WorldWideScience

Sample records for methods secondary analysis

  1. A method for rapid similarity analysis of RNA secondary structures

    Directory of Open Access Journals (Sweden)

    Liu Na

    2006-11-01

    Full Text Available Abstract Background Owing to the rapid expansion of RNA structure databases in recent years, efficient methods for structure comparison are in demand for function prediction and evolutionary analysis. Usually, the similarity of RNA secondary structures is evaluated based on tree models and dynamic programming algorithms. We present here a new method for the similarity analysis of RNA secondary structures. Results Three sets of real data have been used as input for the example applications. Set I includes the structures from 5S rRNAs. Set II includes the secondary structures from RNase P and RNase MRP. Set III includes the structures from 16S rRNAs. Reasonable phylogenetic trees are derived for these three sets of data by using our method. Moreover, our program runs faster as compared to some existing ones. Conclusion The famous Lempel-Ziv algorithm can efficiently extract the information on repeated patterns encoded in RNA secondary structures and makes our method an alternative to analyze the similarity of RNA secondary structures. This method will also be useful to researchers who are interested in evolutionary analysis.

  2. The multiple imputation method: a case study involving secondary data analysis.

    Science.gov (United States)

    Walani, Salimah R; Cleland, Charles M

    2015-05-01

    To illustrate with the example of a secondary data analysis study the use of the multiple imputation method to replace missing data. Most large public datasets have missing data, which need to be handled by researchers conducting secondary data analysis studies. Multiple imputation is a technique widely used to replace missing values while preserving the sample size and sampling variability of the data. The 2004 National Sample Survey of Registered Nurses. The authors created a model to impute missing values using the chained equation method. They used imputation diagnostics procedures and conducted regression analysis of imputed data to determine the differences between the log hourly wages of internationally educated and US-educated registered nurses. The authors used multiple imputation procedures to replace missing values in a large dataset with 29,059 observations. Five multiple imputed datasets were created. Imputation diagnostics using time series and density plots showed that imputation was successful. The authors also present an example of the use of multiple imputed datasets to conduct regression analysis to answer a substantive research question. Multiple imputation is a powerful technique for imputing missing values in large datasets while preserving the sample size and variance of the data. Even though the chained equation method involves complex statistical computations, recent innovations in software and computation have made it possible for researchers to conduct this technique on large datasets. The authors recommend nurse researchers use multiple imputation methods for handling missing data to improve the statistical power and external validity of their studies.

  3. Interpretive focus groups: a participatory method for interpreting and extending secondary analysis of qualitative data

    Directory of Open Access Journals (Sweden)

    Michelle Redman-MacLaren

    2014-08-01

    Full Text Available Background: Participatory approaches to qualitative research practice constantly change in response to evolving research environments. Researchers are increasingly encouraged to undertake secondary analysis of qualitative data, despite epistemological and ethical challenges. Interpretive focus groups can be described as a more participative method for groups to analyse qualitative data. Objective: To facilitate interpretive focus groups with women in Papua New Guinea to extend analysis of existing qualitative data and co-create new primary data. The purpose of this was to inform a transformational grounded theory and subsequent health promoting action. Design: A two-step approach was used in a grounded theory study about how women experience male circumcision in Papua New Guinea. Participants analysed portions or ‘chunks’ of existing qualitative data in story circles and built upon this analysis by using the visual research method of storyboarding. Results: New understandings of the data were evoked when women in interpretive focus groups analysed the data ‘chunks’. Interpretive focus groups encouraged women to share their personal experiences about male circumcision. The visual method of storyboarding enabled women to draw pictures to represent their experiences. This provided an additional focus for whole-of-group discussions about the research topic. Conclusions: Interpretive focus groups offer opportunity to enhance trustworthiness of findings when researchers undertake secondary analysis of qualitative data. The co-analysis of existing data and co-generation of new data between research participants and researchers informed an emergent transformational grounded theory and subsequent health promoting action.

  4. Interpretive focus groups: a participatory method for interpreting and extending secondary analysis of qualitative data.

    Science.gov (United States)

    Redman-MacLaren, Michelle; Mills, Jane; Tommbe, Rachael

    2014-01-01

    Participatory approaches to qualitative research practice constantly change in response to evolving research environments. Researchers are increasingly encouraged to undertake secondary analysis of qualitative data, despite epistemological and ethical challenges. Interpretive focus groups can be described as a more participative method for groups to analyse qualitative data. To facilitate interpretive focus groups with women in Papua New Guinea to extend analysis of existing qualitative data and co-create new primary data. The purpose of this was to inform a transformational grounded theory and subsequent health promoting action. A two-step approach was used in a grounded theory study about how women experience male circumcision in Papua New Guinea. Participants analysed portions or 'chunks' of existing qualitative data in story circles and built upon this analysis by using the visual research method of storyboarding. New understandings of the data were evoked when women in interpretive focus groups analysed the data 'chunks'. Interpretive focus groups encouraged women to share their personal experiences about male circumcision. The visual method of storyboarding enabled women to draw pictures to represent their experiences. This provided an additional focus for whole-of-group discussions about the research topic. Interpretive focus groups offer opportunity to enhance trustworthiness of findings when researchers undertake secondary analysis of qualitative data. The co-analysis of existing data and co-generation of new data between research participants and researchers informed an emergent transformational grounded theory and subsequent health promoting action.

  5. Assessing the Risk of Secondary Transfer Via Fingerprint Brush Contamination Using Enhanced Sensitivity DNA Analysis Methods.

    Science.gov (United States)

    Bolivar, Paula-Andrea; Tracey, Martin; McCord, Bruce

    2016-01-01

    Experiments were performed to determine the extent of cross-contamination of DNA resulting from secondary transfer due to fingerprint brushes used on multiple items of evidence. Analysis of both standard and low copy number (LCN) STR was performed. Two different procedures were used to enhance sensitivity, post-PCR cleanup and increased cycle number. Under standard STR typing procedures, some additional alleles were produced that were not present in the controls or blanks; however, there was insufficient data to include the contaminant donor as a contributor. Inclusion of the contaminant donor did occur for one sample using post-PCR cleanup. Detection of the contaminant donor occurred for every replicate of the 31 cycle amplifications; however, using LCN interpretation recommendations for consensus profiles, only one sample would include the contaminant donor. Our results indicate that detection of secondary transfer of DNA can occur through fingerprint brush contamination and is enhanced using LCN-DNA methods. © 2015 American Academy of Forensic Sciences.

  6. An axisymmetric method of creep analysis for primary and secondary creep

    International Nuclear Information System (INIS)

    Jahed, Hamid; Bidabadi, Jalal

    2003-01-01

    A general axisymmetric method for elastic-plastic analysis was previously proposed by Jahed and Dubey [ASME J Pressure Vessels Technol 119 (1997) 264]. In the present work the method is extended to the time domain. General rate type governing equations are derived and solved in terms of rate of change of displacement as a function of rate of change in loading. Different types of loading, such as internal and external pressure, centrifugal loading and temperature gradient, are considered. To derive specific equations and employ the proposed formulation, the problem of an inhomogeneous non-uniform rotating disc is worked out. Primary and secondary creep behaviour is predicted using the proposed method and results are compared to FEM results. The problem of creep in pressurized vessels is also solved. Several numerical examples show the effectiveness and robustness of the proposed method

  7. Protein secondary structure assignment revisited: a detailed analysis of different assignment methods

    Directory of Open Access Journals (Sweden)

    de Brevern Alexandre G

    2005-09-01

    Full Text Available Abstract Background A number of methods are now available to perform automatic assignment of periodic secondary structures from atomic coordinates, based on different characteristics of the secondary structures. In general these methods exhibit a broad consensus as to the location of most helix and strand core segments in protein structures. However the termini of the segments are often ill-defined and it is difficult to decide unambiguously which residues at the edge of the segments have to be included. In addition, there is a "twilight zone" where secondary structure segments depart significantly from the idealized models of Pauling and Corey. For these segments, one has to decide whether the observed structural variations are merely distorsions or whether they constitute a break in the secondary structure. Methods To address these problems, we have developed a method for secondary structure assignment, called KAKSI. Assignments made by KAKSI are compared with assignments given by DSSP, STRIDE, XTLSSTR, PSEA and SECSTR, as well as secondary structures found in PDB files, on 4 datasets (X-ray structures with different resolution range, NMR structures. Results A detailed comparison of KAKSI assignments with those of STRIDE and PSEA reveals that KAKSI assigns slightly longer helices and strands than STRIDE in case of one-to-one correspondence between the segments. However, KAKSI tends also to favor the assignment of several short helices when STRIDE and PSEA assign longer, kinked, helices. Helices assigned by KAKSI have geometrical characteristics close to those described in the PDB. They are more linear than helices assigned by other methods. The same tendency to split long segments is observed for strands, although less systematically. We present a number of cases of secondary structure assignments that illustrate this behavior. Conclusion Our method provides valuable assignments which favor the regularity of secondary structure segments.

  8. Alarm analysis of secondary loop system based on MFM and SDG methods

    International Nuclear Information System (INIS)

    Yang Ning; Lu Gubing; Chen Pan

    2014-01-01

    The multilevel flow model (MFM) and the signed directed graph (SDG) were combined to analyze the alarm signals of the secondary loop system for nuclear power plant. The MFM was used to delaminate and describe nuclear power plant, and the SDG was used to analyze the logicality of the facility sign in the MFM. Two kinds of faults in the secondary loop system in nuclear power plant were simulated and the alarm signals were analyzed. The simulation results show that the fault source can be identified exactly and the transmit route of the alarm signals can be described clearly, which is helpful for operators to judge. (authors)

  9. Measurement of Primary and Secondary Stability of Dental Implants by Resonance Frequency Analysis Method in Mandible

    Science.gov (United States)

    Shokri, Mehran; Daraeighadikolaei, Arash

    2013-01-01

    Background. There is no doubt that the success of the dental implants depends on the stability. The aim of this work was to measure the stability of dental implants prior to loading the implants, using a resonance frequency analysis (RFA) by Osstell mentor device. Methods. Ten healthy and nonsmoker patients over 40 years of age with at least six months of complete or partial edentulous mouth received screw-type dental implants by a 1-stage procedure. RFA measurements were obtained at surgery and 1, 2, 3, 4, 5, 7, and 11 weeks after the implant surgery. Results. Among fifteen implants, the lowest mean stability measurement was for the 4th week after surgery in all bone types. At placement, the mean ISQ obtained with the magnetic device was 77.2 with 95% confidence interval (CI) = 2.49, and then it decreased until the 4th week to 72.13 (95% CI = 2.88), and at the last measurement, the mean implant stability significantly (P value implant placement. These suggestions need to be further assessed through future studies. PMID:23737790

  10. Qualitative Secondary Analysis: A Case Exemplar.

    Science.gov (United States)

    Tate, Judith Ann; Happ, Mary Beth

    Qualitative secondary analysis (QSA) is the use of qualitative data that was collected by someone else or was collected to answer a different research question. Secondary analysis of qualitative data provides an opportunity to maximize data utility, particularly with difficult-to-reach patient populations. However, qualitative secondary analysis methods require careful consideration and explicit description to best understand, contextualize, and evaluate the research results. In this article, we describe methodologic considerations using a case exemplar to illustrate challenges specific to qualitative secondary analysis and strategies to overcome them. Copyright © 2017 National Association of Pediatric Nurse Practitioners. Published by Elsevier Inc. All rights reserved.

  11. Secondary Fire Analysis.

    Science.gov (United States)

    1981-09-01

    Megaton Weapons and Secondary Ignition There are very few well documented data on fires initiated by physical damage (i.e., secondary ignitions). Those data...where significant physical damage to buildings and/or contents can occur. Where this outer bound is located relative to the primary ignition range is...maintenance 7.9 Busline facilities, including shops 3.0 Convalescent homes8 3.1 Hospitals 8.0 Radio and television transmitters Collges and universities

  12. Uncertainty analysis for secondary energy distributions

    International Nuclear Information System (INIS)

    Gerstl, S.A.W.

    1978-01-01

    In many transport calculations the integral design parameter of interest (response) is determined mainly by secondary particles such as gamma rays from (n,γ) reactions or secondary neutrons from inelastic scattering events or (n,2n) reactions. Standard sensitivity analysis usually allows to calculate the sensitivities to the production cross sections of such secondaries, but an extended formalism is needed to also obtain the sensitivities to the energy distribution of the generated secondary particles. For a 30-group standard cross-section set 84% of all non-zero table positions pertain to the description of secondary energy distributions (SED's) and only 16% to the actual reaction cross sections. Therefore, any sensitivity/uncertainty analysis which does not consider the effects of SED's is incomplete and neglects most of the input data. This paper describes the methods of how sensitivity profiles for SED's are obtained and used to estimate the uncertainty of an integral response due to uncertainties in these SED's. The detailed theory is documented elsewhere and implemented in the LASL sensitivity code SENSIT. SED sensitivity profiles have proven particularly valuable in cross-section uncertainty analyses for fusion reactors. Even when the production cross sections for secondary neutrons were assumed to be without error, the uncertainties in the energy distribution of these secondaries produced appreciable uncertainties in the calculated tritium breeding rate. However, complete error files for SED's are presently nonexistent. Therefore, methods will be described that allow rough error estimates due to estimated SED uncertainties based on integral SED sensitivities

  13. Improved Method for In Vitro Secondary Amastigogenesis of Trypanosoma cruzi: Morphometrical and Molecular Analysis of Intermediate Developmental Forms

    Directory of Open Access Journals (Sweden)

    L. A. Hernández-Osorio

    2010-01-01

    Full Text Available Trypanosoma cruzi undergoes a biphasic life cycle that consists of four alternate developmental stages. In vitro conditions to obtain a synchronic transformation and efficient rates of pure intermediate forms (IFs, which are indispensable for further biochemical, biological, and molecular studies, have not been reported. In the present study, we established an improved method to obtain IFs from secondary amastigogenesis. During the transformation kinetics, we observed progressive decreases in the size of the parasite body, undulating membrane and flagellum that were concomitant with nucleus remodeling and kinetoplast displacement. In addition, a gradual reduction in parasite movement and acquisition of the amastigote-specific Ssp4 antigen were observed. Therefore, our results showed that the in vitro conditions used obtained large quantities of highly synchronous and pure IFs that were clearly distinguished by morphometrical and molecular analyses. Obtaining these IFs represents the first step towards an understanding of the molecular mechanisms involved in amastigogenesis.

  14. Authentic Teaching Experiences in Secondary Mathematics Methods

    Science.gov (United States)

    Stickles, Paula R.

    2015-01-01

    Often secondary mathematics methods courses include classroom peer teaching, but many pre-service teachers find it challenging to teach their classmate peers as there are no discipline issues and little mathematical discourse as the "students" know the content. We will share a recent change in our methods course where pre-service…

  15. Secondary Analysis for Results Tracking Database

    Data.gov (United States)

    US Agency for International Development — The Secondary Analysis and Results Tracking (SART) activity provides support for the development of two databases to manage secondary and third-party data, data...

  16. Methods for Handling Missing Secondary Respondent Data

    Science.gov (United States)

    Young, Rebekah; Johnson, David

    2013-01-01

    Secondary respondent data are underutilized because researchers avoid using these data in the presence of substantial missing data. The authors reviewed, evaluated, and tested solutions to this problem. Five strategies of dealing with missing partner data were reviewed: (a) complete case analysis, (b) inverse probability weighting, (c) correction…

  17. Method for the secondary recovery of petroleum

    Energy Technology Data Exchange (ETDEWEB)

    Roth, H H

    1966-10-11

    A method for the secondary recovery of petroleum from subterranean formations consists of flooding these formations with aqueous fluids. These aqueous fluids contain one or more saline solutes which are either present before the flooding or which are dissolved from the formation during flooding. These fluids contain, as a thickening agent, a substantially linear, high molecular weight, water-soluble alkenylaromatic polymer which has sulfonic acid or sulfonate groups on the aromatic nuclei. This saline solute and polymer are mutually compatible. (5 claims)

  18. NPP Krsko secondary side analysis

    International Nuclear Information System (INIS)

    Fabijan, Lj.

    1987-01-01

    The purpose of this work is to analyze secondary side thermohydraulics response on steam generator tube plugging in order to ensure nominal NPP power. We had established that the additional opening of the governing valve No. 3 and 4 can compensate pressure drop caused by steam generator tube plugging. Two main steam flows with four governing valves were simulated. Steam expansion in turbine and feed water system was modeled separately. All important process point and steam moisture changes impact on nominal NPP power were analysed. (author)

  19. Help-Seeking Behaviors for Intimate Partner Violence Perpetration by Men Receiving Substance Use Treatment: A Mixed-Methods Secondary Analysis.

    Science.gov (United States)

    Hashimoto, Nozomu; Radcliffe, Polly; Gilchrist, Gail

    2018-05-01

    Despite the high prevalence of intimate partner violence (IPV) perpetration by men receiving substance use treatment, little is known about their help-seeking behaviors for IPV. A secondary analysis of a mixed-methods study of men receiving substance use treatment who perpetrated IPV examined the prevalence, characteristics, and barriers associated with IPV perpetration disclosure and help-seeking. In total, 170 men were interviewed using a structured questionnaire, and a subsample of 20 were interviewed in-depth about their experiences. Logistic regression determined variables associated with disclosure and help-seeking. Thematic analysis of the in-depth interviews explored barriers to disclosure and help-seeking. Only half the participants had told anyone about their IPV perpetration and about one quarter reported having sought any sort of support. Whereas participants were more likely to disclose their IPV perpetration to informal resources (such as friends or family), they tended to seek help from formal resources (such as health professionals or the police). A greater proportion of physical IPV perpetrators, who had disclosed, had been arrested or had police involvement for IPV, suggesting that their disclosure may not have been voluntary. The following themes emerged from the qualitative data about the barriers to disclosure and help-seeking for IPV perpetration: fear that their children would be taken into care by social services, shame and embarrassment, and a minimization or normalization of their behavior. In addition, many participants highlighted that they had never been previously asked about IPV during treatment for substance use and stressed the need for greater expertise in or knowledge of this topic from specialist services. Substance use treatment services should enquire about men's relationships and IPV perpetration to facilitate disclosure and provide support. Further research is necessary to determine the context of disclosure and help

  20. Secondary Analysis under Cohort Sampling Designs Using Conditional Likelihood

    Directory of Open Access Journals (Sweden)

    Olli Saarela

    2012-01-01

    Full Text Available Under cohort sampling designs, additional covariate data are collected on cases of a specific type and a randomly selected subset of noncases, primarily for the purpose of studying associations with a time-to-event response of interest. With such data available, an interest may arise to reuse them for studying associations between the additional covariate data and a secondary non-time-to-event response variable, usually collected for the whole study cohort at the outset of the study. Following earlier literature, we refer to such a situation as secondary analysis. We outline a general conditional likelihood approach for secondary analysis under cohort sampling designs and discuss the specific situations of case-cohort and nested case-control designs. We also review alternative methods based on full likelihood and inverse probability weighting. We compare the alternative methods for secondary analysis in two simulated settings and apply them in a real-data example.

  1. Secondary waste minimization in analytical methods

    International Nuclear Information System (INIS)

    Green, D.W.; Smith, L.L.; Crain, J.S.; Boparai, A.S.; Kiely, J.T.; Yaeger, J.S.; Schilling, J.B.

    1995-01-01

    The characterization phase of site remediation is an important and costly part of the process. Because toxic solvents and other hazardous materials are used in common analytical methods, characterization is also a source of new waste, including mixed waste. Alternative analytical methods can reduce the volume or form of hazardous waste produced either in the sample preparation step or in the measurement step. The authors are examining alternative methods in the areas of inorganic, radiological, and organic analysis. For determining inorganic constituents, alternative methods were studied for sample introduction into inductively coupled plasma spectrometers. Figures of merit for the alternative methods, as well as their associated waste volumes, were compared with the conventional approaches. In the radiological area, the authors are comparing conventional methods for gross α/β measurements of soil samples to an alternative method that uses high-pressure microwave dissolution. For determination of organic constituents, microwave-assisted extraction was studied for RCRA regulated semivolatile organics in a variety of solid matrices, including spiked samples in blank soil; polynuclear aromatic hydrocarbons in soils, sludges, and sediments; and semivolatile organics in soil. Extraction efficiencies were determined under varying conditions of time, temperature, microwave power, moisture content, and extraction solvent. Solvent usage was cut from the 300 mL used in conventional extraction methods to about 30 mL. Extraction results varied from one matrix to another. In most cases, the microwave-assisted extraction technique was as efficient as the more common Soxhlet or sonication extraction techniques

  2. Classification of methods and equipment recovery secondary waters

    Directory of Open Access Journals (Sweden)

    G. V. Kalashnikov

    2017-01-01

    Full Text Available The issues of purification of secondary waters of industrial production have an important place and are relevant in the environmental activities of all food and chemical industries. For cleaning the transporter-washing water of beet-sugar production the key role is played by the equipment of treatment plants. A wide variety of wastewater treatment equipment is classified according to various methods. Typical structures used are sedimentation tanks, hydrocyclones, separators, centrifuges. In turn, they have a different degree of purification, productivity through the incoming suspension and purified secondary water. This is equipment is divided into designs, depending on the range of particles to be removed. A general classification of methods for cleaning the transporter-washing water, as well as the corresponding equipment, is made. Based on the analysis of processes and instrumentation, the main methods of wastewater treatment are identified: mechanical, physicochemical, combined, biological and disinfection. To increase the degree of purification and reduce technical and economic costs, a combined method is widely used. The main task of the site for cleaning the transporter-washing waters of sugar beet production is to provide the enterprise with water in the required quantity and quality, with economical use of water resources, taking into account the absence of pollution of surface and groundwater by industrial wastewater. In the sugar industry is currently new types of washing equipment of foreign production are widely used, which require high quality and a large amount of purified transporter-washing water for normal operation. The proposed classification makes it possible to carry out a comparative technical and economic analysis when choosing the methods and equipment for recuperation of secondary waters. The main equipment secondary water recovery used at the beet-sugar plant is considered. The most common beet processing plant is a

  3. Guidelines for secondary analysis in search of response shift

    NARCIS (Netherlands)

    Schwartz, Carolyn E.; Ahmed, Sara; Sawatzky, Richard; Sajobi, Tolulope; Mayo, Nancy; Finkelstein, Joel; Lix, Lisa; Verdam, Mathilde G. E.; Oort, Frans J.; Sprangers, Mirjam A. G.

    2013-01-01

    Response shift methods have developed substantially in the past decade, with a notable emphasis on model-based methods for response shift detection that are appropriate for the analysis of existing data sets. These secondary data analyses have yielded useful insights and motivated the continued

  4. Guidelines for secondary analysis in search of response shift

    NARCIS (Netherlands)

    Schwartz, C.E.; Ahmed, S.; Sawatzky, R.; Sajobi, T.; Mayo, N.; Finkelstein, J.; Verdam, M.G.E.; Oort, F.J.; Sprangers, M.A.G.

    2013-01-01

    Objective: Response shift methods have developed substantially in the past decade, with a notable emphasis on model-based methods for response shift detection that are appropriate for the analysis of existing data sets. These secondary data analyses have yielded useful insights and motivated the

  5. Secondary Data Analysis in Family Research

    Science.gov (United States)

    Hofferth, Sandra L.

    2005-01-01

    This article first provides an overview of the part that secondary data analysis plays in the field of family studies in the early 21st century. It addresses changes over time in the use of existing omnibus data sets and discusses their advantages and disadvantages. The second part of the article focuses on the elements that make a study a…

  6. Nonlinear Finite Strain Consolidation Analysis with Secondary Consolidation Behavior

    Directory of Open Access Journals (Sweden)

    Jieqing Huang

    2014-01-01

    Full Text Available This paper aims to analyze nonlinear finite strain consolidation with secondary consolidation behavior. On the basis of some assumptions about the secondary consolidation behavior, the continuity equation of pore water in Gibson’s consolidation theory is modified. Taking the nonlinear compressibility and nonlinear permeability of soils into consideration, the governing equation for finite strain consolidation analysis is derived. Based on the experimental data of Hangzhou soft clay samples, the new governing equation is solved with the finite element method. Afterwards, the calculation results of this new method and other two methods are compared. It can be found that Gibson’s method may underestimate the excess pore water pressure during primary consolidation. The new method which takes the secondary consolidation behavior, the nonlinear compressibility, and nonlinear permeability of soils into consideration can precisely estimate the settlement rate and the final settlement of Hangzhou soft clay sample.

  7. Secondary air injection system and method

    Science.gov (United States)

    Wu, Ko-Jen; Walter, Darrell J.

    2014-08-19

    According to one embodiment of the invention, a secondary air injection system includes a first conduit in fluid communication with at least one first exhaust passage of the internal combustion engine and a second conduit in fluid communication with at least one second exhaust passage of the internal combustion engine, wherein the at least one first and second exhaust passages are in fluid communication with a turbocharger. The system also includes an air supply in fluid communication with the first and second conduits and a flow control device that controls fluid communication between the air supply and the first conduit and the second conduit and thereby controls fluid communication to the first and second exhaust passages of the internal combustion engine.

  8. Using the Socratic Method in Secondary Teaching.

    Science.gov (United States)

    Schoeman, Stephen

    1997-01-01

    Students are more accustomed to receiving knowledge than to questioning knowledge, challenging underlying assumptions, and seeing inconsistencies and irrelevancies. The Socratic method requires teachers to challenge students' critical thinking abilities by developing questions based on analogies and hypothetical situations. Although the Socratic…

  9. Simplified Hybrid-Secondary Uncluttered Machine And Method

    Science.gov (United States)

    Hsu, John S [Oak Ridge, TN

    2005-05-10

    An electric machine (40, 40') has a stator (43) and a rotor (46) and a primary air gap (48) has secondary coils (47c, 47d) separated from the rotor (46) by a secondary air gap (49) so as to induce a slip current in the secondary coils (47c, 47d). The rotor (46, 76) has magnetic brushes (A, B, C, D) or wires (80) which couple flux in through the rotor (46) to the secondary coils (47c, 47d) without inducing a current in the rotor (46) and without coupling a stator rotational energy component to the secondary coils (47c, 47d). The machine can be operated as a motor or a generator in multi-phase or single-phase embodiments. A method of providing a slip energy controller is also disclosed.

  10. An analysis model of the secondary tunnel lining considering ground-primary support-secondary lining interaction

    Energy Technology Data Exchange (ETDEWEB)

    Seo, Seong-Ho; Chang, Seok-Bue [Yooshin Engineering Corporation, Seoul(Korea); Lee, Sang-Duk [Ajou University, Suwon(Korea)

    2002-06-30

    It is the common practice to over design the reinforcement for the secondary tunnel lining due to the lack of rational insight into the ground loosening loads, and due to the conservative application of the empirical design methods. The main loads of the secondary lining are the ground loosening loads and the ground water pressure, and the ground load is critical in the reinforcement design of the secondary lining in the case of drained tunnel. If the external load is absent around a tunnel. the reasons of the load for secondary tunnel lining are the deterioration of the primary supports such as shotcrete, steel rib, and rock bolts. Accordingly, the analysis method considering the ground-primary supports-secondary lining interaction should be required for the rational design of the secondary tunnel lining. In this paper, the interaction was conceptually described by the simple mass-spring model and the load transfer from the ground and primary supports to the secondary lining is showed by the ground-primary supports-secondary lining reaction curves for the theoretical solution of a circular tunnel, And also, the application of this proposed model to numerical analysis is verified in order to check the potential for the tunnel with the complex analysis conditions. (author). 8 refs., 2 tabs., 7 figs.

  11. Corrosion of non-irradiated UAl{sub x}-Al fuel in the presence of clay pore solution. A quantitative XRD secondary phase analysis applying the DDM method

    Energy Technology Data Exchange (ETDEWEB)

    Neumann, Andreas [Halle-Wittenberg Univ. (Germany). Dept. of Mineralogy and Geochemistry; RWTH Aachen Univ. (Germany). Inst. of Crystallography; Klinkenberg, Martina; Curtius, Hildegard [Forschungszentrum Juelich GmbH (Germany). Inst. of Energy and Climate Research, IEK-6 Nuclear Waste Management

    2017-04-01

    Corrosion experiments with non-irradiated metallic UAl{sub x}-Al research reactor fuel elements were carried out in autoclaves to identify and quantify the corrosion products. Such compounds, considering the long-term safety assessment of final repositories, can interact with the released inventory and this constitutes a sink for radionuclide migration in formation waters. Therefore, the metallic fuel sample was subjected to clay pore solution to investigate its process of disintegration by analyzing the resulting products and the remnants, i.e. the secondary phases. Due to the fast corrosion rate a full sample disintegration was observed within the experimental period of 1 year at 90 C. The obtained solids were subdivided into different grain size fractions and prepared for analysis. The elemental analysis of the suspension showed that, uranium and aluminum are concentrated in the solids, whereas iron was mainly dissolved. Non-ambient X-ray diffraction (XRD) combined with the derivative difference minimization (DDM) method was applied for the qualitative and quantitative phase analysis (QPA) of the secondary phases. Gypsum and hemihydrate (bassanite), residues of non-corroded nuclear fuel, hematite, and goethite were identified. The quantitative phase analysis showed that goethite is the major crystalline phase. The amorphous content exceeded 80 wt% and hosted the uranium. All other compounds were present to a minor content. The obtained results by XRD were well supported by complementary scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDS) analysis.

  12. Hybrid-secondary uncluttered permanent magnet machine and method

    Science.gov (United States)

    Hsu, John S.

    2005-12-20

    An electric machine (40) has a stator (43), a permanent magnet rotor (38) with permanent magnets (39) and a magnetic coupling uncluttered rotor (46) for inducing a slip energy current in secondary coils (47). A dc flux can be produced in the uncluttered rotor when the secondary coils are fed with dc currents. The magnetic coupling uncluttered rotor (46) has magnetic brushes (A, B, C, D) which couple flux in through the rotor (46) to the secondary coils (47c, 47d) without inducing a current in the rotor (46) and without coupling a stator rotational energy component to the secondary coils (47c, 47d). The machine can be operated as a motor or a generator in multi-phase or single-phase embodiments and is applicable to the hybrid electric vehicle. A method of providing a slip energy controller is also disclosed.

  13. Inelastic analysis of prestressed concrete secondary containments

    International Nuclear Information System (INIS)

    Murray, D.W.; Chitnuyanondh, L.; Wong, C.; Rijub-Agha, K.Y.

    1978-07-01

    An elastic-plastic constitutive model for the simulation of stress-strain response of concrete under any biaxial combination of compressive and/or tensile stresses is developed. An effective tensile stress-strain curve is obtained indirectly from experimental results of a test on a large scale prestressed concrete wall segment. These concrete properties are then utilized in predicting the response of a second test and the results compared with the experiment. Modificications to the BOSOR5 program, in order to incorporate the new constitutive relation into it, are described. Techniques of modelling structures in order to perform inelastic analysis of thin shell axisymmetric prestressed concrete secondary containments are investigated. The results of inelastic BOSOR5 analyses of two different models of the University of Alberta Test Structure are presented. The predicted deterioration of the structure and the limit states associated with its behaviour are determined and discussed. It is concluded that the technique is a practical one which can be used for the inelastic analysis of Gentilly-type containment structures. (author)

  14. RNAstructure: software for RNA secondary structure prediction and analysis.

    Science.gov (United States)

    Reuter, Jessica S; Mathews, David H

    2010-03-15

    To understand an RNA sequence's mechanism of action, the structure must be known. Furthermore, target RNA structure is an important consideration in the design of small interfering RNAs and antisense DNA oligonucleotides. RNA secondary structure prediction, using thermodynamics, can be used to develop hypotheses about the structure of an RNA sequence. RNAstructure is a software package for RNA secondary structure prediction and analysis. It uses thermodynamics and utilizes the most recent set of nearest neighbor parameters from the Turner group. It includes methods for secondary structure prediction (using several algorithms), prediction of base pair probabilities, bimolecular structure prediction, and prediction of a structure common to two sequences. This contribution describes new extensions to the package, including a library of C++ classes for incorporation into other programs, a user-friendly graphical user interface written in JAVA, and new Unix-style text interfaces. The original graphical user interface for Microsoft Windows is still maintained. The extensions to RNAstructure serve to make RNA secondary structure prediction user-friendly. The package is available for download from the Mathews lab homepage at http://rna.urmc.rochester.edu/RNAstructure.html.

  15. Phase-rectified signal averaging method to predict perinatal outcome in infants with very preterm fetal growth restriction- a secondary analysis of TRUFFLE-trial

    NARCIS (Netherlands)

    Lobmaier, Silvia M.; Mensing van Charante, Nico; Ferrazzi, Enrico; Giussani, Dino A.; Shaw, Caroline J.; Müller, Alexander; Ortiz, Javier U.; Ostermayer, Eva; Haller, Bernhard; Prefumo, Federico; Frusca, Tiziana; Hecher, Kurt; Arabin, Birgit; Thilaganathan, Baskaran; Papageorghiou, Aris T.; Bhide, Amarnath; Martinelli, Pasquale; Duvekot, Johannes J.; van Eyck, Jim; Visser, Gerard H A; Schmidt, Georg; Ganzevoort, Wessel; Lees, Christoph C.; Schneider, Karl T M; Bilardo, Caterina M.; Brezinka, Christoph; Diemert, Anke; Derks, Jan B.; Schlembach, Dietmar; Todros, Tullia; Valcamonico, Adriana; Marlow, Neil; van Wassenaer-Leemhuis, Aleid

    2016-01-01

    Background Phase-rectified signal averaging, an innovative signal processing technique, can be used to investigate quasi-periodic oscillations in noisy, nonstationary signals that are obtained from fetal heart rate. Phase-rectified signal averaging is currently the best method to predict survival

  16. Phase-rectified signal averaging method to predict perinatal outcome in infants with very preterm fetal growth restriction- a secondary analysis of TRUFFLE-trial

    NARCIS (Netherlands)

    Lobmaier, Silvia M.; Mensing van Charante, Nico; Ferrazzi, Enrico; Giussani, Dino A.; Shaw, Caroline J.; Müller, Alexander; Ortiz, Javier U.; Ostermayer, Eva; Haller, Bernhard; Prefumo, Federico; Frusca, Tiziana; Hecher, Kurt; Arabin, Birgit; Thilaganathan, Baskaran; Papageorghiou, Aris T.; Bhide, Amarnath; Martinelli, Pasquale; Duvekot, Johannes J.; van Eyck, Jim; Visser, Gerard H. A.; Schmidt, Georg; Ganzevoort, Wessel; Lees, Christoph C.; Schneider, Karl T. M.; Bilardo, Caterina M.; Brezinka, Christoph; Diemert, Anke; Derks, Jan B.; Schlembach, Dietmar; Todros, Tullia; Valcamonico, Adriana; Marlow, Neil; van Wassenaer-Leemhuis, Aleid

    2016-01-01

    Phase-rectified signal averaging, an innovative signal processing technique, can be used to investigate quasi-periodic oscillations in noisy, nonstationary signals that are obtained from fetal heart rate. Phase-rectified signal averaging is currently the best method to predict survival after

  17. Coupled response spectrum analysis of secondary systems using uncoupled modal properties

    International Nuclear Information System (INIS)

    Gupta, A.K.; Jaw Jingwen

    1986-01-01

    A method of performing coupled response spectrum analysis of secondary systems is presented. The response spectrum specified at the base of the primary system is used as the input. The complex coupled mode shapes along with frequencies and damping values are calculated using an efficient and accurate perturbation scheme. The new method is applied to a 2 DOF secondary system coupled with a 6 DOF secondary system. The masses and the stiffness of the secondary system are varied to get nine different cases. The coupled system is subjected to El Centro (S00E, 1940) ground motion. It is shown that the response values from the present method are in good agreement with those from the coupled time history analysis. The conventional floor response spectrum method gives response values which are consistently much higher than the corresponding values from the time history analysis. It is concluded that the present method is sufficiently straightforward and efficient, and that it yields accurate response values. (orig.)

  18. Secondary Analysis of National Longitudinal Transition Study 2 Data

    Science.gov (United States)

    Hicks, Tyler A.; Knollman, Greg A.

    2015-01-01

    This review examines published secondary analyses of National Longitudinal Transition Study 2 (NLTS2) data, with a primary focus upon statistical objectives, paradigms, inferences, and methods. Its primary purpose was to determine which statistical techniques have been common in secondary analyses of NLTS2 data. The review begins with an…

  19. RNA STRAND: The RNA Secondary Structure and Statistical Analysis Database

    Directory of Open Access Journals (Sweden)

    Andronescu Mirela

    2008-08-01

    Full Text Available Abstract Background The ability to access, search and analyse secondary structures of a large set of known RNA molecules is very important for deriving improved RNA energy models, for evaluating computational predictions of RNA secondary structures and for a better understanding of RNA folding. Currently there is no database that can easily provide these capabilities for almost all RNA molecules with known secondary structures. Results In this paper we describe RNA STRAND – the RNA secondary STRucture and statistical ANalysis Database, a curated database containing known secondary structures of any type and organism. Our new database provides a wide collection of known RNA secondary structures drawn from public databases, searchable and downloadable in a common format. Comprehensive statistical information on the secondary structures in our database is provided using the RNA Secondary Structure Analyser, a new tool we have developed to analyse RNA secondary structures. The information thus obtained is valuable for understanding to which extent and with which probability certain structural motifs can appear. We outline several ways in which the data provided in RNA STRAND can facilitate research on RNA structure, including the improvement of RNA energy models and evaluation of secondary structure prediction programs. In order to keep up-to-date with new RNA secondary structure experiments, we offer the necessary tools to add solved RNA secondary structures to our database and invite researchers to contribute to RNA STRAND. Conclusion RNA STRAND is a carefully assembled database of trusted RNA secondary structures, with easy on-line tools for searching, analyzing and downloading user selected entries, and is publicly available at http://www.rnasoft.ca/strand.

  20. Metabolomics methods for the synthetic biology of secondary metabolism

    NARCIS (Netherlands)

    Quoc-Thai Nguyen, [No Value; Merlo, Maria E.; Medema, Marnix H.; Jankevics, Andris; Breitling, Rainer; Takano, Eriko; Just, Wilhelm; Reiss, Thomas

    2012-01-01

    Many microbial secondary metabolites are of high biotechnological value for medicine, agriculture, and the food industry. Bacterial genome mining has revealed numerous novel secondary metabolite biosynthetic gene clusters, which encode the potential to synthesize a large diversity of compounds that

  1. Service Time Analysis for Secondary Packet Transmission with Adaptive Modulation

    KAUST Repository

    Wang, Wen-Jing; Usman, Muneer; Yang, Hong-Chuan; Alouini, Mohamed-Slim

    2017-01-01

    Cognitive radio communications can opportunistically access underutilized spectrum for emerging wireless applications. With interweave cognitive implementation, secondary user transmits only if primary user does not occupy the channel and waits for transmission otherwise. Therefore, secondary packet transmission involves both transmission time and waiting time. The resulting extended delivery time (EDT) is critical to the throughput analysis of secondary system. In this paper, we study the EDT of secondary packet transmission with adaptive modulation under interweave implementation to facilitate the delay and throughput analysis of such cognitive radio system. In particular, we propose an analytical framework to derive the probability density functions of EDT considering random-length transmission and waiting slots. We also present selected numerical results to illustrate the mathematical formulations and to verify our analytical approach.

  2. Service Time Analysis for Secondary Packet Transmission with Adaptive Modulation

    KAUST Repository

    Wang, Wen-Jing

    2017-05-12

    Cognitive radio communications can opportunistically access underutilized spectrum for emerging wireless applications. With interweave cognitive implementation, secondary user transmits only if primary user does not occupy the channel and waits for transmission otherwise. Therefore, secondary packet transmission involves both transmission time and waiting time. The resulting extended delivery time (EDT) is critical to the throughput analysis of secondary system. In this paper, we study the EDT of secondary packet transmission with adaptive modulation under interweave implementation to facilitate the delay and throughput analysis of such cognitive radio system. In particular, we propose an analytical framework to derive the probability density functions of EDT considering random-length transmission and waiting slots. We also present selected numerical results to illustrate the mathematical formulations and to verify our analytical approach.

  3. Secondary data analysis of large data sets in urology: successes and errors to avoid.

    Science.gov (United States)

    Schlomer, Bruce J; Copp, Hillary L

    2014-03-01

    Secondary data analysis is the use of data collected for research by someone other than the investigator. In the last several years there has been a dramatic increase in the number of these studies being published in urological journals and presented at urological meetings, especially involving secondary data analysis of large administrative data sets. Along with this expansion, skepticism for secondary data analysis studies has increased for many urologists. In this narrative review we discuss the types of large data sets that are commonly used for secondary data analysis in urology, and discuss the advantages and disadvantages of secondary data analysis. A literature search was performed to identify urological secondary data analysis studies published since 2008 using commonly used large data sets, and examples of high quality studies published in high impact journals are given. We outline an approach for performing a successful hypothesis or goal driven secondary data analysis study and highlight common errors to avoid. More than 350 secondary data analysis studies using large data sets have been published on urological topics since 2008 with likely many more studies presented at meetings but never published. Nonhypothesis or goal driven studies have likely constituted some of these studies and have probably contributed to the increased skepticism of this type of research. However, many high quality, hypothesis driven studies addressing research questions that would have been difficult to conduct with other methods have been performed in the last few years. Secondary data analysis is a powerful tool that can address questions which could not be adequately studied by another method. Knowledge of the limitations of secondary data analysis and of the data sets used is critical for a successful study. There are also important errors to avoid when planning and performing a secondary data analysis study. Investigators and the urological community need to strive to use

  4. Apparatus and method for controlling the secondary injection of fuel

    Science.gov (United States)

    Martin, Scott M.; Cai, Weidong; Harris, Jr., Arthur J.

    2013-03-05

    A combustor (28) for a gas turbine engine is provided comprising a primary combustion chamber (30) for combusting a first fuel to form a combustion flow stream (50) and a transition piece (32) located downstream from the primary combustion chamber (30). The transition piece (32) comprises a plurality of injectors (66) located around a circumference of the transition piece (32) for injecting a second fuel into the combustion flow stream (50). The injectors (66) are effective to create a radial temperature profile (74) at an exit (58) of the transition piece (32) having a reduced coefficient of variation relative to a radial temperature profile (64) at an inlet (54) of the transition piece (32). Methods for controlling the temperature profile of a secondary injection are also provided.

  5. Process and device of elementary and chemical analysis of a sample through a spectral analysis of the secondary electron energies

    International Nuclear Information System (INIS)

    Le Gressus, Claude; Massignon, Daniel; Sopizet, Rene.

    1975-01-01

    The present invention relates to a method of chemical and elementary analysis of samples through a spectral analysis of secondary electrons (Auger electrons) emitted from said sample under a primary monokinetic electron beam concentrated on its surface. Said method is characterized in that the intensity of the primary monokinetic electron beam emitted from an electron gun is modulated at a frequency ω; and in that the secondary electrons of energy E emitted from the sample are then collected. A reference voltage corresponding to the modulation in intensity of the primary electron beam is applied at the input of a phase sensitive detector together with a voltage proportional to the intensity of the flux of said collected secondary electrons to obtain at the output of said detector a voltage proportional to the number of the secondary electrons of energy E. The secondary emission energy spectrum of the sample is then plotted [fr

  6. Secondary Low-Level Waste Treatment Strategy Analysis

    International Nuclear Information System (INIS)

    D.M. LaRue

    1999-01-01

    The objective of this analysis is to identify and review potential options for processing and disposing of the secondary low-level waste (LLW) that will be generated through operation of the Monitored Geologic Repository (MGR). An estimate of annual secondary LLW is generated utilizing the mechanism established in ''Secondary Waste Treatment Analysis'' (Reference 8.1) and ''Secondary Low-Level Waste Generation Rate Analysis'' (Reference 8.5). The secondary LLW quantities are based on the spent fuel and high-level waste (HLW) arrival schedule as defined in the ''Controlled Design Assumptions Document'' (CDA) (Reference 8.6). This analysis presents estimates of the quantities of LLW in its various forms. A review of applicable laws, codes, and standards is discussed, and a synopsis of those applicable laws, codes, and standards and their impacts on potential processing and disposal options is presented. The analysis identifies viable processing/disposal options in light of the existing laws, codes, and standards, and then evaluates these options in regard to: (1) Process and equipment requirements; (2) LLW disposal volumes; and (3) Facility requirements

  7. The surface analysis methods

    International Nuclear Information System (INIS)

    Deville, J.P.

    1998-01-01

    Nowadays, there are a lot of surfaces analysis methods, each having its specificity, its qualities, its constraints (for instance vacuum) and its limits. Expensive in time and in investment, these methods have to be used deliberately. This article appeals to non specialists. It gives some elements of choice according to the studied information, the sensitivity, the use constraints or the answer to a precise question. After having recalled the fundamental principles which govern these analysis methods, based on the interaction between radiations (ultraviolet, X) or particles (ions, electrons) with matter, two methods will be more particularly described: the Auger electron spectroscopy (AES) and x-rays photoemission spectroscopy (ESCA or XPS). Indeed, they are the most widespread methods in laboratories, the easier for use and probably the most productive for the analysis of surface of industrial materials or samples submitted to treatments in aggressive media. (O.M.)

  8. New developments in seismic analysis of primary and secondary systems

    International Nuclear Information System (INIS)

    Gupta, A.K.

    1984-01-01

    Primary and secondary systems often must be analyzed using decoupled models. This paper presents recent advances made at NCSU in the seismic analysis of these systems. Algorithms are presented by which coupled mode shapes and frequencies can be evaluated without performing a new eigenvalue solution, given the mode shapes and frequencies of the decoupled models. Simple and accurate equations are presented to predict changes in frequencies and responses. With the coupled mode shapes and frequencies, one can obtain any primary or secondary response directly from the input spectrum. Alternatively, one can develop instructure spectra at various locations in the primary system accounting for the primary-secondary system interaction. Correlation between the support motions is also generated. Equations are presented for evaluating complex mode shapes and frequencies of coupled systems when due to unequal damping values of primary and secondary systems, the coupled system becomes nonproportionally damped. Recent progress, in case of tuned systems is also reported

  9. Primary and secondary cases in Escherichia coli O157 outbreaks: a statistical analysis.

    LENUS (Irish Health Repository)

    Snedeker, Kate G

    2009-01-01

    BACKGROUND: Within outbreaks of Escherichia coli O157 (E. coli O157), at least 10-15% of cases are thought to have been acquired by secondary transmission. However, there has been little systematic quantification or characterisation of secondary outbreak cases worldwide. The aim of this study was to characterise secondary outbreak cases, estimate the overall proportion of outbreak cases that were the result of secondary transmission and to analyse the relationships between primary and secondary outbreak cases by mode of transmission, country and median age. METHODS: Published data was obtained from 90 confirmed Escherichia coli O157 outbreaks in Great Britain, Ireland, Scandinavia, Canada, the United States and Japan, and the outbreaks were described in terms of modes of primary and secondary transmission, country, case numbers and median case age. Outbreaks were tested for statistically significant differences in the number of ill, confirmed, primary and secondary cases (analysis of variance and Kruskal-Wallis) and in the rate of secondary cases between these variables (Generalised Linear Models). RESULTS: The outbreaks had a median of 13.5 confirmed cases, and mean proportion of 0.195 secondary cases. There were statistically significant differences in the numbers of ill, confirmed, primary and secondary cases between modes of primary transmission (p < 0.021), and in primary and secondary cases between median age categories (p < 0.039) and modes of secondary transmission (p < 0.001).Secondary case rates differed statistically significantly between modes of secondary and primary transmission and median age categories (all p < 0.001), but not between countries (p = 0.23). Statistically significantly higher rates of secondary transmission were found in outbreaks with a median age <6 years and those with secondary transmission via person to person spread in nurseries. No statistically significant interactions were found between country, mode of transmission and age

  10. Methods of Multivariate Analysis

    CERN Document Server

    Rencher, Alvin C

    2012-01-01

    Praise for the Second Edition "This book is a systematic, well-written, well-organized text on multivariate analysis packed with intuition and insight . . . There is much practical wisdom in this book that is hard to find elsewhere."-IIE Transactions Filled with new and timely content, Methods of Multivariate Analysis, Third Edition provides examples and exercises based on more than sixty real data sets from a wide variety of scientific fields. It takes a "methods" approach to the subject, placing an emphasis on how students and practitioners can employ multivariate analysis in real-life sit

  11. Computational RNA secondary structure design: empirical complexity and improved methods

    Directory of Open Access Journals (Sweden)

    Condon Anne

    2007-01-01

    Full Text Available Abstract Background We investigate the empirical complexity of the RNA secondary structure design problem, that is, the scaling of the typical difficulty of the design task for various classes of RNA structures as the size of the target structure is increased. The purpose of this work is to understand better the factors that make RNA structures hard to design for existing, high-performance algorithms. Such understanding provides the basis for improving the performance of one of the best algorithms for this problem, RNA-SSD, and for characterising its limitations. Results To gain insights into the practical complexity of the problem, we present a scaling analysis on random and biologically motivated structures using an improved version of the RNA-SSD algorithm, and also the RNAinverse algorithm from the Vienna package. Since primary structure constraints are relevant for designing RNA structures, we also investigate the correlation between the number and the location of the primary structure constraints when designing structures and the performance of the RNA-SSD algorithm. The scaling analysis on random and biologically motivated structures supports the hypothesis that the running time of both algorithms scales polynomially with the size of the structure. We also found that the algorithms are in general faster when constraints are placed only on paired bases in the structure. Furthermore, we prove that, according to the standard thermodynamic model, for some structures that the RNA-SSD algorithm was unable to design, there exists no sequence whose minimum free energy structure is the target structure. Conclusion Our analysis helps to better understand the strengths and limitations of both the RNA-SSD and RNAinverse algorithms, and suggests ways in which the performance of these algorithms can be further improved.

  12. Radionuclide analysis of drinking water in selected secondary ...

    African Journals Online (AJOL)

    Radionuclide analysis of drinking water in selected secondary schools of Epe ... obtained were in the ranges of (38.3 – 292.8) Bq/L with mean value of 13.4 + 10.8 ... and within the tolerance level indicating minimal radiological health burden.

  13. Methods for RNA Analysis

    DEFF Research Database (Denmark)

    Olivarius, Signe

    of the transcriptome, 5’ end capture of RNA is combined with next-generation sequencing for high-throughput quantitative assessment of transcription start sites by two different methods. The methods presented here allow for functional investigation of coding as well as noncoding RNA and contribute to future...... RNAs rely on interactions with proteins, the establishment of protein-binding profiles is essential for the characterization of RNAs. Aiming to facilitate RNA analysis, this thesis introduces proteomics- as well as transcriptomics-based methods for the functional characterization of RNA. First, RNA...

  14. Analysis of numerical methods

    CERN Document Server

    Isaacson, Eugene

    1994-01-01

    This excellent text for advanced undergraduates and graduate students covers norms, numerical solution of linear systems and matrix factoring, iterative solutions of nonlinear equations, eigenvalues and eigenvectors, polynomial approximation, and other topics. It offers a careful analysis and stresses techniques for developing new methods, plus many examples and problems. 1966 edition.

  15. MODEL OF METHODS OF FORMING BIOLOGICAL PICTURE OF THE WORLD OF SECONDARY SCHOOL PUPILS

    Directory of Open Access Journals (Sweden)

    Mikhail A. Yakunchev

    2016-12-01

    Full Text Available Introduction: the problem of development of a model of methods of forming the biological picture of the world of pupils as a multicomponent and integrative expression of the complete educational process is considered in the article. It is stated that the results of the study have theoretical and practical importance for effective subject preparation of senior pupils based on acquiring of systematic and generalized knowledge about wildlife. The correspondence of the main idea of the article to the scientific profile of the journal “Integration of Education” determines the choice of the periodical for publication. Materials and Methods: the results of the analysis of materials on modeling of the educational process, on specific models of the formation of a complete comprehension of the scientific picture of the world and its biological component make it possible to suggest a lack of elaboration of the aspect of pedagogical research under study. Therefore, the search for methods to overcome these gaps and to substantiate a particular model, relevant for its practical application by a teacher, is important. The study was based on the use of methods of theoretical level, including the analysis of pedagogical and methodological literature, modeling and generalized expression of the model of forming the biological picture of the world of secondary school senior pupils, which were of higher priority. Results: the use of models of organization of subject preparation of secondary school pupils takes a priority position, as they help to achieve the desired results of training, education and development. The model of methods of forming a biological picture of the world is represented as a theoretical construct in the unity of objective, substantive, procedural, diagnostic and effective blocks. Discussion and Conclusions: in a generalized form the article expresses the model of methods of forming the biological picture of the world of secondary school

  16. Radiation leakage monitoring method and device from primary to secondary coolant systems in nuclear reactor

    International Nuclear Information System (INIS)

    Tajiri, Yoshiaki; Umehara, Toshihiro; Yamada, Masataka.

    1993-01-01

    The present invention monitors radiation leaked from any one of primary cooling systems to secondary cooling systems in a plurality of steam generators. That is, radiation monitoring means each corresponding to steam each generators are disposed to the upstream of a position where main steam pipes are joined. With such a constitution, since the detection object of each of radiation monitoring means is secondary coolants before mixing with secondary coolants of other secondary loops or dilution, lowering of detection accuracy can be avoided. Except for the abnormal case, that is, a case neither of radiation leakage nor of background change, the device is adapted as a convenient measuring system only with calculation performance. Once abnormality occurs, a loop having a value exceeding a standard value is identified by a single channel analyzer function. The amount of radiation leakage from the steam generator belonging to the specified loop is monitored quantitatively by a multichannel analyzer function. According to the method of the present invention, since specific spectrum analysis is conducted upon occurrence of abnormality, presence of radiation leakage and the scale thereof can be judged rapidly. (I.S.)

  17. Methods for Risk Analysis

    International Nuclear Information System (INIS)

    Alverbro, Karin

    2010-01-01

    Many decision-making situations today affect humans and the environment. In practice, many such decisions are made without an overall view and prioritise one or other of the two areas. Now and then these two areas of regulation come into conflict, e.g. the best alternative as regards environmental considerations is not always the best from a human safety perspective and vice versa. This report was prepared within a major project with the aim of developing a framework in which both the environmental aspects and the human safety aspects are integrated, and decisions can be made taking both fields into consideration. The safety risks have to be analysed in order to be successfully avoided and one way of doing this is to use different kinds of risk analysis methods. There is an abundance of existing methods to choose from and new methods are constantly being developed. This report describes some of the risk analysis methods currently available for analysing safety and examines the relationships between them. The focus here is mainly on human safety aspects

  18. Secondary neutral mass spectrometry depth profile analysis of silicides

    International Nuclear Information System (INIS)

    Beckmann, P.; Kopnarski, M.; Oechsner, H.

    1985-01-01

    The Direct Bombardment Mode (DBM) of Secondary Neutral Mass Spectrometry (SNMS) has been applied for depth profile analysis of two different multilayer systems containing metal silicides. Due to the extremely high depth resolution obtained with low energy SNMS structural details down to only a few atomic distances are detected. Stoichiometric information on internal oxides and implanted material is supplied by the high quantificability of SNMS. (Author)

  19. The Use of Episiotomy in a Low-Risk Population in The Netherlands : A Secondary Analysis

    NARCIS (Netherlands)

    Seijmonsbergen-Schermers, A. E.; Geerts, C. C.; Prins, M.; van Diem, M. T.; Klomp, T.; Lagro-Janssen, A. L. M.

    2013-01-01

    Background: To examine the episiotomy incidence and determinants and outcomes associated with its use in primary care midwifery practices. Methods: Secondary analysis of two prospective cohort studies (n=3,404). Results: The episiotomy incidence was 10.8 percent (20.9% for nulliparous and 6.3% for

  20. Method of signal analysis

    International Nuclear Information System (INIS)

    Berthomier, Charles

    1975-01-01

    A method capable of handling the amplitude and the frequency time laws of a certain kind of geophysical signals is described here. This method is based upon the analytical signal idea of Gabor and Ville, which is constructed either in the time domain by adding an imaginary part to the real signal (in-quadrature signal), or in the frequency domain by suppressing negative frequency components. The instantaneous frequency of the initial signal is then defined as the time derivative of the phase of the analytical signal, and his amplitude, or envelope, as the modulus of this complex signal. The method is applied to three types of magnetospheric signals: chorus, whistlers and pearls. The results obtained by analog and numerical calculations are compared to results obtained by classical systems using filters, i.e. based upon a different definition of the concept of frequency. The precision with which the frequency-time laws are determined leads then to the examination of the principle of the method and to a definition of instantaneous power density spectrum attached to the signal, and to the first consequences of this definition. In this way, a two-dimensional representation of the signal is introduced which is less deformed by the analysis system properties than the usual representation, and which moreover has the advantage of being obtainable practically in real time [fr

  1. On infrared spectroscopic analysis of transfer RNA secondary structure

    Energy Technology Data Exchange (ETDEWEB)

    Semenov, M A; Starikov, E B

    1987-07-14

    Various techniques of IR spectroscopy in the 1550-1750 cm/sup -1/ region employed to analyse the tRNA secondary structure are discussed and a novel improved method is proposed. The main novel features of this method are the approximation of tRNA helical region spectra by catalogue carbonyl absorption bands and approximation of tRNA nonhelical region spectra by those of homopolyribonucleotides. The IR spectra of tRNA/sub yeast//sup phe/ and tRNA/sub E.coli//sup fmet/ in the carbonyl vibration region are explained on the basis of calculated transition moment coupling.

  2. Aerodynamic analysis of the Darrieus rotor including secondary effects

    Science.gov (United States)

    Paraschivoiu, I.; Delclaux, F.; Fraunie, P.; Beguier, C.

    1983-10-01

    An aerodynamic analysis is made of two variants of the two-actuator-disk theory for modeling the Darrieus wind turbine. The double-multiple-streamtube model with constant and variable interference factors, including secondary effects, is examined for a Darrieus rotor. The influence of the secondary effects, namely, the blade geometry and profile type, the rotating tower, and the presence of struts and aerodynamic spoilers, is relatively significant, especially at high tip-speed ratios. Variation of the induced velocity as a function of the azimuthal angle allows a more accurate calculation of the aerodynamic loads on the downwind zone of the rotor with respect to the assumed constant interference factors. The theoretical results were compared with available experimental data for the Magdalen Islands wind turbine and Sandia-type machines (straight-line/circular-arc shape).

  3. Methods for geochemical analysis

    Science.gov (United States)

    Baedecker, Philip A.

    1987-01-01

    The laboratories for analytical chemistry within the Geologic Division of the U.S. Geological Survey are administered by the Office of Mineral Resources. The laboratory analysts provide analytical support to those programs of the Geologic Division that require chemical information and conduct basic research in analytical and geochemical areas vital to the furtherance of Division program goals. Laboratories for research and geochemical analysis are maintained at the three major centers in Reston, Virginia, Denver, Colorado, and Menlo Park, California. The Division has an expertise in a broad spectrum of analytical techniques, and the analytical research is designed to advance the state of the art of existing techniques and to develop new methods of analysis in response to special problems in geochemical analysis. The geochemical research and analytical results are applied to the solution of fundamental geochemical problems relating to the origin of mineral deposits and fossil fuels, as well as to studies relating to the distribution of elements in varied geologic systems, the mechanisms by which they are transported, and their impact on the environment.

  4. COMPUTER METHODS OF GENETIC ANALYSIS.

    Directory of Open Access Journals (Sweden)

    A. L. Osipov

    2017-02-01

    Full Text Available The basic statistical methods used in conducting the genetic analysis of human traits. We studied by segregation analysis, linkage analysis and allelic associations. Developed software for the implementation of these methods support.

  5. Combining sequence-based prediction methods and circular dichroism and infrared spectroscopic data to improve protein secondary structure determinations

    Directory of Open Access Journals (Sweden)

    Lees Jonathan G

    2008-01-01

    Full Text Available Abstract Background A number of sequence-based methods exist for protein secondary structure prediction. Protein secondary structures can also be determined experimentally from circular dichroism, and infrared spectroscopic data using empirical analysis methods. It has been proposed that comparable accuracy can be obtained from sequence-based predictions as from these biophysical measurements. Here we have examined the secondary structure determination accuracies of sequence prediction methods with the empirically determined values from the spectroscopic data on datasets of proteins for which both crystal structures and spectroscopic data are available. Results In this study we show that the sequence prediction methods have accuracies nearly comparable to those of spectroscopic methods. However, we also demonstrate that combining the spectroscopic and sequences techniques produces significant overall improvements in secondary structure determinations. In addition, combining the extra information content available from synchrotron radiation circular dichroism data with sequence methods also shows improvements. Conclusion Combining sequence prediction with experimentally determined spectroscopic methods for protein secondary structure content significantly enhances the accuracy of the overall results obtained.

  6. Secondary Analysis of Large-Scale Assessment Data: An Alternative to Variable-Centred Analysis

    Science.gov (United States)

    Chow, Kui Foon; Kennedy, Kerry John

    2014-01-01

    International large-scale assessments are now part of the educational landscape in many countries and often feed into major policy decisions. Yet, such assessments also provide data sets for secondary analysis that can address key issues of concern to educators and policymakers alike. Traditionally, such secondary analyses have been based on a…

  7. Extended Delivery Time Analysis for Cognitive Packet Transmission With Application to Secondary Queuing Analysis

    KAUST Repository

    Usman, Muneer

    2015-05-21

    Cognitive radio transceiver can opportunistically access the underutilized spectrum resource of primary systems for new wireless services. With interweave implementation, the secondary transmission may be interrupted by the primary user\\'s transmission. To facilitate the delay analysis of such secondary transmission for fixed-size secondary packets, we study the resulting extended delivery time that includes both transmission time and waiting time. In particular, we derive the exact distribution functions of extended delivery time of secondary transmission for both continuous sensing and periodic sensing cases. Selected numerical and simulation results are presented for illustrating the mathematical formulation. Finally, we consider an M/G/1 queueing set-up at the secondary transmitter and formulate the closed-form expressions for the expected delay with Poisson traffic. The analytical results will greatly facilitate the design of the secondary system for particular target application. © 2015 IEEE.

  8. CROSS-FLOW ULTRAFILTRATION OF SECONDARY EFFLUENTS. MEMBRANE FOULING ANALYSIS

    Directory of Open Access Journals (Sweden)

    Luisa Vera

    2014-12-01

    Full Text Available The application of cross-flow ultrafiltration to regenerate secondary effluents is limited by membrane fouling. This work analyzes the influence of the main operational parameters (transmembrane pressure and cross-flow velocity about the selectivity and fouling observed in an ultrafiltration tubular ceramic membrane. The experimental results have shown a significant retention of the microcolloidal and soluble organic matter (52 – 54% in the membrane. The fouling analysis has defined the critical operational conditions where the fouling resistance is minimized. Such conditions can be described in terms of a dimensionless number known as shear stress number and its relationship with other dimensionless parameter, the fouling number.

  9. Managing breastfeeding and work: a Foucauldian secondary analysis.

    Science.gov (United States)

    Payne, Deborah; Nicholls, David A

    2010-08-01

    This paper is a report of a secondary analysis of the experiences of employed breastfeeding mothers. Health promotion policies exhort mothers to feed their infants breastmilk exclusively for the first 6 months and partially until the age of 2 years. More mothers are returning to paid employment less than a year after having a baby. Combining breastfeeding and paid work is an issue for nursing and midwifery as predominantly female professions caring for women and their children. Foucauldian discourse analysis was used for a secondary analysis of interviews performed in 2005 with 20 women who continued to breastfeed on their return to work. The discursive positions and disciplinary practices were identified and analysed. Combining breastfeeding and paid work required negotiating the positions of good mother and good worker. Being a good mother conferred health benefits on infants. Being a good worker required the mothers to constrain their breastfeeding practices. The practices performed by the mothers involved stockpiling breastmilk, maintaining milk supply, preparing the baby ready for absence, making sacrifices and remaining silent and invisible as a breastfeeding worker. Breastfeeding workers have the potential to threaten the focus of the workplace. They discipline themselves to minimize their disruptive potential. Such strategies serve to maintain the marginalization of breastfeeding in the workplace and to keep women's efforts to continue breastfeeding invisible. The work of breastfeeding workers needs to be better recognized and supported.

  10. Higher Order Inclusion Complexes and Secondary Interactions Studied by Global Analysis of Calorimetric Titrations

    DEFF Research Database (Denmark)

    Schönbeck, Jens Christian Sidney; Holm, René; Westh, Peter

    2012-01-01

    This paper investigates the use of isothermal titration calorimetry (ITC) as a tool for studying molecular systems in which weaker secondary interactions are present in addition to a dominant primary interaction. Such systems are challenging since the signal pertaining to the stronger primary......). The results are validated by a 13C NMR titration and negative controls with a bile salt with no secondary binding site (glycocholate) (K = 2.96 ± 0.01 × 103 M–1). The method proved useful for detailed analysis of ITC data and may strengthen its use as a tool for studying molecular systems by advanced binding...

  11. Analysis of As implantation profiles in silica by nuclear microanalysis and secondary ion emission

    International Nuclear Information System (INIS)

    Dieumegard, D.; Croset, M.; Cohen, C.; Lhoir, A.; Rigo, S.; Chaumont, J.

    1974-01-01

    Results obtained from analysis using, either the method of elastic backscattering of light or semi-heavy ions ( 4 He + , 14 N + ) about one MeV energy, or the secondary ion emission method are compared. The choice of As implanted Si is explained by the following reasons: As is an element relatively heavy in comparison with Si, that allows an analysis to be effected on a few thousands Angstroems depth in silica using elastic backscattering; the silica chosen as substrate being an amorphous material allows channeling phenomena to the avoided during implantation and analysis [fr

  12. Deciphering the shape and deformation of secondary structures through local conformation analysis

    Directory of Open Access Journals (Sweden)

    Camproux Anne-Claude

    2011-02-01

    Full Text Available Abstract Background Protein deformation has been extensively analysed through global methods based on RMSD, torsion angles and Principal Components Analysis calculations. Here we use a local approach, able to distinguish among the different backbone conformations within loops, α-helices and β-strands, to address the question of secondary structures' shape variation within proteins and deformation at interface upon complexation. Results Using a structural alphabet, we translated the 3 D structures of large sets of protein-protein complexes into sequences of structural letters. The shape of the secondary structures can be assessed by the structural letters that modeled them in the structural sequences. The distribution analysis of the structural letters in the three protein compartments (surface, core and interface reveals that secondary structures tend to adopt preferential conformations that differ among the compartments. The local description of secondary structures highlights that curved conformations are preferred on the surface while straight ones are preferred in the core. Interfaces display a mixture of local conformations either preferred in core or surface. The analysis of the structural letters transition occurring between protein-bound and unbound conformations shows that the deformation of secondary structure is tightly linked to the compartment preference of the local conformations. Conclusion The conformation of secondary structures can be further analysed and detailed thanks to a structural alphabet which allows a better description of protein surface, core and interface in terms of secondary structures' shape and deformation. Induced-fit modification tendencies described here should be valuable information to identify and characterize regions under strong structural constraints for functional reasons.

  13. Deciphering the shape and deformation of secondary structures through local conformation analysis.

    Science.gov (United States)

    Baussand, Julie; Camproux, Anne-Claude

    2011-02-01

    Protein deformation has been extensively analysed through global methods based on RMSD, torsion angles and Principal Components Analysis calculations. Here we use a local approach, able to distinguish among the different backbone conformations within loops, α-helices and β-strands, to address the question of secondary structures' shape variation within proteins and deformation at interface upon complexation. Using a structural alphabet, we translated the 3 D structures of large sets of protein-protein complexes into sequences of structural letters. The shape of the secondary structures can be assessed by the structural letters that modeled them in the structural sequences. The distribution analysis of the structural letters in the three protein compartments (surface, core and interface) reveals that secondary structures tend to adopt preferential conformations that differ among the compartments. The local description of secondary structures highlights that curved conformations are preferred on the surface while straight ones are preferred in the core. Interfaces display a mixture of local conformations either preferred in core or surface. The analysis of the structural letters transition occurring between protein-bound and unbound conformations shows that the deformation of secondary structure is tightly linked to the compartment preference of the local conformations. The conformation of secondary structures can be further analysed and detailed thanks to a structural alphabet which allows a better description of protein surface, core and interface in terms of secondary structures' shape and deformation. Induced-fit modification tendencies described here should be valuable information to identify and characterize regions under strong structural constraints for functional reasons.

  14. Pitfalls and Promises: The Use of Secondary Data Analysis in Educational Research

    Science.gov (United States)

    Smith, Emma

    2008-01-01

    This paper considers the use of secondary data analysis in educational research. It addresses some of the promises and potential pitfalls that influence its use and explores a possible role for the secondary analysis of numeric data in the "new" political arithmetic tradition of social research. Secondary data analysis is a relatively under-used…

  15. Key Competencies and Characteristics for Innovative Teaching among Secondary School Teachers: A Mixed-Methods Research

    Science.gov (United States)

    Zhu, Chang; Wang, Di

    2014-01-01

    This research aims to understand the key competencies and characteristics for innovative teaching as perceived by Chinese secondary teachers. A mixed-methods research was used to investigate secondary teachers' views. First, a qualitative study was conducted with interviews of teachers to understand the perceived key competencies and…

  16. Minimal Evidence for a Secondary Loss of Strength After an Acute Muscle Injury: A Systematic Review and Meta-Analysis

    OpenAIRE

    Warren, Gordon L.; Call, Jarrod A.; Farthing, Amy K.; Baadom-Piaro, Bemene

    2016-01-01

    Background An immediate loss of strength follows virtually all types of muscle injury but there is debate whether the initial strength loss is maximal or if a secondary loss of strength occurs during the first 3?days post-injury. Objective The objective of this analysis was to conduct a systematic review and meta-analysis of the research literature to determine if a secondary loss of strength occurs after an injurious initiating event. Methods Literature searches were performed using eight el...

  17. Methods of nonlinear analysis

    CERN Document Server

    Bellman, Richard Ernest

    1970-01-01

    In this book, we study theoretical and practical aspects of computing methods for mathematical modelling of nonlinear systems. A number of computing techniques are considered, such as methods of operator approximation with any given accuracy; operator interpolation techniques including a non-Lagrange interpolation; methods of system representation subject to constraints associated with concepts of causality, memory and stationarity; methods of system representation with an accuracy that is the best within a given class of models; methods of covariance matrix estimation;methods for low-rank mat

  18. Global Analysis of RNA Secondary Structure in Two Metazoans

    Directory of Open Access Journals (Sweden)

    Fan Li

    2012-01-01

    Full Text Available The secondary structure of RNA is necessary for its maturation, regulation, processing, and function. However, the global influence of RNA folding in eukaryotes is still unclear. Here, we use a high-throughput, sequencing-based, structure-mapping approach to identify the paired (double-stranded RNA [dsRNA] and unpaired (single-stranded RNA [ssRNA] components of the Drosophila melanogaster and Caenorhabditis elegans transcriptomes, which allows us to identify conserved features of RNA secondary structure in metazoans. From this analysis, we find that ssRNAs and dsRNAs are significantly correlated with specific epigenetic modifications. Additionally, we find key structural patterns across protein-coding transcripts that indicate that RNA folding demarcates regions of protein translation and likely affects microRNA-mediated regulation of mRNAs in animals. Finally, we identify and characterize 546 mRNAs whose folding pattern is significantly correlated between these metazoans, suggesting that their structure has some function. Overall, our findings provide a global assessment of RNA folding in animals.

  19. Methods to assess secondary volatile lipid oxidation products in complex food matrices

    DEFF Research Database (Denmark)

    Jacobsen, Charlotte; Yesiltas, Betül

    A range of different methods are available to determine secondary volatile lipid oxidation products. These methods include e.g. spectrophotometric determination of anisidine values and TBARS as well as GC based methods for determination of specific volatile oxidation products such as pentanal...... headspace methods on the same food matrices will be presented....

  20. Standard Test Method for Calibration of Non-Concentrator Photovoltaic Secondary Reference Cells

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2010-01-01

    1.1 This test method covers calibration and characterization of secondary terrestrial photovoltaic reference cells to a desired reference spectral irradiance distribution. The recommended physical requirements for these reference cells are described in Specification E1040. Reference cells are principally used in the determination of the electrical performance of a photovoltaic device. 1.2 Secondary reference cells are calibrated indoors using simulated sunlight or outdoors in natural sunlight by reference to a primary reference cell previously calibrated to the same desired reference spectral irradiance distribution. 1.3 Secondary reference cells calibrated according to this test method will have the same radiometric traceability as the of the primary reference cell used for the calibration. Therefore, if the primary reference cell is traceable to the World Radiometric Reference (WRR, see Test Method E816), the resulting secondary reference cell will also be traceable to the WRR. 1.4 This test method appli...

  1. Detection of secondary structure elements in proteins by hydrophobic cluster analysis.

    Science.gov (United States)

    Woodcock, S; Mornon, J P; Henrissat, B

    1992-10-01

    Hydrophobic cluster analysis (HCA) is a protein sequence comparison method based on alpha-helical representations of the sequences where the size, shape and orientation of the clusters of hydrophobic residues are primarily compared. The effectiveness of HCA has been suggested to originate from its potential ability to focus on the residues forming the hydrophobic core of globular proteins. We have addressed the robustness of the bidimensional representation used for HCA in its ability to detect the regular secondary structure elements of proteins. Various parameters have been studied such as those governing cluster size and limits, the hydrophobic residues constituting the clusters as well as the potential shift of the cluster positions with respect to the position of the regular secondary structure elements. The following results have been found to support the alpha-helical bidimensional representation used in HCA: (i) there is a positive correlation (clearly above background noise) between the hydrophobic clusters and the regular secondary structure elements in proteins; (ii) the hydrophobic clusters are centred on the regular secondary structure elements; (iii) the pitch of the helical representation which gives the best correspondence is that of an alpha-helix. The correspondence between hydrophobic clusters and regular secondary structure elements suggests a way to implement variable gap penalties during the automatic alignment of protein sequences.

  2. Estimation method for first excursion probability of secondary system with impact and friction using maximum response

    International Nuclear Information System (INIS)

    Shigeru Aoki

    2005-01-01

    The secondary system such as pipings, tanks and other mechanical equipment is installed in the primary system such as building. The important secondary systems should be designed to maintain their function even if they are subjected to destructive earthquake excitations. The secondary system has many nonlinear characteristics. Impact and friction characteristic, which are observed in mechanical supports and joints, are common nonlinear characteristics. As impact damper and friction damper, impact and friction characteristic are used for reduction of seismic response. In this paper, analytical methods of the first excursion probability of the secondary system with impact and friction, subjected to earthquake excitation are proposed. By using the methods, the effects of impact force, gap size and friction force on the first excursion probability are examined. When the tolerance level is normalized by the maximum response of the secondary system without impact or friction characteristics, variation of the first excursion probability is very small for various values of the natural period. In order to examine the effectiveness of the proposed method, the obtained results are compared with those obtained by the simulation method. Some estimation methods for the maximum response of the secondary system with nonlinear characteristics have been developed. (author)

  3. Multivariate analysis: models and method

    International Nuclear Information System (INIS)

    Sanz Perucha, J.

    1990-01-01

    Data treatment techniques are increasingly used since computer methods result of wider access. Multivariate analysis consists of a group of statistic methods that are applied to study objects or samples characterized by multiple values. A final goal is decision making. The paper describes the models and methods of multivariate analysis

  4. Multivariate analysis methods in physics

    International Nuclear Information System (INIS)

    Wolter, M.

    2007-01-01

    A review of multivariate methods based on statistical training is given. Several multivariate methods useful in high-energy physics analysis are discussed. Selected examples from current research in particle physics are discussed, both from the on-line trigger selection and from the off-line analysis. Also statistical training methods are presented and some new application are suggested [ru

  5. Methods in algorithmic analysis

    CERN Document Server

    Dobrushkin, Vladimir A

    2009-01-01

    …helpful to any mathematics student who wishes to acquire a background in classical probability and analysis … This is a remarkably beautiful book that would be a pleasure for a student to read, or for a teacher to make into a year's course.-Harvey Cohn, Computing Reviews, May 2010

  6. Communication Network Analysis Methods.

    Science.gov (United States)

    Farace, Richard V.; Mabee, Timothy

    This paper reviews a variety of analytic procedures that can be applied to network data, discussing the assumptions and usefulness of each procedure when applied to the complexity of human communication. Special attention is paid to the network properties measured or implied by each procedure. Factor analysis and multidimensional scaling are among…

  7. Complementing Gender Analysis Methods.

    Science.gov (United States)

    Kumar, Anant

    2016-01-01

    The existing gender analysis frameworks start with a premise that men and women are equal and should be treated equally. These frameworks give emphasis on equal distribution of resources between men and women and believe that this will bring equality which is not always true. Despite equal distribution of resources, women tend to suffer and experience discrimination in many areas of their lives such as the power to control resources within social relationships, and the need for emotional security and reproductive rights within interpersonal relationships. These frameworks believe that patriarchy as an institution plays an important role in women's oppression, exploitation, and it is a barrier in their empowerment and rights. Thus, some think that by ensuring equal distribution of resources and empowering women economically, institutions like patriarchy can be challenged. These frameworks are based on proposed equality principle which puts men and women in competing roles. Thus, the real equality will never be achieved. Contrary to the existing gender analysis frameworks, the Complementing Gender Analysis framework proposed by the author provides a new approach toward gender analysis which not only recognizes the role of economic empowerment and equal distribution of resources but suggests to incorporate the concept and role of social capital, equity, and doing gender in gender analysis which is based on perceived equity principle, putting men and women in complementing roles that may lead to equality. In this article the author reviews the mainstream gender theories in development from the viewpoint of the complementary roles of gender. This alternative view is argued based on existing literature and an anecdote of observations made by the author. While criticizing the equality theory, the author offers equity theory in resolving the gender conflict by using the concept of social and psychological capital.

  8. Application of Monte Carlo method in determination of secondary characteristic X radiation in XFA

    International Nuclear Information System (INIS)

    Roubicek, P.

    1982-01-01

    Secondary characteristic radiation is excited by primary radiation from the X-ray tube and by secondary radiation of other elements so that excitations of several orders result. The Monte Carlo method was used to consider all these possibilities and the resulting flux of characteristic radiation was simulated for samples of silicate raw materials. A comparison of the results of these computations with experiments allows to determine the effect of sample preparation on the characteristic radiation flux. (M.D.)

  9. STOCHASTIC METHODS IN RISK ANALYSIS

    Directory of Open Access Journals (Sweden)

    Vladimíra OSADSKÁ

    2017-06-01

    Full Text Available In this paper, we review basic stochastic methods which can be used to extend state-of-the-art deterministic analytical methods for risk analysis. We can conclude that the standard deterministic analytical methods highly depend on the practical experience and knowledge of the evaluator and therefore, the stochastic methods should be introduced. The new risk analysis methods should consider the uncertainties in input values. We present how large is the impact on the results of the analysis solving practical example of FMECA with uncertainties modelled using Monte Carlo sampling.

  10. Calculation methods and algorithms development of dynamic loadings on NPP secondary circuit equipment at shock and pulse actions

    International Nuclear Information System (INIS)

    Kuznetsov, D.V.; Kormilitsyn, V.M.; Proskuryakov, K.N.

    2010-01-01

    Calculation results of acoustic parameters fluctuations in low-pressure regenerative heating system of NPP with WWER-1000 type reactor were presented. The spectral structure of acoustic fluctuations was shown to depend on configuration of secondary circuit equipment, its geometrical sizes and operation mode. Estimations of natural oscillations frequencies of working medium pressure in the secondary circuit equipment were resulted. The developed calculation methods and algorithms are intended for revealing and prevention of initiation conditions of vibrations resonances in elements of the secondary circuit equipment with acoustic oscillations in working medium, both under operating conditions and in the design stage of the second circuit of NPP with WWER-1000 type reactor. Analysis of pass-band dependence on operation mode was carried out to solve the given problem [ru

  11. Programmed Instruction in Secondary Education: A Meta-Analysis of the Impact of Class Size on Its Effectiveness.

    Science.gov (United States)

    Boden, Andrea; Archwamety, Teara; McFarland, Max

    This review used meta-analytic techniques to integrate findings from 30 independent studies that compared programmed instruction to conventional methods of instruction at the secondary level. The meta-analysis demonstrated that programmed instruction resulted in higher achievement when compared to conventional methods of instruction (average…

  12. Pedagogical Applications from Real Analysis for Secondary Mathematics Teachers

    Science.gov (United States)

    Wasserman, Nicholas; Weber, Keith

    2017-01-01

    In this article, we consider the potential influences of the study of proofs in advanced mathematics on secondary mathematics teaching. Thus far, the literature has highlighted the benefits of applying the conclusions of particular proofs to secondary content and of developing a more general sense of disciplinary practices in mathematics in…

  13. Teaching for Conceptual Change in Elementary and Secondary Science Methods Courses.

    Science.gov (United States)

    Marion, Robin; Hewson, Peter W.; Tabachnick, B. Robert; Blomker, Kathryn B.

    1999-01-01

    Describes and analyzes two science methods courses at the elementary and secondary levels for how they addressed four ideas: (1) how students learn science; (2) how teachers teach science to students; (3) how prospective science teachers learn about the first two ideas; and (4) how methods instructors teach prospective science teachers about the…

  14. Methods and Beyond: Learning to Teach Latino Bilingual Learners in Mainstream Secondary[superscript3] Classes

    Science.gov (United States)

    Schall-Leckrone, Laura; Pavlak, Christina

    2014-01-01

    This article reports empirical evidence about the influence of a pre-service methods course on preparing aspiring and practicing content teachers to work with adolescent bilingual learners in secondary schools. Qualitative methods were used to analyze the extent to which participants developed abilities to plan instruction and to think complexly…

  15. Comparing Management Models of Secondary Schools in Tamaulipas, Mexico: An Exploration with a Delphi Method

    Science.gov (United States)

    Navarro-Leal, Marco Aurelio; Garcia, Concepcion Nino; Saldivar, Luisa Caballero

    2012-01-01

    For a preliminary exploration of management models between two secondary schools, a Delphi method was used in order to identify and focus relevant topics for a larger research. A first approximation with this method proved to be a heuristic tool to focus and define some categories and guidelines of enquiry. It was found that in both of the schools…

  16. Basic methods of isotope analysis

    International Nuclear Information System (INIS)

    Ochkin, A.V.; Rozenkevich, M.B.

    2000-01-01

    The bases of the most applied methods of the isotope analysis are briefly presented. The possibilities and analytical characteristics of the mass-spectrometric, spectral, radiochemical and special methods of the isotope analysis, including application of the magnetic resonance, chromatography and refractometry, are considered [ru

  17. Techno-Economic Analysis of a Secondary Air Stripper Process

    Energy Technology Data Exchange (ETDEWEB)

    Heberle, J.R. [Electric Power Research Inst. (EPRI), Palo Alto, CA (United States); Nikolic, Heather [Center for Applied Energy Research, University of Kentucky, Lexington, KY (United States); Thompson, Jesse [Center for Applied Energy Research, University of Kentucky, Lexington, KY (United States); Liu, Kunlei [Center for Applied Energy Research, University of Kentucky, Lexington, KY (United States); Pinkerton, Lora L. [WorleyParsons, Reading, PA (United States); Brubaker, David [WorleyParsons, Reading, PA (United States); Simpson, James C. [WorleyParsons, Reading, PA (United States); Wu, Song [Mitsubishi Hitachi Power Systems America, Inc, Basking Ridge, NJ (United States); Bhown, Abhoyjit S. [Electric Power Research Inst. (EPRI), Palo Alto, CA (United States)

    2017-08-22

    We present results of an initial techno-economic assessment on a post-combustion CO2 capture process developed by the Center for Applied Energy Research (CAER) at the University of Kentucky using Mitsubishi Hitachi Power Systems’ H3-1 aqueous amine solvent. The analysis is based on data collected at a 0.7 MWe pilot unit combined with laboratory data and process simulations. The process adds a secondary air stripper to a conventional solvent process, which increases the cyclic loading of the solvent in two ways. First, air strips additional CO2 from the solvent downstream of the conventional steam-heated thermal stripper. This extra stripping of CO2 reduces the lean loading entering the absorber. Second, the CO2-enriched air is then sent to the boiler for use as secondary air. This recycling of CO2 results in a higher concentration of CO2 in the flue gas sent to the absorber, and hence a higher rich loading of the solvent exiting the absorber. A process model was incorporated into a full-scale supercritical pulverized coal power plant model to determine the plant performance and heat and mass balances. The performance and heat and mass balance data were used to size equipment and develop cost estimates for capital and operating costs. Lifecycle costs were considered through a levelized cost of electricity (LCOE) assessment based on the capital cost estimate and modeled performance. The results of the simulations show that the CAER process yields a regeneration energy of 3.12 GJ/t CO2, a $53.05/t CO2 capture cost, and LCOE of $174.59/MWh. This compares to the U.S. Department of Energy’s projected costs (Case 10) of regeneration energy of 3.58 GJ/t CO2 , a $61.31/t CO2 capture cost, and LCOE of $189.59/MWh. For H3-1, the CAER process results in a regeneration energy of 2.62 GJ/tCO2 with a stripper pressure of 5.2 bar, a capture cost of $46.93/t CO2, and an LCOE of $164.33/MWh.

  18. Classifying Secondary Task Driving Safety Using Method of F-ANP

    Directory of Open Access Journals (Sweden)

    Lisheng Jin

    2015-02-01

    Full Text Available This study was designed to build an evaluation system for secondary task driving safety by using method of Fuzzy Analytic Network Process (F-ANP. Forty drivers completed driving on driving simulator while interacting with or without a secondary task. Measures of fixations, saccades, and vehicle running status were analyzed. According to five experts' opinions, a hierarchical model for secondary task driving safety evaluation was built. The hierarchical model was divided into three levels: goal, assessment dimension, and criteria. Seven indexes make up the level of criteria, and the assessment dimension includes two clusters: vehicle control risk and driver eye movement risk. By method of F-ANP, the priorities of the criteria and the subcriteria were determined. Furthermore, to rank the driving safety, an approach based on the principle of maximum membership degree was adopted. At last, a case study of secondary task driving safety evaluation by forty drivers using the proposed method was done. The results indicated that the application of the proposed method is practically feasible and adoptable for secondary task driving safety evaluation.

  19. SAAS: Short Amino Acid Sequence - A Promising Protein Secondary Structure Prediction Method of Single Sequence

    Directory of Open Access Journals (Sweden)

    Zhou Yuan Wu

    2013-07-01

    Full Text Available In statistical methods of predicting protein secondary structure, many researchers focus on single amino acid frequencies in α-helices, β-sheets, and so on, or the impact near amino acids on an amino acid forming a secondary structure. But the paper considers a short sequence of amino acids (3, 4, 5 or 6 amino acids as integer, and statistics short sequence's probability forming secondary structure. Also, many researchers select low homologous sequences as statistical database. But this paper select whole PDB database. In this paper we propose a strategy to predict protein secondary structure using simple statistical method. Numerical computation shows that, short amino acids sequence as integer to statistics, which can easy see trend of short sequence forming secondary structure, and it will work well to select large statistical database (whole PDB database without considering homologous, and Q3 accuracy is ca. 74% using this paper proposed simple statistical method, but accuracy of others statistical methods is less than 70%.

  20. Pyrosequencing Analysis of Cryogenically Ground Samples from Primary and Secondary/Persistent Endodontic Infections.

    Science.gov (United States)

    Keskin, Cangül; Demiryürek, Ebru Özsezer; Onuk, Ertan Emek

    2017-08-01

    This study aimed to characterize the microbial communities of primary and secondary/persistent endodontic infections using high-throughput pyrosequencing from the pulverized samples. The roots of 20 extracted human teeth with primary endodontic infection and 20 teeth with secondary/persistent endodontic infection were collected. The outer surfaces of the roots were disinfected, and whole roots were cryopulverized. 16S amplicon pyrosequencing data from the DNA extracted from the pulverized root powders were obtained, and microorganism abundance and diversity were calculated. Data were analyzed using statistical and bioinformatic methods. Pyrosequencing analysis resulted a total of 2,606,128 sequences from 40 samples. A total of 15 phyla, 160 genera, and 368 species were detected. No significant difference between primary and secondary/persistent endodontic infections was found regarding the diversity and richness of operational taxonomic units at the phyla, genera, and species levels (P > .005). The present study revealed that the microbial diversity of secondary/persistent endodontic infections did not differ than those of primary endodontic infections. A new archaeal species, Candidatus Nitrosoarchaeum limnia, was detected in root canals of 1 patient with primary endodontic infection for the first time. Copyright © 2017 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  1. Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

    Directory of Open Access Journals (Sweden)

    Mariana Minatel Braga

    2010-03-01

    Full Text Available Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent, radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC analysis, and the area under the ROC curve (Az, and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2 and dentine (D3 thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively. In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

  2. Analysis of secondary motions in square duct flow

    Science.gov (United States)

    Modesti, Davide; Pirozzoli, Sergio; Orlandi, Paolo; Grasso, Francesco

    2018-04-01

    We carry out direct numerical simulations (DNS) of square duct flow spanning the friction Reynolds number range {Re}τ * =150-1055, to study the nature and the role of secondary motions. We preliminarily find that secondary motions are not the mere result of the time averaging procedure, but rather they are present in the instantaneous flow realizations, corresponding to large eddies persistent in both space and time. Numerical experiments have also been carried out whereby the secondary motions are suppressed, hence allowing to quantifying their effect on the mean flow field. At sufficiently high Reynolds number, secondary motions are found to increase the friction coefficient by about 3%, hence proportionally to their relative strength with respect to the bulk flow. Simulations without secondary motions are found to yield larger deviations on the mean velocity profiles from the standard law-of-the-wall, revealing that secondary motions act as a self-regulating mechanism of turbulence whereby the effect of the corners is mitigated.

  3. Analysis of organic compounds by secondary neutral mass spectrometry (SNMS) and secondary ion mass spectrometry (SIMS)

    International Nuclear Information System (INIS)

    Ewinger, H.P.

    1993-05-01

    This study is about the use of secondary neutral mass spectrometry (SNMS) and secondary ion mass spectrometry (SIMS) as analytical techniques with depth resolution in determining organic components in environmental solid microparticles. The first application of plasma SNMS to organic compounds revealed the spectra to be composed mainly of signals from the atoms of all participating elements, such as C, H, O, N, S, P, and Cl. In addition, signals produced by multi-atomic clusters can be detected, such as CH, C 2 , CH 2 , C 2 H, and C 3 , as well as signals indicating the presence of organic compounds with hetero elements, such as OH, NH, and CN. Their intensity decreases very markedly with increasing numbers of atoms. Among the signals from bi-atomic clusters, those coming from elements with large mass differences are most intense. The use of plasma SNMS with organic compounds has shown that, except for spurious chemical reactions induced by ion bombardment and photodesorption by the photons of the plasma, it is possible to analyze with resolution in depth, elements of organic solids. A more detailed molecular characterization of organic compounds is possible by means of SIMS on the basis of multi-atomic fragments and by comparison with suitable signal patterns. (orig./BBR) [de

  4. Probabilistic methods for rotordynamics analysis

    Science.gov (United States)

    Wu, Y.-T.; Torng, T. Y.; Millwater, H. R.; Fossum, A. F.; Rheinfurth, M. H.

    1991-01-01

    This paper summarizes the development of the methods and a computer program to compute the probability of instability of dynamic systems that can be represented by a system of second-order ordinary linear differential equations. Two instability criteria based upon the eigenvalues or Routh-Hurwitz test functions are investigated. Computational methods based on a fast probability integration concept and an efficient adaptive importance sampling method are proposed to perform efficient probabilistic analysis. A numerical example is provided to demonstrate the methods.

  5. Analysis of Precision of Activation Analysis Method

    DEFF Research Database (Denmark)

    Heydorn, Kaj; Nørgaard, K.

    1973-01-01

    The precision of an activation-analysis method prescribes the estimation of the precision of a single analytical result. The adequacy of these estimates to account for the observed variation between duplicate results from the analysis of different samples and materials, is tested by the statistic T...

  6. Analysis apparatus and method of analysis

    International Nuclear Information System (INIS)

    1976-01-01

    A continuous streaming method developed for the excution of immunoassays is described in this patent. In addition, a suitable apparatus for the method was developed whereby magnetic particles are automatically employed for the consecutive analysis of a series of liquid samples via the RIA technique

  7. Nonlinear programming analysis and methods

    CERN Document Server

    Avriel, Mordecai

    2012-01-01

    This text provides an excellent bridge between principal theories and concepts and their practical implementation. Topics include convex programming, duality, generalized convexity, analysis of selected nonlinear programs, techniques for numerical solutions, and unconstrained optimization methods.

  8. Chemical methods of rock analysis

    National Research Council Canada - National Science Library

    Jeffery, P. G; Hutchison, D

    1981-01-01

    A practical guide to the methods in general use for the complete analysis of silicate rock material and for the determination of all those elements present in major, minor or trace amounts in silicate...

  9. Mixed Methods Study Using Constructive Learning Team Model for Secondary Mathematics Teachers

    Science.gov (United States)

    Ritter, Kristy L.

    2010-01-01

    The constructive learning team model for secondary mathematics teachers (CLTM) was created to provide students with learning opportunities and experiences that address deficiencies in oral and written communication, logical processes and analysis, mathematical operations, independent learning, teamwork, and technology utilization. This study…

  10. What Can Secondary Data Analysis Tell Us about School Exclusions in England?

    Science.gov (United States)

    Smith, Emma

    2009-01-01

    Secondary data analysis as a methodological approach is not without its critics. Indeed, three main objections to the use of secondary data analysis in social research stand out: first that because of the socially constructed nature of social data, the act of reducing it to a simple numeric form cannot fully encapsulate its complexity. Secondly,…

  11. Potentials and Limits of Secondary Analysis in a Specific Applied Context: The Case of EDF—Verbatim

    Directory of Open Access Journals (Sweden)

    Magdalini Dargentas

    2005-01-01

    Full Text Available In this paper we present the results of secondary analyses conducted on documents recorded in VERBATIM, the qualitative data archiving system and database developed by the Sociological Surveys Department (GRETS of Electricité de France (EDF. The archived studies, unique in France, offer some specific methodological and theoretical features. In order to explain their properties, constraints, and diversity we present four re-analysis studies, which provide an overview of the research aims and topics, the body of textual data, the methods of the secondary analysis and the conditions under which re-analysis can be judged as reliable. We also explore the use of qualitative software in these analyses. Furthermore, we focus on the Sociological Surveys Department researchers' attitudes towards secondary analysis, which shed light on the future development of secondary analysis in France. Finally, we present a future project concerning scientific collaboration with the Centre d'Informatisation des Données Socio-Politiques (CIDSP which aims to develop more systematic qualitative data archiving and secondary analysis in France. URN: urn:nbn:de:0114-fqs0501404

  12. Experience in Use of Project Method during Technology Lessons in Secondary Schools of the USA

    Science.gov (United States)

    Sheludko, Inna

    2015-01-01

    The article examines the opportunities and prospects for the use of experience of project method during "technology lessons" in US secondary schools, since the value of project technology implementation experience into the educational process in the USA for ensuring holistic development of children, preparing them for adult life, in…

  13. Motivation Beliefs of Secondary School Teachers in Canada and Singapore: A Mixed Methods Study

    Science.gov (United States)

    Klassen, Robert M.; Chong, Wan Har; Huan, Vivien S.; Wong, Isabella; Kates, Allison; Hannok, Wanwisa

    2008-01-01

    A mixed methods approach was used to explore secondary teachers' motivation beliefs in Canada and Singapore. Results from Study 1 revealed that socio-economic status (SES) was the strongest predictor of school climate in Canada, and that collective efficacy mediated the effect of SES on school climate in Singapore, but not in Canada. In Study 2,…

  14. The Physically Active Lifestyle of Flemish Secondary School Teachers: A Mixed-Methods Approach towards Developing a Physical Activity Intervention

    Science.gov (United States)

    Bogaert, Inge; De Martelaer, Kristine; Deforche, Benedicte; Clarys, Peter; Zinzen, Evert

    2015-01-01

    Objective: The primary aim of this study was to describe and analyse the physical activity and sedentary levels of secondary school teachers in Flanders. A secondary aim was to collect information regarding a possible worksite intervention of special relevance to secondary school teachers. Design: Mixed-methods quantitative and qualitative…

  15. Seismic design and analysis methods

    International Nuclear Information System (INIS)

    Varpasuo, P.

    1993-01-01

    Seismic load is in many areas of the world the most important loading situation from the point of view of structural strength. Taking this into account it is understandable, that there has been a strong allocation of resources in the seismic analysis during the past ten years. In this study there are three areas of the center of gravity: (1) Random vibrations; (2) Soil-structure interaction and (3) The methods for determining structural response. The solution of random vibration problems is clarified with the aid of applications in this study and from the point of view of mathematical treatment and mathematical formulations it is deemed sufficient to give the relevant sources. In the soil-structure interaction analysis the focus has been the significance of frequency dependent impedance functions. As a result it was obtained, that the description of the soil with the aid of frequency dependent impedance functions decreases the structural response and it is thus always the preferred method when compared to more conservative analysis types. From the methods to determine the C structural response the following four were tested: (1) The time history method; (2) The complex frequency-response method; (3) Response spectrum method and (4) The equivalent static force method. The time history appeared to be the most accurate method and the complex frequency-response method did have the widest area of application. (orig.). (14 refs., 35 figs.)

  16. [Contribution of lifestyle factors to cancer: secondary analysis of Dutch data over 2010 and a projection for 2020

    NARCIS (Netherlands)

    Lanting, C.I.; Vroome, E.M. de; Elias, S.G.; Brandt, P.A. van den; Leeuwen, F.E. van; Kampman, E.; Kiemeney, L.A.L.M.; Peeters, P.H.M.; Vries, E de; Bausch-Goldbohm, R.A.

    2014-01-01

    OBJECTIVE: To calculate the proportion of cancer cases in the Netherlands in 2010 that were attributable to lifestyle factors by using the most recent data. DESIGN: Secondary analysis. METHOD: Lifestyle risk factors studied were tobacco smoking, alcohol consumption, overweight, lack of physical

  17. Analysis of Poor Performance of Senior Secondary Students in ...

    African Journals Online (AJOL)

    This study investigated the poor performance of students in Chemistry. The widespread poor performance and the negative attitudes towards chemistry of secondary school students have been largely ascribed to teaching problems. A random sample of 109 students from St Pius X College Bodo City was used. The research ...

  18. Analysis of Students' Errors on Linear Programming at Secondary ...

    African Journals Online (AJOL)

    The purpose of this study was to identify secondary school students' errors on linear programming at 'O' level. It is based on the fact that students' errors inform teaching hence an essential tool for any serious mathematics teacher who intends to improve mathematics teaching. The study was guided by a descriptive survey ...

  19. Numerical and Experimental Characterization of a Composite Secondary Bonded Adhesive Lap Joint Using the Ultrasonics method

    Science.gov (United States)

    Kumar, M. R.; Ghosh, A.; Karuppannan, D.

    2018-05-01

    The construction of aircraft using advanced composites have become very popular during the past two decades, in which many innovative manufacturing processes, such as cocuring, cobonding, and secondary bonding processes, have been adopted. The secondary bonding process has become less popular than the other two ones because of nonavailability of process database and certification issues. In this article, an attempt is made to classify the quality of bonding using nondestructive ultrasonic inspection methods. Specimens were prepared and tested using the nondestructive ultrasonic Through Transmission (TT), Pulse Echo (PE), and air coupled guided wave techniques. It is concluded that the ultrasonic pulse echo technique is the best one for inspecting composite secondary bonded adhesive joints.

  20. The use of secondary ion mass spectrometry for uranium analysis in bioassays

    International Nuclear Information System (INIS)

    Amaral, Ademir de Jesus

    1997-01-01

    Today many researches are performed to use mass spectrometry as complementary methods to the alpha spectrometry. In this study performance of the secondary ion mass spectrometry (SIMS) are evaluated for traces of uranium analysis in biological tissues and more particularly in urine. A special attention is done for the samples preparation, using thin polymers. the SIMS method feasibility is presented. The second part of the thesis deals with the use of a tracer to quantify the urinary uranium, the 233 U. The isotopic ratio are obtained with a detection limit of 10 -6 Bq in 238 U per urine litre. Other biological samples are studied to illustrate the adaptability of the SIMS method to internal dosimetry. (A.L.B.)

  1. A new online secondary path modeling method for adaptive active structure vibration control

    International Nuclear Information System (INIS)

    Pu, Yuxue; Zhang, Fang; Jiang, Jinhui

    2014-01-01

    This paper proposes a new variable step size FXLMS algorithm with an auxiliary noise power scheduling strategy for online secondary path modeling. The step size for the secondary path modeling filter and the gain of auxiliary noise are varied in accordance with the parameters available directly. The proposed method has a low computational complexity. Computer simulations show that an active vibration control system with the proposed method gives much better vibration attenuation and modeling accuracy at a faster convergence rate than existing methods. National Instruments’ CompactRIO is used as an embedded processor to control simply supported beam vibration. Experimental results indicate that the vibration of the beam has been effectively attenuated. (papers)

  2. The health benefits of secondary education in adolescents and young adults: An international analysis in 186 low-, middle- and high-income countries from 1990 to 2013

    OpenAIRE

    Russell M. Viner; Dougal S. Hargreaves; Joseph Ward; Chris Bonell; Ali H. Mokdad; George Patton

    2017-01-01

    Background: The health benefits of secondary education have been little studied. We undertook country-level longitudinal analyses of the impact of lengthening secondary education on health outcomes amongst 15-24 year olds. Methods: Exposures: average length of secondary and primary education from 1980 to 2013. Data/Outcomes: Country level adolescent fertility rate (AFR), HIV prevalence and mortality rate from 1989/90 to 2013 across 186 low-, middle- and high-income countries. Analysi...

  3. Protein energetic conformational analysis from NMR chemical shifts (PECAN) and its use in determining secondary structural elements

    Energy Technology Data Exchange (ETDEWEB)

    Eghbalnia, Hamid R.; Wang Liya; Bahrami, Arash [National Magnetic Resonance Facility at Madison, Biochemistry Department (United States); Assadi, Amir [University of Wisconsin-Madison, Mathematics Department (United States); Markley, John L. [National Magnetic Resonance Facility at Madison, Biochemistry Department (United States)], E-mail: eghbalni@nmrfam.wisc.edu

    2005-05-15

    We present an energy model that combines information from the amino acid sequence of a protein and available NMR chemical shifts for the purposes of identifying low energy conformations and determining elements of secondary structure. The model ('PECAN', Protein Energetic Conformational Analysis from NMR chemical shifts) optimizes a combination of sequence information and residue-specific statistical energy function to yield energetic descriptions most favorable to predicting secondary structure. Compared to prior methods for secondary structure determination, PECAN provides increased accuracy and range, particularly in regions of extended structure. Moreover, PECAN uses the energetics to identify residues located at the boundaries between regions of predicted secondary structure that may not fit the stringent secondary structure class definitions. The energy model offers insights into the local energetic patterns that underlie conformational preferences. For example, it shows that the information content for defining secondary structure is localized about a residue and reaches a maximum when two residues on either side are considered. The current release of the PECAN software determines the well-defined regions of secondary structure in novel proteins with assigned chemical shifts with an overall accuracy of 90%, which is close to the practical limit of achievable accuracy in classifying the states.

  4. Protein energetic conformational analysis from NMR chemical shifts (PECAN) and its use in determining secondary structural elements

    International Nuclear Information System (INIS)

    Eghbalnia, Hamid R.; Wang Liya; Bahrami, Arash; Assadi, Amir; Markley, John L.

    2005-01-01

    We present an energy model that combines information from the amino acid sequence of a protein and available NMR chemical shifts for the purposes of identifying low energy conformations and determining elements of secondary structure. The model ('PECAN', Protein Energetic Conformational Analysis from NMR chemical shifts) optimizes a combination of sequence information and residue-specific statistical energy function to yield energetic descriptions most favorable to predicting secondary structure. Compared to prior methods for secondary structure determination, PECAN provides increased accuracy and range, particularly in regions of extended structure. Moreover, PECAN uses the energetics to identify residues located at the boundaries between regions of predicted secondary structure that may not fit the stringent secondary structure class definitions. The energy model offers insights into the local energetic patterns that underlie conformational preferences. For example, it shows that the information content for defining secondary structure is localized about a residue and reaches a maximum when two residues on either side are considered. The current release of the PECAN software determines the well-defined regions of secondary structure in novel proteins with assigned chemical shifts with an overall accuracy of 90%, which is close to the practical limit of achievable accuracy in classifying the states

  5. Simulation and analysis of secondary emission microwave electron gun

    International Nuclear Information System (INIS)

    He Wencan; Pei Yuanji; Jin Kai; Wu Congfeng

    2001-01-01

    The development of high-current, short-duration pulses of electrons has been a challenging problem for many year. Micro-pulse-gun (MPG) is a novel concept that employs the resonant amplification of an electron current by secondary electron emission in a RE cavity. Using the computation code URMEL-T, several kinds of RF cavities under the frequency of 2856 MHz were calculated and optimized, the magnetic and electric field distribution in them were got. Through particle-in-cell (PIC) simulation, the self-bunching process in a MPG was proved, the relationship between the cavity length and selected phase and the relationship between the peak electric field and selected phase were got. With cathode material of high secondary emission coefficient, the MPG can produce high current densities (1132-5303 A/cm 2 ) and short pulses (3.15-10 ps)

  6. Analysis of violence against primary and secondary schools students

    OpenAIRE

    Knafelc, Breda

    2013-01-01

    This master's thesis studies peer and domestic violence on elementary and secondary schools pupils from the theoretical and practical point of view. The first part of the theoretical part in detail studies the notion of violence. Forms of violence are presented with its specific forms, goals and consequences of individual forms of violence. In detail are presented forms of physical violence which represent one of the roughest forms of overpowering an individual, psychological violence as ...

  7. Application of secondary ion mass spectrometry (SIMS) to biological sample analysis

    International Nuclear Information System (INIS)

    Tamura, Hifumi

    1990-01-01

    Some major issues and problems related with the analysis of biological samples are discussed, focusing on demonstrated and possible solutions and the application of secondary ion mass spectrometry (SIMS) to investigation of the composition of biological samples. The effective use of secondary electrons in combination with negative ions is most practical for the analysis of biological samples. Regardless of whether positive or negative ions are used, the electric potential at the surface of a sample stays around a constant value because of the absense of the accumulation of electric charges at the surface, leading to almost complete avoidance of the charging of the biological sample. A soft tissue sample can suffer damage to the tissue or migration of atoms in removing water from the sample. Some processes including fixation and freeze drying are available to prevent this. The application of SIMS to biological analysis is still in the basic research stage and further studies will be required to develop practical methods. Possible areas of its application include medicine, pathology, toxicology, pharmacology, plant physiology and other areas related with marine life and marine contamination. (N.K.)

  8. Service time analysis of secondary packet transmission with opportunistic channel access

    KAUST Repository

    Usman, Muneer; Yang, Hongchuan; Alouini, Mohamed-Slim

    2014-01-01

    Cognitive radio transceiver can opportunistically access the underutilized channels of primary systems for new wireless services. The secondary transmission may be interrupted by the primary user's transmission. To facilitate the delay analysis of such secondary packet transmission, we study the resulting extended delivery time for a fixed-size secondary packet that includes both transmission time and waiting time. In particular we derive the exact distribution functions of extended delivery time of secondary transmission for both continuous sensing and periodic sensing cases. Selected numerical results are presented for illustrating the mathematical formulation.

  9. Service time analysis of secondary packet transmission with opportunistic channel access

    KAUST Repository

    Usman, Muneer

    2014-09-01

    Cognitive radio transceiver can opportunistically access the underutilized channels of primary systems for new wireless services. The secondary transmission may be interrupted by the primary user\\'s transmission. To facilitate the delay analysis of such secondary packet transmission, we study the resulting extended delivery time for a fixed-size secondary packet that includes both transmission time and waiting time. In particular we derive the exact distribution functions of extended delivery time of secondary transmission for both continuous sensing and periodic sensing cases. Selected numerical results are presented for illustrating the mathematical formulation.

  10. Nuclear-Renewable Energy Systems Secondary Product Market Analysis Study

    Energy Technology Data Exchange (ETDEWEB)

    Deason, Wesley Ray [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2015-06-01

    In order to properly create a program surrounding the development of any technological concept it is necessary to fully understand the market in which it is being developed. In the case of Integrated Nuclear-Renewable Hybrid Energy Systems (HES), there are two economic markets in which it must be able to participate in: the electricity market and the secondary product market associated with the specific system. The purpose of the present report is to characterize the secondary product market in the U.S. and to provide recommendations for further developing the HES program. While HESs have been discussed in depth in many other reports, it is helpful to discuss them briefly in the present work [REF]. The concept of the HES can be deduced to a system, featuring a combination of a nuclear power plant, a renewable energy source, and an industrial manufacturing plant . The system is designed in a fashion that allows it either to produce electricity or to manufacture a secondary product as needed. The primary benefit of this concept lies in its ability to maximize economic performance of the integrated system and to manufacture products in a carbon-free manner. A secondary benefit is the enhanced supply-side flexibility gained by allowing the HES to economically provide grid services. A key tenant to nuclear power plant economics in today’s electricity market is their ability to operate at a very high capacity factor. Unfortunately, in regions with a high penetration of renewable energy, the carbon free energy produced by nuclear power may not be needed at all times. This forces the nuclear power plant to find a user for its excess capacity. This may include paying the electric grid to find a user, releasing energy to the environment by ‘dumping steam’, or reducing power. If the plant is unable to economically or safely do any of these actions, the plant is at risk of being shutdown. In order to allow for nuclear power plants to continue to contribute carbon free

  11. Nuclear-Renewable Energy Systems Secondary Product Market Analysis Study

    International Nuclear Information System (INIS)

    Deason, Wesley Ray

    2015-01-01

    In order to properly create a program surrounding the development of any technological concept it is necessary to fully understand the market in which it is being developed. In the case of Integrated Nuclear-Renewable Hybrid Energy Systems (HES), there are two economic markets in which it must be able to participate in: the electricity market and the secondary product market associated with the specific system. The purpose of the present report is to characterize the secondary product market in the U.S. and to provide recommendations for further developing the HES program. While HESs have been discussed in depth in many other reports, it is helpful to discuss them briefly in the present work [REF]. The concept of the HES can be deduced to a system, featuring a combination of a nuclear power plant, a renewable energy source, and an industrial manufacturing plant . The system is designed in a fashion that allows it either to produce electricity or to manufacture a secondary product as needed. The primary benefit of this concept lies in its ability to maximize economic performance of the integrated system and to manufacture products in a carbon-free manner. A secondary benefit is the enhanced supply-side flexibility gained by allowing the HES to economically provide grid services. A key tenant to nuclear power plant economics in today's electricity market is their ability to operate at a very high capacity factor. Unfortunately, in regions with a high penetration of renewable energy, the carbon free energy produced by nuclear power may not be needed at all times. This forces the nuclear power plant to find a user for its excess capacity. This may include paying the electric grid to find a user, releasing energy to the environment by -dumping steam', or reducing power. If the plant is unable to economically or safely do any of these actions, the plant is at risk of being shutdown. In order to allow for nuclear power plants to continue to contribute carbon free

  12. Suitability of Secondary PEEK Telescopic Crowns on Zirconia Primary Crowns: The Influence of Fabrication Method and Taper.

    Science.gov (United States)

    Merk, Susanne; Wagner, Christina; Stock, Veronika; Eichberger, Marlis; Schmidlin, Patrick R; Roos, Malgorzata; Stawarczyk, Bogna

    2016-11-08

    This study investigates the retention load (RL) between ZrO₂ primary crowns and secondary polyetheretherketone (PEEK) crowns made by different fabrication methods with three different tapers. Standardized primary ZrO₂ crowns were fabricated with three different tapers: 0°, 1°, and 2° ( n = 10/group). Ten secondary crowns were fabricated (i) milled from breCam BioHPP blanks (PM); (ii) pressed from industrially fabricated PEEK pellets (PP) (BioHPP Pellet); or (iii) pressed from granular PEEK (PG) (BioHPP Granulat). One calibrated operator adjusted all crowns. In total, the RL of 90 secondary crowns were measured in pull-off tests at 50 mm/min, and each specimen was tested 20 times. Two- and one-way ANOVAs followed by a Scheffé's post-hoc test were used for data analysis ( p impact on the results. Within the 2° taper, the fabrication method had no influence on the RL. Within the PM group, the 2° taper showed significantly higher retention load compared with the 1° taper. The taper with 0° was in the same range value as the 1° and 2° tapers. No impact of the taper on the retention value was observed between the PP groups. Within the PG groups, the 0° taper presented significantly lower RL than the 1° taper, whereas the 2° taper showed no differences. The fabrication method of the secondary PEEK crowns and taper angles showed no consistent effect within all tested groups.

  13. Suitability of Secondary PEEK Telescopic Crowns on Zirconia Primary Crowns: The Influence of Fabrication Method and Taper

    Directory of Open Access Journals (Sweden)

    Susanne Merk

    2016-11-01

    Full Text Available This study investigates the retention load (RL between ZrO2 primary crowns and secondary polyetheretherketone (PEEK crowns made by different fabrication methods with three different tapers. Standardized primary ZrO2 crowns were fabricated with three different tapers: 0°, 1°, and 2° (n = 10/group. Ten secondary crowns were fabricated (i milled from breCam BioHPP blanks (PM; (ii pressed from industrially fabricated PEEK pellets (PP (BioHPP Pellet; or (iii pressed from granular PEEK (PG (BioHPP Granulat. One calibrated operator adjusted all crowns. In total, the RL of 90 secondary crowns were measured in pull-off tests at 50 mm/min, and each specimen was tested 20 times. Two- and one-way ANOVAs followed by a Scheffé’s post-hoc test were used for data analysis (p < 0.05. Within crowns with a 0° taper, the PP group showed significantly higher retention load values compared with the other groups. Among the 1° taper, the PM group presented significantly lower retention loads than the PP group. However, the pressing type had no impact on the results. Within the 2° taper, the fabrication method had no influence on the RL. Within the PM group, the 2° taper showed significantly higher retention load compared with the 1° taper. The taper with 0° was in the same range value as the 1° and 2° tapers. No impact of the taper on the retention value was observed between the PP groups. Within the PG groups, the 0° taper presented significantly lower RL than the 1° taper, whereas the 2° taper showed no differences. The fabrication method of the secondary PEEK crowns and taper angles showed no consistent effect within all tested groups.

  14. Evaluation of Pentachlorophenol Residues in Some Hygienic Papers Prepared from Virgin and Secondary Pulp by Electron Capture Gas Chromatographic Method

    Directory of Open Access Journals (Sweden)

    Behrouz Akbari-adergani

    2016-01-01

    Full Text Available In this study, residual amount of pentachlorophenol (PCP as the most important paper preservative, which is extremely hazardous pollutant, was determined in some tissue papers and napkins. Twenty-five samples of two producing hygienic paper factories prepared from virgin and secondary pulp were analyzed for the presence of trace amount of PCP. The analytical procedure involved direct extraction of PCP from hygienic paper and its determination by gas chromatography with electron capture detection. The statistical results for the analysis of all samples revealed that there were significant differences between mean of PCP in hygienic papers prepared from virgin and secondary pulp (P<0.05. This method gave recoveries of 86-98% for hygienic paper made from virgin pulp and 79-92% for hygienic paper made from secondary pulp. The limit of detection (LOD and limit of quantification (LOQ for PCP were 6.3 and 21.0 mg/kg, respectively. The analytical method has the requisite sensitivity, accuracy, precision and specificity to assay PCP in hygienic papers. This study demonstrates a concern with exposition to PCP considering that hygienic paper is largely consumed in the society.

  15. Determining Methods used in Teaching Geography in Secondary Schools in Rongo District, Kenya

    OpenAIRE

    Omoro Benjamin; Luke Wakhungu Nato

    2014-01-01

    This article dealt with methods of teaching Geography in Kenya but also the world over. The importance of Geography in secondary school curriculum cannot be overemphasized. Improving the performance of Geography education is a great societal need in Kenya not only for industrialization of the country as contained in the vision 2030 but also for ensuring food security in the country through practices like land reclamation and irrigation farming The objective of this article was; to find out th...

  16. SVM-PB-Pred: SVM based protein block prediction method using sequence profiles and secondary structures.

    Science.gov (United States)

    Suresh, V; Parthasarathy, S

    2014-01-01

    We developed a support vector machine based web server called SVM-PB-Pred, to predict the Protein Block for any given amino acid sequence. The input features of SVM-PB-Pred include i) sequence profiles (PSSM) and ii) actual secondary structures (SS) from DSSP method or predicted secondary structures from NPS@ and GOR4 methods. There were three combined input features PSSM+SS(DSSP), PSSM+SS(NPS@) and PSSM+SS(GOR4) used to test and train the SVM models. Similarly, four datasets RS90, DB433, LI1264 and SP1577 were used to develop the SVM models. These four SVM models developed were tested using three different benchmarking tests namely; (i) self consistency, (ii) seven fold cross validation test and (iii) independent case test. The maximum possible prediction accuracy of ~70% was observed in self consistency test for the SVM models of both LI1264 and SP1577 datasets, where PSSM+SS(DSSP) input features was used to test. The prediction accuracies were reduced to ~53% for PSSM+SS(NPS@) and ~43% for PSSM+SS(GOR4) in independent case test, for the SVM models of above two same datasets. Using our method, it is possible to predict the protein block letters for any query protein sequence with ~53% accuracy, when the SP1577 dataset and predicted secondary structure from NPS@ server were used. The SVM-PB-Pred server can be freely accessed through http://bioinfo.bdu.ac.in/~svmpbpred.

  17. Analysis of secondary coxarthrosis by three dimensional computed tomography

    Energy Technology Data Exchange (ETDEWEB)

    Hemmi, Osamu [Keio Univ., Tokyo (Japan). School of Medicine

    1997-11-01

    The majority of coxarthrosis in Japan is due to congenital dislocation of the hip and acetabular dysplasia. Until now coxarthrosis has been chiefly analyzed on the basis of anterior-posterior radiographs. By using three-dimensional (3D) CT, it was possible to analyze the morphological features of secondary coxarthrosis more accurately, and by using new computer graphics software, it was possible to display the contact area in the hip joint and observe changes associated with progression of the stages of the disease. There were 34 subjects (68 joints), and all of who were women. The CT data were read into a work station, and 3D reconstruction was achieved with hip surgery simulation software (SurgiPlan). Pelvic inclination, acetabular anteversion, seven parameters indicating the investment of the femoral head and two indicating the position of the hip joint in the pelvis were measured. The results showed that secondary coxarthrosis is characterized not only by lateral malposition of the hip joint according to the pelvic coordinates, but by anterior malposition as well. Many other measurements provided 3D information on the acetabular dysplasia. Many of them were correlated with the CE angle on plain radiographs. Furthermore, a strong correlation was not found between anterior and posterior acetabular coverage of the femoral head. In addition, SurgiPlan`s distance mapping function enabled 3D observation of the pattern of progression of arthrosis based on the pattern of progression of joint space narrowing. (author)

  18. Analysis of secondary coxarthrosis by three dimensional computed tomography

    International Nuclear Information System (INIS)

    Hemmi, Osamu

    1997-01-01

    The majority of coxarthrosis in Japan is due to congenital dislocation of the hip and acetabular dysplasia. Until now coxarthrosis has been chiefly analyzed on the basis of anterior-posterior radiographs. By using three-dimensional (3D) CT, it was possible to analyze the morphological features of secondary coxarthrosis more accurately, and by using new computer graphics software, it was possible to display the contact area in the hip joint and observe changes associated with progression of the stages of the disease. There were 34 subjects (68 joints), and all of who were women. The CT data were read into a work station, and 3D reconstruction was achieved with hip surgery simulation software (SurgiPlan). Pelvic inclination, acetabular anteversion, seven parameters indicating the investment of the femoral head and two indicating the position of the hip joint in the pelvis were measured. The results showed that secondary coxarthrosis is characterized not only by lateral malposition of the hip joint according to the pelvic coordinates, but by anterior malposition as well. Many other measurements provided 3D information on the acetabular dysplasia. Many of them were correlated with the CE angle on plain radiographs. Furthermore, a strong correlation was not found between anterior and posterior acetabular coverage of the femoral head. In addition, SurgiPlan's distance mapping function enabled 3D observation of the pattern of progression of arthrosis based on the pattern of progression of joint space narrowing. (author)

  19. SWOT ANALYSIS ON SAMPLING METHOD

    Directory of Open Access Journals (Sweden)

    CHIS ANCA OANA

    2014-07-01

    Full Text Available Audit sampling involves the application of audit procedures to less than 100% of items within an account balance or class of transactions. Our article aims to study audit sampling in audit of financial statements. As an audit technique largely used, in both its statistical and nonstatistical form, the method is very important for auditors. It should be applied correctly for a fair view of financial statements, to satisfy the needs of all financial users. In order to be applied correctly the method must be understood by all its users and mainly by auditors. Otherwise the risk of not applying it correctly would cause loose of reputation and discredit, litigations and even prison. Since there is not a unitary practice and methodology for applying the technique, the risk of incorrectly applying it is pretty high. The SWOT analysis is a technique used that shows the advantages, disadvantages, threats and opportunities. We applied SWOT analysis in studying the sampling method, from the perspective of three players: the audit company, the audited entity and users of financial statements. The study shows that by applying the sampling method the audit company and the audited entity both save time, effort and money. The disadvantages of the method are difficulty in applying and understanding its insight. Being largely used as an audit method and being a factor of a correct audit opinion, the sampling method’s advantages, disadvantages, threats and opportunities must be understood by auditors.

  20. Phylogenomic analysis of secondary metabolism genes sheds light on their evolution in Aspergilli

    DEFF Research Database (Denmark)

    Theobald, Sebastian; Vesth, Tammi Camilla; Rasmussen, Jane Lind Nybo

    .Natural products are encoded by genes located in close proximity, called secondary metabolic gene clusters, which makes them interesting targets for genomic analysis. We use a modified version of the Secondary Metabolite Unique Regions Finder (SMURF) algorithm, combined with InterPro annotations to create...... approximate maximum likelihood trees of conserved domains from secondary metabolic genes across 56 species, giving insights into the secondary metabolism gene diversity and evolution.In this study we can describe the evolution of non ribosomal peptide synthetases (NRPS), polyketide synthases (PKS) and hybrids.......In the aspMine project, we are sequencing and analyzing over 300 species of Aspergilli, agroup of filamentous fungi rich in natural compounds. The vast amount of data obtained from these species challenges the way we were mining for products and requires new pipelines for secondary metabolite analysis...

  1. Effectiveness of Demonstration and Lecture Methods in Learning Concept in Economics among Secondary School Students in Borno State, Nigeria

    Science.gov (United States)

    Muhammad, Amin Umar; Bala, Dauda; Ladu, Kolomi Mutah

    2016-01-01

    This study investigated the Effectiveness of Demonstration and Lecture Methods in Learning concepts in Economics among Secondary School Students in Borno state, Nigeria. Five objectives: to determine the effectiveness of demonstration method in learning economics concepts among secondary school students in Borno state, determine the effectiveness…

  2. Effect of cerium additive and secondary phase analysis on Ag0.5Bi0 ...

    Indian Academy of Sciences (India)

    Technical University of Madrid (UPM), Madrid 28012, Spain. MS received 27 ... XRD analysis showed the presence of pyrochlore structure and secondary phase when more .... The present work reports the effect of incorporation of cerium in ...

  3. CompaRNA: a server for continuous benchmarking of automated methods for RNA secondary structure prediction

    Science.gov (United States)

    Puton, Tomasz; Kozlowski, Lukasz P.; Rother, Kristian M.; Bujnicki, Janusz M.

    2013-01-01

    We present a continuous benchmarking approach for the assessment of RNA secondary structure prediction methods implemented in the CompaRNA web server. As of 3 October 2012, the performance of 28 single-sequence and 13 comparative methods has been evaluated on RNA sequences/structures released weekly by the Protein Data Bank. We also provide a static benchmark generated on RNA 2D structures derived from the RNAstrand database. Benchmarks on both data sets offer insight into the relative performance of RNA secondary structure prediction methods on RNAs of different size and with respect to different types of structure. According to our tests, on the average, the most accurate predictions obtained by a comparative approach are generated by CentroidAlifold, MXScarna, RNAalifold and TurboFold. On the average, the most accurate predictions obtained by single-sequence analyses are generated by CentroidFold, ContextFold and IPknot. The best comparative methods typically outperform the best single-sequence methods if an alignment of homologous RNA sequences is available. This article presents the results of our benchmarks as of 3 October 2012, whereas the rankings presented online are continuously updated. We will gladly include new prediction methods and new measures of accuracy in the new editions of CompaRNA benchmarks. PMID:23435231

  4. CompaRNA: a server for continuous benchmarking of automated methods for RNA secondary structure prediction.

    Science.gov (United States)

    Puton, Tomasz; Kozlowski, Lukasz P; Rother, Kristian M; Bujnicki, Janusz M

    2013-04-01

    We present a continuous benchmarking approach for the assessment of RNA secondary structure prediction methods implemented in the CompaRNA web server. As of 3 October 2012, the performance of 28 single-sequence and 13 comparative methods has been evaluated on RNA sequences/structures released weekly by the Protein Data Bank. We also provide a static benchmark generated on RNA 2D structures derived from the RNAstrand database. Benchmarks on both data sets offer insight into the relative performance of RNA secondary structure prediction methods on RNAs of different size and with respect to different types of structure. According to our tests, on the average, the most accurate predictions obtained by a comparative approach are generated by CentroidAlifold, MXScarna, RNAalifold and TurboFold. On the average, the most accurate predictions obtained by single-sequence analyses are generated by CentroidFold, ContextFold and IPknot. The best comparative methods typically outperform the best single-sequence methods if an alignment of homologous RNA sequences is available. This article presents the results of our benchmarks as of 3 October 2012, whereas the rankings presented online are continuously updated. We will gladly include new prediction methods and new measures of accuracy in the new editions of CompaRNA benchmarks.

  5. Stress analysis of secondary ramp and secondary tilting mechanism of inclined fuel transfer machine for 500 MWe PFBR

    International Nuclear Information System (INIS)

    Prabhakaran, K.M.; Vaze, K.K.; Ghosh, A.K.; Rai, Somesh; Sundarani, A.R.; Patel, R.J.; Agrawal, R.G.

    2004-10-01

    Inclined Fuel Transfer Machine (IFTM) is one of the important machine of the fuel handling system of 500 MWe Prototype Fast Breeder Reactor (PFBR). It is used to transfer core sub-assemblies (CSA) from reactor vessel to fuel building and vice-versa. Secondary ramp and Secondary tilting mechanism (SR/STM) is a part of IFTM which acts as a passage to transfer CSA. This mechanism and components were designed by the Refuelling Technology Division of BARC as per the ASME design code as class 2 component. Being critical in nature and complicated in geometry it was required to check the design of these components by detailed finite element analysis. The loading considered in the present study was static, thermal and seismic conditions. This was done using FEM software COSMOS/M. The Stresses were categorised as per the requirement of the ASME code for various levels of loading (Level A, B and C). Based on the analysis performed, it was concluded that the SR/STM qualifies the requirement of ASME code Section-III NC (Class-2 components). This report gives the details of the studies performed. (author)

  6. Secondary-ion mass spectrometry: some applications in the analysis of nuclear material

    International Nuclear Information System (INIS)

    Christie, W.H.; Eby, R.E.; Warmack, R.J.; Landau, L.

    1981-01-01

    Secondary ion mass spectrometry (SIMS) has been shown to offer some significant advantages over conventional mass spectrometry for the analysis of radioactive samples. We have used SIMS for the rapid, accurate analysis of B, Li, Cs, U and Pu in various nuclear materials. In many instances, SIMS allows one to perform mass and isotopic analysis on samples that are not amenable to other mass spectrometric techniques (e.g., surface ionization, electron impact, etc.). The significant advantage that accrues from the use of SIMS for isotopic analysis of these materials is the cmplete elimination of any chemical sample preparation steps, and only sample dissolution is necessary for the application of isotope dilution methods for quantitative analysis. The high sensitivity of SIMS for B, Li, U and Pu makes it possible to analyze sufficiently small radioactive samples so that radiation is reduced to acceptable levels for safe handling. The precision of SIMS isotopic analysis for natural B samples is about 0.5% and is about 1% for natural Li samples

  7. Flows method in global analysis

    International Nuclear Information System (INIS)

    Duong Minh Duc.

    1994-12-01

    We study the gradient flows method for W r,p (M,N) where M and N are Riemannian manifold and r may be less than m/p. We localize some global analysis problem by constructing gradient flows which only change the value of any u in W r,p (M,N) in a local chart of M. (author). 24 refs

  8. Enhanced secondary analysis of survival data: reconstructing the data from published Kaplan-Meier survival curves

    Directory of Open Access Journals (Sweden)

    Guyot Patricia

    2012-02-01

    Full Text Available Abstract Background The results of Randomized Controlled Trials (RCTs on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. Methods We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios with statistics based on repeated reconstructions by multiple observers. Results The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. Conclusion The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.

  9. Methods to reduce intraocular pressure on secondary glaucoma after severe eye burns

    Directory of Open Access Journals (Sweden)

    A. V. Solovieva

    2014-07-01

    Full Text Available Purpose: Show the results of treatment of secondary glaucoma after severe eye burns.Methods: We observed 70 patients (108 eyes with severe burns the eyes and their consequences, secondary glaucoma was observed in 40 patients (58 eyes. All patients with secondary glaucoma received traditional antihypertensive therapy, with its failure to resort to antiglaucomatous surgery. Cataract extraction performed in 24 cases, 16 of them in combination with other surgery: the reconstruction of the anterior chamber, penetrating keratoplasty, sinustrabeculectomy, diode laser cyclocoagulation. Diode laser cy- clocoagulation performed 42 times in 8 of them in combination with other antiglaucomatous surgery: cataract surgery, reconstruction of the anterior chamber. Sinustrabeculectomy in patients with secondary glaucoma was performed in 7 cases, 4 of them with collagen implant drainage. Ahmed glaucoma drainage implant performed in 5 cases.Results: In 23 out of 58 (39.6% of long-term compensation glaucoma IOP was achieved antihypertensive therapy without sur- gery. After cataract extraction resistant compensated IOP was achieved in 10 cases, a temporary (1 to 42 months — in 11 cases, IOP is not reduced in 2 cases. After completing diode laser cyclocoagulation stable normalization of IOP occurred in 16 cases, the temporary (from 1 month to 2 years — in 20 cases, 4 cases of IOP reduction was not achieved. As a result sinustrabeculectomy in 4 cases IOP decreased, in one case the hypotensive effect is not there. After implantation Ahmed glaucoma valve in 2 cases was achieved stable normalization of IOP, in the 2 cases — the temporary; in 1 case developed endophthalmitis, and the device was removed.Conclusion: the immediate effect of antiglaucomatous treatment was 96.6%, but the high incidence of IOP decompensation (73.7% suggesting the need for continuous follow-up patients after severe eye burn injury, and a readiness to use other methods to reduce IOP.

  10. Methods to reduce intraocular pressure on secondary glaucoma after severe eye burns

    Directory of Open Access Journals (Sweden)

    A. V. Solovieva

    2012-01-01

    Full Text Available Purpose: Show the results of treatment of secondary glaucoma after severe eye burns.Methods: We observed 70 patients (108 eyes with severe burns the eyes and their consequences, secondary glaucoma was observed in 40 patients (58 eyes. All patients with secondary glaucoma received traditional antihypertensive therapy, with its failure to resort to antiglaucomatous surgery. Cataract extraction performed in 24 cases, 16 of them in combination with other surgery: the reconstruction of the anterior chamber, penetrating keratoplasty, sinustrabeculectomy, diode laser cyclocoagulation. Diode laser cy- clocoagulation performed 42 times in 8 of them in combination with other antiglaucomatous surgery: cataract surgery, reconstruction of the anterior chamber. Sinustrabeculectomy in patients with secondary glaucoma was performed in 7 cases, 4 of them with collagen implant drainage. Ahmed glaucoma drainage implant performed in 5 cases.Results: In 23 out of 58 (39.6% of long-term compensation glaucoma IOP was achieved antihypertensive therapy without sur- gery. After cataract extraction resistant compensated IOP was achieved in 10 cases, a temporary (1 to 42 months — in 11 cases, IOP is not reduced in 2 cases. After completing diode laser cyclocoagulation stable normalization of IOP occurred in 16 cases, the temporary (from 1 month to 2 years — in 20 cases, 4 cases of IOP reduction was not achieved. As a result sinustrabeculectomy in 4 cases IOP decreased, in one case the hypotensive effect is not there. After implantation Ahmed glaucoma valve in 2 cases was achieved stable normalization of IOP, in the 2 cases — the temporary; in 1 case developed endophthalmitis, and the device was removed.Conclusion: the immediate effect of antiglaucomatous treatment was 96.6%, but the high incidence of IOP decompensation (73.7% suggesting the need for continuous follow-up patients after severe eye burn injury, and a readiness to use other methods to reduce IOP.

  11. Secondary Flow Patterns of Liquid Ejector with Computational Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Kwisung; Yun, Jinwon; Yu, Sangseok [Chungnam National University, Daejeon (Korea, Republic of); Sohn, Inseok [COAVIS, Sejong (Korea, Republic of); Seo, Yongkyo [Korea Automotive Technology Institute, Cheonan (Korea, Republic of)

    2015-02-15

    An ejector is a type of non-powered pump that is used to supply a secondary flow via the ejection of a primary flow. It is utilized in many industrial fields, and is used for fueling the vehicle because of less failures and simple structure. Since most of ejectors in industry are gas-to-gas and liquid to gas ejector, many research activities have been reported in optimization of gas ejector. On the other hand, the liquid ejector is also applied in many industry but few research has been reported. The liquid ejector occurs cavitation, and it causes damage of parts. Cavitation has bees observed at the nozzle throat at the specified pressure. In this study, a two-dimensional axisymmetric simulation of a liquid-liquid ejector was carried out using five different parameters. The angle of the nozzle plays an important role in the cavitation of a liquid ejector, and the performance characteristics of the flow ratio showed that an angle of 35° was the most advantageous. The simulation results showed that the performance of the liquid ejector and the cavitation effect have to be considered simultaneously.

  12. Literacy learning in secondary school science classrooms: A cross-case analysis of three qualitative studies

    Science.gov (United States)

    Dillon, Deborah R.; O'Brien, David G.; Moje, Elizabeth B.; Stewart, Roger A.

    The purpose of this cross-case analysis is to illustrate how and why literacy was incorporated into science teaching and learning in three secondary classrooms. Research questions guiding the analysis include: (a) How were literacy events shaped by the teachers' philosophies about teaching science content and teaching students? and (b) How was literacy (reading, writing, and oral language) structured by the teachers and manifested in science lessons? The methodology of ethnography and the theoretical framework of symbolic interactionism were employed in the three studies on which the cross-case analysis was based. The researchers assumed the role of participant observers, collecting data over the period of 1 year in each of the three classrooms. Data, in the form of fieldnotes, interviews, and artifacts, were collected. In each study, data were analyzed using the constant comparative method (Glaser & Strauss, 1967) to determine patterns in the teachers' beliefs about learning and how these influenced their choice of literacy activities. The cross-case analysis was conducted to determine patterns across the three teachers and their classrooms. The findings from this analysis are used to compare how the teachers' philosophies of teaching science and their beliefs about how students learn influenced their use of literacy practices during lessons. Specifically, each teacher's use of literacy activities varied based on his or her beliefs about teaching science concepts. Furthermore, reading, writing, and oral language were important vehicles to learning science concepts within daily classroom activities in the three classrooms.Received: 1 April 1993; Revised: 30 August 1993;

  13. Improvement of a separation method for the reduction of secondary waste from the water-jet abrasive suspension cutting technique

    International Nuclear Information System (INIS)

    Brandauer, M.; Gentes, S.; Heneka, A.; Krauss, C.O.; Geckeis, H.; Plaschke, M.; Schild, D.; Tobie, W.

    2017-01-01

    Full text of publication follows. Disassembling the reactor pressure vessel and its built-in components is a huge challenge in the deconstruction of a nuclear power plant. After being exposed to neutron irradiation for years, the activated components need to be disassembled and packed by remote controlled techniques. Underwater disassembling systems have the advantage of the shielding effect of water against radiation. To avoid the generation of aerosols, cold cutting processes are preferred. A cutting method that meets these requirements is the water-jet abrasive suspension cutting technique (WASS). This method provides high flexibility and is immune towards mechanical stress in the components. During the cutting process, a mixture of abrasive particles and radioactive steel particles from the cut components is generated. Depending on the operational conditions, the amount of this secondary waste increases substantially. Therefore, despite of its intrinsic technical benefits, WASS has a serious disadvantage towards other cutting techniques due to the huge disposal costs of secondary waste. During our previous joint research project between KIT and AREVA GmbH called NENAWAS ('New Disposal Methods for the Secondary Waste Treatment of the Water-jet Abrasive Suspension Cutting Technique', funded by the German ministry for education and research, BMBF), a prototype separation device for WASS secondary waste was developed and tested. Using a magnetic filter, steel particles could be successfully separated from the rest of the secondary waste. The separation process is examined using elemental analysis (ICP-OES) for quantification of the separation grade. Additionally, morphologies of particles and particle aggregates before and after the separation process were examined by scanning electron microscopy (SEM). In the abrasive particle fraction after separation of the steel particles a remaining contamination by tiny steel particles could be detected by elemental and

  14. Educational activities of secondary school students in Serbia: A time-diary analysis

    Directory of Open Access Journals (Sweden)

    Pešić Jelena

    2013-01-01

    Full Text Available The aim of this study was to determine the time allocation of various educational activities within the structure of a typical day of Serbian secondary school students, and whether there were significant differences in this respect depending on their socio-demographic characteristics. The 24-hour time diary method was applied: the subjects described chronologically, at half-hourly intervals, their activities in one weekday an done weekend day. The research was conducted on a sample of 922 secondary school students, Structured by region, age and type of school. The analysis revealed that on weekdays students spent about 5 hours in school. In work activities outside school they spent almost 2 hours, out of which the largest part in learning (81 minutes, and significantly less in housework (23 minutes and economically productive work (7 minutes. From a total of5 hours and22 minutes of free time, only 5 minutes were devoted to organized extracurricular activities. Significant differences were obtained with regard to students’ gender, type of school, and level of parents’ education. When these results are compared with the data from other countries, it is shown that secondary school students in Serbia, compared to the U.S., spend more time in learning, and significantly less in economically productive work and house­work, much like the youth in European countries. A very low proportion of extracurricular activities shows that school learning is almost the only context of developing educational competencies. The implications of these findings are discussed from the perspective of positive youth development. [Projekat Ministarstva nauke Republike Srbije: Identifikacija, merenje i razvoj kognitivnih i emocionalnih kompetencija važnih društvu orijentisanom na evropske integracije

  15. Exploring urban health in Cape Town, South Africa: an interdisciplinary analysis of secondary data

    Science.gov (United States)

    Mumm, Rebekka; Hänselmann, Eva; Freund, Johanna; Wirsching, Michael; Gärtner, Jan; Gminski, Richard; Vögtlin, Katrin; Körner, Mirjam; Zirn, Lena; Wittwer-Backofen, Ursula; Oni, Tolu

    2017-01-01

    Background: With modern information technology, an overwhelming amount of data is available on different aspects of societies. Our research investigated the feasibility of using secondary data sources to get an overview of determinants of health and health outcomes in different population strata of Cape Town, a large city of South Africa. Methods: The methodological approach of secondary-data analysis was similar in the different disciplines: Biological Anthropology, Public Health, Environmental Health, Mental Health, Palliative Care, Medical Psychology and Sociology at the University of Freiburg and Public Health at the University of Cape Town. The teams collected information on Cape Town through Internet searches and published articles. The information was extracted, analyzed, condensed, and jointly interpreted. Results: Data show the typical picture of a population in epidemiological and demographic transition exposed to often difficult social, mental, and physical environmental conditions. Comparison between low and higher socioeconomic districts demonstrated that the former had higher air pollution, poorer water quality, and deficient sanitary conditions in addition to sub-optimal mental health services and palliative care. Conclusion: Although important information gaps were identified, the data draw attention to critical public health interventions required in poor health districts, and to motivate for pro-equity policies. PMID:28093045

  16. High cycle fatigue analysis of vortex suppression plate and secondary core support structures

    International Nuclear Information System (INIS)

    Xue Guohong; Li Yuan; Zhao Feiyun; Feng Shaodong; Yu Hao

    2013-01-01

    Background: Reactor internals are important equipment s in the reactor coolant system, its structure design needs high reliability in the entire lifetime, Reactor internals have occurred breakdown and the damage event due to flow induced vibrations in the domestic and foreign nuclear power plants, which make immediate influence on reactor safe operation and economic efficiency. Purpose: In this work, the dynamic response of reactor internals-vortex suppression plate and secondary core support structure (SCSS) under the loading from pump induced vibrations and flow induced vibrations are studied. Methods: Based on the finite element model of SCSS, Spectrum analysis and the harmonious analysis are performed, in order to get the response of the structure under flow induced vibrations. Then, the high fatigue of the structure is assessed according to the ASME B and PV Code. Results: The results indicate that alternate stresses of all the components satisfy the limiting value in the correlative requirements. Conclusions: The structure of SCSS could bear the vibration induced from the flow and the pump, and the method used in this article provides the reference for other reactor internals structure analysis like this. (authors)

  17. Data Analysis Methods for Paleogenomics

    DEFF Research Database (Denmark)

    Avila Arcos, Maria del Carmen

    (Danmarks Grundforskningfond) 'Centre of Excellence in GeoGenetics' grant, with additional funding provided by the Danish Council for Independent Research 'Sapere Aude' programme. The thesis comprises five chapters, all of which represent different projects that involved the analysis of massive amounts......, thanks to the introduction of NGS and the implementation of data analysis methods specific for each project. Chapters 1 to 3 have been published in peer-reviewed journals and Chapter 4 is currently in review. Chapter 5 consists of a manuscript describing initial results of an ongoing research project......The work presented in this thesis is the result of research carried out during a three-year PhD at the Centre for GeoGenetics, Natural History Museum of Denmark, University of Copenhagen, under supervision of Professor Tom Gilbert. The PhD was funded by the Danish National Research Foundation...

  18. A New Boron Analysis Method

    Energy Technology Data Exchange (ETDEWEB)

    Weitman, J; Daaverhoeg, N; Farvolden, S

    1970-07-01

    In connection with fast neutron (n, {alpha}) cross section measurements a novel boron analysis method has been developed. The boron concentration is inferred from the mass spectrometrically determined number of helium atoms produced in the thermal and epithermal B-10 (n, {alpha}) reaction. The relation between helium amount and boron concentration is given, including corrections for self shielding effects and background levels. Direct and diffusion losses of helium are calculated and losses due to gettering, adsorption and HF-ionization in the release stage are discussed. A series of boron determinations is described and the results are compared with those obtained by other methods, showing excellent agreement. The lower limit of boron concentration which can be measured varies with type of sample. In e.g. steel, concentrations below 10-5 % boron in samples of 0.1-1 gram may be determined.

  19. The Analysis of the School Burnout in Secondary Education Students in Terms of Various Variables

    Directory of Open Access Journals (Sweden)

    İsmail Seçer

    2012-10-01

    Full Text Available In this research, the burnout levels of the secondary education students was analyzed if the burnout levels differentiate according to sex, high school type, academic success, academic department and taking private teaching institutions’ classes or not. The study group of this study that is aimed to analyze school burnout in secondary education students is formed of 282 females and 221 males, in total 503 students who get educated in secondary schools in Erzurum Yakutiye and Palandöken counties. School burnout inventory developed by Aypay (2011 and personal data form were used to collect data. t test and multivariate analysis of variance (MANOVA were used in the analysis of the data.According to the evidence obtained from the study, the burnout levels of secondary education students differentiate in a meaningful level according to sex, school type, academic success, academic department and taking private teaching institutions’ classes or not.

  20. Extended Delivery Time Analysis for Secondary Packet Transmission With Adaptive Modulation Under Interweave Cognitive Implementation

    KAUST Repository

    Wang, Wen-Jing

    2017-05-02

    Cognitive radio communication can opportunistically access underutilized spectrum for emerging wireless applications. With interweave cognitive implementation, a secondary user (SU) transmits only if primary user does not occupy the channel and waits for transmission otherwise. Therefore, secondary packet transmission involves both transmission periods and waiting periods. The resulting extended delivery time (EDT) is critical to the throughput analysis of secondary system. In this paper, we study the EDT of secondary packet transmission with adaptive modulation under interweave implementation to facilitate the delay analysis of such cognitive radio system. In particular, we propose an analytical framework to derive the probability density functions of EDT considering random-length SU transmission and waiting periods. We also present selected numerical results to illustrate the mathematical formulations and to verify our analytical approach.

  1. Adolescent survivors: a secondary analysis of a clinical trial targeting behavior change.

    Science.gov (United States)

    Cox, Cheryl L; McLaughlin, Rosemary A; Rai, Shesh N; Steen, Brenda D; Hudson, Melissa M

    2005-08-01

    The late effects of radiation and chemotherapy increase childhood cancer survivors' risk of chronic health problems. Survivors' behavior is important in modifying this risk, yet adolescent and young adult survivors fail to engage in important health-promoting behaviors and frequently practice high-risk behaviors. This secondary analysis re-evaluated a multi-component behavior-change intervention that had previously demonstrated no impact in adolescent survivors of childhood cancer. The parent trial compared 132 adolescent survivors in the intervention arm with 135 in the standard-care arm at baseline and at 1 year for disease and treatment knowledge, perception of late effects risk, and the frequency of health-risk and health-protective behaviors (combined as a single summative measure). In contrast, the secondary analysis examined each of the 14 behaviors separately. Additionally, an analysis of covariance (ANCOVA) was conducted to examine the change in health behaviors while statistically controlling for age, gender, and the wide variation in baseline behaviors. Knowledge (P = 0.038), breast self-examination (BSE) (P junk food consumption decreased (P = 0.052) and smoking abstinence was maintained (P = 0.088). Significant interactions between gender and treatment group were demonstrated. Health-risk and health-protective behaviors cannot be effectively combined in a one-dimensional measure. Gender and age influence the impact of interventions targeting health behavior in survivors. Future trials should include observation of the patient-clinician encounter, more complex sampling methods, and pre-trial knowledge of the distribution of the study behaviors.

  2. Enhanced secondary analysis of survival data: reconstructing the data from published Kaplan-Meier survival curves.

    Science.gov (United States)

    Guyot, Patricia; Ades, A E; Ouwens, Mario J N M; Welton, Nicky J

    2012-02-01

    The results of Randomized Controlled Trials (RCTs) on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios) with statistics based on repeated reconstructions by multiple observers. The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.

  3. Effectiveness of Secondary Pregnancy Prevention Programs: A Meta-Analysis

    Science.gov (United States)

    Corcoran, Jacqueline; Pillai, Vijayan K.

    2007-01-01

    Because subsequent pregnancy in teen parents often worsens the impact of adolescent parenting; therefore, a common goal of teenage parent programs has been to reduce repeat pregnancy. To examine the impact of this goal, a meta-analysis was conducted on 16 control-comparison group studies that evaluated the effect of teenage pregnancy and parenting…

  4. Clinical analysis of 34 cases symptomatic epilepsy secondary to cerebrovascular disease

    International Nuclear Information System (INIS)

    Zeng Mingyu; Liu Chunfeng

    2000-01-01

    Objective: To investigate the relation between cerebrovascular disease and symptomatic epilepsy. Method: 786 patients suffered cerebrovascular disease were retrospectively analyzed. Result: The occurrence rate of Secondary to Cerebrovascular Disease symptomatic epilepsy Secondary to Cerebrovascular Disease was 4.3%. Those older than 60 are prone to develop Acrodynia symptomatic epilepsy. Generalized epileptic seizure were often seen. Secondary to Cerebrovascular Disease epilepsy die to cortical lesion are more easily seem than subcortical lesion. Early epilepsy is more than late epilepsy. Conclusion: The cause of symptomatic epilepsy after cerebrovascular disease is not same in different types and course of CVD. Those who developed epilepsy particularly epilepsy continua would have bad prognosis

  5. New results in the limit analysis by secondary modified creep

    International Nuclear Information System (INIS)

    Feijoo, R.A.; Taroco, E.; Zouain, N.

    1982-03-01

    Two methods for computing upper and lower bounds of colapse loads are proposed by means of generalized creep constitutive relations. The actual material behaviour is rigid-perfectly plastic and the techniques here analized consist in the substitution of this material by a fictitious one which presents steady state creep response. Some analytical examples are also presented. (Author) [pt

  6. Tracing Of Scaling Elements In Secondary Cooling System Of GA Siwabessy Reactor By Neutron Activation Analysis

    International Nuclear Information System (INIS)

    Lestari, Diyah Erlina

    2000-01-01

    Determination of content of chemical elements and scale formed in the secondary cooling water has been carried out by means of AAN method. The counting was performed using a gamma spectrometer equipped with high resolution HPGe gamma detector. Result of counting show the elements contained in the scale are: Na, Br, Fe, Ci, Mg and Co which are also found in the secondary cooling water. The main scaling element cannot yet be detected

  7. COMPETITIVE INTELLIGENCE ANALYSIS - SCENARIOS METHOD

    Directory of Open Access Journals (Sweden)

    Ivan Valeriu

    2014-07-01

    Full Text Available Keeping a company in the top performing players in the relevant market depends not only on its ability to develop continually, sustainably and balanced, to the standards set by the customer and competition, but also on the ability to protect its strategic information and to know in advance the strategic information of the competition. In addition, given that economic markets, regardless of their profile, enable interconnection not only among domestic companies, but also between domestic companies and foreign companies, the issue of economic competition moves from the national economies to the field of interest of regional and international economic organizations. The stakes for each economic player is to keep ahead of the competition and to be always prepared to face market challenges. Therefore, it needs to know as early as possible, how to react to others’ strategy in terms of research, production and sales. If a competitor is planning to produce more and cheaper, then it must be prepared to counteract quickly this movement. Competitive intelligence helps to evaluate the capabilities of competitors in the market, legally and ethically, and to develop response strategies. One of the main goals of the competitive intelligence is to acknowledge the role of early warning and prevention of surprises that could have a major impact on the market share, reputation, turnover and profitability in the medium and long term of a company. This paper presents some aspects of competitive intelligence, mainly in terms of information analysis and intelligence generation. Presentation is theoretical and addresses a structured method of information analysis - scenarios method – in a version that combines several types of analysis in order to reveal some interconnecting aspects of the factors governing the activity of a company.

  8. A Cost-Effectiveness Analysis Model for Evaluating and Planning Secondary Vocational Programs

    Science.gov (United States)

    Kim, Jin Eun

    1977-01-01

    This paper conceptualizes a cost-effectiveness analysis and describes a cost-effectiveness analysis model for secondary vocational programs. It generates three kinds of cost-effectiveness measures: program effectiveness, cost efficiency, and cost-effectiveness and/or performance ratio. (Author)

  9. Multielement ultratrace analysis in tungsten using secondary ion mass spectrometry

    International Nuclear Information System (INIS)

    Wilhartitz, P.; Virag, A.; Friedbacher, G.; Grasserbauer, M.

    1987-01-01

    The ever increasing demands on properties of materials create a trend also towards ultrapure products. Characterization of these materials is only possible with modern, highly sophisticated analytical techniques such as activation analysis and mass spectrometry, particularly SSMS, SIMS and GDMS. Analytical strategies were developed for the determination of about 40 elements in a tungsten matrix with high-performance SIMS. Difficulties like the elimination of interferences had to be overcome. Extrapolated detection limits were established in the range of pg/g (alkali metals, halides) to ng/g (e.g. Ta, Th). Depth profiling and ion imaging gave additional information about the lateral and the depth distribution of the elements. (orig.)

  10. Gravimetric and titrimetric methods of analysis

    International Nuclear Information System (INIS)

    Rives, R.D.; Bruks, R.R.

    1983-01-01

    Gravimetric and titrimetric methods of analysis are considered. Methods of complexometric titration are mentioned, as well as methods of increasing sensitivity in titrimetry. Gravimetry and titrimetry are applied during analysis for traces of geological materials

  11. Constraints on primary and secondary particulate carbon sources using chemical tracer and 14C methods during CalNex-Bakersfield

    Data.gov (United States)

    U.S. Environmental Protection Agency — The present study investigates primary and secondary sources of organic carbon for Bakersfield, CA, USA as part of the 2010 CalNex study. The method used here...

  12. Numerical design and testing of a sound source for secondary calibration of microphones using the Boundary Element Method

    DEFF Research Database (Denmark)

    Cutanda Henriquez, Vicente; Juhl, Peter Møller; Barrera Figueroa, Salvador

    2009-01-01

    Secondary calibration of microphones in free field is performed by placing the microphone under calibration in an anechoic chamber with a sound source, and exposing it to a controlled sound field. A calibrated microphone is also measured as a reference. While the two measurements are usually made...... apart to avoid acoustic interaction. As a part of the project Euromet-792, aiming to investigate and improve methods for secondary free-field calibration of microphones, a sound source suitable for simultaneous secondary free-field calibration has been designed using the Boundary Element Method...... of the Danish Fundamental Metrology Institute (DFM). The design and verification of the source are presented in this communication....

  13. Issues encountered in a qualitative secondary analysis of help-seeking in the prodrome to psychosis.

    Science.gov (United States)

    Gladstone, Brenda M; Volpe, Tiziana; Boydell, Katherine M

    2007-10-01

    Primary data are rarely used explicitly as a source of data outside of the original research purpose for which they were collected. As a result, qualitative secondary analysis (QSA) has been described as an "invisible enterprise" for which there is a "notable silence" amongst the qualitative research community. In this paper, we report on the methodological implications of conducting a secondary analysis of qualitative data focusing on parents' narratives of help-seeking activities in the prodrome to psychosis. We review the literature on QSA, highlighting the main characteristics of the approach, and discuss issues and challenges encountered in conducting a secondary analysis. We conclude with some thoughts on the implications for conducting a QSA in children's mental health services and research.

  14. Global analysis of biosynthetic gene clusters reveals vast potential of secondary metabolite production in Penicillium species

    DEFF Research Database (Denmark)

    Nielsen, Jens Christian; Grijseels, Sietske; Prigent, Sylvain

    2017-01-01

    Filamentous fungi produce a wide range of bioactive compounds with important pharmaceutical applications, such as antibiotic penicillins and cholesterol-lowering statins. However, less attention has been paid to fungal secondary metabolites compared to those from bacteria. In this study, we...... sequenced the genomes of 9 Penicillium species and, together with 15 published genomes, we investigated the secondary metabolism of Penicillium and identified an immense, unexploited potential for producing secondary metabolites by this genus. A total of 1,317 putative biosynthetic gene clusters (BGCs) were......-referenced the predicted pathways with published data on the production of secondary metabolites and experimentally validated the production of antibiotic yanuthones in Penicillia and identified a previously undescribed compound from the yanuthone pathway. This study is the first genus-wide analysis of the genomic...

  15. The Analysis of Secondary Motion and Lubrication Performance of Piston considering the Piston Skirt Profile

    Directory of Open Access Journals (Sweden)

    Yanjun Lu

    2018-01-01

    Full Text Available The work performance of piston-cylinder liner system is affected by the lubrication condition and the secondary motion of the piston. Therefore, more and more attention has been paid to the secondary motion and lubrication of the piston. In this paper, the Jakobson-Floberg-Olsson (JFO boundary condition is employed to describe the rupture and reformation of oil film. The average Reynolds equation of skirt lubrication is solved by the finite difference method (FDM. The secondary motion of piston-connecting rod system is modeled; the trajectory of the piston is calculated by the Runge-Kutta method. By considering the inertia of the connecting rod, the influence of the longitudinal and horizontal profiles of piston skirt, the offset of the piston pin, and the thermal deformation on the secondary motion and lubrication performance is investigated. The parabolic longitudinal profile, the smaller top radial reduction and ellipticities of the middle-convex piston, and the bigger bottom radial reduction and ellipticities can effectively reduce the secondary displacement and velocity, the skirt thrust, friction, and the friction power loss. The results show that the connecting rod inertia, piston skirt profile, and thermal deformation have important influence on secondary motion and lubrication performance of the piston.

  16. A quantitative analysis of secondary RNA structure using domination based parameters on trees

    Directory of Open Access Journals (Sweden)

    Zou Yue

    2006-03-01

    Full Text Available Abstract Background It has become increasingly apparent that a comprehensive database of RNA motifs is essential in order to achieve new goals in genomic and proteomic research. Secondary RNA structures have frequently been represented by various modeling methods as graph-theoretic trees. Using graph theory as a modeling tool allows the vast resources of graphical invariants to be utilized to numerically identify secondary RNA motifs. The domination number of a graph is a graphical invariant that is sensitive to even a slight change in the structure of a tree. The invariants selected in this study are variations of the domination number of a graph. These graphical invariants are partitioned into two classes, and we define two parameters based on each of these classes. These parameters are calculated for all small order trees and a statistical analysis of the resulting data is conducted to determine if the values of these parameters can be utilized to identify which trees of orders seven and eight are RNA-like in structure. Results The statistical analysis shows that the domination based parameters correctly distinguish between the trees that represent native structures and those that are not likely candidates to represent RNA. Some of the trees previously identified as candidate structures are found to be "very" RNA like, while others are not, thereby refining the space of structures likely to be found as representing secondary RNA structure. Conclusion Search algorithms are available that mine nucleotide sequence databases. However, the number of motifs identified can be quite large, making a further search for similar motif computationally difficult. Much of the work in the bioinformatics arena is toward the development of better algorithms to address the computational problem. This work, on the other hand, uses mathematical descriptors to more clearly characterize the RNA motifs and thereby reduce the corresponding search space. These

  17. Evaluation of the Teaching Methods Used in Secondary School Biology Lessons

    Directory of Open Access Journals (Sweden)

    Porozovs Juris

    2015-06-01

    Full Text Available The teacher’s skills in conducting the lesson and choice of teaching methods play an essential role in creating students’ interest in biology. The aim of the research was to study the opinion of secondary school students and biology teachers regarding the most successful teaching methods used in biology lessons and viable options to make biology lessons more interesting. The research comprised polling students and biology teachers from several schools, namely: 2 secondary schools in Jelgava, 2 in Riga and 1 in Vecumnieki. The responses revealed that 58% of students find biology lessons interesting. 56% of students indicated that their ability to focus attention during biology lessons depends on the task presented to them. Most of all they prefer watching the teacher’s presentations, listening to their teacher telling about the actual topic as well as performing laboratory work and group-work. Many students like participating in discussions, whereas a far smaller number would do various exercises, individual tasks, fill out worksheets or complete projects. Least of all students wish to work with the textbook. The methods most frequently applied by teachers are as follows: lecture, explanation, demonstration, and discussion. Teachers believe that their students prefer laboratory work and discussions as well as listening to their teacher and watching presentations or films. They also indicate at the necessity to link theory with practice and to involve information technologies. While teaching their subject biology teachers try to establish relationship between theory and real life in order to develop their students’ interest in natural processes.

  18. The viability of alternative assessment methods in the Greek upper secondary school: the oral portfolio

    Directory of Open Access Journals (Sweden)

    Angeliki Daphni

    2012-02-01

    Full Text Available Τhe final examination of the English language subject, in the context of the Greek state upper secondary education, is a traditional paper-and-pencil test which does not include any assessment of oracy skills. This article explores the viability of the oral portfolio as an alternative assessment and pedagogic method that can facilitate the assessment of speaking and listening skills and create a more motivating learning environment. To this effect, three methodological tools were designed, namely, a questionnaire addressing upper secondary English teachers in Greek state schools, a case study involving an oral portfolio implementation and finally, a questionnaire for students to record their experience. The study demonstrates that implementation of the portfolio contributed to a successful assessment of oracy skills and that it was a stimulating experience for students. The results of the study also showed that the pedagogical value of the portfolio counterbalanced its practical constraints. The paper concludes by putting forward recommendations for the future application of this assessment technique in state school education.

  19. Cause analysis for elbow thinning of the secondary loop feedwater system in PWR NPP

    International Nuclear Information System (INIS)

    Yu Tao; Bian Chunhua; Zhang Wei; Luo Kunjie; Wang Li; Li Yan

    2013-01-01

    Wall thickness of some secondary system pipelines were measured on site during the refueling outages in March 2012. Wall thinning happened in some components of APA system. This paper focused on the cause analysis of an elbow with that phenomenon. Wall thickness was carefully measured in laboratory using ultrasonic thickness meter and found that wall thinning happened nearly all elbows including two abnormal thinning regions. Analytical research was conducted using ICP, stereo microscope, SEM, XRD, ANSYS. The result shows that the cause of wall thinning is flow accelerated corrosion. Based on the analysis result and international research progress, this paper makes some suggestions to avoid and alleviate FAC in the secondary system. (authors)

  20. Steady-State and Transient Analysis for Design Validation of SMART-ITL Secondary System

    Energy Technology Data Exchange (ETDEWEB)

    Yun, Eunkoo; Bae, Hwang; Ryu, Sung Uk; Jeon, Byong-Guk; Yang, Jin-Hwa; Yi, Sung-Jae; Park, Hyun-Sik [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2016-10-15

    SMART can prevent large-break loss of coolant accident (LBLOCA) inherently. SMART-ITL is an experimental simulation facility designed to perform integral effect tests for the SMART plant. In terms of the secondary system of SMART-ITL, the design has been simplified from that of reference plant by replacing several components, such as expansion device and condenser, with an appropriate device to be functional as the alternatives. In this paper, in order to understand the operational characteristics as well as design concept, the secondary system of SMRAT-ITL is analyzed in steady-state and transient aspects, and the results are compared with relevant experimental results. This study focuses on the understanding of thermal-hydraulic behavior of SMART-ITL secondary system, which is simplified from that of reference plant. To identify the behaviors of the secondary system, the steady-state and transient analysis were conducted based on experimental results. In steady-state analysis, the results clearly showed that the system pressure is related to the temperature of condensation tank which varies depending on mixture enthalpy. In transient analysis, the dynamic behavior during heat-up process has been investigated. The results reveal that we can reasonably assume the fluid filled in TK-CD-01 be in a saturated condition. The results showed that the design of SMART-ITL secondary system is appropriate, and the system is being properly operated to match the design intent.

  1. Polymorphs and prodrugs and salts (oh my!: an empirical analysis of "secondary" pharmaceutical patents.

    Directory of Open Access Journals (Sweden)

    Amy Kapczynski

    Full Text Available BACKGROUND: While there has been much discussion by policymakers and stakeholders about the effects of "secondary patents" on the pharmaceutical industry, there is no empirical evidence on their prevalence or determinants. Characterizing the landscape of secondary patents is important in light of recent court decisions in the U.S. that may make them more difficult to obtain, and for developing countries considering restrictions on secondary patents. METHODOLOGY/PRINCIPAL FINDINGS: We read the claims of the 1304 Orange Book listed patents on all new molecular entities approved in the U.S. between 1988 and 2005, and coded the patents as including chemical compound claims (claims covering the active molecule itself and/or one of several types of secondary claims. We distinguish between patents with any secondary claims, and those with only secondary claims and no chemical compound claims ("independent" secondary patents. We find that secondary claims are common in the pharmaceutical industry. We also show that independent secondary patents tend to be filed and issued later than chemical compound patents, and are also more likely to be filed after the drug is approved. When present, independent formulation patents add an average of 6.5 years of patent life (95% C.I.: 5.9 to 7.3 years, independent method of use patents add 7.4 years (95% C.I.: 6.4 to 8.4 years, and independent patents on polymorphs, isomers, prodrug, ester, and/or salt claims add 6.3 years (95% C.I.: 5.3 to 7.3 years. We also provide evidence that late-filed independent secondary patents are more common for higher sales drugs. CONCLUSIONS/SIGNIFICANCE: Policies and court decisions affecting secondary patenting are likely to have a significant impact on the pharmaceutical industry. Secondary patents provide substantial additional patent life in the pharmaceutical industry, at least nominally. Evidence that they are also more common for best-selling drugs is consistent with accounts of

  2. Effects of an instruction method in thinking skills with students from compulsory secondary education.

    Science.gov (United States)

    de Acedo Lizarraga, María Luisa Sanz; de Acedo Baquedano, María Teresa Sanz; Pollán Rufo, Milagros

    2010-05-01

    The purpose of this study was to assess the effects caused by the instruction method "Think actively in academic contexts, TAAC", an adaptation of Wallace and Adams' (1993) method of thinking skills, creativity, self-regulation, and academic learning, with students from the second grade of Compulsory Secondary Education (CSE). We used a pretest-intervention-posttest design with control group. The sample was made up of 110 participants, aged between 13 and 15 years, 58 of them in the experimental group and 52 in the control group. Six assessment instruments were administered before and after applying the method in order to measure the dependent variables. The method, divided into eight stages, was used in all the didactic units of the syllabus content of Natural Sciences, Social Sciences, and Language, during one academic course, and allowed the conjoint teaching of thinking skills and the syllabus content. The results of the analyses of variance indicate positive impact of the intervention, as the experimental subjects improved significantly in thinking skills and academic achievement. Some interesting reflections for research and education are derived from this study.

  3. Method of forming components for a high-temperature secondary electrochemical cell

    Science.gov (United States)

    Mrazek, Franklin C.; Battles, James E.

    1983-01-01

    A method of forming a component for a high-temperature secondary electrochemical cell having a positive electrode including a sulfide selected from the group consisting of iron sulfides, nickel sulfides, copper sulfides and cobalt sulfides, a negative electrode including an alloy of aluminum and an electrically insulating porous separator between said electrodes. The improvement comprises forming a slurry of solid particles dispersed in a liquid electrolyte such as the lithium chloride-potassium chloride eutetic, casting the slurry into a form having the shape of one of the components and smoothing the exposed surface of the slurry, cooling the cast slurry to form the solid component, and removing same. Electrodes and separators can be thus formed.

  4. An ontology-based method for secondary use of electronic dental record data

    Science.gov (United States)

    Schleyer, Titus KL; Ruttenberg, Alan; Duncan, William; Haendel, Melissa; Torniai, Carlo; Acharya, Amit; Song, Mei; Thyvalikakath, Thankam P.; Liu, Kaihong; Hernandez, Pedro

    A key question for healthcare is how to operationalize the vision of the Learning Healthcare System, in which electronic health record data become a continuous information source for quality assurance and research. This project presents an initial, ontology-based, method for secondary use of electronic dental record (EDR) data. We defined a set of dental clinical research questions; constructed the Oral Health and Disease Ontology (OHD); analyzed data from a commercial EDR database; and created a knowledge base, with the OHD used to represent clinical data about 4,500 patients from a single dental practice. Currently, the OHD includes 213 classes and reuses 1,658 classes from other ontologies. We have developed an initial set of SPARQL queries to allow extraction of data about patients, teeth, surfaces, restorations and findings. Further work will establish a complete, open and reproducible workflow for extracting and aggregating data from a variety of EDRs for research and quality assurance. PMID:24303273

  5. An ontology-based method for secondary use of electronic dental record data.

    Science.gov (United States)

    Schleyer, Titus Kl; Ruttenberg, Alan; Duncan, William; Haendel, Melissa; Torniai, Carlo; Acharya, Amit; Song, Mei; Thyvalikakath, Thankam P; Liu, Kaihong; Hernandez, Pedro

    2013-01-01

    A key question for healthcare is how to operationalize the vision of the Learning Healthcare System, in which electronic health record data become a continuous information source for quality assurance and research. This project presents an initial, ontology-based, method for secondary use of electronic dental record (EDR) data. We defined a set of dental clinical research questions; constructed the Oral Health and Disease Ontology (OHD); analyzed data from a commercial EDR database; and created a knowledge base, with the OHD used to represent clinical data about 4,500 patients from a single dental practice. Currently, the OHD includes 213 classes and reuses 1,658 classes from other ontologies. We have developed an initial set of SPARQL queries to allow extraction of data about patients, teeth, surfaces, restorations and findings. Further work will establish a complete, open and reproducible workflow for extracting and aggregating data from a variety of EDRs for research and quality assurance.

  6. Processing method for chemical cleaning liquid on the secondary side of steam generator

    International Nuclear Information System (INIS)

    Nishihara, Yukio; Inagaki, Yuzo.

    1993-01-01

    Upon processing nitrilotriacetate (NTA), Fe liquid wastes mainly comprising Fe and Cu liquid wastes mainly comprising ethylene diamine and Cu generated upon chemical cleaning on the secondary side of a steam generator, pH of the Fe liquid wastes is lowered to deposit and separate NTA. Then, Fe ions in a filtrates are deposited on a cathode by electrolysis, as well as remaining NTA is decomposed by oxidation at an anode by O 2 gas. Cu liquid wastes are reacted with naphthalene disulfate and Ba ions and the reaction products are separated by deposition as sludges. Remaining Cu ions in the filtrates are deposited on the cathode by electrolysis. With such procedures, concentration of COD(NTA), Fe ions and Cu ions can greatly be reduced. Further, since capacity of the device can easily be increased in this method, a great amount of liquid wastes can be processed in a relatively short period of time. (T.M.)

  7. Secondary iris recognition method based on local energy-orientation feature

    Science.gov (United States)

    Huo, Guang; Liu, Yuanning; Zhu, Xiaodong; Dong, Hongxing

    2015-01-01

    This paper proposes a secondary iris recognition based on local features. The application of the energy-orientation feature (EOF) by two-dimensional Gabor filter to the extraction of the iris goes before the first recognition by the threshold of similarity, which sets the whole iris database into two categories-a correctly recognized class and a class to be recognized. Therefore, the former are accepted and the latter are transformed by histogram to achieve an energy-orientation histogram feature (EOHF), which is followed by a second recognition with the chi-square distance. The experiment has proved that the proposed method, because of its higher correct recognition rate, could be designated as the most efficient and effective among its companion studies in iris recognition algorithms.

  8. Instructional Methods and Students' End of Term Achievement in Biology in Selected Secondary Schools in Sokoto Metropolis, Sokoto State Nigeria

    Science.gov (United States)

    Shamsuddeen, Abdulrahman; Amina, Hassan

    2016-01-01

    This study investigated the Correlation between instructional methods and students end of term achievement in Biology in selected secondary schools in Sokoto Metropolis, Sokoto State Nigeria. The study addressed three Specific objectives. To examine the relationship between; Cooperative learning methods, guided discovery, Simulation Method and…

  9. Analysis methods (from 301 to 351)

    International Nuclear Information System (INIS)

    Analysis methods of materials used in the nuclear field (uranium, plutonium and their compounds, zirconium, magnesium, water...) and determination of impurities. Only reliable methods are selected [fr

  10. Rapid analysis of fungal cultures and dried figs for secondary metabolites by LC/TOF-MS

    Energy Technology Data Exchange (ETDEWEB)

    Senyuva, Hamide Z. [Ankara Test and Analysis Laboratory, Scientific and Technological Research Council of Turkey, Ankara 06330 (Turkey)], E-mail: hamide.senyuva@tubitak.gov.tr; Gilbert, John [Central Science Laboratory, Sand Hutton, York YO41 1LZ (United Kingdom); Oztuerkoglu, Sebnem [Ankara Test and Analysis Laboratory, Scientific and Technological Research Council of Turkey, Ankara 06330 (Turkey)

    2008-06-09

    A liquid chromatography-time-of-flight mass spectrometry (LC/TOF-MS) method has been developed for profiling fungal metabolites. The performance of the procedure in terms of mass accuracy, selectivity (specificity) and repeatability was established by spiking aflatoxins, ochratoxins, trichothecenes and other metabolites into blank growth media. After extracting, and carrying out LC/TOF-MS analysis, the standards were correctly identified by searching a specially constructed database of 465 secondary metabolites. To demonstrate the viability of this approach 11 toxigenic and four non-toxigenic fungi from reference collections were grown on various media, for 7-14 days. The method was also applied to two toxigenic fungi, A. flavus (200-138) and A. parasiticus (2999-465) grown on gamma radiation sterilised dried figs, for 7-14 days. The fungal hyphae plus a portion of growth media or portions of dried figs were solvent extracted and analysed by LC/TOF-MS using a rapid resolution microbore LC column. Data processing based on cluster analysis, showed that electrospray ionization (ESI)-TOF-MS could be used to unequivocally identify metabolites in crude extracts. Using the elemental metabolite database, it was demonstrated that from culture collection isolates, anticipated metabolites. The speed and simplicity of the method has meant that levels of these metabolites could be monitored daily in sterilised figs. Over a 14-day period, levels of aflatoxins and kojic acid maximised at 5-6 days, whilst levels of 5-methoxysterigmatocystin remained relatively constant. In addition to the known metabolites expected to be produced by these fungi, roquefortine A, fumagillin, fumigaclavine B, malformins (peptides), aspergillic acid, nigragillin, terrein, terrestric acid and penicillic acid were also identified.

  11. Recent characterization of steel by surface analysis methods

    International Nuclear Information System (INIS)

    Suzuki, Shigeru

    1996-01-01

    Surface analysis methods, such as Auger electron spectroscopy, X-ray photoelectron spectroscopy, secondary ion mass spectrometry, glow discharge optical emission spectrometry and so on, have become indispensable to characterize surface and interface of many kinds of steel. Although a number of studies on characterization of steel by these methods have been carried out, several problems still remain in quantification and depth profiling. Nevertheless, the methods have provided essential information on the concentration and chemical state of elements at the surface and interface. Recent results on characterization of oxide layers, coated films, etc. on the surface of steel are reviewed here. (author). 99 refs

  12. The Impact of Guided Notes on Post-Secondary Student Achievement: A Meta-Analysis

    Science.gov (United States)

    Larwin, Karen H.; Larwin, David A.

    2013-01-01

    The common practice of using of guided notes in the post-secondary classroom is not fully appreciated or understood. In an effort to add to the existing research about this phenomenon, the current investigation expands on previously published research and one previously published meta-analysis that examined the impact of guided notes on…

  13. Mathematical Interventions for Secondary Students with Learning Disabilities and Mathematics Difficulties: A Meta-Analysis

    Science.gov (United States)

    Jitendra, Asha K.; Lein, Amy E.; Im, Soo-hyun; Alghamdi, Ahmed A.; Hefte, Scott B.; Mouanoutoua, John

    2018-01-01

    This meta-analysis is the first to provide a quantitative synthesis of empirical evaluations of mathematical intervention programs implemented in secondary schools for students with learning disabilities and mathematics difficulties. Included studies used a treatment-control group design. A total of 19 experimental and quasi-experimental studies…

  14. Eighth Grade In-Service Teachers' Knowledge of Proportional Reasoning and Functions: A Secondary Data Analysis

    Science.gov (United States)

    Masters, Jessica

    2012-01-01

    A secondary data analysis was conducted using a large dataset from a study related to online professional development for eighth grade teachers of mathematics. Using this data, the paper provides a snapshot of the current state of teachers' knowledge related to proportional reasoning and functions. The paper also considers how teachers' knowledge…

  15. Campus Sustainability Governance in Canada: A Content Analysis of Post-Secondary Institutions' Sustainability Policies

    Science.gov (United States)

    Vaughter, Philip; McKenzie, Marcia; Lidstone, Lauri; Wright, Tarah

    2016-01-01

    Purpose: This paper aims to provide an overview of a content analysis of sustainability policies from Canadian post-secondary education institutions. The paper reports findings on the orientations to sustainability evident in the policies; references to other policies within the documents; and other key themes on how sustainability is engaged in…

  16. Making Real Analysis Relevant to Secondary Teachers: Building up from and Stepping down to Practice

    Science.gov (United States)

    Wasserman, Nicholas H.; Fukawa-Connelly, Timothy; Villanueva, Matthew; Mejia-Ramos, Juan Pablo; Weber, Keith

    2017-01-01

    Future teachers often claim that advanced undergraduate courses, even those that attempt to connect to school mathematics, are not useful for their teaching. This paper proposes a new way of designing advanced undergraduate content courses for secondary teachers. The model involves beginning with an analysis of the curriculum and practices of…

  17. DTI analysis methods : Voxel-based analysis

    NARCIS (Netherlands)

    Van Hecke, Wim; Leemans, Alexander; Emsell, Louise

    2016-01-01

    Voxel-based analysis (VBA) of diffusion tensor imaging (DTI) data permits the investigation of voxel-wise differences or changes in DTI metrics in every voxel of a brain dataset. It is applied primarily in the exploratory analysis of hypothesized group-level alterations in DTI parameters, as it does

  18. Bayesian methods for data analysis

    CERN Document Server

    Carlin, Bradley P.

    2009-01-01

    Approaches for statistical inference Introduction Motivating Vignettes Defining the Approaches The Bayes-Frequentist Controversy Some Basic Bayesian Models The Bayes approach Introduction Prior Distributions Bayesian Inference Hierarchical Modeling Model Assessment Nonparametric Methods Bayesian computation Introduction Asymptotic Methods Noniterative Monte Carlo Methods Markov Chain Monte Carlo Methods Model criticism and selection Bayesian Modeling Bayesian Robustness Model Assessment Bayes Factors via Marginal Density Estimation Bayes Factors

  19. Understanding the Priorities of Australian Secondary Schools through an Analysis of Their Mission and Vision Statements

    Science.gov (United States)

    Allen, Kelly-Ann; Kern, Margaret L.; Vella-Brodrick, Dianne; Waters, Lea

    2018-01-01

    Purpose: The vision or mission statement of a school outlines the school's purpose and defines the context, goals, and aspirations that govern the institution. Using vision and mission statements, the present descriptive research study investigated trends in Australian secondary schools' priorities. Research Methods: A stratified sample of…

  20. Substoichiometric method in the simple radiometric analysis

    International Nuclear Information System (INIS)

    Ikeda, N.; Noguchi, K.

    1979-01-01

    The substoichiometric method is applied to simple radiometric analysis. Two methods - the standard reagent method and the standard sample method - are proposed. The validity of the principle of the methods is verified experimentally in the determination of silver by the precipitation method, or of zinc by the ion-exchange or solvent-extraction method. The proposed methods are simple and rapid compared with the conventional superstoichiometric method. (author)

  1. Sustainability of outdoor school ground smoking bans at secondary schools: a mixed-method study.

    Science.gov (United States)

    Rozema, A D; Mathijssen, J J P; Jansen, M W J; van Oers, J A M

    2018-02-01

    Although increasing numbers of countries are implementing outdoor school ground smoking bans at secondary schools, less attention is paid to the post-implementation period even though sustainability of a policy is essential for long-term effectiveness. Therefore, this study assesses the level of sustainability and examines perceived barriers/facilitators related to the sustainability of an outdoor school ground smoking ban at secondary schools. A mixed-method design was used with a sequential explanatory approach. In phase I, 438 online surveys were conducted and in phase II, 15 semi-structured interviews were obtained from directors of relevant schools. ANOVA (phase I) and a thematic approach (phase II) were used to analyze data. Level of sustainability of an outdoor school ground smoking ban was high at the 48% Dutch schools with an outdoor smoking ban. Furthermore, school size was significantly associated with sustainability. The perceived barriers/facilitators fell into three categories: (i) smoking ban implementation factors (side-effects, enforcement, communication, guidelines and collaboration), (ii) school factors (physical environment, school culture, education type and school policy) and (iii) community environment factors (legislation and social environment). Internationally, the spread of outdoor school ground smoking bans could be further promoted. Once implemented, the ban has become 'normal' practice and investments tend to endure. Moreover, involvement of all staff is important for sustainability as they function as role models, have an interrelationship with students, and share responsibility for enforcement. These findings are promising for the sustainability of future tobacco control initiatives to further protect against the morbidity/mortality associated with smoking. © The Author 2017. Published by Oxford University Press on behalf of the European Public Health Association.

  2. RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis.

    Science.gov (United States)

    Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab

    2012-01-01

    RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. http://www.cemb.edu.pk/sw.html RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language.

  3. Numerical analysis of exhaust jet secondary combustion in hypersonic flow field

    Science.gov (United States)

    Yang, Tian-Peng; Wang, Jiang-Feng; Zhao, Fa-Ming; Fan, Xiao-Feng; Wang, Yu-Han

    2018-05-01

    The interaction effect between jet and control surface in supersonic and hypersonic flow is one of the key problems for advanced flight control system. The flow properties of exhaust jet secondary combustion in a hypersonic compression ramp flow field were studied numerically by solving the Navier-Stokes equations with multi-species and combustion reaction effects. The analysis was focused on the flow field structure and the force amplification factor under different jet conditions. Numerical results show that a series of different secondary combustion makes the flow field structure change regularly, and the temperature increases rapidly near the jet exit.

  4. Chemical methods of rock analysis

    National Research Council Canada - National Science Library

    Jeffery, P. G; Hutchison, D

    1981-01-01

    .... Such methods include those based upon spectrophotometry, flame emission spectrometry and atomic absorption spectroscopy, as well as gravimetry, titrimetry and the use of ion-selective electrodes...

  5. Effect of Simulation Techniques and Lecture Method on Students' Academic Performance in Mafoni Day Secondary School Maiduguri, Borno State, Nigeria

    Science.gov (United States)

    Bello, Sulaiman; Ibi, Mustapha Baba; Bukar, Ibrahim Bulama

    2016-01-01

    The study examined the effect of simulation technique and lecture method on students' academic performance in Mafoni Day Secondary School, Maiduguri. The study used both simulation technique and lecture methods of teaching at the basic level of education in the teaching/learning environment. The study aimed at determining the best predictor among…

  6. Gender inequality, health expenditure and maternal mortality in sub-Saharan Africa: A secondary data analysis

    Directory of Open Access Journals (Sweden)

    Frank Chirowa

    2013-08-01

    Full Text Available Background: This article provided an analysis of gender inequality, health expenditure and its relationship to maternal mortality. Objective: The objective of this article was to explore gender inequality and its relationship with health expenditure and maternal mortality in sub-Saharan Africa (SSA. A unique analysis was used to correlate the Gender Inequality Index (GII, Health Expenditure and Maternal Mortality Ratio (MMR. The GII captured inequalities across three dimensions – Reproductive health, Women empowerment and Labour force participation between men and women. The GII is a composite index introduced by the UNDP in 2010 and corrects for the disadavanatges of the other gender indices. Although the GII incorporates MMR in its calculation, it should not be taken as a substitute for, but rather as complementary to, the MMR. Method: An exploratory and descriptive design to a secondary documentary review using quantitative data and qualitative information was used. The article referred to sub-Saharan Africa, but seven countries were purposively selected for an in-depth analysis based on the availability of data. The countries selected were Angola, Botswana, Malawi, Mozambique,South Africa, Zambia and Zimbabwe. Results: Countries with high gender inequality captured by the gender inequality index were associated with high maternal mortality ratios as compared with countries with lower gender inequality, whilst countries that spend less on health were associated with higher maternal deaths than countries that spend more. Conclusion: A potential relationship exists between gender inequality, health expenditure, and maternal mortality. Gender inequalities are systematic and occur at the macro, societal and household levels.

  7. Regression analysis for secondary response variable in a case-cohort study.

    Science.gov (United States)

    Pan, Yinghao; Cai, Jianwen; Kim, Sangmi; Zhou, Haibo

    2017-12-29

    Case-cohort study design has been widely used for its cost-effectiveness. In any real study, there are always other important outcomes of interest beside the failure time that the original case-cohort study is based on. How to utilize the available case-cohort data to study the relationship of a secondary outcome with the primary exposure obtained through the case-cohort study is not well studied. In this article, we propose a non-parametric estimated likelihood approach for analyzing a secondary outcome in a case-cohort study. The estimation is based on maximizing a semiparametric likelihood function that is built jointly on both time-to-failure outcome and the secondary outcome. The proposed estimator is shown to be consistent, efficient, and asymptotically normal. Finite sample performance is evaluated via simulation studies. Data from the Sister Study is analyzed to illustrate our method. © 2017, The International Biometric Society.

  8. Analysis of secondary electron emission for conducting materials using 4-grid LEED/AES optics

    International Nuclear Information System (INIS)

    Patino, M I; Wirz, R E; Raitses, Y; Koel, B E

    2015-01-01

    A facility utilizing 4-grid optics for LEED/AES (low energy electron diffraction/Auger electron spectroscopy) was developed to measure the total secondary electron yield and secondary electron energy distribution function for conducting materials. The facility and experimental procedure were validated with measurements of 50–500 eV primary electrons impacting graphite. The total yield was calculated from measurements of the secondary electron current (i) from the sample and (ii) from the collection assembly, by biasing each surface. Secondary electron yield results from both methods agreed well with each other and were within the spread of previous results for the total yield from graphite. Additionally, measurements of the energy distribution function of secondary electrons from graphite are provided for a wider range of incident electron energies. These results can be used in modeling plasma-wall interactions in plasmas bounded by graphite walls, such as are found in plasma thrusters, and divertors and limiters of magnetic fusion devices. (paper)

  9. Enzyme-linked immunosorbent assay for the quantitative/qualitative analysis of plant secondary metabolites.

    Science.gov (United States)

    Sakamoto, Seiichi; Putalun, Waraporn; Vimolmangkang, Sornkanok; Phoolcharoen, Waranyoo; Shoyama, Yukihiro; Tanaka, Hiroyuki; Morimoto, Satoshi

    2018-01-01

    Immunoassays are antibody-based analytical methods for quantitative/qualitative analysis. Since the principle of immunoassays is based on specific antigen-antibody reaction, the assays have been utilized worldwide for diagnosis, pharmacokinetic studies by drug monitoring, and the quality control of commercially available products. Berson and Yalow were the first to develop an immunoassay, known as radioimmunoassay (RIA), for detecting endogenous plasma insulin [1], a development for which Yalow was awarded the Nobel Prize in Physiology or Medicine in 1977. Even today, after half a century, immunoassays are widely utilized with some modifications from the originally proposed system, e.g., radioisotopes have been replaced with enzymes because of safety concerns regarding the use of radioactivity, which is referred to as enzyme immunoassay/enzyme-linked immunosorbent assay (ELISA). In addition, progress has been made in ELISA with the recent advances in recombinant DNA technology, leading to increase in the range of antibodies, probes, and even systems. This review article describes ELISA and its applications for the detection of plant secondary metabolites.

  10. Methods and Materials in Teaching Secondary School Mathematics - Syllabus. Revised Edition.

    Science.gov (United States)

    Gallia, Thomas J.

    This syllabus describes a course designed for the student interested in teaching mathematics at the secondary level and includes both campus centered activities and a field experience. The professor teaching this class is expected to "bridge the gap" between theory in the college classroom and practice as viewed in the secondary school. The…

  11. Research with secondary data : Different matching methods and does it matter.

    NARCIS (Netherlands)

    de Leeuw, Tim; Keijl, Stefan

    Our review of all SMJ studies of the last six years reveals that 63 percent use multiple secondary databases, but only 11 percent report how the connections between these databases were made. This limits our knowledge of how information across secondary databases can be combined and restricts the

  12. Impact of Including Authentic Inquiry Experiences in Methods Courses for Pre-Service Secondary Teachers

    Science.gov (United States)

    Slater, T. F.; Elfring, L.; Novodvorsky, I.; Talanquer, V.; Quintenz, J.

    2007-12-01

    Science education reform documents universally call for students to have authentic and meaningful experiences using real data in the context of their science education. The underlying philosophical position is that students analyzing data can have experiences that mimic actual research. In short, research experiences that reflect the scientific spirit of inquiry potentially can: prepare students to address real world complex problems; develop students' ability to use scientific methods; prepare students to critically evaluate the validity of data or evidence and of the consequent interpretations or conclusions; teach quantitative skills, technical methods, and scientific concepts; increase verbal, written, and graphical communication skills; and train students in the values and ethics of working with scientific data. However, it is unclear what the broader pre-service teacher preparation community is doing in preparing future teachers to promote, manage, and successful facilitate their own students in conducting authentic scientific inquiry. Surveys of undergraduates in secondary science education programs suggests that students have had almost no experiences themselves in conducting open scientific inquiry where they develop researchable questions, design strategies to pursue evidence, and communicate data-based conclusions. In response, the College of Science Teacher Preparation Program at the University of Arizona requires all students enrolled in its various science teaching methods courses to complete an open inquiry research project and defend their findings at a specially designed inquiry science mini-conference at the end of the term. End-of-term surveys show that students enjoy their research experience and believe that this experience enhances their ability to facilitate their own future students in conducting open inquiry.

  13. Probabilistic methods in combinatorial analysis

    CERN Document Server

    Sachkov, Vladimir N

    2014-01-01

    This 1997 work explores the role of probabilistic methods for solving combinatorial problems. These methods not only provide the means of efficiently using such notions as characteristic and generating functions, the moment method and so on but also let us use the powerful technique of limit theorems. The basic objects under investigation are nonnegative matrices, partitions and mappings of finite sets, with special emphasis on permutations and graphs, and equivalence classes specified on sequences of finite length consisting of elements of partially ordered sets; these specify the probabilist

  14. Methods in quantitative image analysis.

    Science.gov (United States)

    Oberholzer, M; Ostreicher, M; Christen, H; Brühlmann, M

    1996-05-01

    The main steps of image analysis are image capturing, image storage (compression), correcting imaging defects (e.g. non-uniform illumination, electronic-noise, glare effect), image enhancement, segmentation of objects in the image and image measurements. Digitisation is made by a camera. The most modern types include a frame-grabber, converting the analog-to-digital signal into digital (numerical) information. The numerical information consists of the grey values describing the brightness of every point within the image, named a pixel. The information is stored in bits. Eight bits are summarised in one byte. Therefore, grey values can have a value between 0 and 256 (2(8)). The human eye seems to be quite content with a display of 5-bit images (corresponding to 64 different grey values). In a digitised image, the pixel grey values can vary within regions that are uniform in the original scene: the image is noisy. The noise is mainly manifested in the background of the image. For an optimal discrimination between different objects or features in an image, uniformity of illumination in the whole image is required. These defects can be minimised by shading correction [subtraction of a background (white) image from the original image, pixel per pixel, or division of the original image by the background image]. The brightness of an image represented by its grey values can be analysed for every single pixel or for a group of pixels. The most frequently used pixel-based image descriptors are optical density, integrated optical density, the histogram of the grey values, mean grey value and entropy. The distribution of the grey values existing within an image is one of the most important characteristics of the image. However, the histogram gives no information about the texture of the image. The simplest way to improve the contrast of an image is to expand the brightness scale by spreading the histogram out to the full available range. Rules for transforming the grey value

  15. Mass spectrometric methods for trace analysis of metals

    International Nuclear Information System (INIS)

    Bahr, U.; Schulten, H.R.

    1981-01-01

    A brief outline is given of the principles of mass spectrometry (MS) and the fundamentals of qualitative and quantitative mass spectrometric analysis emphasizing recent developments and results. Classical methods of the analysis of solids, i.e. spark-source MS and thermal ionization MS, as well as recent methods of metal analysis are described. Focal points in this survey of recently developed techniques include secondary ion MS, laser probe MS, plasma ion source MS, gas discharge MS and field desorption MS. Here, a more detailed description is given and the merits of these emerging methods are discussed more explicitly. In particular, the results of the field desorption techniques in elemental analyses are reviewed and critically evaluated

  16. Analysis of secondary cytoreduction for recurrent ovarian cancer by robotics, laparoscopy and laparotomy.

    Science.gov (United States)

    Magrina, Javier F; Cetta, Rachel L; Chang, Yu-Hui; Guevara, Gregory; Magtibay, Paul M

    2013-05-01

    Analysis of perioperative outcomes and survival of patients with recurrent ovarian cancer undergoing secondary cytoreduction by robotics, laparoscopy, or laparotomy. Retrospective analysis of 52 selected patients with recurrent ovarian cancer undergoing secondary cytoreduction by laparoscopy (9), laparotomy (33) or robotics (10) between January 2006 and December 2010. Comparison was made by a total of 21 factors including age, BMI, number of previous surgeries, tumor type and grade, number of procedures, and 15 types of procedures performed at secondary cytoreduction. For all patients, the mean operating time was 213.8 min, mean blood loss 657.4 ml; and mean hospital stay 7.5 days. Complete debulking was achieved in 75% of patients. Postoperative complications were noted in 36.5% of patients. Overall and progression-free survival at 3-years were 58.8% and 34.1%, respectively. Laparoscopy and robotics had reduced blood loss and hospital stay, while no differences were observed among the three groups for operating time, complications, complete debulking, and survival. Selected patients with recurrent ovarian cancer benefit from a laparoscopic or robotic secondary cytoreduction without compromising survival. Robotics and laparoscopy provide similar perioperative outcomes, and reduced blood loss and shorter hospital stay as compared to laparotomy. Laparotomy seems preferable for patients with widespread peritoneal implants, multiple sites of recurrence, and/or extensive adhesions. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Moyer's method of mixed dentition analysis: a meta-analysis ...

    African Journals Online (AJOL)

    The applicability of tables derived from the data Moyer used to other ethnic groups has ... This implies that Moyer's method of prediction may have population variations. ... Key Words: meta-analysis, mixed dentition analysis, Moyer's method

  18. Development of the mitigation method for carbon steel corrosion with ceramics in PWR secondary system

    International Nuclear Information System (INIS)

    Okamura, Masato; Shibasaki, Osamu; Miyazaki, Toyoaki; Kaneko, Tetsuji

    2012-09-01

    To verify the effect of depositing ceramic (TiO 2 , La 2 O 3 , and Y 2 O 3 ) on carbon steel to mitigate corrosion, corrosion tests were conducted under simulated chemistry conditions in a PWR secondary system. Test specimens (STPT410) were prepared with and without deposited ceramics. The ceramics were deposited on the specimens under high-temperature and high-pressure water conditions. Corrosion tests were conducted under high pH conditions (9.8) with a flow rate of 1.0-4.7 m/s at 185 deg. C for 200 hours. At a flow rate of 1.0 m/s, the amount of corrosion of the specimens with the ceramics was less than half of that of the specimens without the ceramics. As the flow rate increased, the amount of corrosion increased. However, even at a flow rate of 4.7 m/s, the amount of corrosion was reduced by approximately 30% by depositing the ceramics. After the corrosion tests, the surfaces of the specimens were analyzed with SEM and XRD. When the deposited ceramic was TiO 2 , the surface was densely covered with fine particles (less than 1 μm). From XRD analysis, these particles were identified as ilmenite (FeTiO 3 ). We consider that ilmenite may play an important role in mitigating the corrosion of carbon steel. (authors)

  19. A consistent modelling methodology for secondary settling tanks: a reliable numerical method.

    Science.gov (United States)

    Bürger, Raimund; Diehl, Stefan; Farås, Sebastian; Nopens, Ingmar; Torfs, Elena

    2013-01-01

    The consistent modelling methodology for secondary settling tanks (SSTs) leads to a partial differential equation (PDE) of nonlinear convection-diffusion type as a one-dimensional model for the solids concentration as a function of depth and time. This PDE includes a flux that depends discontinuously on spatial position modelling hindered settling and bulk flows, a singular source term describing the feed mechanism, a degenerating term accounting for sediment compressibility, and a dispersion term for turbulence. In addition, the solution itself is discontinuous. A consistent, reliable and robust numerical method that properly handles these difficulties is presented. Many constitutive relations for hindered settling, compression and dispersion can be used within the model, allowing the user to switch on and off effects of interest depending on the modelling goal as well as investigate the suitability of certain constitutive expressions. Simulations show the effect of the dispersion term on effluent suspended solids and total sludge mass in the SST. The focus is on correct implementation whereas calibration and validation are not pursued.

  20. Clinical analysis of 34 cases with glaucoma secondary to hypermature cataract

    Directory of Open Access Journals (Sweden)

    Lin Jing

    2016-03-01

    Full Text Available AIM:To analyze the clinical symptoms, treatments and prognosis of the glaucoma secondary to hypermature cataract to offer some references for the diagnosis and the treatment.METHODS:Thirty four eyes with glaucoma secondary to hypermature cataract in 34 patients were collected from August 2011 to August 2014 in the West China Hospital, Sichuan University. Analyze different treatment methods selected according to different clinical symptoms, and corresponding prognosis.RESULTS:Thirty four patients were hospitalized in emergency, all the eyes had visual acuity of finger counting or worse, intraocular pressure(IOPwas 35~75mmHg. All patients received comprehensive IOP-lowering therapy before the surgery. Twenty-eight patients underwent phacoemulsification, 6 patients underwent extra-capsular cataract extraction(ECCEand 19 patients underwent primary or secondary IOL implantation. All the patients experienced pain relief after surgery, 30 of them had well-controlled postoperative IOP. One case underwent Ahmed glaucoma valve implant surgery, 3 cases gave up the treatment. Seventeen cases who had IOL implanted got great visual acuity improvement, the best postoperative visual acuity was 0.7.CONCLUSION:As long as we have proper and prompt diagnosis and positive control of IOP and inflammation before surgery, precise surgery skills, close observation after surgery and positive anti-inflammation therapy, most of the glaucoma secondary to hypermature cataract get satisfactory outcomes.

  1. Applying critical analysis - main methods

    Directory of Open Access Journals (Sweden)

    Miguel Araujo Alonso

    2012-02-01

    Full Text Available What is the usefulness of critical appraisal of literature? Critical analysis is a fundamental condition for the correct interpretation of any study that is subject to review. In epidemiology, in order to learn how to read a publication, we must be able to analyze it critically. Critical analysis allows us to check whether a study fulfills certain previously established methodological inclusion and exclusion criteria. This is frequently used in conducting systematic reviews although eligibility criteria are generally limited to the study design. Critical analysis of literature and be done implicitly while reading an article, as in reading for personal interest, or can be conducted in a structured manner, using explicit and previously established criteria. The latter is done when formally reviewing a topic.

  2. Evaluation Considerations for Secondary Uses of Clinical Data: Principles for an Evidence-based Approach to Policy and Implementation of Secondary Analysis.

    Science.gov (United States)

    Scott, P J; Rigby, M; Ammenwerth, E; McNair, J Brender; Georgiou, A; Hyppönen, H; de Keizer, N; Magrabi, F; Nykänen, P; Gude, W T; Hackl, W

    2017-08-01

    Objectives: To set the scientific context and then suggest principles for an evidence-based approach to secondary uses of clinical data, covering both evaluation of the secondary uses of data and evaluation of health systems and services based upon secondary uses of data. Method: Working Group review of selected literature and policy approaches. Results: We present important considerations in the evaluation of secondary uses of clinical data from the angles of governance and trust, theory, semantics, and policy. We make the case for a multi-level and multi-factorial approach to the evaluation of secondary uses of clinical data and describe a methodological framework for best practice. We emphasise the importance of evaluating the governance of secondary uses of health data in maintaining trust, which is essential for such uses. We also offer examples of the re-use of routine health data to demonstrate how it can support evaluation of clinical performance and optimize health IT system design. Conclusions: Great expectations are resting upon "Big Data" and innovative analytics. However, to build and maintain public trust, improve data reliability, and assure the validity of analytic inferences, there must be independent and transparent evaluation. A mature and evidence-based approach needs not merely data science, but must be guided by the broader concerns of applied health informatics. Georg Thieme Verlag KG Stuttgart.

  3. Trial Sequential Methods for Meta-Analysis

    Science.gov (United States)

    Kulinskaya, Elena; Wood, John

    2014-01-01

    Statistical methods for sequential meta-analysis have applications also for the design of new trials. Existing methods are based on group sequential methods developed for single trials and start with the calculation of a required information size. This works satisfactorily within the framework of fixed effects meta-analysis, but conceptual…

  4. The Impact of the Internet on Health Consultation Market Concentration: An Econometric Analysis of Secondary Data

    Science.gov (United States)

    2016-01-01

    Background Many markets have traditionally been dominated by a few best-selling products, and this is also the case for the health care industry. However, we do not know whether the market will be more or less concentrated when health care services are delivered online (known as E-consultation), nor do we know how to reduce the concentration of the E-consultation market. Objective The aim of this study was to investigate the concentration of the E-consultation market and how to reduce its concentration through information disclosure mechanisms (online reputation and self-representation). Methods We employed a secondary data econometric analysis using transaction data obtained from an E-consultation Website (haodf.com) for three diseases (infantile pneumonia, diabetes, and pancreatic cancer) from 2008 to 2015. We included 2439 doctors in the analysis. Results The E-consultation market largely follows the 20/80 principle, namely that approximately 80% of orders are fulfilled by nearly 20% of doctors. This is much higher than the offline health care market. Meanwhile, the market served by doctors with strong online reputations (beta=0.207, Ponline self-representation (beta=0.386, Ponline, the market will be more concentrated (known as the “Superstar” effect), indicating poor service efficiency for society as a whole. To reduce market concentration, E-consultation websites should provide important design elements such as ratings of doctors (user feedback), articles contributed by doctors, and free consultation services (online representation). A possible and important way to reduce the market concentration of the E-consultation market is to accumulate enough highly rated or highly self-represented doctors. PMID:27793793

  5. Characterization of biogenic secondary organic aerosols using statistical methods; Charakterisierung Biogener Sekundaerer Organischer Aerosole mit Statistischen Methoden

    Energy Technology Data Exchange (ETDEWEB)

    Spindler, Christian

    2010-07-01

    Atmospheric aerosols have important influence on the radiation balance of the Earth, on visibility and human health. Secondary organic aerosol is formed from gas-to-particle conversion of oxidized volatile organic compounds. A dominant fraction of the gases originates from plant emissions, making biogenic secondary organic aerosol (BSOA) an especially important constituent of the atmosphere. Knowing the chemical composition of BSOA particles is crucial for a thorough understanding of aerosol processes in the environment. In this work, the chemical composition of BSOA particles was measured with aerosol mass spectrometry and analyzed with statistical methods. The experimental part of the work comprises process studies of the formation and aging of biogenic aerosols in simulation chambers. Using a plant chamber, real tree emissions were used to produce particles in a way close to conditions in forest environments. In the outdoor chamber SAPHIR, OH-radicals were produced from the photooxidation of ozone under illumination with natural sunlight. Here, BSOA was produced from defined mixtures of mono- and sesquiterpenes that represent boreal forest emissions. A third kind of experiments was performed in the indoor chamber AIDA. Here, particles were produced from ozonolysis of single monoterpenes and aged by condensing OH-oxidation products. Two aerosol mass spectrometers (AMS) were used to measure the chemical composition of the particles. One of the instruments is equipped with a quadrupole mass spectrometer providing unit mass resolution. The second instrument contains a time-of-flight mass spectrometer and provides mass resolution sufficient to distinguish different fragments with the same nominal mass. Aerosol mass spectra obtained with these instruments are strongly fragmented due to electron impact ionization of the evaporated molecules. In addition, typical BSOA mass spectra are very similar to each other. In order to get a more detailed knowledge about the mass

  6. Surgical management of pilonidal sinus patients by primary and secondary repair methods: a comparative study

    Directory of Open Access Journals (Sweden)

    Haji Barati B

    2010-12-01

    Full Text Available "n Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:Arial; mso-bidi-theme-font:minor-bidi;} Background: Gross difference in return to work exists in pilonidal sinus patients operated by primary and secondary repair. This survey was to evaluate the results of surgical management of pilonidal sinus with primary or secondary closure."n"nMethods: In a randomized clinical trial, patients with pilonidal sinus referring to the surgical clinic of Shariati Hospital in Tehran, Iran between March 2007 and March 2009 were underwent either excision with midline closure (primary, n=40, or excision without closure (secondary, n=40. The recorded outcomes were hospital stay, healing time, time off work, postoperative pain, patient's satisfaction and the recurrence rate."n"nResults: Majority of the patients were male (87.50%. There was no significant difference in the hospital stay. Time off work (8.65±1.73 Vs. 11.53±2.33 days, p=0.001 and healing time (3.43±0.92 Vs. 5.3±0.79 days, p=0.001 were shorter in primary group; but, there were no significant differences in hospital stay and number of visits. Intensity of postoperative pain in the 1st (37.75±6.5 Vs. 43.63±5.06, p=0.001, 2nd (26.75±6.66 Vs. 34.63±5.48, p=0.001, 3rd (18.25±6.05 Vs. 27.88±6.88, p=0.001, and 7th (8.45±3.85 Vs. 17.88±6.19, p=0.001 days were

  7. A comparative method for finding and folding RNA secondary structures within protein-coding regions

    DEFF Research Database (Denmark)

    Pedersen, Jakob Skou; Meyer, Irmtraud Margret; Forsberg, Roald

    2004-01-01

    that RNA-DECODER's parameters can be automatically trained to successfully fold known secondary structures within the HCV genome. We scan the genomes of HCV and polio virus for conserved secondary-structure elements, and analyze performance as a function of available evolutionary information. On known...... secondary structures, RNA-DECODER shows a sensitivity similar to the programs MFOLD, PFOLD and RNAALIFOLD. When scanning the entire genomes of HCV and polio virus for structure elements, RNA-DECODER's results indicate a markedly higher specificity than MFOLD, PFOLD and RNAALIFOLD....

  8. Neuroprotection and secondary damage following spinal cord injury: concepts and methods.

    Science.gov (United States)

    Hilton, Brett J; Moulson, Aaron J; Tetzlaff, Wolfram

    2017-06-23

    Neuroprotection refers to the attenuation of pathophysiological processes triggered by acute injury to minimize secondary damage. The development of neuroprotective treatments represents a major goal in the field of spinal cord injury (SCI) research. In this review, we discuss the strengths and limitations of the methodologies employed to assess secondary damage and neuroprotection in preclinical models of traumatic SCI. We also discuss modelling issues and how new tools might be exploited to study secondary damage and neuroprotection. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  9. Hybrid methods for cybersecurity analysis :

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Warren Leon,; Dunlavy, Daniel M.

    2014-01-01

    Early 2010 saw a signi cant change in adversarial techniques aimed at network intrusion: a shift from malware delivered via email attachments toward the use of hidden, embedded hyperlinks to initiate sequences of downloads and interactions with web sites and network servers containing malicious software. Enterprise security groups were well poised and experienced in defending the former attacks, but the new types of attacks were larger in number, more challenging to detect, dynamic in nature, and required the development of new technologies and analytic capabilities. The Hybrid LDRD project was aimed at delivering new capabilities in large-scale data modeling and analysis to enterprise security operators and analysts and understanding the challenges of detection and prevention of emerging cybersecurity threats. Leveraging previous LDRD research e orts and capabilities in large-scale relational data analysis, large-scale discrete data analysis and visualization, and streaming data analysis, new modeling and analysis capabilities were quickly brought to bear on the problems in email phishing and spear phishing attacks in the Sandia enterprise security operational groups at the onset of the Hybrid project. As part of this project, a software development and deployment framework was created within the security analyst work ow tool sets to facilitate the delivery and testing of new capabilities as they became available, and machine learning algorithms were developed to address the challenge of dynamic threats. Furthermore, researchers from the Hybrid project were embedded in the security analyst groups for almost a full year, engaged in daily operational activities and routines, creating an atmosphere of trust and collaboration between the researchers and security personnel. The Hybrid project has altered the way that research ideas can be incorporated into the production environments of Sandias enterprise security groups, reducing time to deployment from months and

  10. A modified CCFS approach for the seismic analysis of multiply supported MDOF secondary systems

    International Nuclear Information System (INIS)

    Saudy, A.; Ghobarah, A.; Aziz, T.S.

    1992-01-01

    An alternative technique has been developed to evaluate the ordinates of the Cross Cross Floor Spectra (CCFS). The technique properly accounts for the dynamic interaction, tuning and non-classical damping characters of the combined Primary-Secondary (P-S) systems. The approach is able to estimate the peak response of the tuned non-classically damped P-S systems more accurately. In the analysis, two fictions oscillators are attached to the primary system in the course of evaluating the ordinates rather than attaching only one oscillator to the primary system as was previously suggested. Two numerical examples are analyzed by the original and the proposed techniques. The results are compared with the response values obtained using coupled dynamic analysis. The proposed technique proved to be more accurate in estimating the peak response of the secondary system, specially in cases of tuned, non-classically damped P-S systems. (orig.)

  11. Secondary Data Analysis of National Surveys in Japan Toward Improving Population Health

    Science.gov (United States)

    Ikeda, Nayu

    2016-01-01

    Secondary data analysis of national health surveys of the general population is a standard methodology for health metrics and evaluation; it is used to monitor trends in population health over time and benchmark the performance of health systems. In Japan, the government has established electronic databases of individual records from national surveys of the population’s health. However, the number of publications based on these datasets is small considering the scale and coverage of the surveys. There appear to be two major obstacles to the secondary use of Japanese national health survey data: strict data access control under the Statistics Act and an inadequate interdisciplinary research environment for resolving methodological difficulties encountered when dealing with secondary data. The usefulness of secondary analysis of survey data is evident with examples from the author’s previous studies based on vital records and the National Health and Nutrition Surveys, which showed that (i) tobacco smoking and high blood pressure are the major risk factors for adult mortality from non-communicable diseases in Japan; (ii) the decrease in mean blood pressure in Japan from the late 1980s to the early 2000s was partly attributable to the increased use of antihypertensive medication and reduced dietary salt intake; and (iii) progress in treatment coverage and control of high blood pressure is slower in Japan than in the United States and Britain. National health surveys in Japan are an invaluable asset, and findings from secondary analyses of these surveys would provide important suggestions for improving health in people around the world. PMID:26902170

  12. Microparticle analysis system and method

    Science.gov (United States)

    Morrison, Dennis R. (Inventor)

    2007-01-01

    A device for analyzing microparticles is provided which includes a chamber with an inlet and an outlet for respectively introducing and dispensing a flowing fluid comprising microparticles, a light source for providing light through the chamber and a photometer for measuring the intensity of light transmitted through individual microparticles. The device further includes an imaging system for acquiring images of the fluid. In some cases, the device may be configured to identify and determine a quantity of the microparticles within the fluid. Consequently, a method for identifying and tracking microparticles in motion is contemplated herein. The method involves flowing a fluid comprising microparticles in laminar motion through a chamber, transmitting light through the fluid, measuring the intensities of the light transmitted through the microparticles, imaging the fluid a plurality of times and comparing at least some of the intensities of light between different images of the fluid.

  13. A comparison of two microscale laboratory reporting methods in a secondary chemistry classroom

    Science.gov (United States)

    Martinez, Lance Michael

    This study attempted to determine if there was a difference between the laboratory achievement of students who used a modified reporting method and those who used traditional laboratory reporting. The study also determined the relationships between laboratory performance scores and the independent variables score on the Group Assessment of Logical Thinking (GALT) test, chronological age in months, gender, and ethnicity for each of the treatment groups. The study was conducted using 113 high school students who were enrolled in first-year general chemistry classes at Pueblo South High School in Colorado. The research design used was the quasi-experimental Nonequivalent Control Group Design. The statistical treatment consisted of the Multiple Regression Analysis and the Analysis of Covariance. Based on the GALT, students in the two groups were generally in the concrete and transitional stages of the Piagetian cognitive levels. The findings of the study revealed that the traditional and the modified methods of laboratory reporting did not have any effect on the laboratory performance outcome of the subjects. However, the students who used the traditional method of reporting showed a higher laboratory performance score when evaluation was conducted using the New Standards rubric recommended by the state. Multiple Regression Analysis revealed that there was a significant relationship between the criterion variable student laboratory performance outcome of individuals who employed traditional laboratory reporting methods and the composite set of predictor variables. On the contrary, there was no significant relationship between the criterion variable student laboratory performance outcome of individuals who employed modified laboratory reporting methods and the composite set of predictor variables.

  14. Secondary analysis of data can inform care delivery for Indigenous women in an acute mental health inpatient unit.

    Science.gov (United States)

    Bradley, Pat; Cunningham, Teresa; Lowell, Anne; Nagel, Tricia; Dunn, Sandra

    2017-02-01

    There is a paucity of research exploring Indigenous women's experiences in acute mental health inpatient services in Australia. Even less is known of Indigenous women's experience of seclusion events, as published data are rarely disaggregated by both indigeneity and gender. This research used secondary analysis of pre-existing datasets to identify any quantifiable difference in recorded experience between Indigenous and non-Indigenous women, and between Indigenous women and Indigenous men in an acute mental health inpatient unit. Standard separation data of age, length of stay, legal status, and discharge diagnosis were analysed, as were seclusion register data of age, seclusion grounds, and number of seclusion events. Descriptive statistics were used to summarize the data, and where warranted, inferential statistical methods used SPSS software to apply analysis of variance/multivariate analysis of variance testing. The results showed evidence that secondary analysis of existing datasets can provide a rich source of information to describe the experience of target groups, and to guide service planning and delivery of individualized, culturally-secure mental health care at a local level. The results are discussed, service and policy development implications are explored, and suggestions for further research are offered. © 2016 Australian College of Mental Health Nurses Inc.

  15. Infinitesimal methods of mathematical analysis

    CERN Document Server

    Pinto, J S

    2004-01-01

    This modern introduction to infinitesimal methods is a translation of the book Métodos Infinitesimais de Análise Matemática by José Sousa Pinto of the University of Aveiro, Portugal and is aimed at final year or graduate level students with a background in calculus. Surveying modern reformulations of the infinitesimal concept with a thoroughly comprehensive exposition of important and influential hyperreal numbers, the book includes previously unpublished material on the development of hyperfinite theory of Schwartz distributions and its application to generalised Fourier transforms and harmon

  16. Development of advanced MCR task analysis methods

    International Nuclear Information System (INIS)

    Na, J. C.; Park, J. H.; Lee, S. K.; Kim, J. K.; Kim, E. S.; Cho, S. B.; Kang, J. S.

    2008-07-01

    This report describes task analysis methodology for advanced HSI designs. Task analyses was performed by using procedure-based hierarchical task analysis and task decomposition methods. The results from the task analysis were recorded in a database. Using the TA results, we developed static prototype of advanced HSI and human factors engineering verification and validation methods for an evaluation of the prototype. In addition to the procedure-based task analysis methods, workload estimation based on the analysis of task performance time and analyses for the design of information structure and interaction structures will be necessary

  17. Current status of methods for shielding analysis

    International Nuclear Information System (INIS)

    Engle, W.W.

    1980-01-01

    Current methods used in shielding analysis and recent improvements in those methods are discussed. The status of methods development is discussed based on needs cited at the 1977 International Conference on Reactor Shielding. Additional areas where methods development is needed are discussed

  18. Effects of Lecture Method Supplemented with Music and Computer Animation on Senior Secondary School Students' Academic Achievement in Electrochemistry

    Science.gov (United States)

    Akpoghol, T. V.; Ezeudu, F. O.; Adzape, J. N.; Otor, E. E.

    2016-01-01

    The study investigated the effects of Lecture Method Supplemented with Music (LMM) and Computer Animation (LMC) on senior secondary school students' academic achievement in electrochemistry in Makurdi metropolis. Six research questions and six hypotheses guided the study. The design of the study was quasi experimental, specifically the pre-test,…

  19. Relative Effect of Lecture Method Supplemented with Music and Computer Animation on Senior Secondary School Students' Retention in Electrochemistry

    Science.gov (United States)

    Akpoghol, T. V.; Ezeudu, F. O.; Adzape, J. N.; Otor, E. E.

    2016-01-01

    The study investigated the effects of Lecture Method Supplemented with Music (LMM) and Computer Animation (LMC) on senior secondary school students' retention in electrochemistry in Makurdi metropolis. Three research questions and three hypotheses guided the study. The design of the study was quasi experimental, specifically the pre-test,…

  20. Cross-Calibration of Secondary Electron Multiplier in Noble Gas Analysis

    Science.gov (United States)

    Santato, Alessandro; Hamilton, Doug; Deerberg, Michael; Wijbrans, Jan; Kuiper, Klaudia; Bouman, Claudia

    2015-04-01

    The latest generation of multi-collector noble gas mass spectrometers has decisively improved the precision in isotopic ratio analysis [1, 2] and helped the scientific community to address new questions [3]. Measuring numerous isotopes simultaneously has two significant advantages: firstly, any fluctuations in signal intensity have no effect on the isotope ratio and secondly, the analysis time is reduced. This particular point becomes very important in static vacuum mass spectrometry where during the analysis, the signal intensity decays and at the same time the background increases. However, when multi-collector analysis is utilized, it is necessary to pay special attention to the cross calibration of the detectors. This is a key point in order to have accurate and reproducible isotopic ratios. In isotope ratio mass spectrometry, with regard to the type of detector (i.e. Faraday or Secondary Electron Multiplier, SEM), analytical technique (TIMS, MC-ICP-MS or IRMS) and isotope system of interest, several techniques are currently applied to cross-calibrate the detectors. Specifically, the gain of the Faraday cups is generally stable and only the associated amplifier must be calibrated. For example, on the Thermo Scientific instrument control systems, the 1011 and 1012 ohm amplifiers can easily be calibrated through a fully software controlled procedure by inputting a constant electric signal to each amplifier sequentially [4]. On the other hand, the yield of the SEMs can drift up to 0.2% / hour and other techniques such as peak hopping, standard-sample bracketing and multi-dynamic measurement must be used. Peak hopping allows the detectors to be calibrated by measuring an ion beam of constant intensity across the detectors whereas standard-sample bracketing corrects the drift of the detectors through the analysis of a reference standard of a known isotopic ratio. If at least one isotopic pair of the sample is known, multi-dynamic measurement can be used; in this

  1. Reform-based science teaching: A mixed-methods approach to explaining variation in secondary science teacher practice

    Science.gov (United States)

    Jetty, Lauren E.

    The purpose of this two-phase, sequential explanatory mixed-methods study was to understand and explain the variation seen in secondary science teachers' enactment of reform-based instructional practices. Utilizing teacher socialization theory, this mixed-methods analysis was conducted to determine the relative influence of secondary science teachers' characteristics, backgrounds and experiences across their teacher development to explain the range of teaching practices exhibited by graduates from three reform-oriented teacher preparation programs. Data for this study were obtained from the Investigating the Meaningfulness of Preservice Programs Across the Continuum of Teaching (IMPPACT) Project, a multi-university, longitudinal study funded by NSF. In the first quantitative phase of the study, data for the sample (N=120) were collected from three surveys from the IMPPACT Project database. Hierarchical multiple regression analysis was used to examine the separate as well as the combined influence of factors such as teachers' personal and professional background characteristics, beliefs about reform-based science teaching, feelings of preparedness to teach science, school context, school culture and climate of professional learning, and influences of the policy environment on the teachers' use of reform-based instructional practices. Findings indicate three blocks of variables, professional background, beliefs/efficacy, and local school context added significant contribution to explaining nearly 38% of the variation in secondary science teachers' use of reform-based instructional practices. The five variables that significantly contributed to explaining variation in teachers' use of reform-based instructional practices in the full model were, university of teacher preparation, sense of preparation for teaching science, the quality of professional development, science content focused professional, and the perceived level of professional autonomy. Using the results

  2. WASP (Wavelet Analysis of Secondary Particles Angular Distributions) package. Version 1.0. User's guide

    International Nuclear Information System (INIS)

    Solov'ev, A.G.

    2001-01-01

    WASP package is a C++ program aimed to analyze angular distributions of secondary particles generated in nuclear interactions. (WASP is designed for data analysis of the STAR and ALICE experiments). It uses a wavelet analysis for this purpose and the vanishing momentum or gaussian wavelets are chosen for transformations. WASP provides an user-friendly Graphical User Interface (GUI) which makes it quite simple to use. WASP design, a brief description of the used wavelet transformation algorithm and GUI are presented in this user's guide

  3. International variation in adherence to referral guidelines for suspected cancer: a secondary analysis of survey data

    Science.gov (United States)

    Nicholson, Brian D; Mant, David; Neal, Richard D; Hart, Nigel; Hamilton, Willie; Shinkins, Bethany; Rubin, Greg; Rose, Peter W

    2016-01-01

    Background Variation in cancer survival persists between comparable nations and appears to be due, in part, to primary care practitioners (PCPs) having different thresholds for acting definitively in response to cancer-related symptoms. Aim To explore whether cancer guidelines, and adherence to them, differ between jurisdictions and impacts on PCPs’ propensity to take definitive action on cancer-related symptoms. Design and setting A secondary analysis of survey data from six countries (10 jurisdictions) participating in the International Cancer Benchmarking Partnership. Method PCPs’ responses to five clinical vignettes presenting symptoms and signs of lung (n = 2), colorectal (n = 2), and ovarian cancer (n = 1) were compared with investigation and referral recommendations in cancer guidelines. Results Nine jurisdictions had guidelines covering the two colorectal vignettes. For the lung vignettes, although eight jurisdictions had guidelines for the first, the second was covered by a Swedish guideline alone. Only the UK and Denmark had an ovarian cancer guideline. Survey responses of 2795 PCPs (crude response rate: 12%) were analysed. Guideline adherence ranged from 20–82%. UK adherence was lower than other jurisdictions for the lung vignette covered by the guidance (47% versus 58%; P <0.01) but similar (45% versus 46%) or higher (67% versus 38%; P <0.01) for the two colorectal vignettes. PCPs took definitive action least often when a guideline recommended a non-definitive action or made no recommendation. UK PCPs adhered to recommendations for definitive action less than their counterparts (P <0.01). There wasno association between jurisdictional guideline adherence and 1-year survival. Conclusion Cancer guideline content is variable between similarly developed nations and poor guideline adherence does not explain differential survival. Guidelines that fail to cover high-risk presentations or that recommend non-definitive action may reduce definitive

  4. Medicine prices, availability, and affordability in 36 developing and middle-income countries: a secondary analysis.

    Science.gov (United States)

    Cameron, A; Ewen, M; Ross-Degnan, D; Ball, D; Laing, R

    2009-01-17

    WHO and Health Action International (HAI) have developed a standardised method for surveying medicine prices, availability, affordability, and price components in low-income and middle-income countries. Here, we present a secondary analysis of medicine availability in 45 national and subnational surveys done using the WHO/HAI methodology. Data from 45 WHO/HAI surveys in 36 countries were adjusted for inflation or deflation and purchasing power parity. International reference prices from open international procurements for generic products were used as comparators. Results are presented for 15 medicines included in at least 80% of surveys and four individual medicines. Average public sector availability of generic medicines ranged from 29.4% to 54.4% across WHO regions. Median government procurement prices for 15 generic medicines were 1.11 times corresponding international reference prices, although purchasing efficiency ranged from 0.09 to 5.37 times international reference prices. Low procurement prices did not always translate into low patient prices. Private sector patients paid 9-25 times international reference prices for lowest-priced generic products and over 20 times international reference prices for originator products across WHO regions. Treatments for acute and chronic illness were largely unaffordable in many countries. In the private sector, wholesale mark-ups ranged from 2% to 380%, whereas retail mark-ups ranged from 10% to 552%. In countries where value added tax was applied to medicines, the amount charged varied from 4% to 15%. Overall, public and private sector prices for originator and generic medicines were substantially higher than would be expected if purchasing and distribution were efficient and mark-ups were reasonable. Policy options such as promoting generic medicines and alternative financing mechanisms are needed to increase availability, reduce prices, and improve affordability.

  5. Earth analysis methods, subsurface feature detection methods, earth analysis devices, and articles of manufacture

    Science.gov (United States)

    West, Phillip B [Idaho Falls, ID; Novascone, Stephen R [Idaho Falls, ID; Wright, Jerry P [Idaho Falls, ID

    2011-09-27

    Earth analysis methods, subsurface feature detection methods, earth analysis devices, and articles of manufacture are described. According to one embodiment, an earth analysis method includes engaging a device with the earth, analyzing the earth in a single substantially lineal direction using the device during the engaging, and providing information regarding a subsurface feature of the earth using the analysis.

  6. Parametric Methods for Order Tracking Analysis

    DEFF Research Database (Denmark)

    Nielsen, Jesper Kjær; Jensen, Tobias Lindstrøm

    2017-01-01

    Order tracking analysis is often used to find the critical speeds at which structural resonances are excited by a rotating machine. Typically, order tracking analysis is performed via non-parametric methods. In this report, however, we demonstrate some of the advantages of using a parametric method...

  7. Analysis of unstable secondary particles produced in jet of 30 TeV energy sum

    International Nuclear Information System (INIS)

    Ogata, Takeshi

    1978-01-01

    High energy jet shower with energy sum of about 30 TeV has been obtained in the airplane-bone emulsion chamber. The size of the emulsion chamber was 20 cm x 25 cm x 12 cm. The airplane altitude was 260 g/cm 2 , and the exposure time was 600 hours. In this experiment, two jet events were found, and one of two events, KG-7, was the largest obtained so far. Three secondary charged particles produced by high energy interaction were analysed in detail. The analysis indicated that three charged particles seemed to be created by the decay of an unstable secondary particle. The lifetime of the unstable particle was estimated to be 10 -3 - 10 -14 sec, and this particle seems to be a charm particle. (Yoshimori, M.)

  8. Using secondary analysis of qualitative data of patient experiences of health care to inform health services research and policy.

    Science.gov (United States)

    Ziebland, Sue; Hunt, Kate

    2014-07-01

    Qualitative research is recognized as an important method for including patients' voices and experiences in health services research and policy-making, yet the considerable potential to analyse existing qualitative data to inform health policy and practice has been little realized. This failure may partly be explained by: a lack of awareness amongst health policy makers of the increasing wealth of qualitative data available; and around 15 years of internal debates among qualitative researchers on the strengths, limitations and validity of re-use of qualitative data. Whilst acknowledging the challenges of qualitative secondary data analysis, we argue that there is a growing imperative to be pragmatic and to undertake analysis of existing qualitative data collections where they have the potential to contribute to health policy formulation. Time pressures are inherent in the policy-making process and in many circumstances it is not possible to seek funding, conduct and analyse new qualitative studies of patients' experiences in time to inform a specific policy. The danger then is that the patient voice, and the experiences of relatives and carers, is either excluded or included in a way that is easily dismissed as 'unrepresentative'. We argue that secondary analysis of qualitative data collections may sometimes be an effective means to enable patient experiences to inform policy decision-making. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  9. Methods to induce primary and secondary traumatic damage in organotypic hippocampal slice cultures.

    Science.gov (United States)

    Adamchik, Y; Frantseva, M V; Weisspapir, M; Carlen, P L; Perez Velazquez, J L

    2000-04-01

    Organotypic brain slice cultures have been used in a variety of studies on neurodegenerative processes [K.M. Abdel-Hamid, M. Tymianski, Mechanisms and effects of intracellular calcium buffering on neuronal survival in organotypic hippocampal cultures exposed to anoxia/aglycemia or to excitotoxins, J. Neurosci. 17, 1997, pp. 3538-3553; D.W. Newell, A. Barth, V. Papermaster, A.T. Malouf, Glutamate and non-glutamate receptor mediated toxicity caused by oxygen and glucose deprivation in organotypic hippocampal cultures, J. Neurosci. 15, 1995, pp. 7702-7711; J.L. Perez Velazquez, M.V. Frantseva, P.L. Carlen, In vitro ischemia promotes glutamate mediated free radical generation and intracellular calcium accumulation in pyramidal neurons of cultured hippocampal slices, J. Neurosci. 23, 1997, pp. 9085-9094; L. Stoppini, L.A. Buchs, D. Muller, A simple method for organotypic cultures of nervous tissue, J. Neurosci. Methods 37, 1991, pp. 173-182; R.C. Tasker, J.T. Coyle, J.J. Vornov, The regional vulnerability to hypoglycemia induced neurotoxicity in organotypic hippocampal culture: protection by early tetrodotoxin or delayed MK 801, J. Neurosci. 12, 1992, pp. 4298-4308.]. We describe two methods to induce traumatic cell damage in hippocampal organotypic cultures. Primary trauma injury was achieved by rolling a stainless steel cylinder (0.9 g) on the organotypic slices. Secondary injury was followed after dropping a weight (0.137 g) on a localised area of the organotypic slice, from a height of 2 mm. The time course and extent of cell death were determined by measuring the fluorescence of the viability indicator propidium iodide (PI) at several time points after the injury. The initial localised impact damage spread 24 and 67 h after injury, cell death being 25% and 54%, respectively, when slices were kept at 37 degrees C. To validate these methods as models to assess neuroprotective strategies, similar insults were applied to slices at relatively low temperatures (30

  10. Multifunctional Collaborative Modeling and Analysis Methods in Engineering Science

    Science.gov (United States)

    Ransom, Jonathan B.; Broduer, Steve (Technical Monitor)

    2001-01-01

    Engineers are challenged to produce better designs in less time and for less cost. Hence, to investigate novel and revolutionary design concepts, accurate, high-fidelity results must be assimilated rapidly into the design, analysis, and simulation process. This assimilation should consider diverse mathematical modeling and multi-discipline interactions necessitated by concepts exploiting advanced materials and structures. Integrated high-fidelity methods with diverse engineering applications provide the enabling technologies to assimilate these high-fidelity, multi-disciplinary results rapidly at an early stage in the design. These integrated methods must be multifunctional, collaborative, and applicable to the general field of engineering science and mechanics. Multifunctional methodologies and analysis procedures are formulated for interfacing diverse subdomain idealizations including multi-fidelity modeling methods and multi-discipline analysis methods. These methods, based on the method of weighted residuals, ensure accurate compatibility of primary and secondary variables across the subdomain interfaces. Methods are developed using diverse mathematical modeling (i.e., finite difference and finite element methods) and multi-fidelity modeling among the subdomains. Several benchmark scalar-field and vector-field problems in engineering science are presented with extensions to multidisciplinary problems. Results for all problems presented are in overall good agreement with the exact analytical solution or the reference numerical solution. Based on the results, the integrated modeling approach using the finite element method for multi-fidelity discretization among the subdomains is identified as most robust. The multiple-method approach is advantageous when interfacing diverse disciplines in which each of the method's strengths are utilized. The multifunctional methodology presented provides an effective mechanism by which domains with diverse idealizations are

  11. The delayed neutron method of uranium analysis

    International Nuclear Information System (INIS)

    Wall, T.

    1989-01-01

    The technique of delayed neutron analysis (DNA) is discussed. The DNA rig installed on the MOATA reactor, the assay standards and the types of samples which have been assayed are described. Of the total sample throughput of about 55,000 units since the uranium analysis service began, some 78% has been concerned with analysis of uranium ore samples derived from mining and exploration. Delayed neutron analysis provides a high sensitivity, low cost uranium analysis method for both uranium exploration and other applications. It is particularly suitable for analysis of large batch samples and for non-destructive analysis over a wide range of matrices. 8 refs., 4 figs., 3 tabs

  12. Radiochemistry and nuclear methods of analysis

    International Nuclear Information System (INIS)

    Ehmann, W.D.; Vance, D.

    1991-01-01

    This book provides both the fundamentals of radiochemistry as well as specific applications of nuclear techniques to analytical chemistry. It includes such areas of application as radioimmunoassay and activation techniques using very short-lined indicator radionuclides. It emphasizes the current nuclear methods of analysis such as neutron activation PIXE, nuclear reaction analysis, Rutherford backscattering, isotope dilution analysis and others

  13. School Safety, Severe Disciplinary Actions, and School Characteristics: A Secondary Analysis of the School Survey on Crime and Safety

    Science.gov (United States)

    Han, Seunghee; Akiba, Motoko

    2011-01-01

    On the basis of a secondary analysis of survey data collected from 1,872 secondary school principals in the 2005-2006 School Survey on Crime and Safety, we examined the frequency of and reasons for severe disciplinary actions and the relationship between school characteristics and severe disciplinary actions. We found that severe disciplinary…

  14. Analysis of Measures for Attention to Diversity in Compulsory Secondary Education: The Case of the Region of Murcia, Spain

    Science.gov (United States)

    Arnaiz, Pilar; Martinez, Rogelio; de Haro, Remedios; Escarbajal, Andres

    2013-01-01

    In this paper, we present an analysis of the implementation of measures of attention to diversity for students with special educational support needs studying Compulsory Secondary Education (12-16 years) in the Region of Murcia, Spain. Our aim is to learn about the organisational and curricular structures implemented in five secondary education…

  15. Computational methods in power system analysis

    CERN Document Server

    Idema, Reijer

    2014-01-01

    This book treats state-of-the-art computational methods for power flow studies and contingency analysis. In the first part the authors present the relevant computational methods and mathematical concepts. In the second part, power flow and contingency analysis are treated. Furthermore, traditional methods to solve such problems are compared to modern solvers, developed using the knowledge of the first part of the book. Finally, these solvers are analyzed both theoretically and experimentally, clearly showing the benefits of the modern approach.

  16. Constructing an Intelligent Patent Network Analysis Method

    Directory of Open Access Journals (Sweden)

    Chao-Chan Wu

    2012-11-01

    Full Text Available Patent network analysis, an advanced method of patent analysis, is a useful tool for technology management. This method visually displays all the relationships among the patents and enables the analysts to intuitively comprehend the overview of a set of patents in the field of the technology being studied. Although patent network analysis possesses relative advantages different from traditional methods of patent analysis, it is subject to several crucial limitations. To overcome the drawbacks of the current method, this study proposes a novel patent analysis method, called the intelligent patent network analysis method, to make a visual network with great precision. Based on artificial intelligence techniques, the proposed method provides an automated procedure for searching patent documents, extracting patent keywords, and determining the weight of each patent keyword in order to generate a sophisticated visualization of the patent network. This study proposes a detailed procedure for generating an intelligent patent network that is helpful for improving the efficiency and quality of patent analysis. Furthermore, patents in the field of Carbon Nanotube Backlight Unit (CNT-BLU were analyzed to verify the utility of the proposed method.

  17. Sustainability of outdoor school ground smoking bans at secondary schools : A mixed-method study

    NARCIS (Netherlands)

    Rozema, A. D.; Mathijssen, J. J. P.; Jansen, M. W. J.; Van Oers, J. A. M.

    2017-01-01

    Although increasing numbers of countries are implementing outdoor school ground smoking bans at secondary schools, less attention is paid to the post-implementation period even though sustainability of a policy is essential for long-term effectiveness. Therefore, this study assesses the level of

  18. Developing and Validating a Competence Framework for Secondary Mathematics Student Teachers through a Delphi Method

    Science.gov (United States)

    Muñiz-Rodríguez, Laura; Alonso, Pedro; Rodríguez-Muñiz, Luis J.; Valcke, Martin

    2017-01-01

    Initial teacher education programmes provide student teachers with the desired competences to develop themselves as teachers. Although a generic framework for teaching competences is available covering all school subjects in Spain, the initial teacher education programmes curriculum does not specify which competences secondary mathematics student…

  19. Text analysis methods, text analysis apparatuses, and articles of manufacture

    Science.gov (United States)

    Whitney, Paul D; Willse, Alan R; Lopresti, Charles A; White, Amanda M

    2014-10-28

    Text analysis methods, text analysis apparatuses, and articles of manufacture are described according to some aspects. In one aspect, a text analysis method includes accessing information indicative of data content of a collection of text comprising a plurality of different topics, using a computing device, analyzing the information indicative of the data content, and using results of the analysis, identifying a presence of a new topic in the collection of text.

  20. Nuclear analysis methods. Rudiments of radiation protection

    International Nuclear Information System (INIS)

    Roth, E.

    1998-01-01

    The nuclear analysis methods are generally used to analyse radioactive elements but they can be used also for chemical analysis, with fields such analysis and characterization of traces. The principles of radiation protection are explained (ALARA), the biological effects of ionizing radiations are given, elements and units used in radiation protection are reminded in tables. A part of this article is devoted to how to use radiation protection in a nuclear analysis laboratory. (N.C.)

  1. IEA-R1 primary and secondary coolant piping systems coupled stress analysis

    International Nuclear Information System (INIS)

    Fainer, Gerson; Faloppa, Altair A.; Oliveira, Carlos A.; Mattar Neto, Miguel

    2013-01-01

    The aim of this work is to perform the stress analysis of a coupled primary and secondary piping system of the IEA-R1 based on tridimensional model, taking into account the as built conditions. The nuclear research reactor IEA-R1 is a pool type reactor projected by Babcox-Willcox, which is operated by IPEN since 1957. The operation to 5 MW power limit was only possible after the conduction of life management and modernization programs in the last two decades. In these programs the components of the coolant systems, which are responsible for the water circulation into the reactor core to remove the heat generated inside it, were almost totally refurbished. The changes in the primary and secondary systems, mainly the replacement of pump and heat-exchanger, implied in piping layout modifications, and, therefore, the stress condition of the piping systems had to be reanalyzed. In this paper the structural stress assessment of the coupled primary and secondary piping systems is presented and the final results are discussed. (author)

  2. Pharmacoepidemiological analysis of the drugs used for secondary prevention of brain infarction on dispensary stage

    Directory of Open Access Journals (Sweden)

    Miheyeva N.V.

    2014-03-01

    Full Text Available Aim. The secondary prevention of cerebral infarction on dispensary stage to current clinical guidelines was analyzed. Adherence of patients to prescribe medications was evaluated. Material and methods. 106 patients of hospital neurologic department with brain infarction were included in prospective pharmacoepidemiological study of the drugs used for secondary prevention of brain infarction on dispensary stage since 1 January 2009 to 31 December 2009. Duration of outpatient observation was 3 years. Results. All of the patients were of 64,9 ± 10,3 years old. Hypertension was diagnosed in 102 of them (96.2%, atrial fibrillation — in 33 (31.1% patients. 39 (36.8% patients died during 3 years after discharge from the hospital. ACE inhibitors/angiotensin II receptor antagonist were prescribed for 83 (78.3% patients, antiplatelet- 76 (71,7%, statins — 16 (15,1% patients in discharge from hospital. Warfarin was prescribed only for 1 (3.05% patient with atrial fibrillation and ischemic stroke.consumption of drugs with evidence efficiency were diminished already after one year of observation in outpatient clinics. Conclusion.Therapy for secondary stroke prevention is not fully comply with current clinical guidelines

  3. An efficient method for the prediction of deleterious multiple-point mutations in the secondary structure of RNAs using suboptimal folding solutions

    Directory of Open Access Journals (Sweden)

    Barash Danny

    2008-04-01

    Full Text Available Abstract Background RNAmute is an interactive Java application which, given an RNA sequence, calculates the secondary structure of all single point mutations and organizes them into categories according to their similarity to the predicted structure of the wild type. The secondary structure predictions are performed using the Vienna RNA package. A more efficient implementation of RNAmute is needed, however, to extend from the case of single point mutations to the general case of multiple point mutations, which may often be desired for computational predictions alongside mutagenesis experiments. But analyzing multiple point mutations, a process that requires traversing all possible mutations, becomes highly expensive since the running time is O(nm for a sequence of length n with m-point mutations. Using Vienna's RNAsubopt, we present a method that selects only those mutations, based on stability considerations, which are likely to be conformational rearranging. The approach is best examined using the dot plot representation for RNA secondary structure. Results Using RNAsubopt, the suboptimal solutions for a given wild-type sequence are calculated once. Then, specific mutations are selected that are most likely to cause a conformational rearrangement. For an RNA sequence of about 100 nts and 3-point mutations (n = 100, m = 3, for example, the proposed method reduces the running time from several hours or even days to several minutes, thus enabling the practical application of RNAmute to the analysis of multiple-point mutations. Conclusion A highly efficient addition to RNAmute that is as user friendly as the original application but that facilitates the practical analysis of multiple-point mutations is presented. Such an extension can now be exploited prior to site-directed mutagenesis experiments by virologists, for example, who investigate the change of function in an RNA virus via mutations that disrupt important motifs in its secondary

  4. Small-Signal Analysis of the Microgrid Secondary Control Considering a Communication Time Delay

    DEFF Research Database (Denmark)

    Coelho, Ernane Antônio Alves; Wu, Dan; Guerrero, Josep M.

    2016-01-01

    This paper presents a small-signal analysis of an islanded microgrid composed of two or more voltage-source inverters connected in parallel. The primary control of each inverter is integrated through an internal current and voltage loops using proportional resonant compensators, a virtual impedance......, and an external power controller based on frequency and voltage droops. The frequency restoration function is implemented at the secondary control level, which executes a consensus algorithm that consists of a load-frequency control and a single time delay communication network. The consensus network consists...... the behavior of the system considering control parameters and time delay variation....

  5. Experience of emotion in frail older people towards the end of life: A secondary data analysis.

    Science.gov (United States)

    Findlay, Caitlin; Lloyd, Anna; Finucane, Anne M

    2017-12-02

    People are living longer, but with increased age comes greater frailty and multi-morbidity. This secondary data analysis examines transcripts from interviews with 11 frail older people and 6 informal carers to explore emotion in relation to frailty and deteriorating health. Anger and frustration were frequently experienced with declining functional ability; sadness occurred with social isolation, loss of autonomy and independence; anxiety was evident when transition to a care home was discussed; and contentment was described when connecting with others. Reluctant acceptance emerged as a coping strategy. Insights gained from analysing emotion may inform communications training courses for community nurses, though further research is required.

  6. Differential network analysis reveals evolutionary complexity in secondary metabolism of Rauvolfia serpentina over Catharanthus roseus

    Directory of Open Access Journals (Sweden)

    Shivalika Pathania

    2016-08-01

    Full Text Available Comparative co-expression analysis of multiple species using high-throughput data is an integrative approach to determine the uniformity as well as diversification in biological processes. Rauvolfia serpentina and Catharanthus roseus, both members of Apocyanacae family, are reported to have remedial properties against multiple diseases. Despite of sharing upstream of terpenoid indole alkaloid pathway, there is significant diversity in tissue-specific synthesis and accumulation of specialized metabolites in these plants. This led us to implement comparative co-expression network analysis to investigate the modules and genes responsible for differential tissue-specific expression as well as species-specific synthesis of metabolites. Towards these goals differential network analysis was implemented to identify candidate genes responsible for diversification of metabolites profile. Three genes were identified with significant difference in connectivity leading to differential regulatory behavior between these plants. These mechanisms may be responsible for diversification of secondary metabolism, and thereby for species-specific metabolite synthesis. The network robustness of R. serpentina, determined based on topological properties, was also complemented by comparison of gene-metabolite networks of both plants, and may have evolved to have complex metabolic mechanisms as compared to C. roseus under the influence of various stimuli. This study reveals evolution of complexity in secondary metabolism of Rauvolfia serpentina, and key genes that contribute towards diversification of specific metabolites.

  7. Differential Network Analysis Reveals Evolutionary Complexity in Secondary Metabolism of Rauvolfia serpentina over Catharanthus roseus.

    Science.gov (United States)

    Pathania, Shivalika; Bagler, Ganesh; Ahuja, Paramvir S

    2016-01-01

    Comparative co-expression analysis of multiple species using high-throughput data is an integrative approach to determine the uniformity as well as diversification in biological processes. Rauvolfia serpentina and Catharanthus roseus, both members of Apocyanacae family, are reported to have remedial properties against multiple diseases. Despite of sharing upstream of terpenoid indole alkaloid pathway, there is significant diversity in tissue-specific synthesis and accumulation of specialized metabolites in these plants. This led us to implement comparative co-expression network analysis to investigate the modules and genes responsible for differential tissue-specific expression as well as species-specific synthesis of metabolites. Toward these goals differential network analysis was implemented to identify candidate genes responsible for diversification of metabolites profile. Three genes were identified with significant difference in connectivity leading to differential regulatory behavior between these plants. These genes may be responsible for diversification of secondary metabolism, and thereby for species-specific metabolite synthesis. The network robustness of R. serpentina, determined based on topological properties, was also complemented by comparison of gene-metabolite networks of both plants, and may have evolved to have complex metabolic mechanisms as compared to C. roseus under the influence of various stimuli. This study reveals evolution of complexity in secondary metabolism of R. serpentina, and key genes that contribute toward diversification of specific metabolites.

  8. Comprehensive neutron cross-section and secondary energy distribution uncertainty analysis for a fusion reactor

    International Nuclear Information System (INIS)

    Gerstl, S.A.W.; LaBauve, R.J.; Young, P.G.

    1980-05-01

    On the example of General Atomic's well-documented Power Generating Fusion Reactor (PGFR) design, this report exercises a comprehensive neutron cross-section and secondary energy distribution (SED) uncertainty analysis. The LASL sensitivity and uncertainty analysis code SENSIT is used to calculate reaction cross-section sensitivity profiles and integral SED sensitivity coefficients. These are then folded with covariance matrices and integral SED uncertainties to obtain the resulting uncertainties of three calculated neutronics design parameters: two critical radiation damage rates and a nuclear heating rate. The report documents the first sensitivity-based data uncertainty analysis, which incorporates a quantitative treatment of the effects of SED uncertainties. The results demonstrate quantitatively that the ENDF/B-V cross-section data files for C, H, and O, including their SED data, are fully adequate for this design application, while the data for Fe and Ni are at best marginally adequate because they give rise to response uncertainties up to 25%. Much higher response uncertainties are caused by cross-section and SED data uncertainties in Cu (26 to 45%), tungsten (24 to 54%), and Cr (up to 98%). Specific recommendations are given for re-evaluations of certain reaction cross-sections, secondary energy distributions, and uncertainty estimates

  9. ANALYSIS OF THE SECONDARY CURVES IN PATIENTS UNDERGOING SELECTIVE ARTHRODESIS LENKE I

    Directory of Open Access Journals (Sweden)

    TADEU GERVAZONI DEBOM

    2015-12-01

    Full Text Available Objective : To radiographically evaluate the behavior of the secondary curves in the coronal and sagittal planes in patients with AIS classified as Lenke I, who underwent surgical treatment of selective arthrodesis by posterior approach. Methods : Retrospective study which analyzed 40 patients with AIS, being 33 female. The measurement of the radiographic parameters used followed the recommendations by Cobb. Results : The average correction of the thoracic proximal, primary and lumbar curves was 34.73%, 75.06% and 64.64%, respectively. Conclusion : Surgical treatment by selective arthrodesis in cases of AIS Lenke type I provide correction of compensatory curves in the coronal and maintenance in the sagittal plane.

  10. Calculation of primary and secondary dose in proton therapy of brain tumors using Monte Carlo method

    International Nuclear Information System (INIS)

    Moghbel Esfahani, F.; Alamatsaz, M.; Karimian, A.

    2012-01-01

    High-energy beams of protons offer significant advantages for the treatment of deep-seated local tumors. Their physical depth-dose distribution in tissue is characterized by a small entrance dose and a distinct maximum - Bragg peak - near the end of range with a sharp falloff at the distal edge. Therefore, research must be done to investigate the possible negative and positive effects of using proton therapy as a treatment modality. In proton therapy, protons do account for the vast majority of dose. However, when protons travel through matter, secondary particles are created by the interactions of protons and matter en route to and within the patient. It is believed that secondary dose can lead to secondary cancer, especially in pediatric cases. Therefore, the focus of this work is determining both primary and secondary dose. Dose calculations were performed by MCNPX in tumoral and healthy parts of brain. The brain tumor has a 10 mm diameter and is located 16 cm under the skin surface. The brain was simulated by a cylindrical water phantom with the dimensions of 19 x 19cm 2 (length x diameter), with 0.5 cm thickness of plexiglass (C 4 H 6 O 2 ). Then beam characteristics were investigated to ensure the accuracy of the model. Simulations were initially validated with against packages such as SRIM/TRIM. Dose calculations were performed using different configurations to evaluate depth-dose profiles and dose 2D distributions.The results of the simulation show that the best proton energy interval, to cover completely the brain tumor, is from 152 to 154 MeV. (authors)

  11. Microlocal methods in the analysis of the boundary element method

    DEFF Research Database (Denmark)

    Pedersen, Michael

    1993-01-01

    The application of the boundary element method in numerical analysis is based upon the use of boundary integral operators stemming from multiple layer potentials. The regularity properties of these operators are vital in the development of boundary integral equations and error estimates. We show...

  12. Statistical methods for categorical data analysis

    CERN Document Server

    Powers, Daniel

    2008-01-01

    This book provides a comprehensive introduction to methods and models for categorical data analysis and their applications in social science research. Companion website also available, at https://webspace.utexas.edu/dpowers/www/

  13. Development of Ultraviolet Spectrophotometric Method for Analysis ...

    African Journals Online (AJOL)

    HP

    Method for Analysis of Lornoxicam in Solid Dosage. Forms. Sunit Kumar Sahoo ... testing. Mean recovery was 100.82 % for tablets. Low values of % RSD indicate .... Saharty E, Refaat YS, Khateeb ME. Stability-. Indicating. Spectrophotometric.

  14. Direct surface analysis of pesticides on soil, leaves, grass, and stainless steel by static secondary ion mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Ingram, J.C.; Groenewold, G.S.; Appelhans, A.D.; Delmore, J.E.; Olson, J.E.; Miller, D.L. [Idaho National Engineering Lab., Idaho Falls, ID (United States)

    1997-02-01

    Direct surface analyses by static secondary ion mass spectrometry (SIMS) were performed for the following pesticides adsorbed on dandelion leaves, grass, soil, and stainless steel samples: alachlor, atrazine, captan, carbofuran, chlorpyrifos, chlorosulfuron, chlorthal-dimethyl, cypermethrin, 2,4-D, diuron, glyphosate, malathion, methomyl, methyl arsonic acid, mocap, norflurazon, oxyfluorfen, paraquat, temik, and trifluralin. The purpose of this study was to evaluate static SIMS as a tool for pesticide analysis, principally for use in screening samples for pesticides. The advantage of direct surface analysis compared with conventional pesticide analysis methods is the elimination of sample pretreatment including extraction, which streamlines the analysis substantially; total analysis time for SIMS analysis was ca. 10 min/sample. Detection of 16 of the 20 pesticides on all four substrates was achieved. Of the remaining four pesticides, only one (trifluralin) was not detected on any of the samples. The minimum detectable quantity was determined for paraquat on soil in order to evaluate the efficacy of using SIMS as a screening tool. Paraquat was detected at 3 pg/mm{sup 2} (c.a. 0.005 monolayers). The results of these studies suggest that SIMS is capable of direct surface detection of a range of pesticides, with low volatility, polar pesticides being the most easily detected. 25 refs., 2 figs., 2 tabs.

  15. An introduction to numerical methods and analysis

    CERN Document Server

    Epperson, James F

    2013-01-01

    Praise for the First Edition "". . . outstandingly appealing with regard to its style, contents, considerations of requirements of practice, choice of examples, and exercises.""-Zentralblatt MATH "". . . carefully structured with many detailed worked examples.""-The Mathematical Gazette The Second Edition of the highly regarded An Introduction to Numerical Methods and Analysis provides a fully revised guide to numerical approximation. The book continues to be accessible and expertly guides readers through the many available techniques of numerical methods and analysis. An Introduction to

  16. A comparative study of conventional and supercritical fluid extraction methods for the recovery of secondary metabolites from Syzygium campanulatum Korth#

    Science.gov (United States)

    Memon, Abdul Hakeem; Hamil, Mohammad Shahrul Ridzuan; Laghari, Madeeha; Rithwan, Fahim; Zhari, Salman; Saeed, Mohammed Ali Ahmed; Ismail, Zhari; Majid, Amin Malik Shah Abdul

    2016-01-01

    Syzygium campanulatum Korth is a plant, which is a rich source of secondary metabolites (especially flavanones, chalcone, and triterpenoids). In our present study, three conventional solvent extraction (CSE) techniques and supercritical fluid extraction (SFE) techniques were performed to achieve a maximum recovery of two flavanones, chalcone, and two triterpenoids from S. campanulatum leaves. Furthermore, a Box-Behnken design was constructed for the SFE technique using pressure, temperature, and particle size as independent variables, and yields of crude extract, individual and total secondary metabolites as the dependent variables. In the CSE procedure, twenty extracts were produced using ten different solvents and three techniques (maceration, soxhletion, and reflux). An enriched extract of five secondary metabolites was collected using n-hexane:methanol (1:1) soxhletion. Using food-grade ethanol as a modifier, the SFE methods produced a higher recovery (25.5%‒84.9%) of selected secondary metabolites as compared to the CSE techniques (0.92%‒66.00%). PMID:27604860

  17. A comparative study of conventional and supercritical fluid extraction methods for the recovery of secondary metabolites from Syzygium campanulatum Korth.

    Science.gov (United States)

    Memon, Abdul Hakeem; Hamil, Mohammad Shahrul Ridzuan; Laghari, Madeeha; Rithwan, Fahim; Zhari, Salman; Saeed, Mohammed Ali Ahmed; Ismail, Zhari; Majid, Amin Malik Shah Abdul

    2016-09-01

    Syzygium campanulatum Korth is a plant, which is a rich source of secondary metabolites (especially flavanones, chalcone, and triterpenoids). In our present study, three conventional solvent extraction (CSE) techniques and supercritical fluid extraction (SFE) techniques were performed to achieve a maximum recovery of two flavanones, chalcone, and two triterpenoids from S. campanulatum leaves. Furthermore, a Box-Behnken design was constructed for the SFE technique using pressure, temperature, and particle size as independent variables, and yields of crude extract, individual and total secondary metabolites as the dependent variables. In the CSE procedure, twenty extracts were produced using ten different solvents and three techniques (maceration, soxhletion, and reflux). An enriched extract of five secondary metabolites was collected using n-hexane:methanol (1:1) soxhletion. Using food-grade ethanol as a modifier, the SFE methods produced a higher recovery (25.5%‒84.9%) of selected secondary metabolites as compared to the CSE techniques (0.92%‒66.00%).

  18. Investigation of the spray characteristics for a secondary fuel injection nozzle using a digital image processing method

    Science.gov (United States)

    Jeong, Haeyoung; Lee, Kihyung; Ikeda, Yuji

    2007-05-01

    There are many ways to reduce diesel engine exhaust emissions. However, NOx emission is difficult to reduce because the hydrocarbon (HC) concentration in a diesel engine is not sufficient for NOx conversion. Therefore, in order to create stoichiometric conditions in the De-NOx catalyst, a secondary injection system is designed to inject liquid HC into the exhaust pipe. The atomization and distribution characteristics of the HC injected from a secondary injector are key technologies to obtain a high NOx conversion because inhomogeneous droplets of injected HC cause not only high fuel consumption but also deterioration of NOx emission. This paper describes the spray characteristics of a secondary injector including the spray angle, penetration length and breakup behaviour of the spray to optimize the reduction rate of the NOx catalyst. In this study, various optical diagnostics were applied to investigate these spray characteristics, the atomization mechanism and spray developing process. The visualization and image processing method for the spray pulsation were developed by high speed photography. The influence of the fuel supply pressure on the spray behaviour and a more detailed spray developing process have been analysed experimentally using image processing. Finally, the experimental results were used to correlate the spray structure to the injection system performance and to provide a design guide for a secondary injector nozzle.

  19. Hypothesis analysis methods, hypothesis analysis devices, and articles of manufacture

    Science.gov (United States)

    Sanfilippo, Antonio P [Richland, WA; Cowell, Andrew J [Kennewick, WA; Gregory, Michelle L [Richland, WA; Baddeley, Robert L [Richland, WA; Paulson, Patrick R [Pasco, WA; Tratz, Stephen C [Richland, WA; Hohimer, Ryan E [West Richland, WA

    2012-03-20

    Hypothesis analysis methods, hypothesis analysis devices, and articles of manufacture are described according to some aspects. In one aspect, a hypothesis analysis method includes providing a hypothesis, providing an indicator which at least one of supports and refutes the hypothesis, using the indicator, associating evidence with the hypothesis, weighting the association of the evidence with the hypothesis, and using the weighting, providing information regarding the accuracy of the hypothesis.

  20. Meta-Analysis for Primary and Secondary Data Analysis: The Super-Experiment Metaphor.

    Science.gov (United States)

    Jackson, Sally

    1991-01-01

    Considers the relation between meta-analysis statistics and analysis of variance statistics. Discusses advantages and disadvantages as a primary data analysis tool. Argues that the two approaches are partial paraphrases of one another. Advocates an integrative approach that introduces the best of meta-analytic thinking into primary analysis…

  1. Secondary Use and Analysis of Big Data Collected for Patient Care.

    Science.gov (United States)

    Martin-Sanchez, F J; Aguiar-Pulido, V; Lopez-Campos, G H; Peek, N; Sacchi, L

    2017-08-01

    Objectives: To identify common methodological challenges and review relevant initiatives related to the re-use of patient data collected in routine clinical care, as well as to analyze the economic benefits derived from the secondary use of this data. Through the use of several examples, this article aims to provide a glimpse into the different areas of application, namely clinical research, genomic research, study of environmental factors, and population and health services research. This paper describes some of the informatics methods and Big Data resources developed in this context, such as electronic phenotyping, clinical research networks, biorepositories, screening data banks, and wide association studies. Lastly, some of the potential limitations of these approaches are discussed, focusing on confounding factors and data quality. Methods: A series of literature searches in main bibliographic databases have been conducted in order to assess the extent to which existing patient data has been repurposed for research. This contribution from the IMIA working group on "Data mining and Big Data analytics" focuses on the literature published during the last two years, covering the timeframe since the working group's last survey. Results and Conclusions: Although most of the examples of secondary use of patient data lie in the arena of clinical and health services research, we have started to witness other important applications, particularly in the area of genomic research and the study of health effects of environmental factors. Further research is needed to characterize the economic impact of secondary use across the broad spectrum of translational research. Georg Thieme Verlag KG Stuttgart.

  2. Comparison of Classic vs. Role plays Teaching Methods on the Menstrual Hygiene Behavior of Secondary School Girls in Iran

    Directory of Open Access Journals (Sweden)

    R Ostovar

    2013-09-01

    Background & aim: Awareness about the different aspects of health during puberty plays an important role in the health of girls and finally on their health future pregnancy. The aim of the present study was to to compare the effect of role playing and classical training methods in the the improvement of puberty health among secondary school girls in Yasouj City, Iran. Methods: In this study, the educational need during puberty school girls in the interview was determined. The two schools girls were randomly selected (students any school-60. Next, a knowledge and attitude questionnaire and a behavior checklist related to the main puberty health problems were completed. Then one of the schools randomly was selected as educational interventions schools and other were studied as controls. After grouping the students into four groups of 15, intervention were conducted in four sessions including: role-play, question and answer, and lecture. In the control group, all number of school students received training on puberty health through a classical education (lectures. The results were subsequently compared. Data were analyzed by Student t-test paired t-test, and analysis of variance. Results: The results of this study showed that the level of knowledge, attitude and behavior related to health matters during puberty showed significant improvement in the girls before and after implementation of educational intervention through role play (p<0.05.Thus, the mean score in group role play before intervention was 2.35±1.53 and after was 3.96±1.27 , The mean performance score before intervention 6.04±2.34 and after was, 8.61±1.55, respectively, while in classical group differences were not statistically significant (p<0.05 Conclusion: In comparison with the classical method of health education, teaching through role play significantly improved the level of knowledge, attitude and practice related to puberty health among adolescent girls. Key Words: Education, Adolescent Girls

  3. Relating Actor Analysis Methods to Policy Problems

    NARCIS (Netherlands)

    Van der Lei, T.E.

    2009-01-01

    For a policy analyst the policy problem is the starting point for the policy analysis process. During this process the policy analyst structures the policy problem and makes a choice for an appropriate set of methods or techniques to analyze the problem (Goeller 1984). The methods of the policy

  4. Understanding avoidant leadership in health care: findings from a secondary analysis of two qualitative studies.

    Science.gov (United States)

    Jackson, Debra; Hutchinson, Marie; Peters, Kath; Luck, Lauretta; Saltman, Deborah

    2013-04-01

    To illuminate ways that avoidant leadership can be enacted in contemporary clinical settings. Avoidance is identified in relation to laissez-faire leadership and passive avoidant leadership. However, the nature and characteristics of avoidance and how it can be enacted in a clinical environment are not detailed. This paper applied secondary analysis to data from two qualitative studies. We have identified three forms of avoidant leader response: placating avoidance, where leaders affirmed concerns but abstained from action; equivocal avoidance, where leaders were ambivalent in their response; and hostile avoidance, where the failure of leaders to address concerns escalated hostility towards the complainant. Through secondary analysis of two existing sets of data, we have shed new light on avoidant leaderships and how it can be enacted in contemporary clinical settings. Further work needs to be undertaken to better understand this leadership style. We recommend that organizations ensure that all nurse leaders are aware of how best to respond to concerns of wrongdoing and that mechanisms are created to ensure timely feedback is provided about the actions taken. © 2012 Blackwell Publishing Ltd.

  5. Migration of Lebanese nurses: a questionnaire survey and secondary data analysis.

    Science.gov (United States)

    El-Jardali, Fadi; Dumit, Nuhad; Jamal, Diana; Mouro, Gladys

    2008-10-01

    Nursing is becoming a mobile profession. Nurse migration is multifactorial and not limited to financial incentives. Non-economic factors that might lead to migration include poor recruitment and retention strategies, poor job satisfaction and working conditions, socio-political and economic stability, and the poor social image of the nursing profession. Lebanon is facing a problem of excessive nurse migration to countries of the Gulf, North America and Europe. No study has been conducted to understand the determinants and magnitude of the problem. The objective of this study is to provide an evidence base for understanding the incidence of nurse migration out of Lebanon, its magnitude and reasons. A cross-sectional research design comprising both quantitative and qualitative methods was employed to achieve the stated objectives. This includes a survey of nursing schools in Lebanon, survey of nurse recruitment agencies, secondary data analysis and survey of migrant nurses. An estimated one in five nurses that receive a bachelors of science in nursing migrates out of Lebanon within 1 or 2 years of graduation. The majority of nurses migrate to countries of the Gulf. The main reasons for migration included: shift work, high patient/nurse ratios, lack of autonomy in decision-making, lack of a supportive environment, and poor commitment to excellent nursing care. Further, nurses reported that combinations of financial and non-financial incentives can encourage them to return to practice in Lebanon. The most recurring incentives (pull factors) to encourage nurses to return to practice in Lebanon included educational support, managerial support, better working conditions, utilization of best nursing practices and autonomy. Nurse migration and retention have become major health workforce issues confronting many health systems in the East Mediterranean Region. Our study demonstrated that nurse migration is a product of poor management and lack of effective retention

  6. Nodal method for fast reactor analysis

    International Nuclear Information System (INIS)

    Shober, R.A.

    1979-01-01

    In this paper, a nodal method applicable to fast reactor diffusion theory analysis has been developed. This method has been shown to be accurate and efficient in comparison to highly optimized finite difference techniques. The use of an analytic solution to the diffusion equation as a means of determining accurate coupling relationships between nodes has been shown to be highly accurate and efficient in specific two-group applications, as well as in the current multigroup method

  7. Relationships Among Teacher Preparedness and Instructional Approaches to Secondary Student Achievement in STEM: A Secondary Analysis of TIMSS Data

    Science.gov (United States)

    Miller-Ricks, Karen A.

    Educational reform efforts in Science, Technology, Engineering, Math (STEM) place emphasis on teachers as conduits for student achievement. The purpose of this study was to use TIMSS 2011 data to examine relationships between Science-Technology-Society (STS) instructional practices (student-centered instruction established to promote learning through real-world applications) teacher preparedness, and student achievement and identify variations of achievement between and among eighth-grade science and math classes. The research was framed by both Harper's Anti-Deficit Achievement Theory and Bronfenbrenner's Ecological Systems Theory (BEST). 501 U.S. schools contributed to the TIMSS 2011 data from both the teacher questionnaires and student booklets. Chi-Square, Spearman Correlation, and 2-level hierarchical linear modeling (HLM) were used to analyze data about teachers' preparedness to teach science and math, frequency of using STS instructional practices, and student achievement. The chi-square null hypothesis for math teachers was rejected, providing the assumption that there was an association between the frequency of using STS instruction in math and teacher preparedness. However, the chi-square null hypothesis for science teachers failed to be rejected, providing the assumption that there was no significant association between the frequency of using STS instruction in science and science teacher preparedness. The Spearman Correlation revealed statistically positively significant differences between STS instruction and science achievement, as well as between teacher preparedness and science achievement. The HLM results suggested that 33% of the variance of mathematics achievement was at the individual level and 66% was at the group level. The results for science teachers suggested that 54% of the variance of science achievement was at the individual level and 46% of the variance was at the group level. The data findings support the conclusion that secondary STEM

  8. Inelastic analysis methods for piping systems

    International Nuclear Information System (INIS)

    Boyle, J.T.; Spence, J.

    1980-01-01

    The analysis of pipework systems which operate in an environment where local inelastic strains are evident is one of the most demanding problems facing the stress analyst in the nuclear field. The spatial complexity of even the most modest system makes a detailed analysis using finite element techniques beyond the scope of current computer technology. For this reason the emphasis has been on simplified methods. It is the aim of this paper to provide a reasonably complete, state-of-the-art review of inelastic pipework analysis methods and to attempt to highlight areas where reliable information is lacking and further work is needed. (orig.)

  9. Alkalisation agent measurement with differential conductivity method in secondary water system

    International Nuclear Information System (INIS)

    Wuhrmann, Peter; Lendi, Marco

    2012-09-01

    Besides ammonia hydroxide, also morpholine and ethanol-amine (ETA) are mainly used as a pH regulating agent on the secondary water side [1]. The concentration of the alkalisation agent can only be calculated if the chemical composition in the sample is known [2]. Therefore, for a reliable alkalisation agent measurement, there are three major steps to take: A reliable specific and (degassed) acid conductivity measurement, pH calculation and the selection of the chemical model for concentration calculation of the alkalisation agent (authors)

  10. Excitation methods for energy dispersive analysis

    International Nuclear Information System (INIS)

    Jaklevic, J.M.

    1976-01-01

    The rapid development in recent years of energy dispersive x-ray fluorescence analysis has been based primarily on improvements in semiconductor detector x-ray spectrometers. However, the whole analysis system performance is critically dependent on the availability of optimum methods of excitation for the characteristic x rays in specimens. A number of analysis facilities based on various methods of excitation have been developed over the past few years. A discussion is given of the features of various excitation methods including charged particles, monochromatic photons, and broad-energy band photons. The effects of the excitation method on background and sensitivity are discussed from both theoretical and experimental viewpoints. Recent developments such as pulsed excitation and polarized photons are also discussed

  11. Analysis of trace elements by means of accelerator secondary ion mass spectrometry

    International Nuclear Information System (INIS)

    Ender, R.M.

    1997-01-01

    The analysis of material composition and trace element concentration is of increasing interest primarily in semiconductor technology but also in metallurgy, geology, biology and medicine. At present, Secondary Ion Mass Spectrometry (SIMS) is in many respects the best technique to provide 3-dimensional information on the distribution of trace elements with concentrations below 1 ppm. However, due to the presence of molecular ions the detectability of many trace elements it restricted because of molecular mass interferences. In addition, detectors used in SIMS have a background counting rate of 0.1-1 Hz, which further limits trace element analysis. In Accelerator Mass Spectrometry (AMS) long-lived radionuclides are detected free of molecular interferences and detector background at isotopic ratios as low as 10 -15 . Moreover, isobaric interferences can be reduced as well. In order to benefit from these advantages a combination of SIMS and AMS (Accelerator SIMS) has been proposed almost 20 years ago, but no facility has ever been fully developed. It has been the aim of this work to add a new sputtering chamber for AMS measurements of ultrapure semiconductor material to the existing PSI/ETH AMS facility. To fulfill the requirements of material analysis, an UHV chamber with special precautions against contamination has been built and adapted to the existing AMS setup. For sputtering, a commercial Cs gun with an ExB filter and a 1 o beam bend for neutral particle suppression is used to obtain a pure Cs ion beam. The gun is equipped with different apertures for varying the diameter of the beam spot. With the integrated scanning unit the 10 keV Cs beam can be rastered over approximately 1 mm 2 . This allows different applications such as bulk analysis, depth profiling and imaging. The secondary ion extraction is matched to the ion optical and geometrical requirements of the existing accelerator mass spectrometer. (author) figs., tabs., 67 refs

  12. EFFECTS OF TWO METHODS OF INSTRUCTION ON STUDENTS’ CRITICAL RESPONSE TO PROSE LITERATURE TEXT IN ENGLISH IN SOME SECONDARY SCHOOLS IN BENIN CITY

    Directory of Open Access Journals (Sweden)

    F. O. EZEOKOLI

    2016-08-01

    Full Text Available This study investigated the effects of two methods of instruction on secondary school students’ critical response to Prose Literature text. The study adopted a pretest, posttest, control group quasi experimental design. The participants in the study were 84 Senior Secondary II students of Literature-in-English purposively selected from four Schools in Ikpoba-Okha Local Government Area of Edo State. Two intact classes were randomly assigned to each of the treatment and control groups. Three hypotheses were tested at 0.05 alpha level. The instruments used were: Critical Response to Prose Literature Test (r = .75, Questionnaire on Home Background of Students (r = .82, and Critical Response to Prose Literature Test Marking Guide. Data obtained were subjected to Analysis of Covariance and graph. The results showed significant main effect of treatment on students’ critical response to Prose Literature (F (1, 77 = 44.731; p < .05. Students exposed to Engagement Strategies Method performed better than those exposed to the Conventional Method of instruction. Further, home background of students had no significant effect on students’ critical response to Prose Literature text (F (2, 77 = 4.902; p < .05. There was significant interaction effect of treatment and home background of students on students’ critical response to Prose Literature text (F (2, 77 = 3.508; p < .05. It was concluded that Engagement Strategies Method is effective in promoting students’ critical response to Prose Literature text. Teachers of Literature-in-English should employ Engagement Strategies Method in teaching Prose Literature to students in Senior Secondary Schools.

  13. Individual analysis of nonmetallic Inclusions in Steel by using the gallium focused ion beam secondary ion mass spectrometry

    International Nuclear Information System (INIS)

    Tomiyasu, Bunbunoshin; Inami, Akihiro; Abe, Masakazu; Nihei, Yoshimasa.

    1995-01-01

    Nonmetallic inclusions frequently exert a lot of unfavorable influences on the quality of steel. The size of nonmetallic inclusions in current steel products is less than a few μm in diameter. It is desirable to make clear the origin and generation process of such small particles of nonmetallic inclusion. In order to measure the shape, size, composition and inner elemental distribution, development of characterization methods for each inclusion particle is required. By employing a gallium focused ion beam (FIB) as a primary ion beam of secondary ion mass spectrometry (SIMS), the particle analysis with high spatial resolution is easily achieved. In this paper, we present the novel individual analysis of nonmetallic inclusions in steel by gallium FIB SIMS. We analyzed in two ways the nonmetallic inclusion particles segregated by electron beam melting. (1) By cross-sectioning of the particle using a gallium FIB, elemental maps of cross-section were obtained. The elements were distributed inhomogeneously on the cross-section. (2) We carried out the compositional analysis for several particles individually. Ten particles were analyzed by the shave-off analysis and the multivariate cluster analysis. Based on the composition of each particle, the inclusions were classified into six types. (author)

  14. RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. Y. Prosekov

    2016-01-01

    Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

  15. In-situ measurements of the secondary electron yield in an accelerator environment: Instrumentation and methods

    International Nuclear Information System (INIS)

    Hartung, W.H.; Asner, D.M.; Conway, J.V.; Dennett, C.A.; Greenwald, S.; Kim, J.-S.; Li, Y.; Moore, T.P.; Omanovic, V.; Palmer, M.A.; Strohman, C.R.

    2015-01-01

    The performance of a particle accelerator can be limited by the build-up of an electron cloud (EC) in the vacuum chamber. Secondary electron emission from the chamber walls can contribute to EC growth. An apparatus for in-situ measurements of the secondary electron yield (SEY) in the Cornell Electron Storage Ring (CESR) was developed in connection with EC studies for the CESR Test Accelerator program. The CESR in-situ system, in operation since 2010, allows for SEY measurements as a function of incident electron energy and angle on samples that are exposed to the accelerator environment, typically 5.3 GeV counter-rotating beams of electrons and positrons. The system was designed for periodic measurements to observe beam conditioning of the SEY with discrimination between exposure to direct photons from synchrotron radiation versus scattered photons and cloud electrons. The samples can be exchanged without venting the CESR vacuum chamber. Measurements have been done on metal surfaces and EC-mitigation coatings. The in-situ SEY apparatus and improvements to the measurement tools and techniques are described

  16. In-situ measurements of the secondary electron yield in an accelerator environment: Instrumentation and methods

    Energy Technology Data Exchange (ETDEWEB)

    Hartung, W.H., E-mail: wh29@cornell.edu; Asner, D.M.; Conway, J.V.; Dennett, C.A.; Greenwald, S.; Kim, J.-S.; Li, Y.; Moore, T.P.; Omanovic, V.; Palmer, M.A.; Strohman, C.R.

    2015-05-21

    The performance of a particle accelerator can be limited by the build-up of an electron cloud (EC) in the vacuum chamber. Secondary electron emission from the chamber walls can contribute to EC growth. An apparatus for in-situ measurements of the secondary electron yield (SEY) in the Cornell Electron Storage Ring (CESR) was developed in connection with EC studies for the CESR Test Accelerator program. The CESR in-situ system, in operation since 2010, allows for SEY measurements as a function of incident electron energy and angle on samples that are exposed to the accelerator environment, typically 5.3 GeV counter-rotating beams of electrons and positrons. The system was designed for periodic measurements to observe beam conditioning of the SEY with discrimination between exposure to direct photons from synchrotron radiation versus scattered photons and cloud electrons. The samples can be exchanged without venting the CESR vacuum chamber. Measurements have been done on metal surfaces and EC-mitigation coatings. The in-situ SEY apparatus and improvements to the measurement tools and techniques are described.

  17. A study on the Stress Corrosion Cracking reduction method of Steam Generator secondary side of KSNP

    International Nuclear Information System (INIS)

    Kim, June Hoon; Lee, Goune Jin

    2014-01-01

    In order to avoid sludge accumulation affecting the life of the steam generator, the best way is to prevent the sludge inflow in advance by optimization of water quality management through chemical concentration and pH control etc. However it is very difficult to prevent sludge accumulation under the weak condition of corrosion, such as condensation, boiling and high temperature of feed-water in NPPs. Particularly stress corrosion cracking occurs in a top-of-tube sheet area of steam generator with an increase in number of operation years of Korea Standard Nuclear Plant(KSNP)... The purpose of this study is to improve suppression of stress corrosion cracking and life extension for steam generator and improve plant efficiency by performing full length bulk high chemical cleaning in order to remove iron oxide of steam generator secondary side in KSNP Hanbit Unit 6. This study analyzed the Free EDTA and Fe concentrations and sludge removal after performed full length bulk high temperature chemical cleaning for removing the iron oxide of steam generator secondary side, which of Hanbit unit 6 of KSNP. 1) It showed a typical pattern that Fe concentration increased in accordance with to decrease Free EDTA(Ethylene Diamine Tetea acetic Acid) concentration. 2) Sludge removal based on iron oxide after performing the full length bulk high temperature chemical cleaning was 3001kg and sludge removal by lancing additionally was 200.1kg

  18. Do male secondary sexual characters signal ejaculate quality? A meta-analysis.

    Science.gov (United States)

    Mautz, Brian S; Møller, Anders P; Jennions, Michael D

    2013-08-01

    There are two reasons why researchers are interested in the phenotypic relationship between the expression of male secondary sexual characters (SSCs) and 'ejaculate quality' (defined as sperm/ejaculate traits that are widely assumed to increase female fertility and/or sperm competitiveness). First, if the relationship is positive then females could gain a direct benefit by choosing more attractive males for fertility assurance reasons ('the phenotype-linked fertility' hypothesis). Second, there is much interest in the direction of the correlation between traits favoured by pre-copulatory sexual selection (i.e. affecting mating success) and those favoured by post-copulatory sexual selection (i.e. increasing sperm competitiveness). If the relationship is negative this could lead to the two forms of selection counteracting each other. Theory predicts that the direction of the relationship could be either positive or negative depending on the underlying genetic variance and covariance in each trait, the extent of variation among males in condition (resources available to allocate to reproductive traits), and variation among males in the cost or rate of mating. We conducted a meta-analysis to determine the average relationship between the expression of behavioural and morphological male secondary sexual characters and four assays of ejaculate quality (sperm number, viability, swimming speed and size). Regardless of how the data were partitioned the mean relationship was consistently positive, but always statistically non-significant. The only exception was that secondary sexual character expression was weakly but significantly positively correlated with sperm viability (r = 0.07, P < 0.05). There was no significant difference in the strength or direction of the relationship between behavioural and morphological SSCs, nor among relationships using the four ejaculate quality assays. The implications of our findings are discussed. © 2013 The Authors. Biological Reviews

  19. A strategy for evaluating pathway analysis methods.

    Science.gov (United States)

    Yu, Chenggang; Woo, Hyung Jun; Yu, Xueping; Oyama, Tatsuya; Wallqvist, Anders; Reifman, Jaques

    2017-10-13

    Researchers have previously developed a multitude of methods designed to identify biological pathways associated with specific clinical or experimental conditions of interest, with the aim of facilitating biological interpretation of high-throughput data. Before practically applying such pathway analysis (PA) methods, we must first evaluate their performance and reliability, using datasets where the pathways perturbed by the conditions of interest have been well characterized in advance. However, such 'ground truths' (or gold standards) are often unavailable. Furthermore, previous evaluation strategies that have focused on defining 'true answers' are unable to systematically and objectively assess PA methods under a wide range of conditions. In this work, we propose a novel strategy for evaluating PA methods independently of any gold standard, either established or assumed. The strategy involves the use of two mutually complementary metrics, recall and discrimination. Recall measures the consistency of the perturbed pathways identified by applying a particular analysis method to an original large dataset and those identified by the same method to a sub-dataset of the original dataset. In contrast, discrimination measures specificity-the degree to which the perturbed pathways identified by a particular method to a dataset from one experiment differ from those identifying by the same method to a dataset from a different experiment. We used these metrics and 24 datasets to evaluate six widely used PA methods. The results highlighted the common challenge in reliably identifying significant pathways from small datasets. Importantly, we confirmed the effectiveness of our proposed dual-metric strategy by showing that previous comparative studies corroborate the performance evaluations of the six methods obtained by our strategy. Unlike any previously proposed strategy for evaluating the performance of PA methods, our dual-metric strategy does not rely on any ground truth

  20. Blood Pressure Reduction and Secondary Stroke Prevention: A Systematic Review and Metaregression Analysis of Randomized Clinical Trials.

    Science.gov (United States)

    Katsanos, Aristeidis H; Filippatou, Angeliki; Manios, Efstathios; Deftereos, Spyridon; Parissis, John; Frogoudaki, Alexandra; Vrettou, Agathi-Rosa; Ikonomidis, Ignatios; Pikilidou, Maria; Kargiotis, Odysseas; Voumvourakis, Konstantinos; Alexandrov, Anne W; Alexandrov, Andrei V; Tsivgoulis, Georgios

    2017-01-01

    Current recommendations do not specifically address the optimal blood pressure (BP) reduction for secondary stroke prevention in patients with previous cerebrovascular events. We conducted a systematic review and metaregression analysis on the association of BP reduction with recurrent stroke and cardiovascular events using data from randomized controlled clinical trials of secondary stroke prevention. For all reported events during each eligible study period, we calculated the corresponding risk ratios to express the comparison of event occurrence risk between patients randomized to antihypertensive treatment and those randomized to placebo. On the basis of the reported BP values, we performed univariate metaregression analyses according to the achieved BP values under the random-effects model (Method of Moments) for those adverse events reported in ≥10 total subgroups of included randomized controlled clinical trials. In pairwise meta-analyses, antihypertensive treatment lowered the risk for recurrent stroke (risk ratio, 0.73; 95% confidence interval, 0.62-0.87; Psecondary stroke prevention. © 2016 American Heart Association, Inc.

  1. Instrumental methods of analysis, 7th edition

    International Nuclear Information System (INIS)

    Willard, H.H.; Merritt, L.L. Jr.; Dean, J.A.; Settle, F.A. Jr.

    1988-01-01

    The authors have prepared an organized and generally polished product. The book is fashioned to be used as a textbook for an undergraduate instrumental analysis course, a supporting textbook for graduate-level courses, and a general reference work on analytical instrumentation and techniques for professional chemists. Four major areas are emphasized: data collection and processing, spectroscopic instrumentation and methods, liquid and gas chromatographic methods, and electrochemical methods. Analytical instrumentation and methods have been updated, and a thorough citation of pertinent recent literature is included

  2. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    Directory of Open Access Journals (Sweden)

    Sung-Hye You

    2017-01-01

    Full Text Available Purpose The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL, for measuring the volume of parathyroid glands. Methods Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D and three-dimensional (3D methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. Results The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. Conclusion The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism.

  3. Healthcare professionals' perceptions of neglect of older people in Mexico: A qualitative secondary analysis.

    Science.gov (United States)

    Caceres, Billy A; Bub, Linda; Negrete, Maria Isabel; Giraldo Rodríguez, Liliana; Squires, Allison P

    2018-03-01

    To describe healthcare professionals' perceptions of neglect of older people in Mexico. Mistreatment of older people, particularly neglect, has emerged as a significant public health concern worldwide. However, few studies have been conducted to examine neglect of older people in low- and middle-income countries. Most research has focused on estimating the prevalence of neglect in older populations with little emphasis on the perceptions of healthcare professionals and their role in addressing neglect of older people. Qualitative secondary analysis. The parent study consisted of nine focus groups conducted with healthcare professionals at five public hospitals in Mexico. The purpose of the parent study was to perform a needs assessment to determine the feasibility of adapting the Nurses Improving Care for Healthsystem Elders programme to Mexico. A qualitative secondary analysis with directed content analysis approach was used to extract data related to neglect of older people. A total of 89 participants representing healthcare professionals from several disciplines were interviewed. Three themes emerged: (i) The main point is not here; (ii) We feel hopeless; and (iii) We need preparation. Participants reported distress and hopelessness related to neglect of older people. Lack of community-based resources was noted as contributing to neglect. Increased education regarding care of older people for both caregivers and healthcare professionals and greater interdisciplinary collaboration were identified as potential solutions to combat neglect. Community-based services and resource allocation need to be re-evaluated to improve the care of older Mexicans. Interdisciplinary models of care should be developed to address concerns related to neglect of older people. Neglect negatively impacts healthcare professionals' ability to adequately care for older patients. There is a need to invest in community-based services and models of care to address these concerns. © 2017

  4. Interface and thin film analysis: Comparison of methods, trends

    International Nuclear Information System (INIS)

    Werner, H.W.; Torrisi, A.

    1990-01-01

    Thin film properties are governed by a number of parameters such as: Surface and interface chemical composition, microstructure and the distribution of defects, dopants and impurities. For the determination of most of these aspects sophisticated analytical methods are needed. An overview of these analytical methods is given including: - Features and modes of analytical methods; - Main characteristics, advantages and disadvantages of the established methods [e.g. ESCA (Electron Spectroscopy for Chemical Analysis), AES (Auger Electron Spectroscopy), SIMS (Secondary Ion Mass Spectrometry), RBS (Rutherford Backscattering Spectrometry), SEM (Scanning Electron Microscopy), TEM (Transmission Electron Microscopy), illustrated with typical examples]; - Presentation of relatively new methods such as XRM (X-ray Microscopy) and SCAM (Scanning Acoustic Microscopy). Some features of ESCA (chemical information, insulator analysis, non-destructive depth profiling) have been selected for a more detailed presentation, viz. to illustrate the application of ESCA to practical problems. Trends in instrumental development and analytical applications of the techniques are discussed; the need for a multi-technique approach to solve complex analytical problems is emphasized. (orig.)

  5. A Statistical Method for Aggregated Wind Power Plants to Provide Secondary Frequency Control

    DEFF Research Database (Denmark)

    Hu, Junjie; Ziras, Charalampos; Bindner, Henrik W.

    2017-01-01

    curtailment for aggregated wind power plants providing secondary frequency control (SFC) to the power system. By using historical SFC signals and wind speed data, we calculate metrics for the reserve provision error as a function of the scheduled wind power. We show that wind curtailment can be significantly......The increasing penetration of wind power brings significant challenges to power system operators due to the wind’s inherent uncertainty and variability. Traditionally, power plants and more recently demand response have been used to balance the power system. However, the use of wind power...... as a balancing-power source has also been investigated, especially for wind power dominated power systems such as Denmark. The main drawback is that wind power must be curtailed by setting a lower operating point, in order to offer upward regulation. We propose a statistical approach to reduce wind power...

  6. Efficient isotope ratio analysis of uranium particles in swipe samples by total-reflection x-ray fluorescence spectrometry and secondary ion mass spectrometry

    International Nuclear Information System (INIS)

    Esaka, Fumitaka; Watanabe, Kazuo; Fukuyama, Hiroyasu; Onodera, Takashi; Esaka, Konomi T.; Magara, Masaaki; Sakurai, Satoshi; Usuda, Shigekazu

    2004-01-01

    A new particle recovery method and a sensitive screening method were developed for subsequent isotope ratio analysis of uranium particles in safeguards swipe samples. The particles in the swipe sample were recovered onto a carrier by means of vacuum suction-impact collection method. When grease coating was applied to the carrier, the recovery efficiency was improved to 48±9%, which is superior to that of conventionally-used ultrasoneration method. Prior to isotope ratio analysis with secondary ion mass spectrometry (SIMS), total reflection X-ray fluorescence spectrometry (TXRF) was applied to screen the sample for the presence of uranium particles. By the use of Si carriers in TXRF analysis, the detection limit of 22 pg was achieved for uranium. By combining these methods with SIMS, the isotope ratios of 235 U/ 238 U for individual uranium particles were efficiently determined. (author)

  7. War Reserve Analysis and Secondary Item Procureability Assessment of the AMCOM Supported Weapon Systems

    National Research Council Canada - National Science Library

    Maddux, Gary

    2000-01-01

    .... IOD evaluates the impacts of nonavailability of secondary items on the life cycle supportability of AMCOM weapon systems and evaluates the producibility of secondary items for war reserve requirements...

  8. Becoming pregnant during secondary school: findings from concurrent mixed methods research in Anambra State, Nigeria.

    Science.gov (United States)

    Onyeka, Ifeoma N; Miettola, Juhani; Ilika, Amobi L; Vaskilampi, Tuula

    2012-03-01

    Pregnancies among teenagers and problems associated with premarital births have raised concerns in many countries. It is important to explore unintended pregnancy from the viewpoints of local stakeholders such as students, schools/teachers, and community members. This study assessed reported cases of unintended pregnancy among students and perceptions of these pregnancies by members of the community. This study took place in a rural community in Anambra state, southeastern Nigeria. A cross-sectional survey of 1,234 students and 46 teachers in five secondary schools was carried out using self-administered questionnaires. In addition, focus group discussions (FGD) involving 10 parents and in-depth interview (IDI) with a student who became pregnant were conducted. Reports of pregnancy were more common during second and third years of junior secondary school than other school years or level. According to teachers, ignorance was the main reason given by students who became pregnant. Students who became pregnant were reported to have performed poorly academically and lived with both parents, who were either subsistence farmers or petty traders. In the IDI, the ex-student opined that pregnant students faced shame, marital limitations and lack of respect from community members. Participants in the FGD suggested that teenagers should be provided with sex education in schools and in churches; parents should communicate with teenagers about sexual matters and make adequate financial provision; and the male partners should be held more accountable for the pregnancies. Poor sexual knowledge and poor socioeconomic conditions play important roles in teenage pregnancy. Male participation may enhance effectiveness of prevention programmes.

  9. Limitations of systemic accident analysis methods

    Directory of Open Access Journals (Sweden)

    Casandra Venera BALAN

    2016-12-01

    Full Text Available In terms of system theory, the description of complex accidents is not limited to the analysis of the sequence of events / individual conditions, but highlights nonlinear functional characteristics and frames human or technical performance in relation to normal functioning of the system, in safety conditions. Thus, the research of the system entities as a whole is no longer an abstraction of a concrete situation, but an exceeding of the theoretical limits set by analysis based on linear methods. Despite the issues outlined above, the hypothesis that there isn’t a complete method for accident analysis is supported by the nonlinearity of the considered function or restrictions, imposing a broad vision of the elements introduced in the analysis, so it can identify elements corresponding to nominal parameters or trigger factors.

  10. Application of Software Safety Analysis Methods

    International Nuclear Information System (INIS)

    Park, G. Y.; Hur, S.; Cheon, S. W.; Kim, D. H.; Lee, D. Y.; Kwon, K. C.; Lee, S. J.; Koo, Y. H.

    2009-01-01

    A fully digitalized reactor protection system, which is called the IDiPS-RPS, was developed through the KNICS project. The IDiPS-RPS has four redundant and separated channels. Each channel is mainly composed of a group of bistable processors which redundantly compare process variables with their corresponding setpoints and a group of coincidence processors that generate a final trip signal when a trip condition is satisfied. Each channel also contains a test processor called the ATIP and a display and command processor called the COM. All the functions were implemented in software. During the development of the safety software, various software safety analysis methods were applied, in parallel to the verification and validation (V and V) activities, along the software development life cycle. The software safety analysis methods employed were the software hazard and operability (Software HAZOP) study, the software fault tree analysis (Software FTA), and the software failure modes and effects analysis (Software FMEA)

  11. Spatial analysis statistics, visualization, and computational methods

    CERN Document Server

    Oyana, Tonny J

    2015-01-01

    An introductory text for the next generation of geospatial analysts and data scientists, Spatial Analysis: Statistics, Visualization, and Computational Methods focuses on the fundamentals of spatial analysis using traditional, contemporary, and computational methods. Outlining both non-spatial and spatial statistical concepts, the authors present practical applications of geospatial data tools, techniques, and strategies in geographic studies. They offer a problem-based learning (PBL) approach to spatial analysis-containing hands-on problem-sets that can be worked out in MS Excel or ArcGIS-as well as detailed illustrations and numerous case studies. The book enables readers to: Identify types and characterize non-spatial and spatial data Demonstrate their competence to explore, visualize, summarize, analyze, optimize, and clearly present statistical data and results Construct testable hypotheses that require inferential statistical analysis Process spatial data, extract explanatory variables, conduct statisti...

  12. Advanced analysis methods in particle physics

    Energy Technology Data Exchange (ETDEWEB)

    Bhat, Pushpalatha C.; /Fermilab

    2010-10-01

    Each generation of high energy physics experiments is grander in scale than the previous - more powerful, more complex and more demanding in terms of data handling and analysis. The spectacular performance of the Tevatron and the beginning of operations of the Large Hadron Collider, have placed us at the threshold of a new era in particle physics. The discovery of the Higgs boson or another agent of electroweak symmetry breaking and evidence of new physics may be just around the corner. The greatest challenge in these pursuits is to extract the extremely rare signals, if any, from huge backgrounds arising from known physics processes. The use of advanced analysis techniques is crucial in achieving this goal. In this review, I discuss the concepts of optimal analysis, some important advanced analysis methods and a few examples. The judicious use of these advanced methods should enable new discoveries and produce results with better precision, robustness and clarity.

  13. Prevalence, distribution and correlates of tobacco smoking and chewing in Nepal: a secondary data analysis of Nepal Demographic and Health Survey-2006

    OpenAIRE

    Sreeramareddy Chandrashekhar T; Ramakrishnareddy N; Harsha Kumar HN; Sathian Brijesh; Arokiasamy John T

    2011-01-01

    Abstract Background Nearly four-fifths of estimated 1.1 million smokers live in low or middle-income countries. We aimed to provide national estimates for Nepal on tobacco use prevalence, its distribution across demographic, socio-economic and spatial variables and correlates of tobacco use. Methods A secondary data analysis of 2006 Nepal Demographic and Health Survey (DHS) was done. A representative sample of 9,036 households was selected by two-stage stratified, probability proportional to ...

  14. Moderating factors for the effectiveness of group art therapy for schizophrenia: secondary analysis of data from the MATISSE randomised controlled trial

    OpenAIRE

    Leurent, Baptiste; Killaspy, Helen; Osborn, David P.; Crawford, Mike J.; Hoadley, Angela; Waller, Diane; King, Michael

    2014-01-01

    PURPOSE Although some studies suggest that art therapy may be useful in the treatment of negative symptoms of schizophrenia, a recent large trial of group art therapy found no clinical advantage over standard care, but the study population was heterogeneous and uptake of the intervention was poor. This study aimed to investigate whether art therapy was more effective for specific subgroups of patients. METHODS Secondary analysis of data from a randomised controlled trial of group art therapy ...

  15. Dipyridamole plus aspirin versus aspirin alone in the secondary prevention after TIA or stroke: a meta-analysis by risk

    OpenAIRE

    Halkes, P.H.A.; Gray, Laura J.; Bath, Philip M.W.; Diener, Hans-Christoph; Guiraud-Chaumeil, B.

    2008-01-01

    Objectives: Our aim was to study the effect of combination therapy with aspirin and dipyridamole (A+D) over aspirin alone (ASA) in secondary prevention after transient \\ud ischemic attack or minor stroke of presumed arterial origin and to perform subgroup analyses to identify patients that might benefit most from secondary prevention with A+D.\\ud Data sources: The previously published meta-analysis of individual patient data was updated with data from ESPRIT (N=2,739); trials without data on ...

  16. Review of strain buckling: analysis methods

    International Nuclear Information System (INIS)

    Moulin, D.

    1987-01-01

    This report represents an attempt to review the mechanical analysis methods reported in the literature to account for the specific behaviour that we call buckling under strain. In this report, this expression covers all buckling mechanisms in which the strains imposed play a role, whether they act alone (as in simple buckling under controlled strain), or whether they act with other loadings (primary loading, such as pressure, for example). Attention is focused on the practical problems relevant to LMFBR reactors. The components concerned are distinguished by their high slenderness ratios and by rather high thermal levels, both constant and variable with time. Conventional static buckling analysis methods are not always appropriate for the consideration of buckling under strain. New methods must therefore be developed in certain cases. It is also hoped that this review will facilitate the coding of these analytical methods to aid the constructor in his design task and to identify the areas which merit further investigation

  17. Analysis of mixed data methods & applications

    CERN Document Server

    de Leon, Alexander R

    2013-01-01

    A comprehensive source on mixed data analysis, Analysis of Mixed Data: Methods & Applications summarizes the fundamental developments in the field. Case studies are used extensively throughout the book to illustrate interesting applications from economics, medicine and health, marketing, and genetics. Carefully edited for smooth readability and seamless transitions between chaptersAll chapters follow a common structure, with an introduction and a concluding summary, and include illustrative examples from real-life case studies in developmental toxicolog

  18. Scope-Based Method Cache Analysis

    DEFF Research Database (Denmark)

    Huber, Benedikt; Hepp, Stefan; Schoeberl, Martin

    2014-01-01

    The quest for time-predictable systems has led to the exploration of new hardware architectures that simplify analysis and reasoning in the temporal domain, while still providing competitive performance. For the instruction memory, the method cache is a conceptually attractive solution, as it req......The quest for time-predictable systems has led to the exploration of new hardware architectures that simplify analysis and reasoning in the temporal domain, while still providing competitive performance. For the instruction memory, the method cache is a conceptually attractive solution...

  19. Quantitative analysis method for ship construction quality

    Directory of Open Access Journals (Sweden)

    FU Senzong

    2017-03-01

    Full Text Available The excellent performance of a ship is assured by the accurate evaluation of its construction quality. For a long time, research into the construction quality of ships has mainly focused on qualitative analysis due to a shortage of process data, which results from limited samples, varied process types and non-standardized processes. Aiming at predicting and controlling the influence of the construction process on the construction quality of ships, this article proposes a reliability quantitative analysis flow path for the ship construction process and fuzzy calculation method. Based on the process-quality factor model proposed by the Function-Oriented Quality Control (FOQC method, we combine fuzzy mathematics with the expert grading method to deduce formulations calculating the fuzzy process reliability of the ordinal connection model, series connection model and mixed connection model. The quantitative analysis method is applied in analyzing the process reliability of a ship's shaft gear box installation, which proves the applicability and effectiveness of the method. The analysis results can be a useful reference for setting key quality inspection points and optimizing key processes.

  20. Piping dynamic analysis by the synthesis method

    International Nuclear Information System (INIS)

    Bezler, P.; Curreri, J.R.

    1976-01-01

    Since piping systems are a frequent source of noise and vibrations, their efficient dynamic analysis is imperative. As an alternate to more conventional analyses methods, an application of the synthesis method to piping vibrations analyses is demonstrated. Specifically, the technique is illustrated by determining the normal modes and natural frequencies of a composite bend from the normal mode and natural frequency data of two component parts. A comparison of the results to those derived for the composite bend by other techniques is made

  1. Probabilistic Analysis Methods for Hybrid Ventilation

    DEFF Research Database (Denmark)

    Brohus, Henrik; Frier, Christian; Heiselberg, Per

    This paper discusses a general approach for the application of probabilistic analysis methods in the design of ventilation systems. The aims and scope of probabilistic versus deterministic methods are addressed with special emphasis on hybrid ventilation systems. A preliminary application...... of stochastic differential equations is presented comprising a general heat balance for an arbitrary number of loads and zones in a building to determine the thermal behaviour under random conditions....

  2. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    Energy Technology Data Exchange (ETDEWEB)

    You, Sung Hye; Son, Gyu Ri; Lee, Nam Joon [Dept. of Radiology, Korea University Anam Hospital, Seoul (Korea, Republic of); Suh, Sangil; Ryoo, In Seon; Seol, Hae Young [Dept. of Radiology, Korea University Guro Hospital, Seoul (Korea, Republic of); Lee, Young Hen; Seo, Hyung Suk [Dept. of Radiology, Korea University Ansan Hospital, Ansan (Korea, Republic of)

    2017-01-15

    The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL), for measuring the volume of parathyroid glands. Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D) and three-dimensional (3D) methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs) and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism.

  3. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    International Nuclear Information System (INIS)

    You, Sung Hye; Son, Gyu Ri; Lee, Nam Joon; Suh, Sangil; Ryoo, In Seon; Seol, Hae Young; Lee, Young Hen; Seo, Hyung Suk

    2017-01-01

    The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL), for measuring the volume of parathyroid glands. Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D) and three-dimensional (3D) methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs) and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism

  4. Secondary emission ion analyzer provided with an electron gun for insulating material analysis

    International Nuclear Information System (INIS)

    Blanchard, Bruno; Carrier, Patrick; Marguerite, J.-L.; Rocco, J.-C.

    1976-01-01

    This invention relates to a secondary emission ion analyser, fitted with an electron gun. It is used in the mass spectrometry analysis of electrically insulating bodies. It has already been suggested to bombard the target with an electron beam in conjunction with the beam of primary particles, in order to reduce the space charge near the target. The object of this invention is the application of this known process to appliances of the ion analyser type with a high electric field near the target. Its main characteristic is the use of an electron gun emitting an electron beam through the extraction lens placed opposite the target. The extraction electric field influences the path of the electrons but the electric and mechanical specifications of the electron gun in the invention are such that the target is correctly sprayed by the electron beam [fr

  5. A Note on Penalized Regression Spline Estimation in the Secondary Analysis of Case-Control Data

    KAUST Repository

    Gazioglu, Suzan; Wei, Jiawei; Jennings, Elizabeth M.; Carroll, Raymond J.

    2013-01-01

    Primary analysis of case-control studies focuses on the relationship between disease (D) and a set of covariates of interest (Y, X). A secondary application of the case-control study, often invoked in modern genetic epidemiologic association studies, is to investigate the interrelationship between the covariates themselves. The task is complicated due to the case-control sampling, and to avoid the biased sampling that arises from the design, it is typical to use the control data only. In this paper, we develop penalized regression spline methodology that uses all the data, and improves precision of estimation compared to using only the controls. A simulation study and an empirical example are used to illustrate the methodology.

  6. A Note on Penalized Regression Spline Estimation in the Secondary Analysis of Case-Control Data

    KAUST Repository

    Gazioglu, Suzan

    2013-05-25

    Primary analysis of case-control studies focuses on the relationship between disease (D) and a set of covariates of interest (Y, X). A secondary application of the case-control study, often invoked in modern genetic epidemiologic association studies, is to investigate the interrelationship between the covariates themselves. The task is complicated due to the case-control sampling, and to avoid the biased sampling that arises from the design, it is typical to use the control data only. In this paper, we develop penalized regression spline methodology that uses all the data, and improves precision of estimation compared to using only the controls. A simulation study and an empirical example are used to illustrate the methodology.

  7. Shaping the Conversation: A Secondary Analysis of Reproductive Decision-Making Among Black Mothers with HIV.

    Science.gov (United States)

    Amutah, Ndidiamaka N; Gifuni, Jacqueline; Wesley, Yvonne

    2016-01-01

    The purpose of this qualitative secondary data analysis is to examine the major influencers on mothers with HIV in their childbearing decisions, as well as how those influencers shape conversations with clinicians and health-care providers regarding HIV treatment and prevention. The original study gained insight into the reproductive decision-making of mothers with HIV. By analyzing a subsample of 15 interviews from an original cohort of 25 participants in the earlier study, three major themes were identified as follows: (1) family members, not health-care providers, influence reproductive decisions; (2) negative attitudes toward subsequent pregnancies are mainly due to HIV transmission; and (3) birth control decisions were predominately supported by family members, while health-care providers were not consulted.

  8. Secondary Analysis of Audio Data. Technical Procedures for Virtual Anonymization and Pseudonymization

    Directory of Open Access Journals (Sweden)

    Henning Pätzold

    2005-01-01

    Full Text Available Qualitative material presented as audio data requires a greater degree of protecting of anonymity than for example textual data. Apart from the verbal content, it carries paraverbal aspects including voice characteristics, thus making it easier to identify the speaker. This complicates secondary analysis or reanalysis conducted by researchers who were not involved in the data collection. Difficulties increase if the chances are high that the researcher and the interviewee come in contact for example through a meeting. This paper describes the technical procedures that are used to modify the sound of the audio source in a way that it reduces the possibility of recognition (i.e. similar to that of a carefully written transcript. A discussion of the technical possibilities of this procedure along with an exploration of the boundaries of anonymization is presented. URN: urn:nbn:de:0114-fqs0501249

  9. Analysis of hydrogen isotopes in materials by secondary ion mass spectrometry and nuclear microanalysis

    International Nuclear Information System (INIS)

    Ross, G.G.

    1994-01-01

    Only two techniques are really appropriate for the depth profiling of hydrogen isotopes: nuclear microanalysis (NMA) and secondary ion mass spectrometry (SIMS). The intent of this paper is to give an up to date review of both techniques and to show how they can be used in conjunction. Both techniques (SIMS and NMA) will be described briefly. NMA will divided into two different categories: nuclear reaction analysis (NRA) and elastic recoil detection (ERD). Both techniques (SIMS and NMA) will be discussed in terms of sensitivity, resolution, probing depth, quantitative measurement, generality and selectivity, beam induced effects and surface roughness effects. The principal advantages and disadvantages of each of these techniques will be specified, supporting the contention that SIMS and NMA are complementary and should be used in conjunction. Finally, some examples of, and perspectives for, the complementary use of both techniques will be presented. (Author)

  10. Secondary ion mass spectrometry: The application in the analysis of atmospheric particulate matter

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Di; Hua, Xin; Xiu, Guang-Li; Zheng, Yong-Jie; Yu, Xiao-Ying; Long, Yi-Tao

    2017-10-01

    Currently, considerable attention has been paid to atmospheric particulate matter (PM) investigation due to its importance in human health and global climate change. Surface characterization of PM is important since the chemical heterogeneity between the surface and bulk may vary its impact on the environment and human being. Secondary ion mass spectrometry (SIMS) is a surface technique with high surface sensitivity, capable of high spatial chemical imaging and depth profiling. Recent research shows that SIMS holds great potential in analyzing both surface and bulk chemical information of PM. In this review, we presented the working principal of SIMS in PM characterization, summarized recent applications in PM analysis from different sources, discussed its advantages and limitations, and proposed the future development of this technique with a perspective in environmental sciences.

  11. Shaping the Conversation: A Secondary Analysis of Reproductive Decision-Making among Black Mothers with HIV

    Directory of Open Access Journals (Sweden)

    Ndidiamaka N. Amutah

    2016-01-01

    Full Text Available The purpose of this qualitative secondary data analysis is to examine the major influencers on mothers with HIV in their childbearing decisions, as well as how those influencers shape conversations with clinicians and health-care providers regarding HIV treatment and prevention. The original study gained insight into the reproductive decision-making of mothers with HIV. By analyzing a subsample of 15 interviews from an original cohort of 25 participants in the earlier study, three major themes were identified as follows: (1 family members, not health-care providers, influence reproductive decisions; (2 negative attitudes toward subsequent pregnancies are mainly due to HIV transmission; and (3 birth control decisions were predominately supported by family members, while health-care providers were not consulted.

  12. Calculation of the secondary gamma radiation by the Monte Carlo method at displaced sampling from distributed sources

    International Nuclear Information System (INIS)

    Petrov, Eh.E.; Fadeev, I.A.

    1979-01-01

    A possibility to use displaced sampling from a bulk gamma source in calculating the secondary gamma fields by the Monte Carlo method is discussed. The algorithm proposed is based on the concept of conjugate functions alongside the dispersion minimization technique. For the sake of simplicity a plane source is considered. The algorithm has been put into practice on the M-220 computer. The differential gamma current and flux spectra in 21cm-thick lead have been calculated. The source of secondary gamma-quanta was assumed to be a distributed, constant and isotropic one emitting 4 MeV gamma quanta with the rate of 10 9 quanta/cm 3 xs. The calculations have demonstrated that the last 7 cm of lead are responsible for the whole gamma spectral pattern. The spectra practically coincide with the ones calculated by the ROZ computer code. Thus the algorithm proposed can be offectively used in the calculations of secondary gamma radiation transport and reduces the computation time by 2-4 times

  13. Local in-depth analysis of ceramic materials by neutral beam secondary ion mass spectrometry

    International Nuclear Information System (INIS)

    Borchardt, G.; Scherrer, H.; Weber, S.; Scherrer, S.

    1980-01-01

    Local microanalysis of non-conducting surfaces by means of modern physical methods which use charged low-energy primary particles brings about severe problems because of the electrostatic charge accumulated on the sample surface. This is also true of secondary ion mass spectrometry (SIMS) where ions are usually used as primary particles. In the present work the basic features for production of neutral primary beams in commercial SIMS instruments by a simple technique are described. With suitably high sputtering rates, surface analyses and in-depth profiles can be made in reasonable measuring times. Results are given for chemical concentration distributions in the near-surface regions of an oxide glass and for the isotopic diffusion of Si-30 in a crystalline silicate with olivine structure (Co 2 SiO 4 ). (orig.)

  14. Theoretical and Experimental Studies of Dissimilar Secondary Metallurgy Methods for Improving Steel Cleanliness

    Science.gov (United States)

    Pitts-Baggett, April

    Due to a continual increasing industry demand for clean steels, a multi-depth sampling approach was developed to gain a more detailed depiction of the reactions occurring in the ladle throughout the Ladle Metallurgy Furnace (LMF) processing. This sampling technique allows for the ability for samples to be reached at depths, which have not been able to be captured before, of approximately 1.5 m below the slag layer. These samples were also taken in conjunction with samples taken just under the slag layer as well as in between those samples. Additional samples were also taken during the processing including multi-point slag sampling. The heats were divided in to five key processing steps: Start of heat (S), after Alloying (A), after desulfurization/start of pre-Rinse (R), prior to Ca treatment (C), and End of heat (E). Sampling sets were collected to compare the effects of silicon, desulfurization rates, slag emulsification, slag evolution and inclusion evolution. By gaining the ability to gather multiple depths, it was determined that the slag emulsification has the ability to follow the flow pattern of the ladle deeper into the ladle than previously seen in literature. Inclusion evolution has been shown by numerous researchers; however, this study showed differences in the inclusion grouping and distribution at the different depths of the ladle through Automated Feature Analysis (AFA). Also, the inclusion path was seen to change depending on both the silicon content and the sulfur content of the steel. This method was applied to develop a desulfurization model at Nucor Steel Tuscaloosa, Inc. (NSTI). In addition to a desulfurization model, a calcium (Ca) model was also developed. The Ca model was applied to target a finished inclusion region based on the conditions up to the wire treatment. These conditions included time, silicon content, and sulfur concentration. Due to the inability of this model to handle every process variable, a new procedure was created to

  15. Chemical analysis by nuclear methods. v. 2

    International Nuclear Information System (INIS)

    Alfassi, Z.B.

    1998-01-01

    'Chemical analysis by Nuclear Methods' is an effort of some renowned authors in field of nuclear chemistry and radiochemistry which is compiled by Alfassi, Z.B. and translated into Farsi version collected in two volumes. The second volume consists of the following chapters: Detecting ion recoil scattering and elastic scattering are dealt in the eleventh chapter, the twelfth chapter is devoted to nuclear reaction analysis using charged particles, X-ray emission is discussed at thirteenth chapter, the fourteenth chapter is about using ion microprobes, X-ray fluorescence analysis is discussed in the fifteenth chapter, alpha, beta and gamma ray scattering in chemical analysis are dealt in chapter sixteen, Moessbauer spectroscopy and positron annihilation are discussed in chapter seventeen and eighteen; The last two chapters are about isotope dilution analysis and radioimmunoassay

  16. Numerical methods in software and analysis

    CERN Document Server

    Rice, John R

    1992-01-01

    Numerical Methods, Software, and Analysis, Second Edition introduces science and engineering students to the methods, tools, and ideas of numerical computation. Introductory courses in numerical methods face a fundamental problem-there is too little time to learn too much. This text solves that problem by using high-quality mathematical software. In fact, the objective of the text is to present scientific problem solving using standard mathematical software. This book discusses numerous programs and software packages focusing on the IMSL library (including the PROTRAN system) and ACM Algorithm

  17. Nonlinear structural analysis using integrated force method

    Indian Academy of Sciences (India)

    A new formulation termed the Integrated Force Method (IFM) was proposed by Patnaik ... nated ``Structure (nY m)'' where (nY m) are the force and displacement degrees of ..... Patnaik S N, Yadagiri S 1976 Frequency analysis of structures.

  18. Modern methods of wine quality analysis

    Directory of Open Access Journals (Sweden)

    Галина Зуфарівна Гайда

    2015-06-01

    Full Text Available  In this paper physical-chemical and enzymatic methods of quantitative analysis of the basic wine components were reviewed. The results of own experiments were presented for the development of enzyme- and cell-based amperometric sensors on ethanol, lactate, glucose, arginine

  19. Problem-Based Learning Method: Secondary Education 10th Grade Chemistry Course Mixtures Topic

    Science.gov (United States)

    Üce, Musa; Ates, Ismail

    2016-01-01

    In this research; aim was determining student achievement by comparing problem-based learning method with teacher-centered traditional method of teaching 10th grade chemistry lesson mixtures topic. Pretest-posttest control group research design is implemented. Research sample includes; two classes of (total of 48 students) an Anatolian High School…

  20. Analysis of the VVER-440 reactor steam generator secondary side with the RELAP5/MOD3 code

    International Nuclear Information System (INIS)

    Tuunanen, J.

    1993-01-01

    Nuclear Engineering Laboratory of the Technical Research Centre of Finland has widely used RELAP5/MOD2 and -MOD3 codes to simulate horizontal steam generators. Several models have been developed and successfully used in the VVER-safety analysis. Nevertheless, the models developed have included only rather few nodes in the steam generator secondary side. The secondary side has normally been divided into about 10 to 15 nodes. Since the secondary side at the steam generators of VVER-440 type reactors consists of a rather large water pool, these models were only roughly capable to predict secondary side flows. The paper describes an attempt to use RELAP5/MOD3 code to predict secondary side flows in a steam generator of a VVER-440 reactor. A 2D/3D model has been developed using RELAP5/MOD3 codes cross-flow junctions. The model includes 90 volumes on the steam generator secondary side. The model has been used to calculate steady state flow conditions in the secondary side of a VVER-440 reactor steam generator. (orig.) (1 ref., 9 figs., 2 tabs.)

  1. Multiple predictor smoothing methods for sensitivity analysis

    International Nuclear Information System (INIS)

    Helton, Jon Craig; Storlie, Curtis B.

    2006-01-01

    The use of multiple predictor smoothing methods in sampling-based sensitivity analyses of complex models is investigated. Specifically, sensitivity analysis procedures based on smoothing methods employing the stepwise application of the following nonparametric regression techniques are described: (1) locally weighted regression (LOESS), (2) additive models, (3) projection pursuit regression, and (4) recursive partitioning regression. The indicated procedures are illustrated with both simple test problems and results from a performance assessment for a radioactive waste disposal facility (i.e., the Waste Isolation Pilot Plant). As shown by the example illustrations, the use of smoothing procedures based on nonparametric regression techniques can yield more informative sensitivity analysis results than can be obtained with more traditional sensitivity analysis procedures based on linear regression, rank regression or quadratic regression when nonlinear relationships between model inputs and model predictions are present

  2. Economic analysis of alternative LLW disposal methods

    International Nuclear Information System (INIS)

    Foutes, C.E.

    1987-01-01

    The Environmental Protection Agency (EPA) has evaluated the costs and benefits of alternative disposal technologies as part of its program to develop generally applicable environmental standards for the land disposal of low-level radioactive waste (LLW). Costs, population health effects and Critical Population Group (CPG) exposures resulting from alternative waste treatment and disposal methods were developed and input into the analysis. The cost-effectiveness analysis took into account a number of waste streams, hydrogeologic and climatic region settings, and waste treatment and disposal methods. Total costs of each level of a standard included costs for packaging, processing, transportation, and burial of waste. Benefits are defined in terms of reductions in the general population health risk (expected fatal cancers and genetic effects) evaluated over 10,000 years. A cost-effectiveness ratio, was calculated for each alternative standard. This paper describes the alternatives considered and preliminary results of the cost-effectiveness analysis

  3. Reliability and risk analysis methods research plan

    International Nuclear Information System (INIS)

    1984-10-01

    This document presents a plan for reliability and risk analysis methods research to be performed mainly by the Reactor Risk Branch (RRB), Division of Risk Analysis and Operations (DRAO), Office of Nuclear Regulatory Research. It includes those activities of other DRAO branches which are very closely related to those of the RRB. Related or interfacing programs of other divisions, offices and organizations are merely indicated. The primary use of this document is envisioned as an NRC working document, covering about a 3-year period, to foster better coordination in reliability and risk analysis methods development between the offices of Nuclear Regulatory Research and Nuclear Reactor Regulation. It will also serve as an information source for contractors and others to more clearly understand the objectives, needs, programmatic activities and interfaces together with the overall logical structure of the program

  4. Multiple predictor smoothing methods for sensitivity analysis.

    Energy Technology Data Exchange (ETDEWEB)

    Helton, Jon Craig; Storlie, Curtis B.

    2006-08-01

    The use of multiple predictor smoothing methods in sampling-based sensitivity analyses of complex models is investigated. Specifically, sensitivity analysis procedures based on smoothing methods employing the stepwise application of the following nonparametric regression techniques are described: (1) locally weighted regression (LOESS), (2) additive models, (3) projection pursuit regression, and (4) recursive partitioning regression. The indicated procedures are illustrated with both simple test problems and results from a performance assessment for a radioactive waste disposal facility (i.e., the Waste Isolation Pilot Plant). As shown by the example illustrations, the use of smoothing procedures based on nonparametric regression techniques can yield more informative sensitivity analysis results than can be obtained with more traditional sensitivity analysis procedures based on linear regression, rank regression or quadratic regression when nonlinear relationships between model inputs and model predictions are present.

  5. Spectroscopic Chemical Analysis Methods and Apparatus

    Science.gov (United States)

    Hug, William F. (Inventor); Reid, Ray D. (Inventor); Bhartia, Rohit (Inventor); Lane, Arthur L. (Inventor)

    2018-01-01

    Spectroscopic chemical analysis methods and apparatus are disclosed which employ deep ultraviolet (e.g. in the 200 nm to 300 nm spectral range) electron beam pumped wide bandgap semiconductor lasers, incoherent wide bandgap semiconductor light emitting devices, and hollow cathode metal ion lasers to perform non-contact, non-invasive detection of unknown chemical analytes. These deep ultraviolet sources enable dramatic size, weight and power consumption reductions of chemical analysis instruments. In some embodiments, Raman spectroscopic detection methods and apparatus use ultra-narrow-band angle tuning filters, acousto-optic tuning filters, and temperature tuned filters to enable ultra-miniature analyzers for chemical identification. In some embodiments Raman analysis is conducted along with photoluminescence spectroscopy (i.e. fluorescence and/or phosphorescence spectroscopy) to provide high levels of sensitivity and specificity in the same instrument.

  6. Computational methods for nuclear criticality safety analysis

    International Nuclear Information System (INIS)

    Maragni, M.G.

    1992-01-01

    Nuclear criticality safety analyses require the utilization of methods which have been tested and verified against benchmarks results. In this work, criticality calculations based on the KENO-IV and MCNP codes are studied aiming the qualification of these methods at the IPEN-CNEN/SP and COPESP. The utilization of variance reduction techniques is important to reduce the computer execution time, and several of them are analysed. As practical example of the above methods, a criticality safety analysis for the storage tubes for irradiated fuel elements from the IEA-R1 research has been carried out. This analysis showed that the MCNP code is more adequate for problems with complex geometries, and the KENO-IV code shows conservative results when it is not used the generalized geometry option. (author)

  7. The ethical task of secondary teachers: An analysis through their attitudes and reasoning. Case study in the Mexican context

    Directory of Open Access Journals (Sweden)

    Marcela HERNÁNDEZ GONZÁLEZ

    2016-06-01

    Full Text Available This study focused on the analysis of professional ethics of teachers. It is considered important because this teaching is itself an ethical activity because it touches on the whole person of the learner to encourage it to be gradually a better subject.Moral reasoning and moral attitudes: to have a professional approach to this ethic two related elements were studied. A case study located in Mexico, in the Superior Normal School of Michoacán (ensm, initial training institution was performed, but also welcomes teachers in service for further studies and graduate. Methods of quantitative and qualitative research in the same investigation were integrated approach known as hybrid or mixed method. The instruments were built Likert scale, hypothetical and real moral dilemmas. And the implementation of group discussion with experts.The work investigated on major ethical problems of secondary teachers, argumentation processes performed to make ethical decisions and principal values present.The results found that ethical aspects have an important place in their educational conception. Also there is a high emotional charge in moral attitudes, which are transformed along the experience and professional cycling stage that is going through.Moreover, the presence of the principles of justice and charity in ethical conflicts was recognized, and the importance of the ability of moral sensibility as an element that favors the appropriate educational practices and ethical development of students and educators.The study provides knowledge of reflection to be implemented in teacher training, seeking to promote professional ethics in secondary teachers respond to the needs and demands of the current context.

  8. PIXE - a new method for elemental analysis

    International Nuclear Information System (INIS)

    Johansson, S.A.E.

    1983-01-01

    With elemental analysis we mean the determination of which chemical elements are present in a sample and of their concentration. This is an old and important problem in chemistry. The earliest methods were purely chemical and many such methods are still used. However, various methods based on physical principles have gradually become more and more important. One such method is neutron activation. When the sample is bombarded with neutrons it becomes radioactive and the various radioactive isotopes produced can be identified by the radiation they emit. From the measured intensity of the radiation one can calculate how much of a certain element that is present in the sample. Another possibility is to study the light emitted when the sample is excited in various ways. A spectroscopic investigation of the light can identify the chemical elements and allows also a determination of their concentration in the sample. In the same way, if a sample can be brought to emit X-rays, this radiation is also characteristic for the elements present and can be used to determine the elemental concentration. One such X-ray method which has been developed recently is PIXE. The name is an acronym for Particle Induced X-ray Emission and indicates the principle of the method. Particles in this context means heavy, charged particles such as protons and a-particles of rather high energy. Hence, in PIXE-analysis the sample is irradiated in the beam of an accelerator and the emitted X-rays are studied. (author)

  9. Reducing teacher stress and burnout in high-risk secondary schools in South Africa using transactional analysis

    Directory of Open Access Journals (Sweden)

    Sharon Mary Johnson

    2015-01-01

    Full Text Available One of a number of articles arising from PhD research, this paper focuses on the results of applying transactional analysis as one of three approaches to reducing stress and burnout for teachers in high-risk secondary schools in the gangland areas of the Cape Flats, Western Cape, South Africa. The other approaches were Trauma Release Exercises (TRE and Transpersonal Psychology (TP, and related articles on these and on the quantitative statistical analysis elements of this research are being disseminated elsewhere. A total of 43 teachers in three different schools took part in one intervention held weekly over 10 weeks for one and a half hours (15 hours in total at their school as part of staff development, with a control group of 20 teachers at a fourth school. Qualitative TA intervention questionnaire coding analysis and focus group post-intervention thematic analysis of the mixed-methods study are presented. Coding analysis focused on the intra- and inter-individual tools that impacted teachers, and it was found that TA generated self-awareness, self-help tools and a strong group connection. Thematic analysis gave insights into the physical, emotional and cognitive responses to stress and burnout interventions on the individual, interpersonal and organisational levels and revealed new perspectives on classroom competency, with teachers taking more responsibility for discipline in the classroom. The study gave insights into the well-being and coping of educators who survive in these challenging contexts, and it is proposed that TRE, TP and TA approaches can be incorporated, and possibly combined, into integrative and eclectic ways of dealing with complex psychological challenges of stress and burnout reduction in traumatic environments.

  10. Dependability Analysis Methods For Configurable Software

    International Nuclear Information System (INIS)

    Dahll, Gustav; Pulkkinen, Urho

    1996-01-01

    Configurable software systems are systems which are built up by standard software components in the same way as a hardware system is built up by standard hardware components. Such systems are often used in the control of NPPs, also in safety related applications. A reliability analysis of such systems is therefore necessary. This report discusses what configurable software is, and what is particular with respect to reliability assessment of such software. Two very commonly used techniques in traditional reliability analysis, viz. failure mode, effect and criticality analysis (FMECA) and fault tree analysis are investigated. A real example is used to illustrate the discussed methods. Various aspects relevant to the assessment of the software reliability in such systems are discussed. Finally some models for quantitative software reliability assessment applicable on configurable software systems are described. (author)

  11. Method and equipment for the analysis of gases

    International Nuclear Information System (INIS)

    Bailitis, E.

    1978-01-01

    The density of the gas is determined by the average molecular velocity. The gas and the reference gas flow at known pressure from one volume to the other through a Knudsen-flow, where for example, the pressure increase is measured. After a spontaneous change of the cross section of the Knudsen-flow the measurement is repeated and for example the density is determined from the measured values. A SIMS-Auger-vacuum chamber serves as device after the installation of two secondary valves. The tested gas is CCl 4 for example. The measurement method is also suitable for the gas analysis of coal gassing by means of the determination of the molecular weight. (RW) [de

  12. Fire hazard analysis at the first unit of the Ignalina nuclear power plant: 1. Analysis of fire prevention and ventilation systems and secondary effects

    International Nuclear Information System (INIS)

    Poskas, P.; Simonis, V.; Zujus, R. and others

    2004-01-01

    Evaluation of the fire prevention and ventilation systems and the secondary effects on safety at the Ignalina NPP from the point of view of fire hazard using computerized system is presented. Simplified screening algorithms for fire prevention, ventilation and the evaluation of secondary effects are developed, which allow accelerating fire hazard analysis at the Ignalina NPP. The analysis indicated that the fire prevention systems practically meet the national requirements and international recommendations for fire prevention. But it is necessary to introduce in separate rooms the measures improving fire prevention to guarantee the effective functioning of the ventilation systems and the reduction of the influence of secondary effects on safety. Computerized system of fire prevention and ventilation systems and evaluation of secondary effects on safety can be easily applied for fire hazard analysis at different big plants. (author)

  13. BALSA: integrated secondary analysis for whole-genome and whole-exome sequencing, accelerated by GPU

    Directory of Open Access Journals (Sweden)

    Ruibang Luo

    2014-06-01

    Full Text Available This paper reports an integrated solution, called BALSA, for the secondary analysis of next generation sequencing data; it exploits the computational power of GPU and an intricate memory management to give a fast and accurate analysis. From raw reads to variants (including SNPs and Indels, BALSA, using just a single computing node with a commodity GPU board, takes 5.5 h to process 50-fold whole genome sequencing (∼750 million 100 bp paired-end reads, or just 25 min for 210-fold whole exome sequencing. BALSA’s speed is rooted at its parallel algorithms to effectively exploit a GPU to speed up processes like alignment, realignment and statistical testing. BALSA incorporates a 16-genotype model to support the calling of SNPs and Indels and achieves competitive variant calling accuracy and sensitivity when compared to the ensemble of six popular variant callers. BALSA also supports efficient identification of somatic SNVs and CNVs; experiments showed that BALSA recovers all the previously validated somatic SNVs and CNVs, and it is more sensitive for somatic Indel detection. BALSA outputs variants in VCF format. A pileup-like SNAPSHOT format, while maintaining the same fidelity as BAM in variant calling, enables efficient storage and indexing, and facilitates the App development of downstream analyses. BALSA is available at: http://sourceforge.net/p/balsa.

  14. How does uncertainty shape patient experience in advanced illness? A secondary analysis of qualitative data.

    Science.gov (United States)

    Etkind, Simon Noah; Bristowe, Katherine; Bailey, Katharine; Selman, Lucy Ellen; Murtagh, Fliss Em

    2017-02-01

    Uncertainty is common in advanced illness but is infrequently studied in this context. If poorly addressed, uncertainty can lead to adverse patient outcomes. We aimed to understand patient experiences of uncertainty in advanced illness and develop a typology of patients' responses and preferences to inform practice. Secondary analysis of qualitative interview transcripts. Studies were assessed for inclusion and interviews were sampled using maximum-variation sampling. Analysis used a thematic approach with 10% of coding cross-checked to enhance reliability. Qualitative interviews from six studies including patients with heart failure, chronic obstructive pulmonary disease, renal disease, cancer and liver failure. A total of 30 transcripts were analysed. Median age was 75 (range, 43-95), 12 patients were women. The impact of uncertainty was frequently discussed: the main related themes were engagement with illness, information needs, patient priorities and the period of time that patients mainly focused their attention on (temporal focus). A typology of patient responses to uncertainty was developed from these themes. Uncertainty influences patient experience in advanced illness through affecting patients' information needs, preferences and future priorities for care. Our typology aids understanding of how patients with advanced illness respond to uncertainty. Assessment of these three factors may be a useful starting point to guide clinical assessment and shared decision making.

  15. Dynamic modeling of primary and secondary systems of IRIS reactor for transient analysis using SIMULINK

    International Nuclear Information System (INIS)

    Magalhaes, Mardson Alencar de Sa; Lira, Carlos Alberto Brayner de Oliveira; Silva, Mario Augusto Bezerra da

    2011-01-01

    The IRIS project has significantly advanced in the last few years in response to a demand for a new generation reactor, that could fulfill the essential requirements for a future nuclear power plant: better economics, safety-by-design, low proliferation risk and environmental sustainability. IRIS reactor is a integral type PWR in which all primary components are arranged inside the pressure vessel. This configuration involves important changes in relation to a conventional PWR. These changes require several studies to comply with the safe operational limits for the reactor. In this paper, a study has been conducted to develop a dynamic model (named MODIRIS) for transient analysis, implemented in the MATLAB'S software SIMULINK, allowing the analysis of IRIS behavior by considering the neutron point kinetics for power production. The methodology is based on generating a set of differential equations of neutronic and thermal-hydraulic balances which describes the dynamics of the primary circuit, as well as a set of differential equations describing the dynamics of secondary circuit. The equations and initialization parameters at full power were into the SIMULINK and the code was validated by the confrontation with RELAP simulations for a transient of feedwater reduction in the steam generators. (author)

  16. BALSA: integrated secondary analysis for whole-genome and whole-exome sequencing, accelerated by GPU.

    Science.gov (United States)

    Luo, Ruibang; Wong, Yiu-Lun; Law, Wai-Chun; Lee, Lap-Kei; Cheung, Jeanno; Liu, Chi-Man; Lam, Tak-Wah

    2014-01-01

    This paper reports an integrated solution, called BALSA, for the secondary analysis of next generation sequencing data; it exploits the computational power of GPU and an intricate memory management to give a fast and accurate analysis. From raw reads to variants (including SNPs and Indels), BALSA, using just a single computing node with a commodity GPU board, takes 5.5 h to process 50-fold whole genome sequencing (∼750 million 100 bp paired-end reads), or just 25 min for 210-fold whole exome sequencing. BALSA's speed is rooted at its parallel algorithms to effectively exploit a GPU to speed up processes like alignment, realignment and statistical testing. BALSA incorporates a 16-genotype model to support the calling of SNPs and Indels and achieves competitive variant calling accuracy and sensitivity when compared to the ensemble of six popular variant callers. BALSA also supports efficient identification of somatic SNVs and CNVs; experiments showed that BALSA recovers all the previously validated somatic SNVs and CNVs, and it is more sensitive for somatic Indel detection. BALSA outputs variants in VCF format. A pileup-like SNAPSHOT format, while maintaining the same fidelity as BAM in variant calling, enables efficient storage and indexing, and facilitates the App development of downstream analyses. BALSA is available at: http://sourceforge.net/p/balsa.

  17. Cask crush pad analysis using detailed and simplified analysis methods

    International Nuclear Information System (INIS)

    Uldrich, E.D.; Hawkes, B.D.

    1997-01-01

    A crush pad has been designed and analyzed to absorb the kinetic energy of a hypothetically dropped spent nuclear fuel shipping cask into a 44-ft. deep cask unloading pool at the Fluorinel and Storage Facility (FAST). This facility, located at the Idaho Chemical Processing Plant (ICPP) at the Idaho national Engineering and Environmental Laboratory (INEEL), is a US Department of Energy site. The basis for this study is an analysis by Uldrich and Hawkes. The purpose of this analysis was to evaluate various hypothetical cask drop orientations to ensure that the crush pad design was adequate and the cask deceleration at impact was less than 100 g. It is demonstrated herein that a large spent fuel shipping cask, when dropped onto a foam crush pad, can be analyzed by either hand methods or by sophisticated dynamic finite element analysis using computer codes such as ABAQUS. Results from the two methods are compared to evaluate accuracy of the simplified hand analysis approach

  18. LC-MS based analysis of secondary metabolites from Chaetomium and Stachybotrys growth in indoor environments

    DEFF Research Database (Denmark)

    Dosen, Ina

    of causing negative health impact. With this in mind, a prime goal of this PhD study was to develop and optimize methods for qualitative and semi-quantitative analysis of secondary metabolites and bioactive compounds produced by Stachybotrys spp. and Chaetomium spp. The main analytical technique used...... and not included in the library, as well as tentatively identified compounds. Metabolite profiling of Stachybotrys spp. and Chaetomium spp. was performed in pure agar cultures. Thereafter, mapped secondary metabolites were screened for in extracts of artificially inoculated building materials and materials from...... analytical tools were applied to the analysis of naturally contaminated building materials, where presence of all previously mapped metabolites was confirmed. Work done on Stachybotrys spp showed no significant difference in metabolite profiles obtained in vitro and in vivo. Concurrently the study...

  19. Advanced Analysis Methods in High Energy Physics

    Energy Technology Data Exchange (ETDEWEB)

    Pushpalatha C. Bhat

    2001-10-03

    During the coming decade, high energy physics experiments at the Fermilab Tevatron and around the globe will use very sophisticated equipment to record unprecedented amounts of data in the hope of making major discoveries that may unravel some of Nature's deepest mysteries. The discovery of the Higgs boson and signals of new physics may be around the corner. The use of advanced analysis techniques will be crucial in achieving these goals. The author discusses some of the novel methods of analysis that could prove to be particularly valuable for finding evidence of any new physics, for improving precision measurements and for exploring parameter spaces of theoretical models.

  20. Spatial Analysis Methods of Road Traffic Collisions

    DEFF Research Database (Denmark)

    Loo, Becky P. Y.; Anderson, Tessa Kate

    Spatial Analysis Methods of Road Traffic Collisions centers on the geographical nature of road crashes, and uses spatial methods to provide a greater understanding of the patterns and processes that cause them. Written by internationally known experts in the field of transport geography, the book...... outlines the key issues in identifying hazardous road locations (HRLs), considers current approaches used for reducing and preventing road traffic collisions, and outlines a strategy for improved road safety. The book covers spatial accuracy, validation, and other statistical issues, as well as link...

  1. Simple gas chromatographic method for furfural analysis.

    Science.gov (United States)

    Gaspar, Elvira M S M; Lopes, João F

    2009-04-03

    A new, simple, gas chromatographic method was developed for the direct analysis of 5-hydroxymethylfurfural (5-HMF), 2-furfural (2-F) and 5-methylfurfural (5-MF) in liquid and water soluble foods, using direct immersion SPME coupled to GC-FID and/or GC-TOF-MS. The fiber (DVB/CAR/PDMS) conditions were optimized: pH effect, temperature, adsorption and desorption times. The method is simple and accurate (RSDfurfurals will contribute to characterise and quantify their presence in the human diet.

  2. The Threat of Unexamined Secondary Data: A Critical Race Transformative Convergent Mixed Methods

    Science.gov (United States)

    Garcia, Nichole M.; Mayorga, Oscar J.

    2018-01-01

    This article uses a critical race theory framework to conceptualize a Critical Race Transformative Convergent Mixed Methods (CRTCMM) in education. CRTCMM is a methodology that challenges normative educational research practices by acknowledging that racism permeates educational institutions and marginalizes Communities of Color. The focus of this…

  3. Teaching Basic Quantum Mechanics in Secondary School Using Concepts of Feynman Path Integrals Method

    Science.gov (United States)

    Fanaro, Maria de los Angeles; Otero, Maria Rita; Arlego, Marcelo

    2012-01-01

    This paper discusses the teaching of basic quantum mechanics in high school. Rather than following the usual formalism, our approach is based on Feynman's path integral method. Our presentation makes use of simulation software and avoids sophisticated mathematical formalism. (Contains 3 figures.)

  4. Teaching Politics in Secondary Education: Analyzing Instructional Methods from the 2008 Presidential Election

    Science.gov (United States)

    Journell, Wayne

    2011-01-01

    This article describes the instructional methods of four high school government teachers during their coverage of the 2008 presidential election. By analyzing the ways in which these teachers attempted to generate interest in the election and further their students' conceptualization of politics, the author seeks to better understand political…

  5. Teaching Two Basic Nanotechnology Concepts in Secondary School by Using a Variety of Teaching Methods

    Science.gov (United States)

    Blonder, Ron; Sakhnini, Sohair

    2012-01-01

    A nanotechnology module was developed for ninth grade students in the context of teaching chemistry. Two basic concepts in nanotechnology were chosen: (1) size and scale and (2) surface-area-to-volume ratio (SA/V). A wide spectrum of instructional methods (e.g., game-based learning, learning with multimedia, learning with models, project based…

  6. Appreciative Inquiry as a Method for Participatory Change in Secondary Schools in Lebanon

    Science.gov (United States)

    Shuayb, Maha

    2014-01-01

    Appreciative inquiry is a strategy which takes a positive approach to organizational development. It aims to identify good practice, design effective development plans, and ensure implementation. This article examines the potentials and limitations of using the appreciative inquiry in a mixed methods research design for developing school…

  7. An overview of translation in language teaching methods: implications for EFL in secondary education in the region of Murcia

    Directory of Open Access Journals (Sweden)

    Teresa Marqués Aguado

    2013-07-01

    Full Text Available Various activities and resources have been used across time to promote and enhance the learning of foreign languages. Among these, translation has been cherished or dismissed depending on the preferred teaching method at each period. With the arrival of the Communicative approach, which focuses on communicative competence, its role has apparently become even more unstable.This article seeks to explore the role of translation in the main teaching methods used in Spain. This will in turn serve as the background against which the current educational scenario (with the communicative approach and the tenets of the Common European Framework of Reference for Languages will be measured with a view to ascertaining the role that translation may currently play. The particular situation of Secondary Education in the Region of Murcia will be discussed in the light of the curricula for this stage.

  8. Neutron activation analysis: principle and methods

    International Nuclear Information System (INIS)

    Reddy, A.V.R.; Acharya, R.

    2006-01-01

    Neutron activation analysis (NAA) is a powerful isotope specific nuclear analytical technique for simultaneous determination of elemental composition of major, minor and trace elements in diverse matrices. The technique is capable of yielding high analytical sensitivity and low detection limits (ppm to ppb). Due to high penetration power of neutrons and gamma rays, NAA experiences negligible matrix effects in the samples of different origins. Depending on the sample matrix and element of interest NAA technique is used non-destructively, known as instrumental neutron activation analysis (INAA), or through chemical NAA methods. The present article describes principle of NAA, different methods and gives a overview some applications in the fields like environment, biology, geology, material sciences, nuclear technology and forensic sciences. (author)

  9. Digital dream analysis: a revised method.

    Science.gov (United States)

    Bulkeley, Kelly

    2014-10-01

    This article demonstrates the use of a digital word search method designed to provide greater accuracy, objectivity, and speed in the study of dreams. A revised template of 40 word search categories, built into the website of the Sleep and Dream Database (SDDb), is applied to four "classic" sets of dreams: The male and female "Norm" dreams of Hall and Van de Castle (1966), the "Engine Man" dreams discussed by Hobson (1988), and the "Barb Sanders Baseline 250" dreams examined by Domhoff (2003). A word search analysis of these original dream reports shows that a digital approach can accurately identify many of the same distinctive patterns of content found by previous investigators using much more laborious and time-consuming methods. The results of this study emphasize the compatibility of word search technologies with traditional approaches to dream content analysis. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Numerical methods and analysis of multiscale problems

    CERN Document Server

    Madureira, Alexandre L

    2017-01-01

    This book is about numerical modeling of multiscale problems, and introduces several asymptotic analysis and numerical techniques which are necessary for a proper approximation of equations that depend on different physical scales. Aimed at advanced undergraduate and graduate students in mathematics, engineering and physics – or researchers seeking a no-nonsense approach –, it discusses examples in their simplest possible settings, removing mathematical hurdles that might hinder a clear understanding of the methods. The problems considered are given by singular perturbed reaction advection diffusion equations in one and two-dimensional domains, partial differential equations in domains with rough boundaries, and equations with oscillatory coefficients. This work shows how asymptotic analysis can be used to develop and analyze models and numerical methods that are robust and work well for a wide range of parameters.

  11. Qualitative data analysis a methods sourcebook

    CERN Document Server

    Miles, Matthew B; Saldana, Johnny

    2014-01-01

    The Third Edition of Miles & Huberman's classic research methods text is updated and streamlined by Johnny SaldaNa, author of The Coding Manual for Qualitative Researchers. Several of the data display strategies from previous editions are now presented in re-envisioned and reorganized formats to enhance reader accessibility and comprehension. The Third Edition's presentation of the fundamentals of research design and data management is followed by five distinct methods of analysis: exploring, describing, ordering, explaining, and predicting. Miles and Huberman's original research studies are profiled and accompanied with new examples from SaldaNa's recent qualitative work. The book's most celebrated chapter, "Drawing and Verifying Conclusions," is retained and revised, and the chapter on report writing has been greatly expanded, and is now called "Writing About Qualitative Research." Comprehensive and authoritative, Qualitative Data Analysis has been elegantly revised for a new generation of qualitative r...

  12. An exergy method for compressor performance analysis

    Energy Technology Data Exchange (ETDEWEB)

    McGovern, J A; Harte, S [Trinity Coll., Dublin (Ireland)

    1995-07-01

    An exergy method for compressor performance analysis is presented. The purpose of this is to identify and quantify defects in the use of a compressor`s shaft power. This information can be used as the basis for compressor design improvements. The defects are attributed to friction, irreversible heat transfer, fluid throttling, and irreversible fluid mixing. They are described, on a common basis, as exergy destruction rates and their locations are identified. The method can be used with any type of positive displacement compressor. It is most readily applied where a detailed computer simulation program is available for the compressor. An analysis of an open reciprocating refrigeration compressor that used R12 refrigerant is given as an example. The results that are presented consist of graphs of the instantaneous rates of exergy destruction according to the mechanisms involved, a pie chart of the breakdown of the average shaft power wastage by mechanism, and a pie chart with a breakdown by location. (author)

  13. Formation of secondary phases during deep geological final disposal of research reactor fuel elements. Structure and phase analysis

    International Nuclear Information System (INIS)

    Neumann, Andreas

    2012-01-01

    For the assessment of a confident und sustainable final disposal of high level radioactive waste - fuel elements of german research reactors also account for such waste - in suitable, deep geological facilities, processes of the alteration of the disposed of waste and therefore the formation of the corrosion products, i. e. secondary phases must be well understood considering an accident scenario of a potential water inflow. In order to obtain secondary phases non-irradiated research reactor fuel elements (FR-BE) consisting of UAl x -Al were subjected to magnesium chloride rich brine (brine 2, salt repository) and to clay pore solution, respectively and furthermore of the type U 3 Si 2 -Al were solely subjected to magnesium chloride rich brine. Considering environmental aspects of final repositories the test conditions of the corrosion experiments were adjusted in a way that the temperature was kept constant at 90 C and a reducing anaerobic environment was ensured. As major objective of this research secondary phases, obtained from the autoclave experiments after appropriate processing and grain size separation have been identified and quantified. Powder X-ray diffraction (PXRD) and the application of Rietveld refinement methods allowed the identification of the corrosion products and a quantitative assessment of crystalline and amorphous contents. Scanning and transmission electron microscopy were additionally applied as a complementary method for the characterisation of the secondary phases. The qualitative phase analysis of the preprocessed secondary phases of the systems UAl x -Al and U 3 Si 2 -Al in brine 2 shows many similarities. Lesukite - an aluminium chloro hydrate - was observed for the first time considering the given experimental conditions. Further on different layered structures of the LDH type, iron oxyhydroxide and possibly iron chlorides, uncorroded residues of nuclear fuel and elementary iron were identified as well. Depending on preceding

  14. Methods for genetic linkage analysis using trisomies.

    OpenAIRE

    Feingold, E; Lamb, N E; Sherman, S L

    1995-01-01

    Certain genetic disorders are rare in the general population, but more common in individuals with specific trisomies. Examples of this include leukemia and duodenal atresia in trisomy 21. This paper presents a linkage analysis method for using trisomic individuals to map genes for such traits. It is based on a very general gene-specific dosage model that posits that the trait is caused by specific effects of different alleles at one or a few loci and that duplicate copies of "susceptibility" ...

  15. Machine Learning Methods for Production Cases Analysis

    Science.gov (United States)

    Mokrova, Nataliya V.; Mokrov, Alexander M.; Safonova, Alexandra V.; Vishnyakov, Igor V.

    2018-03-01

    Approach to analysis of events occurring during the production process were proposed. Described machine learning system is able to solve classification tasks related to production control and hazard identification at an early stage. Descriptors of the internal production network data were used for training and testing of applied models. k-Nearest Neighbors and Random forest methods were used to illustrate and analyze proposed solution. The quality of the developed classifiers was estimated using standard statistical metrics, such as precision, recall and accuracy.

  16. Safety relief valve alternate analysis method

    International Nuclear Information System (INIS)

    Adams, R.H.; Javid, A.; Khatua, T.P.

    1981-01-01

    An experimental test program was started in the United States in 1976 to define and quantify Safety Relief Valve (SRV) phenomena in General Electric Mark I Suppression Chambers. The testing considered several discharged devices and was used to correlate SRV load prediction models. The program was funded by utilities with Mark I containments and has resulted in a detailed SRV load definition as a portion of the Mark I containment program Load Definition Report (LDR). The (USNRC) has reviewed and approved the LDR SRV load definition. In addition, the USNRC has permitted calibration of structural models used for predicting torus response to SRV loads. Model calibration is subject to confirmatory in-plant testing. The SRV methodology given in the LDR requires that transient dynamic pressures be applied to a torus structural model that includes a fluid added mass matrix. Preliminary evaluations of torus response have indicated order of magnitude conservatisms, with respect to test results, which could result in unrealistic containment modifications. In addition, structural response trends observed in full-scale tests between cold pipe, first valve actuation and hot pipe, subsequent valve actuation conditions have not been duplicated using current analysis methods. It was suggested by others that an energy approach using current fluid models be utilized to define loads. An alternate SRV analysis method is defined to correct suppression chamber structural response to a level that permits economical but conservative design. Simple analogs are developed for the purpose of correcting the analytical response obtained from LDR analysis methods. Analogs evaluated considered forced vibration and free vibration structural response. The corrected response correlated well with in-plant test response. The correlation of the analytical model at test conditions permits application of the alternate analysis method at design conditions. (orig./HP)

  17. Analysis and comparison of biometric methods

    OpenAIRE

    Zatloukal, Filip

    2011-01-01

    The thesis deals with biometrics and biometric systems and the possibility to use these systems in the enterprise. Aim of this study is an analysis and description of selected types of biometric identification methods and their advantages and shortcomings. The work is divided into two parts. The first part is theoretical, describes the basic concepts of biometrics, biometric identification criteria, currently used identification systems, the ways of biometric systems use, performance measurem...

  18. The classification of secondary colorectal liver cancer in human biopsy samples using angular dispersive x-ray diffraction and multivariate analysis

    International Nuclear Information System (INIS)

    Theodorakou, Chrysoula; Farquharson, Michael J

    2009-01-01

    The motivation behind this study is to assess whether angular dispersive x-ray diffraction (ADXRD) data, processed using multivariate analysis techniques, can be used for classifying secondary colorectal liver cancer tissue and normal surrounding liver tissue in human liver biopsy samples. The ADXRD profiles from a total of 60 samples of normal liver tissue and colorectal liver metastases were measured using a synchrotron radiation source. The data were analysed for 56 samples using nonlinear peak-fitting software. Four peaks were fitted to all of the ADXRD profiles, and the amplitude, area, amplitude and area ratios for three of the four peaks were calculated and used for the statistical and multivariate analysis. The statistical analysis showed that there are significant differences between all the peak-fitting parameters and ratios between the normal and the diseased tissue groups. The technique of soft independent modelling of class analogy (SIMCA) was used to classify normal liver tissue and colorectal liver metastases resulting in 67% of the normal tissue samples and 60% of the secondary colorectal liver tissue samples being classified correctly. This study has shown that the ADXRD data of normal and secondary colorectal liver cancer are statistically different and x-ray diffraction data analysed using multivariate analysis have the potential to be used as a method of tissue classification.

  19. Statistical trend analysis methods for temporal phenomena

    International Nuclear Information System (INIS)

    Lehtinen, E.; Pulkkinen, U.; Poern, K.

    1997-04-01

    We consider point events occurring in a random way in time. In many applications the pattern of occurrence is of intrinsic interest as indicating a trend or some other systematic feature in the rate of occurrence. The purpose of this report is to survey briefly different statistical trend analysis methods and illustrate their applicability to temporal phenomena in particular. The trend testing of point events is usually seen as the testing of the hypotheses concerning the intensity of the occurrence of events. When the intensity function is parametrized, the testing of trend is a typical parametric testing problem. In industrial applications the operational experience generally does not suggest any specified model and method in advance. Therefore, and particularly, if the Poisson process assumption is very questionable, it is desirable to apply tests that are valid for a wide variety of possible processes. The alternative approach for trend testing is to use some non-parametric procedure. In this report we have presented four non-parametric tests: The Cox-Stuart test, the Wilcoxon signed ranks test, the Mann test, and the exponential ordered scores test. In addition to the classical parametric and non-parametric approaches we have also considered the Bayesian trend analysis. First we discuss a Bayesian model, which is based on a power law intensity model. The Bayesian statistical inferences are based on the analysis of the posterior distribution of the trend parameters, and the probability of trend is immediately seen from these distributions. We applied some of the methods discussed in an example case. It should be noted, that this report is a feasibility study rather than a scientific evaluation of statistical methods, and the examples can only be seen as demonstrations of the methods

  20. Statistical trend analysis methods for temporal phenomena

    Energy Technology Data Exchange (ETDEWEB)

    Lehtinen, E.; Pulkkinen, U. [VTT Automation, (Finland); Poern, K. [Poern Consulting, Nykoeping (Sweden)

    1997-04-01

    We consider point events occurring in a random way in time. In many applications the pattern of occurrence is of intrinsic interest as indicating a trend or some other systematic feature in the rate of occurrence. The purpose of this report is to survey briefly different statistical trend analysis methods and illustrate their applicability to temporal phenomena in particular. The trend testing of point events is usually seen as the testing of the hypotheses concerning the intensity of the occurrence of events. When the intensity function is parametrized, the testing of trend is a typical parametric testing problem. In industrial applications the operational experience generally does not suggest any specified model and method in advance. Therefore, and particularly, if the Poisson process assumption is very questionable, it is desirable to apply tests that are valid for a wide variety of possible processes. The alternative approach for trend testing is to use some non-parametric procedure. In this report we have presented four non-parametric tests: The Cox-Stuart test, the Wilcoxon signed ranks test, the Mann test, and the exponential ordered scores test. In addition to the classical parametric and non-parametric approaches we have also considered the Bayesian trend analysis. First we discuss a Bayesian model, which is based on a power law intensity model. The Bayesian statistical inferences are based on the analysis of the posterior distribution of the trend parameters, and the probability of trend is immediately seen from these distributions. We applied some of the methods discussed in an example case. It should be noted, that this report is a feasibility study rather than a scientific evaluation of statistical methods, and the examples can only be seen as demonstrations of the methods. 14 refs, 10 figs.

  1. Analysis Method for Integrating Components of Product

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Jun Ho [Inzest Co. Ltd, Seoul (Korea, Republic of); Lee, Kun Sang [Kookmin Univ., Seoul (Korea, Republic of)

    2017-04-15

    This paper presents some of the methods used to incorporate the parts constituting a product. A new relation function concept and its structure are introduced to analyze the relationships of component parts. This relation function has three types of information, which can be used to establish a relation function structure. The relation function structure of the analysis criteria was established to analyze and present the data. The priority components determined by the analysis criteria can be integrated. The analysis criteria were divided based on their number and orientation, as well as their direct or indirect characteristic feature. This paper presents a design algorithm for component integration. This algorithm was applied to actual products, and the components inside the product were integrated. Therefore, the proposed algorithm was used to conduct research to improve the brake discs for bicycles. As a result, an improved product similar to the related function structure was actually created.

  2. Analysis Method for Integrating Components of Product

    International Nuclear Information System (INIS)

    Choi, Jun Ho; Lee, Kun Sang

    2017-01-01

    This paper presents some of the methods used to incorporate the parts constituting a product. A new relation function concept and its structure are introduced to analyze the relationships of component parts. This relation function has three types of information, which can be used to establish a relation function structure. The relation function structure of the analysis criteria was established to analyze and present the data. The priority components determined by the analysis criteria can be integrated. The analysis criteria were divided based on their number and orientation, as well as their direct or indirect characteristic feature. This paper presents a design algorithm for component integration. This algorithm was applied to actual products, and the components inside the product were integrated. Therefore, the proposed algorithm was used to conduct research to improve the brake discs for bicycles. As a result, an improved product similar to the related function structure was actually created.

  3. Probabilistic methods in fire-risk analysis

    International Nuclear Information System (INIS)

    Brandyberry, M.D.

    1989-01-01

    The first part of this work outlines a method for assessing the frequency of ignition of a consumer product in a building and shows how the method would be used in an example scenario utilizing upholstered furniture as the product and radiant auxiliary heating devices (electric heaters, wood stoves) as the ignition source. Deterministic thermal models of the heat-transport processes are coupled with parameter uncertainty analysis of the models and with a probabilistic analysis of the events involved in a typical scenario. This leads to a distribution for the frequency of ignition for the product. In second part, fire-risk analysis as currently used in nuclear plants is outlines along with a discussion of the relevant uncertainties. The use of the computer code COMPBRN is discussed for use in the fire-growth analysis along with the use of response-surface methodology to quantify uncertainties in the code's use. Generalized response surfaces are developed for temperature versus time for a cable tray, as well as a surface for the hot gas layer temperature and depth for a room of arbitrary geometry within a typical nuclear power plant compartment. These surfaces are then used to simulate the cable tray damage time in a compartment fire experiment

  4. Multiple methods of surgical treatment combined with primary IOL implantation on traumatic lens subluxation/dislocation in patients with secondary glaucoma

    OpenAIRE

    Wang, Rui; Bi, Chun-Chao; Lei, Chun-Ling; Sun, Wen-Tao; Wang, Shan-Shan; Dong, Xiao-Juan

    2014-01-01

    AIM:To describe clinical findings and complications from cases of traumatic lens subluxation/dislocation in patients with secondary glaucoma, and discuss the multiple treating methods of operation combined with primary intraocular lens (IOL) implantation.METHODS:Non-comparative retrospective observational case series. Participants:30 cases (30 eyes) of lens subluxation/dislocation in patients with secondary glaucoma were investigated which accepted the surgical treatment by author in the Opht...

  5. An unconventional method of quantitative microstructural analysis

    International Nuclear Information System (INIS)

    Rastani, M.

    1995-01-01

    The experiment described here introduces a simple methodology which could be used to replace the time-consuming and expensive conventional methods of metallographic and quantitative analysis of thermal treatment effect on microstructure. The method is ideal for the microstructural evaluation of tungsten filaments and other wire samples such as copper wire which can be conveniently coiled. Ten such samples were heat treated by ohmic resistance at temperatures which were expected to span the recrystallization range. After treatment, the samples were evaluated in the elastic recovery test. The normalized elastic recovery factor was defined in terms of these deflections. Experimentally it has shown that elastic recovery factor depends on the degree of recrystallization. In other words this factor is used to determine the fraction of unrecrystallized material. Because the elastic recovery method examines the whole filament rather than just one section through the filament as in metallographical method, it more accurately measures the degree of recrystallization. The method also takes a considerably shorter time and cost compared to the conventional method

  6. Homotopy analysis method for neutron diffusion calculations

    International Nuclear Information System (INIS)

    Cavdar, S.

    2009-01-01

    The Homotopy Analysis Method (HAM), proposed in 1992 by Shi Jun Liao and has been developed since then, is based on a fundamental concept in differential geometry and topology, the homotopy. It has proved useful for problems involving algebraic, linear/non-linear, ordinary/partial differential and differential-integral equations being an analytic, recursive method that provides a series sum solution. It has the advantage of offering a certain freedom for the choice of its arguments such as the initial guess, the auxiliary linear operator and the convergence control parameter, and it allows us to effectively control the rate and region of convergence of the series solution. HAM is applied for the fixed source neutron diffusion equation in this work, which is a part of our research motivated by the question of whether methods for solving the neutron diffusion equation that yield straightforward expressions but able to provide a solution of reasonable accuracy exist such that we could avoid analytic methods that are widely used but either fail to solve the problem or provide solutions through many intricate expressions that are likely to contain mistakes or numerical methods that require powerful computational resources and advanced programming skills due to their very nature or intricate mathematical fundamentals. Fourier basis are employed for expressing the initial guess due to the structure of the problem and its boundary conditions. We present the results in comparison with other widely used methods of Adomian Decomposition and Variable Separation.

  7. Application of Cluster Analysis in Assessment of Dietary Habits of Secondary School Students

    Directory of Open Access Journals (Sweden)

    Zalewska Magdalena

    2014-12-01

    Full Text Available Maintenance of proper health and prevention of diseases of civilization are now significant public health problems. Nutrition is an important factor in the development of youth, as well as the current and future state of health. The aim of the study was to show the benefits of the application of cluster analysis to assess the dietary habits of high school students. The survey was carried out on 1,631 eighteen-year-old students in seven randomly selected secondary schools in Bialystok using a self-prepared anonymous questionnaire. An evaluation of the time of day meals were eaten and the number of meals consumed was made for the surveyed students. The cluster analysis allowed distinguishing characteristic structures of dietary habits in the observed population. Four clusters were identified, which were characterized by relative internal homogeneity and substantial variation in terms of the number of meals during the day and the time of their consumption. The most important characteristics of cluster 1 were cumulated food ration in 2 or 3 meals and long intervals between meals. Cluster 2 was characterized by eating the recommended number of 4 or 5 meals a day. In the 3rd cluster, students ate 3 meals a day with large intervals between them, and in the 4th they had four meals a day while maintaining proper intervals between them. In all clusters dietary mistakes occurred, but most of them were related to clusters 1 and 3. Cluster analysis allowed for the identification of major flaws in nutrition, which may include irregular eating and skipping meals, and indicated possible connections between eating patterns and disturbances of body weight in the examined population.

  8. Detector Simulation: Data Treatment and Analysis Methods

    CERN Document Server

    Apostolakis, J

    2011-01-01

    Detector Simulation in 'Data Treatment and Analysis Methods', part of 'Landolt-Börnstein - Group I Elementary Particles, Nuclei and Atoms: Numerical Data and Functional Relationships in Science and Technology, Volume 21B1: Detectors for Particles and Radiation. Part 1: Principles and Methods'. This document is part of Part 1 'Principles and Methods' of Subvolume B 'Detectors for Particles and Radiation' of Volume 21 'Elementary Particles' of Landolt-Börnstein - Group I 'Elementary Particles, Nuclei and Atoms'. It contains the Section '4.1 Detector Simulation' of Chapter '4 Data Treatment and Analysis Methods' with the content: 4.1 Detector Simulation 4.1.1 Overview of simulation 4.1.1.1 Uses of detector simulation 4.1.2 Stages and types of simulation 4.1.2.1 Tools for event generation and detector simulation 4.1.2.2 Level of simulation and computation time 4.1.2.3 Radiation effects and background studies 4.1.3 Components of detector simulation 4.1.3.1 Geometry modeling 4.1.3.2 External fields 4.1.3.3 Intro...

  9. Data Analysis Methods for Library Marketing

    Science.gov (United States)

    Minami, Toshiro; Kim, Eunja

    Our society is rapidly changing to information society, where the needs and requests of the people on information access are different widely from person to person. Library's mission is to provide its users, or patrons, with the most appropriate information. Libraries have to know the profiles of their patrons, in order to achieve such a role. The aim of library marketing is to develop methods based on the library data, such as circulation records, book catalogs, book-usage data, and others. In this paper we discuss the methodology and imporatnce of library marketing at the beginning. Then we demonstrate its usefulness through some examples of analysis methods applied to the circulation records in Kyushu University and Guacheon Library, and some implication that obtained as the results of these methods. Our research is a big beginning towards the future when library marketing is an unavoidable tool.

  10. An investigation of liquid secondary ion and laser desorption mass spectroscopy for the analysis of planar chromatograms

    Energy Technology Data Exchange (ETDEWEB)

    Dunphy, J.C.

    1990-11-01

    In the work described in this dissertation, interfaces between two mass spectrometric methods, liquid secondary ion mass spectrometry (LSIMS) and laser desorption/ionization Fourier transform mass spectrometry (LD/FTMS), and thin-layer chromatography (TLC) and slab gel electrophoresis were developed for bioanalytical applications. In an investigation of direct LSIMS for TLC analysis (TLC/LSIMS), mass spectra of bile acids and bile salts were characterized directly from high-performance TLC plates. The scanning ability of the LSIMS instrument was used to generate spatial profiles of the characteristic bile acid ions in the mass spectra. A procedure for the analysis of bile salts in dog bile was developed involving an extraction step, followed by TLC separation and direct TLC/LSIMS detection and semi-quantitation. For peptides, an experiment called selected-sequence monitoring'' was developed to locate target peptides related in structure in complex mixtures developed on TLC plates. Ions characteristic of the bradykinin and enkephalin peptides were used to generate spatial profiles of members of those peptide families on TLC plates. Using a Fourier transform mass spectrometer (FTMS), a fundamental investigation was conducted into the factors affecting the quality of analytical data obtained using direct laser desorption/ionization to produce mass spectra from TLC plates.

  11. Halide salts and their structural properties in presence of secondary amine based molecule: A combined experimental and theoretical analysis

    Science.gov (United States)

    Ghosh, Pritam; Hazra, Abhijit; Ghosh, Meenakshi; Chandra Murmu, Naresh; Banerjee, Priyabrata

    2018-04-01

    Biologically relevant halide salts and its solution state structural properties are always been significant. In general, exposure of halide salts into polar solution medium results in solvation which in turn separates the cationic and anionic part of the salt. However, the conventional behaviour of salts might alter in presence of any secondary amine based compound, i.e.; moderately strong Lewis acid. In its consequence, to investigate the effect of secondary amine based compound in the salt solution, novel (E)-2-(4-bromobenzylidene)-1-(perfluorophenyl) hydrazine has been synthesized and used as secondary amine source. The secondary amine compound interestingly shows a drastic color change upon exposure to fluoride salts owing to hydrogen bonding interaction. Several experimental methods, e.g.; SCXRD, UV-Vis, FT-IR, ESI-MS and DLS together with modern DFT (i.e.; DFT-D3) have been performed to explore the structural properties of the halide salts upon exposure to secondary amine based compound. The effect of counter cation of the fluoride salt in binding with secondary amine source has also been investigated.

  12. Phosphorus analysis in milk samples by neutron activation analysis method

    International Nuclear Information System (INIS)

    Oliveira, R.M. de; Cunha, I.I.L.

    1991-01-01

    The determination of phosphorus in milk samples by instrumental thermal neutron activation analysis is described. The procedure involves a short irradiation in a nuclear reactor and measurement of the beta radiation emitted by phosphorus - 32 after a suitable decay period. The sources of error were studied and the established method was applied to standard reference materials of known phosphorus content. (author)

  13. Secondary School Fee Inflation: An Analysis of Private High Schools in Victoria, Australia

    Science.gov (United States)

    Lye, Jenny; Hirschberg, Joe

    2017-01-01

    The recent growth in privately administered secondary education in many developed countries has been a widely observed phenomenon. The Australian private secondary school sector has grown faster than those in any other "OECD" nation, even though the average tuition fees charged by these schools have increased at double the nation's…

  14. Presentation and analysis of a general algorithm for risk-assessment on secondary poisoning

    NARCIS (Netherlands)

    Romijn CAFM; Luttik R; van de Meent D; Slooff W; Canton JH

    1991-01-01

    The study in this report was carried out in the frame of the project "Evaluation system for new chemical substances". The aim of the study was to present a general algorithm for risk-assessment on secondary poisoning of birds and mammals. Risk-assessment on secondary poisoning can be an

  15. An analysis of the status of the secondary noun prefixes in Ndebele ...

    African Journals Online (AJOL)

    The article probes into the nature of secondary noun class prefixes in the morphology of some Nguni languages and Ndebele in particular. The secondary prefixes are known as commentary prefixes mainly because they carry overtones of sarcasm, criticism and caricature among other elements, through loading an implied ...

  16. COMPARATIVE ANALYSIS OF HEALTH IN STUDENTS OF SECONDARY SCHOOL DEPENDING ON THEIR MODE OF LIVING

    Directory of Open Access Journals (Sweden)

    N.B. Mirskaya

    2008-01-01

    Full Text Available 405 students of secondary school in Moscow, Kaliningrad and Murmansk took part in the testing. The correlation between poor health in students and mode of their living was shown. It's recommended to create unified standard of students education in the field of hygiene, breeding and healthy life style.Key words: secondary school students, health, life style.

  17. Association of Group Prenatal Care in US Family Medicine Residencies With Maternity Care Practice: A CERA Secondary Data Analysis.

    Science.gov (United States)

    Barr, Wendy B; Tong, Sebastian T; LeFevre, Nicholas M

    2017-03-01

    Group prenatal care has been shown to improve both maternal and neonatal outcomes. With increasing adaption of group prenatal care by family medicine residencies, this model may serve as a potential method to increase exposure to and interest in maternity care among trainees. This study aims to describe the penetration, regional and program variations, and potential impacts on future maternity care practice of group prenatal care in US family medicine residencies. The CAFM Educational Research Alliance (CERA) conducted a survey of all US family medicine residency program directors in 2013 containing questions about maternity care training. A secondary data analysis was completed to examine relevant data on group prenatal care in US family medicine residencies and maternity care practice patterns. 23.1% of family medicine residency programs report provision of group prenatal care. Programs with group prenatal care reported increased number of vaginal deliveries per resident. Controlling for average number of vaginal deliveries per resident, programs with group prenatal care had a 2.35 higher odds of having more than 10% of graduates practice obstetrics and a 2.93 higher odds of having at least one graduate in the past 5 years enter an obstetrics fellowship. Residency programs with group prenatal care models report more graduates entering OB fellowships and practicing maternity care. Implementing group prenatal care in residency training can be one method in a multifaceted approach to increasing maternity care practice among US family physicians.

  18. A Systematic Protein Refolding Screen Method using the DGR Approach Reveals that Time and Secondary TSA are Essential Variables.

    Science.gov (United States)

    Wang, Yuanze; van Oosterwijk, Niels; Ali, Ameena M; Adawy, Alaa; Anindya, Atsarina L; Dömling, Alexander S S; Groves, Matthew R

    2017-08-24

    Refolding of proteins derived from inclusion bodies is very promising as it can provide a reliable source of target proteins of high purity. However, inclusion body-based protein production is often limited by the lack of techniques for the detection of correctly refolded protein. Thus, the selection of the refolding conditions is mostly achieved using trial and error approaches and is thus a time-consuming process. In this study, we use the latest developments in the differential scanning fluorimetry guided refolding approach as an analytical method to detect correctly refolded protein. We describe a systematic buffer screen that contains a 96-well primary pH-refolding screen in conjunction with a secondary additive screen. Our research demonstrates that this approach could be applied for determining refolding conditions for several proteins. In addition, it revealed which "helper" molecules, such as arginine and additives are essential. Four different proteins: HA-RBD, MDM2, IL-17A and PD-L1 were used to validate our refolding approach. Our systematic protocol evaluates the impact of the "helper" molecules, the pH, buffer system and time on the protein refolding process in a high-throughput fashion. Finally, we demonstrate that refolding time and a secondary thermal shift assay buffer screen are critical factors for improving refolding efficiency.

  19. Analysis of energy-based algorithms for RNA secondary structure prediction

    Directory of Open Access Journals (Sweden)

    Hajiaghayi Monir

    2012-02-01

    Full Text Available Abstract Background RNA molecules play critical roles in the cells of organisms, including roles in gene regulation, catalysis, and synthesis of proteins. Since RNA function depends in large part on its folded structures, much effort has been invested in developing accurate methods for prediction of RNA secondary structure from the base sequence. Minimum free energy (MFE predictions are widely used, based on nearest neighbor thermodynamic parameters of Mathews, Turner et al. or those of Andronescu et al. Some recently proposed alternatives that leverage partition function calculations find the structure with maximum expected accuracy (MEA or pseudo-expected accuracy (pseudo-MEA methods. Advances in prediction methods are typically benchmarked using sensitivity, positive predictive value and their harmonic mean, namely F-measure, on datasets of known reference structures. Since such benchmarks document progress in improving accuracy of computational prediction methods, it is important to understand how measures of accuracy vary as a function of the reference datasets and whether advances in algorithms or thermodynamic parameters yield statistically significant improvements. Our work advances such understanding for the MFE and (pseudo-MEA-based methods, with respect to the latest datasets and energy parameters. Results We present three main findings. First, using the bootstrap percentile method, we show that the average F-measure accuracy of the MFE and (pseudo-MEA-based algorithms, as measured on our largest datasets with over 2000 RNAs from diverse families, is a reliable estimate (within a 2% range with high confidence of the accuracy of a population of RNA molecules represented by this set. However, average accuracy on smaller classes of RNAs such as a class of 89 Group I introns used previously in benchmarking algorithm accuracy is not reliable enough to draw meaningful conclusions about the relative merits of the MFE and MEA-based algorithms

  20. Potential impacts of the Alberta fetal alcohol spectrum disorder service networks on secondary disabilities: a cost-benefit analysis.

    Science.gov (United States)

    Thanh, Nguyen Xuan; Moffatt, Jessica; Jacobs, Philip; Chuck, Anderson W; Jonsson, Egon

    2013-01-01

    To estimate the break-even effectiveness of the Alberta Fetal Alcohol Spectrum Disorder (FASD) Service Networks in reducing occurrences of secondary disabilities associated with FASD. The secondary disabilities addressed within this study include crime, homelessness, mental health problems, and school disruption (for children) or unemployment (for adults). We used a cost-benefit analysis approach where benefits of the service networks were the cost difference between the two approaches: having the 12 service networks and having no service network in place, across Alberta. We used a threshold analysis to estimate the break-even effectiveness (i.e. the effectiveness level at which the service networks became cost-saving). If no network was in place throughout the province, the secondary disabilities would cost $22.85 million (including $8.62 million for adults and $14.24 million for children) per year. Given the cost of network was $6.12 million per year, the break-even effectiveness was estimated at 28% (range: 25% to 32%). Although not all benefits associated with the service networks are included, such as the exclusion of the primary benefit to those experiencing FASD, the benefits to FASD caregivers, and the preventative benefits, the economic and social burden associated with secondary disabilities will "pay-off" if the effectiveness of the program in reducing secondary disabilities is 28%.

  1. Secondary node analysis as an indicator for axillary lymphadenectomy in breast cancer patients.

    Science.gov (United States)

    Cremades, Manel; Torres, Mireia; Solà, Montse; Navinés, Jordi; Pascual, Icíar; Mariscal, Antonio; Caballero, Albert; Castellà, Eva; Luna, Miguel Ángel; Julián, Joan Francesc

    2017-11-01

    Currently, there is no agreement regarding if it would be necessary to perform an axillary lymph node dissection (ALND) in patients who have macrometastases in the sentinel lymph node (SLN). We studied the utility of the secondary node analysis (SN), defined as the following node after the SLN in an anatomical and lymphatic pathway, as a sign of malignant axillary involvement. An observational, retrospective and multicentre study was designed to assess the utility of the SN as a sign of axillary involvement. Among 2273 patients with breast cancer, a valid sample of 283 was obtained representing those who had the SN studied. Main endpoints of our study were: the SLN, the SN and the ALND histological pattern. Sensitivity, specificity and precision of the test were also calculated. SN test, in cases with positive SLN, has a sensitivity of 61.1%, a specificity of 78.7%, a positive predictive value of 45.8% and a negative predictive value of 87.3% with a precision of 74.7%. The study of the SN together with the technique of the SLN allows a more precise staging of the axillary involvement, in patients with breast cancer, than just the SLN technique. Copyright © 2017 AEC. Publicado por Elsevier España, S.L.U. All rights reserved.

  2. Performance Analysis and Optimization for Cognitive Radio Networks with Classified Secondary Users and Impatient Packets

    Directory of Open Access Journals (Sweden)

    Yuan Zhao

    2017-01-01

    Full Text Available A cognitive radio network with classified Secondary Users (SUs is considered. There are two types of SU packets, namely, SU1 packets and SU2 packets, in the system. The SU1 packets have higher priority than the SU2 packets. Considering the diversity of the SU packets and the real-time need of the interrupted SU packets, a novel spectrum allocation strategy with classified SUs and impatient packets is proposed. Based on the number of PU packets, SU1 packets, and SU2 packets in the system, by modeling the queue dynamics of the networks users as a three-dimensional discrete-time Markov chain, the transition probability matrix of the Markov chain is given. Then with the steady-state analysis, some important performance measures of the SU2 packets are derived to show the system performance with numerical results. Specially, in order to optimize the system actions of the SU2 packets, the individually optimal strategy and the socially optimal strategy for the SU2 packets are demonstrated. Finally, a pricing mechanism is provided to oblige the SU2 packets to follow the socially optimal strategy.

  3. Physician cooperation in outpatient cancer care. An amplified secondary analysis of qualitative interview data.

    Science.gov (United States)

    Engler, J; Güthlin, C; Dahlhaus, A; Kojima, E; Müller-Nordhorn, J; Weißbach, L; Holmberg, C

    2017-11-01

    The importance of outpatient cancer care services is increasing due to the growing number of patients having or having had cancer. However, little is known about cooperation among physicians in outpatient settings. To understand what inter- and multidisciplinary care means in community settings, we conducted an amplified secondary analysis that combined qualitative interview data with 42 general practitioners (GPs), 21 oncologists and 21 urologists that mainly worked in medical practices in Germany. We compared their perspectives on cooperation relationships in cancer care. Our results indicate that all participants regarded cooperation as a prerequisite for good cancer care. Oncologists and urologists mainly reported cooperating for tumour-specific treatment tasks, while GPs' reasoning for cooperation was more patient-centred. While oncologists and urologists reported experiencing reciprocal communication with other physicians, GPs had to gather the information they needed. GPs seldom reported engaging in formal cooperation structures, while for specialists, participation in formal spaces of cooperation, such as tumour boards, facilitated a more frequent and informal discussion of patients, for instance on the phone. Further research should focus on ways to foster GPs' integration in cancer care and evaluate if this can be reached by incorporating GPs in formal cooperation structures such as tumour boards. © 2017 John Wiley & Sons Ltd.

  4. Microbiological analysis of bile and its impact in critically ill patients with secondary sclerosing cholangitis.

    Science.gov (United States)

    Voigtländer, Torsten; Leuchs, Ensieh; Vonberg, Ralf-Peter; Solbach, Philipp; Manns, Michael P; Suerbaum, Sebastian; Lankisch, Tim O

    2015-05-01

    Secondary sclerosing cholangitis in critically ill patients (SSC-CIP) is an emerging disease entity with unfavourable outcome. Our aim was to analyze the microbial spectrum in bile of patients with SSC-CIP and to evaluate the potential impact on the empiric antibiotic treatment in these patients. 169 patients (72 patients with SSC-CIP and 97 patients with primary sclerosing cholangitis (PSC)) were included in a prospective observational study between 2010 and 2013. Bile was obtained during endoscopic retrograde cholangiography (ERC) and microbiologically analyzed. Patients with SSC displayed a significantly different microbiological profile in bile. Enterococcus faecium, Pseudomonas aeruginosa and non-albicans species of Candida were more frequent in SSC compared to patients with PSC (p bile (p = 0.001). The antimicrobial therapy was adjusted in 64% of patients due to resistance or presence of microorganisms not covered by the initial therapy regimen. Patients with SSC-CIP have a distinct microbial profile in bile. Difficult to treat organisms are frequent and an ERC with bile fluid collection for microbiological analysis should be considered in case of insufficient antimicrobial treatment. Copyright © 2015 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  5. Robust estimation for homoscedastic regression in the secondary analysis of case-control data

    KAUST Repository

    Wei, Jiawei

    2012-12-04

    Primary analysis of case-control studies focuses on the relationship between disease D and a set of covariates of interest (Y, X). A secondary application of the case-control study, which is often invoked in modern genetic epidemiologic association studies, is to investigate the interrelationship between the covariates themselves. The task is complicated owing to the case-control sampling, where the regression of Y on X is different from what it is in the population. Previous work has assumed a parametric distribution for Y given X and derived semiparametric efficient estimation and inference without any distributional assumptions about X. We take up the issue of estimation of a regression function when Y given X follows a homoscedastic regression model, but otherwise the distribution of Y is unspecified. The semiparametric efficient approaches can be used to construct semiparametric efficient estimates, but they suffer from a lack of robustness to the assumed model for Y given X. We take an entirely different approach. We show how to estimate the regression parameters consistently even if the assumed model for Y given X is incorrect, and thus the estimates are model robust. For this we make the assumption that the disease rate is known or well estimated. The assumption can be dropped when the disease is rare, which is typically so for most case-control studies, and the estimation algorithm simplifies. Simulations and empirical examples are used to illustrate the approach.

  6. Robust estimation for homoscedastic regression in the secondary analysis of case-control data

    KAUST Repository

    Wei, Jiawei; Carroll, Raymond J.; Mü ller, Ursula U.; Keilegom, Ingrid Van; Chatterjee, Nilanjan

    2012-01-01

    Primary analysis of case-control studies focuses on the relationship between disease D and a set of covariates of interest (Y, X). A secondary application of the case-control study, which is often invoked in modern genetic epidemiologic association studies, is to investigate the interrelationship between the covariates themselves. The task is complicated owing to the case-control sampling, where the regression of Y on X is different from what it is in the population. Previous work has assumed a parametric distribution for Y given X and derived semiparametric efficient estimation and inference without any distributional assumptions about X. We take up the issue of estimation of a regression function when Y given X follows a homoscedastic regression model, but otherwise the distribution of Y is unspecified. The semiparametric efficient approaches can be used to construct semiparametric efficient estimates, but they suffer from a lack of robustness to the assumed model for Y given X. We take an entirely different approach. We show how to estimate the regression parameters consistently even if the assumed model for Y given X is incorrect, and thus the estimates are model robust. For this we make the assumption that the disease rate is known or well estimated. The assumption can be dropped when the disease is rare, which is typically so for most case-control studies, and the estimation algorithm simplifies. Simulations and empirical examples are used to illustrate the approach.

  7. Exploring sources of biogenic secondary organic aerosol compounds using chemical analysis and the FLEXPART model

    Directory of Open Access Journals (Sweden)

    J. Martinsson

    2017-09-01

    Full Text Available Molecular tracers in secondary organic aerosols (SOAs can provide information on origin of SOA, as well as regional scale processes involved in their formation. In this study 9 carboxylic acids, 11 organosulfates (OSs and 2 nitrooxy organosulfates (NOSs were determined in daily aerosol particle filter samples from Vavihill measurement station in southern Sweden during June and July 2012. Several of the observed compounds are photo-oxidation products from biogenic volatile organic compounds (BVOCs. Highest average mass concentrations were observed for carboxylic acids derived from fatty acids and monoterpenes (12. 3 ± 15. 6 and 13. 8 ± 11. 6 ng m−3, respectively. The FLEXPART model was used to link nine specific surface types to single measured compounds. It was found that the surface category sea and ocean was dominating the air mass exposure (56 % but contributed to low mass concentration of observed chemical compounds. A principal component (PC analysis identified four components, where the one with highest explanatory power (49 % displayed clear impact of coniferous forest on measured mass concentration of a majority of the compounds. The three remaining PCs were more difficult to interpret, although azelaic, suberic, and pimelic acid were closely related to each other but not to any clear surface category. Hence, future studies should aim to deduce the biogenic sources and surface category of these compounds. This study bridges micro-level chemical speciation to air mass surface exposure at the macro level.

  8. Technological pedagogical content knowledge in South African mathematics classrooms: A secondary analysis of SITES 2006 data

    Directory of Open Access Journals (Sweden)

    Verona Leendertz

    2013-12-01

    Full Text Available This article reports on a secondary data analysis conducted on the South African mathematics teachers’ dataset of the Second Information Technology in Education Study (SITES 2006. The sample consisted of a stratified sample of 640 mathematics teachers from 504 randomly selected computer-using and non–computer-using schools that completed the SITES 2006 teachers’ questionnaire, which investigated their pedagogical use of Information Communication Technology (ICT. The purpose of the current investigation was to investigate the level of Technological Pedagogical Content Knowledge (TPACK of mathematics teachers, and how TPACK attributes contribute towards more effective Grade 8 mathematics teaching in South African schools, using the TPACK conceptual framework. The findings are presented according to the three clusters identified through the association between the main variables of the TPACK model and other variables on the SITES 2006 teachers’ questionnaire: (1 impact of ICT use, (2 teacher practices and (3 barriers. A Cramér V of between 0.3 and 0.4 was considered to signal a medium effect that tended towards practically significant association, and a Cramér V of 0.4 or larger was considered to signal a large effect with practically significant association. The results indicate that the TPACK of mathematics teachers contributes towards more effective Grade 8 mathematics teaching in South African schools.

  9. Synthesis and Surface-Specific Analysis of Molecular Constituents Relevant to Biogenic Secondary Organic Aerosol Material

    Science.gov (United States)

    Be, A. G.; Upshur, M. A.; Chase, H. M.; Geiger, F.; Thomson, R. J.

    2017-12-01

    Secondary organic aerosol (SOA) particles formed from the oxidation of biogenic volatile organic compounds (BVOCs) remain a principal, yet elusive, class of airborne particulate matter that impacts the Earth's radiation budget. Given the characteristic molecular complexity comprising biogenic SOA particles, chemical information selective to the gas-aerosol interface may be valuable in the investigation of such systems, as surface considerations likely dictate the phenomena driving particle evolution mechanisms and climate effects. In particular, cloud activation processes may be parameterized using the surface tension depression that coincides with partitioning of surface-active organic species to the gas-droplet interface. However, the extent to which surface chemical processes, such as cloud droplet condensation, are influenced by the chemical structure and reactivity of individual surface-active molecules in SOA particles is largely unknown. We seek to study terpene-derived organic species relevant to the surfaces of biogenic SOA particles via synthesis of putative oxidation products followed by analysis using surface-selective physicochemical measurements. Using dynamic surface tension measurements, considerable differences are observed in the surface tension depression of aqueous pendant droplets that contain synthetically prepared ozonolysis products derived from abundant terpene precursors. Furthermore, sum frequency generation spectroscopy is utilized for comparison of the surface vibrational spectral responses of synthesized reference compounds with those observed for laboratory aerosol toward probing the surface composition of SOA material. Such ongoing findings highlight the underlying importance of molecular structure and reactivity when considering the surface chemistry of biogenic terpene-derived atmospheric aerosols.

  10. International variation in adherence to referral guidelines for suspected cancer: a secondary analysis of survey data.

    Science.gov (United States)

    Nicholson, Brian D; Mant, David; Neal, Richard D; Hart, Nigel; Hamilton, Willie; Shinkins, Bethany; Rubin, Greg; Rose, Peter W

    2016-02-01

    Variation in cancer survival persists between comparable nations and appears to be due, in part, to primary care practitioners (PCPs) having different thresholds for acting definitively in response to cancer-related symptoms. To explore whether cancer guidelines, and adherence to them, differ between jurisdictions and impacts on PCPs' propensity to take definitive action on cancer-related symptoms. A secondary analysis of survey data from six countries (10 jurisdictions) participating in the International Cancer Benchmarking Partnership. PCPs' responses to five clinical vignettes presenting symptoms and signs of lung (n = 2), colorectal (n = 2), and ovarian cancer (n = 1) were compared with investigation and referral recommendations in cancer guidelines. Nine jurisdictions had guidelines covering the two colorectal vignettes. For the lung vignettes, although eight jurisdictions had guidelines for the first, the second was covered by a Swedish guideline alone. Only the UK and Denmark had an ovarian cancer guideline. Survey responses of 2795 PCPs (crude response rate: 12%) were analysed. Guideline adherence ranged from 20-82%. UK adherence was lower than other jurisdictions for the lung vignette covered by the guidance (47% versus 58%; P nations and poor guideline adherence does not explain differential survival. Guidelines that fail to cover high-risk presentations or that recommend non-definitive action may reduce definitive diagnostic action. © British Journal of General Practice 2016.

  11. Boxing fatalities in relation to rule changes in Japan: secondary data analysis.

    Science.gov (United States)

    Teramoto, Masaru; Cross, Chad L; Cushman, Daniel M; Willick, Stuart E

    2018-01-18

    To examine whether changing weigh-in from the same day of the match to the day before the match and prohibiting 6-oz gloves are associated with fatalities in boxing matches sanctioned by the Japan Boxing Commission (JBC). We analyzed the rates of boxing fatalities before and after the two rule changes above via secondary analysis of data. Demographics and boxing records of deceased boxers were examined using descriptive statistics, exact binomial test the Mann-Whitney-Wilcoxon test and Fisher's exact tests. As of this study, a total of 38 boxers (23.9 ± 3.3 years of age) reportedly died due to injuries sustained in JBC-sanctioned boxing matches since 1952. Changing weigh-in to the day before the match or prohibiting 6-oz gloves was not significantly associated with the rates of boxing fatalities 5 years and 10 years before and after the rule changes (p > 0.05). Deceased boxers after these rule changes were significantly older, completed significantly more rounds in the final match, and were significantly less likely to lose the previous match (prior to the final match) and to do so by knockouts (p boxing fatalities.

  12. An Analysis of Writing Activities in the Student Workbooks of a Secondary-Level Turkish Language Course

    Science.gov (United States)

    Çerçi, Arif

    2016-01-01

    The purpose of this study is to analyze writing activities in the student workbooks of a secondary-level Turkish language course (grades 5 to 8) according to the principles of progressive writing. The study is descriptive and employs content analysis as a qualitative research paradigm. The writing activities of the books in this study all…

  13. Benefit Incidence Analysis of Government Spending on Public-Private Partnership Schooling under Universal Secondary Education Policy in Uganda

    Science.gov (United States)

    Wokadala, J.; Barungi, M.

    2015-01-01

    The study establishes whether government spending on private universal secondary education (USE) schools is equitable across quintiles disaggregated by gender and by region in Uganda. The study employs benefit incidence analysis tool on the Uganda National Panel Survey (UNPS 2009/10) data to establish the welfare impact of public subsidy on…

  14. A picture of Indian adolescent mental health: an analysis from three urban secondary schools.

    Science.gov (United States)

    Long, Katelyn N G; Gren, Lisa H; Long, Paul M; Jaggi, Rachel; Banik, Srabani; Mihalopoulos, Nicole L

    2017-08-01

    Purpose Mental health disorders are a pressing issue among adolescents around the world, including in India. A better understanding of the factors related to poor mental health will allow for more effective and targeted interventions for Indian adolescents. Methods The Indian Adolescent Health Questionnaire (IAHQ), a validated questionnaire designed specifically for use in schools, was administered to approximately 1500 secondary students in three private urban Indian schools in 2012. The Strengths and Difficulties Questionnaire (SDQ) module assessed mental health. Linear regression was used to predict SDQ scores. The biopsychosocial framework was used as an organizing framework to understand how each explanatory variable in the final model might impact the SDQ score. Results One thousand four hundred and eight students returned IAHQ surveys (93.9% response rate); 1102 students completed questions for inclusion in the regression model (78.3% inclusion rate). Statistically significant (p health, negative peer pressure, insults from peers, kindness of peers, feeling safe at home, at school, or with friends, and grades. Discussion Schools have a role to play in improving adolescent mental health. Many of the significant variables in our study can be addressed in the school environment through school-wide, long-term programs utilizing teachers and lay counselors. The IAHQ and SDQ can be used by schools to identify factors that contribute to poor mental health among students and then develop targeted programs to support improved mental health.

  15. Methods of charged-particle activation analysis

    International Nuclear Information System (INIS)

    Chaudhri, M. Anwar; Chaudhri, M. Nasir; Jabbar, Q.; Nadeem, Q.

    2006-01-01

    The accuracy of Chaudhri's method for charged-particle activation analysis published in J. Radioanal. Chem. (1977) v. 37 p. 243 has been further demonstrated by extensive calculations. The nuclear reactions 12 C(d,n) 13 N, 63 Cu( 3 He,p) 65 Zn, 107 Ag(α,n) 110 In and 208 Pb(d,p) 209 Pb, the cross sections of which were easily available, have been examined for the detection of 12 C, 63 Cu, 107 Ag and 208 Pb, respectively, in matrices of Cu, Zr and Pb, at the bombarding energies of 4 - 22 MeV. The 'standard' is assumed to be in a carbon matrix. It has been clearly demonstrated that Chaudhri's method, which makes the charged particle activation analysis as simple as neutron activation analysis, provides results which are almost identical to, or only about 1-2 % different, from the results obtained using the full 'Activity Equation' involving solving complex integrals. It is valid even when the difference in the average atomic weights of matrices of the standard and the sample is large. (author)

  16. Development and analysis of finite volume methods

    International Nuclear Information System (INIS)

    Omnes, P.

    2010-05-01

    This document is a synthesis of a set of works concerning the development and the analysis of finite volume methods used for the numerical approximation of partial differential equations (PDEs) stemming from physics. In the first part, the document deals with co-localized Godunov type schemes for the Maxwell and wave equations, with a study on the loss of precision of this scheme at low Mach number. In the second part, discrete differential operators are built on fairly general, in particular very distorted or nonconforming, bidimensional meshes. These operators are used to approach the solutions of PDEs modelling diffusion, electro and magneto-statics and electromagnetism by the discrete duality finite volume method (DDFV) on staggered meshes. The third part presents the numerical analysis and some a priori as well as a posteriori error estimations for the discretization of the Laplace equation by the DDFV scheme. The last part is devoted to the order of convergence in the L2 norm of the finite volume approximation of the solution of the Laplace equation in one dimension and on meshes with orthogonality properties in two dimensions. Necessary and sufficient conditions, relatively to the mesh geometry and to the regularity of the data, are provided that ensure the second-order convergence of the method. (author)

  17. Creep analysis by the path function method

    International Nuclear Information System (INIS)

    Akin, J.E.; Pardue, R.M.

    1977-01-01

    The finite element method has become a common analysis procedure for the creep analysis of structures. The most recent programs are designed to handle a general class of material properties and are able to calculate elastic, plastic, and creep components of strain under general loading histories. The constant stress approach is too crude a model to accurately represent the actual behaviour of the stress for large time steps. The true path of a point in the effective stress-effective strain (sigmasup(e)-epsilonsup(c)) plane is often one in which the slope is rapidly changing. Thus the stress level quickly moves away from the initial stress level and then gradually approaches the final one. The result is that the assumed constant stress level quickly becomes inaccurate. What is required is a better method of approximation of the true path in the sigmasup(e)-epsilonsup(c) space. The method described here is called the path function approach because it employs an assumed function to estimate the motion of points in the sigmasup(e)-epsilonsup(c) space. (Auth.)

  18. Earthquake Hazard Analysis Methods: A Review

    Science.gov (United States)

    Sari, A. M.; Fakhrurrozi, A.

    2018-02-01

    One of natural disasters that have significantly impacted on risks and damage is an earthquake. World countries such as China, Japan, and Indonesia are countries located on the active movement of continental plates with more frequent earthquake occurrence compared to other countries. Several methods of earthquake hazard analysis have been done, for example by analyzing seismic zone and earthquake hazard micro-zonation, by using Neo-Deterministic Seismic Hazard Analysis (N-DSHA) method, and by using Remote Sensing. In its application, it is necessary to review the effectiveness of each technique in advance. Considering the efficiency of time and the accuracy of data, remote sensing is used as a reference to the assess earthquake hazard accurately and quickly as it only takes a limited time required in the right decision-making shortly after the disaster. Exposed areas and possibly vulnerable areas due to earthquake hazards can be easily analyzed using remote sensing. Technological developments in remote sensing such as GeoEye-1 provide added value and excellence in the use of remote sensing as one of the methods in the assessment of earthquake risk and damage. Furthermore, the use of this technique is expected to be considered in designing policies for disaster management in particular and can reduce the risk of natural disasters such as earthquakes in Indonesia.

  19. Resistivity analysis of epitaxially grown, doped semiconductors using energy dependent secondary ion mass spectroscopy

    International Nuclear Information System (INIS)

    Burnham, Shawn D.; Thomas, Edward W.; Doolittle, W. Alan

    2006-01-01

    A characterization technique is discussed that allows quantitative optimization of doping in epitaxially grown semiconductors. This technique uses relative changes in the host atom secondary ion (HASI) energy distribution from secondary ion mass spectroscopy (SIMS) to indicate relative changes in conductivity of the material. Since SIMS is a destructive process due to sputtering through a film, a depth profile of the energy distribution of sputtered HASIs in a matrix will contain information on the conductivity of the layers of the film as a function of depth. This process is demonstrated with Mg-doped GaN, with the Mg flux slowly increased through the film. Three distinct regions of conductivity were observed: one with Mg concentration high enough to cause compensation and thus high resistivity, a second with moderate Mg concentration and low resistivity, and a third with little to no Mg doping, causing high resistivity due to the lack of free carriers. During SIMS analysis of the first region, the energy distributions of sputtered Ga HASIs were fairly uniform and unchanging for a Mg flux above the saturation, or compensation, limit. For the second region, the Ga HASI energy distributions shifted and went through a region of inconsistent energy distributions for Mg flux slightly below the critical flux for saturation, or compensation. Finally, for the third region, the Ga HASI energy distributions then settled back into another fairly unchanging, uniform pattern. These three distinct regions were analyzed further through growth of Mg-doped step profiles and bulk growth of material at representative Mg fluxes. The materials grown at the two unchanging, uniform regions of the energy distributions yielded highly resistive material due to too high of Mg concentration and low to no Mg concentration, respectively. However, material grown in the transient energy distribution region with Mg concentration between that of the two highly resistive regions yielded low

  20. Resistivity analysis of epitaxially grown, doped semiconductors using energy dependent secondary ion mass spectroscopy

    Science.gov (United States)

    Burnham, Shawn D.; Thomas, Edward W.; Doolittle, W. Alan

    2006-12-01

    A characterization technique is discussed that allows quantitative optimization of doping in epitaxially grown semiconductors. This technique uses relative changes in the host atom secondary ion (HASI) energy distribution from secondary ion mass spectroscopy (SIMS) to indicate relative changes in conductivity of the material. Since SIMS is a destructive process due to sputtering through a film, a depth profile of the energy distribution of sputtered HASIs in a matrix will contain information on the conductivity of the layers of the film as a function of depth. This process is demonstrated with Mg-doped GaN, with the Mg flux slowly increased through the film. Three distinct regions of conductivity were observed: one with Mg concentration high enough to cause compensation and thus high resistivity, a second with moderate Mg concentration and low resistivity, and a third with little to no Mg doping, causing high resistivity due to the lack of free carriers. During SIMS analysis of the first region, the energy distributions of sputtered Ga HASIs were fairly uniform and unchanging for a Mg flux above the saturation, or compensation, limit. For the second region, the Ga HASI energy distributions shifted and went through a region of inconsistent energy distributions for Mg flux slightly below the critical flux for saturation, or compensation. Finally, for the third region, the Ga HASI energy distributions then settled back into another fairly unchanging, uniform pattern. These three distinct regions were analyzed further through growth of Mg-doped step profiles and bulk growth of material at representative Mg fluxes. The materials grown at the two unchanging, uniform regions of the energy distributions yielded highly resistive material due to too high of Mg concentration and low to no Mg concentration, respectively. However, material grown in the transient energy distribution region with Mg concentration between that of the two highly resistive regions yielded low

  1. a Latent Variable Path Analysis Model of Secondary Physics Enrollments in New York State.

    Science.gov (United States)

    Sobolewski, Stanley John

    The Percentage of Enrollment in Physics (PEP) at the secondary level nationally has been approximately 20% for the past few decades. For a more scientifically literate citizenry as well as specialists to continue scientific research and development, it is desirable that more students enroll in physics. Some of the predictor variables for physics enrollment and physics achievement that have been identified previously includes a community's socioeconomic status, the availability of physics, the sex of the student, the curriculum, as well as teacher and student data. This study isolated and identified predictor variables for PEP of secondary schools in New York. Data gathered by the State Education Department for the 1990-1991 school year was used. The source of this data included surveys completed by teachers and administrators on student characteristics and school facilities. A data analysis similar to that done by Bryant (1974) was conducted to determine if the relationships between a set of predictor variables related to physics enrollment had changed in the past 20 years. Variables which were isolated included: community, facilities, teacher experience, number of type of science courses, school size and school science facilities. When these variables were isolated, latent variable path diagrams were proposed and verified by the Linear Structural Relations computer modeling program (LISREL). These diagrams differed from those developed by Bryant in that there were more manifest variables used which included achievement scores in the form of Regents exam results. Two criterion variables were used, percentage of students enrolled in physics (PEP) and percent of students enrolled passing the Regents physics exam (PPP). The first model treated school and community level variables as exogenous while the second model treated only the community level variables as exogenous. The goodness of fit indices for the models was 0.77 for the first model and 0.83 for the second

  2. Restenosis after carotid artery stenting and endarterectomy: a secondary analysis of CREST, a randomised controlled trial.

    Science.gov (United States)

    Lal, Brajesh K; Beach, Kirk W; Roubin, Gary S; Lutsep, Helmi L; Moore, Wesley S; Malas, Mahmoud B; Chiu, David; Gonzales, Nicole R; Burke, J Lee; Rinaldi, Michael; Elmore, James R; Weaver, Fred A; Narins, Craig R; Foster, Malcolm; Hodgson, Kim J; Shepard, Alexander D; Meschia, James F; Bergelin, Robert O; Voeks, Jenifer H; Howard, George; Brott, Thomas G

    2012-09-01

    In the Carotid Revascularization Endarterectomy versus Stenting Trial (CREST), the composite primary endpoint of stroke, myocardial infarction, or death during the periprocedural period or ipsilateral stroke thereafter did not differ between carotid artery stenting and carotid endarterectomy for symptomatic or asymptomatic carotid stenosis. A secondary aim of this randomised trial was to compare the composite endpoint of restenosis or occlusion. Patients with stenosis of the carotid artery who were asymptomatic or had had a transient ischaemic attack, amaurosis fugax, or a minor stroke were eligible for CREST and were enrolled at 117 clinical centres in the USA and Canada between Dec 21, 2000, and July 18, 2008. In this secondary analysis, the main endpoint was a composite of restenosis or occlusion at 2 years. Restenosis and occlusion were assessed by duplex ultrasonography at 1, 6, 12, 24, and 48 months and were defined as a reduction in diameter of the target artery of at least 70%, diagnosed by a peak systolic velocity of at least 3·0 m/s. Studies were done in CREST-certified laboratories and interpreted at the Ultrasound Core Laboratory (University of Washington). The frequency of restenosis was calculated by Kaplan-Meier survival estimates and was compared during a 2-year follow-up period. We used proportional hazards models to assess the association between baseline characteristics and risk of restenosis. Analyses were per protocol. CREST is registered with ClinicalTrials.gov, number NCT00004732. 2191 patients received their assigned treatment within 30 days of randomisation and had eligible ultrasonography (1086 who had carotid artery stenting, 1105 who had carotid endarterectomy). In 2 years, 58 patients who underwent carotid artery stenting (Kaplan-Meier rate 6·0%) and 62 who had carotid endarterectomy (6·3%) had restenosis or occlusion (hazard ratio [HR] 0·90, 95% CI 0·63-1·29; p=0·58). Female sex (1·79, 1·25-2·56), diabetes (2·31, 1·61-3·31

  3. The Impact of the Internet on Health Consultation Market Concentration: An Econometric Analysis of Secondary Data.

    Science.gov (United States)

    Li, Jia; Zhang, Ya; Ma, Ling; Liu, Xuan

    2016-10-28

    Many markets have traditionally been dominated by a few best-selling products, and this is also the case for the health care industry. However, we do not know whether the market will be more or less concentrated when health care services are delivered online (known as E-consultation), nor do we know how to reduce the concentration of the E-consultation market. The aim of this study was to investigate the concentration of the E-consultation market and how to reduce its concentration through information disclosure mechanisms (online reputation and self-representation). We employed a secondary data econometric analysis using transaction data obtained from an E-consultation Website (haodf.com) for three diseases (infantile pneumonia, diabetes, and pancreatic cancer) from 2008 to 2015. We included 2439 doctors in the analysis. The E-consultation market largely follows the 20/80 principle, namely that approximately 80% of orders are fulfilled by nearly 20% of doctors. This is much higher than the offline health care market. Meanwhile, the market served by doctors with strong online reputations (beta=0.207, P<.001) or strong online self-representation (beta=0.386, P<.001) is less concentrated. When health care services are delivered online, the market will be more concentrated (known as the "Superstar" effect), indicating poor service efficiency for society as a whole. To reduce market concentration, E-consultation websites should provide important design elements such as ratings of doctors (user feedback), articles contributed by doctors, and free consultation services (online representation). A possible and important way to reduce the market concentration of the E-consultation market is to accumulate enough highly rated or highly self-represented doctors. ©Jia Li, Ya Zhang, Ling Ma, Xuan Liu. Originally published in the Journal of Medical Internet Research (http://www.jmir.org), 28.10.2016.

  4. Identifying Treatment Effect Modifiers in the STarT Back Trial: A Secondary Analysis.

    Science.gov (United States)

    Beneciuk, Jason M; Hill, Jonathan C; Campbell, Paul; Afolabi, Ebenezer; George, Steven Z; Dunn, Kate M; Foster, Nadine E

    2017-01-01

    Identification of patient characteristics influencing treatment outcomes is a top low back pain (LBP) research priority. Results from the STarT Back trial support the effectiveness of prognostic stratified care for LBP compared with current best care, however, patient characteristics associated with treatment response have not yet been explored. The purpose of this secondary analysis was to identify treatment effect modifiers within the STarT Back trial at 4-month follow-up (n = 688). Treatment response was dichotomized using back-specific physical disability measured using the Roland-Morris Disability Questionnaire (≥7). Candidate modifiers were identified using previous literature and evaluated using logistic regression with statistical interaction terms to provide preliminary evidence of treatment effect modification. Socioeconomic status (SES) was identified as an effect modifier for disability outcomes (odds ratio [OR] = 1.71, P = .028). High SES patients receiving prognostic stratified care were 2.5 times less likely to have a poor outcome compared with low SES patients receiving best current care (OR = .40, P = .006). Education level (OR = 1.33, P = .109) and number of pain medications (OR = .64, P = .140) met our criteria for effect modification with weaker evidence (.20 > P ≥ .05). These findings provide preliminary evidence for SES, education, and number of pain medications as treatment effect modifiers of prognostic stratified care delivered in the STarT Back Trial. This analysis provides preliminary exploratory findings about the characteristics of patients who might least likely benefit from targeted treatment using prognostic stratified care for LBP. Copyright © 2016 American Pain Society. Published by Elsevier Inc. All rights reserved.

  5. Comparison of the Effect of 5 Different Treatment Options for Managing Patellar Tendinopathy: A Secondary Analysis.

    Science.gov (United States)

    van Rijn, Dafne; van den Akker-Scheek, Inge; Steunebrink, Mirjam; Diercks, Ron L; Zwerver, Johannes; van der Worp, Henk

    2017-10-10

    Currently, no treatments exist for patellar tendinopathy (PT) that guarantee quick and full recovery. Our objective was to assess which treatment option provides the best chance of clinical improvement and to assess the influence of patient and injury characteristics on the clinical effect of these treatments. A secondary analysis was performed on the combined databases of 3 previously performed double-blind randomized controlled trials. In total, 138 patients with PT were included in the analysis. Participants were divided into 5 groups, based on the treatment they received: Extracorporeal shockwave therapy (ESWT) (n = 31), ESWT plus eccentric training (n = 43), eccentric training (n = 17), topical glyceryl trinitrate patch plus eccentric training (n = 16), and placebo treatment (n = 31). Clinical improvement (increase of ≥13 points on the Victorian Institute of Sport Assessment-Patella score) after 3 months of treatment. Fifty-two patients (37.7%) improved clinically after 3 months of treatment. Odds ratios (ORs) for clinical improvement were significantly higher in the eccentric training group (OR 6.68, P = 0.009) and the ESWT plus eccentric training group (OR 5.42, P = 0.015) compared with the other groups. We found evidence that a high training volume, a longer duration of symptoms, and older age negatively influence a treatment's clinical outcome (trend toward significance). Our study confirmed the importance of exercise, and eccentric training in particular, in the management of PT. The role of ESWT remains uncertain. Further research focusing on the identified prognostic factors is needed to be able to design patient-specific treatment protocols for the management of PT.

  6. Global earthquake casualties due to secondary effects: A quantitative analysis for improving rapid loss analyses

    Science.gov (United States)

    Marano, K.D.; Wald, D.J.; Allen, T.I.

    2010-01-01

    This study presents a quantitative and geospatial description of global losses due to earthquake-induced secondary effects, including landslide, liquefaction, tsunami, and fire for events during the past 40 years. These processes are of great importance to the US Geological Survey's (USGS) Prompt Assessment of Global Earthquakes for Response (PAGER) system, which is currently being developed to deliver rapid earthquake impact and loss assessments following large/significant global earthquakes. An important question is how dominant are losses due to secondary effects (and under what conditions, and in which regions)? Thus, which of these effects should receive higher priority research efforts in order to enhance PAGER's overall assessment of earthquakes losses and alerting for the likelihood of secondary impacts? We find that while 21.5% of fatal earthquakes have deaths due to secondary (non-shaking) causes, only rarely are secondary effects the main cause of fatalities. The recent 2004 Great Sumatra-Andaman Islands earthquake is a notable exception, with extraordinary losses due to tsunami. The potential for secondary hazards varies greatly, and systematically, due to regional geologic and geomorphic conditions. Based on our findings, we have built country-specific disclaimers for PAGER that address potential for each hazard (Earle et al., Proceedings of the 14th World Conference of the Earthquake Engineering, Beijing, China, 2008). We will now focus on ways to model casualties from secondary effects based on their relative importance as well as their general predictability. ?? Springer Science+Business Media B.V. 2009.

  7. Place of the imaging methods for diagnosis and treatment of primary and secondary hepatic tumors

    Energy Technology Data Exchange (ETDEWEB)

    Mircheva, M [Meditsinska Akademiya, Sofia (Bulgaria). Nauchen Institut po Vytreshni Bolesti

    1991-01-01

    A review is presented of the methods in which the imaging and treatment of liver tumors are mutually connected: ultrasound study, radioimmunoscintigraphy with {sup 111}InF(ab){sub 2}-fragments from anti-CEA monoclonal antibodies and computerized tomography (CT). Special attention has been paid to different approaches for increasing of the sensitivity and specificity of CT: contrast intensification of the image with water-soluble contrast media; bolus administration of the contrast media by dynamic CT-scanning; introduction of the contrast matter in truncus coeliacus and/or a. hepatica; late CT. From the terapeutic point of view suspending of different cytostatics in Lipiodol and their intraarterial administration are discussed. The angiographic study is a prerequisite for arterial chemotherapy. Its advantages is stressed against to transcatheter introduction of antimitotic drugs (by using of percutaneous catheters through a. brachialis, a. femoralis or by surgical implantation). The creation of conjugated chemotherapeutic polymers which helps to obtain a depot-effect in conservative treatment is mentioned as a new approach in improving the regional chemotherapy. The first results from nuclear-magnetic resonance tomography are evaluated. The tendency for integration of the individual visualization and therapeutic approaches is stressed. 58 refs.

  8. Application of microbiological methods for secondary oil recovery from the Carpathian crude oil reservoirs

    Energy Technology Data Exchange (ETDEWEB)

    Karaskiewicz, J

    1974-01-01

    The investigation made it possible to isolate from different ecologic environmental (soil, crude oil, formation water, industrial wastes) bacteria cultures of the genus Arthrobacter, Clostridium, Mycobacterium, Peptococcus, and Pseudomonas. These heterotrophic bacteria are characterized by a high metabolic and biogeochemical activity hydrocarbon transformation. Experiments on a technical scale were conducted from 1961 to 1971 in 20 wells; in this study, only the 16 most typical examples are discussed. The experiments were conducted in Carpathian crude oil reservoirs. To each well, a 500:1 mixture of the so-called bacteria vaccine (containing an active biomass of cultures obtained by a specific cultivation method and holding 6 x 10/sup 5/ bacteria cells in 1 ml of fluid, 2,000 kg of molasses, and 50 cu m of water originating from the reservoir submitted to treatment) was injected at 500 to 1,200 m. The intensification of the microbiological processes in the reservoir was observed. This phenomenon occurred not only in the wells to which the bacteria vaccine was injected, but also in the surrounding producing wells. At the same time, an increase in the crude oil production occurred on the average within the range from 20 to 200% and the surpluses of crude oil production continued for 2 to 8 yr. (92 refs.)

  9. Secondary successions of biota in oil-polluted peat soil upon different biological remediation methods

    Science.gov (United States)

    Melekhina, E. N.; Markarova, M. Yu.; Shchemelinina, T. N.; Anchugova, E. M.; Kanev, V. A.

    2015-06-01

    The effects of different bioremediation methods on restoration of the oil-polluted peat soil (Histosol) in the northernmost taiga subzone of European Russia was studied. The population dynamics of microorganisms belonging to different trophic groups (hydrocarbon-oxidizing, ammonifying, nitrifying, and oligonitrophilic) were analyzed together with data on the soil enzyme (catalase and dehydrogenase) activities, population densities of soil microfauna groups, their structures, and states of phytocenoses during a sevenyear-long succession. The remediation with biopreparations Roder composed of oil-oxidizing microorganisms-Roder with Rhodococcus rubber and R. erythropolis and Universal with Rhodotorula glutinis and Rhodococcus sp.-was more efficient than the agrochemical and technical remediation. It was concluded that the biopreparations activate microbiological oil destruction, thereby accelerating restoration succession of phytocenosis and zoocenosis. The succession of dominant microfauna groups was observed: the dipteran larvae and Mesostigmata mites predominant at the early stages were replaced by collembolans at later stages. The pioneer oribatid mite species were Tectocepheus velatus, Oppiella nova, Liochthonius sellnicki, Oribatula tibialis, and Eupelops sp.

  10. Digital Badges for STEM Learning in Secondary Contexts: A Mixed Methods Study

    Science.gov (United States)

    Elkordy, Angela

    The deficit in STEM skills is a matter of concern for national economies and a major focus for educational policy makers. The development of Information and Communications Technologies (ICT) has resulted in a rapidly changing workforce of global scale. In addition, ICT have fostered the growth of digital and mobile technologies which have been the learning context, formal and informal, for a generation of youth. The purpose of this study was to design an intervention based upon a competency-based, digitally-mediated, learning intervention: digital badges for learning STEM habits of mind and practices. Designed purposefully, digital badge learning trajectories and criteria can be flexible tools for scaffolding, measuring, and communicating the acquisition of knowledge, skills, or competencies. One of the most often discussed attributes of digital badges, is the ability of badges to motivate learners. However, the research base to support this claim is in its infancy; there is little empirical evidence. A skills-based digital badge intervention was designed to demonstrate mastery learning in key, age-appropriate, STEM competencies aligned with Next Generation Science Standards (NGSS) and other educational standards. A mixed methods approach was used to study the impact of a digital badge intervention in the sample middle and high school population. Among the findings were statistically significant measures which substantiate that in this student population, the digital badges increased perceived competence and motivated learners to persist at task.

  11. Perceived Effectiveness of Identified Methods and Techniques Teachers Adopt in Prose Literature Lessons in some Secondary Schools in Owerri

    Directory of Open Access Journals (Sweden)

    F. O. Ezeokoli

    2016-07-01

    Full Text Available The study determined the methods adopted by teachers in prose literature-in-English classrooms, activities of teachers and students, teachers’ perceived effectiveness of techniques used. It also examined the objectives of teaching prose literature that teachers should address and the extent teachers believe in student-identified difficulties of studying prose literature. The study adopted the descriptive survey research design. Purposive sampling technique was used to select 85 schools in Owerri metropolis and in each school, all literature teachers of senior secondary I and II were involved. In all, 246 literature teachers participated out of which 15 were purposively selected for observation. The two instruments were: Teachers’ Questionnaire (r = 0.87 and Classroom Observation Schedule (r = 0.73. Data were analysed using frequency counts and percentages. Results revealed that teachers adopted lecture (28.4%, reading (10.9% and discussion (7.3% methods. Teacher’s activities during the lesson include: giving background information, summarizing, dictating notes, reading aloud and explaining and asking questions. The adopted techniques include: questioning, oral reading, silent reading and discussion. Teachers’ perceived questioning as the most effective technique followed by debating and summarizing. Teachers identified development of students’ critical faculties and analytical skills, literary appreciation and language skills to be of utmost concern. It was concluded that the methods adopted by teachers are not diverse enough to cater for the needs and backgrounds of students. Keywords: Methods, Techniques, Perceived Effectiveness, Objectives, Literature-in-English

  12. WASP (Wavelet Analysis of Secondary Particles Angular Distributions) Package. Version 1.2. Long Write Up and User's Guide

    CERN Document Server

    Altaisky, M V; Soloviev, A G; Stadnik, A V; Shitov, A B

    2001-01-01

    WASP package is a C++ program aimed to analyze angular distributions of secondary particles generated in nuclear interactions. WASP package is based on wavelet transform algorithms. This work includes the user's guide, description of algorithms and mathematical methods, graphical user interface. We have also analyzed what problems of nuclear physics can be tackled with WASP.

  13. A Logistic Regression Analysis of Student Experience Factors for the Enhancement of Developmental Post-Secondary Retention Initiatives

    Science.gov (United States)

    Shenkle, Michael Thomas

    2017-01-01

    In response to stagnant undergraduate completion rates and growing demands for post-secondary accountability, institutions are actively pursuing effective, broadly applicable methods for promoting student success. One notable scarcity in existing research is found in the tailoring of broad academic interventions to better meet the specific needs…

  14. Possibilities of Implementation of Small Business Check-Up Methodology in Comparative Analysis of Secondary Schools and Universities in Slovakia

    Science.gov (United States)

    Štofková, Katarína; Strícek, Ivan; Štofková, Jana

    2014-01-01

    The paper is aimed to evaluate the possibility of applying new methods and tools of more effective educational processes, with an emphasis on increasing their quality especially aimed on educational processes at secondary schools and universities. There are some contributions from practice for the effective implementation of time management, such…

  15. Collaborative partnership and the social value of clinical research: a qualitative secondary analysis.

    Science.gov (United States)

    Nurmi, Sanna-Maria; Halkoaho, Arja; Kangasniemi, Mari; Pietilä, Anna-Maija

    2017-10-25

    Protecting human subjects from being exploited is one of the main ethical challenges for clinical research. However, there is also a responsibility to protect and respect the communities who are hosting the research. Recently, attention has focused on the most efficient way of carrying out clinical research, so that it benefits society by providing valuable research while simultaneously protecting and respecting the human subjects and the communities where the research is conducted. Collaboration between partners plays an important role and that is why we carried out a study to describe how collaborative partnership and social value are emerging in clinical research. A supra-analysis design for qualitative descriptive secondary analysis was employed to consider a novel research question that pertained to nurse leaders' perceptions of ethical recruitment in clinical research and the ethics-related aspects of clinical research from the perspective of administrative staff. The data consisted of two separate pre-existing datasets, comprising 451 pages from 41 interviews, and we considered the research question by using deductive-inductive content analysis with NVivo software. A deductive analysis matrix was generated on the basis of two requirements, namely collaborative partnership and social value, as presented in An Ethical Framework for Biomedical Research by Emanuel et al. The findings showed that collaborative partnership was a cornerstone for ethical clinical research and ways to foster inter-partner collaboration were indicated, such as supporting mutual respect and equality, shared goals and clearly defined roles and responsibilities. In addition, the social value of clinical research was an important precondition for ethical clinical research and its realisation required the research partners to demonstrate collaboration and shared responsibility during the research process. However, concerns emerged that the multidimensional meaning of clinical research for

  16. On-line analysis of ETA and organic acids in secondary systems of PWR plants

    International Nuclear Information System (INIS)

    Kurashina, Masahiko; Uzawa, Hideo; Utagawa, Koya; Takaku, Hiroshi

    2005-01-01

    To reduce the iron concentration in the secondary water of plants with pressurized water reactors (PWRs), ethanolamine (ETA) is used as an alkalizing agent in the secondary cycle. An on-line ion chromatography (IC) monitoring system for monitoring concentrations of ETA and anions of organic acids was developed, its performance was evaluated, and verification tests were conducted at an actual PWR plant. It was demonstrated that the concentration of both ETA and anions of organic acids may be successfully monitored by IC in PWR secondary cycle streams alkalized by ETA. (orig.)

  17. Sensitivity analysis of the Two Geometry Method

    International Nuclear Information System (INIS)

    Wichers, V.A.

    1993-09-01

    The Two Geometry Method (TGM) was designed specifically for the verification of the uranium enrichment of low enriched UF 6 gas in the presence of uranium deposits on the pipe walls. Complications can arise if the TGM is applied under extreme conditions, such as deposits larger than several times the gas activity, small pipe diameters less than 40 mm and low pressures less than 150 Pa. This report presents a comprehensive sensitivity analysis of the TGM. The impact of the various sources of uncertainty on the performance of the method is discussed. The application to a practical case is based on worst case conditions with regards to the measurement conditions, and on realistic conditions with respect to the false alarm probability and the non detection probability. Monte Carlo calculations were used to evaluate the sensitivity for sources of uncertainty which are experimentally inaccessible. (orig.)

  18. Blood proteins analysis by Raman spectroscopy method

    Science.gov (United States)

    Artemyev, D. N.; Bratchenko, I. A.; Khristoforova, Yu. A.; Lykina, A. A.; Myakinin, O. O.; Kuzmina, T. P.; Davydkin, I. L.; Zakharov, V. P.

    2016-04-01

    This work is devoted to study the possibility of plasma proteins (albumin, globulins) concentration measurement using Raman spectroscopy setup. The blood plasma and whole blood were studied in this research. The obtained Raman spectra showed significant variation of intensities of certain spectral bands 940, 1005, 1330, 1450 and 1650 cm-1 for different protein fractions. Partial least squares regression analysis was used for determination of correlation coefficients. We have shown that the proposed method represents the structure and biochemical composition of major blood proteins.

  19. Moessbauer lineshape analysis by the DISPA method

    International Nuclear Information System (INIS)

    Miglierini, M.; Sitek, J.

    1986-01-01

    To evaluate the Moessbauer spectral parameters and hence, the structural and magnetic properties the lineshape should be known. A plot of dispersion versus absorption (DISPA plot) for a pure Lorentzian gives a perfect circle. Directions and magnitudes of DISPA distortions from this reference circle point out the kind of line-broadening mechanism observed. A possibility of the application of the DISPA technique in the Moessbauer lineshape analysis is dealt with in this paper. The method is verified on Moessbauer spectra of sodium nitroprusside, natural iron, and stainless steel. The lineshape of an amorphous metallic alloy Fe 40 Ni 40 B 20 is studied by means of the DISPA plots. (author)

  20. Electromagnetic compatibility methods, analysis, circuits, and measurement

    CERN Document Server

    Weston, David A

    2016-01-01

    Revised, updated, and expanded, Electromagnetic Compatibility: Methods, Analysis, Circuits, and Measurement, Third Edition provides comprehensive practical coverage of the design, problem solving, and testing of electromagnetic compatibility (EMC) in electrical and electronic equipment and systems. This new edition provides novel information on theory, applications, evaluations, electromagnetic computational programs, and prediction techniques available. With sixty-nine schematics providing examples for circuit level electromagnetic interference (EMI) hardening and cost effective EMI problem solving, this book also includes 1130 illustrations and tables. Including extensive data on components and their correct implementation, the myths, misapplication, misconceptions, and fallacies that are common when discussing EMC/EMI will also be addressed and corrected.

  1. Method and apparatus for simultaneous spectroelectrochemical analysis

    Science.gov (United States)

    Chatterjee, Sayandev; Bryan, Samuel A; Schroll, Cynthia A; Heineman, William R

    2013-11-19

    An apparatus and method of simultaneous spectroelectrochemical analysis is disclosed. A transparent surface is provided. An analyte solution on the transparent surface is contacted with a working electrode and at least one other electrode. Light from a light source is focused on either a surface of the working electrode or the analyte solution. The light reflected from either the surface of the working electrode or the analyte solution is detected. The potential of the working electrode is adjusted, and spectroscopic changes of the analyte solution that occur with changes in thermodynamic potentials are monitored.

  2. Secondary Hypertension

    Science.gov (United States)

    Secondary hypertension Overview Secondary hypertension (secondary high blood pressure) is high blood pressure that's caused by another medical condition. Secondary hypertension can be caused by conditions that affect your kidneys, ...

  3. Being in a safe and thus secure place, the core of early labour: A secondary analysis in a Swedish context

    Science.gov (United States)

    Carlsson, Ing-Marie

    2016-01-01

    Background Early labour is the very first phase of the labour process and is considered to be a period of time when no professional attendance is needed. However there is a high frequency of women who seek care at the delivery wards during this phase. When a woman is admitted to the delivery ward, one role for midwives is to determine whether the woman is in established labour or not. If the woman is assessed as being in early labour she will probably then be advised to return home. This recommendation is made due to past research that found that the longer a woman is in hospital the higher the risk for complications for her and her child. Women have described how this situation leaves them in a vulnerable situation where their preferences are not always met and where they are not always included in the decision-making process. Aim The aim of this study was to generate a theory based on where a woman chooses to be during the early labour process and to increase our understanding about how experiences can differ from place to place. Methods The method was a secondary analysis with grounded theory. The data used in the analysis was from two qualitative interview studies and 37 transcripts. Conclusion The findings revealed a substantive theory that women needed to be in a safe and thus secure place during early labour. This theory also describes the interplay between how women ascribed their meaning of childbirth as either a natural live event or a medical one, how this influenced where they wanted to be during early labour, and how that chosen place influenced their experiences of labour and birth. PMID:27172510

  4. Extended Delivery Time Analysis for Secondary Packet Transmission With Adaptive Modulation Under Interweave Cognitive Implementation

    KAUST Repository

    Wang, Wen-Jing; Usman, Muneer; Yang, Hong-Chuan; Alouini, Mohamed-Slim

    2017-01-01

    Cognitive radio communication can opportunistically access underutilized spectrum for emerging wireless applications. With interweave cognitive implementation, a secondary user (SU) transmits only if primary user does not occupy the channel

  5. Primary and secondary battery consumption trends in Sweden 1996–2013: Method development and detailed accounting by battery type

    International Nuclear Information System (INIS)

    Patrício, João; Kalmykova, Yuliya; Berg, Per E.O.; Rosado, Leonardo; Åberg, Helena

    2015-01-01

    Highlights: • Developed MFA method was validated by the national statistics. • Exponential increase of EEE sales leads to increase in integrated battery consumption. • Digital convergence is likely to be a cause for primary batteries consumption decline. • Factors for estimation of integrated batteries in EE are provided. • Sweden reached the collection rates defined by European Union. - Abstract: In this article, a new method based on Material Flow Accounting is proposed to study detailed material flows in battery consumption that can be replicated for other countries. The method uses regularly available statistics on import, industrial production and export of batteries and battery-containing electric and electronic equipment (EEE). To promote method use by other scholars with no access to such data, several empirically results and their trends over time, for different types of batteries occurrence among the EEE types are provided. The information provided by the method can be used to: identify drivers of battery consumption; study the dynamic behavior of battery flows – due to technology development, policies, consumers behavior and infrastructures. The method is exemplified by the study of battery flows in Sweden for years 1996–2013. The batteries were accounted, both in units and weight, as primary and secondary batteries; loose and integrated; by electrochemical composition and share of battery use between different types of EEE. Results show that, despite a fivefold increase in the consumption of rechargeable batteries, they account for only about 14% of total use of portable batteries. Recent increase in digital convergence has resulted in a sharp decline in the consumption of primary batteries, which has now stabilized at a fairly low level. Conversely, the consumption of integrated batteries has increased sharply. In 2013, 61% of the total weight of batteries sold in Sweden was collected, and for the particular case of alkaline manganese

  6. Primary and secondary battery consumption trends in Sweden 1996–2013: Method development and detailed accounting by battery type

    Energy Technology Data Exchange (ETDEWEB)

    Patrício, João, E-mail: joao.patricio@chalmers.se [Department of Civil and Environmental Engineering, Chalmers University of Technology, 412 96 Gothenburg (Sweden); Kalmykova, Yuliya; Berg, Per E.O.; Rosado, Leonardo [Department of Civil and Environmental Engineering, Chalmers University of Technology, 412 96 Gothenburg (Sweden); Åberg, Helena [The Faculty of Education, University of Gothenburg, 40530 Gothenburg (Sweden)

    2015-05-15

    Highlights: • Developed MFA method was validated by the national statistics. • Exponential increase of EEE sales leads to increase in integrated battery consumption. • Digital convergence is likely to be a cause for primary batteries consumption decline. • Factors for estimation of integrated batteries in EE are provided. • Sweden reached the collection rates defined by European Union. - Abstract: In this article, a new method based on Material Flow Accounting is proposed to study detailed material flows in battery consumption that can be replicated for other countries. The method uses regularly available statistics on import, industrial production and export of batteries and battery-containing electric and electronic equipment (EEE). To promote method use by other scholars with no access to such data, several empirically results and their trends over time, for different types of batteries occurrence among the EEE types are provided. The information provided by the method can be used to: identify drivers of battery consumption; study the dynamic behavior of battery flows – due to technology development, policies, consumers behavior and infrastructures. The method is exemplified by the study of battery flows in Sweden for years 1996–2013. The batteries were accounted, both in units and weight, as primary and secondary batteries; loose and integrated; by electrochemical composition and share of battery use between different types of EEE. Results show that, despite a fivefold increase in the consumption of rechargeable batteries, they account for only about 14% of total use of portable batteries. Recent increase in digital convergence has resulted in a sharp decline in the consumption of primary batteries, which has now stabilized at a fairly low level. Conversely, the consumption of integrated batteries has increased sharply. In 2013, 61% of the total weight of batteries sold in Sweden was collected, and for the particular case of alkaline manganese

  7. Using Multilevel Analysis to Examine the Relationship between Upper Secondary Students Internet Safety Awareness, Social Background and Academic Aspirations

    Directory of Open Access Journals (Sweden)

    Ove Edvard Hatlevik

    2014-11-01

    Full Text Available Since 2009, most Norwegian students in upper secondary have had access to their own personal computer at school. Hence, with the increased access to technology, the importance of online connectedness has increased for adolescents’ social interaction and communication. It is, therefore, important to identify and understand the concept of Internet safety among upper secondary school students. A total of 4216 students from 238 classrooms in 23 upper secondary schools completed an Internet safety assessment. The aim of the study was to operationalize and measure Internet safety in a school context, and to further examine the factors predicting students’ Internet safety awareness and responsibility. Our analysis revealed substantial variation in Internet safety awareness between schools, classrooms and students. Overall, the findings indicate that students’ social backgrounds are determining for their development and understanding of Internet safety awareness.

  8. An in Silico Analysis of Ankle Joint Loads in Secondary Ankle Osteoarthritis. Case Study.

    Science.gov (United States)

    Lorkowski, Jacek; Mrzygłód, Mirosław W; Grzegorowska, Oliwia; Kotela, Ireneusz

    2015-01-01

    Secondary, post-traumatic, degenerative lesions of the ankle joint remain a serious clinical challenge. This paper presents the case of a 66-year-old patient with secondary, post-traumatic ankle osteoarthritis and subchondral cysts. The use of rapid computer modelling FEM 2D enabled optimization of surgical treatment. A FEM 2D model of biomechanical changes in bones may help in streamlining treatment as well as improve our understanding of the pathomechanism of osteoarthritis.

  9. Coloured Petri Nets: Basic Concepts, Analysis Methods and Practical Use. Vol. 2, Analysis Methods

    DEFF Research Database (Denmark)

    Jensen, Kurt

    ideas behind the analysis methods are described as well as the mathematics on which they are based and also how the methods are supported by computer tools. Some parts of the volume are theoretical while others are application oriented. The purpose of the volume is to teach the reader how to use......This three-volume work presents a coherent description of the theoretical and practical aspects of coloured Petri nets (CP-nets). The second volume contains a detailed presentation of the analysis methods for CP-nets. They allow the modeller to investigate dynamic properties of CP-nets. The main...... the formal analysis methods, which does not require a deep understanding of the underlying mathematical theory....

  10. Economic analysis of alternative LLW disposal methods

    International Nuclear Information System (INIS)

    Foutes, C.E.; Queenan, C.J. III

    1987-01-01

    The Environmental Protection Agency (EPA) has evaluated the costs and benefits of alternative disposal technologies as part of its program to develop generally applicable environmental standards for the land disposal of low-level radioactive waste (LLW). Costs, population health effects and Critical Population Group (CPG) exposures resulting from alternative waste treatment and disposal methods were evaluated both in absolute terms and also relative to a base case (current practice). Incremental costs of the standard included costs for packaging, processing, transportation, and burial of waste. Benefits are defined in terms of reductions in the general population health risk (expected fatal cancers and genetic effects) evaluated over 10,000 years. A cost-effectiveness ratio, defined as the incremental cost per avoided health effect, was calculated for each alternative standard. The cost-effectiveness analysis took into account a number of waste streams, hydrogeologic and climatic region settings, and waste treatment and disposal methods. This paper describes the alternatives considered and preliminary results of the cost-effectiveness analysis. 15 references, 7 figures, 3 tables

  11. At the intersection of culture and religion: a cultural analysis of religion's implications for secondary control and social affiliation.

    Science.gov (United States)

    Sasaki, Joni Y; Kim, Heejung S

    2011-08-01

    Religion helps people maintain a sense of control, particularly secondary control-acceptance of and adjustment to difficult situations--and contributes to strengthening social relationships in a religious community. However, little is known about how culture may influence these effects. The current research examined the interaction of culture and religion on secondary control and social affiliation, comparing people from individualistic cultures (e.g., European Americans), who tend to be more motivated toward personal agency, and people from collectivistic cultures (e.g., East Asians), who tend to be more motivated to maintain social relationships. In Study 1, an analysis of online church mission statements showed that U.S. websites contained more themes of secondary control than did Korean websites, whereas Korean websites contained more themes of social affiliation than did U.S. websites. Study 2 showed that experimental priming of religion led to acts of secondary control for European Americans but not Asian Americans. Using daily diary methodology, Study 3 showed that religious coping predicted more secondary control for European Americans but not Koreans, and religious coping predicted more social affiliation for Koreans and European Americans. These findings suggest the importance of understanding sociocultural moderators for the effects of religion.

  12. Analysis of methods. [information systems evolution environment

    Science.gov (United States)

    Mayer, Richard J. (Editor); Ackley, Keith A.; Wells, M. Sue; Mayer, Paula S. D.; Blinn, Thomas M.; Decker, Louis P.; Toland, Joel A.; Crump, J. Wesley; Menzel, Christopher P.; Bodenmiller, Charles A.

    1991-01-01

    Information is one of an organization's most important assets. For this reason the development and maintenance of an integrated information system environment is one of the most important functions within a large organization. The Integrated Information Systems Evolution Environment (IISEE) project has as one of its primary goals a computerized solution to the difficulties involved in the development of integrated information systems. To develop such an environment a thorough understanding of the enterprise's information needs and requirements is of paramount importance. This document is the current release of the research performed by the Integrated Development Support Environment (IDSE) Research Team in support of the IISEE project. Research indicates that an integral part of any information system environment would be multiple modeling methods to support the management of the organization's information. Automated tool support for these methods is necessary to facilitate their use in an integrated environment. An integrated environment makes it necessary to maintain an integrated database which contains the different kinds of models developed under the various methodologies. In addition, to speed the process of development of models, a procedure or technique is needed to allow automatic translation from one methodology's representation to another while maintaining the integrity of both. The purpose for the analysis of the modeling methods included in this document is to examine these methods with the goal being to include them in an integrated development support environment. To accomplish this and to develop a method for allowing intra-methodology and inter-methodology model element reuse, a thorough understanding of multiple modeling methodologies is necessary. Currently the IDSE Research Team is investigating the family of Integrated Computer Aided Manufacturing (ICAM) DEFinition (IDEF) languages IDEF(0), IDEF(1), and IDEF(1x), as well as ENALIM, Entity

  13. Integrated Analysis Seismic Inversion and Rockphysics for Determining Secondary Porosity Distribution of Carbonate Reservoir at “FR” Field

    Science.gov (United States)

    Rosid, M. S.; Augusta, F. F.; Haidar, M. W.

    2018-05-01

    In general, carbonate secondary pore structure is very complex due to the significant diagenesis process. Therefore, the determination of carbonate secondary pore types is an important factor which is related to study of production. This paper mainly deals not only to figure out the secondary pores types, but also to predict the distribution of the secondary pore types of carbonate reservoir. We apply Differential Effective Medium (DEM) for analyzing pore types of carbonate rocks. The input parameter of DEM inclusion model is fraction of porosity and the output parameters are bulk moduli and shear moduli as a function of porosity, which is used as input parameter for creating Vp and Vs modelling. We also apply seismic post-stack inversion technique that is used to map the pore type distribution from 3D seismic data. Afterward, we create porosity cube which is better to use geostatistical method due to the complexity of carbonate reservoir. Thus, the results of this study might show the secondary porosity distribution of carbonate reservoir at “FR” field. In this case, North – Northwest of study area are dominated by interparticle pores and crack pores. Hence, that area has highest permeability that hydrocarbon can be more accumulated.

  14. Chapter 11. Community analysis-based methods

    Energy Technology Data Exchange (ETDEWEB)

    Cao, Y.; Wu, C.H.; Andersen, G.L.; Holden, P.A.

    2010-05-01

    Microbial communities are each a composite of populations whose presence and relative abundance in water or other environmental samples are a direct manifestation of environmental conditions, including the introduction of microbe-rich fecal material and factors promoting persistence of the microbes therein. As shown by culture-independent methods, different animal-host fecal microbial communities appear distinctive, suggesting that their community profiles can be used to differentiate fecal samples and to potentially reveal the presence of host fecal material in environmental waters. Cross-comparisons of microbial communities from different hosts also reveal relative abundances of genetic groups that can be used to distinguish sources. In increasing order of their information richness, several community analysis methods hold promise for MST applications: phospholipid fatty acid (PLFA) analysis, denaturing gradient gel electrophoresis (DGGE), terminal restriction fragment length polymorphism (TRFLP), cloning/sequencing, and PhyloChip. Specific case studies involving TRFLP and PhyloChip approaches demonstrate the ability of community-based analyses of contaminated waters to confirm a diagnosis of water quality based on host-specific marker(s). The success of community-based MST for comprehensively confirming fecal sources relies extensively upon using appropriate multivariate statistical approaches. While community-based MST is still under evaluation and development as a primary diagnostic tool, results presented herein demonstrate its promise. Coupled with its inherently comprehensive ability to capture an unprecedented amount of microbiological data that is relevant to water quality, the tools for microbial community analysis are increasingly accessible, and community-based approaches have unparalleled potential for translation into rapid, perhaps real-time, monitoring platforms.

  15. Cleanup standards and pathways analysis methods

    International Nuclear Information System (INIS)

    Devgun, J.S.

    1993-01-01

    Remediation of a radioactively contaminated site requires that certain regulatory criteria be met before the site can be released for unrestricted future use. Since the ultimate objective of remediation is to protect the public health and safety, residual radioactivity levels remaining at a site after cleanup must be below certain preset limits or meet acceptable dose or risk criteria. Release of a decontaminated site requires proof that the radiological data obtained from the site meet the regulatory criteria for such a release. Typically release criteria consist of a composite of acceptance limits that depend on the radionuclides, the media in which they are present, and federal and local regulations. In recent years, the US Department of Energy (DOE) has developed a pathways analysis model to determine site-specific soil activity concentration guidelines for radionuclides that do not have established generic acceptance limits. The DOE pathways analysis computer code (developed by Argonne National Laboratory for the DOE) is called RESRAD (Gilbert et al. 1989). Similar efforts have been initiated by the US Nuclear Regulatory Commission (NRC) to develop and use dose-related criteria based on genetic pathways analyses rather than simplistic numerical limits on residual radioactivity. The focus of this paper is radionuclide contaminated soil. Cleanup standards are reviewed, pathways analysis methods are described, and an example is presented in which RESRAD was used to derive cleanup guidelines

  16. 3D analysis methods - Study and seminar

    International Nuclear Information System (INIS)

    Daaviittila, A.

    2003-10-01

    The first part of the report results from a study that was performed as a Nordic co-operation activity with active participation from Studsvik Scandpower and Westinghouse Atom in Sweden, and VTT in Finland. The purpose of the study was to identify and investigate the effects rising from using the 3D transient com-puter codes in BWR safety analysis, and their influence on the transient analysis methodology. One of the main questions involves the critical power ratio (CPR) calculation methodology. The present way, where the CPR calculation is per-formed with a separate hot channel calculation, can be artificially conservative. In the investigated cases, no dramatic minimum CPR effect coming from the 3D calculation is apparent. Some cases show some decrease in the transient change of minimum CPR with the 3D calculation, which confirms the general thinking that the 1D calculation is conservative. On the other hand, the observed effect on neutron flux behaviour is quite large. In a slower transient the 3D effect might be stronger. The second part of the report is a summary of a related seminar that was held on the 3D analysis methods. The seminar was sponsored by the Reactor Safety part (NKS-R) of the Nordic Nuclear Safety Research Programme (NKS). (au)

  17. Generalized Analysis of a Distribution Separation Method

    Directory of Open Access Journals (Sweden)

    Peng Zhang

    2016-04-01

    Full Text Available Separating two probability distributions from a mixture model that is made up of the combinations of the two is essential to a wide range of applications. For example, in information retrieval (IR, there often exists a mixture distribution consisting of a relevance distribution that we need to estimate and an irrelevance distribution that we hope to get rid of. Recently, a distribution separation method (DSM was proposed to approximate the relevance distribution, by separating a seed irrelevance distribution from the mixture distribution. It was successfully applied to an IR task, namely pseudo-relevance feedback (PRF, where the query expansion model is often a mixture term distribution. Although initially developed in the context of IR, DSM is indeed a general mathematical formulation for probability distribution separation. Thus, it is important to further generalize its basic analysis and to explore its connections to other related methods. In this article, we first extend DSM’s theoretical analysis, which was originally based on the Pearson correlation coefficient, to entropy-related measures, including the KL-divergence (Kullback–Leibler divergence, the symmetrized KL-divergence and the JS-divergence (Jensen–Shannon divergence. Second, we investigate the distribution separation idea in a well-known method, namely the mixture model feedback (MMF approach. We prove that MMF also complies with the linear combination assumption, and then, DSM’s linear separation algorithm can largely simplify the EM algorithm in MMF. These theoretical analyses, as well as further empirical evaluation results demonstrate the advantages of our DSM approach.

  18. Comparative Analysis of Psychological, Hormonal, and Genetic Factors Between Burning Mouth Syndrome and Secondary Oral Burning.

    Science.gov (United States)

    das Neves de Araújo Lima, Emeline; Barbosa, Natália Guimarães; Dos Santos, Ana Celly Souza; AraújoMouraLemos, Telma Maria; de Souza, Cleber Machado; Trevilatto, Paula Cristina; da Silveira, Ericka Janine Dantas; de Medeiros, Ana Miryam Costa

    2016-09-01

    The objective of this study was to evaluate the association between psychological, hormonal, and genetic factors with the development of burning mouth syndrome (BMS) and secondary oral burning (SOB) in order to provide a better characterization and classification of these conditions. Cross sectional study. Patients with complaints of mouth burning registered at the Oral Diagnostic Service of the Federal University of Rio Grande do Norte between 2000 and 2013. The sample consisted of 163 subjects divided into a group of patients with BMS (n = 64) and a group of subjects with SOB (n = 99). The following variables were analyzed: passive and stimulated saliva flow, stress levels and phase, depression, anxiety, serum cortisol and dehydroepiandrosterone (DHEA) levels, and the presence of polymorphisms in the interleukin 6 (IL-6) gene. The results showed significant differences in the presence of xerostomia (p = 0.01), hyposalivation at rest (p < 0.001) and symptoms of depression (p = 0.033) between the two groups, which were more prevalent in the BMS group. DHEA levels were lower in the BMS group (p = 0.003) and were sensitive and specific for the diagnosis of this condition. Genetic analysis revealed no significant association between the polymorphisms analyzed and the development of BMS. These results suggest a possible role of depression, as well as of reduced DHEA levels, as associated factors for development of BMS. © 2016 American Academy of Pain Medicine. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. Factors influencing secondary care pharmacist and nurse independent prescribers' clinical reasoning: An interprofessional analysis.

    Science.gov (United States)

    Abuzour, Aseel S; Lewis, Penny J; Tully, Mary P

    2018-03-01

    In the United Kingdom, pharmacist and nurse independent prescribers are responsible for both the clinical assessment of and prescribing for patients. Prescribing is a complex skill that entails the application of knowledge, skills, and clinical reasoning to arrive at a clinically appropriate decision. Decision-making is influenced and informed by many factors. This study, the first of its kind, explores what factors influence pharmacist and nurse independent prescribers during the process of clinical reasoning. A think-aloud methodology immediately followed by a semi-structured interview was conducted with 11 active nurse and 10 pharmacist independent prescribers working in secondary care. Each participant was presented with validated clinical vignettes for the think-aloud stage. Participants chose the clinical therapeutic areas for the vignettes, based on their self-perceived competencies. Data were audio-recorded, transcribed verbatim, and a constant-comparative approach was used for analysis. Influences on clinical reasoning were broadly categorised into themes: social interaction, intrinsic, and contextual factors. These themes showed that intrinsic, sociocultural, and contextual aspects heavily influenced the clinical reasoning processes of prescribers. For example, prescribers were aware of treatment pathways, but chose to refer patient cases to avoid making the final prescribing decision. Exploration of this behaviour in the interviews revealed that previous experience and attitudes such as confidence and cautiousness associated with responsibility were strong influencers within the decision-making process. In addition, strengthening the professional identity of prescribers could be achieved through collaborative work with interprofessional healthcare teams to orient their professional practice from within the profession. Findings from this study can be used to inform the education, training, and practice of independent prescribers to improve healthcare

  20. [Epidemiology of psoriasis in Germany--analysis of secondary health insurance data].

    Science.gov (United States)

    Schäfer, I; Rustenbach, S J; Radtke, M; Augustin, J; Glaeske, G; Augustin, M

    2011-05-01

    In Germany, population-based data on the epidemiology of psoriasis are still rare. This study aims to assess the prevalence of psoriasis in the total population as well as for subgroups relevant to health care. As further epidemiological parameters the severity and regional distribution of psoriasis were analysed. A secondary analysis of data collected routinely for the members of a nationwide statutory health insurance company was conducted. Prevalences were calculated for a closed cohort of continuously insured persons in 2005. Defined criteria for the existence of psoriasis were at least one diagnoses of psoriasis (ICD-10) relating to ambulatory or hospital treatment or disability. 33,981 of the 1,344,071 continuously insured persons in 2005 were diagnosed with psoriasis, thus the one-year-prevalence in this cohort was 2.53%. Up to the age of 80 years the prevalence rate was increasing with increasing age and highest for the age groups from 50 to 79 years (range: 3.99-4.18%). Insured persons up to 20 years had a prevalence of 0.73%. Regional differences showed up after stratification for broad categories (1 digit) of ZIP codes: Lowest prevalence rates were seen in the south (2.17%) and highest (2.78%) in the north and western regions of Germany. If the prevalence rate of 2.5% assessed in this study is applied to the total resident population, 2 million people are treated because of psoriasis in Germany. Routine data from health insurance companies are a relevant and suitable data source to assess the prevalence of chronic diseases (under medical treatment) in the population. © Georg Thieme Verlag KG Stuttgart · New York.

  1. Some critical methodological issues in secondary analysis of world health organization data on elderly suicide rates.

    Science.gov (United States)

    Shah, Ajit

    2009-07-01

    Suicides may be misclassified as accidental deaths in countries with strict legal definitions of suicide, with cultural and religious factors leading to poor registration of suicide and stigma attached to suicide. The concordance between four different definitions of suicides was evaluated by examining the relationship between pure suicide and accidental death rates, gender differences, age-associated trends and potential distil risk and protective factors by conducting secondary analysis of the latest World Health Organisation data on elderly death rates. The four definitions of suicide were: (i) one-year pure suicides rates; one-year combined suicide rates (pure suicide rates combined with accidental death rates); (iii) five-year average pure suicide rates; and (iv) five-year average combined suicides rates (pure suicides rates combined with accidental death rates). The predicted negative correlation between pure suicide and accidental death rates was not observed. Gender differences were similar for all four definitions of suicide. There was a highly significant concordance for the findings of age-associated trends between one-year pure and combined suicide rates, one-year and five-year average pure suicide rates, and five-year average pure and combined suicide rates. There was poor concordance between pure and combined suicide rates for both one-year and five-year average data for the 14 potential distil risk and protective factors, but this concordance between one-year and five-year average pure suicide rates was highly significant. The use of one-year pure suicide rates in cross-national ecological studies examining gender differences, age-associated trends and potential distil risk and protective factors is likely to be practical, pragmatic and resource-efficient.

  2. Cardiovascular risk assessment in the treatment of nonalcoholic steatohepatitis: a secondary analysis of the MOZART trial.

    Science.gov (United States)

    Lin, Steven C; Ang, Brandon; Hernandez, Carolyn; Bettencourt, Ricki; Jain, Rashmi; Salotti, Joanie; Richards, Lisa; Kono, Yuko; Bhatt, Archana; Aryafar, Hamed; Lin, Grace Y; Valasek, Mark A; Sirlin, Claude B; Brouha, Sharon; Loomba, Rohit

    2016-03-01

    Nonalcoholic steatohepatitis (NASH) is associated with increased cardiovascular risk and mortality. No US Food and Drug Administration (FDA) approved therapies for NASH are available; clinical trials to date have not yet systematically assessed for changes in cardiovascular risk. This study examines the prospective utility of cardiovascular risk assessments, the Framingham risk score (FRS) and coronary artery calcium (CAC) score, as endpoints in a NASH randomized clinical trial, and assesses whether histologic improvements lead to lower cardiovascular risk. Secondary analysis of a 24-week randomized, double-blind, placebo-controlled trial (MOZART) in which 50 biopsy-proven NASH patients received oral ezetimibe 10 mg daily (n = 25) versus placebo (n = 25). Biochemical profiling, FRS, CAC scores, liver biopsies were obtained at baseline and endpoint. Ezetimibe improved FRS whereas placebo did not (4.4 ± 6.2 to 2.9 ± 4.8, p = 0.038; 3.0 ± 4.4 to 2.9 ± 4.2, p = 0.794). CAC scores did not change with ezetimibe or placebo (180.4 ± 577.2 to 194.1 ± 623.9, p = 0.293; 151.4 ± 448.9 to 183.3 ± 555.7, p = 0.256). Ezetimibe improved FRS and CAC scores in more patients than placebo (48% versus 23%, p = 0.079, and 21% versus 0%, p = 0.090, respectively), though not significantly. No differences were noted in cardiovascular risk scores among histologic responders versus nonresponders. Ezetimibe improved FRS whereas placebo did not. FRS and CAC scores improved in a greater proportion of patients with ezetimibe; this trend did not reach significance. These findings indicate the utility and feasibility of monitoring cardiovascular risk in a NASH trial. The utility of CAC scores may be higher in trials of longer duration (⩾52 weeks) and with older patients (age ⩾45). ClinicalTrials.gov registration: NCT01766713.

  3. Assessment methods as effective tools for learning outcomes of students in senior secondary schools in Ila-Orangun, south western Nigeria

    Directory of Open Access Journals (Sweden)

    Lamidi W.A

    2013-06-01

    Full Text Available Different methods of assessment on the students learning outcomes in Agricultural Science at five different secondary schools in Ila-Orangun, Osun State were studied. An arm of a class was used for each test; Continuous Assessment (CA and Conventional Method (CM were used for each arm. Students were taught during their normal school times for the maximum time of forty minutes thrice a week. There were ten objective questions weekly for each assessment of the students in the CA method for six weeks. The same questions were used throughout for all the schools, done simultaneously for CA. Also, sixty questions at once at the end of the sixth week for CM. Standard deviation and regression equations for the mean values were used in the analysis. The results show that CA could be adjudged to be better off than the CM because of its higher mean values in all the schools than the CM. The higher R2 values of 0.99 and 0.88 revealed stronger correlation between different methods of assessment and the targeted learners. The CA test should be used instead of CM; the CM does not make learners to gain much cognitive knowledge when compare with what CA does to students.

  4. Method development for trace and ultratrace analysis

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    Method development, that is, selection of a mode of chromatography and the right column and mobile-phase combination for trace and ultratrace analysis, requires several main considerations. The method should be useful for resolving various trace and ultratrace components present in the sample. If the nature of these components is known, the choice of method may be straightforward, that is, a selection can be made from the following modes of HPLC: (1) adsorption chromatography; (2) normal-phase chromatography; (3) reversed-phase chromatography; (4) ion-pair chromatography; (5) ion-exchange chromatography; (6) ion chromatography. Unfortunately, the nature of all of the components is frequently unknown. However, several intelligent judgments can be made on the nature of impurities. This chapter deals with some basic approaches to mobile-phase selection and optimization. More detailed information may be found in basic texts. Techniques for separation of high-molecular-weight compounds (macromolecules) and chiral compounds may be found elsewhere. Mainly compounds with molecular weight lower than 2,000 are discussed here. 123 refs

  5. Novel Method of Production Decline Analysis

    Science.gov (United States)

    Xie, Shan; Lan, Yifei; He, Lei; Jiao, Yang; Wu, Yong

    2018-02-01

    ARPS decline curves is the most commonly used in oil and gas field due to its minimal data requirements and ease application. And prediction of production decline which is based on ARPS analysis rely on known decline type. However, when coefficient index are very approximate under different decline type, it is difficult to directly recognize decline trend of matched curves. Due to difficulties above, based on simulation results of multi-factor response experiments, a new dynamic decline prediction model is introduced with using multiple linear regression of influence factors. First of all, according to study of effect factors of production decline, interaction experimental schemes are designed. Based on simulated results, annual decline rate is predicted by decline model. Moreover, the new method is applied in A gas filed of Ordos Basin as example to illustrate reliability. The result commit that the new model can directly predict decline tendency without needing recognize decline style. From arithmetic aspect, it also take advantage of high veracity. Finally, the new method improves the evaluation method of gas well production decline in low permeability gas reservoir, which also provides technical support for further understanding of tight gas field development laws.

  6. Phylogenetic analysis using parsimony and likelihood methods.

    Science.gov (United States)

    Yang, Z

    1996-02-01

    The assumptions underlying the maximum-parsimony (MP) method of phylogenetic tree reconstruction were intuitively examined by studying the way the method works. Computer simulations were performed to corroborate the intuitive examination. Parsimony appears to involve very stringent assumptions concerning the process of sequence evolution, such as constancy of substitution rates between nucleotides, constancy of rates across nucleotide sites, and equal branch lengths in the tree. For practical data analysis, the requirement of equal branch lengths means similar substitution rates among lineages (the existence of an approximate molecular clock), relatively long interior branches, and also few species in the data. However, a small amount of evolution is neither a necessary nor a sufficient requirement of the method. The difficulties involved in the application of current statistical estimation theory to tree reconstruction were discussed, and it was suggested that the approach proposed by Felsenstein (1981, J. Mol. Evol. 17: 368-376) for topology estimation, as well as its many variations and extensions, differs fundamentally from the maximum likelihood estimation of a conventional statistical parameter. Evidence was presented showing that the Felsenstein approach does not share the asymptotic efficiency of the maximum likelihood estimator of a statistical parameter. Computer simulations were performed to study the probability that MP recovers the true tree under a hierarchy of models of nucleotide substitution; its performance relative to the likelihood method was especially noted. The results appeared to support the intuitive examination of the assumptions underlying MP. When a simple model of nucleotide substitution was assumed to generate data, the probability that MP recovers the true topology could be as high as, or even higher than, that for the likelihood method. When the assumed model became more complex and realistic, e.g., when substitution rates were

  7. Primary and secondary battery consumption trends in Sweden 1996-2013: method development and detailed accounting by battery type.

    Science.gov (United States)

    Patrício, João; Kalmykova, Yuliya; Berg, Per E O; Rosado, Leonardo; Åberg, Helena

    2015-05-01

    In this article, a new method based on Material Flow Accounting is proposed to study detailed material flows in battery consumption that can be replicated for other countries. The method uses regularly available statistics on import, industrial production and export of batteries and battery-containing electric and electronic equipment (EEE). To promote method use by other scholars with no access to such data, several empirically results and their trends over time, for different types of batteries occurrence among the EEE types are provided. The information provided by the method can be used to: identify drivers of battery consumption; study the dynamic behavior of battery flows - due to technology development, policies, consumers behavior and infrastructures. The method is exemplified by the study of battery flows in Sweden for years 1996-2013. The batteries were accounted, both in units and weight, as primary and secondary batteries; loose and integrated; by electrochemical composition and share of battery use between different types of EEE. Results show that, despite a fivefold increase in the consumption of rechargeable batteries, they account for only about 14% of total use of portable batteries. Recent increase in digital convergence has resulted in a sharp decline in the consumption of primary batteries, which has now stabilized at a fairly low level. Conversely, the consumption of integrated batteries has increased sharply. In 2013, 61% of the total weight of batteries sold in Sweden was collected, and for the particular case of alkaline manganese dioxide batteries, the value achieved 74%. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. External event analysis methods for NUREG-1150

    International Nuclear Information System (INIS)

    Bohn, M.P.; Lambright, J.A.

    1989-01-01

    The US Nuclear Regulatory Commission is sponsoring probabilistic risk assessments of six operating commercial nuclear power plants as part of a major update of the understanding of risk as provided by the original WASH-1400 risk assessments. In contrast to the WASH-1400 studies, at least two of the NUREG-1150 risk assessments will include an analysis of risks due to earthquakes, fires, floods, etc., which are collectively known as eternal events. This paper summarizes the methods to be used in the external event analysis for NUREG-1150 and the results obtained to date. The two plants for which external events are being considered are Surry and Peach Bottom, a PWR and BWR respectively. The external event analyses (through core damage frequency calculations) were completed in June 1989, with final documentation available in September. In contrast to most past external event analyses, wherein rudimentary systems models were developed reflecting each external event under consideration, the simplified NUREG-1150 analyses are based on the availability of the full internal event PRA systems models (event trees and fault trees) and make use of extensive computer-aided screening to reduce them to sequence cut sets important to each external event. This provides two major advantages in that consistency and scrutability with respect to the internal event analysis is achieved, and the full gamut of random and test/maintenance unavailabilities are automatically included, while only those probabilistically important survive the screening process. Thus, full benefit of the internal event analysis is obtained by performing the internal and external event analyses sequentially

  9. Evaluation of the Methods for Response Analysis under Non-Stationary Excitation

    Directory of Open Access Journals (Sweden)

    R.S. Jangid

    1999-01-01

    Full Text Available Response of structures to non-stationary ground motion can be obtained either by the evolutionary spectral analysis or by the Markov approach. In certain conditions, a quasi-stationary analysis can also be performed. The first two methods of analysis are difficult to apply for complex situations such as problems involving soil-structure interaction, non-classical damping and primary-secondary structure interaction. The quasi-stationary analysis, on the other hand, provides an easier solution procedure for such cases. Here-in, the effectiveness of the quasi-stationary analysis is examined with the help of the analysis of a single degree-of-freedom (SDOF system under a set of parametric variations. For this purpose, responses of the SDOF system to uniformly modulated non-stationary random ground excitation are obtained by the three methods and they are compared. In addition, the relative computational efforts for different methods are also investigated.

  10. Ionic secondary emission SIMS principles and instrumentation

    International Nuclear Information System (INIS)

    Darque-Ceretti, E.; Migeon, H.N.; Aucouturier, M.

    1998-01-01

    The ionic analysis by secondary emission (SIMS) is one of material analysis based on the ions bombardment. That is micro-analysis method in taking into account that the dimensions of the analysed volume are under the micrometer. This paper details in a first part some ionic secondary emission principle to introduce a description of the instrumentation: microprobe, ions production, spectrometers. (A.L.B.)

  11. Representation of Tinnitus in the US Newspaper Media and in Facebook Pages: Cross-Sectional Analysis of Secondary Data

    Science.gov (United States)

    Ratinaud, Pierre; Andersson, Gerhard

    2018-01-01

    Background When people with health conditions begin to manage their health issues, one important issue that emerges is the question as to what exactly do they do with the information that they have obtained through various sources (eg, news media, social media, health professionals, friends, and family). The information they gather helps form their opinions and, to some degree, influences their attitudes toward managing their condition. Objective This study aimed to understand how tinnitus is represented in the US newspaper media and in Facebook pages (ie, social media) using text pattern analysis. Methods This was a cross-sectional study based upon secondary analyses of publicly available data. The 2 datasets (ie, text corpuses) analyzed in this study were generated from US newspaper media during 1980-2017 (downloaded from the database US Major Dailies by ProQuest) and Facebook pages during 2010-2016. The text corpuses were analyzed using the Iramuteq software using cluster analysis and chi-square tests. Results The newspaper dataset had 432 articles. The cluster analysis resulted in 5 clusters, which were named as follows: (1) brain stimulation (26.2%), (2) symptoms (13.5%), (3) coping (19.8%), (4) social support (24.2%), and (5) treatment innovation (16.4%). A time series analysis of clusters indicated a change in the pattern of information presented in newspaper media during 1980-2017 (eg, more emphasis on cluster 5, focusing on treatment inventions). The Facebook dataset had 1569 texts. The cluster analysis resulted in 7 clusters, which were named as: (1) diagnosis (21.9%), (2) cause (4.1%), (3) research and development (13.6%), (4) social support (18.8%), (5) challenges (11.1%), (6) symptoms (21.4%), and (7) coping (9.2%). A time series analysis of clusters indicated no change in information presented in Facebook pages on tinnitus during 2011-2016. Conclusions The study highlights the specific aspects about tinnitus that the US newspaper media and Facebook

  12. Do quality improvement initiatives for diabetes care address social inequities? Secondary analysis of a systematic review.

    Science.gov (United States)

    Lu, Jacquie Boyang; Danko, Kristin J; Elfassy, Michael D; Welch, Vivian; Grimshaw, Jeremy M; Ivers, Noah M

    2018-02-14

    Socially disadvantaged populations carry a disproportionate burden of diabetes-related morbidity and mortality. There is an emerging interest in quality improvement (QI) strategies in the care of patients with diabetes, however, the effect of these interventions on disadvantaged groups remains unclear. This is a secondary analysis of a systematic review that seeks to examine the extent of equity considerations in diabetes QI studies, specifically quantifying the proportion of studies that target interventions toward disadvantaged populations and conduct analyses on the impact of interventions on disadvantaged groups. Studies were identified using Medline, HealthStar and the Cochrane Effective Practice and Organisation of Care database. Randomised controlled trials assessing 12 QI strategies targeting health systems, healthcare professionals and/or patients for the management of adult outpatients with diabetes were eligible. The place of residence, race/ethnicity/culture/language, occupational status, gender/sexual identity, religious affiliations, education level, socioeconomic status, social capital, plus age, disability, sexual preferences and relationships (PROGRESS-Plus) framework was used to identify trials that focused on disadvantaged patient populations, to examine the types of equity-relevant factors that are being considered and to explore temporal trends in equity-relevant diabetes QI trials. Of the 278 trials that met the inclusion criteria, 95 trials had equity-relevant considerations. These include 64 targeted trials that focused on a disadvantaged population with the aim to improve the health status of that population and 31 general trials that undertook subgroup analyses to assess the extent to which their interventions may have had differential impacts on disadvantaged subgroups. Trials predominantly focused on race/ethnicity, socioeconomic status and place of residence as potential factors for disadvantage in patients receiving diabetes care. Less

  13. The Impact of Organizational Innovations in Nursing Homes on Staff Perceptions: A Secondary Data Analysis.

    Science.gov (United States)

    Adams, Joost; Verbeek, Hilde; Zwakhalen, Sandra M G

    2017-01-01

    The shift in nursing home care for patients with dementia from traditional task-driven environments towards patient-centered small-scale environments has implications for nursing practice. Information about its implications for nursing staff is lacking, and only a few studies have addressed staff perceptions. We sought to explore staff perceptions of required skills and to determine differences in job satisfaction, motivation, and job characteristics of staff working in both care settings. A secondary data analysis was conducted. The data source used was drawn from a larger study testing the effects of small-scale living (Verbeek et al., 2009). Nursing staff working on a permanent basis and who were directly involved in care were eligible to participate in the study. Data on job satisfaction, motivation, and job characteristics of nursing staff working in typical small-scale and traditional care environments were derived using a questionnaire. Data were analyzed using descriptive statistics. Differences between nursing staff job satisfaction, motivation, and job characteristics were tested using multilinear regression analysis. In total, 138 staff members were included (81 staff members working in traditional nursing home wards and 57 staff members working in small-scale nursing home wards). The findings showed that in typical small-scale nursing homes, job satisfaction and job motivation were significantly higher compared to those in typical traditional nursing homes. Job autonomy and social support were also significantly higher, while job demands were significantly lower in these small-scale nursing homes. Social support was found to be the most significant predictor of job motivation and job satisfaction in both types of typical nursing homes. Nursing staff working in traditional care environments more often expressed the intention to switch to small-scale environments. Based on the findings of this study, it can be concluded that nursing homes environments

  14. Spectral Analysis Methods of Social Networks

    Directory of Open Access Journals (Sweden)

    P. G. Klyucharev

    2017-01-01

    Full Text Available Online social networks (such as Facebook, Twitter, VKontakte, etc. being an important channel for disseminating information are often used to arrange an impact on the social consciousness for various purposes - from advertising products or services to the full-scale information war thereby making them to be a very relevant object of research. The paper reviewed the analysis methods of social networks (primarily, online, based on the spectral theory of graphs. Such methods use the spectrum of the social graph, i.e. a set of eigenvalues of its adjacency matrix, and also the eigenvectors of the adjacency matrix.Described measures of centrality (in particular, centrality based on the eigenvector and PageRank, which reflect a degree of impact one or another user of the social network has. A very popular PageRank measure uses, as a measure of centrality, the graph vertices, the final probabilities of the Markov chain, whose matrix of transition probabilities is calculated on the basis of the adjacency matrix of the social graph. The vector of final probabilities is an eigenvector of the matrix of transition probabilities.Presented a method of dividing the graph vertices into two groups. It is based on maximizing the network modularity by computing the eigenvector of the modularity matrix.Considered a method for detecting bots based on the non-randomness measure of a graph to be computed using the spectral coordinates of vertices - sets of eigenvector components of the adjacency matrix of a social graph.In general, there are a number of algorithms to analyse social networks based on the spectral theory of graphs. These algorithms show very good results, but their disadvantage is the relatively high (albeit polynomial computational complexity for large graphs.At the same time it is obvious that the practical application capacity of the spectral graph theory methods is still underestimated, and it may be used as a basis to develop new methods.The work

  15. Automated correlation and classification of secondary ion mass spectrometry images using a k-means cluster method.

    Science.gov (United States)

    Konicek, Andrew R; Lefman, Jonathan; Szakal, Christopher

    2012-08-07

    We present a novel method for correlating and classifying ion-specific time-of-flight secondary ion mass spectrometry (ToF-SIMS) images within a multispectral dataset by grouping images with similar pixel intensity distributions. Binary centroid images are created by employing a k-means-based custom algorithm. Centroid images are compared to grayscale SIMS images using a newly developed correlation method that assigns the SIMS images to classes that have similar spatial (rather than spectral) patterns. Image features of both large and small spatial extent are identified without the need for image pre-processing, such as normalization or fixed-range mass-binning. A subsequent classification step tracks the class assignment of SIMS images over multiple iterations of increasing n classes per iteration, providing information about groups of images that have similar chemistry. Details are discussed while presenting data acquired with ToF-SIMS on a model sample of laser-printed inks. This approach can lead to the identification of distinct ion-specific chemistries for mass spectral imaging by ToF-SIMS, as well as matrix-assisted laser desorption ionization (MALDI), and desorption electrospray ionization (DESI).

  16. Method and tool for network vulnerability analysis

    Science.gov (United States)

    Swiler, Laura Painton [Albuquerque, NM; Phillips, Cynthia A [Albuquerque, NM

    2006-03-14

    A computer system analysis tool and method that will allow for qualitative and quantitative assessment of security attributes and vulnerabilities in systems including computer networks. The invention is based on generation of attack graphs wherein each node represents a possible attack state and each edge represents a change in state caused by a single action taken by an attacker or unwitting assistant. Edges are weighted using metrics such as attacker effort, likelihood of attack success, or time to succeed. Generation of an attack graph is accomplished by matching information about attack requirements (specified in "attack templates") to information about computer system configuration (contained in a configuration file that can be updated to reflect system changes occurring during the course of an attack) and assumed attacker capabilities (reflected in "attacker profiles"). High risk attack paths, which correspond to those considered suited to application of attack countermeasures given limited resources for applying countermeasures, are identified by finding "epsilon optimal paths."

  17. [Secondary male hypogonadism induced by sellar space-occupying lesion: Clinical analysis of 22 cases].

    Science.gov (United States)

    Lu, Hong-Lei; Wang, Tao; Xu, Hao; Chen, Li-Ping; Rao, Ke; Yang, Jun; Yuan, Hui-Xing; Liu, Ji-Hong

    2016-08-01

    To analyze the clinical characteristics of secondary male hypogonadism induced by sellar space-occupying lesion, explore its pathogenesis, and improve its diagnosis and treatment. We retrospectively analyzed the clinical data about 22 cases of secondary male hypogonadism induced by sellar space-occupying lesion, reviewed related literature, and investigated the clinical manifestation, etiological factors, and treatment methods of the disease. Hypogonadism developed in 10 of the patients before surgery and radiotherapy (group A) and in the other 12 after it (group B). The patients received endocrine therapy with Andriol (n=7) or hCG (n=15). The average diameter of the sellar space-occupying lesions was significantly longer in group A than in B ([2.35±0.71] vs [1.83±0.36] cm, P<0.05) and the incidence rate of prolactinomas was markedly higher in the former than in the latter group (60% vs 0, P<0.01). The levels of lutein hormone (LH), follicle stimulating hormone (FSH) and testosterone (T) were remarkably decreased in group B after surgery and radiotherapy (P<0.01). Compared with the parameters obtained before endocrine therapy, all the patients showed significant increases after intervention with Andriol or hCG in the T level ([0.78±0.40] vs [2.71±0.70] ng/ml with Andriol; [0.93±0.44] vs [3.07±0.67] ng/ml with hCG) and IIEF-5 score (5.00±2.61 vs 14.50±3.62 with Andriol; 5.36±1.82 vs 15.07±3.27 with hCG) (all P<0.01). The testis volume increased and pubic hair began to grow in those with hypoevolutism. The patients treated with hCG showed a significantly increased testis volume (P<0.01) and sperm was detected in 7 of them, whose baseline testis volume was markedly larger than those that failed to produce sperm ([11.5±2.3] vs [7.5±2.3] ml, P<0.01). Those treated with Andriol exhibited no significant difference in the testis volume before and after intervention and produced no sperm, either. Hypothyroidism might be attributed

  18. Quantitative Risk Analysis: Method And Process

    Directory of Open Access Journals (Sweden)

    Anass BAYAGA

    2010-03-01

    Full Text Available Recent and past studies (King III report, 2009: 73-75; Stoney 2007;Committee of Sponsoring Organisation-COSO, 2004, Bartell, 2003; Liebenberg and Hoyt, 2003; Reason, 2000; Markowitz 1957 lament that although, the introduction of quantifying risk to enhance degree of objectivity in finance for instance was quite parallel to its development in the manufacturing industry, it is not the same in Higher Education Institution (HEI. In this regard, the objective of the paper was to demonstrate the methods and process of Quantitative Risk Analysis (QRA through likelihood of occurrence of risk (phase I. This paper serves as first of a two-phased study, which sampled hundred (100 risk analysts in a University in the greater Eastern Cape Province of South Africa.The analysis of likelihood of occurrence of risk by logistic regression and percentages were conducted to investigate whether there were a significant difference or not between groups (analyst in respect of QRA.The Hosmer and Lemeshow test was non-significant with a chi-square(X2 =8.181; p = 0.300, which indicated that there was a good model fit, since the data did not significantly deviate from the model. The study concluded that to derive an overall likelihood rating that indicated the probability that a potential risk may be exercised within the construct of an associated threat environment, the following governing factors must be considered: (1 threat source motivation and capability (2 nature of the vulnerability (3 existence and effectiveness of current controls (methods and process.

  19. Level of literacy and dementia: A secondary post-hoc analysis from North-West India

    Directory of Open Access Journals (Sweden)

    Sunil Kumar Raina

    2014-01-01

    Full Text Available Introduction: A relation between literacy and dementia has been studied in past and an association has been documented. This is in spite of some studies pointing to the contrary. The current study was aimed at investigating the influence of level of literacy on dementia in a sample stratified by geography (Migrant, Urban, Rural and Tribal areas of sub-Himalayan state of Himachal Pradesh, India. Materials and Methods: The study was based on post-hoc analysis of data obtained from a study conducted on elderly population (60 years and above from selected geographical areas (Migrant, Urban, Rural and Tribal of Himachal Pradesh state in North-west India. Results: Analysis of variance revealed an effect of education on cognitive scores [F = 2.823, P =0.01], however, post-hoc Tukey′s HSD test did not reveal any significant pairwise comparisons. Discussion: The possibility that education effects dementia needs further evaluation, more so in Indian context.

  20. Attenuated Total Reflection Fourier Transform Infrared (ATR FT-IR) Spectroscopy as an Analytical Method to Investigate the Secondary Structure of a Model Protein Embedded in Solid Lipid Matrices.

    Science.gov (United States)

    Zeeshan, Farrukh; Tabbassum, Misbah; Jorgensen, Lene; Medlicott, Natalie J

    2018-02-01

    Protein drugs may encounter conformational perturbations during the formulation processing of lipid-based solid dosage forms. In aqueous protein solutions, attenuated total reflection Fourier transform infrared (ATR FT-IR) spectroscopy can investigate these conformational changes following the subtraction of spectral interference of solvent with protein amide I bands. However, in solid dosage forms, the possible spectral contribution of lipid carriers to protein amide I band may be an obstacle to determine conformational alterations. The objective of this study was to develop an ATR FT-IR spectroscopic method for the analysis of protein secondary structure embedded in solid lipid matrices. Bovine serum albumin (BSA) was chosen as a model protein, while Precirol AT05 (glycerol palmitostearate, melting point 58 ℃) was employed as the model lipid matrix. Bovine serum albumin was incorporated into lipid using physical mixing, melting and mixing, or wet granulation mixing methods. Attenuated total reflection FT-IR spectroscopy and size exclusion chromatography (SEC) were performed for the analysis of BSA secondary structure and its dissolution in aqueous media, respectively. The results showed significant interference of Precirol ATO5 with BSA amide I band which was subtracted up to 90% w/w lipid content to analyze BSA secondary structure. In addition, ATR FT-IR spectroscopy also detected thermally denatured BSA solid alone and in the presence of lipid matrix indicating its suitability for the detection of denatured protein solids in lipid matrices. Despite being in the solid state, conformational changes occurred to BSA upon incorporation into solid lipid matrices. However, the extent of these conformational alterations was found to be dependent on the mixing method employed as indicated by area overlap calculations. For instance, the melting and mixing method imparted negligible effect on BSA secondary structure, whereas the wet granulation mixing method promoted

  1. Analysis of secondary particle behavior in multiaperture, multigrid accelerator for the ITER neutral beam injector.

    Science.gov (United States)

    Mizuno, T; Taniguchi, M; Kashiwagi, M; Umeda, N; Tobari, H; Watanabe, K; Dairaku, M; Sakamoto, K; Inoue, T

    2010-02-01

    Heat load on acceleration grids by secondary particles such as electrons, neutrals, and positive ions, is a key issue for long pulse acceleration of negative ion beams. Complicated behaviors of the secondary particles in multiaperture, multigrid (MAMuG) accelerator have been analyzed using electrostatic accelerator Monte Carlo code. The analytical result is compared to experimental one obtained in a long pulse operation of a MeV accelerator, of which second acceleration grid (A2G) was removed for simplification of structure. The analytical results show that relatively high heat load on the third acceleration grid (A3G) since stripped electrons were deposited mainly on A3G. This heat load on the A3G can be suppressed by installing the A2G. Thus, capability of MAMuG accelerator is demonstrated for suppression of heat load due to secondary particles by the intermediate grids.

  2. Preliminary hazard analysis using sequence tree method

    International Nuclear Information System (INIS)

    Huang Huiwen; Shih Chunkuan; Hung Hungchih; Chen Minghuei; Yih Swu; Lin Jiinming

    2007-01-01

    A system level PHA using sequence tree method was developed to perform Safety Related digital I and C system SSA. The conventional PHA is a brainstorming session among experts on various portions of the system to identify hazards through discussions. However, this conventional PHA is not a systematic technique, the analysis results strongly depend on the experts' subjective opinions. The analysis quality cannot be appropriately controlled. Thereby, this research developed a system level sequence tree based PHA, which can clarify the relationship among the major digital I and C systems. Two major phases are included in this sequence tree based technique. The first phase uses a table to analyze each event in SAR Chapter 15 for a specific safety related I and C system, such as RPS. The second phase uses sequence tree to recognize what I and C systems are involved in the event, how the safety related systems work, and how the backup systems can be activated to mitigate the consequence if the primary safety systems fail. In the sequence tree, the defense-in-depth echelons, including Control echelon, Reactor trip echelon, ESFAS echelon, and Indication and display echelon, are arranged to construct the sequence tree structure. All the related I and C systems, include digital system and the analog back-up systems are allocated in their specific echelon. By this system centric sequence tree based analysis, not only preliminary hazard can be identified systematically, the vulnerability of the nuclear power plant can also be recognized. Therefore, an effective simplified D3 evaluation can be performed as well. (author)

  3. CARBON SEQUESTRATION: A METHODS COMPARATIVE ANALYSIS

    International Nuclear Information System (INIS)

    Christopher J. Koroneos; Dimitrios C. Rovas

    2008-01-01

    All human activities are related with the energy consumption. Energy requirements will continue to rise, due to the modern life and the developing countries growth. Most of the energy demand emanates from fossil fuels. Fossil fuels combustion has negative environmental impacts, with the CO 2 production to be dominating. The fulfillment of the Kyoto protocol criteria requires the minimization of CO 2 emissions. Thus the management of the CO 2 emissions is an urgent matter. The use of appliances with low energy use and the adoption of an energy policy that prevents the unnecessary energy use, can play lead to the reduction of carbon emissions. A different route is the introduction of ''clean'' energy sources, such as renewable energy sources. Last but not least, the development of carbon sequestration methods can be promising technique with big future potential. The objective of this work is the analysis and comparison of different carbon sequestration and deposit methods. Ocean deposit, land ecosystems deposit, geological formations deposit and radical biological and chemical approaches will be analyzed

  4. Recent improvement of the resonance analysis methods

    International Nuclear Information System (INIS)

    Sirakov, I.; Lukyanov, A.

    2000-01-01

    By the use of a two-step method called Combined, the R-matrix Wigner-Eisenbud representation in the resonance reaction theory has been converted into other equivalent representations (parameterizations) of the collision matrix with Poles in E domain. Two of them called Capture Elimination (CE) and Reaction Elimination (RE) representation respectively, have energy independent parameters and are both rigorous and applicable. The CE representation is essentially a generalization of the Reich-Moore (RM) formalism. The RE representation, in turn, offers some distinct advantages when analyzing fissile nuclei. The latter does not require any approximation for the capture channels and does not need any assumption about the number of fission channels in contrast to the RM representation. Unlike the RM parameters the RE ones are uniquely determined for applications in the resonance analysis. When given in the RE representation, neutron cross sections of fissile nuclei in the resolved resonance region are presented through simple scalar expressions without the need of matrix inversion. Various computer codes have been developed to demonstrate the viability of the new method. The RM parameters of the fissile nuclei have been converted into equivalent RE parameters implying the RM assumptions (REFINE code). Conversely, the RE parameters have been converted into corresponding RM parameters when one fission channel is present and the RM parameter set is unique, e.g. Pu-239, J =1 (REVERSE code). To further enhance the flexibility of the proposed method the obtained RE parameters have been converted into equivalent Generalized Pole parameters (REFILE code), which are parameters of the rigorous pole expansion of the collision matrix in √E domain. equi valent sets of RM, RE and GP parameters of 239 Pu are given as an example. It has been pointed out that all the advantages of the newly proposed representation can be implemented through an independent evaluation of the RE resonance

  5. Analysis of the alternatives for the chemical treatment of the secondary circuit of PWR power plants

    International Nuclear Information System (INIS)

    Lopes, J.P.G.; Silva Neto, A.J. da; Braganca Junior, A.; Dominguez, D.

    1990-01-01

    The operational experiences within PWR power plants shows that the major problems which affect the plant availability occurs in the secondary side, mainly in the steam generators and condenser. The aim of this report is to perform an evaluation of the main chemical treatment processes, which are applied to the secondary side of PWR power plants in order to reduce the corrosion problems to which are exposed the system equipment, minimizing in this way the shut down and maintenance cost for repairs and replacement of damaged components. (author)

  6. The development of leadership outcome-indicators evaluating the contribution of clinical specialists and advanced practitioners to health care: a secondary analysis.

    Science.gov (United States)

    Elliott, Naomi; Begley, Cecily; Kleinpell, Ruth; Higgins, Agnes

    2014-05-01

    To report a secondary analysis of data collected from the case study phase of a national study of advanced practitioners and to develop leadership outcome-indicators appropriate for advanced practitioners. In many countries, advanced practitioners in nursing and midwifery have responsibility as leaders for health care development, but without having leadership outcome measures available they are unable to demonstrate the results of their activities. In Ireland, a sequential mixed method research study was used to develop a validated tool for the evaluation of clinical specialists and advanced practitioners. Despite strong evidence of leadership activities, few leadership-specific outcomes were generated from the primary analysis. Secondary analysis of a multiple case study data set. Data set comprised 23 case studies of advanced practitioner/clinical specialists from 13 sites across each region in Ireland from all divisions of the Nursing Board Register. Data were collected 2008-2010. Data sources included non-participant observation (n = 92 hours) of advanced practitioners in practice, interviews with clinicians (n = 21), patients (n = 20) and directors of nursing/midwifery (n = 13) and documents. Analysis focused on leadership outcome-indicator development in line with the National Health Service's Good Indicators Guide. The four categories of leadership outcomes for advanced practitioner developed were as follows: (i) capacity and capability building of multidisciplinary team; (ii) measure of esteem; (iii) new initiatives for clinical practice and healthcare delivery; and (iv) clinical practice based on evidence. The proposed set of leadership outcome-indicators derived from a secondary analysis captures the complexity of leadership in practice. They add to existing clinical outcomes measuring advanced practice. © 2013 John Wiley & Sons Ltd.

  7. Transient effects in SIMS analysis of Si with Cs sup + at high incidence angles Secondary ion yield variations

    CERN Document Server

    Heide, P A W

    2002-01-01

    Secondary ion mass spectrometry (SIMS) depth profile analysis of Si wafers using 1 keV Cs sup + primary ions at large incidence angles (80 deg. ) is plagued by unusually strong transient effects (variations in both sputter and ion yields). Analysis of a native oxide terminated Si wafer with and without the aid of an O sub 2 leak, and an Ar sup + pre-sputtered wafer revealed correlations between the implanted Cs content and various secondary ion intensities consistent with that expected from a resonance charge transfer process (that assumed by the electron tunneling model). Cs concentrations were defined through X-ray photoelectron spectroscopy of the sputtered surface from SIMS profiles terminated within the transient region. These scaled with the surface roughening occurring under these conditions and can be explained as resulting from the associated drop in sputter rates. An O induced transient effect from the native oxide was also identified. Characterization of these effects allowed the reconstruction of ...

  8. A reliable method for the stability analysis of structures ...

    African Journals Online (AJOL)

    The detection of structural configurations with singular tangent stiffness matrix is essential because they can be unstable. The secondary paths, especially in unstable buckling, can play the most important role in the loss of stability and collapse of the structure. A new method for reliable detection and accurate computation of ...

  9. Is Middle-Upper Arm Circumference "normally" distributed? Secondary data analysis of 852 nutrition surveys.

    Science.gov (United States)

    Frison, Severine; Checchi, Francesco; Kerac, Marko; Nicholas, Jennifer

    2016-01-01

    Wasting is a major public health issue throughout the developing world. Out of the 6.9 million estimated deaths among children under five annually, over 800,000 deaths (11.6 %) are attributed to wasting. Wasting is quantified as low Weight-For-Height (WFH) and/or low Mid-Upper Arm Circumference (MUAC) (since 2005). Many statistical procedures are based on the assumption that the data used are normally distributed. Analyses have been conducted on the distribution of WFH but there are no equivalent studies on the distribution of MUAC. This secondary data analysis assesses the normality of the MUAC distributions of 852 nutrition cross-sectional survey datasets of children from 6 to 59 months old and examines different approaches to normalise "non-normal" distributions. The distribution of MUAC showed no departure from a normal distribution in 319 (37.7 %) distributions using the Shapiro-Wilk test. Out of the 533 surveys showing departure from a normal distribution, 183 (34.3 %) were skewed (D'Agostino test) and 196 (36.8 %) had a kurtosis different to the one observed in the normal distribution (Anscombe-Glynn test). Testing for normality can be sensitive to data quality, design effect and sample size. Out of the 533 surveys showing departure from a normal distribution, 294 (55.2 %) showed high digit preference, 164 (30.8 %) had a large design effect, and 204 (38.3 %) a large sample size. Spline and LOESS smoothing techniques were explored and both techniques work well. After Spline smoothing, 56.7 % of the MUAC distributions showing departure from normality were "normalised" and 59.7 % after LOESS. Box-Cox power transformation had similar results on distributions showing departure from normality with 57 % of distributions approximating "normal" after transformation. Applying Box-Cox transformation after Spline or Loess smoothing techniques increased that proportion to 82.4 and 82.7 % respectively. This suggests that statistical approaches relying on the

  10. Analysis of thermal power calibration method

    International Nuclear Information System (INIS)

    Zagar, T.; Ravnik, M.; Persic, A.

    2000-01-01

    The methods for determining fuel element burnup have recently become interesting because of activities related to the shipment of highly enriched fuel elements back to the United States for final disposal before 2009. The most common and practical method for determining fuel element burnup in research reactors is reactor calculation. Experience has shown that burnup calculations become complicated and biased with uncertainties if a long period of reactor operation must be reproduced. Besides this, accuracy of calculated burnup is always limited with accuracy of reactor power calibration, since burnup calculation is based on calculated power density distribution, which is usually expressed in terms of power released per fuel element and normalised to the reactor power It is obvious that reactor thermal power calibration is very important for precise fuel element burnup calculation. Calculated fuel element burnup is linearly dependent on the thermal reactor power. The reactor power level may be determined from measured absolute thermal flux distribution across the core in the horizontal and vertical planes. Flux distributions are measured with activation of cadmium covered and bare foils irradiated by the steady reactor power. But it should be realised that this method is time consuming and not accurate. This method is practical only for zero power reactors and is in practice very seldom performed for other reactors (e.g. for TRIGA reactor in Ljubljana absolute thermal flux distribution was not performed since reactor reconstruction in 1991). In case of power reactors and research reactors in which a temperature rise across the core is produced and measured than a heat balance method is the most common and accurate method of determining the power output of the core. The purpose of this paper is to analyse the accuracy of calorimetric reactor power calibration method and to analyse the influence of control rod position on nuclear detector reading for TRIGA reactors

  11. Does the impact of case management vary in different subgroups of multimorbidity? Secondary analysis of a quasi-experiment.

    Science.gov (United States)

    Stokes, Jonathan; Kristensen, Søren Rud; Checkland, Kath; Cheraghi-Sohi, Sudeh; Bower, Peter

    2017-08-03

    Health systems must transition from catering primarily to acute conditions, to meet the increasing burden of chronic disease and multimorbidity. Case management is a popular method of integrating care, seeking to accomplish this goal. However, the intervention has shown limited effectiveness. We explore whether the effects of case management vary in patients with different types of multimorbidity. We extended a previously published quasi-experiment (difference-in-differences analysis) with 2049 propensity matched case management intervention patients, adding an additional interaction term to determine subgroup effects (difference-in-difference-in-differences) by different conceptualisations of multimorbidity: 1) Mental-physical comorbidity versus others; 2) 3+ chronic conditions versus 5 versus others. Outcome measures included a variety of secondary care utilisation and cost measures. The majority of conceptualisations suggested little to no difference in effect between subgroups. Where results were significant, the vast majority of effect sizes identified in either direction were very small. The trend across the majority of the results appeared to show very slight increases of admissions with treatment for the most complex patients (highest risk). The exceptions to this, patients with a Charlson index >5 may benefit slightly more from case management with decreased ACSC admissions (effect size (ES): −0.06) and inpatient re-admissions (30 days, ES: −0.05), and patients with only cardiovascular/metabolic cluster conditions may benefit slightly more with decreased inpatient non-elective admissions (ES: −0.12). Only the three significant estimates for the musculoskeletal disorder cluster met the minimum requirement for at least a ‘small’ effect. Two of these estimates in particular were very large. This cluster represented only 0.5% of the total patients analysed, however, so is hugely vulnerable to the effects of outliers, and makes us very cautious of

  12. Entrepreneurial Skills and Socio-Cultural Factors: An Empirical Analysis in Secondary Education Students

    Science.gov (United States)

    Rosique-Blasco, Mario; Madrid-Guijarro, Antonia; García-Pérez-de-Lema, Domingo

    2016-01-01

    Purpose: The purpose of this paper is to explore how entrepreneurial skills (such as creativity, proactivity and risk tolerance) and socio-cultural factors (such as role model and businessman image) affect secondary education students' propensity towards entrepreneurial options in their future careers. Design/methodology/approach: A sample of…

  13. Status of Credentialing Structures Related to Secondary Transition: A State-Level Policy Analysis

    Science.gov (United States)

    Simonsen, Monica L.; Novak, Jeanne A.; Mazzotti, Valerie L.

    2018-01-01

    To understand the current status of transition-related credentialing systems in driving personnel preparation, it is necessary to identify which state education and rehabilitation services agencies are currently providing certification and licensure in the area of secondary transition. The purpose of this study was to examine the current state of…

  14. A Critical Analysis of Retributive Punishment as a Discipline Measure in Nigeria's Public Secondary Schools

    Science.gov (United States)

    Aboluwodi, Akinjide

    2015-01-01

    In recent time, students in Nigerian secondary schools engage in certain acts considered to be inimical to the health of their schools. There were cases of students who caused their mates and teachers bodily harm, and tore mates' books and school uniform. Most school authorities in Nigeria adopt different forms of punishment including retributive…

  15. An Analysis of Family-School Collaboration in Preventing Adolescent Violence in Urban Secondary Schools

    Science.gov (United States)

    Bender, C. J. Gerda; Emslie, Annemarie

    2010-01-01

    The purpose of this article is to describe how school staff members, learners and parents collaborate to prevent adolescent learner violence in two different urban secondary schools. The increase in acts of interpersonal learner violence has a destructive effect on the safe and positive development of young people. Empirical evidence indicates…

  16. An Analysis of Deformities in Revision Surgeries for Secondary Unilateral Cleft Lip

    International Nuclear Information System (INIS)

    Cheema, S. A.; Asim, M.

    2014-01-01

    Objective: To analyze the secondary cleft lip deformities and the possible causes in a cohort of cases. Study Design: A case series. Place and Duration of Study: Services Institute of Medical Sciences and WAPDA Teaching Hospital Complex, Lahore, from September 2008 to March 2012. Methodology: Consecutive cases of secondary unilateral cleft lip deformities were selected for the study. These cases were interviewed and deformities recorded. Pre and postoperative photographs were taken for comparison. Per operative photographs were taken, after marking of the incisions, to keep a record of the intervention needed to correct the deformities. These cases were then further analyzed to know the deformities and interventions needed for correction of these deformities. Results: Study subjects comprised 114 males and 75 females. Secondary correction was the most common in second decade of life with 82 cases in this group. The most common deformity was unfavorable scar in 150 cases followed by notch at the vermilion border in 124 cases. Short lip was found in 119 cases. Complete revision of the repair was required in 158 cases and 25 cases required partial redo of the initial repair. In other 6 cases, only scar revision was carried out. Conclusion: Unfavorable scar followed by vermilion notch and short lip were the most common secondary cleft lip deformities. Better technique helps favorable scar. Vermilion notch and short lip can be overcome by switching from rotation advancement repair to the triangular flap repair of Noordhoff. (author)

  17. Cost Effectiveness Analysis between Boarding and Day Secondary Students in Kenya

    Science.gov (United States)

    Jagero, N.; Ayodo, T. M.; Agak, J. A.

    2011-01-01

    This paper examines the cost effectiveness of educating boarding and day secondary students in Kisumu district in Kenya. The research designs used in this study were descriptive survey and casual comparative designs. The population consisted of five head teachers, 140 form four teachers and 609 form four students. Saturated and systematic random…

  18. Factors behind Classroom Participation of Secondary School Students (A Gender Based Analysis)

    Science.gov (United States)

    Aziz, Fakhra; Quraishi, Uzma; Kazi, Asma Shahid

    2018-01-01

    It is evidence based conclusion that students' classroom participation makes them more motivated, supports their learning, improves their communication and promotes higher order thinking skills. The current study was an intention to investigate the current level of secondary school students' classroom participation and to identify the underlying…

  19. Predicting Homework Time Management at the Secondary School Level: A Multilevel Analysis

    Science.gov (United States)

    Xu, Jianzhong

    2010-01-01

    The purpose of this study is to test empirical models of variables posited to predict homework time management at the secondary school level. Student- and class-level predictors of homework time management were analyzed in a survey of 1895 students from 111 classes. Most of the variance in homework time management occurred at the student level,…

  20. An Analysis of the Relation between Secondary School Organizational Climate and Teacher Job Satisfaction

    Science.gov (United States)

    Xiaofu, Pan; Qiwen, Qin

    2007-01-01

    This study investigates and analyzes the relation between the secondary school organizational climate and teacher job satisfaction using a self-designed school organizational climate scale based on studies in China and abroad. The findings show that except for interpersonal factors there are significant correlations between the various factors of…