original site) Representative DNA sequence >SLC456 (SLC456Q) /CSM/SL/SLC4-C/SLC456Q.Seq.d/ XXXXX...0 %: vacuolar 4.0 %: peroxisomal >> prediction for SLC456 is nuc 5' end seq. ID -

Obesity-related DNA methylation at imprinted genes in human sperm: Results from the TIEGER study.

Science.gov (United States)

Soubry, Adelheid; Guo, Lisa; Huang, Zhiqing; Hoyo, Cathrine; Romanus, Stephanie; Price, Thomas; Murphy, Susan K

2016-01-01

Epigenetic reprogramming in mammalian gametes resets methylation marks that regulate monoallelic expression of imprinted genes. In males, this involves erasure of the maternal methylation marks and establishment of paternal-specific methylation to appropriately guide normal development. The degree to which exogenous factors influence the fidelity of methylation reprogramming is unknown. We previously found an association between paternal obesity and altered DNA methylation in umbilical cord blood, suggesting that the father's endocrine, nutritional, or lifestyle status could potentiate intergenerational heritable epigenetic abnormalities. In these analyses, we examine the relationship between male overweight/obesity and DNA methylation status of imprinted gene regulatory regions in the gametes. Linear regression models were used to compare sperm DNA methylation percentages, quantified by bisulfite pyrosequencing, at 12 differentially methylated regions (DMRs) from 23 overweight/obese and 44 normal weight men. Our study population included 69 volunteers from The Influence of the Environment on Gametic Epigenetic Reprogramming (TIEGER) study, based in NC, USA. After adjusting for age and fertility patient status, semen from overweight or obese men had significantly lower methylation percentages at the MEG3 (β = -1.99; SE = 0.84; p = 0.02), NDN (β = -1.10; SE = 0.47; p = 0.02), SNRPN (β = -0.65; SE = 0.27; p = 0.02), and SGCE/PEG10 (β = -2.5; SE = 1.01; p = 0.01) DMRs. Our data further suggest a slight increase in DNA methylation at the MEG3-IG DMR (β = +1.22; SE = 0.59; p = 0.04) and H19 DMR (β = +1.37; SE = 0.62; p = 0.03) in sperm of overweight/obese men. Our data support that male overweight/obesity status is traceable in the sperm epigenome. Further research is needed to understand the effect of such changes and the point of origin of DNA methylation differences between lean and

Methylation of deoxycytidine incorporated by excision-repair synthesis of DNA

International Nuclear Information System (INIS)

Kastan, M.B.; Gowans, B.J.; Lieberman, M.W.

1982-01-01

Methylation of deoxycytidine incorporated by DNA excision-repair was studied in human diploid fibroblasts following damage with ultraviolet radiation, N-methyl-N-nitrosourea, or N-acetoxy-2-acetylaminofluorene. In confluent, nondividing cells, methylation in repair patches induced by all three agents is slow and incomplete. Whereas after DNA replication in logarithmic-phase cultures a steady state level of 3.4% 5-methylcytosine is reached in less than 2 hr after cells are labeled with 6- 3H-deoxycytidine, following ultraviolet-stimulated repair synthesis in confluent cells it takes about 3 days to reach a level of approximately 2.0% 5-methylcytosine in the repair patch. In cells from cultures in logarithmic-phase growth, 5-methylcytosine formation in ultraviolet-induced repair patches occurs faster and to a greater extent, reaching a level of approximately 2.7% in 10-20 hr. Preexisting hypomethylated repair patches in confluent cells are methylated further when the cells are stimulated to divide; however, the repair patch may still not be fully methylated before cell division occurs. Thus DNA damage and repair may lead to heritable loss of methylation at some sites

Aberrantly methylated DNA as a biomarker in breast cancer.

Science.gov (United States)

Kristiansen, Søren; Jørgensen, Lars M; Guldberg, Per; Sölétormos, György

2013-01-01

Aberrant DNA hypermethylation at gene promoters is a frequent event in human breast cancer. Recent genome-wide studies have identified hundreds of genes that exhibit differential methylation between breast cancer cells and normal breast tissue. Due to the tumor-specific nature of DNA hypermethylation events, their use as tumor biomarkers is usually not hampered by analytical signals from normal cells, which is a general problem for existing protein tumor markers used for clinical assessment of breast cancer. There is accumulating evidence that DNA-methylation changes in breast cancer patients occur early during tumorigenesis. This may open up for effective screening, and analysis of blood or nipple aspirate may later help in diagnosing breast cancer. As a more detailed molecular characterization of different types of breast cancer becomes available, the ability to divide patients into subgroups based on DNA biomarkers may improve prognosis. Serial monitoring of DNA-methylation markers in blood during treatment may be useful, particularly when the cancer burden is below the detection level for standard imaging techniques. Overall, aberrant DNA methylation has a great potential as a versatile biomarker tool for screening, diagnosis, prognosis and monitoring of breast cancer. Standardization of methods and biomarker panels will be required to fully exploit this clinical potential.

Disruption of Slc52a3 gene causes neonatal lethality with riboflavin deficiency in mice

OpenAIRE

Yoshimatsu, Hiroki; Yonezawa, Atsushi; Yamanishi, Kaori; Yao, Yoshiaki; Sugano, Kumiko; Nakagawa, Shunsaku; Imai, Satoshi; Omura, Tomohiro; Nakagawa, Takayuki; Yano, Ikuko; Masuda, Satohiro; Inui, Ken-ichi; Matsubara, Kazuo

2016-01-01

Homeostasis of riboflavin should be maintained by transporters. Previous in vitro studies have elucidated basic information about riboflavin transporter RFVT3 encoded by SLC52A3 gene. However, the contribution of RFVT3 to the maintenance of riboflavin homeostasis and the significance in vivo remain unclear. Here, we investigated the physiological role of RFVT3 using Slc52a3 knockout (Slc52a3−/−) mice. Most Slc52a3−/− mice died with hyperlipidemia and hypoglycemia within 48 hr after birth. The...

Dicty_cDB: SLC429 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC429 (Link to dictyBase) - - - Contig-U09691-1 SLC429Z (Link... to Original site) - - SLC429Z 419 - - - - Show SLC429 Library SL (Link to library) Clone ID SLC429 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC429Q.Seq.d/ Representative seq. ID SLC42...9Z (Link to Original site) Representative DNA sequence >SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ XXXXX... significant alignments: (bits) Value SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ 708 0.0 SLC392 (SLC392Q

Dicty_cDB: SLC428 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC428 (Link to dictyBase) - - - Contig-U10963-1 SLC428P (Link to Original site) SLC4...28F 573 SLC428Z 307 SLC428P 880 - - Show SLC428 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC428Q.Seq.d/ Representative seq. ID SLC4...28P (Link to Original site) Representative DNA sequence >SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC4...nces producing significant alignments: (bits) Value SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC428Q.Seq.d/ 1526 0.0

Regulation and function of DNA methylation in plants and animals

KAUST Repository

He, Xinjian

2011-02-15

DNA methylation is an important epigenetic mark involved in diverse biological processes. In plants, DNA methylation can be established through the RNA-directed DNA methylation pathway, an RNA interference pathway for transcriptional gene silencing (TGS), which requires 24-nt small interfering RNAs. In mammals, de novo DNA methylation occurs primarily at two developmental stages: during early embryogenesis and during gametogenesis. While it is not clear whether establishment of DNA methylation patterns in mammals involves RNA interference in general, de novo DNA methylation and suppression of transposons in germ cells require 24-32-nt piwi-interacting small RNAs. DNA methylation status is dynamically regulated by DNA methylation and demethylation reactions. In plants, active DNA demethylation relies on the repressor of silencing 1 family of bifunctional DNA glycosylases, which remove the 5-methylcytosine base and then cleave the DNA backbone at the abasic site, initiating a base excision repair (BER) pathway. In animals, multiple mechanisms of active DNA demethylation have been proposed, including a deaminase- and DNA glycosylase-initiated BER pathway. New information concerning the effects of various histone modifications on the establishment and maintenance of DNA methylation has broadened our understanding of the regulation of DNA methylation. The function of DNA methylation in plants and animals is also discussed in this review. © 2011 IBCB, SIBS, CAS All rights reserved.

Dicty_cDB: SLC489 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4

A Protein Complex Required for Polymerase V Transcripts and RNA- Directed DNA Methylation in Arabidopsis

KAUST Repository

Law, Julie A.; Ausí n, Israel; Johnson, Lianna M.; Vashisht, Ajay  A Amar; Zhu, Jian-Kang; Wohlschlegel, James  A A.; Jacobsen, Steven E.

2010-01-01

DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.

A Protein Complex Required for Polymerase V Transcripts and RNA- Directed DNA Methylation in Arabidopsis

KAUST Repository

Law, Julie A.

2010-05-01

DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.

Dicty_cDB: SLC418 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC418 (Link to dictyBase) - G01921 DDB0191271 Contig-U15820-1 SLC4...18E (Link to Original site) SLC418F 604 SLC418Z 554 SLC418P 1158 SLC418E 1076 Show SLC418 Library SL (L...ink to library) Clone ID SLC418 (Link to dictyBase) Atlas ID - NBRP ID G01921 dictyBase ID DDB0191271 Link t...o Contig Contig-U15820-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...18Q.Seq.d/ Representative seq. ID SLC418E (Link to Original site) Representative DNA sequence >SLC418 (SLC4

Reduced DNA methylation of FKBP5 in Cushing's syndrome.

Science.gov (United States)

Resmini, Eugenia; Santos, Alicia; Aulinas, Anna; Webb, Susan M; Vives-Gilabert, Yolanda; Cox, Olivia; Wand, Gary; Lee, Richard S

2016-12-01

FKBP5 encodes a co-chaperone of HSP90 protein that regulates intracellular glucocorticoid receptor sensitivity. When it is bound to the glucocorticoid receptor complex, cortisol binds with lower affinity to glucocorticoid receptor. Cushing's syndrome is associated with memory deficits, smaller hippocampal volumes, and wide range of cognitive impairments. We aimed at evaluating blood DNA methylation of FKBP5 and its relationship with memory and hippocampal volumes in Cushing's syndrome patients. Polymorphism rs1360780 in FKBP5 has also been assessed to determine whether genetic variations can also govern CpG methylation. Thirty-two Cushing's syndrome patients and 32 matched controls underwent memory tests, 3-Tesla MRI of the brain, and DNA extraction from total leukocytes. DNA samples were bisulfite treated, PCR amplified, and pyrosequenced to assess a total of 41CpG-dinucleotides in the introns 1, 2, 5, and 7 of FKBP5. Significantly lower intronic FKBP5 DNA methylation in CS patients compared to controls was observed in ten CpG-dinucleotides. DNA methylation at these CpGs correlated with left and right HV (Intron-2-Region-2-CpG-3: LHV, r = 0.73, p = 0.02; RHV, r = 0.58, p = 0.03). Cured and active CS patients showed both lower methylation of intron 2 (92.37, 91.8, and 93.34 %, respectively, p = 0.03 for both) and of intron 7 (77.08, 73.74, and 79.71 %, respectively, p = 0.02 and p < 0.01) than controls. Twenty-two subjects had the CC genotype, 34 had the TC genotype, and eight had the TT genotype. Lower average DNA methylation in intron 7 was observed in the TT subjects compared to CC (72.5vs. 79.5 %, p = 0.02) and to TC (72.5 vs. 79.0 %, p = 0.03). Our data demonstrate, for the first time, a reduction of intronic DNA methylation of FKBP5 in CS patients.

Dicty_cDB: SLC460 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT

Dicty_cDB: SLC496 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC496 (Link to dictyBase) - - - - SLC496E (Link to Original site) - - - - - - SLC4...96E 443 Show SLC496 Library SL (Link to library) Clone ID SLC496 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...96Q.Seq.d/ Representative seq. ID SLC496E (Link to Original site) R...epresentative DNA sequence >SLC496 (SLC496Q) /CSM/SL/SLC4-D/SLC496Q.Seq.d/ AAGAAATTTGAATCACTCCAAATCATTATCCCA

Dicty_cDB: SLC449 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC449 (Link to dictyBase) - - - - SLC449Z (Link to Original site) - - SLC4...49Z 384 - - - - Show SLC449 Library SL (Link to library) Clone ID SLC449 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...49Q.Seq.d/ Representative seq. ID SLC449Z (Link to Original site) R...epresentative DNA sequence >SLC449 (SLC449Q) /CSM/SL/SLC4-C/SLC449Q.Seq.d/ XXXXXXXXXXGTAAAAAGGAACACCAAGCCACT

Dicty_cDB: SLC465 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG

Dicty_cDB: SLC426 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG

Dicty_cDB: SLC492 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC492 (Link to dictyBase) - - - Contig-U10734-1 | Contig-U12865-1 SLC4...92P (Link to Original site) SLC492F 645 SLC492Z 550 SLC492P 1195 - - Show SLC492 Library SL (Link to library) Clone ID SLC4...734-1 | Contig-U12865-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...92Q.Seq.d/ Representative seq. ID SLC492P (Link to Original site) Representative DNA sequence >SLC492 (SLC4...92Q) /CSM/SL/SLC4-D/SLC492Q.Seq.d/ AAAAAAAAAATATACAAATAATGAATAAATTTTTAGCTTTGTTATTTGTTTTAGCTTTGT

Dicty_cDB: SLC432 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA

Detecting differential DNA methylation from sequencing of bisulfite converted DNA of diverse species.

Science.gov (United States)

Huh, Iksoo; Wu, Xin; Park, Taesung; Yi, Soojin V

2017-07-21

DNA methylation is one of the most extensively studied epigenetic modifications of genomic DNA. In recent years, sequencing of bisulfite-converted DNA, particularly via next-generation sequencing technologies, has become a widely popular method to study DNA methylation. This method can be readily applied to a variety of species, dramatically expanding the scope of DNA methylation studies beyond the traditionally studied human and mouse systems. In parallel to the increasing wealth of genomic methylation profiles, many statistical tools have been developed to detect differentially methylated loci (DMLs) or differentially methylated regions (DMRs) between biological conditions. We discuss and summarize several key properties of currently available tools to detect DMLs and DMRs from sequencing of bisulfite-converted DNA. However, the majority of the statistical tools developed for DML/DMR analyses have been validated using only mammalian data sets, and less priority has been placed on the analyses of invertebrate or plant DNA methylation data. We demonstrate that genomic methylation profiles of non-mammalian species are often highly distinct from those of mammalian species using examples of honey bees and humans. We then discuss how such differences in data properties may affect statistical analyses. Based on these differences, we provide three specific recommendations to improve the power and accuracy of DML and DMR analyses of invertebrate data when using currently available statistical tools. These considerations should facilitate systematic and robust analyses of DNA methylation from diverse species, thus advancing our understanding of DNA methylation. © The Author 2017. Published by Oxford University Press.

Epigenetics in Alzheimer's Disease: Perspective of DNA Methylation.

Science.gov (United States)

Qazi, Talal Jamil; Quan, Zhenzhen; Mir, Asif; Qing, Hong

2018-02-01

Research over the years has shown that causes of Alzheimer's disease are not well understood, but over the past years, the involvement of epigenetic mechanisms in the developing memory formation either under pathological or physiological conditions has become clear. The term epigenetics represents the heredity of changes in phenotype that are independent of altered DNA sequences. Different studies validated that cytosine methylation of genomic DNA decreases with age in different tissues of mammals, and therefore, the role of epigenetic factors in developing neurological disorders in aging has been under focus. In this review, we summarized and reviewed the involvement of different epigenetic mechanisms especially the DNA methylation in Alzheimer's disease (AD), late-onset Alzheimer's disease (LOAD), familial Alzheimer's disease (FAD), and autosomal dominant Alzheimer's disease (ADAD). Down to the minutest of details, we tried to discuss the methylation patterns like mitochondrial DNA methylation and ribosomal DNA (rDNA) methylation. Additionally, we mentioned some therapeutic approaches related to epigenetics, which could provide a potential cure for AD. Moreover, we reviewed some recent studies that validate DNA methylation as a potential biomarker and its role in AD. We hope that this review will provide new insights into the understanding of AD pathogenesis from the epigenetic perspective especially from the perspective of DNA methylation.

Dicty_cDB: SLC450 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V

Dicty_cDB: SLC495 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC495 (Link to dictyBase) - - - Contig-U03919-1 SLC495E (Link to Original site) SLC4...95F 337 SLC495Z 295 SLC495P 632 SLC495E 337 Show SLC495 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC495Q.Seq.d/ Representative seq. ID SLC4...95E (Link to Original site) Representative DNA sequence >SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC4...ficant alignments: (bits) Value SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC495Q.Seq.d/ 446 e-124 VSF494 (VSF494Q) /C

DNA methylation dynamics in muscle development and disease

Directory of Open Access Journals (Sweden)

Elvira eCarrio

2015-03-01

Full Text Available DNA methylation is an essential epigenetic modification for mammalian development and is crucial for the establishment and maintenance of cellular identity. Traditionally, DNA methylation has been considered as a permanent repressive epigenetic mark. However, the application of genome-wide approaches has allowed the analysis of DNA methylation in different genomic contexts revealing a more dynamic regulation than originally thought, since active DNA methylation and demethylation occur during cellular differentiation and tissue specification. Satellite cells are the primary stem cells in adult skeletal muscle and are responsible for postnatal muscle growth, hypertrophy, and muscle regeneration. This review outlines the published data regarding DNA methylation changes along the skeletal muscle program, in both physiological and pathological conditions, to better understand the epigenetic mechanisms that control myogenesis

Dicty_cDB: SLC444 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC444 (Link to dictyBase) - - - Contig-U16368-1 SLC444Z (Link... to Original site) - - SLC444Z 462 - - - - Show SLC444 Library SL (Link to library) Clone ID SLC444 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC444Q.Seq.d/ Representative seq. ID SLC44...4Z (Link to Original site) Representative DNA sequence >SLC444 (SLC444Q) /CSM/SL/SLC4-B/SLC444Q.Seq.d/ XXXXX...tochondrial 8.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: cytoplasmic >> prediction for SLC444 is mit 5' end seq

Dicty_cDB: SLC490 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC490 (Link to dictyBase) - - - Contig-U16444-1 SLC490Z (Link... to Original site) - - SLC490Z 427 - - - - Show SLC490 Library SL (Link to library) Clone ID SLC490 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC490Q.Seq.d/ Representative seq. ID SLC49...0Z (Link to Original site) Representative DNA sequence >SLC490 (SLC490Q) /CSM/SL/SLC4-D/SLC490Q.Seq.d/ XXXXX...itochondrial 24.0 %: cytoplasmic 24.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: plasma membrane 4.0 %: peroxisomal >> prediction for SLC4

Dicty_cDB: SLC484 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4

Comprehensive analysis of preeclampsia-associated DNA methylation in the placenta.

Directory of Open Access Journals (Sweden)

Tianjiao Chu

Full Text Available A small number of recent reports have suggested that altered placental DNA methylation may be associated with early onset preeclampsia. It is important that further studies be undertaken to confirm and develop these findings. We therefore undertook a systematic analysis of DNA methylation patterns in placental tissue from 24 women with preeclampsia and 24 with uncomplicated pregnancy outcome.We analyzed the DNA methylation status of approximately 27,000 CpG sites in placental tissues in a massively parallel fashion using an oligonucleotide microarray. Follow up analysis of DNA methylation at specific CpG loci was performed using the Epityper MassArray approach and high-throughput bisulfite sequencing.Preeclampsia-specific DNA methylation changes were identified in placental tissue samples irrespective of gestational age of delivery. In addition, we identified a group of CpG sites within specific gene sequences that were only altered in early onset-preeclampsia (EOPET although these DNA methylation changes did not correlate with altered mRNA transcription. We found evidence that fetal gender influences DNA methylation at autosomal loci but could find no clear association between DNA methylation and gestational age.Preeclampsia is associated with altered placental DNA methylation. Fetal gender should be carefully considered during the design of future studies in which placental DNA is analyzed at the level of DNA methylation. Further large-scale analyses of preeclampsia-associated DNA methylation are necessary.

Effects of As2O3 on DNA methylation, genomic instability, and LTR retrotransposon polymorphism in Zea mays.

Science.gov (United States)

Erturk, Filiz Aygun; Aydin, Murat; Sigmaz, Burcu; Taspinar, M Sinan; Arslan, Esra; Agar, Guleray; Yagci, Semra

2015-12-01

Arsenic is a well-known toxic substance on the living organisms. However, limited efforts have been made to study its DNA methylation, genomic instability, and long terminal repeat (LTR) retrotransposon polymorphism causing properties in different crops. In the present study, effects of As2O3 (arsenic trioxide) on LTR retrotransposon polymorphism and DNA methylation as well as DNA damage in Zea mays seedlings were investigated. The results showed that all of arsenic doses caused a decreasing genomic template stability (GTS) and an increasing Random Amplified Polymorphic DNAs (RAPDs) profile changes (DNA damage). In addition, increasing DNA methylation and LTR retrotransposon polymorphism characterized a model to explain the epigenetically changes in the gene expression were also found. The results of this experiment have clearly shown that arsenic has epigenetic effect as well as its genotoxic effect. Especially, the increasing of polymorphism of some LTR retrotransposon under arsenic stress may be a part of the defense system against the stress.

A Novel Computational Method for Detecting DNA Methylation Sites with DNA Sequence Information and Physicochemical Properties.

Science.gov (United States)

Pan, Gaofeng; Jiang, Limin; Tang, Jijun; Guo, Fei

2018-02-08

DNA methylation is an important biochemical process, and it has a close connection with many types of cancer. Research about DNA methylation can help us to understand the regulation mechanism and epigenetic reprogramming. Therefore, it becomes very important to recognize the methylation sites in the DNA sequence. In the past several decades, many computational methods-especially machine learning methods-have been developed since the high-throughout sequencing technology became widely used in research and industry. In order to accurately identify whether or not a nucleotide residue is methylated under the specific DNA sequence context, we propose a novel method that overcomes the shortcomings of previous methods for predicting methylation sites. We use k -gram, multivariate mutual information, discrete wavelet transform, and pseudo amino acid composition to extract features, and train a sparse Bayesian learning model to do DNA methylation prediction. Five criteria-area under the receiver operating characteristic curve (AUC), Matthew's correlation coefficient (MCC), accuracy (ACC), sensitivity (SN), and specificity-are used to evaluate the prediction results of our method. On the benchmark dataset, we could reach 0.8632 on AUC, 0.8017 on ACC, 0.5558 on MCC, and 0.7268 on SN. Additionally, the best results on two scBS-seq profiled mouse embryonic stem cells datasets were 0.8896 and 0.9511 by AUC, respectively. When compared with other outstanding methods, our method surpassed them on the accuracy of prediction. The improvement of AUC by our method compared to other methods was at least 0.0399 . For the convenience of other researchers, our code has been uploaded to a file hosting service, and can be downloaded from: https://figshare.com/s/0697b692d802861282d3.

A Novel Computational Method for Detecting DNA Methylation Sites with DNA Sequence Information and Physicochemical Properties

Directory of Open Access Journals (Sweden)

Gaofeng Pan

2018-02-01

Full Text Available DNA methylation is an important biochemical process, and it has a close connection with many types of cancer. Research about DNA methylation can help us to understand the regulation mechanism and epigenetic reprogramming. Therefore, it becomes very important to recognize the methylation sites in the DNA sequence. In the past several decades, many computational methods—especially machine learning methods—have been developed since the high-throughout sequencing technology became widely used in research and industry. In order to accurately identify whether or not a nucleotide residue is methylated under the specific DNA sequence context, we propose a novel method that overcomes the shortcomings of previous methods for predicting methylation sites. We use k-gram, multivariate mutual information, discrete wavelet transform, and pseudo amino acid composition to extract features, and train a sparse Bayesian learning model to do DNA methylation prediction. Five criteria—area under the receiver operating characteristic curve (AUC, Matthew’s correlation coefficient (MCC, accuracy (ACC, sensitivity (SN, and specificity—are used to evaluate the prediction results of our method. On the benchmark dataset, we could reach 0.8632 on AUC, 0.8017 on ACC, 0.5558 on MCC, and 0.7268 on SN. Additionally, the best results on two scBS-seq profiled mouse embryonic stem cells datasets were 0.8896 and 0.9511 by AUC, respectively. When compared with other outstanding methods, our method surpassed them on the accuracy of prediction. The improvement of AUC by our method compared to other methods was at least 0.0399 . For the convenience of other researchers, our code has been uploaded to a file hosting service, and can be downloaded from: https://figshare.com/s/0697b692d802861282d3.

Implications of DNA Methylation in Parkinson’s Disease

Directory of Open Access Journals (Sweden)

Ernesto Miranda-Morales

2017-07-01

Full Text Available It has been 200 years since Parkinson’s disease (PD was first described, yet many aspects of its etiopathogenesis remain unclear. PD is a progressive and complex neurodegenerative disorder caused by genetic and environmental factors including aging, nutrition, pesticides and exposure to heavy metals. DNA methylation may be altered in response to some of these factors; therefore, it is proposed that epigenetic mechanisms, particularly DNA methylation, can have a fundamental role in gene–environment interactions that are related with PD. Epigenetic changes in PD-associated genes are now widely studied in different populations, to discover the mechanisms that contribute to disease development and identify novel biomarkers for early diagnosis and future pharmacological treatment. While initial studies sought to find associations between promoter DNA methylation and the regulation of associated genes in PD brain tissue, more recent studies have described concordant DNA methylation patterns between blood and brain tissue DNA. These data justify the use of peripheral blood samples instead of brain tissue for epigenetic studies. Here, we summarize the current data about DNA methylation changes in PD and discuss the potential of DNA methylation as a potential biomarker for PD. Additionally, we discuss environmental and nutritional factors that have been implicated in DNA methylation. Although the search for significant DNA methylation changes and gene expression analyses of PD-associated genes have yielded inconsistent and contradictory results, epigenetic modifications remain under investigation for their potential to reveal the link between environmental risk factors and the development of PD.

The prognostic significance of whole blood global and specific DNA methylation levels in gastric adenocarcinoma.

Directory of Open Access Journals (Sweden)

Mansour S Al-Moundhri

Full Text Available BACKGROUND: Epigenetics, particularly DNA methylation, has recently been elucidated as important in gastric cancer (GC initiation and progression. We investigated the clinical and prognostic importance of whole blood global and site-specific DNA methylation in GC. METHODS: Genomic DNA was extracted from the peripheral blood of 105 Omani GC patients at diagnosis. DNA methylation was quantified by pyrosequencing of global DNA and specific gene promoter regions at 5 CpG sites for CDH1, 7 CpG sites for p16, 4 CpG sites for p53, and 3 CpG sites for RUNX3. DNA methylation levels in patients were categorized into low, medium, and high tertiles. Associations between methylation level category and clinicopathological features were evaluated using χ(2 tests. Survival analyses were carried out using the Kaplan-Meier method and log rank test. A backward conditional Cox proportional hazards regression model was used to identify independent predictors of survival. RESULTS: Older GC patients had increased methylation levels at specific CpG sites within the CDH1, p53, and RUNX-3 promoters. Male gender was significantly associated with reduced global and increased site-specific DNA methylation levels in CDH1, p16, and p53 promoters. Global DNA low methylation level was associated with better survival on univariate analysis. Patients with high and medium methylation vs. low methylation levels across p16 promoter CpG sites, site 2 in particular, had better survival. Multivariate analysis showed that global DNA hypermethylation was a significant independent predictor of worse survival (hazard ratio (HR = 2.0, 95% CI: 1.1-3.8; p = 0.02 and high methylation mean values across p16 promoter sites 1-7 were associated with better survival with HR of 0.3 (95% CI, 0.1-0.8; p = 0.02 respectively. CONCLUSIONS: Analysis of global and site-specific DNA methylation in peripheral blood by pyrosequencing provides quantitative DNA methylation values that may serve as important

Dicty_cDB: SLC436 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4

SLC1 and SLC4 encode partially redundant acyl-coenzyme A 1-acylglycerol-3-phosphate O-acyltransferases of budding yeast

DEFF Research Database (Denmark)

Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath

2007-01-01

Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...

Dicty_cDB: SLC438 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC438 (Link to dictyBase) - - - Contig-U10771-1 SLC438Z (Link... to Original site) - - SLC438Z 549 - - - - Show SLC438 Library SL (Link to library) Clone ID SLC438 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC438Q.Seq.d/ Representative seq. ID SLC43...8Z (Link to Original site) Representative DNA sequence >SLC438 (SLC438Q) /CSM/SL/SLC4-B/SLC438Q.Seq.d/ XXXXX...es producing significant alignments: (bits) Value SSM825 (SSM825Q) /CSM/SS/SSM8-B/SSM825Q.Seq.d/ 948 0.0 SLC438 (SLC4

Dicty_cDB: SLC440 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA

Traumatic stress and accelerated DNA methylation age: A meta-analysis.

Science.gov (United States)

Wolf, Erika J; Maniates, Hannah; Nugent, Nicole; Maihofer, Adam X; Armstrong, Don; Ratanatharathorn, Andrew; Ashley-Koch, Allison E; Garrett, Melanie; Kimbrel, Nathan A; Lori, Adriana; Va Mid-Atlantic Mirecc Workgroup; Aiello, Allison E; Baker, Dewleen G; Beckham, Jean C; Boks, Marco P; Galea, Sandro; Geuze, Elbert; Hauser, Michael A; Kessler, Ronald C; Koenen, Karestan C; Miller, Mark W; Ressler, Kerry J; Risbrough, Victoria; Rutten, Bart P F; Stein, Murray B; Ursano, Robert J; Vermetten, Eric; Vinkers, Christiaan H; Uddin, Monica; Smith, Alicia K; Nievergelt, Caroline M; Logue, Mark W

2018-06-01

Recent studies examining the association between posttraumatic stress disorder (PTSD) and accelerated aging, as defined by DNA methylation-based estimates of cellular age that exceed chronological age, have yielded mixed results. We conducted a meta-analysis of trauma exposure and PTSD diagnosis and symptom severity in association with accelerated DNA methylation age using data from 9 cohorts contributing to the Psychiatric Genomics Consortium PTSD Epigenetics Workgroup (combined N = 2186). Associations between demographic and cellular variables and accelerated DNA methylation age were also examined, as was the moderating influence of demographic variables. Meta-analysis of regression coefficients from contributing cohorts revealed that childhood trauma exposure (when measured with the Childhood Trauma Questionnaire) and lifetime PTSD severity evidenced significant, albeit small, meta-analytic associations with accelerated DNA methylation age (ps = 0.028 and 0.016, respectively). Sex, CD4T cell proportions, and natural killer cell proportions were also significantly associated with accelerated DNA methylation age (all ps age. There was no evidence of moderation of the trauma or PTSD variables by demographic factors. Results suggest that traumatic stress is associated with advanced epigenetic age and raise the possibility that cells integral to immune system maintenance and responsivity play a role in this. This study highlights the need for additional research into the biological mechanisms linking traumatic stress to accelerated DNA methylation age and the importance of furthering our understanding of the neurobiological and health consequences of PTSD. Published by Elsevier Ltd.

DNA methylation of miRNA coding sequences putatively associated with childhood obesity.

Science.gov (United States)

Mansego, M L; Garcia-Lacarte, M; Milagro, F I; Marti, A; Martinez, J A

2017-02-01

Epigenetic mechanisms may be involved in obesity onset and its consequences. The aim of the present study was to evaluate whether DNA methylation status in microRNA (miRNA) coding regions is associated with childhood obesity. DNA isolated from white blood cells of 24 children (identification sample: 12 obese and 12 non-obese) from the Grupo Navarro de Obesidad Infantil study was hybridized in a 450 K methylation microarray. Several CpGs whose DNA methylation levels were statistically different between obese and non-obese were validated by MassArray® in 95 children (validation sample) from the same study. Microarray analysis identified 16 differentially methylated CpGs between both groups (6 hypermethylated and 10 hypomethylated). DNA methylation levels in miR-1203, miR-412 and miR-216A coding regions significantly correlated with body mass index standard deviation score (BMI-SDS) and explained up to 40% of the variation of BMI-SDS. The network analysis identified 19 well-defined obesity-relevant biological pathways from the KEGG database. MassArray® validation identified three regions located in or near miR-1203, miR-412 and miR-216A coding regions differentially methylated between obese and non-obese children. The current work identified three CpG sites located in coding regions of three miRNAs (miR-1203, miR-412 and miR-216A) that were differentially methylated between obese and non-obese children, suggesting a role of miRNA epigenetic regulation in childhood obesity. © 2016 World Obesity Federation.

Dicty_cDB: SLC486 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4

Dicty_cDB: SLC470 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4

DNA methyltransferase 1 mutations and mitochondrial pathology: is mtDNA methylated?

Directory of Open Access Journals (Sweden)

Alessandra eMaresca

2015-03-01

Full Text Available Autosomal dominant cerebellar ataxia, deafness and narcolepsy (ADCA-DN and Hereditary sensory neuropathy with dementia and hearing loss (HSN1E are two rare, overlapping neurodegenerative syndromes that have been recently linked to allelic dominant pathogenic mutations in the DNMT1 gene, coding for DNA (cytosine-5-methyltransferase 1. DNMT1 is the enzyme responsible for maintaining the nuclear genome methylation patterns during the DNA replication and repair, thus regulating gene expression. The mutations responsible for ADCA-DN and HSN1E affect the replication foci targeting sequence domain, which regulates DNMT1 binding to chromatin. DNMT1 dysfunction is anticipated to lead to a global alteration of the DNA methylation pattern with predictable downstream consequences on gene expression. Interestingly, ADCA-DN and HSN1E phenotypes share some clinical features typical of mitochondrial diseases, such as optic atrophy, peripheral neuropathy and deafness, and some biochemical evidence of mitochondrial dysfunction. The recent discovery of a mitochondrial isoform of DNMT1 and its proposed role in methylating mitochondrial DNA (mtDNA suggests that DNMT1 mutations may directly affect mtDNA and mitochondrial physiology. On the basis of this latter finding the link between DNMT1 abnormal activity and mitochondrial dysfunction in ADCA-DN and HSN1E appears intuitive, however mtDNA methylation remains highly debated. In the last years several groups demonstrated the presence of 5-methylcytosine in mtDNA by different approaches, but, on the other end, the opposite evidence that mtDNA is not methylated has also been published. Since over 1500 mitochondrial proteins are encoded by the nuclear genome, the altered methylation of these genes may well have a critical role in leading to the mitochondrial impairment observed in ADCA-DN and HSN1E. Thus, many open questions still remain unanswered, such as why mtDNA should be methylated, and how this process is

Variations in DNA methylation, acetylated histone H4, and methylated histone H3 during Pinus radiata needle maturation in relation to the loss of in vitro organogenic capability.

Science.gov (United States)

Valledor, Luis; Meijón, Mónica; Hasbún, Rodrigo; Jesús Cañal, Maria; Rodríguez, Roberto

2010-03-15

Needle differentiation is a very complex process associated with the formation of a mature photosynthetic organ. From meristem differentiation to leaf maturation, gene control must play an important role switching required genes on and off to define tissue functions, with the epigenetic code being one of the main regulation mechanisms. In this work, we examined the connections between the variation in the levels of some epigenetic players (DNA methylation, acetylated histone H4 and histone H3 methylation at Lys 4 and Lys 9) at work during needle maturation. Our results indicate that needle maturation, which is associated with a decrease in organogenic capability, is related to an increase in heterochromatin-related epigenetic markers (high DNA methylation and low acetylated histone H4 levels, and the presence of histone H3 methylated at lys 9). Immunohistochemical analyses also showed that the DNA methylation of palisade parenchyma cell layers during the transition from immature to mature scions is associated with the loss of the capacity to induce adventitious organs. Copyright 2009 Elsevier GmbH. All rights reserved.

Dicty_cDB: SLC441 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2

Allele-Specific DNA Methylation Detection by Pyrosequencing®

DEFF Research Database (Denmark)

Kristensen, Lasse Sommer; Johansen, Jens Vilstrup; Grønbæk, Kirsten

2015-01-01

DNA methylation is an epigenetic modification that plays important roles in healthy as well as diseased cells, by influencing the transcription of genes. In spite the fact that human somatic cells are diploid, most of the currently available methods for the study of DNA methylation do not provide......-effective protocol for allele-specific DNA methylation detection based on Pyrosequencing(®) of methylation-specific PCR (MSP) products including a single nucleotide polymorphism (SNP) within the amplicon....

A nonparametric Bayesian approach for clustering bisulfate-based DNA methylation profiles.

Science.gov (United States)

Zhang, Lin; Meng, Jia; Liu, Hui; Huang, Yufei

2012-01-01

DNA methylation occurs in the context of a CpG dinucleotide. It is an important epigenetic modification, which can be inherited through cell division. The two major types of methylation include hypomethylation and hypermethylation. Unique methylation patterns have been shown to exist in diseases including various types of cancer. DNA methylation analysis promises to become a powerful tool in cancer diagnosis, treatment and prognostication. Large-scale methylation arrays are now available for studying methylation genome-wide. The Illumina methylation platform simultaneously measures cytosine methylation at more than 1500 CpG sites associated with over 800 cancer-related genes. Cluster analysis is often used to identify DNA methylation subgroups for prognosis and diagnosis. However, due to the unique non-Gaussian characteristics, traditional clustering methods may not be appropriate for DNA and methylation data, and the determination of optimal cluster number is still problematic. A Dirichlet process beta mixture model (DPBMM) is proposed that models the DNA methylation expressions as an infinite number of beta mixture distribution. The model allows automatic learning of the relevant parameters such as the cluster mixing proportion, the parameters of beta distribution for each cluster, and especially the number of potential clusters. Since the model is high dimensional and analytically intractable, we proposed a Gibbs sampling "no-gaps" solution for computing the posterior distributions, hence the estimates of the parameters. The proposed algorithm was tested on simulated data as well as methylation data from 55 Glioblastoma multiform (GBM) brain tissue samples. To reduce the computational burden due to the high data dimensionality, a dimension reduction method is adopted. The two GBM clusters yielded by DPBMM are based on data of different number of loci (P-value < 0.1), while hierarchical clustering cannot yield statistically significant clusters.

Risk and protective genetic variants in suicidal behaviour: association with SLC1A2, SLC1A3, 5-HTR1B &NTRK2 polymorphisms.

LENUS (Irish Health Repository)

Murphy, Therese M

2012-02-01

BACKGROUND: Suicidal behaviour is known to aggregate in families. Patients with psychiatric disorders are at higher risk for suicide attempts (SA), however protective and risk genetic variants for suicide appear to be independent of underlying psychiatric disorders. Here we investigate genetic variants in genes important for neurobiological pathways linked to suicidal behaviour and\\/or associated endophenotypes, for association with SA among patients with co-existing psychiatric illness. Selected gene-gene and gene-environment interactions were also tested. METHODS: DNA was obtained from bloods of 159 patients (76 suicide attempters and 83 non-attempters), who were profiled for DSM-IV Axis I psychiatric diagnosis. Twenty-eight single nucleotide polymorphisms (SNPs) from 18 candidate genes (COMT, 5-HT2A, 5-HT1A, 5-HTR1B, TPH1, MAO-A, TPH2, DBH, CNR1, BDNF, ABCG1, GABRA5, GABRG2, GABRB2, SLC1A2, SLC1A3, NTRK2, CRHR1) were genotyped. Genotyping was performed by KBioscience. Tests of association between genetic variants and SA were conducted using Chi squared and Armitage Trend tests. Binary logistical regression analyses were performed to evaluate the contribution of individual genetic variants to the prediction of SA, and to examine SNPs for potential gene-gene and gene-environment interactions. RESULTS: Our analysis identified 4 SNPs (rs4755404, rs2269272, rs6296 and rs1659400), which showed evidence of association with SA compared to a non-attempter control group. We provide evidence of a 3-locus gene-gene interaction, and a putative gene-environment interaction, whereby genetic variation at the NTRK2 locus may moderate the risk associated with history of childhood abuse. CONCLUSION: Preliminary findings suggest that allelic variability in SLC1A2\\/3, 5-HTR1B and NTRK2 may be relevant to the underlying diathesis for suicidal acts.

A DNA methylation-based definition of biologically distinct breast cancer subtypes.

Science.gov (United States)

Stefansson, Olafur A; Moran, Sebastian; Gomez, Antonio; Sayols, Sergi; Arribas-Jorba, Carlos; Sandoval, Juan; Hilmarsdottir, Holmfridur; Olafsdottir, Elinborg; Tryggvadottir, Laufey; Jonasson, Jon G; Eyfjord, Jorunn; Esteller, Manel

2015-03-01

In cancer, epigenetic states are deregulated and thought to be of significance in cancer development and progression. We explored DNA methylation-based signatures in association with breast cancer subtypes to assess their impact on clinical presentation and patient prognosis. DNA methylation was analyzed using Infinium 450K arrays in 40 tumors and 17 normal breast samples, together with DNA copy number changes and subtype-specific markers by tissue microarrays. The identified methylation signatures were validated against a cohort of 212 tumors annotated for breast cancer subtypes by the PAM50 method (The Cancer Genome Atlas). Selected markers were pyrosequenced in an independent validation cohort of 310 tumors and analyzed with respect to survival, clinical stage and grade. The results demonstrate that DNA methylation patterns linked to the luminal-B subtype are characterized by CpG island promoter methylation events. In contrast, a large fraction of basal-like tumors are characterized by hypomethylation events occurring within the gene body. Based on these hallmark signatures, we defined two DNA methylation-based subtypes, Epi-LumB and Epi-Basal, and show that they are associated with unfavorable clinical parameters and reduced survival. Our data show that distinct mechanisms leading to changes in CpG methylation states are operative in different breast cancer subtypes. Importantly, we show that a few selected proxy markers can be used to detect the distinct DNA methylation-based subtypes thereby providing valuable information on disease prognosis. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

DNA Methylation as a Biomarker for Preeclampsia

Energy Technology Data Exchange (ETDEWEB)

Anderson, Cindy M.; Ralph, Jody L.; Wright, Michelle L.; Linggi, Bryan E.; Ohm, Joyce E.

2014-10-01

Background: Preeclampsia contributes significantly to pregnancy-associated morbidity and mortality as well as future risk of cardiovascular disease in mother and offspring, and preeclampsia in offspring. The lack of reliable methods for early detection limits the opportunities for prevention, diagnosis, and timely treatment. Purpose: The purpose of this study was to explore distinct DNA methylation patterns associated with preeclampsia in both maternal cells and fetal-derived tissue that represent potential biomarkers to predict future preeclampsia and inheritance in children. Method: A convenience sample of nulliparous women (N = 55) in the first trimester of pregnancy was recruited for this prospective study. Genome-wide DNA methylation was quantified in first-trimester maternal peripheral white blood cells and placental chorionic tissue from normotensive women and those with preeclampsia (n = 6/group). Results: Late-onset preeclampsia developed in 12.7% of women. Significant differences in DNA methylation were identified in 207 individual linked cytosine and guanine (CpG) sites in maternal white blood cells collected in the first trimester (132 sites with gain and 75 sites with loss of methylation), which were common to approximately 75% of the differentially methylated CpG sites identified in chorionic tissue of fetal origin. Conclusion: This study is the first to identify maternal epigenetic targets and common targets in fetal-derived tissue that represent putative biomarkers for early detection and heritable risk of preeclampsia. Findings may pave the way for diagnosis of preeclampsia prior to its clinical presentation and acute damaging effects, and the potential for prevention of the detrimental long-term sequelae.

Oxidative Stress and DNA Methylation in Prostate Cancer

Directory of Open Access Journals (Sweden)

Krishna Vanaja Donkena

2010-01-01

Full Text Available The protective effects of fruits, vegetables, and other foods on prostate cancer may be due to their antioxidant properties. An imbalance in the oxidative stress/antioxidant status is observed in prostate cancer patients. Genome oxidative damage in prostate cancer patients is associated with higher lipid peroxidation and lower antioxidant levels. Oxygen radicals are associated with different steps of carcinogenesis, including structural DNA damage, epigenetic changes, and protein and lipid alterations. Epigenetics affects genetic regulation, cellular differentiation, embryology, aging, cancer, and other diseases. DNA methylation is perhaps the most extensively studied epigenetic modification, which plays an important role in the regulation of gene expression and chromatin architecture, in association with histone modification and other chromatin-associated proteins. This review will provide a broad overview of the interplay of oxidative stress and DNA methylation, DNA methylation changes in regulation of gene expression, lifestyle changes for prostate cancer prevention, DNA methylation as biomarkers for prostate cancer, methods for detection of methylation, and clinical application of DNA methylation inhibitors for epigenetic therapy.

Exercise-associated DNA methylation change in skeletal muscle and the importance of imprinted genes: a bioinformatics meta-analysis.

Science.gov (United States)

Brown, William M

2015-12-01

Epigenetics is the study of processes--beyond DNA sequence alteration--producing heritable characteristics. For example, DNA methylation modifies gene expression without altering the nucleotide sequence. A well-studied DNA methylation-based phenomenon is genomic imprinting (ie, genotype-independent parent-of-origin effects). We aimed to elucidate: (1) the effect of exercise on DNA methylation and (2) the role of imprinted genes in skeletal muscle gene networks (ie, gene group functional profiling analyses). Gene ontology (ie, gene product elucidation)/meta-analysis. 26 skeletal muscle and 86 imprinted genes were subjected to g:Profiler ontology analysis. Meta-analysis assessed exercise-associated DNA methylation change. g:Profiler found four muscle gene networks with imprinted loci. Meta-analysis identified 16 articles (387 genes/1580 individuals) associated with exercise. Age, method, sample size, sex and tissue variation could elevate effect size bias. Only skeletal muscle gene networks including imprinted genes were reported. Exercise-associated effect sizes were calculated by gene. Age, method, sample size, sex and tissue variation were moderators. Six imprinted loci (RB1, MEG3, UBE3A, PLAGL1, SGCE, INS) were important for muscle gene networks, while meta-analysis uncovered five exercise-associated imprinted loci (KCNQ1, MEG3, GRB10, L3MBTL1, PLAGL1). DNA methylation decreased with exercise (60% of loci). Exercise-associated DNA methylation change was stronger among older people (ie, age accounted for 30% of the variation). Among older people, genes exhibiting DNA methylation decreases were part of a microRNA-regulated gene network functioning to suppress cancer. Imprinted genes were identified in skeletal muscle gene networks and exercise-associated DNA methylation change. Exercise-associated DNA methylation modification could rewind the 'epigenetic clock' as we age. CRD42014009800. Published by the BMJ Publishing Group Limited. For permission to use (where

Global DNA Methylation in the Chestnut Blight Fungus Cryphonectria parasitica and Genome-Wide Changes in DNA Methylation Accompanied with Sectorization

Directory of Open Access Journals (Sweden)

Kum-Kang So

2018-02-01

Full Text Available Mutation in CpBck1, an ortholog of the cell wall integrity mitogen-activated protein kinase kinase kinase (MAPKKK of Saccharomyces cerevisiae, in the chestnut blight fungus Cryphonectria parasitica resulted in a sporadic sectorization as culture proceeded. The progeny from the sectored area maintained the characteristics of the sector, showing a massive morphogenetic change, including robust mycelial growth without differentiation. Epigenetic changes were investigated as the genetic mechanism underlying this sectorization. Quantification of DNA methylation and whole-genome bisulfite sequencing revealed genome-wide DNA methylation of the wild-type at each nucleotide level and changes in DNA methylation of the sectored progeny. Compared to the wild-type, the sectored progeny exhibited marked genome-wide DNA hypomethylation but increased methylation sites. Expression analysis of two DNA methyltransferases, including two representative types of DNA methyltransferase (DNMTase, demonstrated that both were significantly down-regulated in the sectored progeny. However, functional analysis using mutant phenotypes of corresponding DNMTases demonstrated that a mutant of CpDmt1, an ortholog of RID of Neurospora crassa, resulted in the sectored phenotype but the CpDmt2 mutant did not, suggesting that the genetic basis of fungal sectorization is more complex. The present study revealed that a mutation in a signaling pathway component resulted in sectorization accompanied with changes in genome-wide DNA methylation, which suggests that this signal transduction pathway is important for epigenetic control of sectorization via regulation of genes involved in DNA methylation.

Obesity-induced sperm DNA methylation changes at satellite repeats are reprogrammed in rat offspring

Directory of Open Access Journals (Sweden)

Neil A Youngson

2016-01-01

Full Text Available There is now strong evidence that the paternal contribution to offspring phenotype at fertilisation is more than just DNA. However, the identity and mechanisms of this nongenetic inheritance are poorly understood. One of the more important questions in this research area is: do changes in sperm DNA methylation have phenotypic consequences for offspring? We have previously reported that offspring of obese male rats have altered glucose metabolism compared with controls and that this effect was inherited through nongenetic means. Here, we describe investigations into sperm DNA methylation in a new cohort using the same protocol. Male rats on a high-fat diet were 30% heavier than control-fed males at the time of mating (16-19 weeks old, n = 14/14. A small (0.25% increase in total 5-methyl-2Ͳ-deoxycytidine was detected in obese rat spermatozoa by liquid chromatography tandem mass spectrometry. Examination of the repetitive fraction of the genome with methyl-CpG binding domain protein-enriched genome sequencing (MBD-Seq and pyrosequencing revealed that retrotransposon DNA methylation states in spermatozoa were not affected by obesity, but methylation at satellite repeats throughout the genome was increased. However, examination of muscle, liver, and spermatozoa from male 27-week-old offspring from obese and control fathers (both groups from n = 8 fathers revealed that normal DNA methylation levels were restored during offspring development. Furthermore, no changes were found in three genomic imprints in obese rat spermatozoa. Our findings have implications for transgenerational epigenetic reprogramming. They suggest that postfertilization mechanisms exist for normalising some environmentally-induced DNA methylation changes in sperm cells.

Infant sex-specific placental cadmium and DNA methylation associations

Energy Technology Data Exchange (ETDEWEB)

Mohanty, April F., E-mail: april.mohanty@va.gov [Cardiovascular Health Research Unit, University of Washington, 1730 Minor Ave, Seattle, WA 98101 (United States); Department of Epidemiology, School of Public Health, University of Washington, Seattle, WA (United States); Farin, Fred M., E-mail: freddy@u.washington.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way N.E., Suite #100, Seattle, WA 98105 (United States); Bammler, Theo K., E-mail: tbammler@u.washington.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way N.E., Suite #100, Seattle, WA 98105 (United States); MacDonald, James W., E-mail: jmacdon@uw.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way N.E., Suite #100, Seattle, WA 98105 (United States); Afsharinejad, Zahra, E-mail: zafshari@u.washington.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way N.E., Suite #100, Seattle, WA 98105 (United States); Burbacher, Thomas M., E-mail: tmb@uw.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, Box: 357234, 1705 N.E. Pacific Street, Seattle, WA 98195 (United States); Siscovick, David S., E-mail: dsiscovick@nyam.org [Cardiovascular Health Research Unit, University of Washington, 1730 Minor Ave, Seattle, WA 98101 (United States); Department of Epidemiology, School of Public Health, University of Washington, Seattle, WA (United States); Department of Medicine, University of Washington, Seattle, WA (United States); and others

2015-04-15

Background: Recent evidence suggests that maternal cadmium (Cd) burden and fetal growth associations may vary by fetal sex. However, mechanisms contributing to these differences are unknown. Objectives: Among 24 maternal-infant pairs, we investigated infant sex-specific associations between placental Cd and placental genome-wide DNA methylation. Methods: We used ANOVA models to examine sex-stratified associations of placental Cd (dichotomized into high/low Cd using sex-specific Cd median cutoffs) with DNA methylation at each cytosine-phosphate-guanine site or region. Statistical significance was defined using a false discovery rate cutoff (<0.10). Results: Medians of placental Cd among females and males were 5 and 2 ng/g, respectively. Among females, three sites (near ADP-ribosylation factor-like 9 (ARL9), siah E3 ubiquitin protein ligase family member 3 (SIAH3), and heparin sulfate (glucosamine) 3-O-sulfotransferase 4 (HS3ST4) and one region on chromosome 7 (including carnitine O-octanoyltransferase (CROT) and TP5S target 1 (TP53TG1)) were hypomethylated in high Cd placentas. Among males, high placental Cd was associated with methylation of three sites, two (hypomethylated) near MDS1 and EVI1 complex locus (MECOM) and one (hypermethylated) near spalt-like transcription factor 1 (SALL1), and two regions (both hypomethylated, one on chromosome 3 including MECOM and another on chromosome 8 including rho guanine nucleotide exchange factor (GEF) 10 (ARHGEF10). Differentially methylated sites were at or close to transcription start sites of genes involved in cell damage response (SIAH3, HS3ST4, TP53TG1) in females and cell differentiation, angiogenesis and organ development (MECOM, SALL1) in males. Conclusions: Our preliminary study supports infant sex-specific placental Cd-DNA methylation associations, possibly accounting for previously reported differences in Cd-fetal growth associations across fetal sex. Larger studies are needed to replicate and extend these

Infant sex-specific placental cadmium and DNA methylation associations

International Nuclear Information System (INIS)

Mohanty, April F.; Farin, Fred M.; Bammler, Theo K.; MacDonald, James W.; Afsharinejad, Zahra; Burbacher, Thomas M.; Siscovick, David S.

2015-01-01

Background: Recent evidence suggests that maternal cadmium (Cd) burden and fetal growth associations may vary by fetal sex. However, mechanisms contributing to these differences are unknown. Objectives: Among 24 maternal-infant pairs, we investigated infant sex-specific associations between placental Cd and placental genome-wide DNA methylation. Methods: We used ANOVA models to examine sex-stratified associations of placental Cd (dichotomized into high/low Cd using sex-specific Cd median cutoffs) with DNA methylation at each cytosine-phosphate-guanine site or region. Statistical significance was defined using a false discovery rate cutoff (<0.10). Results: Medians of placental Cd among females and males were 5 and 2 ng/g, respectively. Among females, three sites (near ADP-ribosylation factor-like 9 (ARL9), siah E3 ubiquitin protein ligase family member 3 (SIAH3), and heparin sulfate (glucosamine) 3-O-sulfotransferase 4 (HS3ST4) and one region on chromosome 7 (including carnitine O-octanoyltransferase (CROT) and TP5S target 1 (TP53TG1)) were hypomethylated in high Cd placentas. Among males, high placental Cd was associated with methylation of three sites, two (hypomethylated) near MDS1 and EVI1 complex locus (MECOM) and one (hypermethylated) near spalt-like transcription factor 1 (SALL1), and two regions (both hypomethylated, one on chromosome 3 including MECOM and another on chromosome 8 including rho guanine nucleotide exchange factor (GEF) 10 (ARHGEF10). Differentially methylated sites were at or close to transcription start sites of genes involved in cell damage response (SIAH3, HS3ST4, TP53TG1) in females and cell differentiation, angiogenesis and organ development (MECOM, SALL1) in males. Conclusions: Our preliminary study supports infant sex-specific placental Cd-DNA methylation associations, possibly accounting for previously reported differences in Cd-fetal growth associations across fetal sex. Larger studies are needed to replicate and extend these

Variants in SLC18A3, vesicular acetylcholine transporter, cause congenital myasthenic syndrome

NARCIS (Netherlands)

O'Grady, Gina L.; Verschuuren, Corien; Yuen, Michaela; Webster, Richard; Menezes, Manoj; Fock, Johanna M.; Pride, Natalie; Best, Heather A.; Damm, Tatiana Benavides; Turner, Christian; Lek, Monkol; Engel, Andrew G.; North, Kathryn N.; Clarke, Nigel F.; MacArthur, Daniel G.; Kamsteeg, Erik-Jan; Cooper, Sandra T.

2016-01-01

Objective: To describe the clinical and genetic characteristics of presynaptic congenital myasthenic syndrome secondary to biallelic variants in SLC18A3. Methods: Individuals from 2 families were identified with biallelic variants in SLC18A3, the gene encoding the vesicular acetylcholine transporter

A panel of genes methylated with high frequency in colorectal cancer

International Nuclear Information System (INIS)

Mitchell, Susan M; Beetson, Iain; Rand, Keith N; McEvoy, Aidan; Thomas, Melissa L; Baker, Rohan T; Wattchow, David A; Young, Graeme P; Lockett, Trevor J; Pedersen, Susanne K; LaPointe, Lawrence C; Ross, Jason P; Molloy, Peter L; Drew, Horace R; Ho, Thu; Brown, Glenn S; Saunders, Neil FW; Duesing, Konsta R; Buckley, Michael J; Dunne, Rob

2014-01-01

(SOX21, SLC6A15, NPY, GRASP, ST8SIA1 and ZSCAN18) show very low methylation in non-neoplastic colorectal tissue and are candidate biomarkers for stool-based assays, while 11 genes (BCAT1, COL4A2, DLX5, FGF5, FOXF1, FOXI2, GRASP, IKZF1, IRF4, SDC2 and SOX21) have very low methylation in peripheral blood DNA and are suitable for further evaluation as blood-based diagnostic markers

Folate, colorectal cancer and the involvement of DNA methylation.

Science.gov (United States)

Williams, Elizabeth A

2012-11-01

Diet is a major factor in the aetiology of colorectal cancer (CRC). Epidemiological evidence suggests that folate confers a modest protection against CRC risk. However, the relationship is complex, and evidence from human intervention trials and animal studies suggests that a high-dose of folic acid supplementation may enhance the risk of colorectal carcinogenesis in certain circumstances. The molecular mechanisms underlying the apparent dual modulatory effect of folate on colorectal carcinogenesis are not fully understood. Folate is central to C1 metabolism and is needed for both DNA synthesis and DNA methylation, providing plausible biological mechanisms through which folate could modulate cancer risk. Aberrant DNA methylation is an early event in colorectal carcinogenesis and is typically associated with the transcriptional silencing of tumour suppressor genes. Folate is required for the production of S-adenosyl methionine, which serves as a methyl donor for DNA methylation events; thereby folate availability is proposed to modulate DNA methylation status. The evidence for an effect of folate on DNA methylation in the human colon is limited, but a modulation of DNA methylation in response to folate has been demonstrated. More research is required to clarify the optimum intake of folate for CRC prevention and to elucidate the effect of folate availability on DNA methylation and the associated impact on CRC biology.

Age-associated sperm DNA methylation alterations: possible implications in offspring disease susceptibility.

Science.gov (United States)

Jenkins, Timothy G; Aston, Kenneth I; Pflueger, Christian; Cairns, Bradley R; Carrell, Douglas T

2014-07-01

Recent evidence demonstrates a role for paternal aging on offspring disease susceptibility. It is well established that various neuropsychiatric disorders (schizophrenia, autism, etc.), trinucleotide expansion associated diseases (myotonic dystrophy, Huntington's, etc.) and even some forms of cancer have increased incidence in the offspring of older fathers. Despite strong epidemiological evidence that these alterations are more common in offspring sired by older fathers, in most cases the mechanisms that drive these processes are unclear. However, it is commonly believed that epigenetics, and specifically DNA methylation alterations, likely play a role. In this study we have investigated the impact of aging on DNA methylation in mature human sperm. Using a methylation array approach we evaluated changes to sperm DNA methylation patterns in 17 fertile donors by comparing the sperm methylome of 2 samples collected from each individual 9-19 years apart. With this design we have identified 139 regions that are significantly and consistently hypomethylated with age and 8 regions that are significantly hypermethylated with age. A representative subset of these alterations have been confirmed in an independent cohort. A total of 117 genes are associated with these regions of methylation alterations (promoter or gene body). Intriguingly, a portion of the age-related changes in sperm DNA methylation are located at genes previously associated with schizophrenia and bipolar disorder. While our data does not establish a causative relationship, it does raise the possibility that the age-associated methylation of the candidate genes that we observe in sperm might contribute to the increased incidence of neuropsychiatric and other disorders in the offspring of older males. However, further study is required to determine whether, and to what extent, a causative relationship exists.

DNA Methylation: A Frontier in Tooth Organogenesis and Developmental Dental Defects.

Science.gov (United States)

Wan, Mian; Li, Hongyu; Zhou, Yachuan; Du, Wei; Xu, Xin; Ye, Ling; Zhou, Xuedong; Zheng, Liwei

2018-01-01

Tooth development relies on interactions between epithelial and mesenchymal tissues, which are controlled by sophisticated networks of conserved signaling. The signaling networks regulating odontogenesis have been well characterized, but the epigenetic mechanisms underlying remain to be elucidated. In this review, we describe current researches regarding the control of various genes expression by DNA methylation during odontogenesis, summarize genomic mapping of DNA methylation in various stages of tooth formation and diverse dental tissues by high-throughput approaches, and highlight the roles of DNA methylation in odontogenesis. Researches on mammals have revealed that the genomic methylation, which occurs on cytosine residues, regulates certain genes transcription. Consequently, DNA methylation plays a crucial role in spatiotemporal organization of signaling pathways, and is essential for organogenesis. Recently, mounting evidence proves that methylation of genomes contributes to the spatiotemporal gene dynamics during odontogenesis. With emerging new technologies of mapping cytosine modifications in global genome, investigators are seeking an overall view of DNA methylome dynamics that characterize genetic information to manifest across incredibly varied tooth development stages, dental tissues, and developmental dental defects. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Genome-wide DNA methylation analyses in the brain reveal four differentially methylated regions between humans and non-human primates

Directory of Open Access Journals (Sweden)

Wang Jinkai

2012-08-01

Full Text Available Abstract Background The highly improved cognitive function is the most significant change in human evolutionary history. Recently, several large-scale studies reported the evolutionary roles of DNA methylation; however, the role of DNA methylation on brain evolution is largely unknown. Results To test if DNA methylation has contributed to the evolution of human brain, with the use of MeDIP-Chip and SEQUENOM MassARRAY, we conducted a genome-wide analysis to identify differentially methylated regions (DMRs in the brain between humans and rhesus macaques. We first identified a total of 150 candidate DMRs by the MeDIP-Chip method, among which 4 DMRs were confirmed by the MassARRAY analysis. All 4 DMRs are within or close to the CpG islands, and a MIR3 repeat element was identified in one DMR, but no repeat sequence was observed in the other 3 DMRs. For the 4 DMR genes, their proteins tend to be conserved and two genes have neural related functions. Bisulfite sequencing and phylogenetic comparison among human, chimpanzee, rhesus macaque and rat suggested several regions of lineage specific DNA methylation, including a human specific hypomethylated region in the promoter of K6IRS2 gene. Conclusions Our study provides a new angle of studying human brain evolution and understanding the evolutionary role of DNA methylation in the central nervous system. The results suggest that the patterns of DNA methylation in the brain are in general similar between humans and non-human primates, and only a few DMRs were identified.

Colorimetric determination of DNase I activity with a DNA-methyl green substrate.

Science.gov (United States)

Sinicropi, D; Baker, D L; Prince, W S; Shiffer, K; Shak, S

1994-11-01

A simple, high throughput, and precise assay was developed for quantification of deoxyribonuclease I (DNase; IUB 3.1.21.1) activity. The method was adapted from the procedure devised by Kurnick which employs a substrate comprised of highly polymerized native DNA complexed with methyl green. Hydrolysis of the DNA produced unbound methyl green and a decrease in the absorbance of the solution at 620 nm. By adjusting the time and temperature of the reaction, the assay permits quantification of DNase activity over a wide concentration range (0.4 to 8900 ng/ml). Samples and standards were added to the substrate in microtiter plates and were incubated for 1-24 h at 25-37 degrees C to achieve the desired assay range. The DNase activity of the samples was interpolated from a standard curve generated with Pulmozyme recombinant human deoxyribonuclease I (rhDNase). Interassay precision was less than 12% CV and recovery was within 100 +/- 11%. Activity determination by the DNA-methyl green method correlated well with that determined by the widely used "hyperchromicity" method originated by Kunitz, which is based on the increase in absorbance at 260 nm upon hydrolysis of DNA. The DNA-methyl green assay was simpler and more versatile than the hyperchromicity method and was used to characterize the activity of rhDNase and DNase isolated from human urine.

Quantitative analysis of DNA methylation in chronic lymphocytic leukemia patients.

Science.gov (United States)

Lyko, Frank; Stach, Dirk; Brenner, Axel; Stilgenbauer, Stephan; Döhner, Hartmut; Wirtz, Michaela; Wiessler, Manfred; Schmitz, Oliver J

2004-06-01

Changes in the genomic DNA methylation level have been found to be closely associated with tumorigenesis. In order to analyze the relation of aberrant DNA methylation to clinical and biological risk factors, we have determined the cytosine methylation level of 81 patients diagnosed with chronic lymphocytic leukemia (CLL). The analysis was based on DNA hydrolysis followed by derivatization of the 2'-desoxyribonucleoside-3'-monophosphates with BODIPY FL EDA. Derivatives were separated by micellar electrokinetic chromatography, and laser-induced fluorescence was used for detection. We analyzed potential correlations between DNA methylation levels and numerous patient parameters, including clinical observations and biological data. As a result, we observed a significant correlation with the immunoglobulin variable heavy chain gene (VH) mutation status. This factor has been repeatedly proposed as a reliable prognostic marker for CLL, which suggests that the methylation level might be a valuable factor in determining the prognostic outcome of CLL. We are now in the process of refining our method to broaden its application potential. In this context, we show here that the oxidation of the fluorescence marker in the samples and the evaporation of methanol in the electrolytes can be prevented by a film of paraffin oil. In summary, our results thus establish capillary electrophoresis as a valuable tool for analyzing the DNA methylation status of clinical samples.

Aberrant DNA Methylation: Implications in Racial Health Disparity.

Directory of Open Access Journals (Sweden)

Xuefeng Wang

Full Text Available Incidence and mortality rates of colorectal carcinoma (CRC are higher in African Americans (AAs than in Caucasian Americans (CAs. Deficient micronutrient intake due to dietary restrictions in racial/ethnic populations can alter genetic and molecular profiles leading to dysregulated methylation patterns and the inheritance of somatic to germline mutations.Total DNA and RNA samples of paired tumor and adjacent normal colon tissues were prepared from AA and CA CRC specimens. Reduced Representation Bisulfite Sequencing (RRBS and RNA sequencing were employed to evaluate total genome methylation of 5'-regulatory regions and dysregulation of gene expression, respectively. Robust analysis was conducted using a trimming-and-retrieving scheme for RRBS library mapping in conjunction with the BStool toolkit.DNA from the tumor of AA CRC patients, compared to adjacent normal tissues, contained 1,588 hypermethylated and 100 hypomethylated differentially methylated regions (DMRs. Whereas, 109 hypermethylated and 4 hypomethylated DMRs were observed in DNA from the tumor of CA CRC patients; representing a 14.6-fold and 25-fold change, respectively. Specifically; CHL1, 4 anti-inflammatory genes (i.e., NELL1, GDF1, ARHGEF4, and ITGA4, and 7 miRNAs (of which miR-9-3p and miR-124-3p have been implicated in CRC were hypermethylated in DNA samples from AA patients with CRC. From the same sample set, RNAseq analysis revealed 108 downregulated genes (including 14 ribosomal proteins and 34 upregulated genes (including POLR2B and CYP1B1 [targets of miR-124-3p] in AA patients with CRC versus CA patients.DNA methylation profile and/or products of its downstream targets could serve as biomarker(s addressing racial health disparity.

DNA methylation and healthy human aging.

Science.gov (United States)

Jones, Meaghan J; Goodman, Sarah J; Kobor, Michael S

2015-12-01

The process of aging results in a host of changes at the cellular and molecular levels, which include senescence, telomere shortening, and changes in gene expression. Epigenetic patterns also change over the lifespan, suggesting that epigenetic changes may constitute an important component of the aging process. The epigenetic mark that has been most highly studied is DNA methylation, the presence of methyl groups at CpG dinucleotides. These dinucleotides are often located near gene promoters and associate with gene expression levels. Early studies indicated that global levels of DNA methylation increase over the first few years of life and then decrease beginning in late adulthood. Recently, with the advent of microarray and next-generation sequencing technologies, increases in variability of DNA methylation with age have been observed, and a number of site-specific patterns have been identified. It has also been shown that certain CpG sites are highly associated with age, to the extent that prediction models using a small number of these sites can accurately predict the chronological age of the donor. Together, these observations point to the existence of two phenomena that both contribute to age-related DNA methylation changes: epigenetic drift and the epigenetic clock. In this review, we focus on healthy human aging throughout the lifetime and discuss the dynamics of DNA methylation as well as how interactions between the genome, environment, and the epigenome influence aging rates. We also discuss the impact of determining 'epigenetic age' for human health and outline some important caveats to existing and future studies. © 2015 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

Relaxation of IGF2/H19 imprinting in Wilms tumour is associated with a switch in DNA methylation

Energy Technology Data Exchange (ETDEWEB)

Reeve, A.E.; Taniguchi, T.; Sullivan, M.J.; Ogawa, O. [Univ. of Otago, Dunedin (New Zealand)

1994-09-01

We and others have recently shown that the normal imprinting of the insulin-like growth factor 2 (IGF2) gene is disrupted in Wilms tumor. The process of relaxation of IGF2 imprinting leads to the activation of transcription of the normally silent maternally inherited IGF2 allele such that both alleles of the IGF2 gene are transcribed. Relaxation of IGF2 imprinting has also been detected as a constitutional event in patients with the Beckwith-Wiedemann syndrom and a patient with gigantism and Wilms tumor. We have now shown that in Wilms tumors in which imprinting is relaxed, IGF2 is transcribed from the maternal allele and there is a concomitant transcriptional inactivation of the H19 maternal allele. Furthermore, the patterns of methylation of the IGF2 and H19 gene are reversed on the maternal chromosome. Relaxation of imprinting in Wilms tumors appear, therefore, to be associated with a switch in gene expression and methylation at the IGF2/H19 locus. The data supports the notion of a disrupted IGF2/H19 imprinting switch in Wilms tumor.

DNA methylation regulates neurophysiological spatial representation in memory formation

Directory of Open Access Journals (Sweden)

Eric D. Roth

2015-04-01

Full Text Available Epigenetic mechanisms including altered DNA methylation are critical for altered gene transcription subserving synaptic plasticity and the retention of learned behavior. Here, we tested the idea that one role for activity-dependent altered DNA methylation is stabilization of cognition-associated hippocampal place cell firing in response to novel place learning. We observed that a behavioral protocol (spatial exploration of a novel environment known to induce hippocampal place cell remapping resulted in alterations of hippocampal Bdnf DNA methylation. Further studies using neurophysiological in vivo single-unit recordings revealed that pharmacological manipulations of DNA methylation decreased long-term but not short-term place field stability. Together, our data highlight a role for DNA methylation in regulating neurophysiological spatial representation and memory formation.

DNA methylation regulates neurophysiological spatial representation in memory formation.

Science.gov (United States)

Roth, Eric D; Roth, Tania L; Money, Kelli M; SenGupta, Sonda; Eason, Dawn E; Sweatt, J David

2015-04-01

Epigenetic mechanisms including altered DNA methylation are critical for altered gene transcription subserving synaptic plasticity and the retention of learned behavior. Here we tested the idea that one role for activity-dependent altered DNA methylation is stabilization of cognition-associated hippocampal place cell firing in response to novel place learning. We observed that a behavioral protocol (spatial exploration of a novel environment) known to induce hippocampal place cell remapping resulted in alterations of hippocampal Bdnf DNA methylation. Further studies using neurophysiological in vivo single unit recordings revealed that pharmacological manipulations of DNA methylation decreased long-term but not short-term place field stability. Together our data highlight a role for DNA methylation in regulating neurophysiological spatial representation and memory formation.

Evidence Suggesting Absence of Mitochondrial DNA Methylation

DEFF Research Database (Denmark)

Mechta, Mie; Ingerslev, Lars R; Fabre, Odile

2017-01-01

, 16S, ND5 and CYTB, suggesting that mtDNA supercoiled structure blocks the access to bisulfite conversion. Here, we identified an artifact of mtDNA bisulfite sequencing that can lead to an overestimation of mtDNA methylation levels. Our study supports that cytosine methylation is virtually absent...

Whole genome DNA methylation: beyond genes silencing

OpenAIRE

Tirado-Magallanes, Roberto; Rebbani, Khadija; Lim, Ricky; Pradhan, Sriharsa; Benoukraf, Touati

2016-01-01

The combination of DNA bisulfite treatment with high-throughput sequencing technologies has enabled investigation of genome-wide DNA methylation at near base pair level resolution, far beyond that of the kilobase-long canonical CpG islands that initially revealed the biological relevance of this covalent DNA modification. The latest high-resolution studies have revealed a role for very punctual DNA methylation in chromatin plasticity, gene regulation and splicing. Here, we aim to outline the ...

Methylation effect on the ohmic resistance of a poly-GC DNA-like chain

Energy Technology Data Exchange (ETDEWEB)

Moura, F.A.B.F. de, E-mail: fidelis@fis.ufal.br [Instituto de Física, Universidade Federal de Alagoas, Maceió AL 57072-970 (Brazil); Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, Maceió AL 57072-970 (Brazil); Almeida, M.L. de; Ourique, G.S.; Fulco, U.L.; Albuquerque, E.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil)

2016-10-14

We determine, by using a tight-binding model Hamiltonian, the characteristic current–voltage (IxV) curves of a 5-methylated cytosine single strand poly-GC DNA-like finite segment, considering the methyl groups attached laterally to a random fraction of the cytosine basis. Striking, we found that the methylation significantly impacts the ohmic resistance (R) of the DNA-like segments, indicating that measurements of R can be used as a biosensor tool to probe the presence of anomalous methylation. - Highlights: • Ohmic resistance of finite segments of poly-CG DNA-like segments. • Possibility for the development of biosensor devices. • Methylation effect and electronic transport in DNA-like segments.

DNA methylation regulates transcriptional homeostasis of algal endosymbiosis in the coral model Aiptasia

KAUST Repository

Li, Yong

2017-11-03

The symbiotic relationship between cnidarians and dinoflagellates is the cornerstone of coral reef ecosystems. Although research is focusing on the molecular mechanisms underlying this symbiosis, the role of epigenetic mechanisms, which have been implicated in transcriptional regulation and acclimation to environmental change, is unknown. To assess the role of DNA methylation in the cnidarian-dinoflagellate symbiosis, we analyzed genome-wide CpG methylation, histone associations, and transcriptomic states of symbiotic and aposymbiotic anemones in the model system Aiptasia. We find methylated genes are marked by histone H3K36me3 and show significant reduction of spurious transcription and transcriptional noise, revealing a role of DNA methylation in the maintenance of transcriptional homeostasis. Changes in DNA methylation and expression show enrichment for symbiosis-related processes such as immunity, apoptosis, phagocytosis recognition and phagosome formation, and unveil intricate interactions between the underlying pathways. Our results demonstrate that DNA methylation provides an epigenetic mechanism of transcriptional homeostasis during symbiosis.

DNA methylation regulates transcriptional homeostasis of algal endosymbiosis in the coral model Aiptasia

KAUST Repository

Li, Yong; Liew, Yi Jin; Cui, Guoxin; Cziesielski, Maha J; Zahran, Noura Ibrahim Omar; Michell, Craig T; Voolstra, Christian R.; Aranda, Manuel

2017-01-01

The symbiotic relationship between cnidarians and dinoflagellates is the cornerstone of coral reef ecosystems. Although research is focusing on the molecular mechanisms underlying this symbiosis, the role of epigenetic mechanisms, which have been implicated in transcriptional regulation and acclimation to environmental change, is unknown. To assess the role of DNA methylation in the cnidarian-dinoflagellate symbiosis, we analyzed genome-wide CpG methylation, histone associations, and transcriptomic states of symbiotic and aposymbiotic anemones in the model system Aiptasia. We find methylated genes are marked by histone H3K36me3 and show significant reduction of spurious transcription and transcriptional noise, revealing a role of DNA methylation in the maintenance of transcriptional homeostasis. Changes in DNA methylation and expression show enrichment for symbiosis-related processes such as immunity, apoptosis, phagocytosis recognition and phagosome formation, and unveil intricate interactions between the underlying pathways. Our results demonstrate that DNA methylation provides an epigenetic mechanism of transcriptional homeostasis during symbiosis.

Methylated DNA Immunoprecipitation Analysis of Mammalian Endogenous Retroviruses.

Science.gov (United States)

Rebollo, Rita; Mager, Dixie L

2016-01-01

Endogenous retroviruses are repetitive sequences found abundantly in mammalian genomes which are capable of modulating host gene expression. Nevertheless, most endogenous retrovirus copies are under tight epigenetic control via histone-repressive modifications and DNA methylation. Here we describe a common method used in our laboratory to detect, quantify, and compare mammalian endogenous retrovirus DNA methylation. More specifically we describe methylated DNA immunoprecipitation (MeDIP) followed by quantitative PCR.

Maternal Methyl-Group Donor Intake and Global DNA (HydroxyMethylation before and during Pregnancy

Directory of Open Access Journals (Sweden)

Sara Pauwels