WorldWideScience

Sample records for methods provide means

  1. Incentives and provider payment methods.

    Science.gov (United States)

    Barnum, H; Kutzin, J; Saxenian, H

    1995-01-01

    The mode of payment creates powerful incentives affecting provider behavior and the efficiency, equity and quality outcomes of health finance reforms. This article examines provider incentives as well as administrative costs, and institutional conditions for successful implementation associated with provider payment alternatives. The alternatives considered are budget reforms, capitation, fee-for-service, and case-based reimbursement. We conclude that competition, whether through a regulated private sector or within a public system, has the potential to improve the performance of any payment method. All methods generate both adverse and beneficial incentives. Systems with mixed forms of provider payment can provide tradeoffs to offset the disadvantages of individual modes. Low-income countries should avoid complex payment systems requiring higher levels of institutional development.

  2. Geriatric care: ways and means of providing comfort.

    Science.gov (United States)

    Ribeiro, Patricia Cruz Pontifice Sousa Valente; Marques, Rita Margarida Dourado; Ribeiro, Marta Pontifice

    2017-01-01

    To know the ways and means of comfort perceived by the older adults hospitalized in a medical service. Ethnographic study with a qualitative approach. We conducted semi-structured interviews with 22 older adults and participant observation of care situations. The ways and means of providing comfort are centered on strategies for promoting care mobilized by nurses and recognized by patients(clarifying/informing, positive interaction/communication, music therapy, touch, smile, unconditional presence, empathy/proximity relationship, integrating the older adult or the family as partner in the care, relief of discomfort through massage/mobilization/therapy) and on particular moments of comfort (the first contact, the moment of personal hygiene, and the visit of the family), which constitute the foundation of care/comfort. Geriatric care is built on the relationship that is established and complete with meaning, and is based on the meeting/interaction between the actors under the influence of the context in which they are inserted. The different ways and means of providing comfort aim to facilitate/increase care, relieve discomfort and/or invest in potential comfort. Conhecer os modos e formas de confortar percecionadas pelos idosos hospitalizados num serviço de medicina. Estudo etnográfico com abordagem qualitativa. Realizamos entrevistas semiestruturadas com 22 doentes idosos e observação participante nas situações de cuidados. Os modos e formas de confortar centram-se em estratégias promotoras de conforto mobilizadas pelo enfermeiro e reconhecidas pelos doentes (informação/esclarecimento, interação/comunicação positiva, toque, sorriso, presença incondicional, integração do idoso/família nos cuidados e o alívio de desconfortos através da massagem/mobilização/terapêutica) e em momentos particulares de conforto (contato inaugural, visita da família., cuidados de higiene e arranjo pessoal), que se constituem como alicerces do cuidar

  3. MEANS AND METHODS OF CYBER WARFARE

    Directory of Open Access Journals (Sweden)

    Dan-Iulian VOITAȘEC

    2016-06-01

    Full Text Available According to the Declaration of Saint Petersburg of 1868 “the only legitimate object which States should endeavor to accomplish during war is to weaken the military forces of the enemy”. Thus, International Humanitarian Law prohibits or limits the use of certain means and methods of warfare. The rapid development of technology has led to the emergence of a new dimension of warfare. The cyber aspect of armed conflict has led to the development of new means and methods of warfare. The purpose of this paper is to study how the norms of international humanitarian law apply to the means and methods of cyber warfare.

  4. Gait variability: methods, modeling and meaning

    Directory of Open Access Journals (Sweden)

    Hausdorff Jeffrey M

    2005-07-01

    Full Text Available Abstract The study of gait variability, the stride-to-stride fluctuations in walking, offers a complementary way of quantifying locomotion and its changes with aging and disease as well as a means of monitoring the effects of therapeutic interventions and rehabilitation. Previous work has suggested that measures of gait variability may be more closely related to falls, a serious consequence of many gait disorders, than are measures based on the mean values of other walking parameters. The Current JNER series presents nine reports on the results of recent investigations into gait variability. One novel method for collecting unconstrained, ambulatory data is reviewed, and a primer on analysis methods is presented along with a heuristic approach to summarizing variability measures. In addition, the first studies of gait variability in animal models of neurodegenerative disease are described, as is a mathematical model of human walking that characterizes certain complex (multifractal features of the motor control's pattern generator. Another investigation demonstrates that, whereas both healthy older controls and patients with a higher-level gait disorder walk more slowly in reduced lighting, only the latter's stride variability increases. Studies of the effects of dual tasks suggest that the regulation of the stride-to-stride fluctuations in stride width and stride time may be influenced by attention loading and may require cognitive input. Finally, a report of gait variability in over 500 subjects, probably the largest study of this kind, suggests how step width variability may relate to fall risk. Together, these studies provide new insights into the factors that regulate the stride-to-stride fluctuations in walking and pave the way for expanded research into the control of gait and the practical application of measures of gait variability in the clinical setting.

  5. Methods and means of sodium fire fighting

    International Nuclear Information System (INIS)

    Zemskij, G.T.

    1985-01-01

    Methods and means for coaling sodium fire fighting are analyzed. Their advantages and drawbacks are considered. Comparative data on sodium fire fighting using some of considered compositions are presented. High efficiency of self-expanding compositions (Grafeks SK-23 and RS) is noted. Properties of MGS new composition for sodium fire fighting are considered. High fighting ability of the composition independent of burning metal layer width is shown. It is noted that fire fighting MGS efficiency decreases with growth of time of free fire burning which affects fire fighting methods. Technical means of powder delivery to burning sodium are reported

  6. History based batch method preserving tally means

    International Nuclear Information System (INIS)

    Shim, Hyung Jin; Choi, Sung Hoon

    2012-01-01

    In the Monte Carlo (MC) eigenvalue calculations, the sample variance of a tally mean calculated from its cycle-wise estimates is biased because of the inter-cycle correlations of the fission source distribution (FSD). Recently, we proposed a new real variance estimation method named the history-based batch method in which a MC run is treated as multiple runs with small number of histories per cycle to generate independent tally estimates. In this paper, the history-based batch method based on the weight correction is presented to preserve the tally mean from the original MC run. The effectiveness of the new method is examined for the weakly coupled fissile array problem as a function of the dominance ratio and the batch size, in comparison with other schemes available

  7. Methods and means for coating paper by film coating

    NARCIS (Netherlands)

    van der Maarel, Marc; Ter Veer, Arend Berend Cornelis; Vrieling-Smit, Annet; Delnoye, Pierre

    2015-01-01

    This invention relates to the field of paper coating, more in particular to means and methods for providing paper with at least one layer of pigment using film coating to obtain a well printable surface. Provided is a method for preparing coated paper comprising the steps of: a) providing a

  8. MEANS AND METHODS FOR CLONING NUCLEIC ACID SEQUENCES

    NARCIS (Netherlands)

    Geertsma, Eric Robin; Poolman, Berend

    2008-01-01

    The invention provides means and methods for efficiently cloning nucleic acid sequences of interest in micro-organisms that are less amenable to conventional nucleic acid manipulations, as compared to, for instance, E.coli. The present invention enables high-throughput cloning (and, preferably,

  9. Mean field methods for cortical network dynamics

    DEFF Research Database (Denmark)

    Hertz, J.; Lerchner, Alexander; Ahmadi, M.

    2004-01-01

    We review the use of mean field theory for describing the dynamics of dense, randomly connected cortical circuits. For a simple network of excitatory and inhibitory leaky integrate- and-fire neurons, we can show how the firing irregularity, as measured by the Fano factor, increases...... with the strength of the synapses in the network and with the value to which the membrane potential is reset after a spike. Generalizing the model to include conductance-based synapses gives insight into the connection between the firing statistics and the high- conductance state observed experimentally in visual...

  10. Tumour screening by means of tomography methods

    International Nuclear Information System (INIS)

    Diederich, S.

    2005-01-01

    Tomography methods such as computer tomography (CT), magnetic resonance tomography (MRT), and sonography/ultrasound examinations make it possible to detect small asymptomatic tumours, thus potentially preventing their manifestation at an advanced stage and improving survival prospects for the patients concerned. There are data available on various common tumours which show that modern tomography methods are capable of detecting not only small asymptomatic tumours but also their benign precursors (e.g. polyps of the large intestine). This has been demonstrated for lung cancer, colon cancer and breast cancer. However, it has not been possible to date to show for any tomography method or any type of tumour that the systematic use of such diagnostic procedures does anything to lower the mortality rate for that tumour. For other types of tumour (pancreatic cancer, kidney cancer, ovary cancer) the above named methods are either not sufficiently sensitive or the body of data that has accumulated on their respective use is too small to judge the benefit of tomography screenings. Current technical developments make it appear probable that for many types of cancer the reliability with which small tumours can be detected will improve in future. Studies aimed at clarifying the potential of screenings for reducing mortality rates are already underway for lung cancer and would be worthwhile performing for other tumour types

  11. Method and means for determining heat quantities

    Energy Technology Data Exchange (ETDEWEB)

    Waasdorp, G G; de Jong, J J; Bijl, A

    1965-08-24

    To determine the quantity of potential heat W that has flowed past a certain point in a certain time, the velocity of the combustible Q, the temperature T, and the specific gravity YDTU are measured, and these values are transmitted to a computer which automatically calculates the quantity: ..pi..EQUATION/sup -/ in which delta T is the difference between the combustible temperature T and a reference temperature, and in which the relation f(YDTU, delta T) represents the heat of combustion as a function of the quantities YDTU and delta T and possibly other properties of the combustible. Alternatively the quantity: ..pi..EQUATION/sup -/ may be measured; here the quantities have the same meaning as above.

  12. Method and means for cracking oils

    Energy Technology Data Exchange (ETDEWEB)

    Crozier, R H

    1928-05-18

    In a retort for the distillation of coal, shale or the like utilizing the heat in vapors drawn off at different stages from the retort to distill off oils of lower boiling point, the arrangement at the lower end of the retort of a flue or a series of flues acting as bracing members and providing for the introduction of a gas burner or gas burners adapted to be supplied with gas from the gas mains of the like or the retort whereby the gas produced may be utilized to the greatest advantage.

  13. Gas measuring apparatus with standardization means, and method therefor

    International Nuclear Information System (INIS)

    Typpo, P.M.

    1980-01-01

    An apparatus and a method for standardizing a gas measuring device has a source capable of emitting a beam of radiation aligned to impinge a detector. A housing means encloses the beam. The housing means has a plurality of apertures permitting the gas to enter the housing means, to intercept the beam, and to exit from the housing means. The device further comprises means for closing the apertures and a means for purging said gas from the housing means

  14. The meaning of providing caring to obese patients to a group of nurses

    Directory of Open Access Journals (Sweden)

    Emilly Souza Marques

    2014-03-01

    Full Text Available This qualitative study was performed with six nurses of a public hospital, with the objective to describe their view of the meaning of providing care to obese patients. Interviews were conducted using a semi-structured script. The data were organized under themes extracted from the subjects’ statements, after being thoroughly read. Symbolic Interactionism was adopted to interpret the findings. The results from the analysis were organized under the following themes: Being obese is excessive, it is not healthy; Providing care to the obese is a structural issue; Obese patients are troublesome, they require care, no big deal; Providing care to the obese requires teamwork. The grasped meanings can interfere in the care provided. The nurses, however, recognize the need to work as a team to deliver comprehensive care. Making positive changes to the meanings found in this study is possible, thus, contributing to providing prejudice-free nursing care to obese patients. Descriptors: Obesity; Nursing Care; Hospital Care.

  15. Fuzzy C-means method for clustering microarray data.

    Science.gov (United States)

    Dembélé, Doulaye; Kastner, Philippe

    2003-05-22

    Clustering analysis of data from DNA microarray hybridization studies is essential for identifying biologically relevant groups of genes. Partitional clustering methods such as K-means or self-organizing maps assign each gene to a single cluster. However, these methods do not provide information about the influence of a given gene for the overall shape of clusters. Here we apply a fuzzy partitioning method, Fuzzy C-means (FCM), to attribute cluster membership values to genes. A major problem in applying the FCM method for clustering microarray data is the choice of the fuzziness parameter m. We show that the commonly used value m = 2 is not appropriate for some data sets, and that optimal values for m vary widely from one data set to another. We propose an empirical method, based on the distribution of distances between genes in a given data set, to determine an adequate value for m. By setting threshold levels for the membership values, genes which are tigthly associated to a given cluster can be selected. Using a yeast cell cycle data set as an example, we show that this selection increases the overall biological significance of the genes within the cluster. Supplementary text and Matlab functions are available at http://www-igbmc.u-strasbg.fr/fcm/

  16. Mapping Mixed Methods Research: Methods, Measures, and Meaning

    Science.gov (United States)

    Wheeldon, J.

    2010-01-01

    This article explores how concept maps and mind maps can be used as data collection tools in mixed methods research to combine the clarity of quantitative counts with the nuance of qualitative reflections. Based on more traditional mixed methods approaches, this article details how the use of pre/post concept maps can be used to design qualitative…

  17. Improved Performance of Unsupervised Method by Renovated K-Means

    OpenAIRE

    Ashok, P.; Nawaz, G. M Kadhar; Elayaraja, E.; Vadivel, V.

    2013-01-01

    Clustering is a separation of data into groups of similar objects. Every group called cluster consists of objects that are similar to one another and dissimilar to objects of other groups. In this paper, the K-Means algorithm is implemented by three distance functions and to identify the optimal distance function for clustering methods. The proposed K-Means algorithm is compared with K-Means, Static Weighted K-Means (SWK-Means) and Dynamic Weighted K-Means (DWK-Means) algorithm by using Davis...

  18. Single pass kernel k-means clustering method

    Indian Academy of Sciences (India)

    In unsupervised classification, kernel -means clustering method has been shown to perform better than conventional -means clustering method in ... 518501, India; Department of Computer Science and Engineering, Jawaharlal Nehru Technological University, Anantapur College of Engineering, Anantapur 515002, India ...

  19. Two numerical methods for mean-field games

    KAUST Repository

    Gomes, Diogo A.

    2016-01-09

    Here, we consider numerical methods for stationary mean-field games (MFG) and investigate two classes of algorithms. The first one is a gradient flow method based on the variational characterization of certain MFG. The second one uses monotonicity properties of MFG. We illustrate our methods with various examples, including one-dimensional periodic MFG, congestion problems, and higher-dimensional models.

  20. Two numerical methods for mean-field games

    KAUST Repository

    Gomes, Diogo A.

    2016-01-01

    Here, we consider numerical methods for stationary mean-field games (MFG) and investigate two classes of algorithms. The first one is a gradient flow method based on the variational characterization of certain MFG. The second one uses monotonicity properties of MFG. We illustrate our methods with various examples, including one-dimensional periodic MFG, congestion problems, and higher-dimensional models.

  1. Smoothed analysis of the k-means method

    NARCIS (Netherlands)

    Arthur, David; Manthey, Bodo; Röglin, Heiko

    2011-01-01

    The k-means method is one of the most widely used clustering algorithms, drawing its popularity from its speed in practice. Recently, however, it was shown to have exponential worst-case running time. In order to close the gap between practical performance and theoretical analysis, the k-means

  2. Single pass kernel k-means clustering method

    Indian Academy of Sciences (India)

    paper proposes a simple and faster version of the kernel k-means clustering ... It has been considered as an important tool ... On the other hand, kernel-based clustering methods, like kernel k-means clus- ..... able at the UCI machine learning repository (Murphy 1994). ... All the data sets have only numeric valued features.

  3. Dependability validation by means of fault injection: method, implementation, application

    International Nuclear Information System (INIS)

    Arlat, Jean

    1990-01-01

    This dissertation presents theoretical and practical results concerning the use of fault injection as a means for testing fault tolerance in the framework of the experimental dependability validation of computer systems. The dissertation first presents the state-of-the-art of published work on fault injection, encompassing both hardware (fault simulation, physical fault Injection) and software (mutation testing) issues. Next, the major attributes of fault injection (faults and their activation, experimental readouts and measures, are characterized taking into account: i) the abstraction levels used to represent the system during the various phases of its development (analytical, empirical and physical models), and Il) the validation objectives (verification and evaluation). An evaluation method is subsequently proposed that combines the analytical modeling approaches (Monte Carlo Simulations, closed-form expressions. Markov chains) used for the representation of the fault occurrence process and the experimental fault Injection approaches (fault Simulation and physical injection); characterizing the error processing and fault treatment provided by the fault tolerance mechanisms. An experimental tool - MESSALINE - is then defined and presented. This tool enables physical faults to be Injected In an hardware and software prototype of the system to be validated. Finally, the application of MESSALINE for testing two fault-tolerant systems possessing very dissimilar features and the utilization of the experimental results obtained - both as design feedbacks and for dependability measures evaluation - are used to illustrate the relevance of the method. (author) [fr

  4. Axial and Centrifugal Compressor Mean Line Flow Analysis Method

    Science.gov (United States)

    Veres, Joseph P.

    2009-01-01

    This paper describes a method to estimate key aerodynamic parameters of single and multistage axial and centrifugal compressors. This mean-line compressor code COMDES provides the capability of sizing single and multistage compressors quickly during the conceptual design process. Based on the compressible fluid flow equations and the Euler equation, the code can estimate rotor inlet and exit blade angles when run in the design mode. The design point rotor efficiency and stator losses are inputs to the code, and are modeled at off design. When run in the off-design analysis mode, it can be used to generate performance maps based on simple models for losses due to rotor incidence and inlet guide vane reset angle. The code can provide an improved understanding of basic aerodynamic parameters such as diffusion factor, loading levels and incidence, when matching multistage compressor blade rows at design and at part-speed operation. Rotor loading levels and relative velocity ratio are correlated to the onset of compressor surge. NASA Stage 37 and the three-stage NASA 74-A axial compressors were analyzed and the results compared to test data. The code has been used to generate the performance map for the NASA 76-B three-stage axial compressor featuring variable geometry. The compressor stages were aerodynamically matched at off-design speeds by adjusting the variable inlet guide vane and variable stator geometry angles to control the rotor diffusion factor and incidence angles.

  5. Determination of beta attenuation coefficients by means of timing method

    International Nuclear Information System (INIS)

    Ermis, E.E.; Celiktas, C.

    2012-01-01

    Highlights: ► Beta attenuation coefficients of absorber materials were found in this study. ► For this process, a new method (timing method) was suggested. ► The obtained beta attenuation coefficients were compatible with the results from the traditional one. ► The timing method can be used to determine beta attenuation coefficient. - Abstract: Using a counting system with plastic scintillation detector, beta linear and mass attenuation coefficients were determined for bakelite, Al, Fe and plexiglass absorbers by means of timing method. To show the accuracy and reliability of the obtained results through this method, the coefficients were also found via conventional energy method. Obtained beta attenuation coefficients from both methods were compared with each other and the literature values. Beta attenuation coefficients obtained through timing method were found to be compatible with the values obtained from conventional energy method and the literature.

  6. Mirror bootstrap method for testing hypotheses of one mean

    OpenAIRE

    Varvak, Anna

    2012-01-01

    The general philosophy for bootstrap or permutation methods for testing hypotheses is to simulate the variation of the test statistic by generating the sampling distribution which assumes both that the null hypothesis is true, and that the data in the sample is somehow representative of the population. This philosophy is inapplicable for testing hypotheses for a single parameter like the population mean, since the two assumptions are contradictory (e.g., how can we assume both that the mean o...

  7. Methods for providing intermediates in the synthesis of atorvastatin.

    NARCIS (Netherlands)

    Dömling, Alexander Stephan Siegfried

    2016-01-01

    The invention relates to the field of medicinal chemistry, In particular, it relates to methods for providing intermediates in the synthesis of Atorvastatin, a competitive inhibitor of HMG-Co A reductase. Provided is a process for providing a compound having a Formula (I) or a pharmaceutically

  8. Improved smoothed analysis of the k-means method

    NARCIS (Netherlands)

    Manthey, Bodo; Röglin, Heiko; Mathieu, C.

    2009-01-01

    The k-means method is a widely used clustering algorithm. One of its distinguished features is its speed in practice. Its worst-case running-time, however, is exponential, leaving a gap between practical and theoretical performance. Arthur and Vassilvitskii [3] aimed at closing this gap, and they

  9. Neutron flux calculation by means of Monte Carlo methods

    International Nuclear Information System (INIS)

    Barz, H.U.; Eichhorn, M.

    1988-01-01

    In this report a survey of modern neutron flux calculation procedures by means of Monte Carlo methods is given. Due to the progress in the development of variance reduction techniques and the improvements of computational techniques this method is of increasing importance. The basic ideas in application of Monte Carlo methods are briefly outlined. In more detail various possibilities of non-analog games and estimation procedures are presented, problems in the field of optimizing the variance reduction techniques are discussed. In the last part some important international Monte Carlo codes and own codes of the authors are listed and special applications are described. (author)

  10. Validation of mean glandular dose values provided by a digital breast tomosynthesis system in Brazil

    International Nuclear Information System (INIS)

    Beraldo O, B.; Paixao, L.; Donato da S, S.; Araujo T, M. H.; Nogueira, M. S.

    2014-08-01

    Digital breast tomosynthesis (DBT) is an emerging imaging modality that provides quasi-three-dimensional structural information of the breast and has strong promise to improve the differentiation of normal tissue and suspicious masses reducing the tissue overlaps. DBT images are reconstructed from a sequence of low-dose X-ray projections of the breast acquired at a small number of angles over a limited angular range. The Ho logic Selen ia Dimensions system is equipped with an amorphous Selenium (a-Se) detector layer of 250 μm thickness and a 70 μm pixel pitch. Studies are needed to determine the radiation dose of patients that are undergoing this emerging procedure to compare with the results obtained in DBT images. The mean glandular dose (D G ) is the dosimetric quantity used in quality control of the mammographic systems. The aim of this work is to validate D G values for different breast thicknesses provided by a Ho logic Selen ia Dimensions system using a DBT mode in comparison with the same results obtained by a calibrated 90 X 5-6M-model Radcal ionization chamber. D G values were derived from the incident air kerma (K i ) measurements and tabulated conversion coefficients that are dependent on the half value layer (HVL) of the X-ray spectrum. Voltage and tube loading values were recorded in irradiations using W/Al anode/filter combination, automatic exposure control mode and polymethyl methacrylate (PMMA) slabs which simulate different breast thicknesses. For K i measurements, the ionization chamber was positioned at 655 mm from the focus and the same radiographic technique values were selected with the manual mode. D G values for a complete procedure ranged from 0.9 ± 0.1 to 3.7 ± 0.4 mGy. The results for different breast thicknesses are in accordance with values obtained by DBT images and with acceptable levels established by the Commission of the European Communities (Cec) and the International Atomic Energy Agency (IAEA). This work contributes to

  11. Validation of mean glandular dose values provided by a digital breast tomosynthesis system in Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Beraldo O, B.; Paixao, L.; Donato da S, S. [Centro de Desenvolvimento da Tecnologia Nuclear / CNEN, Post-graduation in Sciences and Technology of Radiations Minerals and Materials, Pte. Antonio Carlos 6627, 31270-901 Belo Horizonte (Brazil); Araujo T, M. H. [Dr Maria Helena Araujo Teixeira Clinic, Guajajaras 40, 30180-100 Belo Horizonte (Brazil); Nogueira, M. S., E-mail: bbo@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear / CNEN, Pte. Antonio Carlos 6627, 31270-901 Belo Horizonte (Brazil)

    2014-08-15

    Digital breast tomosynthesis (DBT) is an emerging imaging modality that provides quasi-three-dimensional structural information of the breast and has strong promise to improve the differentiation of normal tissue and suspicious masses reducing the tissue overlaps. DBT images are reconstructed from a sequence of low-dose X-ray projections of the breast acquired at a small number of angles over a limited angular range. The Ho logic Selen ia Dimensions system is equipped with an amorphous Selenium (a-Se) detector layer of 250 μm thickness and a 70 μm pixel pitch. Studies are needed to determine the radiation dose of patients that are undergoing this emerging procedure to compare with the results obtained in DBT images. The mean glandular dose (D{sub G}) is the dosimetric quantity used in quality control of the mammographic systems. The aim of this work is to validate D{sub G} values for different breast thicknesses provided by a Ho logic Selen ia Dimensions system using a DBT mode in comparison with the same results obtained by a calibrated 90 X 5-6M-model Radcal ionization chamber. D{sub G} values were derived from the incident air kerma (K{sub i}) measurements and tabulated conversion coefficients that are dependent on the half value layer (HVL) of the X-ray spectrum. Voltage and tube loading values were recorded in irradiations using W/Al anode/filter combination, automatic exposure control mode and polymethyl methacrylate (PMMA) slabs which simulate different breast thicknesses. For K{sub i} measurements, the ionization chamber was positioned at 655 mm from the focus and the same radiographic technique values were selected with the manual mode. D{sub G} values for a complete procedure ranged from 0.9 ± 0.1 to 3.7 ± 0.4 mGy. The results for different breast thicknesses are in accordance with values obtained by DBT images and with acceptable levels established by the Commission of the European Communities (Cec) and the International Atomic Energy Agency (IAEA

  12. Improved means and methods for expressing recombinant proteins

    NARCIS (Netherlands)

    Poolman, Berend; Martinez Linares, Daniel; Gul, Nadia

    2014-01-01

    The invention relates to the field of genetic engineering and the production of recombinant proteins in microbial host cells. Provided is a method for enhanced expression of a recombinant protein of interest in a microbial host cell, comprising providing a microbial host cell wherein the function of

  13. Meaning

    Science.gov (United States)

    Harteveld, Casper

    The second world to be considered concerns Meaning. In contrast to Reality and Play, this world relates to the people, disciplines, and domains that are focused on creating a certain value. For example, if this value is about providing students knowledge about physics, it involves teachers, the learning sciences, and the domains education and physics. This level goes into the aspects and criteria that designers need to take into account from this perspective. The first aspect seems obvious when we talk of “games with a serious purpose.” They have a purpose and this needs to be elaborated on, for example in terms of what “learning objectives” it attempts to achieve. The subsequent aspect is not about what is being pursued but how. To attain a value, designers have to think about a strategy that they employ. In my case this concerned looking at the learning paradigms that have come into existence in the past century and see what they have to tell us about learning. This way, their principles can be translated into a game environment. This translation involves making the strategy concrete. Or, in other words, operationalizing the plan. This is the third aspect. In this level, I will further specifically explain how I derived requirements from each of the learning paradigms, like reflection and exploration, and how they can possibly be related to games. The fourth and final aspect is the context in which the game is going to be used. It matters who uses the game and when, where, and how the game is going to be used. When designers have looked at these aspects, they have developed a “value proposal” and the worth of it may be judged by criteria, like motivation, relevance, and transfer. But before I get to this, I first go into how we human beings are meaning creators and what role assumptions, knowledge, and ambiguity have in this. I will illustrate this with some silly jokes about doctors and Mickey Mouse, and with an illusion.

  14. Improved Fuzzy Art Method for Initializing K-means

    Directory of Open Access Journals (Sweden)

    Sevinc Ilhan

    2010-09-01

    Full Text Available The K-means algorithm is quite sensitive to the cluster centers selected initially and can perform different clusterings depending on these initialization conditions. Within the scope of this study, a new method based on the Fuzzy ART algorithm which is called Improved Fuzzy ART (IFART is used in the determination of initial cluster centers. By using IFART, better quality clusters are achieved than Fuzzy ART do and also IFART is as good as Fuzzy ART about capable of fast clustering and capability on large scaled data clustering. Consequently, it is observed that, with the proposed method, the clustering operation is completed in fewer steps, that it is performed in a more stable manner by fixing the initialization points and that it is completed with a smaller error margin compared with the conventional K-means.

  15. A Method for Calculating the Mean Orbits of Meteor Streams

    Science.gov (United States)

    Voloshchuk, Yu. I.; Kashcheev, B. L.

    An examination of the published catalogs of orbits of meteor streams and of a large number of works devoted to the selection of streams, their analysis and interpretation, showed that elements of stream orbits are calculated, as a rule, as arithmetical (sometimes, weighed) sample means. On the basis of these means, a search for parent bodies, a study of the evolution of swarms generating these streams, an analysis of one-dimensional and multidimensional distributions of these elements, etc., are performed. We show that systematic errors in the estimates of elements of the mean orbits are present in each of the catalogs. These errors are caused by the formal averaging of orbital elements over the sample, while ignoring the fact that they represent not only correlated, but dependent quantities, with nonlinear, in most cases, interrelations between them. Numerous examples are given of such inaccuracies, in particular, the cases where the "mean orbit of the stream" recorded by ground-based techniques does not cross the Earth's orbit. We suggest the computation algorithm, in which the averaging over the sample is carried out at the initial stage of the calculation of the mean orbit, and only for the variables required for subsequent calculations. After this, the known astrometric formulas are used to sequentially calculate all other parameters of the stream, considered now as a standard orbit. Variance analysis is used to estimate the errors in orbital elements of the streams, in the case that their orbits are obtained by averaging the orbital elements of meteoroids forming the stream, without taking into account their interdependence. The results obtained in this analysis indicate the behavior of systematic errors in the elements of orbits of meteor streams. As an example, the effect of the incorrect computation method on the distribution of elements of the stream orbits close to the orbits of asteroids of the Apollo, Aten, and Amor groups (AAA asteroids) is examined.

  16. Determining Coastal Mean Dynamic Topography by Geodetic Methods

    Science.gov (United States)

    Huang, Jianliang

    2017-11-01

    In geodesy, coastal mean dynamic topography (MDT) was traditionally determined by spirit leveling technique. Advances in navigation satellite positioning (e.g., GPS) and geoid determination enable space-based leveling with an accuracy of about 3 cm at tide gauges. Recent CryoSat-2, a satellite altimetry mission with synthetic aperture radar (SAR) and SAR interferometric measurements, extends the space-based leveling to the coastal ocean with the same accuracy. However, barriers remain in applying the two space-based geodetic methods for MDT determination over the coastal ocean because current geoid modeling focuses primarily on land as a substitute to spirit leveling to realize the vertical datum.

  17. Isotope decay equations solved by means of a recursive method

    International Nuclear Information System (INIS)

    Grant, Carlos

    2009-01-01

    The isotope decay equations have been solved using forward finite differences taking small time steps, among other methods. This is the case of the cell code WIMS, where it is assumed that concentrations of all fissionable isotopes remain constant during the integration interval among other simplifications. Even when the problem could be solved running through a logical tree, all algorithms used for resolution of these equations used an iterative programming formulation. That happened because nearly all computer languages used up to a recent past by the scientific programmers did not support recursion, such as the case of the old versions of FORTRAN or BASIC. Nowadays also an integral form of the depletion equations is used in Monte Carlo simulation. In this paper we propose another programming solution using a recursive algorithm, running through all descendants of each isotope and adding their contributions to all isotopes in each generation. The only assumption made for this solution is that fluxes remain constant during the whole time step. Recursive process is interrupted when a stable isotope was attained or the calculated contributions are smaller than a given precision. These algorithms can be solved by means an exact analytic method that can have some problems when circular loops appear for isotopes with alpha decay, and a more general polynomial method. Both methods are shown. (author)

  18. Method for providing uranium with a protective copper coating

    Science.gov (United States)

    Waldrop, Forrest B.; Jones, Edward

    1981-01-01

    The present invention is directed to a method for providing uranium metal with a protective coating of copper. Uranium metal is subjected to a conventional cleaning operation wherein oxides and other surface contaminants are removed, followed by etching and pickling operations. The copper coating is provided by first electrodepositing a thin and relatively porous flash layer of copper on the uranium in a copper cyanide bath. The resulting copper-layered article is then heated in an air or inert atmosphere to volatilize and drive off the volatile material underlying the copper flash layer. After the heating step an adherent and essentially non-porous layer of copper is electro-deposited on the flash layer of copper to provide an adherent, multi-layer copper coating which is essentially impervious to corrosion by most gases.

  19. System and Method for Providing a Climate Data Persistence Service

    Science.gov (United States)

    Schnase, John L. (Inventor); Ripley, III, William David (Inventor); Duffy, Daniel Q. (Inventor); Thompson, John H. (Inventor); Strong, Savannah L. (Inventor); McInerney, Mark (Inventor); Sinno, Scott (Inventor); Tamkin, Glenn S. (Inventor); Nadeau, Denis (Inventor)

    2018-01-01

    A system, method and computer-readable storage devices for providing a climate data persistence service. A system configured to provide the service can include a climate data server that performs data and metadata storage and management functions for climate data objects, a compute-storage platform that provides the resources needed to support a climate data server, provisioning software that allows climate data server instances to be deployed as virtual climate data servers in a cloud computing environment, and a service interface, wherein persistence service capabilities are invoked by software applications running on a client device. The climate data objects can be in various formats, such as International Organization for Standards (ISO) Open Archival Information System (OAIS) Reference Model Submission Information Packages, Archive Information Packages, and Dissemination Information Packages. The climate data server can enable scalable, federated storage, management, discovery, and access, and can be tailored for particular use cases.

  20. Specific binding-adsorbent assay method and test means

    International Nuclear Information System (INIS)

    1981-01-01

    A description is given of an improved specific binding assay method and test means employing a nonspecific adsorbent for the substance to be determined, particularly hepatitis B surface (HBsub(s)) antigen, in its free state or additionally in the form of its immune complex. The invention is illustrated by 1) the radioimmunoadsorbent assay for HBsub(s) antigen, 2) the radioimmunoadsorbent assay for HBsub(s) antigen in the form of immune complex with antibody, 3) a study of adsorption characteristics of various anion exchange materials for HBsub(s) antigen, 4) the use of hydrophobic adsorbents in a radioimmunoadsorbent assay for HBsub(s) antigen and 5) the radioimmunoadsorbent assay for antibody to HBsub(s) antigen. The advantages of the present method for detecting HBsub(s) antigen compared to previous methods include the manufacturing advantages of eliminating the need for insolubilised anti-HBsub(s) and the advantages of a single incubation step, fewer manipulations, storability of adsorbent materials, increased sensitivity and versatility of detecting HBsub(s) antigen in the form of its immune complex if desired. (U.K.)

  1. Regression toward the mean – a detection method for unknown population mean based on Mee and Chua's algorithm

    Directory of Open Access Journals (Sweden)

    Lüdtke Rainer

    2008-08-01

    Full Text Available Abstract Background Regression to the mean (RTM occurs in situations of repeated measurements when extreme values are followed by measurements in the same subjects that are closer to the mean of the basic population. In uncontrolled studies such changes are likely to be interpreted as a real treatment effect. Methods Several statistical approaches have been developed to analyse such situations, including the algorithm of Mee and Chua which assumes a known population mean μ. We extend this approach to a situation where μ is unknown and suggest to vary it systematically over a range of reasonable values. Using differential calculus we provide formulas to estimate the range of μ where treatment effects are likely to occur when RTM is present. Results We successfully applied our method to three real world examples denoting situations when (a no treatment effect can be confirmed regardless which μ is true, (b when a treatment effect must be assumed independent from the true μ and (c in the appraisal of results of uncontrolled studies. Conclusion Our method can be used to separate the wheat from the chaff in situations, when one has to interpret the results of uncontrolled studies. In meta-analysis, health-technology reports or systematic reviews this approach may be helpful to clarify the evidence given from uncontrolled observational studies.

  2. Means, methods and performances of the AREVA's HTR compact controls

    International Nuclear Information System (INIS)

    Banchet, J.; Guillermier, P.; Tisseur, D.; Vitali, M. P.

    2008-01-01

    In the AREVA's HTR development program, the reactor plant is composed of a prismatic core containing graphite cylindrical fuel elements, called compacts, where TRISO particles are dispersed. Starting from its past compacting process, the latter being revamped through the use of state of the art equipments, CERCA, 100% AREVA NP's subsidiary, was able to recover the quality of past compacts production. The recovered compacting process is composed of the following manufacturing steps: graphite matrix granulation, mix between the obtained granulates and particles, compacting and calcining at low pressure and temperature. To adapt this past process to new manufacturing equipments, non destructive examination tests were carried out to assess the compact quality, the latter being assessed via in house developed equipments and methods at each step of the design of experiments. As for the manufacturing process, past quality control methods were revamped to measure compact dimensional features (diameter, perpendicularity and cone effect), visual aspect, SiC layer failure fraction (via anodic disintegration and burn leach test) and homogeneity via 2D radiography coupled to ceramography. Although meeting quality requirements, 2D radiography method could not provide a quantified specification for compact homogeneity characterization. This limitation yielded the replacement of this past technique by a method based on X-Ray tomography. Development was conducted on this new technique to enable the definition of a criterion to quantify compact homogeneity, as well as to provide information about the distances in between particles. This study also included a comparison between simulated and real compacts to evaluate the accuracy of the technique as well as the influence of particle packing fraction on compact homogeneity. The developed quality control methods and equipments guided the choices of manufacturing parameters adjustments at the development stage and are now applied for

  3. Critical study of the dispersive n- 90Zr mean field by means of a new variational method

    Science.gov (United States)

    Mahaux, C.; Sartor, R.

    1994-02-01

    A new variational method is developed for the construction of the dispersive nucleon-nucleus mean field at negative and positive energies. Like the variational moment approach that we had previously proposed, the new method only uses phenomenological optical-model potentials as input. It is simpler and more flexible than the previous approach. It is applied to a critical investigation of the n- 90Zr mean field between -25 and +25 MeV. This system is of particular interest because conflicting results had recently been obtained by two different groups. While the imaginary parts of the phenomenological optical-model potentials provided by these two groups are similar, their real parts are quite different. Nevertheless, we demonstrate that these two sets of phenomenological optical-model potentials are both compatible with the dispersion relation which connects the real and imaginary parts of the mean field. Previous hints to the contrary, by one of the two other groups, are shown to be due to unjustified approximations. A striking outcome of the present study is that it is important to explicitly introduce volume absorption in the dispersion relation, although volume absorption is negligible in the energy domain investigated here. Because of the existence of two sets of phenomenological optical-model potentials, our variational method yields two dispersive mean fields whose real parts are quite different at small or negative energies. No preference for one of the two dispersive mean fields can be expressed on purely empirical grounds since they both yield fair agreement with the experimental cross sections as well as with the observed energies of the bound single-particle states. However, we argue that one of these two mean fields is physically more meaningful, because the radial shape of its Hartree-Fock type component is independent of energy, as expected on theoretical grounds. This preferred mean field is very close to the one which had been obtained by the Ohio

  4. Method for Providing Semiconductors Having Self-Aligned Ion Implant

    Science.gov (United States)

    Neudeck, Philip G. (Inventor)

    2014-01-01

    A method is disclosed that provides a self-aligned nitrogen-implant particularly suited for a Junction Field Effect Transistor (JFET) semiconductor device preferably comprised of a silicon carbide (SiC). This self-aligned nitrogen-implant allows for the realization of durable and stable electrical functionality of high temperature transistors such as JFETs. The method implements the self-aligned nitrogen-implant having predetermined dimensions, at a particular step in the fabrication process, so that the SiC junction field effect transistors are capable of being electrically operating continuously at 500.degree. C. for over 10,000 hours in an air ambient with less than a 10% change in operational transistor parameters.

  5. Method for providing a low density high strength polyurethane foam

    Science.gov (United States)

    Whinnery, Jr., Leroy L.; Goods, Steven H.; Skala, Dawn M.; Henderson, Craig C.; Keifer, Patrick N.

    2013-06-18

    Disclosed is a method for making a polyurethane closed-cell foam material exhibiting a bulk density below 4 lbs/ft.sup.3 and high strength. The present embodiment uses the reaction product of a modified MDI and a sucrose/glycerine based polyether polyol resin wherein a small measured quantity of the polyol resin is "pre-reacted" with a larger quantity of the isocyanate in a defined ratio such that when the necessary remaining quantity of the polyol resin is added to the "pre-reacted" resin together with a tertiary amine catalyst and water as a blowing agent, the polymerization proceeds slowly enough to provide a stable foam body.

  6. A SIMPLE ANALYTICAL METHOD TO DETERMINE SOLAR ENERGETIC PARTICLES' MEAN FREE PATH

    International Nuclear Information System (INIS)

    He, H.-Q.; Qin, G.

    2011-01-01

    To obtain the mean free path of solar energetic particles (SEPs) for a solar event, one usually has to fit time profiles of both flux and anisotropy from spacecraft observations to numerical simulations of SEPs' transport processes. This method can be called a simulation method. But a reasonably good fitting needs a lot of simulations, which demand a large amount of calculation resources. Sometimes, it is necessary to find an easy way to obtain the mean free path of SEPs quickly, for example, in space weather practice. Recently, Shalchi et al. provided an approximate analytical formula of SEPs' anisotropy time profile as a function of particles' mean free path for impulsive events. In this paper, we determine SEPs' mean free path by fitting the anisotropy time profiles from Shalchi et al.'s analytical formula to spacecraft observations. This new method can be called an analytical method. In addition, we obtain SEPs' mean free path with the traditional simulation methods. Finally, we compare the mean free path obtained with the simulation method to that of the analytical method to show that the analytical method, with some minor modifications, can give us a good, quick approximation of SEPs' mean free path for impulsive events.

  7. Weighted mean: A possible method to express overall Dhatu Sarata

    Directory of Open Access Journals (Sweden)

    Chandar Prakash Gunawat

    2015-01-01

    Full Text Available Several questions are being raised regarding the accuracy of the methods of diagnosis and reporting of various clinical parameters according to Ayurveda in recent times. Uniformity in reporting, issues related to inter-rater variability, uniformity in applying statistical tests, reliability, consistency, and validation of various tools, - are some of the major concerns that are being voiced. Dhatu Sarata is one such domain where no substantial work has been carried out to address these issues. The Sanskrit term "Dhatu" roughly translates as a "tissue.". Sarata stands for the status of Dhatu in a given individual, i.e., it describes whether the status is excellent, moderate, or poor. In the available research literature, there are several gaps while dealing with and reporting the clinical assessment of Dhatu. Most of the workers group an individual into any one of the categories of Dhatu Sarata, and this approach neglects the contribution of other Dhatus to the overall Sarata in that individual. In this communication, we propose the usefulness of "weighted mean" in expressing the overall Sarata in an individual. This gives the researcher a freedom of not classifying an individual into any one group of Sarata, while also simultaneously allowing him/her to retain the focus on the status of an individual Dhatu.

  8. Weighted mean: A possible method to express overall Dhatu Sarata.

    Science.gov (United States)

    Gunawat, Chandar Prakash; Singh, Girish; Patwardhan, Kishor; Gehlot, Sangeeta

    2015-01-01

    Several questions are being raised regarding the accuracy of the methods of diagnosis and reporting of various clinical parameters according to Ayurveda in recent times. Uniformity in reporting, issues related to inter-rater variability, uniformity in applying statistical tests, reliability, consistency, and validation of various tools, - are some of the major concerns that are being voiced. Dhatu Sarata is one such domain where no substantial work has been carried out to address these issues. The Sanskrit term "Dhatu" roughly translates as a "tissue." Sarata stands for the status of Dhatu in a given individual, i.e., it describes whether the status is excellent, moderate, or poor. In the available research literature, there are several gaps while dealing with and reporting the clinical assessment of Dhatu. Most of the workers group an individual into any one of the categories of Dhatu Sarata, and this approach neglects the contribution of other Dhatus to the overall Sarata in that individual. In this communication, we propose the usefulness of "weighted mean" in expressing the overall Sarata in an individual. This gives the researcher a freedom of not classifying an individual into any one group of Sarata, while also simultaneously allowing him/her to retain the focus on the status of an individual Dhatu.

  9. Means and method for examining the human body by means of penetrating radiation

    International Nuclear Information System (INIS)

    1983-01-01

    The invention relates to a tomography method in which data are obtained by directing a fan of X-ray beams to the human body. The fan can rotate around the body. Moreover, the sources may rotate about an axis perpendicular to the plane of irradiation. (Auth.)

  10. Method and means for repairing injection fuel pump pistons

    Energy Technology Data Exchange (ETDEWEB)

    Ash, E.G.; Tompkins, M.J. Jr.

    1988-06-07

    This patent describes an improvement in timing pistons for rotary fuel injection pumps of the type having a die cast aluminum housing. The housing has a cylindrical chamber, a steel piston, the piston being received in the chamber, means for reciprocating the piston lengthwise of the chamber, an aluminum jacket surrounding the piston and extending the full length thereof, the jacket being rigidly secured to the piston. The jacket has an exterior surface hard coat anodized to the hardness of about 60-70 Rockwell (C scale) as the means of preventing galling due to the reciprocal movement of the aluminum jacket piston within the aluminum chamber.

  11. How Preservice Teachers Make Meaning of Mathematics Methods Texts

    Science.gov (United States)

    Harkness, Shelly Sheats; Brass, Amy

    2017-01-01

    Mathematics methods texts are important resources for supporting preservice teachers' learning. Methods instructors routinely assign readings from texts. Yet, anecdotally and also based on reading compliance literature, many students report that they do not read assigned readings. Within this paper we briefly describe the findings from a survey of…

  12. Methods of Complex Data Processing from Technical Means of Monitoring

    Directory of Open Access Journals (Sweden)

    Serhii Tymchuk

    2017-03-01

    Full Text Available The problem of processing the information from different types of monitoring equipment was examined. The use of generalized methods of information processing, based on the techniques of clustering combined territorial information sources for monitoring and the use of framing model of knowledge base for identification of monitoring objects was proposed as a possible solution of the problem. Clustering methods were formed on the basis of Lance-Williams hierarchical agglomerative procedure using the Ward metrics. Frame model of knowledge base was built using the tools of object-oriented modeling.

  13. 32 CFR 199.14 - Provider reimbursement methods.

    Science.gov (United States)

    2010-07-01

    ... physicians. (6) All services provided by nurse anesthetists. (7) All services related to discharges involving... more accurate data became available. (v) No update for inflation. The children's hospital differential... considered lower volume hospitals. (B) Hospitals that subsequently become higher volume hospitals. In any...

  14. To the Question of Information Security and Providing State and Municipal Services by Means of the Internet

    Directory of Open Access Journals (Sweden)

    Alexander A. Galushkin

    2015-09-01

    Full Text Available In the present article author investigates interconnected questions of information security and providing state and municipal services by means of the global information Internet. Author analyzes opinions of the number of leading Russian and foreign experts and scientists. In the summary author draws a conclusion that implementation of rules of law answering to modern realities and also fruitful work of law enforcement and supervisory authorities regarding law application practice improvement is necessary for information security and human rights protection.

  15. Means and Method for Measurement of Drilling Fluid Properties

    Science.gov (United States)

    Lysyannikov, A.; Kondrashov, P.; Pavlova, P.

    2016-06-01

    The paper addresses the problem on creation of a new design of the device for determining rheological parameters of drilling fluids and the basic requirements which it must meet. The key quantitative parameters that define the developed device are provided. The algorithm of determining the coefficient of the yield point from the rheological Shvedov- Bingam model at a relative speed of rotation of glasses from the investigated drilling fluid of 300 and 600 rpm is presented.

  16. Potential shallow aquifers characterization through an integrated geophysical method: multivariate approach by means of k-means algorithms

    Directory of Open Access Journals (Sweden)

    Stefano Bernardinetti

    2017-06-01

    Full Text Available The need to obtain a detailed hydrogeological characterization of the subsurface and its interpretation for the groundwater resources management, often requires to apply several and complementary geophysical methods. The goal of the approach in this paper is to provide a unique model of the aquifer by synthesizing and optimizing the information provided by several geophysical methods. This approach greatly reduces the degree of uncertainty and subjectivity of the interpretation by exploiting the different physical and mechanic characteristics of the aquifer. The studied area, into the municipality of Laterina (Arezzo, Italy, is a shallow basin filled by lacustrine and alluvial deposits (Pleistocene and Olocene epochs, Quaternary period, with alternated silt, sand with variable content of gravel and clay where the bottom is represented by arenaceous-pelitic rocks (Mt. Cervarola Unit, Tuscan Domain, Miocene epoch. This shallow basin constitutes the unconfined superficial aquifer to be exploited in the nearly future. To improve the geological model obtained from a detailed geological survey we performed electrical resistivity and P wave refraction tomographies along the same line in order to obtain different, independent and integrable data sets. For the seismic data also the reflected events have been processed, a remarkable contribution to draw the geologic setting. Through the k-means algorithm, we perform a cluster analysis for the bivariate data set to individuate relationships between the two sets of variables. This algorithm allows to individuate clusters with the aim of minimizing the dissimilarity within each cluster and maximizing it among different clusters of the bivariate data set. The optimal number of clusters “K”, corresponding to the individuated geophysical facies, depends to the multivariate data set distribution and in this work is estimated with the Silhouettes. The result is an integrated tomography that shows a finite

  17. Determination System Of Food Vouchers For the Poor Based On Fuzzy C-Means Method

    Science.gov (United States)

    Anamisa, D. R.; Yusuf, M.; Syakur, M. A.

    2018-01-01

    Food vouchers are government programs to tackle the poverty of rural communities. This program aims to help the poor group in getting enough food and nutrients from carbohydrates. There are several factors that influence to receive the food voucher, such as: job, monthly income, Taxes, electricity bill, size of house, number of family member, education certificate and amount of rice consumption every week. In the execution for the distribution of vouchers is often a lot of problems, such as: the distribution of food vouchers has been misdirected and someone who receives is still subjective. Some of the solutions to decision making have not been done. The research aims to calculating the change of each partition matrix and each cluster using Fuzzy C-Means method. Hopefully this research makes contribution by providing higher result using Fuzzy C-Means comparing to other method for this case study. In this research, decision making is done by using Fuzzy C-Means method. The Fuzzy C-Means method is a clustering method that has an organized and scattered cluster structure with regular patterns on two-dimensional datasets. Furthermore, Fuzzy C-Means method used for calculates the change of each partition matrix. Each cluster will be sorted by the proximity of the data element to the centroid of the cluster to get the ranking. Various trials were conducted for grouping and ranking of proposed data that received food vouchers based on the quota of each village. This testing by Fuzzy C-Means method, is developed and abled for determining the recipient of the food voucher with satisfaction results. Fulfillment of the recipient of the food voucher is 80% to 90% and this testing using data of 115 Family Card from 6 Villages. The quality of success affected, has been using the number of iteration factors is 20 and the number of clusters is 3

  18. Methodical Approaches to Communicative Providing of Retailer Branding

    Directory of Open Access Journals (Sweden)

    Andrey Kataev

    2017-07-01

    Full Text Available The thesis is devoted to the rationalization of methodical approaches for provision of branding of retail trade enterprises. The article considers the features of brand perception by retail consumers and clarifies the specifics of customer reviews of stores for the procedures accompanying brand management. It is proved that besides traditional communication mix, the most important tool of communicative influence on buyers is the store itself as a place for comfortable shopping. The shop should have a stimulating effect on all five human senses, including sight, smell, hearing, touch, and taste, which shall help maximize consumer integration into the buying process.

  19. System and Method for Providing a Climate Data Analytic Services Application Programming Interface Distribution Package

    Science.gov (United States)

    Schnase, John L. (Inventor); Duffy, Daniel Q. (Inventor); Tamkin, Glenn S. (Inventor)

    2016-01-01

    A system, method and computer-readable storage devices for providing a climate data analytic services application programming interface distribution package. The example system can provide various components. The system provides a climate data analytic services application programming interface library that enables software applications running on a client device to invoke the capabilities of a climate data analytic service. The system provides a command-line interface that provides a means of interacting with a climate data analytic service by issuing commands directly to the system's server interface. The system provides sample programs that call on the capabilities of the application programming interface library and can be used as templates for the construction of new client applications. The system can also provide test utilities, build utilities, service integration utilities, and documentation.

  20. Novel beam bunching methods by perfect crystals and electromagnetic means

    International Nuclear Information System (INIS)

    Rauch, H.

    1985-01-01

    The use of perfect crystals for installing new neutron small-angle scattering cameras provides advantages for measurements in the small Q-range and for real-time experiments. A neutron resonator is proposed which is based on the combination of perfect crystal back-reflections in Zeman energy splitting. The neutron magnetic resonance system in combination with gated crystals can act as a pumping unit for neutrons and as a new pulse-shaping unit. It is shown how travelling magnetic waves can act as powerful neutron bunching units. The achievable velocity changes are around 5 m/s and, therefore, by a factor of 100 larger than in the case of neutron magnetic resonance systems. The advantage of expanding potentials for focusing neutrons from a source with a long pulse duration becomes obvious. Real gain factors higher than 10 are expected for properly designed systems. (author)

  1. Method for well logging by means of gamma rays

    International Nuclear Information System (INIS)

    Angehrn, J.A.; Groeschel, V.E.

    1979-01-01

    Gamma spectrum measuring signals are received by a well instrument with scintillation counter and coupled into a multi-channel analyzer. The analyzer converts the signals to the energy levels of the received measurements into impulses in separate channels. The energy channels from the multichannel analyzer are coupled in digital decoders which are put on for energy level windows for chosen elements and the whole count. These outlets are coupled in a microprocessor stripper provided with memory comparing buffers dimensioned with respect to the measuring velocity. The buffer has a crystal which is used in a scintillation counter. These memory comparing registers allow filtering in addition to the stripping of the different energy channels of the influence irradiation which are produced by the elements with an energy band centrically put around a superior energy level. After stripping the outlets for every chosen energy channel can be coupled in a digital recorder or in counting ratemeters for conversion into analog voltages in order to operate a table recorder. (orig.) [de

  2. Spiking cortical model-based nonlocal means method for speckle reduction in optical coherence tomography images

    Science.gov (United States)

    Zhang, Xuming; Li, Liu; Zhu, Fei; Hou, Wenguang; Chen, Xinjian

    2014-06-01

    Optical coherence tomography (OCT) images are usually degraded by significant speckle noise, which will strongly hamper their quantitative analysis. However, speckle noise reduction in OCT images is particularly challenging because of the difficulty in differentiating between noise and the information components of the speckle pattern. To address this problem, the spiking cortical model (SCM)-based nonlocal means method is presented. The proposed method explores self-similarities of OCT images based on rotation-invariant features of image patches extracted by SCM and then restores the speckled images by averaging the similar patches. This method can provide sufficient speckle reduction while preserving image details very well due to its effectiveness in finding reliable similar patches under high speckle noise contamination. When applied to the retinal OCT image, this method provides signal-to-noise ratio improvements of >16 dB with a small 5.4% loss of similarity.

  3. A New Method and a New Scaling for Deriving Fermionic Mean-Field Dynamics

    International Nuclear Information System (INIS)

    Petrat, Sören; Pickl, Peter

    2016-01-01

    We introduce a new method for deriving the time-dependent Hartree or Hartree-Fock equations as an effective mean-field dynamics from the microscopic Schrödinger equation for fermionic many-particle systems in quantum mechanics. The method is an adaption of the method used in Pickl (Lett. Math. Phys. 97 (2) 151–164 2011) for bosonic systems to fermionic systems. It is based on a Gronwall type estimate for a suitable measure of distance between the microscopic solution and an antisymmetrized product state. We use this method to treat a new mean-field limit for fermions with long-range interactions in a large volume. Some of our results hold for singular attractive or repulsive interactions. We can also treat Coulomb interaction assuming either a mild singularity cutoff or certain regularity conditions on the solutions to the Hartree(-Fock) equations. In the considered limit, the kinetic and interaction energy are of the same order, while the average force is subleading. For some interactions, we prove that the Hartree(-Fock) dynamics is a more accurate approximation than a simpler dynamics that one would expect from the subleading force. With our method we also treat the mean-field limit coupled to a semiclassical limit, which was discussed in the literature before, and we recover some of the previous results. All results hold for initial data close (but not necessarily equal) to antisymmetrized product states and we always provide explicit rates of convergence.

  4. Interval estimation methods of the mean in small sample situation and the results' comparison

    International Nuclear Information System (INIS)

    Wu Changli; Guo Chunying; Jiang Meng; Lin Yuangen

    2009-01-01

    The methods of the sample mean's interval estimation, namely the classical method, the Bootstrap method, the Bayesian Bootstrap method, the Jackknife method and the spread method of the Empirical Characteristic distribution function are described. Numerical calculation on the samples' mean intervals is carried out where the numbers of the samples are 4, 5, 6 respectively. The results indicate the Bootstrap method and the Bayesian Bootstrap method are much more appropriate than others in small sample situation. (authors)

  5. Position detectors, methods of detecting position, and methods of providing positional detectors

    Science.gov (United States)

    Weinberg, David M.; Harding, L. Dean; Larsen, Eric D.

    2002-01-01

    Position detectors, welding system position detectors, methods of detecting various positions, and methods of providing position detectors are described. In one embodiment, a welding system positional detector includes a base that is configured to engage and be moved along a curved surface of a welding work piece. At least one position detection apparatus is provided and is connected with the base and configured to measure angular position of the detector relative to a reference vector. In another embodiment, a welding system positional detector includes a weld head and at least one inclinometer mounted on the weld head. The one inclinometer is configured to develop positional data relative to a reference vector and the position of the weld head on a non-planar weldable work piece.

  6. Children's activities and their meanings for parents: a mixed-methods study in six Western cultures.

    Science.gov (United States)

    Harkness, Sara; Zylicz, Piotr Olaf; Super, Charles M; Welles-Nyström, Barbara; Bermúdez, Moisés Ríos; Bonichini, Sabrina; Moscardino, Ughetta; Mavridis, Caroline Johnston

    2011-12-01

    Theoretical perspectives and research in sociology, anthropology, sociolinguistics, and cultural psychology converge in recognizing the significance of children's time spent in various activities, especially in the family context. Knowing how children's time is deployed, however, only gives us a partial answer to how children acquire competence; the other part must take into account the culturally constructed meanings of activities, from the perspective of those who organize and direct children's daily lives. In this article, we report on a study of children's routine daily activities and on the meanings that parents attribute to them in six Western middle-class cultural communities located in Italy, The Netherlands, Poland, Spain, Sweden, and the United States (N = 183). Using week-long time diaries kept by parents, we first demonstrate similarities as well as significant differences in children's daily routines across the cultural samples. We then present brief vignettes--"a day in the life" --of children from each sample. Parent interviews were coded for themes in the meanings attributed to various activities. Excerpts from parent interviews, focusing on four major activities (meals, family time, play, school- or developmentally related activities), are presented to illustrate how cultural meanings and themes are woven into parents' organization and understanding of their children's daily lives. The results of this mixed-method approach provide a more reliable and nuanced picture of children's and families' daily lives than could be derived from either method alone.

  7. An initialization method for the k-means using the concept of useful nearest centers

    OpenAIRE

    Ismkhan, Hassan

    2017-01-01

    The aim of the k-means is to minimize squared sum of Euclidean distance from the mean (SSEDM) of each cluster. The k-means can effectively optimize this function, but it is too sensitive for initial centers (seeds). This paper proposed a method for initialization of the k-means using the concept of useful nearest center for each data point.

  8. Protein Based Molecular Markers Provide Reliable Means to Understand Prokaryotic Phylogeny and Support Darwinian Mode of Evolution

    Directory of Open Access Journals (Sweden)

    Vaibhav eBhandari

    2012-07-01

    Full Text Available The analyses of genome sequences have led to the proposal that lateral gene transfers (LGTs among prokaryotes are so widespread that they disguise the interrelationships among these organisms. This has led to questioning whether the Darwinian model of evolution is applicable to the prokaryotic organisms. In this review, we discuss the usefulness of taxon-specific molecular markers such as conserved signature indels (CSIs and conserved signature proteins (CSPs for understanding the evolutionary relationships among prokaryotes and to assess the influence of LGTs on prokaryotic evolution. The analyses of genomic sequences have identified large numbers of CSIs and CSPs that are unique properties of different groups of prokaryotes ranging from phylum to genus levels. The species distribution patterns of these molecular signatures strongly support a tree-like vertical inheritance of the genes containing these molecular signatures that is consistent with phylogenetic trees. Recent detailed studies in this regard on Thermotogae and Archaea, which are reviewed here, have identified large numbers of CSIs and CSPs that are specific for the species from these two taxa and a number of their major clades. The genetic changes responsible for these CSIs (and CSPs initially likely occurred in the common ancestors of these taxa and then vertically transferred to various descendants. Although some CSIs and CSPs in unrelated groups of prokaryotes were identified, their small numbers and random occurrence has no apparent influence on the consistent tree-like branching pattern emerging from other markers. These results provide evidence that although LGT is an important evolutionary force, it does not mask the tree-like branching pattern of prokaryotes or understanding of their evolutionary relationships. The identified CSIs and CSPs also provide novel and highly specific means for identification of different groups of microbes and for taxonomical and biochemical

  9. Protein based molecular markers provide reliable means to understand prokaryotic phylogeny and support Darwinian mode of evolution.

    Science.gov (United States)

    Bhandari, Vaibhav; Naushad, Hafiz S; Gupta, Radhey S

    2012-01-01

    The analyses of genome sequences have led to the proposal that lateral gene transfers (LGTs) among prokaryotes are so widespread that they disguise the interrelationships among these organisms. This has led to questioning of whether the Darwinian model of evolution is applicable to prokaryotic organisms. In this review, we discuss the usefulness of taxon-specific molecular markers such as conserved signature indels (CSIs) and conserved signature proteins (CSPs) for understanding the evolutionary relationships among prokaryotes and to assess the influence of LGTs on prokaryotic evolution. The analyses of genomic sequences have identified large numbers of CSIs and CSPs that are unique properties of different groups of prokaryotes ranging from phylum to genus levels. The species distribution patterns of these molecular signatures strongly support a tree-like vertical inheritance of the genes containing these molecular signatures that is consistent with phylogenetic trees. Recent detailed studies in this regard on the Thermotogae and Archaea, which are reviewed here, have identified large numbers of CSIs and CSPs that are specific for the species from these two taxa and a number of their major clades. The genetic changes responsible for these CSIs (and CSPs) initially likely occurred in the common ancestors of these taxa and then vertically transferred to various descendants. Although some CSIs and CSPs in unrelated groups of prokaryotes were identified, their small numbers and random occurrence has no apparent influence on the consistent tree-like branching pattern emerging from other markers. These results provide evidence that although LGT is an important evolutionary force, it does not mask the tree-like branching pattern of prokaryotes or understanding of their evolutionary relationships. The identified CSIs and CSPs also provide novel and highly specific means for identification of different groups of microbes and for taxonomical and biochemical studies.

  10. Means and method for controlling the neutron output of a neutron generator tube

    International Nuclear Information System (INIS)

    Langford, O.M.; Peelman, H.E.

    1978-01-01

    Means and method are described for energizing and regulating a neutron generator tube having a target, an ion source and a replenisher. It providing a negative high voltage to the target and monitoring the target current. A constant current from a constant current source is divided into a shunt current and a replenisher current in accordence with the target current. The replenisher current is applied to the replenisher in a neutron generator tube so as to control the neutron output in accordance with the target current

  11. The burden of neck pain: its meaning for persons with neck pain and healthcare providers, explored by concept mapping.

    Science.gov (United States)

    van Randeraad-van der Zee, Carlijn H; Beurskens, Anna J H M; Swinkels, Raymond A H M; Pool, Jan J M; Batterham, Roy W; Osborne, Richard H; de Vet, Henrica C W

    2016-05-01

    To empirically define the concept of burden of neck pain. The lack of a clear understanding of this construct from the perspective of persons with neck pain and care providers hampers adequate measurement of this burden. An additional aim was to compare the conceptual model obtained with the frequently used Neck Disability Index (NDI). Concept mapping, combining qualitative (nominal group technique and group consensus) and quantitative research methods (cluster analysis and multidimensional scaling), was applied to groups of persons with neck pain (n = 3) and professionals treating persons with neck pain (n = 2). Group members generated statements, which were organized into concept maps. Group members achieved consensus about the number and description of domains and the researchers then generated an overall mind map covering the full breadth of the burden of neck pain. Concept mapping revealed 12 domains of burden of neck pain: impaired mobility neck, neck pain, fatigue/concentration, physical complaints, psychological aspects/consequences, activities of daily living, social participation, financial consequences, difficult to treat/difficult to diagnose, difference of opinion with care providers, incomprehension by social environment, and how person with neck pain deal with complaints. All ten items of the NDI could be linked to the mind map, but the NDI measures only part of the burden of neck pain. This study revealed the relevant domains for the burden of neck pain from the viewpoints of persons with neck pain and their care providers. These results can guide the identification of existing measurements instruments for each domain or the development of new ones to measure the burden of neck pain.

  12. The use of Second Life as an effective means of providing informal science education to secondary school students

    Science.gov (United States)

    Amous, Haytham

    This research study evaluated the use of Second Life and its virtual museums as a means of providing effective informal science education for both junior high and high school students. This study investigated whether the attitudes of students toward science change as a result of scholastic exposure to the science museums in Second Life. The dependence between attitudes and learning styles was also investigated. The data gathered from the experiences and the perceptions of students using Second Life in informal science education were analyzed to address the questions of the study. The researcher used qualitative and quantitative research methodologies to investigate the research questions. The first and second research questions were quantitative and used TOSRA2 research instrument to assess attitude and perceptions and learning style questionnaire scores. The attitudes toward science before and after visiting the Second Life museums showed no significant change. A weak relationship between the attitudes toward science and the participants learning styles was found. The researcher therefore concluded that no relationship existed between the average of the TOSRA scores and the learning styles questionnaire scores. To address questions research three and four, a collective qualitative case study approach (Creswell, 2007), as well as a structured interviews focusing on the students' perspectives about using Second Life for informal science education was used. The students did not prefer informal science education using second life over formal education. This was in part attributed to the poor usability and/or familiarity with the program. Despite the students' technical difficulties confronted in visiting Second Life the perception of student about their learning experiences and the use of Second Life on informal science environment were positive.

  13. A convolution method for predicting mean treatment dose including organ motion at imaging

    International Nuclear Information System (INIS)

    Booth, J.T.; Zavgorodni, S.F.; Royal Adelaide Hospital, SA

    2000-01-01

    Full text: The random treatment delivery errors (organ motion and set-up error) can be incorporated into the treatment planning software using a convolution method. Mean treatment dose is computed as the convolution of a static dose distribution with a variation kernel. Typically this variation kernel is Gaussian with variance equal to the sum of the organ motion and set-up error variances. We propose a novel variation kernel for the convolution technique that additionally considers the position of the mobile organ in the planning CT image. The systematic error of organ position in the planning CT image can be considered random for each patient over a population. Thus the variance of the variation kernel will equal the sum of treatment delivery variance and organ motion variance at planning for the population of treatments. The kernel is extended to deal with multiple pre-treatment CT scans to improve tumour localisation for planning. Mean treatment doses calculated with the convolution technique are compared to benchmark Monte Carlo (MC) computations. Calculations of mean treatment dose using the convolution technique agreed with MC results for all cases to better than ± 1 Gy in the planning treatment volume for a prescribed 60 Gy treatment. Convolution provides a quick method of incorporating random organ motion (captured in the planning CT image and during treatment delivery) and random set-up errors directly into the dose distribution. Copyright (2000) Australasian College of Physical Scientists and Engineers in Medicine

  14. σ-SCF: A direct energy-targeting method to mean-field excited states.

    Science.gov (United States)

    Ye, Hong-Zhou; Welborn, Matthew; Ricke, Nathan D; Van Voorhis, Troy

    2017-12-07

    The mean-field solutions of electronic excited states are much less accessible than ground state (e.g., Hartree-Fock) solutions. Energy-based optimization methods for excited states, like Δ-SCF (self-consistent field), tend to fall into the lowest solution consistent with a given symmetry-a problem known as "variational collapse." In this work, we combine the ideas of direct energy-targeting and variance-based optimization in order to describe excited states at the mean-field level. The resulting method, σ-SCF, has several advantages. First, it allows one to target any desired excited state by specifying a single parameter: a guess of the energy of that state. It can therefore, in principle, find all excited states. Second, it avoids variational collapse by using a variance-based, unconstrained local minimization. As a consequence, all states-ground or excited-are treated on an equal footing. Third, it provides an alternate approach to locate Δ-SCF solutions that are otherwise hardly accessible by the usual non-aufbau configuration initial guess. We present results for this new method for small atoms (He, Be) and molecules (H 2 , HF). We find that σ-SCF is very effective at locating excited states, including individual, high energy excitations within a dense manifold of excited states. Like all single determinant methods, σ-SCF shows prominent spin-symmetry breaking for open shell states and our results suggest that this method could be further improved with spin projection.

  15. σ-SCF: A direct energy-targeting method to mean-field excited states

    Science.gov (United States)

    Ye, Hong-Zhou; Welborn, Matthew; Ricke, Nathan D.; Van Voorhis, Troy

    2017-12-01

    The mean-field solutions of electronic excited states are much less accessible than ground state (e.g., Hartree-Fock) solutions. Energy-based optimization methods for excited states, like Δ-SCF (self-consistent field), tend to fall into the lowest solution consistent with a given symmetry—a problem known as "variational collapse." In this work, we combine the ideas of direct energy-targeting and variance-based optimization in order to describe excited states at the mean-field level. The resulting method, σ-SCF, has several advantages. First, it allows one to target any desired excited state by specifying a single parameter: a guess of the energy of that state. It can therefore, in principle, find all excited states. Second, it avoids variational collapse by using a variance-based, unconstrained local minimization. As a consequence, all states—ground or excited—are treated on an equal footing. Third, it provides an alternate approach to locate Δ-SCF solutions that are otherwise hardly accessible by the usual non-aufbau configuration initial guess. We present results for this new method for small atoms (He, Be) and molecules (H2, HF). We find that σ-SCF is very effective at locating excited states, including individual, high energy excitations within a dense manifold of excited states. Like all single determinant methods, σ-SCF shows prominent spin-symmetry breaking for open shell states and our results suggest that this method could be further improved with spin projection.

  16. A spectral chart method for estimating the mean turbulent kinetic energy dissipation rate

    Science.gov (United States)

    Djenidi, L.; Antonia, R. A.

    2012-10-01

    We present an empirical but simple and practical spectral chart method for determining the mean turbulent kinetic energy dissipation rate DNS spectra, points to this scaling being also valid at small Reynolds numbers, provided effects due to inhomogeneities in the flow are negligible. The methods avoid the difficulty associated with estimating time or spatial derivatives of the velocity fluctuations. It also avoids using the second hypothesis of K41, which implies the existence of a -5/3 inertial subrange only when the Taylor microscale Reynods number R λ is sufficiently large. The method is in fact applied to the lower wavenumber end of the dissipative range thus avoiding most of the problems due to inadequate spatial resolution of the velocity sensors and noise associated with the higher wavenumber end of this range.The use of spectral data (30 ≤ R λ ≤ 400) in both passive and active grid turbulence, a turbulent mixing layer and the turbulent wake of a circular cylinder indicates that the method is robust and should lead to reliable estimates of < \\varepsilon rangle in flows or flow regions where the first similarity hypothesis should hold; this would exclude, for example, the region near a wall.

  17. Approximate calculation method for integral of mean square value of nonstationary response

    International Nuclear Information System (INIS)

    Aoki, Shigeru; Fukano, Azusa

    2010-01-01

    The response of the structure subjected to nonstationary random vibration such as earthquake excitation is nonstationary random vibration. Calculating method for statistical characteristics of such a response is complicated. Mean square value of the response is usually used to evaluate random response. Integral of mean square value of the response corresponds to total energy of the response. In this paper, a simplified calculation method to obtain integral of mean square value of the response is proposed. As input excitation, nonstationary white noise and nonstationary filtered white noise are used. Integrals of mean square value of the response are calculated for various values of parameters. It is found that the proposed method gives exact value of integral of mean square value of the response.

  18. More recent robust methods for the estimation of mean and standard deviation of data

    International Nuclear Information System (INIS)

    Kanisch, G.

    2003-01-01

    Outliers in a data set result in biased values of mean and standard deviation. One way to improve the estimation of a mean is to apply tests to identify outliers and to exclude them from the calculations. Tests according to Grubbs or to Dixon, which are frequently used in practice, especially within laboratory intercomparisons, are not very efficient in identifying outliers. Since more than ten years now so-called robust methods are used more and more, which determine mean and standard deviation by iteration and down-weighting values far from the mean, thereby diminishing the impact of outliers. In 1989 the Analytical Methods Committee of the British Royal Chemical Society published such a robust method. Since 1993 the US Environmental Protection Agency published a more efficient and quite versatile method. Mean and standard deviation are calculated by iteration and application of a special weight function for down-weighting outlier candidates. In 2000, W. Cofino et al. published a very efficient robust method which works quite different from the others. It applies methods taken from the basics of quantum mechanics, such as ''wave functions'' associated with each laboratory mean value and matrix algebra (solving eigenvalue problems). In contrast to the other ones, this method includes the individual measurement uncertainties. (orig.)

  19. The burden of neck pain: its meaning for persons with neck pain and healthcare providers, explored by concept mapping

    NARCIS (Netherlands)

    Carlijn H. van Randeraad-van der Zee; Anna Beurskens; Raymond Swinkels; Jan Pool; Roy Batterham; Richard Osborne; Henrica de Vet

    2015-01-01

    Purpose To empirically define the concept of burden of neck pain. The lack of a clear understanding of this construct from the perspective of persons with neck pain and care providers hampers adequate measurement of this burden. An additional aim was to compare the conceptual model obtained with the

  20. The burden of neck pain : its meaning for persons with neck pain and healthcare providers, explored by concept mapping

    NARCIS (Netherlands)

    Carlijn H. van Randeraad-van der Zee; Anna J.H.M. Beurskens; Reymond A.H.M. Swinkels; Jan J.M. Pool; Richard H. Osborne; Roy W. Batterham; Henrica C.W. de Vet

    2015-01-01

    Purpose To empirically define the concept of burden of neck pain. The lack of a clear understanding of this construct from the perspective of persons with neck pain and care providers hampers adequate measurement of this burden. An additional aim was to compare the conceptual model obtained with the

  1. Examination of Cast Iron Material Properties by Means of the Nanoindentation Method

    Directory of Open Access Journals (Sweden)

    Trytek A.

    2012-12-01

    Full Text Available The paper presents results of examination of material parameters of cast iron with structure obtained under rapid resolidification conditions carried out by means of the nanoindentation method.

  2. A spectral chart method for estimating the mean turbulent kinetic energy dissipation rate

    Energy Technology Data Exchange (ETDEWEB)

    Djenidi, L.; Antonia, R.A. [The University of Newcastle, School of Engineering, Newcastle, NSW (Australia)

    2012-10-15

    We present an empirical but simple and practical spectral chart method for determining the mean turbulent kinetic energy dissipation rate left angle {epsilon}right angle in a variety of turbulent flows. The method relies on the validity of the first similarity hypothesis of Kolmogorov (C R (Doklady) Acad Sci R R SS, NS 30:301-305, 1941) (or K41) which implies that spectra of velocity fluctuations scale on the kinematic viscosity {nu} and left angle {epsilon}right angle at large Reynolds numbers. However, the evidence, based on the DNS spectra, points to this scaling being also valid at small Reynolds numbers, provided effects due to inhomogeneities in the flow are negligible. The methods avoid the difficulty associated with estimating time or spatial derivatives of the velocity fluctuations. It also avoids using the second hypothesis of K41, which implies the existence of a -5/3 inertial subrange only when the Taylor microscale Reynolds number R{sub {lambda}} is sufficiently large. The method is in fact applied to the lower wavenumber end of the dissipative range thus avoiding most of the problems due to inadequate spatial resolution of the velocity sensors and noise associated with the higher wavenumber end of this range.The use of spectral data (30 {<=} R{sub {lambda}}{<=} 400) in both passive and active grid turbulence, a turbulent mixing layer and the turbulent wake of a circular cylinder indicates that the method is robust and should lead to reliable estimates of left angle {epsilon}right angle in flows or flow regions where the first similarity hypothesis should hold; this would exclude, for example, the region near a wall. (orig.)

  3. A novel method of providing a library of n-mers or biopolymers

    DEFF Research Database (Denmark)

    2012-01-01

    The present invention relates to a method of providing a library of n-mer sequences, wherein the library is composed of an n-mer sequence. Also the invention concerns a method of providing a library of biopolymer sequences having one or more n-mers in common. Further provided are specific primers...

  4. Asynchronous hatching provides females with a means for increasing male care but incurs a cost by reducing offspring fitness.

    Science.gov (United States)

    Ford, L E; Smiseth, P T

    2016-02-01

    In species with biparental care, sexual conflict occurs because the benefit of care depends on the total amount of care provided by the two parents while the cost of care depends on each parent's own contribution. Asynchronous hatching may play a role in mediating the resolution of this conflict over parental care. The sexual conflict hypothesis for the evolution of asynchronous hatching suggests that females adjust hatching patterns in order to increase male parental effort relative to female effort. We tested this hypothesis in the burying beetle Nicrophorus vespilloides by setting up experimental broods with three different hatching patterns: synchronous, asynchronous and highly asynchronous broods. As predicted, we found that males provided care for longer in asynchronous broods whereas the opposite was true of females. However, we did not find any benefit to females of reducing their duration of care in terms of increased lifespan or reduced mass loss during breeding. We found substantial negative effects of hatching asynchrony on offspring fitness as larval mass was lower and fewer larvae survived to dispersal in highly asynchronous broods compared to synchronous or asynchronous broods. Our results suggest that, even though females can increase male parental effort by hatching their broods more asynchronously, females pay a substantial cost from doing so in terms of reducing offspring growth and survival. Thus, females should be under selection to produce a hatching pattern that provides the best possible trade-off between the benefits of increased male parental effort and the costs due to reduced offspring fitness. © 2015 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2015 European Society For Evolutionary Biology.

  5. Analysis of S-box in Image Encryption Using Root Mean Square Error Method

    Science.gov (United States)

    Hussain, Iqtadar; Shah, Tariq; Gondal, Muhammad Asif; Mahmood, Hasan

    2012-07-01

    The use of substitution boxes (S-boxes) in encryption applications has proven to be an effective nonlinear component in creating confusion and randomness. The S-box is evolving and many variants appear in literature, which include advanced encryption standard (AES) S-box, affine power affine (APA) S-box, Skipjack S-box, Gray S-box, Lui J S-box, residue prime number S-box, Xyi S-box, and S8 S-box. These S-boxes have algebraic and statistical properties which distinguish them from each other in terms of encryption strength. In some circumstances, the parameters from algebraic and statistical analysis yield results which do not provide clear evidence in distinguishing an S-box for an application to a particular set of data. In image encryption applications, the use of S-boxes needs special care because the visual analysis and perception of a viewer can sometimes identify artifacts embedded in the image. In addition to existing algebraic and statistical analysis already used for image encryption applications, we propose an application of root mean square error technique, which further elaborates the results and enables the analyst to vividly distinguish between the performances of various S-boxes. While the use of the root mean square error analysis in statistics has proven to be effective in determining the difference in original data and the processed data, its use in image encryption has shown promising results in estimating the strength of the encryption method. In this paper, we show the application of the root mean square error analysis to S-box image encryption. The parameters from this analysis are used in determining the strength of S-boxes

  6. Variance of a potential of mean force obtained using the weighted histogram analysis method.

    Science.gov (United States)

    Cukier, Robert I

    2013-11-27

    A potential of mean force (PMF) that provides the free energy of a thermally driven system along some chosen reaction coordinate (RC) is a useful descriptor of systems characterized by complex, high dimensional potential energy surfaces. Umbrella sampling window simulations use potential energy restraints to provide more uniform sampling along a RC so that potential energy barriers that would otherwise make equilibrium sampling computationally difficult can be overcome. Combining the results from the different biased window trajectories can be accomplished using the Weighted Histogram Analysis Method (WHAM). Here, we provide an analysis of the variance of a PMF along the reaction coordinate. We assume that the potential restraints used for each window lead to Gaussian distributions for the window reaction coordinate densities and that the data sampling in each window is from an equilibrium ensemble sampled so that successive points are statistically independent. Also, we assume that neighbor window densities overlap, as required in WHAM, and that further-than-neighbor window density overlap is negligible. Then, an analytic expression for the variance of the PMF along the reaction coordinate at a desired level of spatial resolution can be generated. The variance separates into a sum over all windows with two kinds of contributions: One from the variance of the biased window density normalized by the total biased window density and the other from the variance of the local (for each window's coordinate range) PMF. Based on the desired spatial resolution of the PMF, the former variance can be minimized relative to that from the latter. The method is applied to a model system that has features of a complex energy landscape evocative of a protein with two conformational states separated by a free energy barrier along a collective reaction coordinate. The variance can be constructed from data that is already available from the WHAM PMF construction.

  7. Natural antigenic differences in the functionally equivalent extracellular DNABII proteins of bacterial biofilms provide a means for targeted biofilm therapeutics

    Science.gov (United States)

    Rocco, Christopher J.; Davey, Mary Ellen; Bakaletz, Lauren O.; Goodman, Steven D.

    2016-01-01

    SUMMARY Bacteria that persist in the oral cavity exist within complex biofilm communities. A hallmark of biofilms is the presence of an extracellular polymeric substance (EPS), which consists of polysaccharides, extracellular DNA (eDNA), and proteins, including the DNABII family of proteins. The removal of DNABII proteins from a biofilm results in the loss of structural integrity of the eDNA and the collapse of the biofilm structure. We examined the role of DNABII proteins in the biofilm structure of the periodontal pathogen Porphyromonas gingivalis and the oral commensal Streptococcus gordonii. Co-aggregation with oral streptococci is thought to facilitate the establishment of P. gingivalis within the biofilm community. We demonstrate that DNABII proteins are present in the EPS of both S. gordonii and P. gingivalis biofilms, and that these biofilms can be disrupted through the addition of antisera derived against their respective DNABII proteins. We provide evidence that both eDNA and DNABII proteins are limiting in S. gordonii but not in P. gingivalis biofilms. In addition, these proteins are capable of complementing one another functionally. We also found that while antisera derived against most DNABII proteins are capable of binding a wide variety of DNABII proteins, the P. gingivalis DNABII proteins are antigenically distinct. The presence of DNABII proteins in the EPS of these biofilms and the antigenic uniqueness of the P. gingivalis proteins provide an opportunity to develop therapies that are targeted to remove P. gingivalis and biofilms that contain P. gingivalis from the oral cavity. PMID:26988714

  8. Automating the mean-field method for large dynamic gossip networks

    NARCIS (Netherlands)

    Bakhshi, Rena; Endrullis, Jörg; Endrullis, Stefan; Fokkink, Wan; Haverkort, Boudewijn R.H.M.

    We investigate an abstraction method, called mean- field method, for the performance evaluation of dynamic net- works with pairwise communication between nodes. It allows us to evaluate systems with very large numbers of nodes, that is, systems of a size where traditional performance evaluation

  9. Method and apparatus for simultaneous determination of fluid mass flow rate, mean velocity and density

    International Nuclear Information System (INIS)

    Hamel, W.R.

    1984-01-01

    This invention relates to a new method and new apparatus for determining fluid mass flow rate and density. In one aspect of the invention, the fluid is passed through a straight cantilevered tube in which transient oscillation has been induced, thus generating Coriolis damping forces on the tube. The decay rate and frequency of the resulting damped oscillation are measured, and the fluid mass flow rate and density are determined therefrom. In another aspect of the invention, the fluid is passed through the cantilevered tube while an electrically powered device imparts steady-state harmonic excitation to the tube. This generates Coriolis tube-damping forces which are dependent on the mass flow rate of the fluid. Means are provided to respond to incipient flow-induced changes in the amplitude of vibration by changing the power input to the excitation device as required to sustain the original amplitude of vibration. The fluid mass flow rate and density are determined from the required change in power input. The invention provides stable, rapid, and accurate measurements. It does not require bending of the fluid flow

  10. A possible extension to the RInChI as a means of providing machine readable process data.

    Science.gov (United States)

    Jacob, Philipp-Maximilian; Lan, Tian; Goodman, Jonathan M; Lapkin, Alexei A

    2017-04-11

    The algorithmic, large-scale use and analysis of reaction databases such as Reaxys is currently hindered by the absence of widely adopted standards for publishing reaction data in machine readable formats. Crucial data such as yields of all products or stoichiometry are frequently not explicitly stated in the published papers and, hence, not reported in the database entry for those reactions, limiting their usefulness for algorithmic analysis. This paper presents a possible extension to the IUPAC RInChI standard via an auxiliary layer, termed ProcAuxInfo, which is a standardised, extensible form in which to report certain key reaction parameters such as declaration of all products and reactants as well as auxiliaries known in the reaction, reaction stoichiometry, amounts of substances used, conversion, yield and operating conditions. The standard is demonstrated via creation of the RInChI including the ProcAuxInfo layer based on three published reactions and demonstrates accurate data recoverability via reverse translation of the created strings. Implementation of this or another method of reporting process data by the publishing community would ensure that databases, such as Reaxys, would be able to abstract crucial data for big data analysis of their contents.

  11. Lessons learned: role of influenza vaccine production, distribution, supply, and demand--what it means for the provider.

    Science.gov (United States)

    Orenstein, Walter A; Schaffner, William

    2008-07-01

    The Advisory Committee on Immunization Practices of the Centers for Disease Control and Prevention (CDC) has been increasing the size of the population for whom influenza vaccine is recommended to reduce the substantial and persistent annual health burden of influenza. Realization of current and future public health influenza immunization goals requires assuring vaccine supply will be adequate to meet demand. This has posed distinct challenges for the many stakeholders in the influenza vaccine program--government agencies, federal, state, and local policymakers, vaccine manufacturers and distributors, and the medical community--each of whom must make critical decisions in a constantly shifting environment. Factors such as the yearly changes in influenza virus strains, the complicated vaccine production and distribution process, revisions in vaccination recommendations, and changing demographics can all affect the delicate balance between supply and demand. While vaccine shortages and delays have been well-publicized concerns in the recent past, there has been a marked increase in supply in the past several years, with substantial growth in supply expected in the future. The primary issue today is to strengthen the demand for the influenza vaccine, which would in turn help ensure the continued availability of the vaccine to reduce disease burden. A number of strategies are discussed, including increased efforts to publicize and fully implement current CDC recommendations and to offer influenza vaccine beyond the typical vaccination season of October and November, because in the great majority of years, vaccination into January and beyond will still provide health benefits.

  12. MODEL FOR FORMATION OF ENTREPRENEUR’S STYLE THINKING AMONG STUDENTS OF SECONDARY SCHOOLS PROVIDING GENERAL EDUCATION WHILE USING MEANS THAT DEVELOP SOCIAL AND PEDAGOGICAL ENVIRONMENT

    Directory of Open Access Journals (Sweden)

    A. M. Gorodovich

    2008-01-01

    Full Text Available The paper rises problems pertaining to formation of entrepreneur competence among students of secondary schools providing general education while using means that develop social and pedagogical environment.

  13. The two means method for the attenuation coefficient determination of archaeological ceramics from the North of Parana

    International Nuclear Information System (INIS)

    Silva, Richard Maximiliano Cunha e

    1997-01-01

    This work reports an alternative methodology for the linear attenuation coefficient determination (μ ρ) of irregular form samples, in such a way that is not necessary to consider the sample thickness. With this methodology, indigenous archaeological ceramics fragments from the region of Londrina, north of Parana, were studied. These ceramics fragments belong to the Kaingaing and Tupiguarani traditions. The equation for the μ ρ determination employing the two mean method was obtained and it was used for μ ρ determination by the gamma ray beam attenuation if immersed ceramics, by turns, in two different means with known linear attenuation coefficient. By the other side, μ theoretical value was determined with the XCOM computer code. This code uses as input the ceramics chemistry composition and provides an energy versus mass attenuation coefficient table. In order to validate the two mean method validation, five ceramics samples of thickness 1.15 cm and 1.87 cm were prepared with homogeneous clay. Using these ceramics, μ ρ was determined using the attenuation method, and the two mean method. The result obtained for μ ρ and its respective deviation were compared for these samples, for the two methods. With the obtained results, it was concluded that the two means method is good for the linear attenuation coefficient determination of materials of irregular shape, what is suitable, specially, for archaeometric studies. (author)

  14. Linear–Quadratic Mean-Field-Type Games: A Direct Method

    Directory of Open Access Journals (Sweden)

    Tyrone E. Duncan

    2018-02-01

    Full Text Available In this work, a multi-person mean-field-type game is formulated and solved that is described by a linear jump-diffusion system of mean-field type and a quadratic cost functional involving the second moments, the square of the expected value of the state, and the control actions of all decision-makers. We propose a direct method to solve the game, team, and bargaining problems. This solution approach does not require solving the Bellman–Kolmogorov equations or backward–forward stochastic differential equations of Pontryagin’s type. The proposed method can be easily implemented by beginners and engineers who are new to the emerging field of mean-field-type game theory. The optimal strategies for decision-makers are shown to be in a state-and-mean-field feedback form. The optimal strategies are given explicitly as a sum of the well-known linear state-feedback strategy for the associated deterministic linear–quadratic game problem and a mean-field feedback term. The equilibrium cost of the decision-makers are explicitly derived using a simple direct method. Moreover, the equilibrium cost is a weighted sum of the initial variance and an integral of a weighted variance of the diffusion and the jump process. Finally, the method is used to compute global optimum strategies as well as saddle point strategies and Nash bargaining solution in state-and-mean-field feedback form.

  15. Numerical Solutions of the Mean-Value Theorem: New Methods for Downward Continuation of Potential Fields

    Science.gov (United States)

    Zhang, Chong; Lü, Qingtian; Yan, Jiayong; Qi, Guang

    2018-04-01

    Downward continuation can enhance small-scale sources and improve resolution. Nevertheless, the common methods have disadvantages in obtaining optimal results because of divergence and instability. We derive the mean-value theorem for potential fields, which could be the theoretical basis of some data processing and interpretation. Based on numerical solutions of the mean-value theorem, we present the convergent and stable downward continuation methods by using the first-order vertical derivatives and their upward continuation. By applying one of our methods to both the synthetic and real cases, we show that our method is stable, convergent and accurate. Meanwhile, compared with the fast Fourier transform Taylor series method and the integrated second vertical derivative Taylor series method, our process has very little boundary effect and is still stable in noise. We find that the characters of the fading anomalies emerge properly in our downward continuation with respect to the original fields at the lower heights.

  16. Integration K-Means Clustering Method and Elbow Method For Identification of The Best Customer Profile Cluster

    Science.gov (United States)

    Syakur, M. A.; Khotimah, B. K.; Rochman, E. M. S.; Satoto, B. D.

    2018-04-01

    Clustering is a data mining technique used to analyse data that has variations and the number of lots. Clustering was process of grouping data into a cluster, so they contained data that is as similar as possible and different from other cluster objects. SMEs Indonesia has a variety of customers, but SMEs do not have the mapping of these customers so they did not know which customers are loyal or otherwise. Customer mapping is a grouping of customer profiling to facilitate analysis and policy of SMEs in the production of goods, especially batik sales. Researchers will use a combination of K-Means method with elbow to improve efficient and effective k-means performance in processing large amounts of data. K-Means Clustering is a localized optimization method that is sensitive to the selection of the starting position from the midpoint of the cluster. So choosing the starting position from the midpoint of a bad cluster will result in K-Means Clustering algorithm resulting in high errors and poor cluster results. The K-means algorithm has problems in determining the best number of clusters. So Elbow looks for the best number of clusters on the K-means method. Based on the results obtained from the process in determining the best number of clusters with elbow method can produce the same number of clusters K on the amount of different data. The result of determining the best number of clusters with elbow method will be the default for characteristic process based on case study. Measurement of k-means value of k-means has resulted in the best clusters based on SSE values on 500 clusters of batik visitors. The result shows the cluster has a sharp decrease is at K = 3, so K as the cut-off point as the best cluster.

  17. Performance Analysis of Entropy Methods on K Means in Clustering Process

    Science.gov (United States)

    Dicky Syahputra Lubis, Mhd.; Mawengkang, Herman; Suwilo, Saib

    2017-12-01

    K Means is a non-hierarchical data clustering method that attempts to partition existing data into one or more clusters / groups. This method partitions the data into clusters / groups so that data that have the same characteristics are grouped into the same cluster and data that have different characteristics are grouped into other groups.The purpose of this data clustering is to minimize the objective function set in the clustering process, which generally attempts to minimize variation within a cluster and maximize the variation between clusters. However, the main disadvantage of this method is that the number k is often not known before. Furthermore, a randomly chosen starting point may cause two points to approach the distance to be determined as two centroids. Therefore, for the determination of the starting point in K Means used entropy method where this method is a method that can be used to determine a weight and take a decision from a set of alternatives. Entropy is able to investigate the harmony in discrimination among a multitude of data sets. Using Entropy criteria with the highest value variations will get the highest weight. Given this entropy method can help K Means work process in determining the starting point which is usually determined at random. Thus the process of clustering on K Means can be more quickly known by helping the entropy method where the iteration process is faster than the K Means Standard process. Where the postoperative patient dataset of the UCI Repository Machine Learning used and using only 12 data as an example of its calculations is obtained by entropy method only with 2 times iteration can get the desired end result.

  18. How should we best estimate the mean recency duration for the BED method?

    Directory of Open Access Journals (Sweden)

    John Hargrove

    Full Text Available BED estimates of HIV incidence from cross-sectional surveys are obtained by restricting, to fixed time T, the period over which incidence is estimated. The appropriate mean recency duration (Ω(T then refers to the time where BED optical density (OD is less than a pre-set cut-off C, given the patient has been HIV positive for at most time T. Five methods, tested using data for postpartum women in Zimbabwe, provided similar estimates of Ω(T for C = 0.8: i The ratio (r/s of the number of BED-recent infections to all seroconversions over T = 365 days: 192 days [95% CI 168-216]. ii Linear mixed modeling (LMM: 191 days [95% CI 174-208]. iii Non-linear mixed modeling (NLMM: 196 days [95% CrI 188-204]. iv Survival analysis (SA: 192 days [95% CI 168-216]. Graphical analysis: 193 days. NLMM estimates of Ω(T--based on a biologically more appropriate functional relationship than LMM--resulted in best fits to OD data, the smallest variance in estimates of VT, and best correspondence between BED and follow-up estimates of HIV incidence, for the same subjects over the same time period. SA and NLMM produced very similar estimates of Ω(T but the coefficient of variation of the former was .3 times as high. The r/s method requires uniformly distributed seroconversion events but is useful if data are available only from a single follow-up. The graphical method produces the most variable results, involves unsound methodology and should not be used to provide estimates of Ω(T. False-recent rates increased as a quadratic function of C: for incidence estimation C should thus be chosen as small as possible, consistent with an adequate resultant number of recent cases, and accurate estimation of Ω(T. Inaccuracies in the estimation of Ω(T should not now provide an impediment to incidence estimation.

  19. GLOBAL CLASSIFICATION OF DERMATITIS DISEASE WITH K-MEANS CLUSTERING IMAGE SEGMENTATION METHODS

    OpenAIRE

    Prafulla N. Aerkewar1 & Dr. G. H. Agrawal2

    2018-01-01

    The objective of this paper to presents a global technique for classification of different dermatitis disease lesions using the process of k-Means clustering image segmentation method. The word global is used such that the all dermatitis disease having skin lesion on body are classified in to four category using k-means image segmentation and nntool of Matlab. Through the image segmentation technique and nntool can be analyze and study the segmentation properties of skin lesions occurs in...

  20. Using means and methods of general physical training in education of bowlers

    Directory of Open Access Journals (Sweden)

    Fanigina O.U.

    2011-04-01

    Full Text Available There were discovered the main directions of bowlers education. The means and methods of physical education, which insure the formation of high quality moves being the part of main skill, are discovered. There were shown different means of general education accounting individual peculiarities of bowler. The principles of choosing general developing exercises and main direction of influence on developing different abilities are represented. It's created the scientific-methodic support of physical education in teaching-training process for children who play bowing in sport schools.

  1. Means and method for controlling the neutron output of a neutron generator tube

    International Nuclear Information System (INIS)

    1980-01-01

    A specification is given for an energizing and regulating circuit for a gas filled neutron generator tube consisting of a target, an ion source and a replenisher, the circuit consisting of a power supply to provide a negative high voltage to the target and a target current corresponding to the neutron output of the tube, a constant current source, and control means connected to the power supply and to the constant current source, the control means being responsive to the target current to provide a portion of the constant current to the replenisher substantially to regulate the neutron output of the tube. (author)

  2. DETERMINATION OF HYDRAULIC TURBINE EFFICIENCY BY MEANS OF THE CURRENT METER METHOD

    Directory of Open Access Journals (Sweden)

    PURECE C.

    2016-12-01

    Full Text Available The paper presents methodology used for determining the efficiency of a low head Kaplan hydraulic turbine with short converging intake. The measurement method used was the current meters method, the only measurement method recommended by the IEC 41standard for flow measurement in this case. The paper also presents the methodology used for measuring the flow by means of the current meters method and the various procedures for calculating the flow. In the last part the paper presents the flow measurements carried out on the Fughiu HPP hydraulic turbines for determining the actual operating efficiency.

  3. Methods for fitting of efficiency curves obtained by means of HPGe gamma rays spectrometers

    International Nuclear Information System (INIS)

    Cardoso, Vanderlei

    2002-01-01

    The present work describes a few methodologies developed for fitting efficiency curves obtained by means of a HPGe gamma-ray spectrometer. The interpolated values were determined by simple polynomial fitting and polynomial fitting between the ratio of experimental peak efficiency and total efficiency, calculated by Monte Carlo technique, as a function of gamma-ray energy. Moreover, non-linear fitting has been performed using a segmented polynomial function and applying the Gauss-Marquardt method. For the peak area obtainment different methodologies were developed in order to estimate the background area under the peak. This information was obtained by numerical integration or by using analytical functions associated to the background. One non-calibrated radioactive source has been included in the curve efficiency in order to provide additional calibration points. As a by-product, it was possible to determine the activity of this non-calibrated source. For all fittings developed in the present work the covariance matrix methodology was used, which is an essential procedure in order to give a complete description of the partial uncertainties involved. (author)

  4. IP2P K-means: an efficient method for data clustering on sensor networks

    Directory of Open Access Journals (Sweden)

    Peyman Mirhadi

    2013-03-01

    Full Text Available Many wireless sensor network applications require data gathering as the most important parts of their operations. There are increasing demands for innovative methods to improve energy efficiency and to prolong the network lifetime. Clustering is considered as an efficient topology control methods in wireless sensor networks, which can increase network scalability and lifetime. This paper presents a method, IP2P K-means – Improved P2P K-means, which uses efficient leveling in clustering approach, reduces false labeling and restricts the necessary communication among various sensors, which obviously saves more energy. The proposed method is examined in Network Simulator Ver.2 (NS2 and the preliminary results show that the algorithm works effectively and relatively more precisely.

  5. Efficiency of Picture Description and Storytelling Methods in Language Sampling According to the Mean Length of Utterance Index

    Directory of Open Access Journals (Sweden)

    Salime Jafari

    2012-10-01

    Full Text Available Background and Aim: Due to limitation of standardized tests for Persian-speakers with language disorders, spontaneous language sampling collection is an important part of assessment of languageprotocol. Therefore, selection of a language sampling method, which will provide information of linguistic competence in a short time, is important. Therefore, in this study, we compared the languagesamples elicited with picture description and storytelling methods in order to determine the effectiveness of the two methods.Methods: In this study 30 first-grade elementary school girls were selected with simple sampling. To investigate picture description method, we used two illustrated stories with four pictures. Languagesamples were collected through storytelling by telling a famous children’s story. To determine the effectiveness of these two methods the two indices of duration of sampling and mean length ofutterance (MLU were compared.Results: There was no significant difference between MLU in description and storytelling methods(p>0.05. However, duration of sampling was shorter in the picture description method than the storytelling method (p<0.05.Conclusion: Findings show that, the two methods of picture description and storytelling have the same potential in language sampling. Since, picture description method can provide language samples with the same complexity in a shorter time than storytelling, it can be used as a beneficial method forclinical purposes.

  6. Project-Based Method as an Effective Means of Interdisciplinary Interaction While Teaching a Foreign Language

    Science.gov (United States)

    Bondar, Irina Alekseevna; Kulbakova, Renata Ivanovna; Svintorzhitskaja, Irina Andreevna; Pilat, Larisa Pavlovna; Zavrumov, Zaur Aslanovich

    2016-01-01

    The article explains how to use a project-based method as an effective means of interdisciplinary interaction when teaching a foreign language on the example of The Institute of service, tourism and design (branch) of the North Caucasus Federal University (Pyatigorsk, Stavropol Territory Russia). The article holds the main objectives of the…

  7. Estimating Mean and Variance Through Quantiles : An Experimental Comparison of Different Methods

    NARCIS (Netherlands)

    Moors, J.J.A.; Strijbosch, L.W.G.; van Groenendaal, W.J.H.

    2002-01-01

    If estimates of mean and variance are needed and only experts' opinions are available, the literature agrees that it is wise behaviour to ask only for their (subjective) estimates of quantiles: from these, estimates of the desired parameters are calculated.Quite a number of methods have been

  8. Non-destructive methods and means for quality control of structural products

    International Nuclear Information System (INIS)

    Dmitriev, V.V.

    1989-01-01

    Progressive non-destructive methods (acoustic, magnetic, radiation with liquid penetrants) and means of control of structural product quality, allowing to determine the state of products and structures not only immediately after their production but directly at the erected or reconstructed objects are described

  9. Assessing the accuracy of globe thermometer method in predicting outdoor mean radiant temperature under Malaysia tropical microclimate

    Science.gov (United States)

    Khrit, N. G.; Alghoul, M. A.; Sopian, K.; Lahimer, A. A.; Elayeb, O. K.

    2017-11-01

    Assessing outdoor human thermal comfort and urban climate quality require experimental investigation of microclimatic conditions and their variations in open urban spaces. For this, it is essential to provide quantitative information on air temperature, humidity, wind velocity and mean radiant temperature. These parameters can be quantified directly except mean radiant temperature (Tmrt). The most accurate method to quantify Tmrt is integral radiation measurements (3-D shortwave and long-wave) which require using expensive radiometer instruments. To overcome this limitation the well-known globe thermometer method was suggested to calculate Tmrt. The aim of this study was to assess the possibility of using indoor globe thermometer method in predicting outdoor mean radiant temperature under Malaysia tropical microclimate. Globe thermometer method using small and large sizes of black-painted copper globes (50mm, 150mm) were used to estimate Tmrt and compare it with the reference Tmrt estimated by integral radiation method. The results revealed that the globe thermometer method considerably overestimated Tmrt during the middle of the day and slightly underestimated it in the morning and late evening. The difference between the two methods was obvious when the amount of incoming solar radiation was high. The results also showed that the effect of globe size on the estimated Tmrt is mostly small. Though, the estimated Tmrt by the small globe showed a relatively large amount of scattering caused by rapid changes in radiation and wind speed.

  10. System and Method for Providing Vertical Profile Measurements of Atmospheric Gases

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — A system and method for using an air collection device to collect a continuous air sample as the device descends through the atmosphere are provided. The air...

  11. Interconnection blocks: a method for providing reusable, rapid, multiple, aligned and planar microfluidic interconnections

    DEFF Research Database (Denmark)

    Sabourin, David; Snakenborg, Detlef; Dufva, Hans Martin

    2009-01-01

    In this paper a method is presented for creating 'interconnection blocks' that are re-usable and provide multiple, aligned and planar microfluidic interconnections. Interconnection blocks made from polydimethylsiloxane allow rapid testing of microfluidic chips and unobstructed microfluidic observ...

  12. Aircrew Exposure To Cosmic Radiation Evaluated By Means Of Several Methods; Results Obtained In 2006

    International Nuclear Information System (INIS)

    Ploc, Ondrej; Spurny, Frantisek; Jadrnickova, Iva; Turek, Karel

    2008-01-01

    Routine evaluation of aircraft crew exposure to cosmic radiation in the Czech Republic is performed by means of calculation method. Measurements onboard aircraft work as a control tool of the routine method, as well as a possibility of comparison of results measured by means of several methods. The following methods were used in 2006: (1) mobile dosimetry unit (MDU) type Liulin--a spectrometer of energy deposited in Si-detector; (2) two types of LET spectrometers based on the chemically etched track detectors (TED); (3) two types of thermoluminescent detectors; and (4) two calculation methods. MDU represents currently one of the most reliable equipments for evaluation of the aircraft crew exposure to cosmic radiation. It is an active device which measures total energy depositions (E dep ) in the semiconductor unit, and, after appropriate calibration, is able to give a separate estimation for non-neutron and neutron-like components of H*(10). This contribution consists mostly of results acquired by means of this equipment; measurements with passive detectors and calculations are mentioned because of comparison. Reasonably good agreement of all data sets could be stated

  13. Evaluation of in-core measurements by means of principal components method

    International Nuclear Information System (INIS)

    Makai, M.; Temesvari, E.

    1996-01-01

    Surveillance of a nuclear reactor core comprehends determination of assemblies' three-dimensional (3D) power distribution. Derived from other assemblies' measured values, power of non-measured assembly is calculated for every assembly with the help of principal components method (PCM) which is also presented. The measured values are interpolated for different geometrical coverings of the WWER-440 core. Different procedures have been elaborated and investigated, among them the most successful methods are discussed. Each method offers self consistent means to determine numerical errors of the interpolated values. (author). 13 refs, 7 figs, 2 tabs

  14. The log mean heat transfer rate method of heat exchanger considering the influence of heat radiation

    International Nuclear Information System (INIS)

    Wong, K.-L.; Ke, M.-T.; Ku, S.-S.

    2009-01-01

    The log mean temperature difference (LMTD) method is conventionally used to calculate the total heat transfer rate of heat exchangers. Because the heat radiation equation contains the 4th order exponential of temperature which is very complicate in calculations, thus LMTD method neglects the influence of heat radiation. From the recent investigation of a circular duct in some practical situations, it is found that even in the situation of the temperature difference between outer duct surface and surrounding is low to 1 deg. C, the heat radiation effect can not be ignored in the situations of lower ambient convective heat coefficient and greater surface emissivities. In this investigation, the log mean heat transfer rate (LMHTR) method which considering the influence of heat radiation, is developed to calculate the total heat transfer rate of heat exchangers.

  15. A DIRECT METHOD TO DETERMINE THE PARALLEL MEAN FREE PATH OF SOLAR ENERGETIC PARTICLES WITH ADIABATIC FOCUSING

    International Nuclear Information System (INIS)

    He, H.-Q.; Wan, W.

    2012-01-01

    The parallel mean free path of solar energetic particles (SEPs), which is determined by physical properties of SEPs as well as those of solar wind, is a very important parameter in space physics to study the transport of charged energetic particles in the heliosphere, especially for space weather forecasting. In space weather practice, it is necessary to find a quick approach to obtain the parallel mean free path of SEPs for a solar event. In addition, the adiabatic focusing effect caused by a spatially varying mean magnetic field in the solar system is important to the transport processes of SEPs. Recently, Shalchi presented an analytical description of the parallel diffusion coefficient with adiabatic focusing. Based on Shalchi's results, in this paper we provide a direct analytical formula as a function of parameters concerning the physical properties of SEPs and solar wind to directly and quickly determine the parallel mean free path of SEPs with adiabatic focusing. Since all of the quantities in the analytical formula can be directly observed by spacecraft, this direct method would be a very useful tool in space weather research. As applications of the direct method, we investigate the inherent relations between the parallel mean free path and various parameters concerning physical properties of SEPs and solar wind. Comparisons of parallel mean free paths with and without adiabatic focusing are also presented.

  16. Four-dimensional cone beam CT reconstruction and enhancement using a temporal nonlocal means method

    Energy Technology Data Exchange (ETDEWEB)

    Jia Xun; Tian Zhen; Lou Yifei; Sonke, Jan-Jakob; Jiang, Steve B. [Center for Advanced Radiotherapy Technologies and Department of Radiation Medicine and Applied Sciences, University of California San Diego, La Jolla, California 92037 (United States); School of Electrical and Computer Engineering, Georgia Institute of Technology, Atlanta, Georgia 30318 (United States); Department of Radiation Oncology, Netherlands Cancer Institute-Antoni van Leeuwenhoek Hospital, Plesmanlaan 121, 1066 CX Amsterdam (Netherlands); Center for Advanced Radiotherapy Technologies and Department of Radiation Medicine and Applied Sciences, University of California San Diego, La Jolla, California 92037 (United States)

    2012-09-15

    Purpose: Four-dimensional cone beam computed tomography (4D-CBCT) has been developed to provide respiratory phase-resolved volumetric imaging in image guided radiation therapy. Conventionally, it is reconstructed by first sorting the x-ray projections into multiple respiratory phase bins according to a breathing signal extracted either from the projection images or some external surrogates, and then reconstructing a 3D CBCT image in each phase bin independently using FDK algorithm. This method requires adequate number of projections for each phase, which can be achieved using a low gantry rotation or multiple gantry rotations. Inadequate number of projections in each phase bin results in low quality 4D-CBCT images with obvious streaking artifacts. 4D-CBCT images at different breathing phases share a lot of redundant information, because they represent the same anatomy captured at slightly different temporal points. Taking this redundancy along the temporal dimension into account can in principle facilitate the reconstruction in the situation of inadequate number of projection images. In this work, the authors propose two novel 4D-CBCT algorithms: an iterative reconstruction algorithm and an enhancement algorithm, utilizing a temporal nonlocal means (TNLM) method. Methods: The authors define a TNLM energy term for a given set of 4D-CBCT images. Minimization of this term favors those 4D-CBCT images such that any anatomical features at one spatial point at one phase can be found in a nearby spatial point at neighboring phases. 4D-CBCT reconstruction is achieved by minimizing a total energy containing a data fidelity term and the TNLM energy term. As for the image enhancement, 4D-CBCT images generated by the FDK algorithm are enhanced by minimizing the TNLM function while keeping the enhanced images close to the FDK results. A forward-backward splitting algorithm and a Gauss-Jacobi iteration method are employed to solve the problems. The algorithms implementation on

  17. Systems and methods for providing power to a load based upon a control strategy

    Science.gov (United States)

    Perisic, Milun; Kajouke, Lateef A; Ransom, Ray M

    2013-12-24

    Systems and methods are provided for an electrical system. The electrical system includes a load, an interface configured to receive a voltage from a voltage source, and a controller configured to receive the voltage from the voltage source through the interface and to provide a voltage and current to the load. Wherein, when the controller is in a constant voltage mode, the controller provides a constant voltage to the load, when the controller is in a constant current mode, the controller provides a constant current to the load, and when the controller is in a constant power mode, the controller provides a constant power to the load.

  18. Method and Apparatus Providing Deception and/or Altered Operation in an Information System Operating System

    Science.gov (United States)

    Cohen, Fred; Rogers, Deanna T.; Neagoe, Vicentiu

    2008-10-14

    A method and/or system and/or apparatus providing deception and/or execution alteration in an information system. In specific embodiments, deceptions and/or protections are provided by intercepting and/or modifying operation of one or more system calls of an operating system.

  19. Provider Payment Trends and Methods in the Massachusetts Health Care System

    OpenAIRE

    Allison Barrett; Timothy Lake

    2010-01-01

    This report investigates provider payment methods in Massachusetts. Payments include fee-for-service, the predominant model; global payments, which pay providers a single fee for all or most required services during a contract period; and pay-for-performance models, which layer quality incentives onto payments.

  20. 47 CFR 51.329 - Notice of network changes: Methods for providing notice.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 3 2010-10-01 2010-10-01 false Notice of network changes: Methods for providing notice. 51.329 Section 51.329 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED...) Filing a public notice with the Commission; or (2) Providing public notice through industry fora...

  1. Finite-State Mean-Field Games, Crowd Motion Problems, and its Numerical Methods

    KAUST Repository

    Machado Velho, Roberto

    2017-09-10

    In this dissertation, we present two research projects, namely finite-state mean-field games and the Hughes model for the motion of crowds. In the first part, we describe finite-state mean-field games and some applications to socio-economic sciences. Examples include paradigm shifts in the scientific community and the consumer choice behavior in a free market. The corresponding finite-state mean-field game models are hyperbolic systems of partial differential equations, for which we propose and validate a new numerical method. Next, we consider the dual formulation to two-state mean-field games, and we discuss numerical methods for these problems. We then depict different computational experiments, exhibiting a variety of behaviors, including shock formation, lack of invertibility, and monotonicity loss. We conclude the first part of this dissertation with an investigation of the shock structure for two-state problems. In the second part, we consider a model for the movement of crowds proposed by R. Hughes in [56] and describe a numerical approach to solve it. This model comprises a Fokker-Planck equation coupled with an Eikonal equation with Dirichlet or Neumann data. We first establish a priori estimates for the solutions. Next, we consider radial solutions, and we identify a shock formation mechanism. Subsequently, we illustrate the existence of congestion, the breakdown of the model, and the trend to the equilibrium. We also propose a new numerical method for the solution of Fokker-Planck equations and then to systems of PDEs composed by a Fokker-Planck equation and a potential type equation. Finally, we illustrate the use of the numerical method both to the Hughes model and mean-field games. We also depict cases such as the evacuation of a room and the movement of persons around Kaaba (Saudi Arabia).

  2. Detection of bursts in neuronal spike trains by the mean inter-spike interval method

    Institute of Scientific and Technical Information of China (English)

    Lin Chen; Yong Deng; Weihua Luo; Zhen Wang; Shaoqun Zeng

    2009-01-01

    Bursts are electrical spikes firing with a high frequency, which are the most important property in synaptic plasticity and information processing in the central nervous system. However, bursts are difficult to identify because bursting activities or patterns vary with phys-iological conditions or external stimuli. In this paper, a simple method automatically to detect bursts in spike trains is described. This method auto-adaptively sets a parameter (mean inter-spike interval) according to intrinsic properties of the detected burst spike trains, without any arbitrary choices or any operator judgrnent. When the mean value of several successive inter-spike intervals is not larger than the parameter, a burst is identified. By this method, bursts can be automatically extracted from different bursting patterns of cultured neurons on multi-electrode arrays, as accurately as by visual inspection. Furthermore, significant changes of burst variables caused by electrical stimulus have been found in spontaneous activity of neuronal network. These suggest that the mean inter-spike interval method is robust for detecting changes in burst patterns and characteristics induced by environmental alterations.

  3. Method for determination of the mean fraction of glandular tissue in individual female breasts using mammography

    International Nuclear Information System (INIS)

    Jansen, J T M; Veldkamp, W J H; Thijssen, M A O; Woudenberg, S van; Zoetelief, J

    2005-01-01

    The nationwide breast cancer screening programme using mammography has been in full operation in the Netherlands since 1997. Quality control of the screening programme has been assigned to the National Expert and Training Centre for Breast Cancer Screening. Limits are set to the mean glandular dose and the centre monitors these for all facilities engaged in the screening programme. This procedure is restricted to the determination of the entrance dose on a 5 cm thick polymethylmethacrylate (PMMA) phantom. The mean glandular dose for a compressed breast is estimated from these data. Individual breasts may deviate largely from this 5 cm PMMA breast model. Not only may the compressed breast size vary from 2 to 10 cm, but breast composition varies also. The mean glandular dose is dependent on the fraction of glandular tissue (glandularity) of the breast. To estimate the risk related to individual mammograms requires the development of a method for determination of the glandularity of individual breasts. A method has been developed to derive the glandularity using the attenuation of mammography x-rays in the breast. The method was applied to a series of mammograms at a screening unit. The results, i.e., a glandularity of 93% within the range of 0 to 1, were comparable with data in the literature. The glandularity as a function of compressed breast thickness is similar to results from other investigators using differing methods

  4. AN EFFICIENT INITIALIZATION METHOD FOR K-MEANS CLUSTERING OF HYPERSPECTRAL DATA

    Directory of Open Access Journals (Sweden)

    A. Alizade Naeini

    2014-10-01

    Full Text Available K-means is definitely the most frequently used partitional clustering algorithm in the remote sensing community. Unfortunately due to its gradient decent nature, this algorithm is highly sensitive to the initial placement of cluster centers. This problem deteriorates for the high-dimensional data such as hyperspectral remotely sensed imagery. To tackle this problem, in this paper, the spectral signatures of the endmembers in the image scene are extracted and used as the initial positions of the cluster centers. For this purpose, in the first step, A Neyman–Pearson detection theory based eigen-thresholding method (i.e., the HFC method has been employed to estimate the number of endmembers in the image. Afterwards, the spectral signatures of the endmembers are obtained using the Minimum Volume Enclosing Simplex (MVES algorithm. Eventually, these spectral signatures are used to initialize the k-means clustering algorithm. The proposed method is implemented on a hyperspectral dataset acquired by ROSIS sensor with 103 spectral bands over the Pavia University campus, Italy. For comparative evaluation, two other commonly used initialization methods (i.e., Bradley & Fayyad (BF and Random methods are implemented and compared. The confusion matrix, overall accuracy and Kappa coefficient are employed to assess the methods’ performance. The evaluations demonstrate that the proposed solution outperforms the other initialization methods and can be applied for unsupervised classification of hyperspectral imagery for landcover mapping.

  5. An interpretive phenomenological method for illuminating the meaning of caring relationship.

    Science.gov (United States)

    Berg, Linda; Skott, Carola; Danielson, Ella

    2006-03-01

    This study is a part of a larger project in which the aim is to illuminate the meaning of the caring relationship between patients and nurses in daily nursing practice. Empirical studies in this area inspired from the interpretive phenomenological method are not commonly used. The aim of this paper is to describe how an interpretive phenomenological method was used to illuminate the meaning of the phenomenon caring relationship in daily nursing practice. Data were collected during 16 nursing care proceedings using participant observation with field notes, and in addition to that two interviews, one patient and one nurse. The interpretation moved back and forth between the whole and the parts in a dialectic process. Initial interpretive understanding of interviews and field notes, meaning units and comprehensive understanding were presented. Themes from the patient's interviews were competence, lack of continuity, strain and vulnerability. Themes from the nurse's interviews were competence and striving. Themes from the field notes were interactions towards a goal. The use of interpretive phenomenology offered an opportunity for learning to understand the meaning of the phenomenon caring relationship in daily nursing practice with both strengths and limitations. This study gave an understanding of the phenomenon through the illumination of the patient's and the nurse's thoughts, feelings and actions in the nursing care proceedings that led to a more profound knowledge about how they together create an encounter through their unique competence.

  6. An improved K-means clustering method for cDNA microarray image segmentation.

    Science.gov (United States)

    Wang, T N; Li, T J; Shao, G F; Wu, S X

    2015-07-14

    Microarray technology is a powerful tool for human genetic research and other biomedical applications. Numerous improvements to the standard K-means algorithm have been carried out to complete the image segmentation step. However, most of the previous studies classify the image into two clusters. In this paper, we propose a novel K-means algorithm, which first classifies the image into three clusters, and then one of the three clusters is divided as the background region and the other two clusters, as the foreground region. The proposed method was evaluated on six different data sets. The analyses of accuracy, efficiency, expression values, special gene spots, and noise images demonstrate the effectiveness of our method in improving the segmentation quality.

  7. Contemporary methods and means of monitoring for Karabach region's forest ecosystems

    International Nuclear Information System (INIS)

    Aliyev, N.R.; Abdurahmanova, I.G.; Askerov, R.A.

    2010-01-01

    Full Text: In the article is analyzed the changing of a condition in the Karabach regions forests. The negative influence to region as well as in other regions of Azerbaijan of a mass cutting down of forests because of need for energy and wood industry, life conditions and also the results of military operations were lighted. The effective methods of reception of the operative information on an ecological condition of wood ecological systems on the basis of modern technical means are offered

  8. Integration of Lax and Zakharov-Schabat equations by means of algebraic geometry's methods

    International Nuclear Information System (INIS)

    Gozman, N.Ja.; Latyshev, A.V.; Savostjanov, M.V.; Lebedev, D.R.

    1982-01-01

    The solutions of nonlinear partial differential equations of Lax and Zakharov-Schabat types are obtained with the help of algebro-geometric method. The Krichever-Drinfeld bimodule for rational curve with cusp point is constructed. It is noted that rational solutions of Zakharov-Schabat equations can be found by means of constructed bimodule in the case of rank 1 only. The evolution of the poles of these solutions is investigated

  9. Monotone numerical methods for finite-state mean-field games

    KAUST Repository

    Gomes, Diogo A.; Saude, Joao

    2017-01-01

    Here, we develop numerical methods for finite-state mean-field games (MFGs) that satisfy a monotonicity condition. MFGs are determined by a system of differential equations with initial and terminal boundary conditions. These non-standard conditions are the main difficulty in the numerical approximation of solutions. Using the monotonicity condition, we build a flow that is a contraction and whose fixed points solve the MFG, both for stationary and time-dependent problems. We illustrate our methods in a MFG modeling the paradigm-shift problem.

  10. Monotone numerical methods for finite-state mean-field games

    KAUST Repository

    Gomes, Diogo A.

    2017-04-29

    Here, we develop numerical methods for finite-state mean-field games (MFGs) that satisfy a monotonicity condition. MFGs are determined by a system of differential equations with initial and terminal boundary conditions. These non-standard conditions are the main difficulty in the numerical approximation of solutions. Using the monotonicity condition, we build a flow that is a contraction and whose fixed points solve the MFG, both for stationary and time-dependent problems. We illustrate our methods in a MFG modeling the paradigm-shift problem.

  11. Performance Analysis of a Maximum Power Point Tracking Technique using Silver Mean Method

    Directory of Open Access Journals (Sweden)

    Shobha Rani Depuru

    2018-01-01

    Full Text Available The proposed paper presents a simple and particularly efficacious Maximum Power Point Tracking (MPPT algorithm based on Silver Mean Method (SMM. This method operates by choosing a search interval from the P-V characteristics of the given solar array and converges to MPP of the Solar Photo-Voltaic (SPV system by shrinking its interval. After achieving the maximum power, the algorithm stops shrinking and maintains constant voltage until the next interval is decided. The tracking capability efficiency and performance analysis of the proposed algorithm are validated by the simulation and experimental results with a 100W solar panel for variable temperature and irradiance conditions. The results obtained confirm that even without any perturbation and observation process, the proposed method still outperforms the traditional perturb and observe (P&O method by demonstrating far better steady state output, more accuracy and higher efficiency.

  12. An image segmentation method based on fuzzy C-means clustering and Cuckoo search algorithm

    Science.gov (United States)

    Wang, Mingwei; Wan, Youchuan; Gao, Xianjun; Ye, Zhiwei; Chen, Maolin

    2018-04-01

    Image segmentation is a significant step in image analysis and machine vision. Many approaches have been presented in this topic; among them, fuzzy C-means (FCM) clustering is one of the most widely used methods for its high efficiency and ambiguity of images. However, the success of FCM could not be guaranteed because it easily traps into local optimal solution. Cuckoo search (CS) is a novel evolutionary algorithm, which has been tested on some optimization problems and proved to be high-efficiency. Therefore, a new segmentation technique using FCM and blending of CS algorithm is put forward in the paper. Further, the proposed method has been measured on several images and compared with other existing FCM techniques such as genetic algorithm (GA) based FCM and particle swarm optimization (PSO) based FCM in terms of fitness value. Experimental results indicate that the proposed method is robust, adaptive and exhibits the better performance than other methods involved in the paper.

  13. Spiking cortical model based non-local means method for despeckling multiframe optical coherence tomography data

    Science.gov (United States)

    Gu, Yameng; Zhang, Xuming

    2017-05-01

    Optical coherence tomography (OCT) images are severely degraded by speckle noise. Existing methods for despeckling multiframe OCT data cannot deliver sufficient speckle suppression while preserving image details well. To address this problem, the spiking cortical model (SCM) based non-local means (NLM) method has been proposed in this letter. In the proposed method, the considered frame and two neighboring frames are input into three SCMs to generate the temporal series of pulse outputs. The normalized moment of inertia (NMI) of the considered patches in the pulse outputs is extracted to represent the rotational and scaling invariant features of the corresponding patches in each frame. The pixel similarity is computed based on the Euclidean distance between the NMI features and used as the weight. Each pixel in the considered frame is restored by the weighted averaging of all pixels in the pre-defined search window in the three frames. Experiments on the real multiframe OCT data of the pig eye demonstrate the advantage of the proposed method over the frame averaging method, the multiscale sparsity based tomographic denoising method, the wavelet-based method and the traditional NLM method in terms of visual inspection and objective metrics such as signal-to-noise ratio (SNR), contrast-to-noise ratio (CNR), equivalent number of looks (ENL) and cross-correlation (XCOR).

  14. Functional connectivity analysis of the neural bases of emotion regulation: A comparison of independent component method with density-based k-means clustering method.

    Science.gov (United States)

    Zou, Ling; Guo, Qian; Xu, Yi; Yang, Biao; Jiao, Zhuqing; Xiang, Jianbo

    2016-04-29

    Functional magnetic resonance imaging (fMRI) is an important tool in neuroscience for assessing connectivity and interactions between distant areas of the brain. To find and characterize the coherent patterns of brain activity as a means of identifying brain systems for the cognitive reappraisal of the emotion task, both density-based k-means clustering and independent component analysis (ICA) methods can be applied to characterize the interactions between brain regions involved in cognitive reappraisal of emotion. Our results reveal that compared with the ICA method, the density-based k-means clustering method provides a higher sensitivity of polymerization. In addition, it is more sensitive to those relatively weak functional connection regions. Thus, the study concludes that in the process of receiving emotional stimuli, the relatively obvious activation areas are mainly distributed in the frontal lobe, cingulum and near the hypothalamus. Furthermore, density-based k-means clustering method creates a more reliable method for follow-up studies of brain functional connectivity.

  15. Interconnection blocks: a method for providing reusable, rapid, multiple, aligned and planar microfluidic interconnections

    International Nuclear Information System (INIS)

    Sabourin, D; Snakenborg, D; Dufva, M

    2009-01-01

    In this paper a method is presented for creating 'interconnection blocks' that are re-usable and provide multiple, aligned and planar microfluidic interconnections. Interconnection blocks made from polydimethylsiloxane allow rapid testing of microfluidic chips and unobstructed microfluidic observation. The interconnection block method is scalable, flexible and supports high interconnection density. The average pressure limit of the interconnection block was near 5.5 bar and all individual results were well above the 2 bar threshold considered applicable to most microfluidic applications

  16. Configurable memory system and method for providing atomic counting operations in a memory device

    Science.gov (United States)

    Bellofatto, Ralph E.; Gara, Alan G.; Giampapa, Mark E.; Ohmacht, Martin

    2010-09-14

    A memory system and method for providing atomic memory-based counter operations to operating systems and applications that make most efficient use of counter-backing memory and virtual and physical address space, while simplifying operating system memory management, and enabling the counter-backing memory to be used for purposes other than counter-backing storage when desired. The encoding and address decoding enabled by the invention provides all this functionality through a combination of software and hardware.

  17. Method of immobilizing weapons plutonium to provide a durable, disposable waste product

    Science.gov (United States)

    Ewing, Rodney C.; Lutze, Werner; Weber, William J.

    1996-01-01

    A method of atomic scale fixation and immobilization of plutonium to provide a durable waste product. Plutonium is provided in the form of either PuO.sub.2 or Pu(NO.sub.3).sub.4 and is mixed with and SiO.sub.2. The resulting mixture is cold pressed and then heated under pressure to form (Zr,Pu)SiO.sub.4 as the waste product.

  18. Cloud Service Provider Methods for Managing Insider Threats: Analysis Phase 1

    Science.gov (United States)

    2013-11-01

    of Standards and Technology (NIST) Special Publication 800-145 (NIST SP 800-145) defines three types of cloud services : Software as a Service ( SaaS ...among these three models. NIST SP 800-145 describes the three service models as follows: SaaS —The capability provided to the consumer is to use the...Cloud Service Provider Methods for Managing Insider Threats: Analysis Phase I Greg Porter November 2013 TECHNICAL NOTE CMU/SEI-2013-TN-020

  19. A Novel Method to Predict Genomic Islands Based on Mean Shift Clustering Algorithm.

    Directory of Open Access Journals (Sweden)

    Daniel M de Brito

    Full Text Available Genomic Islands (GIs are regions of bacterial genomes that are acquired from other organisms by the phenomenon of horizontal transfer. These regions are often responsible for many important acquired adaptations of the bacteria, with great impact on their evolution and behavior. Nevertheless, these adaptations are usually associated with pathogenicity, antibiotic resistance, degradation and metabolism. Identification of such regions is of medical and industrial interest. For this reason, different approaches for genomic islands prediction have been proposed. However, none of them are capable of predicting precisely the complete repertory of GIs in a genome. The difficulties arise due to the changes in performance of different algorithms in the face of the variety of nucleotide distribution in different species. In this paper, we present a novel method to predict GIs that is built upon mean shift clustering algorithm. It does not require any information regarding the number of clusters, and the bandwidth parameter is automatically calculated based on a heuristic approach. The method was implemented in a new user-friendly tool named MSGIP--Mean Shift Genomic Island Predictor. Genomes of bacteria with GIs discussed in other papers were used to evaluate the proposed method. The application of this tool revealed the same GIs predicted by other methods and also different novel unpredicted islands. A detailed investigation of the different features related to typical GI elements inserted in these new regions confirmed its effectiveness. Stand-alone and user-friendly versions for this new methodology are available at http://msgip.integrativebioinformatics.me.

  20. A diabetic retinopathy detection method using an improved pillar K-means algorithm.

    Science.gov (United States)

    Gogula, Susmitha Valli; Divakar, Ch; Satyanarayana, Ch; Rao, Allam Appa

    2014-01-01

    The paper presents a new approach for medical image segmentation. Exudates are a visible sign of diabetic retinopathy that is the major reason of vision loss in patients with diabetes. If the exudates extend into the macular area, blindness may occur. Automated detection of exudates will assist ophthalmologists in early diagnosis. This segmentation process includes a new mechanism for clustering the elements of high-resolution images in order to improve precision and reduce computation time. The system applies K-means clustering to the image segmentation after getting optimized by Pillar algorithm; pillars are constructed in such a way that they can withstand the pressure. Improved pillar algorithm can optimize the K-means clustering for image segmentation in aspects of precision and computation time. This evaluates the proposed approach for image segmentation by comparing with Kmeans and Fuzzy C-means in a medical image. Using this method, identification of dark spot in the retina becomes easier and the proposed algorithm is applied on diabetic retinal images of all stages to identify hard and soft exudates, where the existing pillar K-means is more appropriate for brain MRI images. This proposed system help the doctors to identify the problem in the early stage and can suggest a better drug for preventing further retinal damage.

  1. An optimized ensemble local mean decomposition method for fault detection of mechanical components

    International Nuclear Information System (INIS)

    Zhang, Chao; Chen, Shuai; Wang, Jianguo; Li, Zhixiong; Hu, Chao; Zhang, Xiaogang

    2017-01-01

    Mechanical transmission systems have been widely adopted in most of industrial applications, and issues related to the maintenance of these systems have attracted considerable attention in the past few decades. The recently developed ensemble local mean decomposition (ELMD) method shows satisfactory performance in fault detection of mechanical components for preventing catastrophic failures and reducing maintenance costs. However, the performance of ELMD often heavily depends on proper selection of its model parameters. To this end, this paper proposes an optimized ensemble local mean decomposition (OELMD) method to determinate an optimum set of ELMD parameters for vibration signal analysis. In OELMD, an error index termed the relative root-mean-square error ( Relative RMSE ) is used to evaluate the decomposition performance of ELMD with a certain amplitude of the added white noise. Once a maximum Relative RMSE , corresponding to an optimal noise amplitude, is determined, OELMD then identifies optimal noise bandwidth and ensemble number based on the Relative RMSE and signal-to-noise ratio (SNR), respectively. Thus, all three critical parameters of ELMD (i.e. noise amplitude and bandwidth, and ensemble number) are optimized by OELMD. The effectiveness of OELMD was evaluated using experimental vibration signals measured from three different mechanical components (i.e. the rolling bearing, gear and diesel engine) under faulty operation conditions. (paper)

  2. An optimized ensemble local mean decomposition method for fault detection of mechanical components

    Science.gov (United States)

    Zhang, Chao; Li, Zhixiong; Hu, Chao; Chen, Shuai; Wang, Jianguo; Zhang, Xiaogang

    2017-03-01

    Mechanical transmission systems have been widely adopted in most of industrial applications, and issues related to the maintenance of these systems have attracted considerable attention in the past few decades. The recently developed ensemble local mean decomposition (ELMD) method shows satisfactory performance in fault detection of mechanical components for preventing catastrophic failures and reducing maintenance costs. However, the performance of ELMD often heavily depends on proper selection of its model parameters. To this end, this paper proposes an optimized ensemble local mean decomposition (OELMD) method to determinate an optimum set of ELMD parameters for vibration signal analysis. In OELMD, an error index termed the relative root-mean-square error (Relative RMSE) is used to evaluate the decomposition performance of ELMD with a certain amplitude of the added white noise. Once a maximum Relative RMSE, corresponding to an optimal noise amplitude, is determined, OELMD then identifies optimal noise bandwidth and ensemble number based on the Relative RMSE and signal-to-noise ratio (SNR), respectively. Thus, all three critical parameters of ELMD (i.e. noise amplitude and bandwidth, and ensemble number) are optimized by OELMD. The effectiveness of OELMD was evaluated using experimental vibration signals measured from three different mechanical components (i.e. the rolling bearing, gear and diesel engine) under faulty operation conditions.

  3. A Control Variate Method for Probabilistic Performance Assessment. Improved Estimates for Mean Performance Quantities of Interest

    Energy Technology Data Exchange (ETDEWEB)

    MacKinnon, Robert J.; Kuhlman, Kristopher L

    2016-05-01

    We present a method of control variates for calculating improved estimates for mean performance quantities of interest, E(PQI) , computed from Monte Carlo probabilistic simulations. An example of a PQI is the concentration of a contaminant at a particular location in a problem domain computed from simulations of transport in porous media. To simplify the presentation, the method is described in the setting of a one- dimensional elliptical model problem involving a single uncertain parameter represented by a probability distribution. The approach can be easily implemented for more complex problems involving multiple uncertain parameters and in particular for application to probabilistic performance assessment of deep geologic nuclear waste repository systems. Numerical results indicate the method can produce estimates of E(PQI)having superior accuracy on coarser meshes and reduce the required number of simulations needed to achieve an acceptable estimate.

  4. Mean Field Type Control with Congestion (II): An Augmented Lagrangian Method

    Energy Technology Data Exchange (ETDEWEB)

    Achdou, Yves, E-mail: achdou@ljll.univ-paris-diderot.fr; Laurière, Mathieu [Univ. Paris Diderot, Sorbonne Paris Cité, Laboratoire Jacques-Louis Lions, UMR 7598, UPMC, CNRS (France)

    2016-12-15

    This work deals with a numerical method for solving a mean-field type control problem with congestion. It is the continuation of an article by the same authors, in which suitably defined weak solutions of the system of partial differential equations arising from the model were discussed and existence and uniqueness were proved. Here, the focus is put on numerical methods: a monotone finite difference scheme is proposed and shown to have a variational interpretation. Then an Alternating Direction Method of Multipliers for solving the variational problem is addressed. It is based on an augmented Lagrangian. Two kinds of boundary conditions are considered: periodic conditions and more realistic boundary conditions associated to state constrained problems. Various test cases and numerical results are presented.

  5. On some methods to produce high-energy polarized electron beams by means of proton synchrotrons

    International Nuclear Information System (INIS)

    Bessonov, E.G.; Vazdik, Ya.A.

    1980-01-01

    Some methods of production of high-energy polarized electron beams by means of proton synchrotrons are considered. These methods are based on transfer by protons of a part of their energy to the polarized electrons of a thin target placed inside the working volume of the synchrotron. It is suggested to use as a polarized electron target a magnetized crystalline iron in which proton channeling is realized, polarized atomic beams and the polarized plasma. It is shown that by this method one can produce polarized electron beams with energy approximately 100 GeV, energy spread +- 5 % and intensity approximately 10 7 electron/c, polarization approximately 30% and with intensity approximately 10 4 -10 5 electron/c, polarization approximately 100% [ru

  6. Variance-to-mean method generalized by linear difference filter technique

    International Nuclear Information System (INIS)

    Hashimoto, Kengo; Ohsaki, Hiroshi; Horiguchi, Tetsuo; Yamane, Yoshihiro; Shiroya, Seiji

    1998-01-01

    The conventional variance-to-mean method (Feynman-α method) seriously suffers the divergency of the variance under such a transient condition as a reactor power drift. Strictly speaking, then, the use of the Feynman-α is restricted to a steady state. To apply the method to more practical uses, it is desirable to overcome this kind of difficulty. For this purpose, we propose an usage of higher-order difference filter technique to reduce the effect of the reactor power drift, and derive several new formulae taking account of the filtering. The capability of the formulae proposed was demonstrated through experiments in the Kyoto University Critical Assembly. The experimental results indicate that the divergency of the variance can be effectively suppressed by the filtering technique, and that the higher-order filter becomes necessary with increasing variation rate in power

  7. Testing a statistical method of global mean palotemperature estimations in a long climate simulation

    Energy Technology Data Exchange (ETDEWEB)

    Zorita, E.; Gonzalez-Rouco, F. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Hydrophysik

    2001-07-01

    Current statistical methods of reconstructing the climate of the last centuries are based on statistical models linking climate observations (temperature, sea-level-pressure) and proxy-climate data (tree-ring chronologies, ice-cores isotope concentrations, varved sediments, etc.). These models are calibrated in the instrumental period, and the longer time series of proxy data are then used to estimate the past evolution of the climate variables. Using such methods the global mean temperature of the last 600 years has been recently estimated. In this work this method of reconstruction is tested using data from a very long simulation with a climate model. This testing allows to estimate the errors of the estimations as a function of the number of proxy data and the time scale at which the estimations are probably reliable. (orig.)

  8. Advances in dynamic and mean field games theory, applications, and numerical methods

    CERN Document Server

    Viscolani, Bruno

    2017-01-01

    This contributed volume considers recent advances in dynamic games and their applications, based on presentations given at the 17th Symposium of the International Society of Dynamic Games, held July 12-15, 2016, in Urbino, Italy. Written by experts in their respective disciplines, these papers cover various aspects of dynamic game theory including mean-field games, stochastic and pursuit-evasion games, and computational methods for dynamic games. Topics covered include Pedestrian flow in crowded environments Models for climate change negotiations Nash Equilibria for dynamic games involving Volterra integral equations Differential games in healthcare markets Linear-quadratic Gaussian dynamic games Aircraft control in wind shear conditions Advances in Dynamic and Mean-Field Games presents state-of-the-art research in a wide spectrum of areas. As such, it serves as a testament to the continued vitality and growth of the field of dynamic games and their applications. It will be of interest to an interdisciplinar...

  9. A novel intrusion detection method based on OCSVM and K-means recursive clustering

    Directory of Open Access Journals (Sweden)

    Leandros A. Maglaras

    2015-01-01

    Full Text Available In this paper we present an intrusion detection module capable of detecting malicious network traffic in a SCADA (Supervisory Control and Data Acquisition system, based on the combination of One-Class Support Vector Machine (OCSVM with RBF kernel and recursive k-means clustering. Important parameters of OCSVM, such as Gaussian width o and parameter v affect the performance of the classifier. Tuning of these parameters is of great importance in order to avoid false positives and over fitting. The combination of OCSVM with recursive k- means clustering leads the proposed intrusion detection module to distinguish real alarms from possible attacks regardless of the values of parameters o and v, making it ideal for real-time intrusion detection mechanisms for SCADA systems. Extensive simulations have been conducted with datasets extracted from small and medium sized HTB SCADA testbeds, in order to compare the accuracy, false alarm rate and execution time against the base line OCSVM method.

  10. Mean transit time image - a new method of analyzing brain perfusion studies

    Energy Technology Data Exchange (ETDEWEB)

    Szabo, Z.; Ritzl, F.

    1983-05-01

    Point-by-point calculation of the mean transit time based on gamma fit was used to analyze brain perfusion studies in a vertex view. The algorithm and preliminary results in normal brain and in different stages of cerebral perfusion abnormality (ischemia, stroke, migraine, tumor, abscess) are demonstrated. In contrast to the traditional methods using fixed, a priori defined regions of interest this type of mapping of the relative regions cerebral perfusion shows more clearly the irregular outlines of the disturbance. Right to left activity ratios in the arterial part of the time-activity curves showed significant correlation with the mean transit time ratios (Q/sub 1/=1.185-0.192 Qsub(a), n=38, r=0.716, P<0.001).

  11. A New Soft Computing Method for K-Harmonic Means Clustering.

    Science.gov (United States)

    Yeh, Wei-Chang; Jiang, Yunzhi; Chen, Yee-Fen; Chen, Zhe

    2016-01-01

    The K-harmonic means clustering algorithm (KHM) is a new clustering method used to group data such that the sum of the harmonic averages of the distances between each entity and all cluster centroids is minimized. Because it is less sensitive to initialization than K-means (KM), many researchers have recently been attracted to studying KHM. In this study, the proposed iSSO-KHM is based on an improved simplified swarm optimization (iSSO) and integrates a variable neighborhood search (VNS) for KHM clustering. As evidence of the utility of the proposed iSSO-KHM, we present extensive computational results on eight benchmark problems. From the computational results, the comparison appears to support the superiority of the proposed iSSO-KHM over previously developed algorithms for all experiments in the literature.

  12. Decision Making in Uncertain Rural Scenarios by means of Fuzzy TOPSIS Method

    Directory of Open Access Journals (Sweden)

    Eva Armero

    2011-01-01

    Full Text Available A great deal of uncertain information which is difficult to quantify is taken into account by farmers and experts in the enterprise when making decisions. We are interested in the problems of the implementation of a rabbit-breeding farm. One of the first decisions to be taken refers to the design or type of structure for housing the animals, which is determined by the level of environmental control sought to be maintained in its interior. A farmer was consulted, and his answers were incorporated into the analysis, by means of the fuzzy TOPSIS methodology. The main purpose of this paper is to study the problem by means of the fuzzy TOPSIS method as multicriteria decision making, when the information was given in linguistic terms.

  13. An Assessment of Mean Areal Precipitation Methods on Simulated Stream Flow: A SWAT Model Performance Assessment

    Directory of Open Access Journals (Sweden)

    Sean Zeiger

    2017-06-01

    Full Text Available Accurate mean areal precipitation (MAP estimates are essential input forcings for hydrologic models. However, the selection of the most accurate method to estimate MAP can be daunting because there are numerous methods to choose from (e.g., proximate gauge, direct weighted average, surface-fitting, and remotely sensed methods. Multiple methods (n = 19 were used to estimate MAP with precipitation data from 11 distributed monitoring sites, and 4 remotely sensed data sets. Each method was validated against the hydrologic model simulated stream flow using the Soil and Water Assessment Tool (SWAT. SWAT was validated using a split-site method and the observed stream flow data from five nested-scale gauging sites in a mixed-land-use watershed of the central USA. Cross-validation results showed the error associated with surface-fitting and remotely sensed methods ranging from −4.5 to −5.1%, and −9.8 to −14.7%, respectively. Split-site validation results showed the percent bias (PBIAS values that ranged from −4.5 to −160%. Second order polynomial functions especially overestimated precipitation and subsequent stream flow simulations (PBIAS = −160 in the headwaters. The results indicated that using an inverse-distance weighted, linear polynomial interpolation or multiquadric function method to estimate MAP may improve SWAT model simulations. Collectively, the results highlight the importance of spatially distributed observed hydroclimate data for precipitation and subsequent steam flow estimations. The MAP methods demonstrated in the current work can be used to reduce hydrologic model uncertainty caused by watershed physiographic differences.

  14. A fuzzy inventory model with acceptable shortage using graded mean integration value method

    Science.gov (United States)

    Saranya, R.; Varadarajan, R.

    2018-04-01

    In many inventory models uncertainty is due to fuzziness and fuzziness is the closed possible approach to reality. In this paper, we proposed a fuzzy inventory model with acceptable shortage which is completely backlogged. We fuzzily the carrying cost, backorder cost and ordering cost using Triangular and Trapezoidal fuzzy numbers to obtain the fuzzy total cost. The purpose of our study is to defuzzify the total profit function by Graded Mean Integration Value Method. Further a numerical example is also given to demonstrate the developed crisp and fuzzy models.

  15. Performance analysis of Arithmetic Mean method in determining peak junction temperature of semiconductor device

    Directory of Open Access Journals (Sweden)

    Mohana Sundaram Muthuvalu

    2015-12-01

    Full Text Available High reliability users of microelectronic devices have been derating junction temperature and other critical stress parameters to improve device reliability and extend operating life. The reliability of a semiconductor is determined by junction temperature. This paper gives a useful analysis on mathematical approach which can be implemented to predict temperature of a silicon die. The problem could be modeled as heat conduction equation. In this study, numerical approach based on implicit scheme and Arithmetic Mean (AM iterative method will be applied to solve the governing heat conduction equation. Numerical results are also included in order to assert the effectiveness of the proposed technique.

  16. Means and method for controlling the neutron output of a neutron generator tube

    International Nuclear Information System (INIS)

    1977-01-01

    A means and method for energizing and regulating a neutron generator tube is described. It has a target, an ion source and a replenisher. A negative high voltage is applied to the target and the target current monitored. A constant current from a constant current source is divided into a shunt current and a replenisher current in accordance with the target current. The replenisher current is applied to the replenisher in a neutron generator tube so as to control the neutron output in accordance with the target current. (C.F.)

  17. Method and means of passive detection of leaks in buried pipes

    International Nuclear Information System (INIS)

    Claytor, T.N.

    1981-01-01

    A method and means for passive detection of a leak in a buried pipe containing fluid under pressure includes a plurality of acoustic detectors that are placed in contact with the pipe. Noise produced by the leak is detected by the detectors, and the detected signals are correlated to locate the leak. In one embodiment of the invention two detectors are placed at different locations to locate a leak between them. In an alternate embodiment two detectors of different waves are placed at substantially the same location to determine the distance of the leak from the location

  18. Connecting the dots and merging meaning: using mixed methods to study primary care delivery transformation.

    Science.gov (United States)

    Scammon, Debra L; Tomoaia-Cotisel, Andrada; Day, Rachel L; Day, Julie; Kim, Jaewhan; Waitzman, Norman J; Farrell, Timothy W; Magill, Michael K

    2013-12-01

    To demonstrate the value of mixed methods in the study of practice transformation and illustrate procedures for connecting methods and for merging findings to enhance the meaning derived. An integrated network of university-owned, primary care practices at the University of Utah (Community Clinics or CCs). CC has adopted Care by Design, its version of the Patient Centered Medical Home. Convergent case study mixed methods design. Analysis of archival documents, internal operational reports, in-clinic observations, chart audits, surveys, semistructured interviews, focus groups, Centers for Medicare and Medicaid Services database, and the Utah All Payer Claims Database. Each data source enriched our understanding of the change process and understanding of reasons that certain changes were more difficult than others both in general and for particular clinics. Mixed methods enabled generation and testing of hypotheses about change and led to a comprehensive understanding of practice change. Mixed methods are useful in studying practice transformation. Challenges exist but can be overcome with careful planning and persistence. © Health Research and Educational Trust.

  19. Study of confined many electron atoms by means of the POEP method

    International Nuclear Information System (INIS)

    Sarsa, A; Buendía, E; Gálvez, F J

    2014-01-01

    The electronic structure of confined atoms under impenetrable spherical walls is studied by means of the parameterized optimized effective potential method. A cut-off factor is employed to account for Dirichlet boundary conditions. Two atomic basis sets commonly used for describing free atoms have been analyzed within this scheme. The accuracy of the method is similar to that achieved for the free atoms. The ground state electrostatic multiplet of the carbon atom as well as the ground state and both the [Ar]4s3d 7 5 F and [Ar]3d 8 3 F excited states of the iron atom are studied. The behaviour of the energy levels with the confinement has been analyzed in terms of the different contributions to the total energy of the atom. For the iron atom, the effect of confinement on the outermost orbitals is studied. (paper)

  20. [Means and methods of personal hygiene in the experiment with 520-day isolation].

    Science.gov (United States)

    Shumilina, G A; Shumilina, I V; Solov'eva, S O

    2013-01-01

    Six volunteers (3 Russians, a Frenchman, an Italian and a Chinese) participated in assessment of the input of sanitation and housekeeping provisions to their wellbeing during 520-day isolation and confinement. Subject of the study was quality and sufficiency of housekeeping agents and procedures as well as more than 60 names of personal hygiene items. The sanitation and housekeeping monitoring involved the clinical, hygienic and microbiological methods, and also consideration of crew comments on the items at their disposal and recommended procedures. Based on the analysis of the functional condition of the integument and oral cavity and entries in the questionnaires, i.e. objective data and subjective feelings, all test subjects remained in the invariably good state. Owing to the application of the selected hygienic means and methods the microbial status of the crew was stable throughout 520-day isolation.

  1. Mean-Variance-CvaR Model of Multiportfolio Optimization via Linear Weighted Sum Method

    Directory of Open Access Journals (Sweden)

    Younes Elahi

    2014-01-01

    Full Text Available We propose a new approach to optimizing portfolios to mean-variance-CVaR (MVC model. Although of several researches have studied the optimal MVC model of portfolio, the linear weighted sum method (LWSM was not implemented in the area. The aim of this paper is to investigate the optimal portfolio model based on MVC via LWSM. With this method, the solution of the MVC model of portfolio as the multiobjective problem is presented. In data analysis section, this approach in investing on two assets is investigated. An MVC model of the multiportfolio was implemented in MATLAB and tested on the presented problem. It is shown that, by using three objective functions, it helps the investors to manage their portfolio better and thereby minimize the risk and maximize the return of the portfolio. The main goal of this study is to modify the current models and simplify it by using LWSM to obtain better results.

  2. Prediction of Human Phenotype Ontology terms by means of hierarchical ensemble methods.

    Science.gov (United States)

    Notaro, Marco; Schubach, Max; Robinson, Peter N; Valentini, Giorgio

    2017-10-12

    The prediction of human gene-abnormal phenotype associations is a fundamental step toward the discovery of novel genes associated with human disorders, especially when no genes are known to be associated with a specific disease. In this context the Human Phenotype Ontology (HPO) provides a standard categorization of the abnormalities associated with human diseases. While the problem of the prediction of gene-disease associations has been widely investigated, the related problem of gene-phenotypic feature (i.e., HPO term) associations has been largely overlooked, even if for most human genes no HPO term associations are known and despite the increasing application of the HPO to relevant medical problems. Moreover most of the methods proposed in literature are not able to capture the hierarchical relationships between HPO terms, thus resulting in inconsistent and relatively inaccurate predictions. We present two hierarchical ensemble methods that we formally prove to provide biologically consistent predictions according to the hierarchical structure of the HPO. The modular structure of the proposed methods, that consists in a "flat" learning first step and a hierarchical combination of the predictions in the second step, allows the predictions of virtually any flat learning method to be enhanced. The experimental results show that hierarchical ensemble methods are able to predict novel associations between genes and abnormal phenotypes with results that are competitive with state-of-the-art algorithms and with a significant reduction of the computational complexity. Hierarchical ensembles are efficient computational methods that guarantee biologically meaningful predictions that obey the true path rule, and can be used as a tool to improve and make consistent the HPO terms predictions starting from virtually any flat learning method. The implementation of the proposed methods is available as an R package from the CRAN repository.

  3. CAMSHIFT IMPROVEMENT WITH MEAN-SHIFT SEGMENTATION, REGION GROWING, AND SURF METHOD

    Directory of Open Access Journals (Sweden)

    Ferdinan Ferdinan

    2013-10-01

    Full Text Available CAMSHIFT algorithm has been widely used in object tracking. CAMSHIFT utilizescolor features as the model object. Thus, original CAMSHIFT may fail when the object color issimilar with the background color. In this study, we propose CAMSHIFT tracker combined withmean-shift segmentation, region growing, and SURF in order to improve the tracking accuracy.The mean-shift segmentation and region growing are applied in object localization phase to extractthe important parts of the object. Hue-distance, saturation, and value are used to calculate theBhattacharyya distance to judge whether the tracked object is lost. Once the object is judged lost,SURF is used to find the lost object, and CAMSHIFT can retrack the object. The Object trackingsystem is built with OpenCV. Some measurements of accuracy have done using frame-basedmetrics. We use datasets BoBoT (Bonn Benchmark on Tracking to measure accuracy of thesystem. The results demonstrate that CAMSHIFT combined with mean-shift segmentation, regiongrowing, and SURF method has higher accuracy than the previous methods.

  4. The effect of skin thermistor fixation method on weighted mean skin temperature

    International Nuclear Information System (INIS)

    Tyler, Christopher James

    2011-01-01

    The purpose of this study was to investigate the effect of three different skin thermistor attachment methods on weighted mean skin temperature (WMT sk ) at three different ambient temperatures (∼24 °C (TEMP); ∼30 °C (WARM); ∼35 °C (HOT)) compared to uncovered thermistors. Eleven, non-acclimated, volunteers completed three 5 min bouts of submaximal cycling (∼70 W mechanical work)—one at each environmental condition in sequential order (TEMP, WARM, HOT). One thermistor was fixed to the sternal notch whilst four skin thermistors were spaced at 3 cm intervals on each of the sites on the limbs as per the formula of Ramanathan (1964 J. Appl. Physiol. 19 531–3). Each thermistor was either held against the skin uncovered (UC) or attached with surgical acrylic film dressing (T); surgical acrylic film dressing and hypoallergenic surgical tape (TT) or surgical acrylic film dressing, hypoallergenic surgical tape and surgical bandage (TTC). The WMT sk calculated was significantly lower in UC compared to T, TT and TTC (p < 0.001, d = 0.46), in T compared to TT and TTC (p < 0.001, d = 0.33) and in TT compared to TTC (p < 0.001; d = 0.25). The mean differences (across the three temperatures) were + 0.27 ±0.34 °C, + 0.52 ± 0.35 °C and + 0.82 ± 0.34 °C for T, TT and TTC, respectively. The results demonstrate that the method of skin thermistor attachment can result in the significant over-estimation of weighted mean skin temperature

  5. Analysis of the material's expenditure of electric contacts by means of the isotopic method

    International Nuclear Information System (INIS)

    Farkash, K.

    1979-01-01

    To investigate lifetime of the weak-current and heavy-current contacts different radioisotopic methods have been developed. Advantages of the radioisotopic methods as compared with other methods of testing consists of the fact that due to their sensitivity they permit to determine low expense of material; permit to determine quantitatively expense of each element separately from the elements, composing the contacts alloy; by means of these methods it is possible to evaluate quantitatively topological distribution of the matter separated from the contacts into the environment; it is possible to determine morphological characteristics of the matter separated from the contact. During investigation of the lifetime of contacts there were determined: value of the expense of the material of contacts; composition of the expense of the material of contacts; composition of the matter separated from the contact; distribution of the separated matter depending on the electrical parameters and number of the closings of contact in the case of different compositions of contacts and in different conditions. Strength of the contacts' alloys related to the electrical load was investigated at the special stand [ru

  6. The method of belief scales as a means for dealing with uncertainty in tough regulatory decisions.

    Energy Technology Data Exchange (ETDEWEB)

    Pilch, Martin M.

    2005-10-01

    Modeling and simulation is playing an increasing role in supporting tough regulatory decisions, which are typically characterized by variabilities and uncertainties in the scenarios, input conditions, failure criteria, model parameters, and even model form. Variability exists when there is a statistically significant database that is fully relevant to the application. Uncertainty, on the other hand, is characterized by some degree of ignorance. A simple algebraic problem was used to illustrate how various risk methodologies address variability and uncertainty in a regulatory context. These traditional risk methodologies include probabilistic methods (including frequensic and Bayesian perspectives) and second-order methods where variabilities and uncertainties are treated separately. Representing uncertainties with (subjective) probability distributions and using probabilistic methods to propagate subjective distributions can lead to results that are not logically consistent with available knowledge and that may not be conservative. The Method of Belief Scales (MBS) is developed as a means to logically aggregate uncertain input information and to propagate that information through the model to a set of results that are scrutable, easily interpretable by the nonexpert, and logically consistent with the available input information. The MBS, particularly in conjunction with sensitivity analyses, has the potential to be more computationally efficient than other risk methodologies. The regulatory language must be tailored to the specific risk methodology if ambiguity and conflict are to be avoided.

  7. Interactive K-Means Clustering Method Based on User Behavior for Different Analysis Target in Medicine.

    Science.gov (United States)

    Lei, Yang; Yu, Dai; Bin, Zhang; Yang, Yang

    2017-01-01

    Clustering algorithm as a basis of data analysis is widely used in analysis systems. However, as for the high dimensions of the data, the clustering algorithm may overlook the business relation between these dimensions especially in the medical fields. As a result, usually the clustering result may not meet the business goals of the users. Then, in the clustering process, if it can combine the knowledge of the users, that is, the doctor's knowledge or the analysis intent, the clustering result can be more satisfied. In this paper, we propose an interactive K -means clustering method to improve the user's satisfactions towards the result. The core of this method is to get the user's feedback of the clustering result, to optimize the clustering result. Then, a particle swarm optimization algorithm is used in the method to optimize the parameters, especially the weight settings in the clustering algorithm to make it reflect the user's business preference as possible. After that, based on the parameter optimization and adjustment, the clustering result can be closer to the user's requirement. Finally, we take an example in the breast cancer, to testify our method. The experiments show the better performance of our algorithm.

  8. DIFFERENTIAL DIAGNOSTICS MODEL RESEARCH BY MEANS OF THE POTENTIAL FUNCTIONS METHOD FOR NEUROLOGY DISEASES CLASSIFICATION

    Directory of Open Access Journals (Sweden)

    V. Z. Stetsyuk

    2016-10-01

    Full Text Available Informatization in medicine offers a lot of opportunities to enhance quality of medical support, accuracy of diagnosis and provides the use of accumulated experience. Modern program systems are utilized now as additional tools to get appropriate advice. This article offers the way to provide help for neurology department doctor of NCSH «OKHMATDYT» during diagnosis determining. It was decided to design the program system for this purpose based on differential diagnostic model. The key problems in differential diagnosis are symptoms similarity between each other in one disease group and the absence of key symptom. Therefore the differential diagnostic model is needed. It is constructed using the potential function method in characteristics space. This characteristics space is formed by 100-200 points - patients with their symptoms. The main feature of this method here is that the decision function is building during recognition step united with learning that became possible with the help of modern powerful computers.

  9. THIRD PARTY LOGISTIC SERVICE PROVIDER SELECTION USING FUZZY AHP AND TOPSIS METHOD

    Directory of Open Access Journals (Sweden)

    Golam Kabir

    2012-03-01

    Full Text Available The use of third party logistic(3PL services providers is increasing globally to accomplish the strategic objectives. In the increasingly competitive environment, logistics strategic management requires systematic and structured approach to have cutting edge over the rival. Logistics service provider selection is a complex multi-criteria decision making process; in which, decision makers have to deals with the optimization of conflicting objectives such as quality, cost, and delivery time. In this paper, fuzzy analytic hierarchy process (FAHP approach based on technique for order preference by similarity to ideal solution (TOPSIS method has been proposed for evaluating and selecting an appropriate logistics service provider, where the ratings of each alternative and importance weight of each criterion are expressed in triangular fuzzy numbers.

  10. A method of providing a barrier in a fracture-containing system

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention relates to a method of providing a barrier in a fracture-containing system, comprising: i) Providing a treatment fluid comprising: a) a base fluid; b) an elastomeric material, wherein said elastomeric material comprises at least one polymer capable of crosslinking into an el......The present invention relates to a method of providing a barrier in a fracture-containing system, comprising: i) Providing a treatment fluid comprising: a) a base fluid; b) an elastomeric material, wherein said elastomeric material comprises at least one polymer capable of crosslinking...... into an elastomer, and c) at least one crosslinking agent; ii) Placing the treatment fluid in a fracture-containing system; iii) Allowing the elastomeric material to crosslink with itself to form a barrier in said fracture-containing system; wherein the elastomeric material and/or the crosslinking agent...... are of neutral buoyancy with regard to the base fluid. The invention is contemplated to having utility not only in the oil-drilling industry but also in the plugging of fractures in sewer drains, pipelines etc....

  11. Mean-Square Convergence of Drift-Implicit One-Step Methods for Neutral Stochastic Delay Differential Equations with Jump Diffusion

    Directory of Open Access Journals (Sweden)

    Lin Hu

    2011-01-01

    Full Text Available A class of drift-implicit one-step schemes are proposed for the neutral stochastic delay differential equations (NSDDEs driven by Poisson processes. A general framework for mean-square convergence of the methods is provided. It is shown that under certain conditions global error estimates for a method can be inferred from estimates on its local error. The applicability of the mean-square convergence theory is illustrated by the stochastic θ-methods and the balanced implicit methods. It is derived from Theorem 3.1 that the order of the mean-square convergence of both of them for NSDDEs with jumps is 1/2. Numerical experiments illustrate the theoretical results. It is worth noting that the results of mean-square convergence of the stochastic θ-methods and the balanced implicit methods are also new.

  12. An Initialization Method Based on Hybrid Distance for k-Means Algorithm.

    Science.gov (United States)

    Yang, Jie; Ma, Yan; Zhang, Xiangfen; Li, Shunbao; Zhang, Yuping

    2017-11-01

    The traditional [Formula: see text]-means algorithm has been widely used as a simple and efficient clustering method. However, the performance of this algorithm is highly dependent on the selection of initial cluster centers. Therefore, the method adopted for choosing initial cluster centers is extremely important. In this letter, we redefine the density of points according to the number of its neighbors, as well as the distance between points and their neighbors. In addition, we define a new distance measure that considers both Euclidean distance and density. Based on that, we propose an algorithm for selecting initial cluster centers that can dynamically adjust the weighting parameter. Furthermore, we propose a new internal clustering validation measure, the clustering validation index based on the neighbors (CVN), which can be exploited to select the optimal result among multiple clustering results. Experimental results show that the proposed algorithm outperforms existing initialization methods on real-world data sets and demonstrates the adaptability of the proposed algorithm to data sets with various characteristics.

  13. Numerical Methods for a Multicomponent Two-Phase Interface Model with Geometric Mean Influence Parameters

    KAUST Repository

    Kou, Jisheng

    2015-07-16

    In this paper, we consider an interface model for multicomponent two-phase fluids with geometric mean influence parameters, which is popularly used to model and predict surface tension in practical applications. For this model, there are two major challenges in theoretical analysis and numerical simulation: the first one is that the influence parameter matrix is not positive definite; the second one is the complicated structure of the energy function, which requires us to find out a physically consistent treatment. To overcome these two challenging problems, we reduce the formulation of the energy function by employing a linear transformation and a weighted molar density, and furthermore, we propose a local minimum grand potential energy condition to establish the relation between the weighted molar density and mixture compositions. From this, we prove the existence of the solution under proper conditions and prove the maximum principle of the weighted molar density. For numerical simulation, we propose a modified Newton\\'s method for solving this nonlinear model and analyze its properties; we also analyze a finite element method with a physical-based adaptive mesh-refinement technique. Numerical examples are tested to verify the theoretical results and the efficiency of the proposed methods.

  14. Numerical Methods for a Multicomponent Two-Phase Interface Model with Geometric Mean Influence Parameters

    KAUST Repository

    Kou, Jisheng; Sun, Shuyu

    2015-01-01

    In this paper, we consider an interface model for multicomponent two-phase fluids with geometric mean influence parameters, which is popularly used to model and predict surface tension in practical applications. For this model, there are two major challenges in theoretical analysis and numerical simulation: the first one is that the influence parameter matrix is not positive definite; the second one is the complicated structure of the energy function, which requires us to find out a physically consistent treatment. To overcome these two challenging problems, we reduce the formulation of the energy function by employing a linear transformation and a weighted molar density, and furthermore, we propose a local minimum grand potential energy condition to establish the relation between the weighted molar density and mixture compositions. From this, we prove the existence of the solution under proper conditions and prove the maximum principle of the weighted molar density. For numerical simulation, we propose a modified Newton's method for solving this nonlinear model and analyze its properties; we also analyze a finite element method with a physical-based adaptive mesh-refinement technique. Numerical examples are tested to verify the theoretical results and the efficiency of the proposed methods.

  15. Methods and means for improving the man-machine systems for NPP control

    International Nuclear Information System (INIS)

    Konstantinov, L.V.; Rakitin, I.D.

    1984-01-01

    Consideration is being given to the role of ''human factors'' and the ways of improving the man-machine interaction in NPP control and safety systems (CSS). Simulators and tAaining equipment on the basis of dynamic power unit models used for training and improving skill of NPP operatoAs, as well as for mastering collective actions of personnel under accidental conditions are considered in detail. The most perfect program complexes for fast NPP diagnostics and theiA pealization in the Federal Republic of Germany, Japan, Canada, the USA and other countries are described. A special attention is paid to the means and methods of videoterminal dialogue operator interaction with an object both in normal and extreme situations. It is noted that the problems of the man-machine interaction have become the subject of study only in the end of 70s after analyzing the causes of the Three-Mile-Island accident (USA). Publications dealing with the development of perspective control rooms for NPP were analyzed. It was concluded that radical changes both in equipment and principles of organizing the personnel activity will take place in the nearest future. They will be based on the progress in creating dialogue means and computers of the fourth and fifth generations as well as on engineering and psychological and technical aspects of designing

  16. Implementation of K-Means Clustering Method for Electronic Learning Model

    Science.gov (United States)

    Latipa Sari, Herlina; Suranti Mrs., Dewi; Natalia Zulita, Leni

    2017-12-01

    Teaching and Learning process at SMK Negeri 2 Bengkulu Tengah has applied e-learning system for teachers and students. The e-learning was based on the classification of normative, productive, and adaptive subjects. SMK Negeri 2 Bengkulu Tengah consisted of 394 students and 60 teachers with 16 subjects. The record of e-learning database was used in this research to observe students’ activity pattern in attending class. K-Means algorithm in this research was used to classify students’ learning activities using e-learning, so that it was obtained cluster of students’ activity and improvement of student’s ability. Implementation of K-Means Clustering method for electronic learning model at SMK Negeri 2 Bengkulu Tengah was conducted by observing 10 students’ activities, namely participation of students in the classroom, submit assignment, view assignment, add discussion, view discussion, add comment, download course materials, view article, view test, and submit test. In the e-learning model, the testing was conducted toward 10 students that yielded 2 clusters of membership data (C1 and C2). Cluster 1: with membership percentage of 70% and it consisted of 6 members, namely 1112438 Anggi Julian, 1112439 Anis Maulita, 1112441 Ardi Febriansyah, 1112452 Berlian Sinurat, 1112460 Dewi Anugrah Anwar and 1112467 Eka Tri Oktavia Sari. Cluster 2:with membership percentage of 30% and it consisted of 4 members, namely 1112463 Dosita Afriyani, 1112471 Erda Novita, 1112474 Eskardi and 1112477 Fachrur Rozi.

  17. The two-wave X-ray field calculated by means of integral-equation methods

    International Nuclear Information System (INIS)

    Bremer, J.

    1984-01-01

    The problem of calculating the two-wave X-ray field on the basis of the Takagi-Taupin equations is discussed for the general case of curved lattice planes. A two-dimensional integral equation which incorporates the nature of the incoming radiation, the form of the crystal/vacuum boundary, and the curvature of the structure, is deduced. Analytical solutions for the symmetrical Laue case with incoming plane waves are obtained directly for perfect crystals by means of iteration. The same method permits a simple derivation of the narrow-wave Laue and Bragg cases. Modulated wave fronts are discussed, and it is shown that a cut-off in the width of an incoming plane wave leads to lateral oscillations which are superimposed on the Pendelloesung fringes. Bragg and Laue shadow fields are obtained. The influence of a non-zero kernel is discussed and a numerical procedure for calculating wave amplitudes in curved crystals is presented. (Auth.)

  18. Algorithm based on regional separation for automatic grain boundary extraction using improved mean shift method

    Science.gov (United States)

    Zhenying, Xu; Jiandong, Zhu; Qi, Zhang; Yamba, Philip

    2018-06-01

    Metallographic microscopy shows that the vast majority of metal materials are composed of many small grains; the grain size of a metal is important for determining the tensile strength, toughness, plasticity, and other mechanical properties. In order to quantitatively evaluate grain size in metals, grain boundaries must be identified in metallographic images. Based on the phenomenon of grain boundary blurring or disconnection in metallographic images, this study develops an algorithm based on regional separation for automatically extracting grain boundaries by an improved mean shift method. Experimental observation shows that the grain boundaries obtained by the proposed algorithm are highly complete and accurate. This research has practical value because the proposed algorithm is suitable for grain boundary extraction from most metallographic images.

  19. A simple and fast method to determine the parameters for fuzzy c-means cluster analysis

    DEFF Research Database (Denmark)

    Schwämmle, Veit; Jensen, Ole Nørregaard

    2010-01-01

    MOTIVATION: Fuzzy c-means clustering is widely used to identify cluster structures in high-dimensional datasets, such as those obtained in DNA microarray and quantitative proteomics experiments. One of its main limitations is the lack of a computationally fast method to set optimal values...... of algorithm parameters. Wrong parameter values may either lead to the inclusion of purely random fluctuations in the results or ignore potentially important data. The optimal solution has parameter values for which the clustering does not yield any results for a purely random dataset but which detects cluster...... formation with maximum resolution on the edge of randomness. RESULTS: Estimation of the optimal parameter values is achieved by evaluation of the results of the clustering procedure applied to randomized datasets. In this case, the optimal value of the fuzzifier follows common rules that depend only...

  20. Elementary methods for statistical systems, mean field, large-n, and duality

    International Nuclear Information System (INIS)

    Itzykson, C.

    1983-01-01

    Renormalizable field theories are singled out by such precise restraints that regularization schemes must be used to break these invariances. Statistical methods can be adapted to these problems where asymptotically free models fail. This lecture surveys approximation schemes developed in the context of statistical mechanics. The confluence point of statistical mechanics and field theory is the use of discretized path integrals, where continuous space time has been replaced by a regular lattice. Dynamic variables, a Boltzman weight factor, and boundary conditions are the ingredients. Mean field approximations --field equations, Random field transform, and gauge invariant systems--are surveyed. Under Large-N limits vector models are found to simplify tremendously. The reasons why matrix models drawn from SU (n) gauge theories do not simplify are discussed. In the epilogue, random curves versus random surfaces are offered as an example where global and local symmetries are not alike

  1. Reliability of an analysis method for measuring diaphragm excursion by means of direct visualization with videofluoroscopy.

    Science.gov (United States)

    Yi, Liu C; Nascimento, Oliver A; Jardim, José R

    2011-06-01

    The purpose of this study was to verify the reproducibility between two different observers of an analysis method for diaphragmatic displacement measurements using direct visualization with videofluoroscopy. 29 mouth breathing children aged 5 to 12 years from both genders were analyzed. The diaphragmatic displacement evaluation was divided in three parts: videofluoroscopy with VHS recording in standing, sitting, and dorsal positions; digitalization of the images; and measurement of the distance between diaphragmatic domes during a breathing cycle using Adobe Photoshop 5.5 and Adobe Premiere PRO 6.5 software. The intraclass correlation coefficients presented excellent reproducibility in all positions, with coefficients always above 0.94. Mean of the measurements of the diaphagramatic domes displacement done by the two observers were similar (Phealthcare professionals. Copyright © 2010 SEPAR. Published by Elsevier Espana. All rights reserved.

  2. Methods for estimating flow-duration and annual mean-flow statistics for ungaged streams in Oklahoma

    Science.gov (United States)

    Esralew, Rachel A.; Smith, S. Jerrod

    2010-01-01

    Flow statistics can be used to provide decision makers with surface-water information needed for activities such as water-supply permitting, flow regulation, and other water rights issues. Flow statistics could be needed at any location along a stream. Most often, streamflow statistics are needed at ungaged sites, where no flow data are available to compute the statistics. Methods are presented in this report for estimating flow-duration and annual mean-flow statistics for ungaged streams in Oklahoma. Flow statistics included the (1) annual (period of record), (2) seasonal (summer-autumn and winter-spring), and (3) 12 monthly duration statistics, including the 20th, 50th, 80th, 90th, and 95th percentile flow exceedances, and the annual mean-flow (mean of daily flows for the period of record). Flow statistics were calculated from daily streamflow information collected from 235 streamflow-gaging stations throughout Oklahoma and areas in adjacent states. A drainage-area ratio method is the preferred method for estimating flow statistics at an ungaged location that is on a stream near a gage. The method generally is reliable only if the drainage-area ratio of the two sites is between 0.5 and 1.5. Regression equations that relate flow statistics to drainage-basin characteristics were developed for the purpose of estimating selected flow-duration and annual mean-flow statistics for ungaged streams that are not near gaging stations on the same stream. Regression equations were developed from flow statistics and drainage-basin characteristics for 113 unregulated gaging stations. Separate regression equations were developed by using U.S. Geological Survey streamflow-gaging stations in regions with similar drainage-basin characteristics. These equations can increase the accuracy of regression equations used for estimating flow-duration and annual mean-flow statistics at ungaged stream locations in Oklahoma. Streamflow-gaging stations were grouped by selected drainage

  3. ELV Recycling Service Provider Selection Using the Hybrid MCDM Method: A Case Application in China

    Directory of Open Access Journals (Sweden)

    Fuli Zhou

    2016-05-01

    Full Text Available With the rapid depletion of natural resources and undesired environmental changes globally, more interest has been shown in the research of green supply chain practices, including end-of-life vehicle (ELV recycling. The ELV recycling is mandatory for auto-manufacturers by legislation for the purpose of minimizing potential environmental damages. The purpose of the present research is to determine the best choice of ELV recycling service provider by employing an integrating hybrid multi-criteria decision making (MCDM method. In this research, economic, environmental and social factors are taken into consideration. The linguistic variables and trapezoidal fuzzy numbers (TFNs are applied into this evaluation to deal with the vague and qualitative information. With the combined weight calculation of criteria based on fuzzy aggregation and Shannon Entropy techniques, the normative multi-criteria optimization technique (FVIKOR method is applied to explore the best solution. An application was performed based on the proposed hybrid MCDM method, and sensitivity analysis was conducted on different decision making scenarios. The present study provides a decision-making approach on ELV recycling business selection under sustainability and green philosophy with high robustness and easy implementation.

  4. Short-term variations in core surface flow resolved from an improved method of calculating observatory monthly means

    DEFF Research Database (Denmark)

    Olsen, Nils; Whaler, K. A.; Finlay, Chris

    2014-01-01

    Monthly means of the magnetic field measurements taken by ground observatories are a useful data source for studying temporal changes of the core magnetic field and the underlying core flow. However, the usual way of calculating monthly means as the arithmetic mean of all days (geomagnetic quiet...... as well as disturbed) and all local times (day and night) may result in contributions from external (magnetospheric and ionospheric) origin in the (ordinary, omm) monthly means. Such contamination makes monthly means less favourable for core studies. We calculated revised monthly means (rmm......), and their uncertainties, from observatory hourly means using robust means and after removal of external field predictions, using an improved method for characterising the magnetospheric ring current. The utility of the new method for calculating observatory monthly means is demonstrated by inverting their first...

  5. Non-destructive Determination of Martensitic Content by Means of Magnetic Methods

    Energy Technology Data Exchange (ETDEWEB)

    Niffenegger, M.; Bauer, R.; Kalkhof, D

    2003-07-01

    The detection of material degradation in a pre-cracked stage would be very advantageous. Therefore the main objective of the EC 5th Framework Programme Project CRETE (Contract No. FIS5-1999-00280) was to assess the capability and the reliability of innovative NDT-inspection techniques for the detection of material degradation, induced by low cycle fatigue (LCF) and neutron irradiation of metastable austenitic and ferritic low-alloy steel. Within work package WP6 and WP7 several project partners tested aged or irradiated samples, using various advanced measuring techniques, such as acoustic, magnetic and thermoelectric ones. These indirect methods require a careful interpretation of the measured signal in terms of micro-structural evolutions due to ageing of the material. Therefore the material had to be characterized in its undamaged, as well as in its damaged state. Based on results from former investigations, main attention was paid to the content of martensitic phase as an indicator for fatigue. Since most NDT-methods are considered as indirect methods for the detection of martensite, neutron diffraction was applied as a reference method for a quantitative determination of martensite. The material characterization performed at PSI and INSA de Lyon is published in the PSI Bericht Nr. 03-17, July 2003, (ISSN 1019-0643). The present report only describes the magnetic methods applied at PSI for the detection of material degradation and summarises the results obtained in WP3 of the CRETE project. The report is issued simultaneously as a PSI report and the CRETE work package WP3 report. At PSI the following magnetic methods were applied to LCF specimens: (1) Ferromaster for measuring the magnetic permeability, (2) Eddy current impedance measuring by means of a Giant Magneto Resistance sensor (GMR), (3) Remanence field measurements using high sensitive Fluxgate and SQUID sensors. With these methods three sets of fatigue specimens, made from different metastable

  6. System and method of providing quick thermal comfort with reduced energy by using directed spot conditioning

    Science.gov (United States)

    Wang, Mingyu; Kadle, Prasad S.; Ghosh, Debashis; Zima, Mark J.; Wolfe, IV, Edward; Craig, Timothy D

    2016-10-04

    A heating, ventilation, and air conditioning (HVAC) system and a method of controlling a HVAC system that is configured to provide a perceived comfortable ambient environment to an occupant seated in a vehicle cabin. The system includes a nozzle configured to direct an air stream from the HVAC system to the location of a thermally sensitive portion of the body of the occupant. The system also includes a controller configured to determine an air stream temperature and an air stream flow rate necessary to establish the desired heat supply rate for the sensitive portion and provide a comfortable thermal environment by thermally isolating the occupant from the ambient vehicle cabin temperature. The system may include a sensor to determine the location of the sensitive portion. The nozzle may include a thermoelectric device to heat or cool the air stream.

  7. Method of App Selection for Healthcare Providers Based on Consumer Needs.

    Science.gov (United States)

    Lee, Jisan; Kim, Jeongeun

    2018-01-01

    Mobile device applications can be used to manage health. However, healthcare providers hesitate to use them because selection methods that consider the needs of health consumers and identify the most appropriate application are rare. This study aimed to create an effective method of identifying applications that address user needs. Women experiencing dysmenorrhea and premenstrual syndrome were the targeted users. First, we searched for related applications from two major sources of mobile applications. Brainstorming, mind mapping, and persona and scenario techniques were used to create a checklist of relevant criteria, which was used to rate the applications. Of the 2784 applications found, 369 were analyzed quantitatively. Of those, five of the top candidates were evaluated by three groups: application experts, clinical experts, and potential users. All three groups ranked one application the highest; however, the remaining rankings differed. The results of this study suggest that the method created is useful because it considers not only the needs of various users but also the knowledge of application and clinical experts. This study proposes a method for finding and using the best among existing applications and highlights the need for nurses who can understand and combine opinions of users and application and clinical experts.

  8. Discussion of a method for providing general risk information by linking with the nuclear information

    International Nuclear Information System (INIS)

    Shobu, Nobuhiro; Yokomizo, Shirou; Umezawa, Sayaka

    2004-06-01

    'Risk information navigator (http://www.ricotti.jp/risknavi/)', an internet tool for arousing public interest and fostering people's risk literacy, has been developed as the contents for the official website of Techno Community Square 'RICOTTI' (http://www.ricotti.jp) at TOKAI village. In this report we classified the risk information into the fields, Health/Daily Life', 'Society/Crime/Disaster' and Technology/Environment/Energy', for the internet tool contents. According to these categories we discussed a method for providing various risk information on general fields by linking with the information on nuclear field. The web contents are attached to this report with the CD-R media. (author)

  9. Evaluation of Two Statistical Methods Provides Insights into the Complex Patterns of Alternative Polyadenylation Site Switching

    Science.gov (United States)

    Li, Jie; Li, Rui; You, Leiming; Xu, Anlong; Fu, Yonggui; Huang, Shengfeng

    2015-01-01

    Switching between different alternative polyadenylation (APA) sites plays an important role in the fine tuning of gene expression. New technologies for the execution of 3’-end enriched RNA-seq allow genome-wide detection of the genes that exhibit significant APA site switching between different samples. Here, we show that the independence test gives better results than the linear trend test in detecting APA site-switching events. Further examination suggests that the discrepancy between these two statistical methods arises from complex APA site-switching events that cannot be represented by a simple change of average 3’-UTR length. In theory, the linear trend test is only effective in detecting these simple changes. We classify the switching events into four switching patterns: two simple patterns (3’-UTR shortening and lengthening) and two complex patterns. By comparing the results of the two statistical methods, we show that complex patterns account for 1/4 of all observed switching events that happen between normal and cancerous human breast cell lines. Because simple and complex switching patterns may convey different biological meanings, they merit separate study. We therefore propose to combine both the independence test and the linear trend test in practice. First, the independence test should be used to detect APA site switching; second, the linear trend test should be invoked to identify simple switching events; and third, those complex switching events that pass independence testing but fail linear trend testing can be identified. PMID:25875641

  10. 3D dose distribution calculation in a voxelized human phantom by means of Monte Carlo method

    International Nuclear Information System (INIS)

    Abella, V.; Miro, R.; Juste, B.; Verdu, G.

    2010-01-01

    The aim of this work is to provide the reconstruction of a real human voxelized phantom by means of a MatLab program and the simulation of the irradiation of such phantom with the photon beam generated in a Theratron 780 (MDS Nordion) 60 Co radiotherapy unit, by using the Monte Carlo transport code MCNP (Monte Carlo N-Particle), version 5. The project results in 3D dose mapping calculations inside the voxelized antropomorphic head phantom. The program provides the voxelization by first processing the CT slices; the process follows a two-dimensional pixel and material identification algorithm on each slice and three-dimensional interpolation in order to describe the phantom geometry via small cubic cells, resulting in an MCNP input deck format output. Dose rates are calculated by using the MCNP5 tool FMESH, superimposed mesh tally, which gives the track length estimation of the particle flux in units of particles/cm 2 . Furthermore, the particle flux is converted into dose by using the conversion coefficients extracted from the NIST Physical Reference Data. The voxelization using a three-dimensional interpolation technique in combination with the use of the FMESH tool of the MCNP Monte Carlo code offers an optimal simulation which results in 3D dose mapping calculations inside anthropomorphic phantoms. This tool is very useful in radiation treatment assessments, in which voxelized phantoms are widely utilized.

  11. Mean protein evolutionary distance: a method for comparative protein evolution and its application.

    Directory of Open Access Journals (Sweden)

    Michael J Wise

    Full Text Available Proteins are under tight evolutionary constraints, so if a protein changes it can only do so in ways that do not compromise its function. In addition, the proteins in an organism evolve at different rates. Leveraging the history of patristic distance methods, a new method for analysing comparative protein evolution, called Mean Protein Evolutionary Distance (MeaPED, measures differential resistance to evolutionary pressure across viral proteomes and is thereby able to point to the proteins' roles. Different species' proteomes can also be compared because the results, consistent across virus subtypes, concisely reflect the very different lifestyles of the viruses. The MeaPED method is here applied to influenza A virus, hepatitis C virus, human immunodeficiency virus (HIV, dengue virus, rotavirus A, polyomavirus BK and measles, which span the positive and negative single-stranded, doubled-stranded and reverse transcribing RNA viruses, and double-stranded DNA viruses. From this analysis, host interaction proteins including hemagglutinin (influenza, and viroporins agnoprotein (polyomavirus, p7 (hepatitis C and VPU (HIV emerge as evolutionary hot-spots. By contrast, RNA-directed RNA polymerase proteins including L (measles, PB1/PB2 (influenza and VP1 (rotavirus, and internal serine proteases such as NS3 (dengue and hepatitis C virus emerge as evolutionary cold-spots. The hot spot influenza hemagglutinin protein is contrasted with the related cold spot H protein from measles. It is proposed that evolutionary cold-spot proteins can become significant targets for second-line anti-viral therapeutics, in cases where front-line vaccines are not available or have become ineffective due to mutations in the hot-spot, generally more antigenically exposed proteins. The MeaPED package is available from www.pam1.bcs.uwa.edu.au/~michaelw/ftp/src/meaped.tar.gz.

  12. Mean protein evolutionary distance: a method for comparative protein evolution and its application.

    Science.gov (United States)

    Wise, Michael J

    2013-01-01

    Proteins are under tight evolutionary constraints, so if a protein changes it can only do so in ways that do not compromise its function. In addition, the proteins in an organism evolve at different rates. Leveraging the history of patristic distance methods, a new method for analysing comparative protein evolution, called Mean Protein Evolutionary Distance (MeaPED), measures differential resistance to evolutionary pressure across viral proteomes and is thereby able to point to the proteins' roles. Different species' proteomes can also be compared because the results, consistent across virus subtypes, concisely reflect the very different lifestyles of the viruses. The MeaPED method is here applied to influenza A virus, hepatitis C virus, human immunodeficiency virus (HIV), dengue virus, rotavirus A, polyomavirus BK and measles, which span the positive and negative single-stranded, doubled-stranded and reverse transcribing RNA viruses, and double-stranded DNA viruses. From this analysis, host interaction proteins including hemagglutinin (influenza), and viroporins agnoprotein (polyomavirus), p7 (hepatitis C) and VPU (HIV) emerge as evolutionary hot-spots. By contrast, RNA-directed RNA polymerase proteins including L (measles), PB1/PB2 (influenza) and VP1 (rotavirus), and internal serine proteases such as NS3 (dengue and hepatitis C virus) emerge as evolutionary cold-spots. The hot spot influenza hemagglutinin protein is contrasted with the related cold spot H protein from measles. It is proposed that evolutionary cold-spot proteins can become significant targets for second-line anti-viral therapeutics, in cases where front-line vaccines are not available or have become ineffective due to mutations in the hot-spot, generally more antigenically exposed proteins. The MeaPED package is available from www.pam1.bcs.uwa.edu.au/~michaelw/ftp/src/meaped.tar.gz.

  13. A nonparametric mean-variance smoothing method to assess Arabidopsis cold stress transcriptional regulator CBF2 overexpression microarray data.

    Science.gov (United States)

    Hu, Pingsha; Maiti, Tapabrata

    2011-01-01

    Microarray is a powerful tool for genome-wide gene expression analysis. In microarray expression data, often mean and variance have certain relationships. We present a non-parametric mean-variance smoothing method (NPMVS) to analyze differentially expressed genes. In this method, a nonlinear smoothing curve is fitted to estimate the relationship between mean and variance. Inference is then made upon shrinkage estimation of posterior means assuming variances are known. Different methods have been applied to simulated datasets, in which a variety of mean and variance relationships were imposed. The simulation study showed that NPMVS outperformed the other two popular shrinkage estimation methods in some mean-variance relationships; and NPMVS was competitive with the two methods in other relationships. A real biological dataset, in which a cold stress transcription factor gene, CBF2, was overexpressed, has also been analyzed with the three methods. Gene ontology and cis-element analysis showed that NPMVS identified more cold and stress responsive genes than the other two methods did. The good performance of NPMVS is mainly due to its shrinkage estimation for both means and variances. In addition, NPMVS exploits a non-parametric regression between mean and variance, instead of assuming a specific parametric relationship between mean and variance. The source code written in R is available from the authors on request.

  14. Two new methods to determine the adhesion by means of internal friction in materials covered with films

    International Nuclear Information System (INIS)

    Colorado, H. A.; Ghilarducci, A. A.; Salva, H. R.

    2006-01-01

    Two new models are proposed to determine the adhesion energy be means of the internal friction technique (IF) in thin films layered materials. for the first method is necessary to determine enthalpy by means of the IF technique, for which the adhesion work has been determined with experimental data. In the second method are necessary to perform IF tests at constant temperature. (Author)

  15. A method to provide rapid in situ determination of tip radius in dynamic atomic force microscopy

    International Nuclear Information System (INIS)

    Santos, Sergio; Guang Li; Souier, Tewfik; Gadelrab, Karim; Chiesa, Matteo; Thomson, Neil H.

    2012-01-01

    We provide a method to characterize the tip radius of an atomic force microscopy in situ by monitoring the dynamics of the cantilever in ambient conditions. The key concept is that the value of free amplitude for which transitions from the attractive to repulsive force regimes are observed, strongly depends on the curvature of the tip. In practice, the smaller the value of free amplitude required to observe a transition, the sharper the tip. This general behavior is remarkably independent of the properties of the sample and cantilever characteristics and shows the strong dependence of the transitions on the tip radius. The main advantage of this method is rapid in situ characterization. Rapid in situ characterization enables one to continuously monitor the tip size during experiments. Further, we show how to reproducibly shape the tip from a given initial size to any chosen larger size. This approach combined with the in situ tip size monitoring enables quantitative comparison of materials measurements between samples. These methods are set to allow quantitative data acquisition and make direct data comparison readily available in the community.

  16. Methods and means of the radioisotope flaw detection of the nuclear power reactors components

    International Nuclear Information System (INIS)

    Dekopov, A.S.; Majorov, A.N.; Firsov, V.G.

    1979-01-01

    Methods and means are considered for the radioisotopic flaw detection of the nuclear reactors pressure vessels and structural components of the reactor circuit. Methods of control are described as in the technological process of fabrication of the power reactors assemblies as during the systematic-preventive repair of the nuclear power station equipment during exploitation. Methodological base is given of the technology of radiation control of welded joints of the pressure vessel branch piper of the WWER-440 and WWER-1000 reactors in the process of assembling and exploitation and joining pipes with the pipe-plate of the steamgenerator in the process of fabrication. Methods of the radioisotope flaw detection in the process of exploitation take into consideration the influence of the radioisotope background, and ensure obtaining of the demanded by the rules of control, sensitivity. Methods of control of welded joints of the steamgenerator of nuclear power plants are based on the simultaneous examination of all joints with application of the shaped radiographic plate-holders. Special gamma-flaw-detection equipment is developed for control of the welded joints of the main branch-pipes. Design peculiarities are given of the installation for flaw detection. These installations are equipped with the system for emergency return of the radiation source into the storage position from the position for exposure. They have automatic exposure-meters for determination of the exposure time. Successfull exploitation of such installations in the Finland during assembling equipment for the nuclear reactor of the nuclear power plant ''Loviisa-1'' and in the USSR on the Novovoronezh nuclear power plant has shown possibility for detection of flaws having dimensions about 1% of the equipment used. For control of welded joints of pipes with pipe-plates at the steam generators, portable flaw-detectors are used. Sensitivity of these flaw-detectors towards detection of the wire standards has

  17. Bonding brackets on white spot lesions pretreated by means of two methods

    Directory of Open Access Journals (Sweden)

    Julia Sotero Vianna

    2016-04-01

    Full Text Available Abstract Objective: The aim of this study was to evaluate the shear bond strength (SBS of brackets bonded to demineralized enamel pretreated with low viscosity Icon Infiltrant resin (DMG and glass ionomer cement (Clinpro XT Varnish, 3M Unitek with and without aging. Methods: A total of 75 bovine enamel specimens were allocated into five groups (n = 15. Group 1 was the control group in which the enamel surface was not demineralized. In the other four groups, the surfaces were submitted to cariogenic challenge and white spot lesions were treated. Groups 2 and 3 were treated with Icon Infiltrant resin; Groups 4 and 5, with Clinpro XT Varnish. After treatment, Groups 3 and 5 were artificially aged. Brackets were bonded with Transbond XT adhesive system and SBS was evaluated by means of a universal testing machine. Statistical analysis was performed by one-way analysis of variance followed by Tukey post-hoc test. Results: All groups tested presented shear bond strengths similar to or higher than the control group. Specimens of Group 4 had significantly higher shear bond strength values (p < 0.05 than the others. Conclusion: Pretreatment of white spot lesions, with or without aging, did not decrease the SBS of brackets.

  18. Method for providing slip energy control in permanent magnet electrical machines

    Science.gov (United States)

    Hsu, John S.

    2006-11-14

    An electric machine (40) has a stator (43), a permanent magnet rotor (38) with permanent magnets (39) and a magnetic coupling uncluttered rotor (46) for inducing a slip energy current in secondary coils (47). A dc flux can be produced in the uncluttered rotor when the secondary coils are fed with dc currents. The magnetic coupling uncluttered rotor (46) has magnetic brushes (A, B, C, D) which couple flux in through the rotor (46) to the secondary coils (47c, 47d) without inducing a current in the rotor (46) and without coupling a stator rotational energy component to the secondary coils (47c, 47d). The machine can be operated as a motor or a generator in multi-phase or single-phase embodiments and is applicable to the hybrid electric vehicle. A method of providing a slip energy controller is also disclosed.

  19. Providing the physical basis of SCS curve number method and its proportionality relationship from Richards' equation

    Science.gov (United States)

    Hooshyar, M.; Wang, D.

    2016-12-01

    The empirical proportionality relationship, which indicates that the ratio of cumulative surface runoff and infiltration to their corresponding potentials are equal, is the basis of the extensively used Soil Conservation Service Curve Number (SCS-CN) method. The objective of this paper is to provide the physical basis of the SCS-CN method and its proportionality hypothesis from the infiltration excess runoff generation perspective. To achieve this purpose, an analytical solution of Richards' equation is derived for ponded infiltration in shallow water table environment under the following boundary conditions: 1) the soil is saturated at the land surface; and 2) there is a no-flux boundary which moves downward. The solution is established based on the assumptions of negligible gravitational effect, constant soil water diffusivity, and hydrostatic soil moisture profile between the no-flux boundary and water table. Based on the derived analytical solution, the proportionality hypothesis is a reasonable approximation for rainfall partitioning at the early stage of ponded infiltration in areas with a shallow water table for coarse textured soils.

  20. Content and Methods used to Train Tobacco Cessation Treatment Providers: An International Survey.

    Science.gov (United States)

    Kruse, Gina R; Rigotti, Nancy A; Raw, Martin; McNeill, Ann; Murray, Rachael; Piné-Abata, Hembadoon; Bitton, Asaf; McEwen, Andy

    2017-12-01

    There are limited existing data describing the training methods used to educate tobacco cessation treatment providers around the world. To measure the prevalence of tobacco cessation treatment content, skills training and teaching methods reported by tobacco treatment training programs across the world. Web-based survey in May-September 2013 among tobacco cessation training experts across six geographic regions and four World Bank income levels. Response rate was 73% (84 of 115 countries contacted). Of 104 individual programs from 84 countries, most reported teaching brief advice (78%) and one-to-one counseling (74%); telephone counseling was uncommon (33%). Overall, teaching of knowledge topics was more commonly reported than skills training. Programs in lower income countries less often reported teaching about medications, behavioral treatments and biomarkers and less often reported skills-based training about interviewing clients, medication management, biomarker measurement, assessing client outcomes, and assisting clients with co-morbidities. Programs reported a median 15 hours of training. Face-to-face training was common (85%); online programs were rare (19%). Almost half (47%) included no learner assessment. Only 35% offered continuing education. Nearly all programs reported teaching evidence-based treatment modalities in a face-to-face format. Few programs delivered training online or offered continuing education. Skills-based training was less common among low- and middle-income countries (LMICs). There is a large unmet need for tobacco treatment training protocols which emphasize practical skills, and which are more rapidly scalable than face-to-face training in LMICs.

  1. Exponential mean-square stability of two classes of theta Milstein methods for stochastic delay differential equations

    Science.gov (United States)

    Rouz, Omid Farkhondeh; Ahmadian, Davood; Milev, Mariyan

    2017-12-01

    This paper establishes exponential mean square stability of two classes of theta Milstein methods, namely split-step theta Milstein (SSTM) method and stochastic theta Milstein (STM) method, for stochastic differential delay equations (SDDEs). We consider the SDDEs problem under a coupled monotone condition on drift and diffusion coefficients, as well as a necessary linear growth condition on the last term of theta Milstein method. It is proved that the SSTM method with θ ∈ [0, ½] can recover the exponential mean square stability of the exact solution with some restrictive conditions on stepsize, but for θ ∈ (½, 1], we proved that the stability results hold for any stepsize. Then, based on the stability results of SSTM method, we examine the exponential mean square stability of the STM method and obtain the similar stability results to that of the SSTM method. In the numerical section the figures show thevalidity of our claims.

  2. Comparison of Epicyclic Gearing Design Methods by Means of Quality Criteria Evaluation

    Directory of Open Access Journals (Sweden)

    I. V. Leonov

    2015-01-01

    Full Text Available The performance of modern economy depends on the usage of different machines. Execution of the many tasks a society entrusts to the machinery requires a huge amount of the mechanical energy imparted to the mechanical system due to different engines. Combining the motors and actuators in turn occurs through various transmissions.Among the numerous types of transmission the planetary gears occupy an important place. With a number of advantages and differences from other types of transmission of rotational motion, planetary gear can be used as a gear or a differential gear. The planetary gear firmly holds a leading position for its frequent use in transmissions of various technological and transport vehicles, as it has a convenient layout and high load capacity.Despite the fact that people have been using planetary gears over two thousand years, there is no simple method of their design, allowing both a minimizing design time and an optimization of their performance characteristics and technological qualities.The proposed design method is derived from the classical method of factors. It limits the number of options by isolating a promising region of a set of reduced criteria values of the overall dimensions, one of the main design criteria. A minimizing size criterion optimization is provided through rapprochement of gear sizes in two rows of gearings and proximity to the minimum possible number of teeth from the undercut condition, environment for numerous satellites, and gear assembly as well as through specifying the numbers of teeth of one of the rows to be equal to the arithmetic average of the teeth numbers of the other row.

  3. Gamma Knife radiosurgery of olfactory groove meningiomas provides a method to preserve subjective olfactory function.

    Science.gov (United States)

    Gande, Abhiram; Kano, Hideyuki; Bowden, Gregory; Mousavi, Seyed H; Niranjan, Ajay; Flickinger, John C; Lunsford, L Dade

    2014-02-01

    Anosmia is a common outcome after resection of olfactory groove meningioma(s) (OGM) and for some patients represents a significant disability. To evaluate long term tumor control rates and preservation of subjective olfaction after Gamma Knife (GK) stereotactic radiosurgery (SRS) of OGM. We performed a retrospective chart review and telephone assessments of 41 patients who underwent GK SRS between 1987 and 2008. Clinical outcomes were stratified by full, partial or no subjective olfaction, whereas tumor control was assessed by changes in volume greater or lesser than 25%. The median clinical and imaging follow-up were 76 and 65 months, respectively. Prior to SRS, 19 (46%) patients had surgical resections and two (5%) had received fractionated radiation therapy. Twenty four patients (59%) reported a normal sense of smell, 12 (29%) reported a reduced sense of smell and five (12%) had complete anosmia. The median tumor volume was 8.5 cm(3) (range 0.6-56.1), the mean radiation dose at the tumor margin was 13 Gy (range 10-20) and the median estimated dose to the olfactory nerve was 5.1 Gy (range 1.1-18.1). At follow-up, 27 patients (66%) reported intact olfaction (three (7%) described return to a normal sense of smell), nine (22%) described partial anosmia, and five (12%) had complete anosmia. No patient reported deterioration in olfaction after SRS. Thirteen patients (32%) showed significant tumor regression, 26 (63%) had no further growth and two (5%) had progressed. The progression free tumor control rates were 97% at 1 year and 95% at 2, 10 and 20 years. Symptomatic adverse radiation effects occurred in three (7%) patients. Stereotactic radiosurgery provided both long term tumor control and preservation of olfaction.

  4. Evaluation of nifurtimox treatment of chronic Chagas disease by means of several parasitological methods.

    Science.gov (United States)

    Muñoz, Catalina; Zulantay, Inés; Apt, Werner; Ortiz, Sylvia; Schijman, Alejandro G; Bisio, Margarita; Ferrada, Valentina; Herrera, Cinthya; Martínez, Gabriela; Solari, Aldo

    2013-09-01

    Currently, evaluation of drug efficacy for Chagas disease remains a controversial issue with no consensus. In this work, we evaluated the parasitological efficacy of Nifurtimox treatment in 21 women with chronic Chagas disease from an area of endemicity in Chile who were treated according to current protocols. Under pre- and posttherapy conditions, blood (B) samples and xenodiagnosis (XD) samples from these patients were subjected to analysis by real-time PCR targeting the nuclear satellite DNA of Trypanosoma cruzi (Sat DNA PCR-B, Sat DNA PCR-XD) and by PCR targeting the minicircle of kinetoplast DNA of T. cruzi (kDNA PCR-B, kDNA PCR-XD) and by T. cruzi genotyping using hybridization minicircle tests in blood and fecal samples of Triatoma infestans feed by XD. In pretherapy, kDNA PCR-B and kDNA PCR-XD detected T. cruzi in 12 (57%) and 18 (86%) cases, respectively, whereas Sat DNA quantitative PCR-B (qPCR-B) and Sat DNA qPCR-XD were positive in 18 cases (86%) each. Regarding T. cruzi genotype analysis, it was possible to observe in pretherapy the combination of TcI, TcII, and TcV lineages, including mixtures of T. cruzi strains in most of the cases. At 13 months posttherapy, T. cruzi DNA was detectable in 6 cases (29.6%) and 4 cases (19.1%) by means of Sat DNA PCR-XD and kDNA PCR-XD, respectively, indicating treatment failure with recovery of live parasites refractory to chemotherapy. In 3 cases, it was possible to identify persistence of the baseline genotypes. The remaining 15 baseline PCR-positive cases gave negative results by all molecular and parasitological methods at 13 months posttreatment, suggesting parasite response. Within this follow-up period, kDNA PCR-XD and Sat DNA qPCR-XD proved to be more sensitive tools for the parasitological evaluation of the efficacy of Nifurtimox treatment than the corresponding PCR methods performed directly from blood samples.

  5. Method to separate various isotopes in compounds by means of laser radiation

    International Nuclear Information System (INIS)

    Meyer-Kretschmer, G.; Jetter, H.; Toennies, P.

    1980-01-01

    The uranium hexafluoride together with an inert addition gas is cooled down below 50 K by adiabatic expansion, then the state of oscillation of the molecules is changed specifically for each isotope using laser light, and subsequently positive ions are produced by means of an electron beam. The ions are removed from the gas by means of an electric field. (DG) [de

  6. Trajectory Optimization of Spray Painting Robot for Complex Curved Surface Based on Exponential Mean Bézier Method

    Directory of Open Access Journals (Sweden)

    Wei Chen

    2017-01-01

    Full Text Available Automated tool trajectory planning for spray painting robots is still a challenging problem, especially for a large complex curved surface. This paper presents a new method of trajectory optimization for spray painting robot based on exponential mean Bézier method. The definition and the three theorems of exponential mean Bézier curves are discussed. Then a spatial painting path generation method based on exponential mean Bézier curves is developed. A new simple algorithm for trajectory optimization on complex curved surfaces is introduced. A golden section method is adopted to calculate the values. The experimental results illustrate that the exponential mean Bézier curves enhanced flexibility of the path planning, and the trajectory optimization algorithm achieved satisfactory performance. This method can also be extended to other applications.

  7. Short-term variations in core surface flow resolved from an improved method of calculating observatory monthly means

    Science.gov (United States)

    Olsen, Nils; Whaler, Kathryn A.; Finlay, Christopher C.

    2014-05-01

    Monthly means of the magnetic field measurements taken by ground observatories are a useful data source for studying temporal changes of the core magnetic field and the underlying core flow. However, the usual way of calculating monthly means as the arithmetic mean of all days (geomagnetic quiet as well as disturbed) and all local times (day and night) may result in contributions from external (magnetospheric and ionospheric) origin in the (ordinary, omm) monthly means. Such contamination makes monthly means less favourable for core studies. We calculated revised monthly means (rmm), and their uncertainties, from observatory hourly means using robust means and after removal of external field predictions, using an improved method for characterising the magnetospheric ring current. The utility of the new method for calculating observatory monthly means is demonstrated by inverting their first differences for core surface advective flows. The flow is assumed steady over three consecutive months to ensure uniqueness; the effects of more rapid changes should be attenuated by the weakly conducting mantle. Observatory data are inverted directly for a regularised core flow, rather than deriving it from a secular variation spherical harmonic model. The main field is specified by the CHAOS-4 model. Data from up to 128 observatories between 1997 and 2013 were used to calculate 185 flow models from the omm and rmm, for each possible set of three consecutive months. The full 3x3 (non-diagonal) data covariance matrix was used, and two-norm (least squares) minimisation performed. We are able to fit the data to the target (weighted) misfit of 1, for both omm and rmm inversions, provided we incorporate the full data covariance matrix, and produce consistent, plausible flows. Fits are better for rmm flows. The flows exhibit noticeable changes over timescales of a few months. However, they follow rapid excursions in the omm that we suspect result from external field contamination

  8. Experiences and meanings of integration of TCAM (Traditional, Complementary and Alternative Medical) providers in three Indian states: results from a cross-sectional, qualitative implementation research study.

    Science.gov (United States)

    Nambiar, D; Narayan, V V; Josyula, L K; Porter, J D H; Sathyanarayana, T N; Sheikh, K

    2014-11-25

    Efforts to engage Traditional, Complementary and Alternative Medical (TCAM) practitioners in the public health workforce have growing relevance for India's path to universal health coverage. We used an action-centred framework to understand how policy prescriptions related to integration were being implemented in three distinct Indian states. Health departments and district-level primary care facilities in the states of Kerala, Meghalaya and Delhi. In each state, two or three districts were chosen that represented a variation in accessibility and distribution across TCAM providers (eg, small or large proportions of local health practitioners, Homoeopaths, Ayurvedic and/or Unani practitioners). Per district, two blocks or geographical units were selected. TCAM and allopathic practitioners, administrators and representatives of the community at the district and state levels were chosen based on publicly available records from state and municipal authorities. A total of 196 interviews were carried out: 74 in Kerala, and 61 each in Delhi and Meghalaya. We sought to understand experiences and meanings associated with integration across stakeholders, as well as barriers and facilitators to implementing policies related to integration of Traditional, Complementary and Alternative (TCA) providers at the systems level. We found that individual and interpersonal attributes tended to facilitate integration, while system features and processes tended to hinder it. Collegiality, recognition of stature, as well as exercise of individual personal initiative among TCA practitioners and of personal experience of TCAM among allopaths enabled integration. The system, on the other hand, was characterised by the fragmentation of jurisdiction and facilities, intersystem isolation, lack of trust in and awareness of TCA systems, and inadequate infrastructure and resources for TCA service delivery. State-tailored strategies that routinise interaction, reward individual and system

  9. Safety evaluations by means of the method use of the risk matrix in radiotherapy treatments

    International Nuclear Information System (INIS)

    Sanchez, L.; Diaz, A.; Correa, T.; Gonzalez, Y.

    2014-08-01

    The quality of a radiotherapy treatment is linked to multidisciplinary factors that need to be taken into account in combined form whenever an evaluation of the safety is carried out. Knowing the accidents happened in this area, and to guarantee their prevention, the causes and sequences that could behave to them should be controlled, for what is necessary to make periodic evaluations of the same one. Our objective was to carry out the safety evaluation to the treatment process of a radiotherapy service and to identify the causes and consequences that can cause these accidental exposures, for patients, worker or people, from the equipment installation until the treatment completion. The method of Risk Matrices was used, by means the SEVRRA system carried out by the Comision Nacional de Seguridad Nuclear y Salvaguardias of Mexico; this system allows to carry out a combined analysis of the occurrence frequency of the event initiator, the probability of human errors or barrier failures and the graveness of the consequences, facilitating the identification of the associated risk to the radiotherapy procedures. The method establishes priorities for the risk administration and identifies the main causes that could cause accidental exposures; also allows preventing the accidents occurrence using risk criterions that take into account the probability and magnitude of the potential exposures. This method, although does not allow to quantify numerically the risk, makes possible to classify it in levels, what is enough to establish priorities, without carrying out risks analysis but precise but more expensive. As a result we obtained that for the Co 60 77% of the treatments, is realized with low or half risk and 23% with high risk; the work load that is elevated in our case, intervenes directly in 46 initiators, in second and third place, the non realization of a portal image in the first treatment section and in the weekly continuation, as a consequences reducer, but these

  10. Performance Analysis of Combined Methods of Genetic Algorithm and K-Means Clustering in Determining the Value of Centroid

    Science.gov (United States)

    Adya Zizwan, Putra; Zarlis, Muhammad; Budhiarti Nababan, Erna

    2017-12-01

    The determination of Centroid on K-Means Algorithm directly affects the quality of the clustering results. Determination of centroid by using random numbers has many weaknesses. The GenClust algorithm that combines the use of Genetic Algorithms and K-Means uses a genetic algorithm to determine the centroid of each cluster. The use of the GenClust algorithm uses 50% chromosomes obtained through deterministic calculations and 50% is obtained from the generation of random numbers. This study will modify the use of the GenClust algorithm in which the chromosomes used are 100% obtained through deterministic calculations. The results of this study resulted in performance comparisons expressed in Mean Square Error influenced by centroid determination on K-Means method by using GenClust method, modified GenClust method and also classic K-Means.

  11. DETECTION OF REPORTS FALSIFICATION PROVIDED TO A BANK BY A BORROWER USING THE METHOD OF DYNAMIC PARAMETERS ANALYSIS

    Directory of Open Access Journals (Sweden)

    M. S. Lyuft

    2015-01-01

    Full Text Available Summary. The main stop-factors in a landing were formed in the article according to the procedure of the European Bank for Reconstruction and Development by the means of questioning the leading Russian banks that finance small-scale business. It is given the description of this method, also it is identified the main weaknesses of the EBRD methodology. There is a description of the main methods of the borrowing company’s analytical balance and thereupon it is made the conclusion about the necessity of the analysis of the balance’s principal factors across time. The analysis of indicators and factors in the dynamics enables us to see trends in the development of the company, and to identify deviations in the coefficients. Either materiality or difference from normal values of these coefficients may indicate the factors of the borrowers’ misconduct, and in particular it gives evidence concerning falsification of reports provided to a bank. There are stages of information processing for falsification’s detection, excluding the interest from decision-makers about the possibility of lending in the results of a transaction. The formula that determinates the value of net profit falsification has been made on basis of dynamic parameters of the analytical balance and the connection with the administrative profit-and-loss report. Further, the article provides the second method of a determination of the net profit falsification already based on data of the parameters in dynamics namely business profitability rate. The process of calculation Payment To Income - payment to income - an indicator, in order to obtain good data on who falsify net income. Are key strengths of this method of identifying and conclusions paragraph article.

  12. Development of guidance and methodical documents for providing the decommissioning of radiation-hazardous objects

    International Nuclear Information System (INIS)

    Ermakov, A.

    2015-01-01

    Federal Center for Nuclear and Radiation Safety (JSC FCNRS) developed and approbated guidance and methodical documents for providing the facility to radiologically safe status in the course of Building B decommissioning activity at JSC VNIINM (A.A. Bochvar High-Technology Scientific Research Institute for Inorganic Materials). The scope of application of the documents developed is as follows: - preliminary segregation of radwaste into streams during its collection and preparation for removal from facilities/sites under decommissioning; - express assessment of specific activity (activity) of radwaste generated in the course of dismantling and decontamination activities; - radiological survey of premises and building structures following completion of dismantling and decontamination activities; - SRW processing (compaction, reduction in size), packaging, characterisation and containerisation in order to reduce risks of spread of radioactive contamination. Documents that have been developed can be used both at nuclear facilities/ sites similar to the JSC VNIINM Building B in terms of work stages and types of waste to be generated, and other facilities/ sites taking into consideration their peculiarities. (author)

  13. [Membrane-filtration immunoassay: reagents, methods and the diagnostic and technical means for detection].

    Science.gov (United States)

    Khramov, E N; Osin, N S; Pomelova, V G; Vikha, I V; Bychenkova, T A; Smirnova, V G; Grakina, G I; Kas'ianova, T A

    1999-01-01

    The comprehensive development of dot-EIA made at the State Research Institute of Biological Instrument-Making Industry has provided devices KIMF-02 and KIMF-03), a base of chemical reagents, immunoassays, test systems for detection of a wide range of causative agents of viral and bacterial infections, that of serodiagnosis of their related diseases. The KIMF-02 kit has undergone engineering and medical tests and recommended for the Ministry of Health of the Russian Federation to produce them in stock. The kit includes all required for analysis even in an ill-equipped laboratory, a set of attached agents ensures a valid visual recording of results. The developed procedures and test systems allow the immunoassay to be as sensitive as TIFA; however, they are laborious and much simpler in design. The simple and rapid procedures of dot-EIA are recommended for incorporation into the a package of laboratory methods for verification of the accumulation of virus-specific antigens in various biological substrata, environmental samples, for control of the activity of antigens and antibodies used in serological tests, for detection of specific antigens in the clinical samples, and for serodiagnosis of infections.

  14. Finite-State Mean-Field Games, Crowd Motion Problems, and its Numerical Methods

    KAUST Repository

    Machado Velho, Roberto

    2017-01-01

    -economic sciences. Examples include paradigm shifts in the scientific community and the consumer choice behavior in a free market. The corresponding finite-state mean-field game models are hyperbolic systems of partial differential equations, for which we propose

  15. Development of a sensitive method for a structural elucidation of acyl carnitines by means of GC-MS techniques

    International Nuclear Information System (INIS)

    Altmann, E.

    1999-11-01

    The goal of the present work was to develop a sensitive and reliable method to characterize the urinary acyl carnitines, to further establish it as routine procedure in hospitals, especially in Pedriatic Departments. The determination of the excreted acyl carnitines allows drawing conclusions on errors or deviations in the cellular metabolism. Applying the volatile lactone derivatives of the acyl carnitines various methods of GC/MS technique are compared. With the examined lactones under concern EI mass spectra furnish just a first incomplete information. Frequently the molecular peaks are not sufficiently intense. Yet by means of the retention times, the signals m/z 84, 85 and 144 as ion traces, as well as the characteristic fragmentation helpful information is provided. Concerning the +CI/NH 3 - mass spectra the protonated molecular ions (M + H) + and the usually very intense (M + NH 4 ) + - ions unambiguously render structural assignments. In the case of the - CI/NH 3 - mass spectra the (M-1) and (M-85) ions allow definitive assignments due to their lesser fragmentation tendency. Each of the analytical outcoming can be regarded as leading contribution in helpfully establishing the current method in every clinical hospital. (author)

  16. PEOPLE RETRIEVAL BY MEANS OF COMPOSITE PICTURES: METHODS, SYSTEMS AND PRACTICAL DECISIONS

    Directory of Open Access Journals (Sweden)

    G. A. Kukharev

    2015-07-01

    Full Text Available We discuss the problem of people retrieval by means of composite pictures and methods of its practical realization. Earlier on, the problem was posed in the previous paper by the authors, and this paper deals with its further development. The starting premise here is that for the successful search of people by their sketches it is necessary to transform these sketches into sets of populations of sketches imitating evidence of «group of witnesses» and evidence with incomplete information in verbal portraits. Variants of structures for benchmark «photo-sketch» databases are presented, intended for modeling and practical realization of original photos retrieval by sketches, which new component is a population of sketches. Problems of preprocessing for initial sketches and original photos and its influence on the result of their comparison are discussed. Simple sketch recognition systems (Simple FaRetSys and a problem of original photos retrieval by the sketches are considered. Shortcomings of such systems are shown and new decisions on extending and development of simple systems (Extended FaRetSys are presented. Experiments on searching of original photos by sketches in the CUFS database of sketches and similar experiments on widely known FERET and CUFSF facial databases are presented. Three frameworks are offered for retrieval performance improvement. In the first one, original sketches are transformed into populations, and then in these populations the sketch similar to the given sketch (Forensic Sketch is already defined. The class of the sketch found in a population «by definition» unambiguously corresponds to a class of the original photo. In the second framework, the Forensic Sketch is transformed to a population of sketches, and all original sketches in a benchmarking database are compared to sketches from populations of the Forensic Sketch. The class of matches is determined in the same manner as in the first framework. The third

  17. The Effect of Health Information Technology on Health Care Provider Communication: A Mixed-Method Protocol.

    Science.gov (United States)

    Manojlovich, Milisa; Adler-Milstein, Julia; Harrod, Molly; Sales, Anne; Hofer, Timothy P; Saint, Sanjay; Krein, Sarah L

    2015-06-11

    Communication failures between physicians and nurses are one of the most common causes of adverse events for hospitalized patients, as well as a major root cause of all sentinel events. Communication technology (ie, the electronic medical record, computerized provider order entry, email, and pagers), which is a component of health information technology (HIT), may help reduce some communication failures but increase others because of an inadequate understanding of how communication technology is used. Increasing use of health information and communication technologies is likely to affect communication between nurses and physicians. The purpose of this study is to describe, in detail, how health information and communication technologies facilitate or hinder communication between nurses and physicians with the ultimate goal of identifying how we can optimize the use of these technologies to support effective communication. Effective communication is the process of developing shared understanding between communicators by establishing, testing, and maintaining relationships. Our theoretical model, based in communication and sociology theories, describes how health information and communication technologies affect communication through communication practices (ie, use of rich media; the location and availability of computers) and work relationships (ie, hierarchies and team stability). Therefore we seek to (1) identify the range of health information and communication technologies used in a national sample of medical-surgical acute care units, (2) describe communication practices and work relationships that may be influenced by health information and communication technologies in these same settings, and (3) explore how differences in health information and communication technologies, communication practices, and work relationships between physicians and nurses influence communication. This 4-year study uses a sequential mixed-methods design, beginning with a

  18. Optimization of control parameters of a hot cold controller by means of Simplex type methods

    Science.gov (United States)

    Porte, C.; Caron-Poussin, M.; Carot, S.; Couriol, C.; Moreno, M. Martin; Delacroix, A.

    1997-01-01

    This paper describes a hot/cold controller for regulating crystallization operations. The system was identified with a common method (the Broida method) and the parameters were obtained by the Ziegler-Nichols method. The paper shows that this empirical method will only allow a qualitative approach to regulation and that, in some instances, the parameters obtained are unreliable and therefore cannot be used to cancel variations between the set point and the actual values. Optimization methods were used to determine the regulation parameters and solve this identcation problem. It was found that the weighted centroid method was the best one. PMID:18924791

  19. Digital photography provides a fast, reliable, and noninvasive method to estimate anthocyanin pigment concentration in reproductive and vegetative plant tissues.

    Science.gov (United States)

    Del Valle, José C; Gallardo-López, Antonio; Buide, Mª Luisa; Whittall, Justen B; Narbona, Eduardo

    2018-03-01

    Anthocyanin pigments have become a model trait for evolutionary ecology as they often provide adaptive benefits for plants. Anthocyanins have been traditionally quantified biochemically or more recently using spectral reflectance. However, both methods require destructive sampling and can be labor intensive and challenging with small samples. Recent advances in digital photography and image processing make it the method of choice for measuring color in the wild. Here, we use digital images as a quick, noninvasive method to estimate relative anthocyanin concentrations in species exhibiting color variation. Using a consumer-level digital camera and a free image processing toolbox, we extracted RGB values from digital images to generate color indices. We tested petals, stems, pedicels, and calyces of six species, which contain different types of anthocyanin pigments and exhibit different pigmentation patterns. Color indices were assessed by their correlation to biochemically determined anthocyanin concentrations. For comparison, we also calculated color indices from spectral reflectance and tested the correlation with anthocyanin concentration. Indices perform differently depending on the nature of the color variation. For both digital images and spectral reflectance, the most accurate estimates of anthocyanin concentration emerge from anthocyanin content-chroma ratio, anthocyanin content-chroma basic, and strength of green indices. Color indices derived from both digital images and spectral reflectance strongly correlate with biochemically determined anthocyanin concentration; however, the estimates from digital images performed better than spectral reflectance in terms of r 2 and normalized root-mean-square error. This was particularly noticeable in a species with striped petals, but in the case of striped calyces, both methods showed a comparable relationship with anthocyanin concentration. Using digital images brings new opportunities to accurately quantify the

  20. A method for analyzing the business case for provider participation in the National Cancer Institute's Community Clinical Oncology Program and similar federally funded, provider-based research networks.

    Science.gov (United States)

    Reiter, Kristin L; Song, Paula H; Minasian, Lori; Good, Marjorie; Weiner, Bryan J; McAlearney, Ann Scheck

    2012-09-01

    The Community Clinical Oncology Program (CCOP) plays an essential role in the efforts of the National Cancer Institute (NCI) to increase enrollment in clinical trials. Currently, there is little practical guidance in the literature to assist provider organizations in analyzing the return on investment (ROI), or business case, for establishing and operating a provider-based research network (PBRN) such as the CCOP. In this article, the authors present a conceptual model of the business case for PBRN participation, a spreadsheet-based tool and advice for evaluating the business case for provider participation in a CCOP organization. A comparative, case-study approach was used to identify key components of the business case for hospitals attempting to support a CCOP research infrastructure. Semistructured interviews were conducted with providers and administrators. Key themes were identified and used to develop the financial analysis tool. Key components of the business case included CCOP start-up costs, direct revenue from the NCI CCOP grant, direct expenses required to maintain the CCOP research infrastructure, and incidental benefits, most notably downstream revenues from CCOP patients. The authors recognized the value of incidental benefits as an important contributor to the business case for CCOP participation; however, currently, this component is not calculated. The current results indicated that providing a method for documenting the business case for CCOP or other PBRN involvement will contribute to the long-term sustainability and expansion of these programs by improving providers' understanding of the financial implications of participation. Copyright © 2011 American Cancer Society.

  1. Meaning and challenges in the practice of multiple therapeutic massage modalities: a combined methods study.

    Science.gov (United States)

    Porcino, Antony J; Boon, Heather S; Page, Stacey A; Verhoef, Marja J

    2011-09-20

    Therapeutic massage and bodywork (TMB) practitioners are predominantly trained in programs that are not uniformly standardized, and in variable combinations of therapies. To date no studies have explored this variability in training and how this affects clinical practice. Combined methods, consisting of a quantitative, population-based survey and qualitative interviews with practitioners trained in multiple therapies, were used to explore the training and practice of TMB practitioners in Alberta, Canada. Of the 5242 distributed surveys, 791 were returned (15.1%). Practitioners were predominantly female (91.7%), worked in a range of environments, primarily private (44.4%) and home clinics (35.4%), and were not significantly different from other surveyed massage therapist populations. Seventy-seven distinct TMB therapies were identified. Most practitioners were trained in two or more therapies (94.4%), with a median of 8 and range of 40 therapies. Training programs varied widely in number and type of TMB components, training length, or both. Nineteen interviews were conducted. Participants described highly variable training backgrounds, resulting in practitioners learning unique combinations of therapy techniques. All practitioners reported providing individualized patient treatment based on a responsive feedback process throughout practice that they described as being critical to appropriately address the needs of patients. They also felt that research treatment protocols were different from clinical practice because researchers do not usually sufficiently acknowledge the individualized nature of TMB care provision. The training received, the number of therapies trained in, and the practice descriptors of TMB practitioners are all highly variable. In addition, clinical experience and continuing education may further alter or enhance treatment techniques. Practitioners individualize each patient's treatment through a highly adaptive process. Therefore, treatment

  2. Characterization of biogenic ferrihydrite nanoparticles by means of SAXS, SRD and IBA methods

    Science.gov (United States)

    Balasoiu, M.; Kichanov, S.; Pantelica, A.; Pantelica, D.; Stolyar, S.; Iskhakov, R.; Aranghel, D.; Ionescu, P.; Badita, C. R.; Kurkin, S.; Orelovich, O.; Tiutiunikov, S.

    2018-03-01

    Investigations of biogenic ferrihydrite nanoparticles produced by bacteria Klebsiella oxytoca by applying small angle X-ray scattering, synchrotron radiation diffraction and ion beam analysis methods are reviewed. Different experimental data processing methods are used and analyzed.

  3. Solution of linear ordinary differential equations by means of the method of variation of arbitrary constants

    DEFF Research Database (Denmark)

    Mejlbro, Leif

    1997-01-01

    An alternative formula for the solution of linear differential equations of order n is suggested. When applicable, the suggested method requires fewer and simpler computations than the well-known method using Wronskians.......An alternative formula for the solution of linear differential equations of order n is suggested. When applicable, the suggested method requires fewer and simpler computations than the well-known method using Wronskians....

  4. Image Segmentation Method Using Fuzzy C Mean Clustering Based on Multi-Objective Optimization

    Science.gov (United States)

    Chen, Jinlin; Yang, Chunzhi; Xu, Guangkui; Ning, Li

    2018-04-01

    Image segmentation is not only one of the hottest topics in digital image processing, but also an important part of computer vision applications. As one kind of image segmentation algorithms, fuzzy C-means clustering is an effective and concise segmentation algorithm. However, the drawback of FCM is that it is sensitive to image noise. To solve the problem, this paper designs a novel fuzzy C-mean clustering algorithm based on multi-objective optimization. We add a parameter λ to the fuzzy distance measurement formula to improve the multi-objective optimization. The parameter λ can adjust the weights of the pixel local information. In the algorithm, the local correlation of neighboring pixels is added to the improved multi-objective mathematical model to optimize the clustering cent. Two different experimental results show that the novel fuzzy C-means approach has an efficient performance and computational time while segmenting images by different type of noises.

  5. A mixed methods study of patient-provider communication about opioid analgesics.

    Science.gov (United States)

    Hughes, Helen Kinsman; Korthuis, Philip Todd; Saha, Somnath; Eggly, Susan; Sharp, Victoria; Cohn, Jonathan; Moore, Richard; Beach, Mary Catherine

    2015-04-01

    To describe patient-provider communication about opioid pain medicine and explore how these discussions affect provider attitudes toward patients. We audio-recorded 45 HIV providers and 423 patients in routine outpatient encounters at four sites across the country. Providers completed post-visit questionnaires assessing their attitudes toward patients. We identified discussions about opioid pain management and analyzed them qualitatively. We used logistic regression to assess the association between opioid discussion and providers' attitudes toward patients. 48 encounters (11% of the total sample) contained substantive discussion of opioid-related pain management. Most conversations were initiated by patients (n=28, 58%) and ended by the providers (n=36, 75%). Twelve encounters (25%) contained dialog suggesting a difference of opinion or conflict. Providers more often agreed than disagreed to give the prescription (50% vs. 23%), sometimes reluctantly; in 27% (n=13) of encounters, no decision was made. Fewer than half of providers (n=20, 42%) acknowledged the patient's experience of pain. Providers had a lower odds of positive regard for the patient (adjusted OR=0.51, 95% CI: 0.27-0.95) when opioids were discussed. Pain management discussions are common in routine outpatient HIV encounters and providers may regard patients less favorably if opioids are discussed during visits. The sometimes-adversarial nature of these discussions may negatively affect provider attitudes toward patients. Empathy and pain acknowledgment are tools that clinicians can use to facilitate productive discussions of pain management. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  6. Simulation of anisotropic diffusion by means of a diffusion velocity method

    CERN Document Server

    Beaudoin, A; Rivoalen, E

    2003-01-01

    An alternative method to the Particle Strength Exchange method for solving the advection-diffusion equation in the general case of a non-isotropic and non-uniform diffusion is proposed. This method is an extension of the diffusion velocity method. It is shown that this extension is quite straightforward due to the explicit use of the diffusion flux in the expression of the diffusion velocity. This approach is used to simulate pollutant transport in groundwater and the results are compared to those of the PSE method presented in an earlier study by Zimmermann et al.

  7. A REVIEW WAVELET TRANSFORM AND FUZZY K-MEANS BASED IMAGE DE-NOISING METHOD

    OpenAIRE

    Nidhi Patel*, Asst. Prof. Pratik Kumar Soni

    2017-01-01

    The research area of image processing technique using fuzzy k-means and wavelet transform. The enormous amount of data necessary for images is a main reason for the growth of many areas within the research field of computer imaging such as image processing and compression. In order to get this in requisites of the concerned research work, wavelet transforms and k-means clustering is applied. This can be done in order to discover more possible combinations that may lead to the finest de-noisin...

  8. QC methods and means during pellets and fuel rods manufacturing at JSC 'MSZ'

    International Nuclear Information System (INIS)

    Kouznetsov, A.I.

    2000-01-01

    The report contains the description of the main methods and devices used in fabrication of pellets and fuel rods to prove their conformity to the requirements of technical specifications. The basic principals, range and accuracy of methods and devices are considered in detail, as well as system of metrological support of measurements. The latter includes the metrological certification and periodical verification of the devices, metrological qualification of measurement procedures, standard samples provision and checking the correctness of the analyses performance. If one makes an overall review of testing methods used in different fuel production plants he will find that most part of methods and devices are very similar. There are still some variations in methods which could be a subject for interesting discussions among specialists. This report contains a brief review of testing methods and devices used at our plant. More detailed description is given to methods which differ from those commonly used. (author)

  9. Development of methods and means to improve a performance of microprocessor shock sensors for car alarms

    Directory of Open Access Journals (Sweden)

    S. A. Vasyukov

    2014-01-01

    Full Text Available Existing shock sensors for car protection using the sensitive elements (SE of piezoelectric, microphone and electromagnetic types and the analogue circuitry of signal processing, have a number of essential shortcomings:- piezoelectric sensitive elements have no characteristics repeatability that complicates their use in mass production;- microphone sensors are structurally complicated and demand difficult information signal processing;- sensitive elements of electromagnetic sensors demand individual control (a specified clearance to be set between a magnet and the coil.Use of analogue elements (resistors, capacitors in the amplifier and filter circuits reduces temporary and temperature stability of characteristics. An adjustment of the sensor operating zones via variable resistors on a printed circuit is extremely inconvenient and doesn't allow to change quickly the sensor sensitivity depending on an external situation (for example, to increase quickly an operating zone of the sensor with an alarm system of a key fob when securing a car in the country or in the woods, or to reduce it in the street with heavy traffic streams.An analogue circuit–based sensor design disables its automatic adaptation to such external impacts as a rain, a stream passing by cars, etc.The article considers how to solve some of above problems while designing the two-zone digital shock sensors with a SE of electromagnetic type. It shows the SE design developed by the authors as a module containing the coil and a magnet, secured on the coil axis in a silicone extension. The circuitry solution and algorithms of signals processing allowed authors to realize a remote control of the prevention and alarm zones (with 16 gradation of sensitivity. The algorithm of self-adaptation to the repeating external impacts is proposed. The developed method to form the basic levels of digital comparators for each gradation of sensitivity enables the sensor to have the straight

  10. Algorithmic impediments filtration using the α-truncated mean method in resolver-to-digital converter

    Directory of Open Access Journals (Sweden)

    Gordiyenko V. I.

    2009-02-01

    Full Text Available A test diagram of the microcontroller-type resolver-to-digital converter and algorithms for impediments filtration therein are developed. Experimental verification of the α-truncated mean algorithm intended for the suppression of impulse and noise interference is conducted. The test results are given.

  11. Constitutive modeling of two phase materials using the Mean Field method for homogenization

    NARCIS (Netherlands)

    Perdahcioglu, Emin Semih; Geijselaers, Hubertus J.M.

    2010-01-01

    A Mean-Field homogenization framework for constitutive modeling of materials involving two distinct elastic-plastic phases is presented. With this approach it is possible to compute the macroscopic mechanical behavior of this type of materials based on the constitutive models of the constituent

  12. Building a Method for Researching Attribution of Meaning by Children Aged 5 to 6 in School

    Science.gov (United States)

    Tertoolen, Anja; van Oers, Bert; Geldens, Jeannette; Popeijus, Herman

    2012-01-01

    This article reports on the first phase of a research project in which we looked for the voices of young children, aged 5 to 6, in school. What do children experience in school? What do they see as the meaning of school? What is their motivation? Children have the right to be listened to. The question is which settings, under which circumstances,…

  13. Mutation breeding of bulb crops by means of radioactive irradiation and other methods

    International Nuclear Information System (INIS)

    Alkema, H.Y.

    1974-01-01

    Results of mutation breeding of bulb crops by means of radioactive irradiation, colchicine and heat treatment are discussed. The optimal dose of X radiation is stated. Mutation frequency was low; it is suggested to apply radiation on plant material that is propagated by way of adventitious buds

  14. Building a method for researching attribution of meaning by children aged 5 to 6 in school.

    NARCIS (Netherlands)

    Tertoolen, A.; van Oers, B.; Geldens, J.; Popeijus, H.

    2012-01-01

    This article reports on the first phase of a research project in which we looked for the voices of young children, aged 5 to 6, in school. What do children experience in school? What do they see as the meaning of school? What is their motivation? Children have the right to be listened to. The

  15. Devices and methods of operation thereof for providing stable flow for centrifugal compressors

    Science.gov (United States)

    Skoch, Gary J. (Inventor); Stevens, Mark A. (Inventor); Jett, Thomas A. (Inventor)

    2008-01-01

    Centrifugal compressor flow stabilizing devices and methods of operation thereof are disclosed that act upon the flow field discharging from the impeller of a centrifugal compressor and modify the flow field ahead of the diffuser vanes such that flow conditions contributing to rotating stall and surge are reduced or even eliminated. In some embodiments, shaped rods and methods of operation thereof are disclosed, whereas in other embodiments reverse-tangent air injection devices and methods are disclosed.

  16. EXPLORATION BY MEANS OF GEOPHYSICAL METHODS OF GEOTHERMAL FIELDS AND CASE STUDIES

    Directory of Open Access Journals (Sweden)

    Züheyr KAMACI

    1997-01-01

    Full Text Available Geothermal energy which is one of the reuseable energy resources, can save as much as 77 million barrels of petroleum equivalent annually when used in the production of electricity and heating-environment. Geophysical exploration methods plays in important role in the fields of geothermal exploration, development and observational studies. Thermal and geoelectrical methods are the most effective methods which shows the temperature variation anomalies and mechanical drilling places. But, when the other methods of gravity, magnetic, radiometric, well geophysics and well logs can be used in conjunction with seismic tomography, apart from the mentioned geophysical exploration method, better results could be obtained. From the above mentioned facts various case history reports are given from our country and worldwide to determine geothermal energy resources by using geophysical exploration technique application. From these results of studies a 55 °C hot water artessian aquifer is found in the Uşak-Banaz geothermal field by applying geoelectrical methods.

  17. Investigation of periodic systems by means of the generalized Hill method

    International Nuclear Information System (INIS)

    Baitin, A.V.; Ivanov, A.A.

    1994-01-01

    We propose the new method of investigation of infinite periodic determination which is a generalized Hill method. This method has been used for finding of the characteristic value for the Hill equation. finding the band structure of the one-dimensional periodic and obtaining of the dispersion equation for the electromagnetic wave propagation in the waveguide by plasma arbitrary periodic density modulation by plasma arbitrary periodic density modulation

  18. Automated correlation and classification of secondary ion mass spectrometry images using a k-means cluster method.

    Science.gov (United States)

    Konicek, Andrew R; Lefman, Jonathan; Szakal, Christopher

    2012-08-07

    We present a novel method for correlating and classifying ion-specific time-of-flight secondary ion mass spectrometry (ToF-SIMS) images within a multispectral dataset by grouping images with similar pixel intensity distributions. Binary centroid images are created by employing a k-means-based custom algorithm. Centroid images are compared to grayscale SIMS images using a newly developed correlation method that assigns the SIMS images to classes that have similar spatial (rather than spectral) patterns. Image features of both large and small spatial extent are identified without the need for image pre-processing, such as normalization or fixed-range mass-binning. A subsequent classification step tracks the class assignment of SIMS images over multiple iterations of increasing n classes per iteration, providing information about groups of images that have similar chemistry. Details are discussed while presenting data acquired with ToF-SIMS on a model sample of laser-printed inks. This approach can lead to the identification of distinct ion-specific chemistries for mass spectral imaging by ToF-SIMS, as well as matrix-assisted laser desorption ionization (MALDI), and desorption electrospray ionization (DESI).

  19. Unsafe abortion in urban and rural Tanzania: method, provider and consequences

    DEFF Research Database (Denmark)

    Rasch, Vibeke; Kipingili, Rose

    2009-01-01

    OBJECTIVE: To describe unsafe abortion methods and associated health consequences in Tanzania, where induced abortion is restricted by law but common and known to account for a disproportionate share of hospital admissions. METHOD: Cross-sectional study of women admitted with alleged miscarriage...

  20. Study on variance-to-mean method as subcriticality monitor for accelerator driven system operated with pulse-mode

    International Nuclear Information System (INIS)

    Yamauchi, Hideto; Kitamura, Yasunori; Yamane, Yoshihiro; Misawa, Tsuyoshi; Unesaki, Hironobu

    2003-01-01

    Two types of the variance-to-mean methods for the subcritical system that was driven by the periodic and pulsed neutron source were developed and their experimental examination was performed with the Kyoto University Critical Assembly and a pulsed neutron generator. As a result, it was demonstrated that the prompt neutron decay constant could be measured by these methods. From this fact, it was concluded that the present variance-to-mean methods had potential for being used in the subcriticality monitor for the future accelerator driven system operated with the pulse-mode. (author)

  1. Comparison of in vivo and in sacco methods to estimate mean ...

    African Journals Online (AJOL)

    This method has some advantages, the most obvious being ... for the present feeding regime. Pilot experiments .... These values are very close to the observed value obtained at 8,52 hand. 16,12 h using the in vivo method on the same two diets. Thus, when an estimate of the outflow of fermentable OM is included, the ...

  2. Planktonic primary production evaluation by means of the 14C method with liquid scintillation counting

    International Nuclear Information System (INIS)

    Frangopol, T.P.; Bologa, S.A.

    1979-05-01

    Preliminary results on the planktonic primary production obtained for the first time with the 14 C method off the Romanian Black Sea coast (1977, 1978) and in the Sinoe, Mamaia and Bicaz lakes (1978) are presented, along with a review of this method with special reference to liquid scintillation counting. 140 Refs. (author)

  3. Preventing aggressive incidents and seclusions in forensic care by means of the 'Early Recognition Method'

    NARCIS (Netherlands)

    Fluttert, F.A.J.; Meijel, B.K.G. van; Nijman, H.L.I.; Björkly, S.; Grypdonck, M.H.F.

    2010-01-01

    Objective. The Early Recognition Method aims at improving collaboration between nurses and patients to prevent aggression in forensic psychiatric care. To achieve this goal, Early Recognition Method strongly focuses on early signs of aggression. In the current study, we investigated whether

  4. Analysis of residual stresses on the transverse beam of a casting stand by means of drilling method

    Directory of Open Access Journals (Sweden)

    P. Frankovský

    2014-10-01

    Full Text Available The presented paper demonstrates the application of drilling method in the analysis of residual stresses on the transverse beam of a casting stand. In the initial stage of the analysis the determination of strains was done for individual steps of drilling in the area which was determined by means of numerical analysis. The drilling was carried out gradually by 0,5 mm up to the depth of 5 mm, while the diameter of the drilled hole was 3,2 mm. During the analysis we used the drilling device RS-200, strain indicator P3 and SGD 1-RY21-3/120. The paper presents the development of residual stresses throughout the depth of the drilled hole which were determined according to standard ASTM E837-01, by means of integral method, power series method and by means of Power Series method.

  5. What does it mean to use a method? Towards a practice theory for software engineering

    DEFF Research Database (Denmark)

    Dittrich, Yvonne

    2016-01-01

    Context Methods and processes, along with the tools to support them, are at the heart of software engineering as a discipline. However, as we all know, that often the use of the same method neither impacts software projects in a comparable manner nor the software they result in. What is lacking...... software development and teaching are indicated. Conclusion The theoretical/philosophical concepts allow the explaining of heterogeneity in application of software engineering methods in line with empirical research results....... is an understanding of how methods affect software development. Objective The article develops a set of concepts based on the practice-concept in philosophy of sociology as a base to describe software development as social practice, and develop an understanding of methods and their application that explains...

  6. Measurement of unattached aerosols of 222 Rn progeny by means of an electrostatic deposition method

    International Nuclear Information System (INIS)

    Canoba, Analia C.; Lopez, Fabio O.

    2001-01-01

    A method for the measurement of unattached radon progeny based on its electrostatic deposition onto wire screens, using only one pump, has been implemented and calibrated. The importance of being able of making use of this method is related with the special radiological significance that has the unattached fraction of the short-lived radon progeny. Because of this, the assesment of exposure could be directly related to dose with far greater accuracy than before.The advantages of this method are its simplicity, even with the tools needed for the sample collection, as well as the measurement instruments used. Also, the suitability of this method is enhanced by the fact that it can effectively be used with a simple measuring procedure such as the Kusnetz method. (author)

  7. Calculations of Neutron Flux Distributions by Means of Integral Transport Methods

    Energy Technology Data Exchange (ETDEWEB)

    Carlvik, I

    1967-05-15

    Flux distributions have been calculated mainly in one energy group, for a number of systems representing geometries interesting for reactor calculations. Integral transport methods of two kinds were utilised, collision probabilities (CP) and the discrete method (DIT). The geometries considered comprise the three one-dimensional geometries, planes, sphericals and annular, and further a square cell with a circular fuel rod and a rod cluster cell with a circular outer boundary. For the annular cells both methods (CP and DIT) were used and the results were compared. The purpose of the work is twofold, firstly to demonstrate the versatility and efficacy of integral transport methods and secondly to serve as a guide for anybody who wants to use the methods.

  8. In-service inspection of condenser tubes by means of electrochemical methods

    International Nuclear Information System (INIS)

    Taelemans, G.

    The commissioning of an increasing number of large nuclear power plants involves an increased significance of such condenser tube problems as: - erosion on tube ends, - generalized corrosion and pitting corrosion, - deposits in the tubes. In order to solve such problems, investigations were performed especially focused on a measurement technique that enables in-service behaviour of condenser tubes to be monitored. For such a purpose, measurement of the polarization resistance has been adopted. The existing corrosion products and scaled-off iron oxides were eliminated by means of a carborundum balls processing, as clearly appears from polarization resistance reduction. Then iron sulphate was injected in order to build a new and better protective layer. In addition, the tube was kept clean by means of foam rubber balls. There is a second implementation area: fouled condenser tubes. A significant polarization resistance reduction is noted during the acid cleaning. (orig.) [de

  9. Attenuation correction for renal scintigraphy with 99mTc - DMSA: comparison between Raynaud and the geometric mean methods

    International Nuclear Information System (INIS)

    Argenta, J.; Brambilla, C.R.; Marques da Silva, A.M.

    2009-01-01

    The evaluation of the index of renal function (IF) requires soft-tissue attenuation correction. This paper investigates the impact over the IF, when attenuation correction is applied using the Raynaud method and the geometric mean method in renal planar scintigraphy, using posterior and anterior views. The study was conducted with Monte Carlo simulated images of five GSF family voxel phantoms with different relative uptakes in each kidney from normal (50% -50%) to pathological (10% -90%). The results showed that Raynaud method corrects more efficiently the cases where the renal depth is close to the value of the standard phantom. The geometric mean method showed similar results to the Raynaud method for Baby, Child and Golem. For Helga and Donna models, the errors were above 20%, increasing with relative uptake. Further studies should be conducted to assess the influences of the standard phantom in the correcting attenuation methods. (author)

  10. A Theoretically Consistent Method for Minimum Mean-Square Error Estimation of Mel-Frequency Cepstral Features

    DEFF Research Database (Denmark)

    Jensen, Jesper; Tan, Zheng-Hua

    2014-01-01

    We propose a method for minimum mean-square error (MMSE) estimation of mel-frequency cepstral features for noise robust automatic speech recognition (ASR). The method is based on a minimum number of well-established statistical assumptions; no assumptions are made which are inconsistent with others....... The strength of the proposed method is that it allows MMSE estimation of mel-frequency cepstral coefficients (MFCC's), cepstral mean-subtracted MFCC's (CMS-MFCC's), velocity, and acceleration coefficients. Furthermore, the method is easily modified to take into account other compressive non-linearities than...... the logarithmic which is usually used for MFCC computation. The proposed method shows estimation performance which is identical to or better than state-of-the-art methods. It further shows comparable ASR performance, where the advantage of being able to use mel-frequency speech features based on a power non...

  11. Attenuation correction for renal scintigraphy with 99mTc-DMSA: analysis between Raynaud and the geometric mean methods

    International Nuclear Information System (INIS)

    Argenta, Jackson; Brambilla, Claudia R.; Silva, Ana Maria M. da

    2010-01-01

    The evaluation of the index of renal function (IF) requires soft-tissue attenuation correction. This paper investigates the impact over the IF, when attenuation correction is applied using the Raynaud method and the Geometric Mean method in renal planar scintigraphy, using posterior and anterior views. The study was conducted with Monte Carlo simulated images of five GSF family voxel phantoms with different relative uptakes in each kidney from normal (50% -50%) to pathological (10% -90%). The results showed that Raynaud method corrects more efficiently the cases where the renal depth is close to the value of the standard phantom. The geometric mean method showed similar results to the Raynaud method for Baby, Child and Golem. For Helga and Donna models, the errors were above 20%, increasing with relative uptake. Further studies should be conducted to assess the influences of the standard phantom in the correcting attenuation methods. (author)

  12. Water-equivalent solid sources prepared by means of two distinct methods

    International Nuclear Information System (INIS)

    Koskinas, Marina F.; Yamazaki, Ione M.; Potiens Junior, Ademar

    2014-01-01

    The Nuclear Metrology Laboratory at IPEN is involved in developing radioactive water-equivalent solid sources prepared from an aqueous solution of acrylamide using two distinct methods for polymerization. One of them is the polymerization by high dose of 60 Co irradiation; in the other method the solid matrix-polyacrylamide is obtained from an aqueous solution composed by acrylamide, catalyzers and an aliquot of a radionuclide. The sources have been prepared in cylindrical geometry. In this paper, the study of the distribution of radioactive material in the solid sources prepared by both methods is presented. (author)

  13. CASE METHOD AS A MEANS TO INTENSIFY THE EDUCATIONAL PROCESS OF INTENDING ECONOMISTS

    Directory of Open Access Journals (Sweden)

    Олександр Вашків

    2014-04-01

    Full Text Available The article presents practical aspects of case-method usage in the process of researching social responsibility of business. The paper also gives a detailed insight into a situational exercise on the level of its constituting elements. Case-method has been characterized in terms of its peculiarities and the advantages, and in comparison to the traditional teaching methods. This article also presents a scenario of a situational exercise «Our daily bread», which has been prepared as a result of authors’ participation in the state programme «the Ukrainian Initiative», which presupposed training at the enterprises in Germany.

  14. Compositions and methods for providing plants with tolerance to abiotic stress conditions

    KAUST Repository

    Hirt, Heribert; De Zelicourt, Axel; Saad, Maged

    2017-01-01

    It has been discovered that the desert endophytic bacterium SA187 SA187 can provide resistance or tolerance to abiotic stress conditions to seeds or plants. Compositions containing SA187 can be used to enhance plant development and yield under

  15. Reduction of gas flow nonuniformity in gas turbine engines by means of gas-dynamic methods

    Science.gov (United States)

    Matveev, V.; Baturin, O.; Kolmakova, D.; Popov, G.

    2017-08-01

    Gas flow nonuniformity is one of the main sources of rotor blade vibrations in the gas turbine engines. Usually, the flow circumferential nonuniformity occurs near the annular frames, located in the flow channel of the engine. This leads to the increased dynamic stresses in blades and as a consequence to the blade damage. The goal of the research was to find an acceptable method of reducing the level of gas flow nonuniformity as the source of dynamic stresses in the rotor blades. Two different methods were investigated during this research. Thus, this study gives the ideas about methods of improving the flow structure in gas turbine engine. On the basis of existing conditions (under development or existing engine) it allows the selection of the most suitable method for reducing gas flow nonuniformity.

  16. Realization of the Evristic Combination Methods by Means of Computer Graphics

    Directory of Open Access Journals (Sweden)

    S. A. Novoselov

    2012-01-01

    Full Text Available The paper looks at the ways of enhancing and stimulating the creative activity and initiative of pedagogic students – the prospective specialists called for educating and upbringing socially and professionally competent, originally thinking, versatile personalities. For developing their creative abilities the author recommends introducing the heuristic combination methods, applied for engineering creativity facilitation; associative-synectic technology; and computer graphics tools. The paper contains the comparative analysis of the main heuristic method operations and the computer graphics redactor in creating a visual composition. The examples of implementing the heuristic combination methods are described along with the extracts of the laboratory classes designed for creativity and its motivation developments. The approbation of the given method in the several universities confirms the prospects of enhancing the students’ learning and creative activities. 

  17. Measurement of heavy metals by means of a plasma-assisted method

    International Nuclear Information System (INIS)

    Hernberg, R.; Haeyrinen, V.; Oikari, R.

    1995-01-01

    The plasma-assisted measuring device for on-line measurement of alkali metal concentrations in pressurised processes, which has been developed in the Laboratory, will be further developed to provide for simultaneous measurement of heavy metal concentrations. (author)

  18. Surface structure analysis by means of Rutherford scattering: methods to study surface relaxation

    International Nuclear Information System (INIS)

    Turkenburg, W.C.; Soszka, W.; Saris, F.W.; Kersten, H.H.; Colenbrander, B.G.

    1976-01-01

    The use of Rutherford backscattering for structural analysis of single crystal surfaces is reviewed, and a new method is introduced. With this method, which makes use of the channeling and blocking phenomenon of light ions of medium energy, surface atoms can be located with a precision of 0.02 A. This is demonstrated in a measurement of surface relaxation for the Cu(110) surface. (Auth.)

  19. Optimal systems of means and methods and universal algorithm of decontamination of radio nuclide's contaminated soils

    International Nuclear Information System (INIS)

    Kutlakhmedov, Y.; Zezina, N.; Micheev, A.; Jouve, A.; Perepelyatnikov, G.

    1996-01-01

    This paper represents our data of comparative analysis of efficacy of different countermeasures in decontamination of soils in Ukraine in total and in case study Milyachi. On this base it was created of optimal algorithm of strategy of decontamination of soils which is based on method of usage turf harvester for unploughed soils and method of phytodesactivation for ploughed soils of Ukraine after Chernobyl accident

  20. Gas phase collision dynamics by means of pulse-radiolysis methods

    International Nuclear Information System (INIS)

    Hatano, Yoshihiko

    1989-01-01

    After a brief survey of recent advances in gas-phase collision dynamics studies using pulse radiolysis methods, the following two topics in our research programs are presented with emphasis on the superior advantages of the pulse radiolysis methods over the various methods of gas-phase collision dynamics, such as beam methods, swarm methods and flow methods. One of the topics is electron attachment to van der Waals molecules. The attachment rates of thermal electrons to O 2 and other molecules in dense gases have been measured in wide ranges of both gas temperatures and pressures, from which experimental evidence has been obtained for electron attachment to van der Waals molecules. The results have been compared with theories and discussed in terms of the effect of van der Waals interaction on the electron attachment resonance. The obtained conclusions have been related with investigations of electron attachment, solvation and localization in the condensed phase. The other is Penning ionization and its related processes. The rate constants for the de-excitation of He(2 1 P), He(2 3 S), Ne( 3 P 0 ), Ne( 3 P 1 ), Ne( 3 P 2 ), Ar( 1 P 1 ), Ar( 3 P 1 ), by atoms and molecules have been measured in the temperature range from 100 to 300 K, thus obtaining the collisional energy dependence of the de-excitation cross sections. The results are compared in detail with theories classified according to the excited rare gas atoms in the metastable and resonance states. (author)

  1. Combination of the method of basic precipitation of lanthanons with the ion exchange distribution method by means of ammonium acetate

    International Nuclear Information System (INIS)

    Hubicki, W.; Hubicka, H.

    1980-01-01

    The method of basic precipitation of lanthanons was combined with the ion exchange distribution method using ammonium acetate. As a result of chromatogram development 1:2 the good results of distribution of Sm -Nd, the fractions 99,9% Nd 2 O 3 and Pr 6 O 11 and 99,5% La 2 O 3 were obtained. It was found that the way of packing the column influenced greatly the efficiency of ion distribution. (author)

  2. Residual Stress Distribution In Heat Affected Zone Of Welded Steel By Means Of Neutron Diffraction Method

    International Nuclear Information System (INIS)

    Fajar, Andika; Prasuad; Gunawan; Muslich, M. Rifai

    1996-01-01

    Three dimensional residual stress distribution in the heat affected zone of 10 mm thick welded steel by means of neutron diffraction technique has been measured. The results showed that the residual stress was distributed near the welded metal, namely within about 46,25 mm. The major tensile stresses occurred in the X-direction, and they attained a level greater than 2000 MPa through the position far away fram the weld. The tensile stresses in the Y and Z- directions lied between 500 and 1500 MPa, The results also suggest that the stress in the surface was greater than that in the middle of the sample

  3. Homogeneity tests for variances and mean test under heterogeneity conditions in a single way ANOVA method

    International Nuclear Information System (INIS)

    Morales P, J.R.; Avila P, P.

    1996-01-01

    If we have consider the maximum permissible levels showed for the case of oysters, it results forbidding to collect oysters at the four stations of the El Chijol Channel ( Veracruz, Mexico), as well as along the channel itself, because the metal concentrations studied exceed these limits. In this case the application of Welch tests were not necessary. For the water hyacinth the means of the treatments were unequal in Fe, Cu, Ni, and Zn. This case is more illustrative, for the conclusion has been reached through the application of the Welch tests to treatments with heterogeneous variances. (Author)

  4. A novel method for rapid inspection of sewer networks: combining acoustic and optical means

    OpenAIRE

    Plihal, H.; Kretschmer, F.; Bin Ali, M.T.; See, C.H.; Romanova, A.; Horoshenkov, K.V.; Ertl, T.

    2015-01-01

    Operation and maintenance of the public sewer system represent key tasks for an\\ud operator. Condition assessment is usually conducted by conventional closed\\ud circuit television (CCTV) inspection. However, alternative tools such as\\ud manhole-zoom cameras (MZCs) and the acoustic technology SewerBatt® are\\ud available today.\\ud The INNOKANIS project investigates structural and operational condition\\ud assessment in the sewer system by means of 3 MZC models and SewerBatt® to\\ud develop a comb...

  5. Laser materials development by means of a solid-state bonding method

    International Nuclear Information System (INIS)

    Sugiyama, Akira

    2011-01-01

    This paper reviews laser materials development via a bonding method without adhesives. Instead of conventional chemical etching, a dry etching technique using an argon beam has been newly developed for the bonding method. This method meets the requirement for the use of optical materials. We succeeded in the fabrication of a composite laser crystal with good heat conductivity by bonding two kinds of crystals; one is neodymium-doped YVO 4 crystal (Nd:YVO 4 ) and the other is its host crystal YVO 4 . In the comparison of the laser performance between the normal and composite crystal, the composite one shows the good lasing capability of increasing laser output without fracture of the crystal due to thermal stress which appeared in the normal one. (author)

  6. Means and method for controlling the neutron output of a neutron generator tube

    International Nuclear Information System (INIS)

    Langford, O.M.; Peelman, H.E.

    1980-01-01

    A gas filled neutron tube in a nuclear well logging tool has a target an ion source voltage and a replenisher connected to ground. A negative high voltage is applied to the target by a power supply also providing a target current corresponding to the neutron output of the neutron generator tube. A constant current source provides a constant current. A network receiving the target current and the constant current provides a portion of the constant current as a replenisher current which is applied to the replenisher in a neutron generating tube. The network controls the magnitude of the replenisher current in accordance with the target current so as to control the neutron output of the neutron generating tube. (auth)

  7. A method of estimating hydrogen in solid and liquid samples by means of neutron thermalisation

    International Nuclear Information System (INIS)

    Carter, D.H.; Sanders, J.E.

    1967-06-01

    The count-rate of a cadmium-covered Pu239 fission chamber placed in a reactor neutron flux increases when a hydrogen-containing material is inserted due to the thermalisation of epicadmium neutrons. This effect forms the basis of a non-destructive method of estimating hydrogen in solid or liquid samples, and trial experiments to demonstrate the principles have been made. The sensitivity is such that hydrogen down to 10 p.p.m. in a typical metal should be detected. A useful feature of the method is its very low response to elements other than hydrogen. (author)

  8. Remarks on a financial inverse problem by means of Monte Carlo Methods

    Science.gov (United States)

    Cuomo, Salvatore; Di Somma, Vittorio; Sica, Federica

    2017-10-01

    Estimating the price of a barrier option is a typical inverse problem. In this paper we present a numerical and statistical framework for a market with risk-free interest rate and a risk asset, described by a Geometric Brownian Motion (GBM). After approximating the risk asset with a numerical method, we find the final option price by following an approach based on sequential Monte Carlo methods. All theoretical results are applied to the case of an option whose underlying is a real stock.

  9. The standard deviation method: data analysis by classical means and by neural networks

    International Nuclear Information System (INIS)

    Bugmann, G.; Stockar, U. von; Lister, J.B.

    1989-08-01

    The Standard Deviation Method is a method for determining particle size which can be used, for instance, to determine air-bubble sizes in a fermentation bio-reactor. The transmission coefficient of an ultrasound beam through a gassy liquid is measured repetitively. Due to the displacements and random positions of the bubbles, the measurements show a scatter whose standard deviation is dependent on the bubble-size. The precise relationship between the measured standard deviation, the transmission and the particle size has been obtained from a set of computer-simulated data. (author) 9 figs., 5 refs

  10. NMR system and method having a permanent magnet providing a rotating magnetic field

    Science.gov (United States)

    Schlueter, Ross D [Berkeley, CA; Budinger, Thomas F [Berkeley, CA

    2009-05-19

    Disclosed herein are systems and methods for generating a rotating magnetic field. The rotating magnetic field can be used to obtain rotating-field NMR spectra, such as magic angle spinning spectra, without having to physically rotate the sample. This result allows magic angle spinning NMR to be conducted on biological samples such as live animals, including humans.

  11. The duty to provide information in the case of neuroradiological examination methods

    International Nuclear Information System (INIS)

    Deutsch, E.

    1987-01-01

    The author gives a survey on the judicial decisions concerning the obligation to give information in the case of neuroradiological examination methods. The scope and content of the medical explanation depends inter alia on the urgency and the necessity of the medical diagnosis and on the understanding of the patient. (WG) [de

  12. Vehicle Tracking System, Vehicle Infrastructure Provided with Vehicle Tracking System and Method for Tracking

    NARCIS (Netherlands)

    Papp, Z.; Doodeman, G.J.N.; Nelisse, M.W.; Sijs, J.; Theeuwes, J.A.C.; Driessen, B.J.F.

    2010-01-01

    A vehicle tracking system is described comprising - a plurality of sensor nodes (10) that each provide a message (D) indicative for an occupancy status of a detection area of an vehicle infrastructure monitored by said sensor node, said sensor nodes (10) being arranged in the vehicle infrastructure

  13. Compositions and methods for providing plants with tolerance to abiotic stress conditions

    KAUST Repository

    Hirt, Heribert

    2017-07-27

    It has been discovered that the desert endophytic bacterium SA187 SA187 can provide resistance or tolerance to abiotic stress conditions to seeds or plants. Compositions containing SA187 can be used to enhance plant development and yield under environmental stress conditions.

  14. K-Means Algorithm Performance Analysis With Determining The Value Of Starting Centroid With Random And KD-Tree Method

    Science.gov (United States)

    Sirait, Kamson; Tulus; Budhiarti Nababan, Erna

    2017-12-01

    Clustering methods that have high accuracy and time efficiency are necessary for the filtering process. One method that has been known and applied in clustering is K-Means Clustering. In its application, the determination of the begining value of the cluster center greatly affects the results of the K-Means algorithm. This research discusses the results of K-Means Clustering with starting centroid determination with a random and KD-Tree method. The initial determination of random centroid on the data set of 1000 student academic data to classify the potentially dropout has a sse value of 952972 for the quality variable and 232.48 for the GPA, whereas the initial centroid determination by KD-Tree has a sse value of 504302 for the quality variable and 214,37 for the GPA variable. The smaller sse values indicate that the result of K-Means Clustering with initial KD-Tree centroid selection have better accuracy than K-Means Clustering method with random initial centorid selection.

  15. Kinetic investigation of heterogeneous catalytic reactions by means of the kinetic isotope method

    Energy Technology Data Exchange (ETDEWEB)

    Bauer, F; Dermietzel, J [Akademie der Wissenschaften der DDR, Leipzig. Zentralinstitut fuer Isotopen- und Strahlenforschung

    1978-09-01

    The application of the kinetic isotope method to heterogeneous catalytic processes is possible for surface compounds by using the steady-state relation. However, the characterization of intermediate products becomes ambiguous if sorption rates are of the same order of magnitude as surface reactions rates. The isotopic exchange reaction renders possible the estimation of sorption rates.

  16. Measuring subjective meaning structures by the laddering method: Theoretical considerations and methodological problems

    DEFF Research Database (Denmark)

    Grunert, Klaus G.; Grunert, Suzanne C.

    1995-01-01

    Starting from a general model of measuring cognitive structures for predicting consumer behaviour, we discuss laddering as a possible method to obtain estimates of consumption-relevant cognitive structures which will have predictive validity. Four criteria for valid measurement are derived and ap...

  17. Implementation of a quantitative Foucault knife-edge method by means of isophotometry

    Science.gov (United States)

    Zhevlakov, A. P.; Zatsepina, M. E.; Kirillovskii, V. K.

    2014-06-01

    Detailed description of stages of computer processing of the shadowgrams during implementation of a modern quantitative Foucault knife-edge method is presented. The map of wave-front aberrations introduced by errors of an optical surface or a system, along with the results of calculation of the set of required characteristics of image quality, are shown.

  18. "I See What You Mean": Using Visual Data Collection Methods to Explore Leadership Curriculum Planning

    Science.gov (United States)

    Reid, Anna; Koglbauer, René

    2018-01-01

    This article reports on the use of a visual methods approach to collecting and analysing data in relation to the area of leadership curriculum development. The focus of the study is the structure of the current leadership curriculum for the National Professional Qualifications (NPQs) in England. In particular, the authors explore the extent to…

  19. Method of projects on informatics lesson - as means of pupils’ informative competency development.

    Directory of Open Access Journals (Sweden)

    О. Staryh

    2008-06-01

    Full Text Available Information competence forms most effectively by pupils under joint execution of three conditions: problem-solving education, using of multimedia technologies and drafts method. Untraditional lessons that are conducted in Kherson Academical Lyceum help to arouse children’s longing to self-education, realization of their abilities.

  20. Prediction method of long-term reliability in improving residual stresses by means of surface finishing

    International Nuclear Information System (INIS)

    Sera, Takehiko; Hirano, Shinro; Chigusa, Naoki; Okano, Shigetaka; Saida, Kazuyoshi; Mochizuki, Masahito; Nishimoto, Kazutoshi

    2012-01-01

    Surface finishing methods, such as Water Jet Peening (WJP), have been applied to welds in some major components of nuclear power plants as a counter measure to Primary Water Stress Corrosion Cracking (PWSCC). In addition, the methods of surface finishing (buffing treatment) is being standardized, and thus the buffing treatment has been also recognized as the well-established method of improving stress. On the other hand, the long-term stability of peening techniques has been confirmed by accelerated test. However, the effectiveness of stress improvement by surface treatment is limited to thin layers and the effect of complicated residual stress distribution in the weld metal beneath the surface is not strictly taken into account for long-term stability. This paper, therefore, describes the accelerated tests, which confirmed that the long-term stability of the layer subjected to buffing treatment was equal to that subjected to WJP. The long-term reliability of very thin stress improved layer was also confirmed through a trial evaluation by thermal elastic-plastic creep analysis, even if the effect of complicated residual stress distribution in the weld metal was excessively taken into account. Considering the above findings, an approach is proposed for constructing the prediction method of the long-term reliability of stress improvement by surface finishing. (author)

  1. Discussion of plastic instabilities of a pressure vessel by means of the finite element method

    International Nuclear Information System (INIS)

    Laemmer, H.; Ritter, B.; Tsakmakis, C.

    1994-06-01

    In this report the influence of geometrical and thermal imperfections on the load-carrying capacity of pressure vessels has been studied by means of the ABAQUS finite element code. Using a thermo-plasticity model for finite strains failure due to plastic instability has been investigated. The parameters needed for this model were identified with uniaxial tensile tests. The parameters were fitted in such a way that necking of the tensile rod was described in a satisfactory manner. Starting from the tensile rod the influence of imperfections on necking of a structure is discussed. Axisymmetric and three dimensional calculations showed that for a sufficient size of the imperfection necking can be obtained. As expected, the maximum internal pressure at failure and the beginning of localization of plastic deformations depend on the size of the imperfection. (orig.) [de

  2. Determination of the shape factor of 90Sr by means of the cutoff energy yield method

    International Nuclear Information System (INIS)

    Grau Carles, A.; Kossert, K.; Grau Malonda, A.

    2008-01-01

    Usually, Kurie plots are used to analyze beta-spectra shape-factor functions measured by means of semiconductor and magnetic spectrometers. A drawback of these techniques is the occurrence of self-absorption within the samples through which the emission spectrum is altered. In liquid-scintillation samples self-absorption does not occur, but the poor energy resolution makes the analysis of the spectra difficult. To overcome this problem, two resolution-invariant observables are used for determining the shape-factor function of 90 Sr: (1) the maximum point energy and (2) the cutoff energy yield. The measured shape-factor function of 90 Sr agrees with the one which is predicted by theory for the first-forbidden unique transition

  3. Development of methods and means to improve the financial monitoring system

    International Nuclear Information System (INIS)

    Spiridonov, A.M.

    2011-01-01

    The paper discusses the ways of enhancing the effectiveness of National system of financial monitoring, or Russian national system of counteraction to legalization (laundering) of proceeds from crime and financing of terrorism (NS CLP/FT). The author suggests that to achieve this goal it is necessary to solve the following main objectives: to study the current state of the NS CLP/FT, and to build its structural and functional models, to determine the criteria of efficiency of the system, to develop a methodology to assess the effectiveness of the NS CLP/FT, to apply it and to identify promising trends of this system development. On the basis of the obtained data, it is proposed to develop a means of increasing the effectiveness of the NS CLP/FT [ru

  4. A Novel Resource Management Method of Providing Operating System as a Service for Mobile Transparent Computing

    Directory of Open Access Journals (Sweden)

    Yonghua Xiong

    2014-01-01

    Full Text Available This paper presents a framework for mobile transparent computing. It extends the PC transparent computing to mobile terminals. Since resources contain different kinds of operating systems and user data that are stored in a remote server, how to manage the network resources is essential. In this paper, we apply the technologies of quick emulator (QEMU virtualization and mobile agent for mobile transparent computing (MTC to devise a method of managing shared resources and services management (SRSM. It has three layers: a user layer, a manage layer, and a resource layer. A mobile virtual terminal in the user layer and virtual resource management in the manage layer cooperate to maintain the SRSM function accurately according to the user’s requirements. An example of SRSM is used to validate this method. Experiment results show that the strategy is effective and stable.

  5. A novel resource management method of providing operating system as a service for mobile transparent computing.

    Science.gov (United States)

    Xiong, Yonghua; Huang, Suzhen; Wu, Min; Zhang, Yaoxue; She, Jinhua

    2014-01-01

    This paper presents a framework for mobile transparent computing. It extends the PC transparent computing to mobile terminals. Since resources contain different kinds of operating systems and user data that are stored in a remote server, how to manage the network resources is essential. In this paper, we apply the technologies of quick emulator (QEMU) virtualization and mobile agent for mobile transparent computing (MTC) to devise a method of managing shared resources and services management (SRSM). It has three layers: a user layer, a manage layer, and a resource layer. A mobile virtual terminal in the user layer and virtual resource management in the manage layer cooperate to maintain the SRSM function accurately according to the user's requirements. An example of SRSM is used to validate this method. Experiment results show that the strategy is effective and stable.

  6. METHODS OF PROVIDING NOISE IMMUNITY IN AUTOMOBILE ANTI-THEFT SYSTEM CONTROL

    Directory of Open Access Journals (Sweden)

    Frolov, V.

    2013-06-01

    Full Text Available In modern ani-theft systems they use frequency and phase modulation. Since the width of the signal is limited, it is possible to intercept the signal and then switch off the alarm at the right time.To ensure the noise immunity and secrecy manufacturers use more sophisticated codes using the methods of cryptography. Significant increase in noise immunity in modern ani-theft systems is possible using broadband signals.

  7. System and Method for Providing Web-Based Remote Application Service

    OpenAIRE

    Shuen-Tai Wang; Yu-Ching Lin; Hsi-Ya Chang

    2017-01-01

    With the development of virtualization technologies, a new type of service named cloud computing service is produced. Cloud users usually encounter the problem of how to use the virtualized platform easily over the web without requiring the plug-in or installation of special software. The object of this paper is to develop a system and a method enabling process interfacing within an automation scenario for accessing remote application by using the web browser. To meet this challenge, we have ...

  8. Cloud Service Provider Methods for Managing Insider Threats: Analysis Phase 2, Expanded Analysis and Recommendations

    Science.gov (United States)

    2014-01-01

    and software as a service ( SaaS )) for staff’s abnormal behavior that may indicate an insider incident. As mentioned above, combining SIEM data...Mellon Software Engineering Institute, contacted commercial and government cloud service providers (CSPs) to better understand the administrative and...availability services . We have observed a number of scenarios in which a customer leaves a CSP’s IaaS, PaaS, or SaaS , but its data remains online for some

  9. Modeling of asphalt by means of discrete element method – an initial study

    DEFF Research Database (Denmark)

    Feng, Huan; Hededal, Ole; Stang, Henrik

    of conducting time-consuming and lab-costly procedures. The use of numerical models, capable of reducing greatly the testing cost, has shown great potential in characterizing asphalt-aggregate mixtures for both material evaluation and structural design purposes, [1],[2]. Discrete element method (DEM) is one...... – will be applied. The work presented here will focus on the discrete element method as a tool for modelling composite materials, i.e. determination of a representative volume; boundary conditions; characterisation of the components mastic (binder + filler) and aggregates; and establishment of virtual test samples....... Results from initial tests will be presented and the future development of the model towards characterising asphalt from its composition will be outlined....

  10. Reprojection method using CT data. New means of visualization by improved technique

    International Nuclear Information System (INIS)

    Ishimori, Yoshiyuki; Tanaka, Masato; Komuro, Hiroyuki

    1995-01-01

    Reprojection Method (RPM) using computed tomography (CT) data can create simulating images of plain X-ray film. We could create material extracted images by selecting projected CT values, and created tomographic images by selecting spatial values. Virtual X-ray source can be set anywhere. So it can create stereographic images composed of a pair of beam's eye view, and can create panoramic images to set the source inside the volume data. Since RPM does not need the binaryzation process, the densities of the image reflect the original CT value of each voxel. RPM using CT data is a useful method to get the most information regarding X-ray attenuation and to cope with the fast scan CT system. (author)

  11. Simulation of acoustic streaming by means of the finite-difference time-domain method

    DEFF Research Database (Denmark)

    Santillan, Arturo Orozco

    2012-01-01

    Numerical simulations of acoustic streaming generated by a standing wave in a narrow twodimensional cavity are presented. In this case, acoustic streaming arises from the viscous boundary layers set up at the surfaces of the walls. It is known that streaming vortices inside the boundary layer have...... directions of rotation that are opposite to those of the outer streaming vortices (Rayleigh streaming). The general objective of the work described in this paper has been to study the extent to which it is possible to simulate both the outer streaming vortices and the inner boundary layer vortices using...... the finite-difference time-domain method. To simplify the problem, thermal effects are not considered. The motivation of the described investigation has been the possibility of using the numerical method to study acoustic streaming, particularly under non-steady conditions. Results are discussed for channels...

  12. The Sorption Behavior of Wood Studied by Means of an Improved Cup Method

    DEFF Research Database (Denmark)

    Eitelberger, Johannes; Svensson, Staffan

    2012-01-01

    background of transport processes, a special experimental test setup—the improved cup method—is presented. It allows for separation of sorption from other processes. In this test, a diffusion cup contains a thin specimen of wood, with one side facing outwards to a climate chamber and the opposite side facing...... inwards the cup. In contrast to the common cup method, the herein presented method uses a data logger for relative humidity and temperature placed inside the cup. The use of thin cross-cut specimens allows for explicit separation of the different processes occurring during transient moisture transport....... Mass changes were determined and relative humidity inside the cups was measured for eight specimens of Norway spruce with different specimen thicknesses. Relative humidity was increased in three uniform steps in the test chamber from 4.0 up to 76.5%. The results obtained with this special test setup...

  13. Carbon nanowalls synthesis by means of atmospheric dcPECVD method

    International Nuclear Information System (INIS)

    Mesko, Marcel; Kotrusz, Peter; Skakalova, Viera; Vretenar, Viliam; Hulman, Martin; Soltys, Jan

    2012-01-01

    Carbon nanowalls (CNWs) were grown by atmospheric dc plasma enhanced chemical vapour deposition method. Maintaining plasma at atmospheric pressure give us possibility to synthetize CNWs at high rate. By using two different liquid carbon sources we can control CNWs density. Growth of sparsely distributed CNWs can be achieved by using ethanol, while hexane gives densely packed CNWs films. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  14. Analysis of radioactive corrosion test specimens by means of ICP-MS. Comparison with earlier methods

    International Nuclear Information System (INIS)

    Forsyth, Roy

    1997-07-01

    In June 1992, an ICP-MS instrument (Inductively Coupled Plasma-Mass Spectrometry) was commissioned for use with radioactive sample solutions at Studsvik Nuclear's Hot Cell Laboratory. For conventional environmental samples the instrument permits the simultaneous analysis of many trace elements, but the software used in evaluation of the mass spectra is based on a library of isotopic compositions relevant only for elements in the lithosphere. Fission products and actinides, however, have isotopic compositions which are significantly different from the natural elements, and which also vary with the burnup of the nuclear fuel specimen. Consequently, a spread-sheet had to be developed which could evaluate the mass spectra with these isotopic compositions. Following these preparations, a large number of samples (about 200) from SKB's experimental programme for the study of spent fuel corrosion have been analyzed by the ICP-MS technique. Many of these samples were archive solutions of samples which had been taken earlier in the programme. This report presents a comparison of the analytical results for uranium, plutonium, cesium, strontium and technetium by both the ICP-MS technique, and the previously used analytical methods. For three products, a satisfactory agreement between the results from the various methods was obtained, but for uranium and plutonium the ICP-MS method gave results which were 10-20% higher than the conventional methods. The comparison programme has also shown, not unexpectedly, that significant losses of plutonium from solution had occurred, by precipitation and/or absorption, in the archive solutions during storage. It can be expected that such losses also occur for the other actinides, and consequently, all the analytical results for actinides in older archive solutions must be treated with great caution. 9 refs

  15. The Extraction of Heavy Metals by Means of a New Electrolytic Method

    International Nuclear Information System (INIS)

    Guiragossian, Z. G.; Martoyan, G. A.; Injeyan, S. G.; Tonikyan, S. G.; Nalbandyan, G. G.

    2003-01-01

    The extraction of metals in known metallurgical methods is pursued on the basis of separating as much as possible the desired metal's content from the ore concentrate, in the most economical manner. When these principles are also applied to the extraction of heavy metals, the related environmental factors do not readily meet with requirements. Today, an acceptable extraction technology for metals must satisfy the need to produce the deep separation of metals from their source in both economical and environmentally safe manner. This pertains to the direction of our ongoing research and development, among others in the field of environmental remediation. Earlier, we successfully addressed in an environmentally safe manner the selective extraction of radioactive isotopes from liquid radioactive wastes, produced at Armenia's Metzamor Nuclear Power Plant and implemented a functioning LRW station at the NPP. Currently, we extended our new electrodialysis-based electrolytic method in a laboratory scale, for the extraction and deep separation of different metals, including the heavy metals. Our new method, its efficiency, economy and full compliance with environmental issues will be presented

  16. Rapid maxillary expansion effects: An alternative assessment method by means of cone-beam tomography

    Directory of Open Access Journals (Sweden)

    Camilo Aquino Melgaço

    2014-10-01

    Full Text Available INTRODUCTION: This study aims to develop a method to assess the changes in palatal and lingual cross-sectional areas in patients submitted to rapid maxillary expansion (RME. METHODS: The sample comprised 31 Class I malocclusion individuals submitted to RME and divided into two groups treated with Haas (17 patients and Hyrax (14 patients expanders. Cone-beam computed tomography scans were acquired at T0 (before expansion and T1 (six months after screw stabilization. Maxillary and mandibular cross-sectional areas were assessed at first permanent molars and first premolars regions and compared at T0 and T1. Mandibular occlusal area was also analyzed. RESULTS: Maxillary cross-sectional areas increased in 56.18 mm2 and 44.32 mm2 for the posterior and anterior regions. These values were smaller for the mandible, representing augmentation of 40.32 mm2 and 39.91 mm2 for posterior and anterior sections. No differences were found when comparing both expanders. Mandibular occlusal area increased 43.99mm2 and mandibular incisors proclined. Increments of 1.74 mm and 1.7 mm occurred in mandibular intermolar and interpremolar distances. These same distances presented increments of 5.5 mm and 5.57 mm for the maxillary arch. CONCLUSION: Occlusal and cross-sectional areas increased significantly after RME. The method described seems to be reliable and precise to assess intraoral area changes.

  17. A Trajectory Regression Clustering Technique Combining a Novel Fuzzy C-Means Clustering Algorithm with the Least Squares Method

    Directory of Open Access Journals (Sweden)

    Xiangbing Zhou

    2018-04-01

    Full Text Available Rapidly growing GPS (Global Positioning System trajectories hide much valuable information, such as city road planning, urban travel demand, and population migration. In order to mine the hidden information and to capture better clustering results, a trajectory regression clustering method (an unsupervised trajectory clustering method is proposed to reduce local information loss of the trajectory and to avoid getting stuck in the local optimum. Using this method, we first define our new concept of trajectory clustering and construct a novel partitioning (angle-based partitioning method of line segments; second, the Lagrange-based method and Hausdorff-based K-means++ are integrated in fuzzy C-means (FCM clustering, which are used to maintain the stability and the robustness of the clustering process; finally, least squares regression model is employed to achieve regression clustering of the trajectory. In our experiment, the performance and effectiveness of our method is validated against real-world taxi GPS data. When comparing our clustering algorithm with the partition-based clustering algorithms (K-means, K-median, and FCM, our experimental results demonstrate that the presented method is more effective and generates a more reasonable trajectory.

  18. Improvement of the cruise performances of a wing by means of aerodynamic optimization. Validation with a Far-Field method

    Science.gov (United States)

    Jiménez-Varona, J.; Ponsin Roca, J.

    2015-06-01

    Under a contract with AIRBUS MILITARY (AI-M), an exercise to analyze the potential of optimization techniques to improve the wing performances at cruise conditions has been carried out by using an in-house design code. The original wing was provided by AI-M and several constraints were posed for the redesign. To maximize the aerodynamic efficiency at cruise, optimizations were performed using the design techniques developed internally at INTA under a research program (Programa de Termofluidodinámica). The code is a gradient-based optimizaa tion code, which uses classical finite differences approach for gradient computations. Several techniques for search direction computation are implemented for unconstrained and constrained problems. Techniques for geometry modifications are based on different approaches which include perturbation functions for the thickness and/or mean line distributions and others by Bézier curves fitting of certain degree. It is very e important to afford a real design which involves several constraints that reduce significantly the feasible design space. And the assessment of the code is needed in order to check the capabilities and the possible drawbacks. Lessons learnt will help in the development of future enhancements. In addition, the validation of the results was done using also the well-known TAU flow solver and a far-field drag method in order to determine accurately the improvement in terms of drag counts.

  19. Supplier Risk Assessment Based on Best-Worst Method and K-Means Clustering: A Case Study

    Directory of Open Access Journals (Sweden)

    Merve Er Kara

    2018-04-01

    Full Text Available Supplier evaluation and selection is one of the most critical strategic decisions for developing a competitive and sustainable organization. Companies have to consider supplier related risks and threats in their purchasing decisions. In today’s competitive and risky business environment, it is very important to work with reliable suppliers. This study proposes a clustering based approach to group suppliers based on their risk profile. Suppliers of a company in the heavy-machinery sector are assessed based on 17 qualitative and quantitative risk types. The weights of the criteria are determined by using the Best-Worst method. Four factors are extracted by applying Factor Analysis to the supplier risk data. Then k-means clustering algorithm is applied to group core suppliers of the company based on the four risk factors. Three clusters are created with different risk exposure levels. The interpretation of the results provides insights for risk management actions and supplier development programs to mitigate supplier risk.

  20. Development of high-density bentonite barriers by means of spraying methods. Part 2. Investigation of field conditions

    International Nuclear Information System (INIS)

    Tanaka, Toshiyuki; Kobayashi, Ichizo; Nakajima, Makoto; Toida, Masaru

    2006-01-01

    The authors have developed a method of constructing high-density bentonite by means of wet spraying to act as a backfill material in narrow places in radioactive waste disposal facilities. On the basis of the results of laboratory tests, they conducted field spraying tests to investigate the field conditions. The results of these tests are summarized as follows: 1) The bentonite could be sprayed smoothly by using a rotary spraying machine and a screw conveyor. 2) Provided that the air flow was at least 18.5 m 3 /min and the nozzle diameter did not exceed 25 mm, an average dry density of bentonite of 1.6 Mg/m 3 or higher could be achieved. 3) The dry density was constant within the spraying distance range 500 mm ∼ 2000 mm. 4) With a nozzle diameter of 19 mm, a spraying distance of 1000 mm, and a water content of 19.5%, an average dry density of the sprayed bentonite of 1.6 Mg/m 3 or higher and a rebound ratio not exceeding 30% was achieved. 5) The dry density of the sprayed bentonite decreased as the volume of bentonite supplied was increased, and it was shows to be closely related to the rotational speed of the spraying machine and the volume of bentonite sprayed from each hole. (author)

  1. Methods for estimating the occurrence of polypharmacy by means of a prescription database

    DEFF Research Database (Denmark)

    Bjerrum, L; Rosholm, J U; Hallas, J

    1997-01-01

    to equal the amount of drug purchased, as measured in defined daily doses (DDD), thereby assuming a daily intake of one DDD. PP was defined as overlapping periods of consumption for different drugs. A Venn diagram was used to illustrate and compare this estimator of PP with two other indicators of multiple......-drug use: the number of drugs purchased in 3 months and the mean number of drugs used in 1 year. A receiver operating curve (ROC) was used to evaluate the possibility of predicting episodes of PP from the number of drugs purchased in 3 months. RESULTS: The proposed estimator of PP was robust towards...... for the first time in 1994 stabilised after approximately 6 months, resulting in an incidence of major PP of 0.2% and of minor PP of 1.2% per month. For individuals exposed to PP, the median number of days of exposure was 61 and 10.5% were exposed for more than 350 days of the year. Purchase of five or more...

  2. What do you mean "drunk"? Convergent validation of multiple methods of mapping alcohol expectancy memory networks.

    Science.gov (United States)

    Reich, Richard R; Ariel, Idan; Darkes, Jack; Goldman, Mark S

    2012-09-01

    The configuration and activation of memory networks have been theorized as mechanisms that underlie the often observed link between alcohol expectancies and drinking. A key component of this network is the expectancy "drunk." The memory network configuration of "drunk" was mapped by using cluster analysis of data gathered from the paired-similarities task (PST) and the Alcohol Expectancy Multi-Axial Assessment (AEMAX). A third task, the free associates task (FA), assessed participants' strongest alcohol expectancy associates and was used as a validity check for the cluster analyses. Six hundred forty-seven 18-19-year-olds completed these measures and a measure of alcohol consumption at baseline assessment for a 5-year longitudinal study. For both the PST and AEMAX, "drunk" clustered with mainly negative and sedating effects (e.g., "sick," "dizzy," "sleepy") in lighter drinkers and with more positive and arousing effects (e.g., "happy," "horny," "outgoing") in heavier drinkers, showing that the cognitive organization of expectancies reflected drinker type (and might influence the choice to drink). Consistent with the cluster analyses, in participants who gave "drunk" as an FA response, heavier drinkers rated the word as more positive and arousing than lighter drinkers. Additionally, gender did not account for the observed drinker-type differences. These results support the notion that for some emerging adults, drinking may be linked to what they mean by the word "drunk." PsycINFO Database Record (c) 2012 APA, all rights reserved.

  3. Mean Blood Pressure Assessment during Post-Exercise: Result from Two Different Methods of Calculation

    Directory of Open Access Journals (Sweden)

    Gianmarco Sainas, Raffaele Milia, Girolamo Palazzolo, Gianfranco Ibba, Elisabetta Marongiu, Silvana Roberto, Virginia Pinna, Giovanna Ghiani, Filippo Tocco, Antonio Crisafulli

    2016-09-01

    Full Text Available At rest the proportion between systolic and diastolic periods of the cardiac cycle is about 1/3 and 2/3 respectively. Therefore, mean blood pressure (MBP is usually calculated with a standard formula (SF as follows: MBP = diastolic blood pressure (DBP + 1/3 [systolic blood pressure (SBP – DBP]. However, during exercise this proportion is lost because of tachycardia, which shortens diastole more than systole. We analysed the difference in MBP calculation between the SF and a corrected formula (CF which takes into account changes in the diastolic and systolic periods caused by exercise-induced tachycardia. Our hypothesis was that the SF potentially induce a systematic error in MBP assessment during recovery after exercise. Ten healthy males underwent two exercise-recovery tests on a cycle-ergometer at mild-moderate and moderate-heavy workloads. Hemodynamics and MBP were monitored for 30 minutes after exercise bouts. The main result was that the SF on average underestimated MBP by –4.1 mmHg with respect to the CF. Moreover, in the period immediately after exercise, when sustained tachycardia occurred, the difference between SF and CF was large (in the order of -20-30 mmHg. Likewise, a systematic error in systemic vascular resistance assessment was present. It was concluded that the SF introduces a substantial error in MBP estimation in the period immediately following effort. This equation should not be used in this situation.

  4. COMPARISON OF ULTRASOUND IMAGE FILTERING METHODS BY MEANS OF MULTIVARIABLE KURTOSIS

    Directory of Open Access Journals (Sweden)

    Mariusz Nieniewski

    2017-06-01

    Full Text Available Comparison of the quality of despeckled US medical images is complicated because there is no image of a human body that would be free of speckles and could serve as a reference. A number of various image metrics are currently used for comparison of filtering methods; however, they do not satisfactorily represent the visual quality of images and medical expert’s satisfaction with images. This paper proposes an innovative use of relative multivariate kurtosis for the evaluation of the most important edges in an image. Multivariate kurtosis allows one to introduce an order among the filtered images and can be used as one of the metrics for image quality evaluation. At present there is no method which would jointly consider individual metrics. Furthermore, these metrics are typically defined by comparing the noisy original and filtered images, which is incorrect since the noisy original cannot serve as a golden standard. In contrast to this, the proposed kurtosis is the absolute measure, which is calculated independently of any reference image and it agrees with the medical expert’s satisfaction to a large extent. The paper presents a numerical procedure for calculating kurtosis and describes results of such calculations for a computer-generated noisy image, images of a general purpose phantom and a cyst phantom, as well as real-life images of thyroid and carotid artery obtained with SonixTouch ultrasound machine. 16 different methods of image despeckling are compared via kurtosis. The paper shows that visually more satisfactory despeckling results are associated with higher kurtosis, and to a certain degree kurtosis can be used as a single metric for evaluation of image quality.

  5. Calculation of one-loop anomalous dimensions by means of the background field method

    International Nuclear Information System (INIS)

    Morozov, A.Yu.

    1983-01-01

    The knowledge of propagators in background fields makes calculation of anomalous dimensions (AD) straightforward and brief. The paper illustrates this statement by calculation of AD of many spin-zero and one QCD operators up to the eighth dimension included. The method presented does not simplify calculations in case of four-quark operators, therefore these are not discussed. Together with calculational difficulties arising for operators with derivatives this limits capacities of the whole approach and leads to incompleteness of some mixing matrices found in the article

  6. Foundation of the semiclassical approximation by means of path integral methods

    International Nuclear Information System (INIS)

    Krisztinkovics, F.

    1984-01-01

    The aim of our study is to find a technically unique semiclassical treatment to describe the collision processes between heavy ions. Thereby it shall be started from a complete quantum mechanical formulation of the collision process. This aim requires: 1. A completely quantum mechanical initial formulation for the whole system, 2. a unique and conceptually clear transition to semiclassics. In order to fulfil the requirements a method is offered which is in closest connection with the Feynman propagator respectively influence functional. (orig./HSI) [de

  7. Apparatus and method of inserting a microelectrode in body tissue or the like using vibration means

    Science.gov (United States)

    Feldstein, C.; Crawford, D. W.; Kanabus, E. W. (Inventor)

    1979-01-01

    An arrangement for and method of inserting a glass microelectrode having a tip in the micron range into body tissue is presented. The arrangement includes a microelectrode. The top of the microelectrode is attached to the diaphragm center of a first speaker. The microelectrode tip is brought into contact with the tissue by controlling a micromanipulator. Thereafter, an audio signal is applied to the speaker to cause the microelectrode to vibrate and thereby pierce the tissue surface without breaking the microelectrode tip. Thereafter, the tip is inserted into the tissue to the desired depth by operating the micromanipulator with the microelectrode in a vibratory or non-vibratory state.

  8. A method for reducing energy dependence of thermoluminescence dosimeter response by means of filters

    International Nuclear Information System (INIS)

    Bapat, V.N.

    1980-01-01

    This work describes the application of the method of partial surface shielding for reducing the energy dependence of the X-ray and γ-ray response of a dosimeter containing a CaSO 4 :Dy thermoluminescent phosphor mixed with KCl. in pellet form. Results are given of approximate computation of filter combinations that accomplish this aim, and of experimental verifications. Incorporation of the described filter combination makes it possible to use this relatively sensitive dosimeter for environmental radiation monitoring. A similar approach could be applied to any type of dosimeter in the form of a thin pellet or wafer. (author)

  9. Studies of urea geometry by means of ab initio methods and computer simulations of liquids

    OpenAIRE

    Cirino, José Jair Vianna; Bertran, Celso Aparecido

    2002-01-01

    A study was carried out on the urea geometries using ab initio calculation and Monte Carlo computational simulation of liquids. The ab initio calculated results showed that urea has a non-planar conformation in the gas phase in which the hydrogen atoms are out of the plane formed by the heavy atoms. Free energies associated to the rotation of the amino groups of urea in water were obtained using the Monte Carlo method in which the thermodynamic perturbation theory is implemented. The magnitud...

  10. Determination of water in nuclear materials by means of the Karl Fischer method

    International Nuclear Information System (INIS)

    Pereira, W.; Rocha, S.M.R.; Atalla, L.T.; Abrao, A.

    1987-06-01

    Karl Fischer Method was adapted for water determination in uranium coumpounds and substances of nuclear interest, by using a comercial equipment. The experimental conditions for the analysis of U 3 O 8 , UO 3 , UO 2 , UF 4 KFnHF and (NH 4 ) 4 UO 2 (CO 3 ) 3 were established. The influence of the agitation and contact time between sample and solvent, of the sample weight, of the reaction end point determination and of the sample granulometry on the precision and accuracy of results was also studied. (Author) [pt

  11. Capacitors for Integrated Circuits Produced by Means of a Double Implantation Method

    International Nuclear Information System (INIS)

    Zukowski, P.; Partyka, J.; Wegierek, P.

    1998-01-01

    The paper presents a description of a method to produce capacitors in integrated circuits that consists in implanting weakly doped silicon with the same impurity, then subjecting it to annealing (producing the inner plate) and implanting it again with ions of neutral elements to produce the dielectric layer. Results of the testing capacitors produced that way are also presented. Unit capacity of C u = 4.5 nF/mm 2 at tgδ = 0.01 has been obtained. The authors are of the opinion that the interesting problem of discontinuous variations of dielectric losses and capacities considered as functions of temperature, must be viewed as an open problem. (author)

  12. A study on hepato-biliary and alimentary scintigram by means of triple tracer method

    International Nuclear Information System (INIS)

    Aibata, Hirofumi; Torizumi, Kazutami; Okada, Takashi; Kiji, Shigeyuki; Yamada, Ryusaku; Shimada, Kosuke; Taniguchi, Katsutoshi; Aoki, Yozo

    1987-01-01

    In order to evaluate the gastric emptying and postprandial mixing of bile with food, the scintigraphies of hepatobiliary and gastrointestinal tracts by using three different kinds of radioisotopes were performed simultaneously ( 99m Tc-E · HIDA for hepatobiliary scintigraphy, 111 In-DTPA containing orange juice and 131 I-albumin containing scrambled egg for gastrointestinal scintigraphy). This method was available for observation of gastric emptying of liquid and solid foods and also examination of the mixing effect of bile and food quantitatively. (author)

  13. Study of technological parameters influence on homogeneity of rubber mixings by means of radiotracer methods

    International Nuclear Information System (INIS)

    Koczorowska, E.

    1995-01-01

    The radiotracer methods have been worked out for analysis of physico-chemical phenomena. The analysis were carried out for rubber mixings in technological conditions and played a deciding role for quality of manufacturing assortment. The 35 S and 65 Zn have been used as radiotracers. Analysis of different technological parameters influence on behaviour of soluble and polymerized sulfur, zinc compounds as well as other components of the rubber mixing enables to formulate the conclusions important for rubber industry and technology from view point of quality of manufacturing products

  14. Method and means for measuring the anisotropy of a plasma in a magnetic field

    Science.gov (United States)

    Shohet, J.L.; Greene, D.G.S.

    1973-10-23

    Anisotropy is measured of a free-free-bremsstrahlungradiation-generating plasma in a magnetic field by collimating the free-free bremsstrahlung radiation in a direction normal to the magnetic field and scattering the collimated free- free bremsstrahlung radiation to resolve the radiation into its vector components in a plane parallel to the electric field of the bremsstrahlung radiation. The scattered vector components are counted at particular energy levels in a direction parallel to the magnetic field and also normal to the magnetic field of the plasma to provide a measure of anisotropy of the plasma. (Official Gazette)

  15. Physicians' opinions about partner notification methods: case reporting, patient referral, and provider referral.

    Science.gov (United States)

    Hogben, M; St Lawrence, J S; Montaño, D E; Kasprzyk, D; Leichliter, J S; Phillips, W R

    2004-02-01

    The United States has relied upon partner notification strategies to help break the chain of infection and re-infection for sexually transmitted diseases (STD). Physicians are a vital link in the system of STD control, but little is known of physician opinions about partner notification strategies. We collected opinions about partner notification from a national probability sample of physicians in specialties diagnosing STDs. Physicians responded to 17 questions about three relevant forms of STD partner notification: patient based referral, provider based referral, and case reporting. Exploratory factor analyses showed that responses for each form of partner notification could be grouped into four categories: perceived practice norms, infection control, patient relationships, and time/money. Multivariate analyses of the factors showed that physicians endorsed patient based referral most favourably and provider based referral least favourably. Physicians' opinions about partner notification strategies appear to reflect objective reality in some areas, but not in others. Strategies that improve the fit between physicians' opinions and effective notification are needed: some are discussed here.

  16. Simple Method to Estimate Mean Heart Dose From Hodgkin Lymphoma Radiation Therapy According to Simulation X-Rays

    Energy Technology Data Exchange (ETDEWEB)

    Nimwegen, Frederika A. van [Department of Psychosocial Research, Epidemiology, and Biostatistics, The Netherlands Cancer Institute, Amsterdam (Netherlands); Cutter, David J. [Clinical Trial Service Unit, University of Oxford, Oxford (United Kingdom); Oxford Cancer Centre, Oxford University Hospitals NHS Trust, Oxford (United Kingdom); Schaapveld, Michael [Department of Psychosocial Research, Epidemiology, and Biostatistics, The Netherlands Cancer Institute, Amsterdam (Netherlands); Rutten, Annemarieke [Department of Radiology, The Netherlands Cancer Institute, Amsterdam (Netherlands); Kooijman, Karen [Department of Psychosocial Research, Epidemiology, and Biostatistics, The Netherlands Cancer Institute, Amsterdam (Netherlands); Krol, Augustinus D.G. [Department of Radiation Oncology, Leiden University Medical Center, Leiden (Netherlands); Janus, Cécile P.M. [Department of Radiation Oncology, Erasmus MC Cancer Center, Rotterdam (Netherlands); Darby, Sarah C. [Clinical Trial Service Unit, University of Oxford, Oxford (United Kingdom); Leeuwen, Flora E. van [Department of Psychosocial Research, Epidemiology, and Biostatistics, The Netherlands Cancer Institute, Amsterdam (Netherlands); Aleman, Berthe M.P., E-mail: b.aleman@nki.nl [Department of Radiation Oncology, The Netherlands Cancer Institute, Amsterdam (Netherlands)

    2015-05-01

    Purpose: To describe a new method to estimate the mean heart dose for Hodgkin lymphoma patients treated several decades ago, using delineation of the heart on radiation therapy simulation X-rays. Mean heart dose is an important predictor for late cardiovascular complications after Hodgkin lymphoma (HL) treatment. For patients treated before the era of computed tomography (CT)-based radiotherapy planning, retrospective estimation of radiation dose to the heart can be labor intensive. Methods and Materials: Patients for whom cardiac radiation doses had previously been estimated by reconstruction of individual treatments on representative CT data sets were selected at random from a case–control study of 5-year Hodgkin lymphoma survivors (n=289). For 42 patients, cardiac contours were outlined on each patient's simulation X-ray by 4 different raters, and the mean heart dose was estimated as the percentage of the cardiac contour within the radiation field multiplied by the prescribed mediastinal dose and divided by a correction factor obtained by comparison with individual CT-based dosimetry. Results: According to the simulation X-ray method, the medians of the mean heart doses obtained from the cardiac contours outlined by the 4 raters were 30 Gy, 30 Gy, 31 Gy, and 31 Gy, respectively, following prescribed mediastinal doses of 25-42 Gy. The absolute-agreement intraclass correlation coefficient was 0.93 (95% confidence interval 0.85-0.97), indicating excellent agreement. Mean heart dose was 30.4 Gy with the simulation X-ray method, versus 30.2 Gy with the representative CT-based dosimetry, and the between-method absolute-agreement intraclass correlation coefficient was 0.87 (95% confidence interval 0.80-0.95), indicating good agreement between the two methods. Conclusion: Estimating mean heart dose from radiation therapy simulation X-rays is reproducible and fast, takes individual anatomy into account, and yields results comparable to the labor

  17. A Few Comments on Determining the Shapes of Hyperboloid Cooling Towers by the Means of Ambient Tangents Method

    OpenAIRE

    Jasińska, Elżbieta; Preweda, Edward

    2004-01-01

    The paper presents the contemplations on determining the parameters of location and shape of the model hyperboloid cooling tower by the means of the ambient tangents method. The attention has been drawn to the method of determining the so-called length of the tangent, understood as the horizontal distance between the station and the points of tangency with the structure, as well as to the impact of calculation of this length on the parameters of the shell being determined. The calculations of...

  18. SOME ASPECTS OF THE INTEGRATION OF CONTENT, FORMS, MEANS, METHODS OF TEACHING FOREIGN LANGUAGESIN THE CONDITIONS OF INFORMATIZATION OF EDUCATION

    Directory of Open Access Journals (Sweden)

    И Ю Мишота

    2016-12-01

    Full Text Available In article some questions of integration of training methods to foreign languages using means of informatization of education are considered.The attention that application of information technologies in teaching foreign languages integrally supplements is focused and expands possibilities of an effective solution of didactic tasks in case of creation of modern pedagogical models and is a certain factor of integration of methods and forms of education.

  19. Numerical simulation of the flow field in pump intakes by means of Lattice Boltzmann methods

    International Nuclear Information System (INIS)

    Schneider, A; Conrad, D; Böhle, M

    2013-01-01

    Lattice Boltzmann Methods are nowadays popular schemes for solving fluid flow problems of engineering interest. This popularity is due to the advantages of these schemes: For example, the meshing of the fluid domain can be performed fully automatically which results in great simplicity in handling complex geometries. In this paper a numerical scheme for the flow simulation in pump intakes based on a Lattice Boltzmann large eddy approach is presented. The ability of this scheme to capture the flow phenomena of the intake flow at different operating conditions is analysed. For the operational reliability and efficiency of pumps and pump systems, the incoming flow conditions are crucial. Since the efficiency and reliability requirements of pumps are rising and must be guaranteed, the flow conditions in pump intakes have to be evaluated during plant planning. Recent trends show that pump intakes are built more and more compact, which makes the flow in the intake even more complex. Numerical methods are a promising technique for conduction flow analysis in pump intakes, because they can be realised rapidly and cheaply

  20. Electrical Resistivity Measurement of Petroleum Coke Powder by Means of Four-Probe Method

    Science.gov (United States)

    Rouget, G.; Majidi, B.; Picard, D.; Gauvin, G.; Ziegler, D.; Mashreghi, J.; Alamdari, H.

    2017-10-01

    Carbon anodes used in Hall-Héroult electrolysis cells are involved in both electrical and chemical processes of the cell. Electrical resistivity of anodes depends on electrical properties of its constituents, of which carbon coke aggregates are the most prevalent. Electrical resistivity of coke aggregates is usually characterized according to the ISO 10143 standardized test method, which consists of measuring the voltage drop in the bed of particles between two electrically conducing plungers through which the current is also applied. Estimation of the electrical resistivity of coke particles from the resistivity of particle bed is a challenging task and needs consideration of the contribution of the interparticle void fraction and the particle/particle contact resistances. In this work, the bed resistivity was normalized by subtracting the interparticle void fraction. Then, the contact size was obtained from discrete element method simulation and the contact resistance was calculated using Holm's theory. Finally, the resistivity of the coke particles was obtained from the bed resistivity.

  1. Rainfall assimilation in RAMS by means of the Kuo parameterisation inversion: method and preliminary results

    Science.gov (United States)

    Orlandi, A.; Ortolani, A.; Meneguzzo, F.; Levizzani, V.; Torricella, F.; Turk, F. J.

    2004-03-01

    In order to improve high-resolution forecasts, a specific method for assimilating rainfall rates into the Regional Atmospheric Modelling System model has been developed. It is based on the inversion of the Kuo convective parameterisation scheme. A nudging technique is applied to 'gently' increase with time the weight of the estimated precipitation in the assimilation process. A rough but manageable technique is explained to estimate the partition of convective precipitation from stratiform one, without requiring any ancillary measurement. The method is general purpose, but it is tuned for geostationary satellite rainfall estimation assimilation. Preliminary results are presented and discussed, both through totally simulated experiments and through experiments assimilating real satellite-based precipitation observations. For every case study, Rainfall data are computed with a rapid update satellite precipitation estimation algorithm based on IR and MW satellite observations. This research was carried out in the framework of the EURAINSAT project (an EC research project co-funded by the Energy, Environment and Sustainable Development Programme within the topic 'Development of generic Earth observation technologies', Contract number EVG1-2000-00030).

  2. A new method for intraoperative localization of epilepsy focus by means of a gamma probe

    International Nuclear Information System (INIS)

    Carneiro Filho, Omar; Vilela Filho, Osvaldo; Ragazzo, Paulo Cesar; Fonseca, Lea Mirian Barbosa da

    2014-01-01

    Objective: to evaluate the utility of a new multimodal image-guided intervention technique to detect epileptogenic areas with a gamma probe as compared with intraoperative electrocorticography. Materials and methods: two symptomatic patients with refractory epilepsy underwent magnetic resonance imaging, videoelectroencephalography, brain SPECT scan, neuropsychological evaluation and were submitted to gamma probe-assisted surgery. Results: in patient 1, maximum radioactive count was initially observed on the temporal gyrus at about 3.5 cm posteriorly to the tip of the left temporal lobe. After corticotomy, the gamma probe indicated maximum count at the head of the hippocampus, in agreement with the findings of intraoperative electrocorticography. In patient 2, maximum count was observed in the occipital region at the transition between the temporal and parietal lobes (right hemisphere). During the surgery, the area of epileptogenic activity mapped at electrocorticography was also delimited, demarcated, and compared with the gamma probe findings. After lesionectomy, new radioactive counts were performed both in the patients and on the surgical specimens (ex-vivo). Conclusion: the comparison between intraoperative electrocorticography and gamma probe-assisted surgery showed similarity of both methods. The advantages of gamma probe include: noninvasiveness, low cost and capacity to demonstrate decrease in the radioactive activity at the site of excision after lesionectomy. (author)

  3. Standard Test Method for Impact Resistance of Monolithic Polycarbonate Sheet by Means of a Falling Weight

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1995-01-01

    1.1 This test method covers the determination of the energy required to initiate failure in monolithic polycarbonate sheet material under specified conditions of impact using a free falling weight. 1.2 Two specimen types are defined as follows: 1.2.1 Type A consists of a flat plate test specimen and employs a clamped ring support. 1.2.2 Type B consists of a simply supported three-point loaded beam specimen (Fig. 1) and is recommended for use with material which can not be failed using the Type A specimen. For a maximum drop height of 6.096 m (20 ft) and a maximum drop weight of 22.68 kg (50 lb), virgin polycarbonate greater than 12.70 mm (1/2 in.) thick will probably require use of the Type B specimen. Note 1 - See also ASTM Methods: D 1709, D 2444 and D 3029. This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of reg...

  4. Studies of leukemogenesis by means of in vitro CA membrane method

    International Nuclear Information System (INIS)

    Seki, Masatoshi; Yoshida, Kazuko; Shimizu, Shizuko; Nishimura, Mayumi

    1978-01-01

    A new method of hematopoietic colony formation in vitro with macrophage-fibroblast (M-F) layer, which forms on cellulose acetate membrane in the peritoneal cavity of mouse, has been developed in this laboratory. Granuloid colonies develop in M-F layer without any external colony stimulating factors. Clear dose-response relationship between the number of seeded bone marrow cells and the colony counts has been obtained. Erythroid colonies can develop too, only when Erythropoietin is added in culture medium. With this method, the kinetics of granulopoiesis was studied. Granuloid cell line is consisted from two compartments, i.e. proliferative and maturative compartment. The presence of some unknown regulatory mechanism between those compartments has been suggested. In leukemia, the influx of promyclocyte, an element of proliferative compartment, into maturative compartment is inhibited to various extent, so that tremendous enlargement of the former takes place. M-F layer is proved to play an active role on the production and transfer of leukemic virus. Leukemic stem cells capable of forming clusters in conventional semisolid cultures make the well-developed colonies in M-F layer in vitro. (author)

  5. REMOVAL OF HARDLY BIO-DEGRADABALE ORGANIC COMPOUNDS FROM WASTEWATER BY MEANS OF REAGENTLESS METHODS

    Directory of Open Access Journals (Sweden)

    Joanna Szulżyk-Cieplak

    2017-09-01

    Full Text Available The paper discusses the issue of removing persistent organic pollutants (POPs from wastewater, especially the polycyclic organic hydrocarbons (PAHs. The results obtained in literature studies indicate that the commonly employed traditional methods of wastewater treatment are not always efficient in eliminating the hardly bio-degradable pollutants. Therefore, extensive research is being conducted on the application of efficient POPs removal technologies. One of the considered variants involves incorporating advanced oxidation processes (AOP into the wastewater treatment systems based on the biological processes. These include the reagentless methods, e.g. the processes involving ultrasounds and hydrodynamic cavitation. On the basis of the author’s own studies conducted in a laboratory system comprising a static cavitation reactor, the possibility of applying hydrodynamic cavitation for the decomposition of PAHs was evaluated on the basis of model solutions of anthracene and phenanthrene. It was shown that the employed advanced oxidation process with hydro-cavitation has a significant impact on reducing the concentration of the considered PAHs. It was confirmed that the degradation degree of a substance depends on the intensity and the course of the cavitation process. The energy efficiency of the conducted process was analyzed as well and expressed as the ratio pertaining to the amount of the degraded compound to the electric energy supplied to the system.

  6. Assessment of dental implant stability by means of the electromechanical impedance method

    International Nuclear Information System (INIS)

    Boemio, Giovanni; Rizzo, Piervincenzo; Nardo, Luigi De

    2011-01-01

    Implant stability is a prerequisite for functional recovery in load-bearing prostheses. Robust, reliable and noninvasive methods to assess the bone interface of dental and orthopedic implants are increasingly demanded for clinical diagnosis and direct prognosis. In this paper, a study of the feasibility of a noninvasive method based on electromechanical impedance (EMI) to assess dental prostheses stability is presented. Two different dental screws were entrenched in polyurethane foams (Sawbones ® ) and immersed in a solution of nitric acid to allow material degradation, inversely simulating a bone healing process. This process was monitored by bonding a piezoceramic transducer (PZT) to the implant and measuring the admittance of the PZT over time. It was found that the PZT's conductance and the statistical features associated with its analysis were sensitive to the degradation of the foams and can be correlated to the Sawbones mechanical properties. The present study shows promising results and may pave the road towards an innovative approach for the noninvasive monitoring of implanted prostheses

  7. ASSESSMENT OF CERAMIC TILE FROST RESISTANCE BY MEANS OF THE FREQUENCY INSPECTION METHOD

    Directory of Open Access Journals (Sweden)

    MICHAL MATYSÍK

    2011-06-01

    Full Text Available The paper presents some results of our experimental analysis of ceramic cladding element frost resistance, particular attention being paid to the application of the frequency inspection method. Three different sets of ceramic tiles of the Ia class to EN 14 411 B standard made by various manufacturers have been analyzed. The ceramic tiles under investigation have been subjected to freeze-thaw-cycle-based degradation in compliance with the relevant ČSN EN ISO 10545-12 standard. Furthermore, accelerated degradation procedure has been applied to selected test specimens, consisting in reducing the temperature of water soaked ceramic tiles in the course of the degradation cycles down –70°C. To verify the correctness of the frequency inspection results, additional physical properties of the ceramic tiles under test have been measured, such as, the ceramic tile strength limit, modulus of elasticity and modulus of deformability, resulting from the flexural tensile strength tests, integrity defect and surface micro-geometry tracking. It has been proved that the acoustic method of frequency inspection is a sensitive indicator of the structure condition and can be applied to the ceramic cladding element frost resistance and service life prediction assessment.

  8. Methods and means for the in-house training of mining machine operators

    Directory of Open Access Journals (Sweden)

    Velikanov Vladimir

    2017-01-01

    Full Text Available This study investigates the quality issue of the in-house training process for mining machine operators. The authors prove the urgency of the designated problem. The changes in modern society, as well as the development of science and technology have a direct impact on the vocational education system. This paper describes the main aspects of the in-house training process of mining machine operators; define the essence, structure, contents, and main directions of its revitalization. The following solutions are proposed in order to improve the quality of the in-house training process: to use the original method based on a rating system of the operator knowledge evaluation, active and interactive forms of using modern training technologies. The authors conducted testing techniques in mining enterprises with the aim of confirming the adequacy of the suggested approaches. The results are given in the work. It was proposed that the methods and tools integration has a positive impact on professional training system.

  9. Predictive ability of the feeding system in Iberian pig by means of several analytical methods

    Directory of Open Access Journals (Sweden)

    González, E.

    2013-04-01

    Full Text Available The reliability of several analytical methods proposed to predict the feeding system received by Iberian pigs during the fattening period has been contrasted. Samples of subcutaneous adipose tissue were analyzed from 38 batches of pigs fattened in three seasons of montanera (acorn and pastures feeding. They corresponded to the four categories described in the Quality Standard for Iberian pig products: 251 samples of bellota, 164 of recebo, 197 of cebo de campo and 137 of cebo. To perform the study, the following analytical methods were used: fatty acid quantification, NIR, alpha and gamma tocopherol, chemical sensor, triacilglycerides, stable isotopes and neophytadiene. The laboratories received the samples without any information about the fattening system to which they belonged and remitted their predictions with respect to the above categories. The results showed a high percentage of accurate predictions of the methods when the fattening type corresponds to the extreme categories (bellota and cebo, however, the methods had difficulty in discerning between samples from a mixed feeding regime with acorn and feed (recebo and problems when pigs are fattened with compound feeds including vegetable fats with high levels of oleic acid. Although a simplification into only two categories (cebo/campo and recebo/bellota results in a success rate higher than 90% for some methods, the combination of two or three techniques with problematic samples allows for differentiating among the four categories with the same accuracy.Se ha contrastado la fiabilidad de varios métodos analíticos para determinar el tipo de alimentación recibida durante el cebo por cerdos Ibéricos a partir de muestras de tejido adiposo subcutáneo, procedentes de 38 partidas de cerdos de tres campañas de montanera. Las muestras correspondieron con las categorías de alimentación contempladas en la Norma de Calidad: 251 fueron de bellota, 164 de recebo, 197 de campo y 137 de cebo

  10. Multiple Attribute Group Decision-Making Methods Based on Trapezoidal Fuzzy Two-Dimensional Linguistic Partitioned Bonferroni Mean Aggregation Operators.

    Science.gov (United States)

    Yin, Kedong; Yang, Benshuo; Li, Xuemei

    2018-01-24

    In this paper, we investigate multiple attribute group decision making (MAGDM) problems where decision makers represent their evaluation of alternatives by trapezoidal fuzzy two-dimensional uncertain linguistic variable. To begin with, we introduce the definition, properties, expectation, operational laws of trapezoidal fuzzy two-dimensional linguistic information. Then, to improve the accuracy of decision making in some case where there are a sort of interrelationship among the attributes, we analyze partition Bonferroni mean (PBM) operator in trapezoidal fuzzy two-dimensional variable environment and develop two operators: trapezoidal fuzzy two-dimensional linguistic partitioned Bonferroni mean (TF2DLPBM) aggregation operator and trapezoidal fuzzy two-dimensional linguistic weighted partitioned Bonferroni mean (TF2DLWPBM) aggregation operator. Furthermore, we develop a novel method to solve MAGDM problems based on TF2DLWPBM aggregation operator. Finally, a practical example is presented to illustrate the effectiveness of this method and analyses the impact of different parameters on the results of decision-making.

  11. Neural interface methods and apparatus to provide artificial sensory capabilities to a subject

    Energy Technology Data Exchange (ETDEWEB)

    Buerger, Stephen P.; Olsson, III, Roy H.; Wojciechowski, Kenneth E.; Novick, David K.; Kholwadwala, Deepesh K.

    2017-01-24

    Embodiments of neural interfaces according to the present invention comprise sensor modules for sensing environmental attributes beyond the natural sensory capability of a subject, and communicating the attributes wirelessly to an external (ex-vivo) portable module attached to the subject. The ex-vivo module encodes and communicates the attributes via a transcutaneous inductively coupled link to an internal (in-vivo) module implanted within the subject. The in-vivo module converts the attribute information into electrical neural stimuli that are delivered to a peripheral nerve bundle within the subject, via an implanted electrode. Methods and apparatus according to the invention incorporate implantable batteries to power the in-vivo module allowing for transcutaneous bidirectional communication of low voltage (e.g. on the order of 5 volts) encoded signals as stimuli commands and neural responses, in a robust, low-error rate, communication channel with minimal effects to the subjects' skin.

  12. Method for providing uranium articles with a corrosion resistant anodized coating

    International Nuclear Information System (INIS)

    Waldrop, F.B.; Washington, C.A.

    1982-01-01

    Uranium articles are provided with anodized oxide coatings in an aqueous solution of an electrolyte selected from the group consisting of potassium phosphate, potassium hydroxide, ammonium hydroxide, and a mixture of potassium tetraborate and boric acid. The uranium articles are anodized at a temperature greater than about 75 degrees C. With a current flow of less than about 0.036 A/cm2 of surface area while the Ph of the solution is maintained in a range of about 2 to 11.5. The Ph values of the aqueous solution and the low current density utilized during the electrolysis prevent excessive dissolution of the uranium and porosity in the film or watering. The relatively high temperature of the electrolyte bath inhibits hydration and the attendant deleterious pitting so as to enhance corrosion resistance of the anodized coating

  13. A Statistical Method for Aggregated Wind Power Plants to Provide Secondary Frequency Control

    DEFF Research Database (Denmark)

    Hu, Junjie; Ziras, Charalampos; Bindner, Henrik W.

    2017-01-01

    curtailment for aggregated wind power plants providing secondary frequency control (SFC) to the power system. By using historical SFC signals and wind speed data, we calculate metrics for the reserve provision error as a function of the scheduled wind power. We show that wind curtailment can be significantly......The increasing penetration of wind power brings significant challenges to power system operators due to the wind’s inherent uncertainty and variability. Traditionally, power plants and more recently demand response have been used to balance the power system. However, the use of wind power...... as a balancing-power source has also been investigated, especially for wind power dominated power systems such as Denmark. The main drawback is that wind power must be curtailed by setting a lower operating point, in order to offer upward regulation. We propose a statistical approach to reduce wind power...

  14. Evaluation of zinc toxicity in soils by means of the CaCl/sub 2/ method

    Energy Technology Data Exchange (ETDEWEB)

    Merkel, D; Koester, W

    1976-01-01

    Soils in the valleys of the rivers Innerste and Oker, north of the Harz mountains, are seriously contaminated by heavy metals. Above all high zinc contents cause severe plant damages. They are like injuries caused by air pollution in the environment of smelting-houses. Usually the heavy metal content of the soil is estimated by extraction with diluted acids, e.g., 0.43 N HNO/sub 3/. In this way nearly the whole zinc store is recorded. For an evaluation of the plant available zinc content we extracted contaminated soils with 0.025 N CaCl/sub 2/. This procedure records the influence of soil properties on the plant availability of the zinc like pH value and clay content. With 0.43 NHNO/sub 3/ 260-7500 ppM zinc were estimated. The maximum content of the CaCl/sub 2/ solution was 109 ppM. Cereals at stage of shooting contained 68-1210 ppM (DM), sugar beet leaves 72-812 ppM (DM). The CaCl/sub 2/ method brought about a closer relationship between soils and plants compared with the HNO/sub 3/ method. Beyond it these method permits the establishment of a preliminary toxicity limit which is supposed in the range of 1 ppM. The percent quota of Zn-CaCl/sub 2/ on Zn-HNO/sub 3/ as a measure of the zinc availability was closely related to the pH value of the soil. The relationship was closer the more soils with lower pH values were present, but there was an essential relationship even at pH levels above 7.0. In the environment of a smelting-house the zinc content of plants was closer related to Zn-HNO/sub 3/ compared with Zn-CaCl/sub 2/. In this case the zinc content of the plants was partly caused by the zinc pollution. But at increasing pH value of the soil even here the availability of the soil zinc decreased too. 33 references.

  15. Pediatric primary care providers' perspectives regarding hospital discharge communication: a mixed methods analysis.

    Science.gov (United States)

    Leyenaar, JoAnna K; Bergert, Lora; Mallory, Leah A; Engel, Richard; Rassbach, Caroline; Shen, Mark; Woehrlen, Tess; Cooperberg, David; Coghlin, Daniel

    2015-01-01

    Effective communication between inpatient and outpatient providers may mitigate risks of adverse events associated with hospital discharge. However, there is an absence of pediatric literature defining effective discharge communication strategies at both freestanding children's hospitals and general hospitals. The objectives of this study were to assess associations between pediatric primary care providers' (PCPs) reported receipt of discharge communication and referral hospital type, and to describe PCPs' perspectives regarding effective discharge communication and areas for improvement. We administered a questionnaire to PCPs referring to 16 pediatric hospital medicine programs nationally. Multivariable models were developed to assess associations between referral hospital type and receipt and completeness of discharge communication. Open-ended questions asked respondents to describe effective strategies and areas requiring improvement regarding discharge communication. Conventional qualitative content analysis was performed to identify emergent themes. Responses were received from 201 PCPs, for a response rate of 63%. Although there were no differences between referral hospital type and PCP-reported receipt of discharge communication (relative risk 1.61, 95% confidence interval 0.97-2.67), PCPs referring to general hospitals more frequently reported completeness of discharge communication relative to those referring to freestanding children's hospitals (relative risk 1.78, 95% confidence interval 1.26-2.51). Analysis of free text responses yielded 4 major themes: 1) structured discharge communication, 2) direct personal communication, 3) reliability and timeliness of communication, and 4) communication for effective postdischarge care. This study highlights potential differences in the experiences of PCPs referring to general hospitals and freestanding children's hospitals, and presents valuable contextual data for future quality improvement initiatives

  16. Methods to estimate annual mean spring discharge to the Snake River between Milner Dam and King Hill, Idaho

    Science.gov (United States)

    Kjelstrom, L.C.

    1995-01-01

    Many individual springs and groups of springs discharge water from volcanic rocks that form the north canyon wall of the Snake River between Milner Dam and King Hill. Previous estimates of annual mean discharge from these springs have been used to understand the hydrology of the eastern part of the Snake River Plain. Four methods that were used in previous studies or developed to estimate annual mean discharge since 1902 were (1) water-budget analysis of the Snake River; (2) correlation of water-budget estimates with discharge from 10 index springs; (3) determination of the combined discharge from individual springs or groups of springs by using annual discharge measurements of 8 springs, gaging-station records of 4 springs and 3 sites on the Malad River, and regression equations developed from 5 of the measured springs; and (4) a single regression equation that correlates gaging-station records of 2 springs with historical water-budget estimates. Comparisons made among the four methods of estimating annual mean spring discharges from 1951 to 1959 and 1963 to 1980 indicated that differences were about equivalent to a measurement error of 2 to 3 percent. The method that best demonstrates the response of annual mean spring discharge to changes in ground-water recharge and discharge is method 3, which combines the measurements and regression estimates of discharge from individual springs.

  17. Generation of triangulated random surfaces by means of the Monte Carlo method in the grand canonical ensemble

    International Nuclear Information System (INIS)

    Zmushko, V.V.; Migdal, A.A.

    1987-01-01

    A model of triangulated random surfaces which is the discrete analogue of the Polyakov string is considered in the work. An algorithm is proposed which enables one to study the model by means of the Monte Carlo method in the grand canonical ensemble. Preliminary results are presented on the evaluation of the critical index γ

  18. The bonded in the chestnut-tree (Aesculus hippocastanum L.) bark water freezing process studied by means NMR method

    International Nuclear Information System (INIS)

    Haranczyk, H.; Weglarz, W.

    1994-01-01

    The bonded in the chestnut-tree (Aesculus hippocastanum L.) bark water freezing process was studied by means NMR method. The measured relaxation time (as a function of temperature) shows two compounds. First from solid state water (T 2 * 20 μs) and the second one from liquid water (T 2 * = 1 ms). This results are presented and discussed

  19. Equipment related methods and means for professional selection of operators in the Kozloduy NPP

    International Nuclear Information System (INIS)

    Pandov, E.; Popandreeva, A.

    1993-01-01

    The principal methods of psychological tests for the selection of nuclear power plant operators are presented. The mobility of the psychic processes, the stability and the shift of attention, the short-term memory and the speed of the sensory-motor reactions are evaluated by adopted testing procedures to assess the functional status of the applicants. A set of 11 tests, divided into 4 groups according to the qualities under evaluation is described. The tests include various reactions to light and sound stimulus and a repetitive numerical test in limited time. The differentiating bimodal response is considered as the most conclusive for the assessment of the sensory-motor response of importance in the nuclear reactor operators work. 4 refs. (R.Ts.)

  20. Glycine as Alternative Fuel in Making Hydrotalcite Compound by Means of Combustion Method

    International Nuclear Information System (INIS)

    Shamsudin, I.K.; Helwani, Z.; Abdullah, A.Z.

    2013-01-01

    Hydrotalcite is anion compound capable of exchanging ions; it has the potential as a catalyst and adsorbent for variety of applications. Hydrotalcite can be prepared through several approaches, depending on the specific need and the characteristics of the compound. In this study, hydrotalcite was prepared through combustion method using glycine as fuel for the first time. Glycine was selected as opposed to urea so that hydrotalcite is safe for use in food processing or health. Hydrotalcite that was successfully obtained via combustion technique using glycine as fuel showed interesting characteristics. The compound demonstrated high thermal endurance and highest alkalinity, which suited the application for bio diesel production from vegetable oil and hydrogenation in the making of fats. However, the surface area was low in comparison with the same compound obtained from co-precipitation and sol-gel techniques. (author)

  1. INVESTIGATIONS OF THE FLOW INTO A STORAGE TANK BY MEANS OF ADVANCED EXPERIMENTAL AND THEORETICAL METHODS

    DEFF Research Database (Denmark)

    Jordan, Ulrike; Shah, Louise Jivan; Furbo, Simon

    2003-01-01

    that the luminescence intensity depends on the water temperature, the temperature fields in the tank can be visualized and also be recorded with a camera. The measurements were compared with calculations of the flow and temperature fields carried out with the Computational Fluid Dynamics (CFD) tool Fluent. In future...... is to study the influence of the inlet device geometry and of the operating conditions (the flow rate, draw-off volume, and temperatures) on the thermal stratification in the tank. Measurements of the flow and temperature fields were carried out with two visualization techniques: - To visualize the flow field...... a method called Particle Image Velocimetry (PIV) was applied. Particles with a size of 1 to 10 mm were seeded in the water and then illuminated by a laser within a narrow plane. In order to measure the three velocity components of the flow within the plane, the particle displacements between laser pulses...

  2. Comparison of k-means related clustering methods for nuclear medicine images segmentation

    Science.gov (United States)

    Borys, Damian; Bzowski, Pawel; Danch-Wierzchowska, Marta; Psiuk-Maksymowicz, Krzysztof

    2017-03-01

    In this paper, we evaluate the performance of SURF descriptor for high resolution satellite imagery (HRSI) retrieval through a BoVW model on a land-use/land-cover (LULC) dataset. Local feature approaches such as SIFT and SURF descriptors can deal with a large variation of scale, rotation and illumination of the images, providing, therefore, a better discriminative power and retrieval efficiency than global features, especially for HRSI which contain a great range of objects and spatial patterns. Moreover, we combine SURF and color features to improve the retrieval accuracy, and we propose to learn a category-specific dictionary for each image category which results in a more discriminative image representation and boosts the image retrieval performance.

  3. Simple method to estimate mean heart dose from Hodgkin lymphoma radiation therapy according to simulation X-rays.

    Science.gov (United States)

    van Nimwegen, Frederika A; Cutter, David J; Schaapveld, Michael; Rutten, Annemarieke; Kooijman, Karen; Krol, Augustinus D G; Janus, Cécile P M; Darby, Sarah C; van Leeuwen, Flora E; Aleman, Berthe M P

    2015-05-01

    To describe a new method to estimate the mean heart dose for Hodgkin lymphoma patients treated several decades ago, using delineation of the heart on radiation therapy simulation X-rays. Mean heart dose is an important predictor for late cardiovascular complications after Hodgkin lymphoma (HL) treatment. For patients treated before the era of computed tomography (CT)-based radiotherapy planning, retrospective estimation of radiation dose to the heart can be labor intensive. Patients for whom cardiac radiation doses had previously been estimated by reconstruction of individual treatments on representative CT data sets were selected at random from a case-control study of 5-year Hodgkin lymphoma survivors (n=289). For 42 patients, cardiac contours were outlined on each patient's simulation X-ray by 4 different raters, and the mean heart dose was estimated as the percentage of the cardiac contour within the radiation field multiplied by the prescribed mediastinal dose and divided by a correction factor obtained by comparison with individual CT-based dosimetry. According to the simulation X-ray method, the medians of the mean heart doses obtained from the cardiac contours outlined by the 4 raters were 30 Gy, 30 Gy, 31 Gy, and 31 Gy, respectively, following prescribed mediastinal doses of 25-42 Gy. The absolute-agreement intraclass correlation coefficient was 0.93 (95% confidence interval 0.85-0.97), indicating excellent agreement. Mean heart dose was 30.4 Gy with the simulation X-ray method, versus 30.2 Gy with the representative CT-based dosimetry, and the between-method absolute-agreement intraclass correlation coefficient was 0.87 (95% confidence interval 0.80-0.95), indicating good agreement between the two methods. Estimating mean heart dose from radiation therapy simulation X-rays is reproducible and fast, takes individual anatomy into account, and yields results comparable to the labor-intensive representative CT-based method. This simpler method may produce a

  4. Developing methods and means to improve the sensitivity and stability characteristics of microwave sensors.

    Directory of Open Access Journals (Sweden)

    S. A. Vasyukov

    2014-01-01

    sensor. It means that the sensitivity gradually decreases under repetitive external effects (downpour, passing cars in the streets with heavy traffic, etc. and with returning to the level of preliminary adjustment as the intensity of external effects decreases. Circuit engineering solutions and algorithms of digital signal processing are implemented in line-produced sensors of car alarms with a trademark “Excellent” (Magic Ring Ltd.

  5. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  6. Analysis of methods of providing anonymity in facial photographs; a randomised controlled study.

    LENUS (Irish Health Repository)

    Clover, A J P

    2010-09-01

    Clinical images are invaluable in medical teaching and research publications. In the past efforts to conceal patient identity, if any, were limited to a black bar concealing the eyes. However, there is no consensus on this among major journals and publishing houses. This research analyses the effectiveness of blacking out the eyes in facial photographs and evaluates alternative techniques. 126 questionnaires were completed. The average numbers of correct responses out of 30 was 24.64 (82.13%) in the control group, 20.59 (68.63%) in the eyes, 20.42 (68.07%) in the eyes and nose group, and 17.53 (58.43%) in the T-shaped group (eyes, nose and mouth). The traditional method of covering the eyes does significantly decrease recognition, however it is only as effective as covering the nose and mouth. The more of the face that is covered the less likely it is that the person is recognised. However, there are people who remain identifiable no matter how much of the face is covered. This work highlights the importance of obtaining consent prior to publication as well as attempting to hide identity.

  7. Method and means for filtering polychlorinated biphenyls from a gas stream

    International Nuclear Information System (INIS)

    Sowinski, R.F.

    1992-01-01

    This patent describes a method of filtering, adjacent to an end user-customer's residence or business in which at least a single gas appliance is located, a natural gas stream in which polychlorinated biphenyls (PCB's) and degraded PCB products have been concentrated at sufficient levels to be a health threat in a natural gas gathering and distributing network. It comprises: introducing the natural gas stream to a filter selected from a group that includes impingement, absorbing and adsorbing media whereby PCB's and degraded PCB products concentrated in the gas stream at sufficient levels to be a health threat by a periodic loading of the natural gas within the gathering and distributing network, are filtered from the gas stream and captured irrespective of mode of transport, passing the filtered natural gas stream to the customer's gas appliance wherein safe use of the energy associated with the stream occurs; periodically and safely removing the filter, inserting a new filter in place of the removed filter

  8. Distribution of uranium in dental porcelains by means of the fission track method

    International Nuclear Information System (INIS)

    Shimizu, Masami; Noguchi, Kunikazu; Moriwaki, Kazunari; Sairenji, Eiko

    1980-01-01

    Porcelain teeth, some of which contain uranium compounds for aesthetic purpose, have been widely used in dental clinics. Hazardous effects due to uranium radiation have been suggested by recent publications. In the previous study, the authors reported the uranium content of porcelain teeth and radiation dose by it. In this study, using the fission track method, the authors examined spatial distribution of uranium in dental porcelain teeth (4 brands) which were marketed in Japan. From each sample of porcelain tooth, a 1-mm-thick specimen was sliced, and uranium content was measured at every 0.19 mm from labial side to lingual side for making a uranium distribution chart. Higher uranium concentration was found in Trubyte Bioblend porcelain teeth (USA) and they showed almost uniform distribution of uranium, while those of the Japanese three brands indicated, in most case, comparatively lower concentration and found to be non-uniform distributions. Range of uranium concentration in these brands were N.D. -- 5.2 ppm (Shofu-Ace), N.D. -- 342 ppm (Shofu-Real), N.D. -- 47 ppm (G.C. Livdent) and N.D. -- 235 ppm (Trubyte Bioblend), respectively. (author)

  9. Implementation of child safety and health management system by means of FMEA method

    Directory of Open Access Journals (Sweden)

    B. Akbari Neisiani

    2016-01-01

    Full Text Available Every year, many accidents leading to physical injuries in kindergartens, indicates that a very large percentage of them are related to the safety concerns and lack of hygiene in these places. Families, due to their busy life style and working hours and also children needs of preschool education, are searching to find most suitable kindergartens for their children. Selecting a kindergarten with various suitable training programs, although very important criteria for selection, but is not sufficient. Indicators such as health, safety and environment issues in these places must be crucial factors in this decision making. Child safety and health management system is an integrated system, derived from health, safety and environmental management regulations which helps the kindergartens complies with relevant regulations to reduce the number of accidents occurrence. The present case study has tried, by using failure modes and effects analysis method and child safety and health management system to find the best practicable indicators to assess the relative impact of different failures in order to identify the parts of the process that are most in need of change. In this regards, 10 semi-governmental kindergartens located in Tehran District 6 of Tehran Municipality, which are supervised by municipality of Tehran were selected and evaluated. The results showed that according to the child safety and health management system and failure modes and effects analysis, all these places need massive infrastructural changes according to the preventive action list in order to be considered a safe and hygienic place for the children.

  10. The study on the state of hydrogen dissolved in metals by means of the channelling method

    International Nuclear Information System (INIS)

    Yagi, Eiichi

    2000-01-01

    The lattice locations of hydrogen dissolved in V, Nb, Ta and Nb-Mo alloys are investigated by the channelling method utilizing a nuclear reaction 1 H( 11 B, α) αα with a 11 B beam. The H atoms are located at tetrahedral (T) sites in V, Nb and Ta. In V, under the [001] compressive stress of 7 kg/mm 2 , the H atoms are displaced from T sites by about 0.44 A towards octahedral (O) sites, and after the release of the stress they return to the T sites. In Nb-3 at%Mo alloys the H atoms are located at the sites displaced from the T sites by about 0.6 A towards the nearest neighbour lattice points at room temperature and become located at the T sites at 373 K, indicating the trapping of H by Mo atoms at room temperature. With increasing Mo concentration, the fraction of the H atoms located at the trapped sites decreases, and most of them are located at the T sites and some portion of them are at the O sites. (author)

  11. New method for protecting mine roadways in thin coal seams by means of prefabricated yielding blocks

    Energy Technology Data Exchange (ETDEWEB)

    Peknik, J

    1983-05-01

    The use of concrete blocks for strata control in mine roadways driven in thin coal seams is evaluated. Two types of prefabricated blocks are used: BZT blocks made of reinforced concrete and yielding elements or popilbet blocks made of a mixture of fly ash (from coal power plants) and concrete. When the popilbet blocks were used no yielding elements were necessary. Mechanical properties of blocks made of reinforced concrete were controlled by yielding elements. Mechanical properties (compression strength) of the popilbet blocks were controlled by proportion of water, cement and fly ash. The BZT and the popilbet blocks were used for strata control in mine roadways in coal seams from 60 to 80 cm thick and dip angle from 5 to 18 degrees. Use of the BZT and the popilbet blocks reduced roadway deformation by about 50% in comparison to traditional strata control methods (timber cribbings, use of waste rock, etc.). Use of the blocks is explained. The BZT and the popilbet blocks were placed in a roadway wall. Height of the block wall equaled coal seam thickness. Yielding arched steel supports and timber liners were used for strata control in the roadway. The popilbet blocks were 50% less expensive than the BZT blocks. 9 references

  12. Determination of calibration equations by means of the generalized least squares method

    International Nuclear Information System (INIS)

    Zijp, W.L.

    1984-12-01

    For the determination of two-dimensional calibration curves (e.g. in tank calibration procedures) or of three dimensional calibration equations (e.g. for the calibration of NDA equipment for enrichment measurements) one performs measurements under well chosen conditions, where all observables of interest (inclusive the values of the standard material) are subject to measurement uncertainties. Moreover correlations in several measurements may occur. This document describes the mathematical-statistical approach to determine the values of the model parameters and their covariance matrix, which fit best to the mathematical model for the calibration equation. The formulae are based on the method of generalized least squares where the term generalized implies that non-linear equations in the unknown parameters and also covariance matrices of the measurement data of the calibration can be taken into account. In the general case an iteration procedure is required. No iteration is required when the model is linear in the parameters and the covariance matrices for the measurements of co-ordinates of the calibration points are proportional to each other

  13. Sentinel 2: implementation of the means and methods for the CAL/VAL commissioning phase

    Science.gov (United States)

    Trémas, Thierry L.; Déchoz, Cécile; Lacherade, Sophie; Nosavan, Julien; Petrucci, Beatrice; Martimort, P.; Isola, Claudia

    2013-10-01

    In partnership with the European Commission and in the frame of the Copernicus program, the European Space Agency (ESA) is developing the Sentinel-2 optical imaging mission devoted to the operational monitoring of land and coastal areas. The Sentinel-2 mission is based on a satellites constellation deployed in polar sun-synchronous orbit. Sentinel-2 will offer a unique combination of global coverage with a wide field of view (290km), a high revisit (5 days with two satellites), a high resolution (10m, 20m and 60m) and multi-spectral imagery (13 spectral bands in visible and shortwave infra-red domains). The first satellite is planned to be launched in late 2014. In this context, the Centre National d'Etudes Spatiales (CNES) supports ESA to insure the cal/val commissioning phase. This paper provides first, an overview of the Sentinel-2 system and the image products delivered by the ground processing. Then the paper will present the ground segment, presently under preparation at CNES, and the various devices that compose it : the GPP in charge of producing the level 1 files, the "radiometric unit" that processes sensitivity parameters, the "geometric unit" in charge of fitting the images on a reference map, MACCS that will produce Level 2A files (computing reflectances at the Bottom of Atmosphere) and the TEC-S2 that will coordinate all the previous software and drive a database in which will be gather the incoming Level 0 files and the processed Level 1 files.

  14. Experimental Validation of Ex-Vessel Neutron Spectrum by Means of Dosimeter Materials Activation Method

    Directory of Open Access Journals (Sweden)

    S.A. Santa

    2017-06-01

    Full Text Available Neutron spectrum information in reactor core and around of ex-vessel reactor needs to be known with a certain degree of accuracy to support the development of fuels, materials, and other components. The most common method to determine neutron spectra is by utilizing the radioactivation of dosimeter materials. This report presents the evaluation of neutron flux incident on M3dosimeter sets which were irradiated outside the reactor vessel,as well as the validation of  neutron spectrum calculation. Al capsules containing both dosimeter set covered withCd and dosimeter set without Cd cover have been irradiated during the 35th operational cycle in the M3 ex-vessel irradiation hole position207 cmfrom core centerline at the space between the reactor vessel and the safety vessel. The capsules were positioned at Z=0.0 cm of core midplane. Each dosimeter set consists of Co-Al, Sc, Fe, Np, Nb, Ni, B, and Ta. The gamma-ray spectra of irradiated dosimeter materials were measured by 63 cc HPGe solid-state detector and photo-peak spectra were analyzed using BOB75 code. The reaction rates of each dosimeter materials and its uncertainty were analyzed based on 59Co (n,g 60Co, 237Np (n,f 95Zr-103Ru,  45Sc (n,g 46Sc, 58Fe (n,g 59Fe, 181Ta (n,g 182Ta, and 58Ni (n,p58Co reactions. The measured Cd ratios indicate that neutron spectrum at the irradiated dosimeter sets was dominated by low energy neutron. The experimental result shows that the calculated neutron spectra by DORT code at the ex-vessel positions need correction, especially in the fast neutron energy region, so as to obtain reasonable unfolding result consistent with the reaction rate measurement without any exception. Using biased DORT initial spectrum, the neutron spectrum and its integral quantity were unfolded by NEUPAC code. The result shows that total neutron flux, flux above 1.0 MeV, flux above 0.1 MeV, and the displacement rate of the dosimeter set not covered with Cd were 1.75× 1012 n cm2 s-1, 1

  15. Subsurface structures and properties of a medium-scale peatland area by means of hydrogeophysical methods

    Science.gov (United States)

    Altdorff, Daniel; van der Kruk, Jan; Bechtold, Michel; Tiemeyer, Bärbel; Huismann, Sander

    2013-04-01

    Intact peatlands are natural sinks of climate-relevant atmospheric CO2 and they are able to store high amounts of organic carbon (C). In addition, intact peatlands are increasingly important given positive effects on biodiversity, hydrological processes and corresponding management issues. Nevertheless, large parts of peatlands in populated areas were modified by human activity during the last centuries. In Germany, more than 90% of the peatlands are drained, mainly for agricultural use. Due to the recent recognition of the positive effects of intact peatlands, there are presently several initiatives for re-wetting parts of these peatlands. However, a restoration to nearly natural conditions needs an evaluation of the current situation as well as an assessment of the restoration potential. Therefore, soil properties like peat layer thickness, bulk density and moisture content need to be known. Non-invasive hydrogeophysical methods offer the possibility for a time and cost-effective characterization of peatlands. In this study, we investigated a medium-scale peatland area (approximately 35 ha) of the 3000 ha large 'Großes Moor' peatland. We present apparent conductivity (ECa) values obtained from Electromagnetic Induction (EMI) measurements representative for three investigation depths (approximately 0.25, 0.5, and 1m). We selected zones with dissimilar ECa to identify areas where strong changes in the subsoil properties with depth are expected (i.e. shallow peat soil on top of sand). Within these areas, additional measurements were made using Ground Penetration Radar (GPR) and soil sampling was performed. In total, six 30 m long GPR profiles and corresponding common midpoint (CMP) measurements were recorded. Additionally, 15 soil cores were taken down to a depth of 0.9 m in order to obtain peat thickness, water content, pore water EC, bulk density (BD), as well as C and N content. Each core was divided into several 5 to 20 cm thick layers to obtain information on

  16. High Performance Harmonic Isolation By Means of The Single-phase Series Active Filter Employing The Waveform Reconstruction Method

    DEFF Research Database (Denmark)

    Senturk, Osman Selcuk; Hava, Ahmet M.

    2009-01-01

    current sampling delay reduction method (SDRM), a single-phase SAF compensated system provides higher harmonic isolation performance and higher stability margins compared to the system using conventional synchronous reference frame based methods. The analytical, simulation, and experimental studies of a 2...

  17. Private providers' knowledge, attitudes and misconceptions related to long-acting and permanent contraceptive methods: a case study in Bangladesh.

    Science.gov (United States)

    Ugaz, Jorge; Banke, Kathryn; Rahaim, Stephen; Chowdhury, Wahiduzzaman; Williams, Julie

    2016-11-01

    In Bangladesh, use of long-acting and permanent methods of contraception (LAPMs) remains stagnant. Providers' limited knowledge and biases may be a factor. We assessed private providers' knowledge, misconceptions and general attitudes towards LAPM in two urban areas. The ultimate goal is to shape programs and interventions to overcome these obstacles and improve full method choice in Bangladesh. Trained data collectors interviewed a convenience sample of 235 female doctors (obstetricians-gynecologists and general practitioners) and 150 female nurses from 194 commercial (for-profit) health care facilities in Chittagong City Corporation and Dhaka district. Data were collected on the nature of the practice, training received, knowledge about modern contraceptives and attitudes towards LAPM [including intrauterine device (IUDs), implants, female and male sterilization]. All providers, and especially doctors, lacked adequate knowledge regarding side effects for all LAPMs, particularly female and male sterilization. Providers had misconceptions about the effectiveness and convenience of LAPMs compared to short-acting contraceptive methods. Implants and IUDs were generally perceived more negatively than other methods. The majority of providers believed that husbands favor short-acting methods rather than LAPMs and that women should not use a method that their husbands do not approve of. Our findings document knowledge and attitudinal barriers among private for-profit providers in urban areas affecting their provision of accurate information about LAPM choices. Practitioners should be offered the necessary tools to provide women full access to all modern methods, especially LAPMs, in order to contribute to decreasing unmet need and improving full method choice in Bangladesh. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Evaluation of three methods of DNA extraction from paraffin-embedded material for the amplification of genomic DNA by means of the PCR technique

    Directory of Open Access Journals (Sweden)

    MESQUITA Ricardo Alves

    2001-01-01

    Full Text Available There are several protocols reported in the literature for the extraction of genomic DNA from formalin-fixed paraffin-embedded samples. Genomic DNA is utilized in molecular analyses, including PCR. This study compares three different methods for the extraction of genomic DNA from formalin-fixed paraffin-embedded (inflammatory fibrous hyperplasia and non-formalin-fixed (normal oral mucosa samples: phenol with enzymatic digestion, and silica with and without enzymatic digestion. The amplification of DNA by means of the PCR technique was carried out with primers for the exon 7 of human keratin type 14. Amplicons were analyzed by means of electrophoresis in an 8% polyacrylamide gel with 5% glycerol, followed by silver-staining visualization. The phenol/enzymatic digestion and the silica/enzymatic digestion methods provided amplicons from both tissue samples. The method described is a potential aid in the establishment of the histopathologic diagnosis and in retrospective studies with archival paraffin-embedded samples.

  19. Transcranial magnetic stimulation provides means to assess cortical plasticity and excitability in humans with fragile X syndrome and autism spectrum disorder

    Directory of Open Access Journals (Sweden)

    Lindsay M Oberman

    2010-06-01

    Full Text Available Fragile X Syndrome (FXS is the most common heritable cause of intellectual disability. In vitro electrophysiologic data from mouse models of FXS suggest that loss of Fragile X Mental Retardation Protein (FMRP affects intracortical excitability and synaptic plasticity. Specifically, the cortex appears hyperexcitable, and use-dependent long-term potentiation (LTP and long-term depression (LTD of synaptic strength are abnormal. Though animal models provide important information, FXS and other neurodevelopmental disorders are human diseases and as such translational research to evaluate cortical excitability and plasticity must be applied in the human. Transcranial magnetic stimulation (TMS paradigms have recently been developed to noninvasively investigate cortical excitability using paired-pulse stimulation, as well as LTP- and LTD-like synaptic plasticity in response to theta burst stimulation (TBS in vivo in the human. TBS applied on consecutive days can be used to measure metaplasticity (the ability of the synapse to undergo a second plastic change following a recent induction of plasticity. The current study investigated intracortical inhibition, plasticity and metaplasticity in full mutation females with FXS, participants with autism spectrum disorders (ASD, and neurotypical controls. Results suggest that intracortical inhibition is normal in participants with FXS, while plasticity and metaplasticity appear abnormal. ASD participants showed abnormalities in plasticity and metaplasticity, as well as heterogeneity in intracortical inhibition. Our findings highlight the utility of noninvasive neurophysiological measures to translate insights from animal models to humans with neurodevelopmental disorders, and thus provide direct confirmation of cortical dysfunction in patients with FXS and ASD.

  20. A comparison of latent class, K-means, and K-median methods for clustering dichotomous data.

    Science.gov (United States)

    Brusco, Michael J; Shireman, Emilie; Steinley, Douglas

    2017-09-01

    The problem of partitioning a collection of objects based on their measurements on a set of dichotomous variables is a well-established problem in psychological research, with applications including clinical diagnosis, educational testing, cognitive categorization, and choice analysis. Latent class analysis and K-means clustering are popular methods for partitioning objects based on dichotomous measures in the psychological literature. The K-median clustering method has recently been touted as a potentially useful tool for psychological data and might be preferable to its close neighbor, K-means, when the variable measures are dichotomous. We conducted simulation-based comparisons of the latent class, K-means, and K-median approaches for partitioning dichotomous data. Although all 3 methods proved capable of recovering cluster structure, K-median clustering yielded the best average performance, followed closely by latent class analysis. We also report results for the 3 methods within the context of an application to transitive reasoning data, in which it was found that the 3 approaches can exhibit profound differences when applied to real data. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  1. Automated Means of Identifying Landslide Deposits using LiDAR Data using the Contour Connection Method Algorithm

    Science.gov (United States)

    Olsen, M. J.; Leshchinsky, B. A.; Tanyu, B. F.

    2014-12-01

    Landslides are a global natural hazard, resulting in severe economic, environmental and social impacts every year. Often, landslides occur in areas of repeated slope instability, but despite these trends, significant residential developments and critical infrastructure are built in the shadow of past landslide deposits and marginally stable slopes. These hazards, despite their sometimes enormous scale and regional propensity, however, are difficult to detect on the ground, often due to vegetative cover. However, new developments in remote sensing technology, specifically Light Detection and Ranging mapping (LiDAR) are providing a new means of viewing our landscape. Airborne LiDAR, combined with a level of post-processing, enable the creation of spatial data representative of the earth beneath the vegetation, highlighting the scars of unstable slopes of the past. This tool presents a revolutionary technique to mapping landslide deposits and their associated regions of risk; yet, their inventorying is often done manually, an approach that can be tedious, time-consuming and subjective. However, the associated LiDAR bare earth data present the opportunity to use this remote sensing technology and typical landslide geometry to create an automated algorithm that can detect and inventory deposits on a landscape scale. This algorithm, called the Contour Connection Method (CCM), functions by first detecting steep gradients, often associated with the headscarp of a failed hillslope, and initiating a search, highlighting deposits downslope of the failure. Based on input of search gradients, CCM can assist in highlighting regions identified as landslides consistently on a landscape scale, capable of mapping more than 14,000 hectares rapidly (help better define these regions of risk.

  2. Quantitation of IgE by means of a modified radial immunodiffusion method in comparison with the radioimmunosorbent test (RIST)

    International Nuclear Information System (INIS)

    Wiedermann, G.; Stemberg, H.; Kraft, D.; Ambrosch, F.; Schadlbauer, B.; Jarischko, E.; Vienna Univ.

    1974-01-01

    Serum IgE were quantitied by means of modified radial immunodiffusion technique (RID). To improve visibility of precipitin bands a staining procedure with DOPA was applied. Pretreatment of sera with dextransulfate proved necessary in order to avoid unspecific ringformation in the agargel. In comparison with the RIST it turned out that sera containing less than 500 I.U. IgE/ml did not produce precipitin bands with this method. Sera containing 500-999 I.U. IgE/ml occasionally exhibited positive results with the RID technique, whereas sera with more than 1,000 I.U./ml were regulary positive. In its present form the RID may be used as screening method for sera with higher IgE levels. Within the above mentioned limits the IgE levels calculated by means of the RID-test roughly corresponded the values determined by the RIST. (orig.) [de

  3. A study of Monte Carlo methods for weak approximations of stochastic particle systems in the mean-field?

    KAUST Repository

    Haji Ali, Abdul Lateef

    2016-01-01

    I discuss using single level and multilevel Monte Carlo methods to compute quantities of interests of a stochastic particle system in the mean-field. In this context, the stochastic particles follow a coupled system of Ito stochastic differential equations (SDEs). Moreover, this stochastic particle system converges to a stochastic mean-field limit as the number of particles tends to infinity. I start by recalling the results of applying different versions of Multilevel Monte Carlo (MLMC) for particle systems, both with respect to time steps and the number of particles and using a partitioning estimator. Next, I expand on these results by proposing the use of our recent Multi-index Monte Carlo method to obtain improved convergence rates.

  4. CHARACTERISTICS OF PRODUCTS MADE OF 17-4PH STEEL BY MEANS OF 3D PRINTING METHOD

    Directory of Open Access Journals (Sweden)

    Mariusz WALCZAK

    2016-09-01

    Full Text Available The article presents the results of tests of 17-4PH steel fabricated by means of the method consisting in laser additive manufacturing (LAM – direct metal laser sintering (DMLS. This grade of steel is characterized by excellent stress corrosion resistance in the first place and is applied as construction material in chemical, aircraft, medical or mould making industry. 3D metal printing is a relatively new method enabling significant change of structural properties of these materials at printing parameters predetermined by printers manufacturer for ”offline” printing mode.In order to achieve this goal, the authors have carried out the analysis of chemical composition, SEM tests and the tests of products surface roughness. Furthermore the products have been subjected to X-ray analysis by means of computed tomography (X-ray CT. Structural discontinuities have been found in upper layer and inside printouts subjected to tests.

  5. A study of Monte Carlo methods for weak approximations of stochastic particle systems in the mean-field?

    KAUST Repository

    Haji Ali, Abdul Lateef

    2016-01-08

    I discuss using single level and multilevel Monte Carlo methods to compute quantities of interests of a stochastic particle system in the mean-field. In this context, the stochastic particles follow a coupled system of Ito stochastic differential equations (SDEs). Moreover, this stochastic particle system converges to a stochastic mean-field limit as the number of particles tends to infinity. I start by recalling the results of applying different versions of Multilevel Monte Carlo (MLMC) for particle systems, both with respect to time steps and the number of particles and using a partitioning estimator. Next, I expand on these results by proposing the use of our recent Multi-index Monte Carlo method to obtain improved convergence rates.

  6. Fault feature extraction method based on local mean decomposition Shannon entropy and improved kernel principal component analysis model

    Directory of Open Access Journals (Sweden)

    Jinlu Sheng

    2016-07-01

    Full Text Available To effectively extract the typical features of the bearing, a new method that related the local mean decomposition Shannon entropy and improved kernel principal component analysis model was proposed. First, the features are extracted by time–frequency domain method, local mean decomposition, and using the Shannon entropy to process the original separated product functions, so as to get the original features. However, the features been extracted still contain superfluous information; the nonlinear multi-features process technique, kernel principal component analysis, is introduced to fuse the characters. The kernel principal component analysis is improved by the weight factor. The extracted characteristic features were inputted in the Morlet wavelet kernel support vector machine to get the bearing running state classification model, bearing running state was thereby identified. Cases of test and actual were analyzed.

  7. Application of Mean of Absolute Deviation Method for the Selection of Best Nonlinear Component Based on Video Encryption

    Science.gov (United States)

    Anees, Amir; Khan, Waqar Ahmad; Gondal, Muhammad Asif; Hussain, Iqtadar

    2013-07-01

    The aim of this work is to make use of the mean of absolute deviation (MAD) method for the evaluation process of substitution boxes used in the advanced encryption standard. In this paper, we use the MAD technique to analyze some popular and prevailing substitution boxes used in encryption processes. In particular, MAD is applied to advanced encryption standard (AES), affine power affine (APA), Gray, Lui J., Residue Prime, S8 AES, SKIPJACK, and Xyi substitution boxes.

  8. Method and means for a spatial and temporal probe for laser-generated plumes based on density gradients

    Science.gov (United States)

    Yeung, E.S.; Chen, G.

    1990-05-01

    A method and means are disclosed for a spatial and temporal probe for laser generated plumes based on density gradients includes generation of a plume of vaporized material from a surface by an energy source. The probe laser beam is positioned so that the plume passes through the probe laser beam. Movement of the probe laser beam caused by refraction from the density gradient of the plume is monitored. Spatial and temporal information, correlated to one another, is then derived. 15 figs.

  9. A method for hardening or curing adhesives for flocking thermally sensitive substrata by means of an electron-beam

    International Nuclear Information System (INIS)

    Nablo, S.V.; Fussa, A.D.

    1975-01-01

    The invention relates to a method for hardening or curing adhesives for flocking thermally sensitive substrata by means of an electron-beam. That method consists in accurately adjusting the parameters of irradiation by an electron-beam and the beam velocity so as to obtain, a very rapid hardening of adhesives used for fixing flocking materials, or the like, to thermally sensitive substrate. That can be applied to hardening or curing adhesives for flocking thermally-sensitive substrata which normally restrict the hardening rate [fr

  10. A soluble RecN homologue provides means for biochemical and genetic analysis of DNA double-strand break repair in Escherichia coli.

    Science.gov (United States)

    Grove, Jane I; Wood, Stuart R; Briggs, Geoffrey S; Oldham, Neil J; Lloyd, Robert G

    2009-12-03

    RecN is a highly conserved, SMC-like protein in bacteria. It plays an important role in the repair of DNA double-strand breaks and is therefore a key factor in maintaining genome integrity. The insolubility of Escherichia coli RecN has limited efforts to unravel its function. We overcame this limitation by replacing the resident coding sequence with that of Haemophilus influenzae RecN. The heterologous construct expresses Haemophilus RecN from the SOS-inducible E. coli promoter. The hybrid gene is fully functional, promoting survival after I-SceI induced DNA breakage, gamma irradiation or exposure to mitomycin C as effectively as the native gene, indicating that the repair activity is conserved between these two species. H. influenzae RecN is quite soluble, even when expressed at high levels, and is readily purified. Its analysis by ionisation-mass spectrometry, gel filtration and glutaraldehyde crosslinking indicates that it is probably a dimer under physiological conditions, although a higher multimer cannot be excluded. The purified protein displays a weak ATPase activity that is essential for its DNA repair function in vivo. However, no DNA-binding activity was detected, which contrasts with RecN from Bacillus subtilis. RecN proteins from Aquifex aeolicus and Bacteriodes fragilis also proved soluble. Neither binds DNA, but the Aquifex RecN has weak ATPase activity. Our findings support studies indicating that RecN, and the SOS response in general, behave differently in E. coli and B. subtilis. The hybrid recN reported provides new opportunities to study the genetics and biochemistry of how RecN operates in E. coli.

  11. CORRECTION OF CHAIN-LINKING METHOD BY MEANS OF LLOYD-MOULTON-FISHER-TÖRNQVIST INDEX ON CROATIAN GDP DATA

    Directory of Open Access Journals (Sweden)

    Ante Rozga

    2013-02-01

    Full Text Available National statistical agencies of European Union use chain-linking method to achieve the best possible decomposition of GDP. The main advantage of this method is its simplicity, thus it can be applied in practice, which makes it particularly attractive in the situation when GDP has to be compiled on due time. By this method transformation-substitution effect – inherent to rational producers and consumers, has been implicitly built into GDP compilation, which is prior assumption of normative economic theory. On empirical (ex-post ground it gives more precise volume-price decomposition. In this paper, by means of constructing LMTF index and Fisher index derived from the previous one, it is suggested how to improve chain linking method, due to following reasons: a it is theoretically restrictive, b it gives only rough GDP decomposition into volume and price and, what seems to be its main disadvantage, c it gives additively inconsistent GDP.

  12. Size-specific dose estimate (SSDE) provides a simple method to calculate organ dose for pediatric CT examinations

    Energy Technology Data Exchange (ETDEWEB)

    Moore, Bria M.; Brady, Samuel L., E-mail: samuel.brady@stjude.org; Kaufman, Robert A. [Department of Radiological Sciences, St Jude Children' s Research Hospital, Memphis, Tennessee 38105 (United States); Mirro, Amy E. [Department of Biomedical Engineering, Washington University, St Louis, Missouri 63130 (United States)

    2014-07-15

    Purpose: To investigate the correlation of size-specific dose estimate (SSDE) with absorbed organ dose, and to develop a simple methodology for estimating patient organ dose in a pediatric population (5–55 kg). Methods: Four physical anthropomorphic phantoms representing a range of pediatric body habitus were scanned with metal oxide semiconductor field effect transistor (MOSFET) dosimeters placed at 23 organ locations to determine absolute organ dose. Phantom absolute organ dose was divided by phantom SSDE to determine correlation between organ dose and SSDE. Organ dose correlation factors (CF{sub SSDE}{sup organ}) were then multiplied by patient-specific SSDE to estimate patient organ dose. The CF{sub SSDE}{sup organ} were used to retrospectively estimate individual organ doses from 352 chest and 241 abdominopelvic pediatric CT examinations, where mean patient weight was 22 kg ± 15 (range 5–55 kg), and mean patient age was 6 yrs ± 5 (range 4 months to 23 yrs). Patient organ dose estimates were compared to published pediatric Monte Carlo study results. Results: Phantom effective diameters were matched with patient population effective diameters to within 4 cm; thus, showing appropriate scalability of the phantoms across the entire pediatric population in this study. IndividualCF{sub SSDE}{sup organ} were determined for a total of 23 organs in the chest and abdominopelvic region across nine weight subcategories. For organs fully covered by the scan volume, correlation in the chest (average 1.1; range 0.7–1.4) and abdominopelvic region (average 0.9; range 0.7–1.3) was near unity. For organ/tissue that extended beyond the scan volume (i.e., skin, bone marrow, and bone surface), correlation was determined to be poor (average 0.3; range: 0.1–0.4) for both the chest and abdominopelvic regions, respectively. A means to estimate patient organ dose was demonstrated. Calculated patient organ dose, using patient SSDE and CF{sub SSDE}{sup organ}, was compared to

  13. A combined approach for the enhancement and segmentation of mammograms using modified fuzzy C-means method in wavelet domain.

    Science.gov (United States)

    Srivastava, Subodh; Sharma, Neeraj; Singh, S K; Srivastava, R

    2014-07-01

    In this paper, a combined approach for enhancement and segmentation of mammograms is proposed. In preprocessing stage, a contrast limited adaptive histogram equalization (CLAHE) method is applied to obtain the better contrast mammograms. After this, the proposed combined methods are applied. In the first step of the proposed approach, a two dimensional (2D) discrete wavelet transform (DWT) is applied to all the input images. In the second step, a proposed nonlinear complex diffusion based unsharp masking and crispening method is applied on the approximation coefficients of the wavelet transformed images to further highlight the abnormalities such as micro-calcifications, tumours, etc., to reduce the false positives (FPs). Thirdly, a modified fuzzy c-means (FCM) segmentation method is applied on the output of the second step. In the modified FCM method, the mutual information is proposed as a similarity measure in place of conventional Euclidian distance based dissimilarity measure for FCM segmentation. Finally, the inverse 2D-DWT is applied. The efficacy of the proposed unsharp masking and crispening method for image enhancement is evaluated in terms of signal-to-noise ratio (SNR) and that of the proposed segmentation method is evaluated in terms of random index (RI), global consistency error (GCE), and variation of information (VoI). The performance of the proposed segmentation approach is compared with the other commonly used segmentation approaches such as Otsu's thresholding, texture based, k-means, and FCM clustering as well as thresholding. From the obtained results, it is observed that the proposed segmentation approach performs better and takes lesser processing time in comparison to the standard FCM and other segmentation methods in consideration.

  14. Optimization of the ship type using waveform by means of Rankine source method; Rankine source ho ni yoru hakei wo mochiita funagata saitekika ni tsuite

    Energy Technology Data Exchange (ETDEWEB)

    Hirayama, A; Eguchi, T [Mitsui Engineering and Shipbuilding Co. Ltd., Tokyo (Japan)

    1996-04-10

    Among the numerical calculation methods for steady-state wave-making problems, the panel shift Rankine source (PSRS) method has the advantages of rather precise determination of wave pattern of practical ship types, and short calculation period. The wave pattern around the hull was calculated by means of the PSRS method. The waveform analysis was carried out for the wave, to obtain an amplitude function of the original ship type. Based on the amplitude function, a ship type improvement method aiming at the optimization of ship type was provided using a conditional calculus of variation. A Series 60 (Cb=0.6) ship type was selected for the ship type improvement, to apply this technique. It was suggested that optimum design can be made for reducing the wave making resistance by means of this method. For the improvement of Series 60 ship type using this method, a great degree of reduction in the wave making resistance was recognized from the results of numerical waveform analysis. It was suggested that the ship type improvement aiming at the reduction of wave-making resistance can be made in shorter period and by smaller labor compared with the method using a waveform analysis of cistern tests. 5 refs., 9 figs.

  15. A Simple but Powerful Heuristic Method for Accelerating k-Means Clustering of Large-Scale Data in Life Science.

    Science.gov (United States)

    Ichikawa, Kazuki; Morishita, Shinichi

    2014-01-01

    K-means clustering has been widely used to gain insight into biological systems from large-scale life science data. To quantify the similarities among biological data sets, Pearson correlation distance and standardized Euclidean distance are used most frequently; however, optimization methods have been largely unexplored. These two distance measurements are equivalent in the sense that they yield the same k-means clustering result for identical sets of k initial centroids. Thus, an efficient algorithm used for one is applicable to the other. Several optimization methods are available for the Euclidean distance and can be used for processing the standardized Euclidean distance; however, they are not customized for this context. We instead approached the problem by studying the properties of the Pearson correlation distance, and we invented a simple but powerful heuristic method for markedly pruning unnecessary computation while retaining the final solution. Tests using real biological data sets with 50-60K vectors of dimensions 10-2001 (~400 MB in size) demonstrated marked reduction in computation time for k = 10-500 in comparison with other state-of-the-art pruning methods such as Elkan's and Hamerly's algorithms. The BoostKCP software is available at http://mlab.cb.k.u-tokyo.ac.jp/~ichikawa/boostKCP/.

  16. Correction for tissue attenuation in radionuclide gastric emptying studies: a comparison of a lateral image method and a geometric mean method

    Energy Technology Data Exchange (ETDEWEB)

    Collins, P.J.; Chatterton, B.E. (Royal Adelaide Hospital (Australia)); Horowitz, M.; Shearman, D.J.C. (Adelaide Univ. (Australia). Dept. of Medicine)

    1984-08-01

    Variation in depth of radionuclide within the stomach may result in significant errors in the measurement of gastric emptying if no attempt is made to correct for gamma-ray attenuation by the patient's tissues. A method of attenuation correction, which uses a single posteriorly located scintillation camera and correction factors derived from a lateral image of the stomach, was compared with a two-camera geometric mean method, in phantom studies and in five volunteer subjects. A meal of 100 g of ground beef containing /sup 99/Tcsup(m)-chicken liver, and 150 ml of water was used in the in vivo studies. In all subjects the geometric mean data showed that solid food emptied in two phases: an initial lag period, followed by a linear emptying phase. Using the geometric mean data as a standard, the anterior camera overestimated the 50% emptying time (T/sub 50/) by an average of 15% (range 5-18) and the posterior camera underestimated this parameter by 15% (4-22). The posterior data, corrected for attenuation using the lateral image method, underestimated the T/sub 50/ by 2% (-7 to +7). The difference in the distances of the proximal and distal stomach from the posterior detector was large in all subjects (mean 5.7 cm, range 3.9-7.4).

  17. Solutions of Heat-Like and Wave-Like Equations with Variable Coefficients by Means of the Homotopy Analysis Method

    International Nuclear Information System (INIS)

    Alomari, A. K.; Noorani, M. S. M.; Nazar, R.

    2008-01-01

    We employ the homotopy analysis method (HAM) to obtain approximate analytical solutions to the heat-like and wave-like equations. The HAM contains the auxiliary parameter ħ, which provides a convenient way of controlling the convergence region of series solutions. The analysis is accompanied by several linear and nonlinear heat-like and wave-like equations with initial boundary value problems. The results obtained prove that HAM is very effective and simple with less error than the Adomian decomposition method and the variational iteration method

  18. Identification of a Threshold Value for the DEMATEL Method: Using the Maximum Mean De-Entropy Algorithm

    Science.gov (United States)

    Chung-Wei, Li; Gwo-Hshiung, Tzeng

    To deal with complex problems, structuring them through graphical representations and analyzing causal influences can aid in illuminating complex issues, systems, or concepts. The DEMATEL method is a methodology which can be used for researching and solving complicated and intertwined problem groups. The end product of the DEMATEL process is a visual representation—the impact-relations map—by which respondents organize their own actions in the world. The applicability of the DEMATEL method is widespread, ranging from analyzing world problematique decision making to industrial planning. The most important property of the DEMATEL method used in the multi-criteria decision making (MCDM) field is to construct interrelations between criteria. In order to obtain a suitable impact-relations map, an appropriate threshold value is needed to obtain adequate information for further analysis and decision-making. In this paper, we propose a method based on the entropy approach, the maximum mean de-entropy algorithm, to achieve this purpose. Using real cases to find the interrelationships between the criteria for evaluating effects in E-learning programs as an examples, we will compare the results obtained from the respondents and from our method, and discuss that the different impact-relations maps from these two methods.

  19. Application of some pattern recognition methods for the early detection of failures at NPP components by means of noise diagnosis

    International Nuclear Information System (INIS)

    Weiss, F.P.

    1985-01-01

    The automation of the decisions on normality or abnormality of the plant condition being based on automated measurements is an essential step for the integration of noise diagnostics into the control and safety system of a nuclear power plant. By reason of the stochastic character of noise diagnostic measuring quantities principles of statistical pattern recognition are used in order automatically to get a decision on the plant condition. Four different pattern recognition methods complementing each other have been developed respectively tested with data from a WWER-440 type reactor. These four methods are included in a specially written software package. According to stationarity, correlation and probability distribution type of the state describing features and according to the necessary detection sensitivity to failures either the decorrelation method, the cluster method, the Parzen method or the distribution test of Wilcoxon, Mann and Whitney has to be applied. The efficiency and the limits of the investigated methods are discussed in detail. In context with the surveillance of the WWER-440 core by means of the power spectral densities of neutron flux fluctuations it could as well experimentally as theoretically be shown that the logarithmic power spectral densities follow a Gaussian probability distribution. (author)

  20. THE SIMULATION DIAGNOSTIC METHODS AND REGENERATION WAYS OF REINFORCED - CONCRETE CONSTRUCTIONS OF BRIDGES IN PROVIDING THEIR OPERATING RELIABILITY AND LONGEVITY

    Directory of Open Access Journals (Sweden)

    B. V. Savchinskiy

    2010-03-01

    Full Text Available On the basis of analysis of existing diagnostic methods and regeneration ways of reinforced-concrete constructions of bridges the recommendations on introduction of new modern technologies of renewal of reinforced-concrete constructions of bridges in providing their operating reliability and longevity are offered.

  1. THE SIMULATION DIAGNOSTIC METHODS AND REGENERATION WAYS OF REINFORCED - CONCRETE CONSTRUCTIONS OF BRIDGES IN PROVIDING THEIR OPERATING RELIABILITY AND LONGEVITY

    OpenAIRE

    B. V. Savchinskiy

    2010-01-01

    On the basis of analysis of existing diagnostic methods and regeneration ways of reinforced-concrete constructions of bridges the recommendations on introduction of new modern technologies of renewal of reinforced-concrete constructions of bridges in providing their operating reliability and longevity are offered.

  2. A Mixed-Methods Investigation of Early Childhood Professional Development for Providers and Recipients in the United States

    Science.gov (United States)

    Linder, Sandra M.; Rembert, Kellye; Simpson, Amber; Ramey, M. Deanna

    2016-01-01

    This multi-phase mixed-methods study explores provider and recipient perceptions of the current state of early childhood professional development in a southeastern area of the United States. Professional development for the early childhood workforce has been shown to positively influence the quality of early childhood classrooms. This study…

  3. Perceptions of vaginal microbicides as an HIV prevention method among health care providers in KwaZulu-Natal, South Africa

    Directory of Open Access Journals (Sweden)

    Mantell Joanne E

    2007-03-01

    Full Text Available Abstract Background The promise of microbicides as an HIV prevention method will not be realized if not supported by health care providers. They are the primary source of sexual health information for potential users, in both the public and private health sectors. Therefore, the aim of this study was to determine perceptions of vaginal microbicides as a potential HIV prevention method among health care providers in Durban and Hlabisa, South Africa, using a combination of quantitative and qualitative methods. Results During 2004, semi structured interviews with 149 health care providers were conducted. Fifty seven percent of hospital managers, 40% of pharmacists and 35% of nurses possessed some basic knowledge of microbicides, such as the product being used intra-vaginally before sex to prevent HIV infection. The majority of them were positive about microbicides and were willing to counsel users regarding potential use. Providers from both public and private sectors felt that an effective microbicide should be available to all people, regardless of HIV status. Providers felt that the product should be accessed over-the-counter in pharmacies and in retail stores. They also felt a need for potential microbicides to be available free of charge, and packaged with clear instructions. The media was seen by health care providers as being an effective strategy for promoting microbicides. Conclusion Overall, health care providers were very positive about the possible introduction of an effective microbicide for HIV prevention. The findings generated by this study illustrated the need for training health care providers prior to making the product accessible, as well as the importance of addressing the potential barriers to use of the product by women. These are important concerns in the health care community, and this study also served to educate them for the day when research becomes reality.

  4. Calculation of the energy provided by a PV generator. Comparative study: Conventional methods vs. artificial neural networks

    International Nuclear Information System (INIS)

    Almonacid, F.; Rus, C.; Perez-Higueras, P.; Hontoria, L.

    2011-01-01

    The use of photovoltaics for electricity generation purposes has recorded one of the largest increases in the field of renewable energies. The energy production of a grid-connected PV system depends on various factors. In a wide sense, it is considered that the annual energy provided by a generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. However, a range of factors is influencing the expected outcome by reducing the generation of energy. The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network developed by the R and D Group for Solar and Automatic Energy at the University of Jaen. The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study, mainly due to the fact that this method takes also into account some second order effects, such as low irradiance, angular and spectral effects. -- Research highlights: → It is considered that the annual energy provided by a PV generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. → A range of factors are influencing the expected outcome by reducing the generation of energy (mismatch losses, dirt and dust, Ohmic losses,.). → The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network. → The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study. While classical methods have only taken into account temperature losses, the method based in

  5. Various Solution Methods, Accompanied by Dynamic Investigation, for the Same Problem as a Means for Enriching the Mathematical Toolbox

    Science.gov (United States)

    Oxman, Victor; Stupel, Moshe

    2018-01-01

    A geometrical task is presented with multiple solutions using different methods, in order to show the connection between various branches of mathematics and to highlight the importance of providing the students with an extensive 'mathematical toolbox'. Investigation of the property that appears in the task was carried out using a computerized tool.

  6. On the validity of the arithmetic-geometric mean method to locate the optimal solution in a supply chain system

    Science.gov (United States)

    Chung, Kun-Jen

    2012-08-01

    Cardenas-Barron [Cardenas-Barron, L.E. (2010) 'A Simple Method to Compute Economic order Quantities: Some Observations', Applied Mathematical Modelling, 34, 1684-1688] indicates that there are several functions in which the arithmetic-geometric mean method (AGM) does not give the minimum. This article presents another situation to reveal that the AGM inequality to locate the optimal solution may be invalid for Teng, Chen, and Goyal [Teng, J.T., Chen, J., and Goyal S.K. (2009), 'A Comprehensive Note on: An Inventory Model under Two Levels of Trade Credit and Limited Storage Space Derived without Derivatives', Applied Mathematical Modelling, 33, 4388-4396], Teng and Goyal [Teng, J.T., and Goyal S.K. (2009), 'Comment on 'Optimal Inventory Replenishment Policy for the EPQ Model under Trade Credit Derived without Derivatives', International Journal of Systems Science, 40, 1095-1098] and Hsieh, Chang, Weng, and Dye [Hsieh, T.P., Chang, H.J., Weng, M.W., and Dye, C.Y. (2008), 'A Simple Approach to an Integrated Single-vendor Single-buyer Inventory System with Shortage', Production Planning and Control, 19, 601-604]. So, the main purpose of this article is to adopt the calculus approach not only to overcome shortcomings of the arithmetic-geometric mean method of Teng et al. (2009), Teng and Goyal (2009) and Hsieh et al. (2008), but also to develop the complete solution procedures for them.

  7. Burn-up determination of irradiated uranium oxide by means of direct gama spectrometry and by radiochemical method

    International Nuclear Information System (INIS)

    Cunha, I.I.L.; Nastasi, M.J.C.; Lima, F.W.

    1981-09-01

    The burn-up of thermal neutrons irradiated U 3 O 8 (natural uranium) samples has been determined by using both direct gamma spectrometry and radiochemical methods and the results obtained were compared. The fission products 144 Ce, 103 Ru, 106 Ru, 137 Cs and 95 Zr were chosen as burn-up monitors. In order to isolate the radioisotopes chosen as monitors, a radiochemical separation procedure has been established, in which the solvent extraction technique was used to separate cerium, cesium and ruthenium one from the other and all of them from uranium. The separation between zirconium and niobium and of both elements from the other radioisotopes and uranium was accomplished by means of adsorption on a silica-gel column, followed by selective elution of zirconium and of niobium. When use was made of the direct gamma-ray spectrometry method, the radioactivity of each nuclide of interest was measured in presence of all others. For this purpose use was made of gamma-ray spectrometry and of a Ge-Li detector. Comparison of burn-up values obtained by both methods was made by means of Student's 't' test, and this showed that results obtained in each case are statistically equal. (Author) [pt

  8. GPU accelerated real-time confocal fluorescence lifetime imaging microscopy (FLIM) based on the analog mean-delay (AMD) method

    Science.gov (United States)

    Kim, Byungyeon; Park, Byungjun; Lee, Seungrag; Won, Youngjae

    2016-01-01

    We demonstrated GPU accelerated real-time confocal fluorescence lifetime imaging microscopy (FLIM) based on the analog mean-delay (AMD) method. Our algorithm was verified for various fluorescence lifetimes and photon numbers. The GPU processing time was faster than the physical scanning time for images up to 800 × 800, and more than 149 times faster than a single core CPU. The frame rate of our system was demonstrated to be 13 fps for a 200 × 200 pixel image when observing maize vascular tissue. This system can be utilized for observing dynamic biological reactions, medical diagnosis, and real-time industrial inspection. PMID:28018724

  9. A combined usage of stochastic and quantitative risk assessment methods in the worksites: Application on an electric power provider

    International Nuclear Information System (INIS)

    Marhavilas, P.K.; Koulouriotis, D.E.

    2012-01-01

    An individual method cannot build either a realistic forecasting model or a risk assessment process in the worksites, and future perspectives should focus on the combined forecasting/estimation approach. The main purpose of this paper is to gain insight into a risk prediction and estimation methodological framework, using the combination of three different methods, including the proportional quantitative-risk-assessment technique (PRAT), the time-series stochastic process (TSP), and the method of estimating the societal-risk (SRE) by F–N curves. In order to prove the usefulness of the combined usage of stochastic and quantitative risk assessment methods, an application on an electric power provider industry is presented to, using empirical data.

  10. Neutron spectrometry by means of threshold detectors - Neutron spectrometry by means of activation detectors. Studies of the method of approximation by polygonal function. Application to dose determination

    International Nuclear Information System (INIS)

    Bricka, M.

    1962-03-01

    This report addresses the problem of determination of neutron spectrum by using a set of detectors. The spectrum approximation method based on a polygonal function is more particularly studied. The author shows that the coefficients of the usual mathematical model can be simply formulated and assessed. The study of spectra approximation by a polygonal function shows that dose can be expressed by a linear function of the activity of the different detectors [fr

  11. W5″ Test: A simple method for measuring mean power output in the bench press exercise.

    Science.gov (United States)

    Tous-Fajardo, Julio; Moras, Gerard; Rodríguez-Jiménez, Sergio; Gonzalo-Skok, Oliver; Busquets, Albert; Mujika, Iñigo

    2016-11-01

    The aims of the present study were to assess the validity and reliability of a novel simple test [Five Seconds Power Test (W5″ Test)] for estimating the mean power output during the bench press exercise at different loads, and its sensitivity to detect training-induced changes. Thirty trained young men completed as many repetitions as possible in a time of ≈5 s at 25%, 45%, 65% and 85% of one-repetition maximum (1RM) in two test sessions separated by four days. The number of repetitions, linear displacement of the bar and time needed to complete the test were recorded by two independent testers, and a linear encoder was used as the criterion measure. For each load, the mean power output was calculated in the W5″ Test as mechanical work per time unit and compared with that obtained from the linear encoder. Subsequently, 20 additional subjects (10 training group vs. 10 control group) were assessed before and after completing a seven-week training programme designed to improve maximal power. Results showed that both assessment methods correlated highly in estimating mean power output at different loads (r range: 0.86-0.94; p bench press exercise in subjects who have previous resistance training experience.

  12. Using the geometric mean fluorescence intensity index method to measure ZAP-70 expression in patients with chronic lymphocytic leukemia.

    Science.gov (United States)

    Wu, Yu-Jie; Wang, Hui; Liang, Jian-Hua; Miao, Yi; Liu, Lu; Qiu, Hai-Rong; Qiao, Chun; Wang, Rong; Li, Jian-Yong

    2016-01-01

    Expression of ζ-chain-associated protein kinase 70 kDa (ZAP-70) in chronic lymphocytic leukemia (CLL) is associated with more aggressive disease and can help differentiate CLL from cases expressing mutated or unmutated immunoglobulin heavy chain variable region (IgHV) genes. However, standardizing ZAP-70 expression by flow cytometric analysis has proved unsatisfactory. The key point is that ZAP-70 is weakly expressed with a continuous expression pattern rather than a clear discrimination between positive and negative CLL cells, which means that the resulting judgment is subjective. Thus, in this study, we aimed at assessing the reliability and repeatability of ZAP-70 expression using the geometric mean fluorescence intensity (geo MFI) index method based on flow cytometry with 256-channel resolution in a series of 402 CLL patients and to compare ZAP-70 with other biological and clinical prognosticators. According to IgHV mutational status, we were able to confirm that the optimal cut-off point for the geo MFI index was 3.5 in the test set. In multivariate analyses that included the major clinical and biological prognostic markers for CLL, the prognostic impact of ZAP-70 expression appeared to have stronger discriminatory power when the geo MFI index method was applied. In addition, we found that ZAP-70-positive patients according to the geo MFI index method had shorter time to first treatment or overall survival (P=0.0002, P=0.0491). This is the first report showing that ZAP-70 expression can be evaluated by a new approach, the geo MFI index, which could be a useful prognostic method as it is more reliable, less subjective, and therefore better associated with improvement of CLL prognostication and prediction of clinical course.

  13. The nuclear N-body problem and the effective interaction in self-consistent mean-field methods

    International Nuclear Information System (INIS)

    Duguet, Thomas

    2002-01-01

    This work deals with two aspects of mean-field type methods extensively used in low-energy nuclear structure. The first study is at the mean-field level. The link between the wave-function describing an even-even nucleus and the odd-even neighbor is revisited. To get a coherent description as a function of the pairing intensity in the system, the utility of the formalization of this link through a two steps process is demonstrated. This two-steps process allows to identify the role played by different channels of the force when a nucleon is added in the system. In particular, perturbative formula evaluating the contribution of time-odd components of the functional to the nucleon separation energy are derived for zero and realistic pairing intensities. Self-consistent calculations validate the developed scheme as well as the derived perturbative formula. This first study ends up with an extended analysis of the odd-even mass staggering in nuclei. The new scheme allows to identify the contribution to this observable coming from different channels of the force. The necessity of a better understanding of time-odd terms in order to decide which odd-even mass formulae extracts the pairing gap the most properly is identified. These terms being nowadays more or less out of control, extended studies are needed to make precise the fit of a pairing force through the comparison of theoretical and experimental odd-even mass differences. The second study deals with beyond mean-field methods taking care of the correlations associated with large amplitude oscillations in nuclei. Their effects are usually incorporated through the GCM or the projected mean-field method. We derive a perturbation theory motivating such variational calculations from a diagrammatic point of view for the first time. Resuming two-body correlations in the energy expansion, we obtain an effective interaction removing the hard-core problem in the context of configuration mixing calculations. Proceeding to a

  14. The influence of electromyographic recording methods and the innervation zone on the mean power frequency-torque relationships.

    Science.gov (United States)

    Herda, Trent J; Zuniga, Jorge M; Ryan, Eric D; Camic, Clayton L; Bergstrom, Haley C; Smith, Doug B; Weir, Joseph P; Cramer, Joel T; Housh, Terry J

    2015-06-01

    This study examined the effects of electromyographic (EMG) recording methods and innervation zone (IZ) on the mean power frequency (MPF)-torque relationships. Nine subjects performed isometric ramp muscle actions of the leg extensors from 5% to 100% of maximal voluntary contraction with an eight channel linear electrode array over the IZ of the vastus lateralis. The slopes were calculated from the log-transformed monopolar and bipolar EMG MPF-torque relationships for each channel and subject and 95% confidence intervals (CI) were constructed around the slopes for each relationship and the composite of the slopes. Twenty-two to 55% of the subjects exhibited 95% CIs that did not include a slope of zero for the monopolar EMG MPF-torque relationships while 25-75% of the subjects exhibited 95% CIs that did not include a slope of zero for the bipolar EMG MPF-torque relationships. The composite of the slopes from the EMG MPF-torque relationships were not significantly different from zero for any method or channel, however, the method and IZ location slightly influenced the number of significant slopes on a subject-by-subject basis. The log-transform model indicated that EMG MPF-torque patterns were nonlinear regardless of recording method or distance from the IZ. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Power Quality Improvement and LVRT Capability Enhancement of Wind Farms by Means of an Inductive Filtering Method

    Directory of Open Access Journals (Sweden)

    Yanjian Peng

    2016-04-01

    Full Text Available Unlike the traditional method for power quality improvement and low-voltage ride through (LVRT capability enhancement of wind farms, this paper proposes a new wind power integrated system by means of an inductive filtering method, especially if it contains a grid-connected transformer, a static synchronous compensator (STATCOM and fully-tuned (FT branches. First, the main circuit topology of the new wind power integrated system is presented. Then, the mathematical model is established to reveal the mechanism of harmonic suppression and the reactive compensation of the proposed wind power integrated system, and then the realization conditions of the inductive filtering method is obtained. Further, the control strategy of STATCOM is introduced. Based on the measured data for a real wind farm, the simulation studies are carried out to illustrate the performance of the proposed new wind power integrated system. The results indicate that the new system can not only enhance the LVRT capability of wind farms, but also prevent harmonic components flowing into the primary (grid winding of the grid-connected transformer. Moreover, since the new method can compensate for reactive power in a wind farm, the power factor at the grid side can be improved effectively.

  16. Evaluation of protection factors provided by full-face masks using man-test method at workplace

    International Nuclear Information System (INIS)

    Izumi, Yukio; Kinouchi, Nobuyuki; Ikezawa, Yoshio.

    1994-01-01

    From a practical angle of view to estimate the protection factors (PFs) provided by full-face masks, a number of protection factors were measured with a man-test apparatus just before the wearers started to do radiation work in radiation controlled area. PFs of the total number of 2,279 cases were measured under five simulated working conditions. The measured PFs were widely distributed from 2.3 to 6,700. About 95% of workers obtained PFs more than 50, and about 64% showed much higher PFs more than 1,000 due to good fitting. In the case of some persons, the measured PFs irregularly varied and changed to a large degree. This method is a reliable technique that has been confirmed to protect unexpected internal exposure. From the results obtained, the method should be necessary to provide a better mask and higher PF for each worker. (author)

  17. Using the geometric mean fluorescence intensity index method to measure ZAP-70 expression in patients with chronic lymphocytic leukemia

    Directory of Open Access Journals (Sweden)

    Wu YJ

    2016-02-01

    Full Text Available Yu-Jie Wu, Hui Wang, Jian-Hua Liang, Yi Miao, Lu Liu, Hai-Rong Qiu, Chun Qiao, Rong Wang, Jian-Yong Li Department of Hematology, First Affiliated Hospital of Nanjing Medical University, Jiangsu Province Hospital, Nanjing, People’s Republic of China Abstract: Expression of ζ-chain-associated protein kinase 70 kDa (ZAP-70 in chronic lymphocytic leukemia (CLL is associated with more aggressive disease and can help differentiate CLL from cases expressing mutated or unmutated immunoglobulin heavy chain variable region (IgHV genes. However, standardizing ZAP-70 expression by flow cytometric analysis has proved unsatisfactory. The key point is that ZAP-70 is weakly expressed with a continuous expression pattern rather than a clear discrimination between positive and negative CLL cells, which means that the resulting judgment is subjective. Thus, in this study, we aimed at assessing the reliability and repeatability of ZAP-70 expression using the geometric mean fluorescence intensity (geo MFI index method based on flow cytometry with 256-channel resolution in a series of 402 CLL patients and to compare ZAP-70 with other biological and clinical prognosticators. According to IgHV mutational status, we were able to confirm that the optimal cut-off point for the geo MFI index was 3.5 in the test set. In multivariate analyses that included the major clinical and biological prognostic markers for CLL, the prognostic impact of ZAP-70 expression appeared to have stronger discriminatory power when the geo MFI index method was applied. In addition, we found that ZAP-70-positive patients according to the geo MFI index method had shorter time to first treatment or overall survival (P=0.0002, P=0.0491. This is the first report showing that ZAP-70 expression can be evaluated by a new approach, the geo MFI index, which could be a useful prognostic method as it is more reliable, less subjective, and therefore better associated with improvement of CLL prognostication

  18. INFORMATION TECHNOLOGY AS A MEANS TO CAPTURE THE STUDENTS OF THE COURSE "METHODS OF "MATHEMATICS" EDUCATIONAL TEACHING FIELD"

    Directory of Open Access Journals (Sweden)

    Skvortsova S.

    2014-11-01

    Full Text Available The paper presents an analysis of the concepts of "information technology", "Information Technologies in Education", "Information technology education", "computer technology", "New Information Technologies", "New Information Technologies in Education". Found that the most common concept in this list is the concept of "information technology" as a set of methods and technical means for collecting, processing, storing, processing, transmission and presentation of data. Slightly narrower in this context, the concept of "new information technologies," which mandates the involvement of computer and other technical means to work with data. The emphasis on the learning process of information technology requires detailed terms "Information Technologies in Education" and "New Information Technologies in Education", which are defined as involvement of information technology and accordingly, including the technical means to create new perceptions and knowledge transfer, evaluation studies and all-round development of the individual in the educational process. Along with these terms also used such as "information technology training," which denotes a set of training and educational materials, and technical tools for educational purposes, as well as the system of scientific knowledge about their role and place in the educational process. Meanwhile, the term "information technology" encompasses all these concepts, so in a broad sense can be used to denote any signified concepts. As an extension of the term "information technology", the term information and communication technologies (ICT, and "information technology education", understood as educational technology using special methods, software and hardware to work with information and "ICT training "- as IT training focused on the use of computer communications networks for solving instructional problems or their fragments. Taking into account tasks, such as creating methodical maintenance of discipline

  19. WE-AB-207A-06: Progressive Dose Control for Cone Beam CT with Deformation Assisted Temporal Nonlocal Means Method

    International Nuclear Information System (INIS)

    Chen, L; Shen, C; Wang, J; Jiang, S; Jia, X

    2016-01-01

    Purpose: To reduce cone beam CT (CBCT) imaging dose, we previously proposed a progressive dose control (PDC) scheme to employ temporal correlation between CBCT images at different fractions for image quality enhancement. A temporal non-local means (TNLM) method was developed to enhance quality of a new low-dose CBCT using existing high-quality CBCT. To enhance a voxel value, the TNLM method searches for similar voxels in a window. Due to patient deformation among the two CBCTs, a large searching window was required, reducing image quality and computational efficiency. This abstract proposes a deformation-assisted TNLM (DA-TNLM) method to solve this problem. Methods: For a low-dose CBCT to be enhanced using a high-quality CBCT, we first performed deformable image registration between the low-dose CBCT and the high-quality CBCT to approximately establish voxel correspondence between the two. A searching window for a voxel was then set based on the deformation vector field. Specifically, the search window for each voxel was shifted by the deformation vector. A TNLM step was then applied using only voxels within this determined window to correct image intensity at the low-dose CBCT. Results: We have tested the proposed scheme on simulated CIRS phantom data and real patient data. The CITS phantom was scanned on Varian onboard imaging CBCT system with coach shifting and dose reducing for each time. The real patient data was acquired in four fractions with dose reduced from standard CBCT dose to 12.5% of standard dose. It was found that the DA-TNLM method can reduce total dose by over 75% on average in the first four fractions. Conclusion: We have developed a PDC scheme which can enhance the quality of image scanned at low dose using a DA-TNLM method. Tests in phantom and patient studies demonstrated promising results.

  20. Primary standardization of C-14 by means of CIEMAT/NIST, TDCR and 4πβ-γ methods

    International Nuclear Information System (INIS)

    Kuznetsova, Maria

    2016-01-01

    In this work, the primary standardization of "1"4C solution, which emits beta particles of maximum energy 156 keV, was made by means of three different methods: CIEMAT/NIST and TDCR (Triple To Double Coincidence Ratio) methods in liquid scintillation systems and the tracing method, in the 4πβ-γ coincidence system. TRICARB LSC (Liquid Scintillator Counting) system, equipped with two photomultipliers tubes, was used for CIEMAT/NIST method, using a "3H standard that emits beta particles with maximum energy of 18.7 keV, as efficiency tracing. HIDEX 300SL LSC system, equipped with three photomultipliers tubes, was used for TDCR method. Samples of "1"4C and "3H, for the liquid scintillator system, were prepared using three commercial scintillation cocktails, UltimaGold, Optiphase Hisafe3 and InstaGel-Plus, in order to compare the performance in the measurements. All samples were prepared with 15 mL scintillators, in glass vials with low potassium concentration. Known aliquots of radioactive solution were dropped onto the cocktail scintillators. In order to obtain the quenching parameter curve, a nitro methane carrier solution and 1 mL of distilled water were used. For measurements in the 4πβ-γ system, "6"0Co was used as beta gamma emitter. SCS (software coincidence system) was applied and the beta efficiency was changed by using electronic discrimination. The behavior of the extrapolation curve was predicted with code ESQUEMA, using Monte Carlo technique. The "1"4C activity obtained by the three methods applied in this work was compared and the results showed to be in agreement, within the experimental uncertainty. (author)

  1. Dynamic knock detection and quantification in a spark ignition engine by means of a pressure based method

    International Nuclear Information System (INIS)

    Galloni, Enzo

    2012-01-01

    Highlights: ► Experimental data have been analyzed by a pressure based method. ► Knock intensity level depends on a threshold varying with the engine operating point. ► A dynamic method is proposed to overcome the definition of a predetermined threshold. ► The knock intensity of each operating point is quantified by a dimensionless index. ► The knock limited spark advance can be detected by means of this index. - Abstract: In spark ignition engines, knock onset limits the maximum spark advance. An inaccurate identification of this limit penalises the fuel conversion efficiency. Thus it is very important to define a knock detection method able to assess the knock intensity of an engine operating point. Usually, in engine development, knock event is evaluated by analysing the in-cylinder pressure trace. Data are filtered and processed in order to obtain some indices correlated to the knock intensity, then the calculated value is compared to a predetermined threshold. The calibration of this threshold is complex and difficult; statistical approach should be used, but often empirical values are considered. In this paper a method that dynamically calculates the knock threshold necessary to determine the knock event is proposed. The purpose is to resolve cycle by cycle the knock intensity related to an individual engine cycle without setting a predetermined threshold. The method has been applied to an extensive set of experimental data relative to a gasoline spark-ignition engine. Results are correlated to those obtained considering a traditional method, where a statistical approach has been used to detect knock.

  2. A METHOD AND AN APPARATUS FOR PROVIDING TIMING SIGNALS TO A NUMBER OF CIRCUITS, AN INTEGRATED CIRCUIT AND A NODE

    DEFF Research Database (Denmark)

    2006-01-01

    A method of providing or transporting a timing signal between a number of circuits, electrical or optical, where each circuit is fed by a node. The nodes forward timing signals between each other, and at least one node is adapted to not transmit a timing signal before having received a timing...... signal from at least two nodes. In this manner, the direction of the timing skew between nodes and circuits is known and data transport between the circuits made easier....

  3. Method of predicting the mean lung dose based on a patient's anatomy and dose-volume histograms

    Energy Technology Data Exchange (ETDEWEB)

    Zawadzka, Anna, E-mail: a.zawadzka@zfm.coi.pl [Medical Physics Department, Centre of Oncology, Maria Sklodowska-Curie Memorial Cancer Center, Warsaw (Poland); Nesteruk, Marta [Faculty of Physics, University of Warsaw, Warsaw (Poland); Department of Radiation Oncology, University Hospital Zurich and University of Zurich, Zurich (Switzerland); Brzozowska, Beata [Faculty of Physics, University of Warsaw, Warsaw (Poland); Kukołowicz, Paweł F. [Medical Physics Department, Centre of Oncology, Maria Sklodowska-Curie Memorial Cancer Center, Warsaw (Poland)

    2017-04-01

    The aim of this study was to propose a method to predict the minimum achievable mean lung dose (MLD) and corresponding dosimetric parameters for organs-at-risk (OAR) based on individual patient anatomy. For each patient, the dose for 36 equidistant individual multileaf collimator shaped fields in the treatment planning system (TPS) was calculated. Based on these dose matrices, the MLD for each patient was predicted by the homemade DosePredictor software in which the solution of linear equations was implemented. The software prediction results were validated based on 3D conformal radiotherapy (3D-CRT) and volumetric modulated arc therapy (VMAT) plans previously prepared for 16 patients with stage III non–small-cell lung cancer (NSCLC). For each patient, dosimetric parameters derived from plans and the results calculated by DosePredictor were compared. The MLD, the maximum dose to the spinal cord (D{sub max} {sub cord}) and the mean esophageal dose (MED) were analyzed. There was a strong correlation between the MLD calculated by the DosePredictor and those obtained in treatment plans regardless of the technique used. The correlation coefficient was 0.96 for both 3D-CRT and VMAT techniques. In a similar manner, MED correlations of 0.98 and 0.96 were obtained for 3D-CRT and VMAT plans, respectively. The maximum dose to the spinal cord was not predicted very well. The correlation coefficient was 0.30 and 0.61 for 3D-CRT and VMAT, respectively. The presented method allows us to predict the minimum MLD and corresponding dosimetric parameters to OARs without the necessity of plan preparation. The method can serve as a guide during the treatment planning process, for example, as initial constraints in VMAT optimization. It allows the probability of lung pneumonitis to be predicted.

  4. A method for visual inspection of welding by means of image processing of x-ray photograph

    International Nuclear Information System (INIS)

    Koshimizu, Hiroyasu; Yoshida, Tohru.

    1983-01-01

    Computer image processing is becoming a helpful tool even in industrial inspections. A computerized method for welding visual inspection is proposed in this paper. This method is based on computer image processing of X-ray photograph of welding, in which the appearance information of weldments such as shape of weld bead really exists. Structural patterns are extracted at first and seven computer measures for inspection are calculated using those patterns. Software system for visual inspection is constructed based on these seven measures. It was experimentally made clear that this system can provide a performance of more than 0.85 correlation to human visual inspection. As a result, the visual inspection by computer using X-ray photograph became a promising tool to realize objectivity and quantitativity of welding inspection. Additionally, the consistency of the system, the possibility to reduce computing costs, and so on are discussed to improve the proposed method. (author)

  5. Prioritizing the risk of plant pests by clustering methods; self-organising maps, k-means and hierarchical clustering

    Directory of Open Access Journals (Sweden)

    Susan Worner

    2013-09-01

    Full Text Available For greater preparedness, pest risk assessors are required to prioritise long lists of pest species with potential to establish and cause significant impact in an endangered area. Such prioritization is often qualitative, subjective, and sometimes biased, relying mostly on expert and stakeholder consultation. In recent years, cluster based analyses have been used to investigate regional pest species assemblages or pest profiles to indicate the risk of new organism establishment. Such an approach is based on the premise that the co-occurrence of well-known global invasive pest species in a region is not random, and that the pest species profile or assemblage integrates complex functional relationships that are difficult to tease apart. In other words, the assemblage can help identify and prioritise species that pose a threat in a target region. A computational intelligence method called a Kohonen self-organizing map (SOM, a type of artificial neural network, was the first clustering method applied to analyse assemblages of invasive pests. The SOM is a well known dimension reduction and visualization method especially useful for high dimensional data that more conventional clustering methods may not analyse suitably. Like all clustering algorithms, the SOM can give details of clusters that identify regions with similar pest assemblages, possible donor and recipient regions. More important, however SOM connection weights that result from the analysis can be used to rank the strength of association of each species within each regional assemblage. Species with high weights that are not already established in the target region are identified as high risk. However, the SOM analysis is only the first step in a process to assess risk to be used alongside or incorporated within other measures. Here we illustrate the application of SOM analyses in a range of contexts in invasive species risk assessment, and discuss other clustering methods such as k-means

  6. Evaluation of Effective Factors on e-Loyalty in Organizations Providing Electronic Services using Fuzzy AHP Method

    Directory of Open Access Journals (Sweden)

    fatemeh mohammadi

    2012-12-01

    Full Text Available In today's business world, proper identification of customer’s requirements and a quick response to these requirements is a key to commercial success. Increasing customer loyalty affects the profitability and organizations can ensure their long-term interests by means of planning. In today's competitive world, the services provided by the competing company have to be more similar to each other and can be hard to surprise customers within completely new service in the long term, because the newest services are quickly imitated by competitors and marketed. Hence investment in customer loyalty is an effective and profitable investment for companies. One criticism that has entered into the e-service is customer loyalty. In order to study the causes of e-loyalty for organization providing e-services, this research identified the factors affecting customer loyalty in e-services and with questionnaire prepared and by using fuzzy hierarchical decision-making process acquires the weight of each factor and ultimately rank them. The results show that the quality of service provided to e-services customers is the most important factor in creating e-loyalty.

  7. Organizational and provider level factors in implementation of trauma-informed care after a city-wide training: an explanatory mixed methods assessment.

    Science.gov (United States)

    Damian, April Joy; Gallo, Joseph; Leaf, Philip; Mendelson, Tamar

    2017-11-21

    While there is increasing support for training youth-serving providers in trauma-informed care (TIC) as a means of addressing high prevalence of U.S. childhood trauma, we know little about the effects of TIC training on organizational culture and providers' professional quality of life. This mixed-methods study evaluated changes in organizational- and provider-level factors following participation in a citywide TIC training. Government workers and nonprofit professionals (N = 90) who participated in a nine-month citywide TIC training completed a survey before and after the training to assess organizational culture and professional quality of life. Survey data were analyzed using multiple regression analyses. A subset of participants (n = 16) was interviewed using a semi-structured format, and themes related to organizational and provider factors were identified using qualitative methods. Analysis of survey data indicated significant improvements in participants' organizational culture and professional satisfaction at training completion. Participants' perceptions of their own burnout and secondary traumatic stress also increased. Four themes emerged from analysis of the interview data, including "Implementation of more flexible, less-punitive policies towards clients," "Adoption of trauma-informed workplace design," "Heightened awareness of own traumatic stress and need for self-care," and "Greater sense of camaraderie and empathy for colleagues." Use of a mixed-methods approach provided a nuanced understanding of the impact of TIC training and suggested potential benefits of the training on organizational and provider-level factors associated with implementation of trauma-informed policies and practices. Future trainings should explicitly address organizational factors such as safety climate and morale, managerial support, teamwork climate and collaboration, and individual factors including providers' compassion satisfaction, burnout, and secondary

  8. Minimal Subdermal Shaving by Means of Sclerotherapy Using Absolute Ethanol: A New Method for the Treatment of Axillary Osmidrosis

    Directory of Open Access Journals (Sweden)

    Hyung­Sup Shim

    2013-07-01

    Full Text Available Background Axillary osmidrosis is characterized by unpleasant odors originating from the axillary apocrine glands, resulting in psychosocial stress. The main treatment modality is apocrine gland removal. Until now, of the various surgical techniques have sometimes caused serious complications. We describe herein the favorable outcomes of a new method for ablating apocrine glands by minimal subdermal shaving using sclerotherapy with absolute ethanol.Methods A total of 12 patients underwent the procedure. The severity of osmidrosis was evaluated before surgery. Conventional subdermal shaving was performed on one side (control group and ablation by means of minimal subdermal shaving and absolute ethanol on the other side (study group. Postoperative outcomes were compared between the study and control groups.Results The length of time to removal of the drain was 1 day shorter in the study group than in the control group. There were no serious complications, such as hematoma or seroma, in either group, but flap margin necrosis and flap desquamation occurred in the control group, and were successfully managed with conservative treatment. Six months after surgery, we and our patients were satisfied with the outcomes.Conclusions Sclerotherapy using absolute ethanol combined with minimal subdermal shaving may be useful for the treatment of axillary osmidrosis. It can reduce the incidence of seroma and hematoma and allow the skin flap to adhere to its recipient site. It can degrade and ablate the remaining apocrine glands and eliminate causative organisms. Furthermore, since this technique is relatively simple, it takes less time than the conventional method.

  9. MO-DE-207A-11: Sparse-View CT Reconstruction Via a Novel Non-Local Means Method

    International Nuclear Information System (INIS)

    Chen, Z; Qi, H; Wu, S; Xu, Y; Zhou, L

    2016-01-01

    Purpose: Sparse-view computed tomography (CT) reconstruction is an effective strategy to reduce the radiation dose delivered to patients. Due to its insufficiency of measurements, traditional non-local means (NLM) based reconstruction methods often lead to over-smoothness in image edges. To address this problem, an adaptive NLM reconstruction method based on rotational invariance (RIANLM) is proposed. Methods: The method consists of four steps: 1) Initializing parameters; 2) Algebraic reconstruction technique (ART) reconstruction using raw projection data; 3) Positivity constraint of the image reconstructed by ART; 4) Update reconstructed image by using RIANLM filtering. In RIANLM, a novel similarity metric that is rotational invariance is proposed and used to calculate the distance between two patches. In this way, any patch with similar structure but different orientation to the reference patch would win a relatively large weight to avoid over-smoothed image. Moreover, the parameter h in RIANLM which controls the decay of the weights is adaptive to avoid over-smoothness, while it in NLM is not adaptive during the whole reconstruction process. The proposed method is named as ART-RIANLM and validated on Shepp-Logan phantom and clinical projection data. Results: In our experiments, the searching neighborhood size is set to 15 by 15 and the similarity window is set to 3 by 3. For the simulated case with a resolution of 256 by 256 Shepp-Logan phantom, the ART-RIANLM produces higher SNR (35.38dB<24.00dB) and lower MAE (0.0006<0.0023) reconstructed image than ART-NLM. The visual inspection demonstrated that the proposed method could suppress artifacts or noises more effectively and preserve image edges better. Similar results were found for clinical data case. Conclusion: A novel ART-RIANLM method for sparse-view CT reconstruction is presented with superior image. Compared to the conventional ART-NLM method, the SNR and MAE from ART-RIANLM increases 47% and decreases 74

  10. A Similarity-Ranking Method on Semantic Computing for Providing Information-Services in Station-Concierge System

    Directory of Open Access Journals (Sweden)

    Motoki Yokoyama

    2017-07-01

    Full Text Available The prevalence of smartphones and wireless broadband networks have been progressing as a new Railway infomration environment. According to the spread of such devices and information technology, various types of information can be obtained from databases connected to the Internet. One scenario of obtaining such a wide variety of information resources is in the phase of user’s transportation. This paper proposes an information provision system, named the Station Concierge System that matches the situation and intention of passengers. The purpose of this system is to estimate the needs of passengers like station staff or hotel concierge and to provide information resources that satisfy user’s expectations dynamically. The most important module of the system is constructed based on a new information ranking method for passenger intention prediction and service recommendation. This method has three main features, which are (1 projecting a user to semantic vector space by using her current context, (2 predicting the intention of a user based on selecting a semantic vector subspace, and (3 ranking the services by a descending order of relevant scores to the user’ intention. By comparing the predicted results of our method with those of two straightforward computation methods, the experimental studies show the effectiveness and efficiency of the proposed method. Using this system, users can obtain transit information and service map that dynamically matches their context.

  11. Stats means business

    CERN Document Server

    Buglear, John

    2010-01-01

    Stats Means Business is an introductory textbook written for Business, Hospitality and Tourism students who take modules on Statistics or Quantitative research methods. Recognising that most users of this book will have limited if any grounding in the subject, this book minimises technical language, provides clear definition of key terms, and gives emphasis to interpretation rather than technique.Stats Means Business enables readers to:appreciate the importance of statistical analysis in business, hospitality and tourism understand statis

  12. Fractal dimension to classify the heart sound recordings with KNN and fuzzy c-mean clustering methods

    Science.gov (United States)

    Juniati, D.; Khotimah, C.; Wardani, D. E. K.; Budayasa, K.

    2018-01-01

    The heart abnormalities can be detected from heart sound. A heart sound can be heard directly with a stethoscope or indirectly by a phonocardiograph, a machine of the heart sound recording. This paper presents the implementation of fractal dimension theory to make a classification of phonocardiograms into a normal heart sound, a murmur, or an extrasystole. The main algorithm used to calculate the fractal dimension was Higuchi’s Algorithm. There were two steps to make a classification of phonocardiograms, feature extraction, and classification. For feature extraction, we used Discrete Wavelet Transform to decompose the signal of heart sound into several sub-bands depending on the selected level. After the decomposition process, the signal was processed using Fast Fourier Transform (FFT) to determine the spectral frequency. The fractal dimension of the FFT output was calculated using Higuchi Algorithm. The classification of fractal dimension of all phonocardiograms was done with KNN and Fuzzy c-mean clustering methods. Based on the research results, the best accuracy obtained was 86.17%, the feature extraction by DWT decomposition level 3 with the value of kmax 50, using 5-fold cross validation and the number of neighbors was 5 at K-NN algorithm. Meanwhile, for fuzzy c-mean clustering, the accuracy was 78.56%.

  13. Method for accurate registration of tissue autofluorescence imaging data with corresponding histology: a means for enhanced tumor margin assessment

    Science.gov (United States)

    Unger, Jakob; Sun, Tianchen; Chen, Yi-Ling; Phipps, Jennifer E.; Bold, Richard J.; Darrow, Morgan A.; Ma, Kwan-Liu; Marcu, Laura

    2018-01-01

    An important step in establishing the diagnostic potential for emerging optical imaging techniques is accurate registration between imaging data and the corresponding tissue histopathology typically used as gold standard in clinical diagnostics. We present a method to precisely register data acquired with a point-scanning spectroscopic imaging technique from fresh surgical tissue specimen blocks with corresponding histological sections. Using a visible aiming beam to augment point-scanning multispectral time-resolved fluorescence spectroscopy on video images, we evaluate two different markers for the registration with histology: fiducial markers using a 405-nm CW laser and the tissue block's outer shape characteristics. We compare the registration performance with benchmark methods using either the fiducial markers or the outer shape characteristics alone to a hybrid method using both feature types. The hybrid method was found to perform best reaching an average error of 0.78±0.67 mm. This method provides a profound framework to validate diagnostical abilities of optical fiber-based techniques and furthermore enables the application of supervised machine learning techniques to automate tissue characterization.

  14. Acoustic nonlinearity parameter B/A determined by means of thermodynamic method under elevated pressures for alkanediols.

    Science.gov (United States)

    Zorębski, Edward; Zorębski, Michał

    2014-01-01

    The so-called Beyer nonlinearity parameter B/A is calculated for 1,2- and 1,3-propanediol, 1,2-, 1,3-, and 1,4-butanediol, as well as 2-methyl-2,4-pentanediol by means of a thermodynamic method. The calculations are made for temperatures from (293.15 to 318.15) K and pressures up to 100 MPa. The decrease in B/A values with the increasing pressure is observed. In the case of 1,3-butanediol, the results are compared with corresponding literature data. The consistency is very satisfactory. A simple relationship between the internal pressure and B/A nonlinearity parameter has also been studied. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Reliability determination of aluminium electrolytic capacitors by the mean of various methods application to the protection system of the LHC

    CERN Document Server

    Perisse, F; Rojat, G

    2004-01-01

    The lifetime of power electronic components is often calculated from reliability reports, but this method can be discussed. We compare in this article the results of various reliability reports to an accelerated ageing test of component and introduced the load-strength concept. Large aluminium electrolytic capacitors are taken here in example in the context of the protection system of LHC (Large Hadron Collider) in CERN where the level of reliability is essential. We notice important differences of MTBF (Mean Time Between Failure) according to the reliability report used. Accelerating ageing tests carried out prove that a Weibull law is more adapted to determinate failure rates of components. The load-strength concept associated with accelerated ageing tests can be a solution to determine the lifetime of power electronic components.

  16. A new method of spatio-temporal topographic mapping by correlation coefficient of K-means cluster.

    Science.gov (United States)

    Li, Ling; Yao, Dezhong

    2007-01-01

    It would be of the utmost interest to map correlated sources in the working human brain by Event-Related Potentials (ERPs). This work is to develop a new method to map correlated neural sources based on the time courses of the scalp ERPs waveforms. The ERP data are classified first by k-means cluster analysis, and then the Correlation Coefficients (CC) between the original data of each electrode channel and the time course of each cluster centroid are calculated and utilized as the mapping variable on the scalp surface. With a normalized 4-concentric-sphere head model with radius 1, the performance of the method is evaluated by simulated data. CC, between simulated four sources (s (1)-s (4)) and the estimated cluster centroids (c (1)-c (4)), and the distances (Ds), between the scalp projection points of the s (1)-s (4) and that of the c (1)-c (4), are utilized as the evaluation indexes. Applied to four sources with two of them partially correlated (with maximum mutual CC = 0.4892), CC (Ds) between s (1)-s (4) and c (1)-c (4) are larger (smaller) than 0.893 (0.108) for noise levels NSRclusters located at left, right occipital and frontal. The estimated vectors of the contra-occipital area demonstrate that attention to the stimulus location produces increased amplitude of the P1 and N1 components over the contra-occipital scalp. The estimated vector in the frontal area displays two large processing negativity waves around 100 ms and 250 ms when subjects are attentive, and there is a small negative wave around 140 ms and a P300 when subjects are unattentive. The results of simulations and real Visual Evoked Potentials (VEPs) data demonstrate the validity of the method in mapping correlated sources. This method may be an objective, heuristic and important tool to study the properties of cerebral, neural networks in cognitive and clinical neurosciences.

  17. Methods to evaluate some reservoir characterization by means of the geophysical data in the strata of limestone and marl

    Directory of Open Access Journals (Sweden)

    V. M. Seidov

    2017-12-01

    Full Text Available As we know, the main goal of interpreting the materials of well logging, including the allocation of collectors and assessment of their saturation, are successfully achieved when the process of interpretation has a strong methodological support. This means, that it is justified by the necessary interpretational models and effective instructional techniques are used. They are based on structural and petrophysical models of reservoirs of the section investigated. The problem of studying the marl rocks with the help of the geophysical methods is not worked out properly. Many years of experience of studying limestone and marl rocks has made it possible to justify the optimal method of data interpretation of geophysical research wells in carbonate sections, which was represented by limestone and marl formations. A new method was developed to study marl rocks. It includes the following main studies: detection of reservoirs in the carbonate section according to the materials of geophysical studies of wells; determination of the geophysical parameters of each reservoir; assessment of the quality of well logging curves; introduction of amendments; selection of reference layers; the calculation of the relative double differencing parameters; the involvement of core data; identifying the lithological rock composition; the rationale for structural models of reservoirs; the definition of the block and of the total porosity; determination of argillaceous carbonate rocks; determination of the coefficient of water saturation of formations based on the type of the collector; setting a critical value for effective porosity, etc. This method was applied in the Eocene deposits of the Interfluve of the Kura and Iori, which is a promising object of hydrocarbons in Azerbaijan. The following conclusions have been made: this methodology successfully solves the problem of petrophysical characteristics of marl rocks; bad connection is observed between some of the

  18. Organizational and provider level factors in implementation of trauma-informed care after a city-wide training: an explanatory mixed methods assessment

    Directory of Open Access Journals (Sweden)

    April Joy Damian

    2017-11-01

    Full Text Available Abstract Background While there is increasing support for training youth-serving providers in trauma-informed care (TIC as a means of addressing high prevalence of U.S. childhood trauma, we know little about the effects of TIC training on organizational culture and providers’ professional quality of life. This mixed-methods study evaluated changes in organizational- and provider-level factors following participation in a citywide TIC training. Methods Government workers and nonprofit professionals (N = 90 who participated in a nine-month citywide TIC training completed a survey before and after the training to assess organizational culture and professional quality of life. Survey data were analyzed using multiple regression analyses. A subset of participants (n = 16 was interviewed using a semi-structured format, and themes related to organizational and provider factors were identified using qualitative methods. Results Analysis of survey data indicated significant improvements in participants’ organizational culture and professional satisfaction at training completion. Participants’ perceptions of their own burnout and secondary traumatic stress also increased. Four themes emerged from analysis of the interview data, including “Implementation of more flexible, less-punitive policies towards clients,” “Adoption of trauma-informed workplace design,” “Heightened awareness of own traumatic stress and need for self-care,” and “Greater sense of camaraderie and empathy for colleagues.” Conclusion Use of a mixed-methods approach provided a nuanced understanding of the impact of TIC training and suggested potential benefits of the training on organizational and provider-level factors associated with implementation of trauma-informed policies and practices. Future trainings should explicitly address organizational factors such as safety climate and morale, managerial support, teamwork climate and collaboration, and

  19. Assessment of dietary intake of flavouring substances within the procedure for their safety evaluation: advantages and limitations of estimates obtained by means of a per capita method.

    Science.gov (United States)

    Arcella, D; Leclercq, C

    2005-01-01

    The procedure for the safety evaluation of flavourings adopted by the European Commission in order to establish a positive list of these substances is a stepwise approach which was developed by the Joint FAO/WHO Expert Committee on Food Additives (JECFA) and amended by the Scientific Committee on Food. Within this procedure, a per capita amount based on industrial poundage data of flavourings, is calculated to estimate the dietary intake by means of the maximised survey-derived daily intake (MSDI) method. This paper reviews the MSDI method in order to check if it can provide conservative intake estimates as needed at the first steps of a stepwise procedure. Scientific papers and opinions dealing with the MSDI method were reviewed. Concentration levels reported by the industry were compared with estimates obtained with the MSDI method. It appeared that, in some cases, these estimates could be orders of magnitude (up to 5) lower than those calculated considering concentration levels provided by the industry and regular consumption of flavoured foods and beverages. A critical review of two studies which had been used to support the statement that MSDI is a conservative method for assessing exposure to flavourings among high consumers was performed. Special attention was given to the factors that affect exposure at high percentiles, such as brand loyalty and portion sizes. It is concluded that these studies may not be suitable to validate the MSDI method used to assess intakes of flavours by European consumers due to shortcomings in the assumptions made and in the data used. Exposure assessment is an essential component of risk assessment. The present paper suggests that the MSDI method is not sufficiently conservative. There is therefore a clear need for either using an alternative method to estimate exposure to flavourings in the procedure or for limiting intakes to the levels at which the safety was assessed.

  20. Behavioural responses to hypoxia provide a non-invasive method for distinguishing between stress coping styles in fish

    DEFF Research Database (Denmark)

    Laursen, Danielle Caroline; Olsén, Hanna L.; Ruiz-Gomez, Maria de Lourdes

    2011-01-01

    . These individual differences may result in suboptimal production and compromised welfare in aquaculture. An approach to overcome these problems could be to sort fish and optimise rearing conditions according to coping style. It has been previously demonstrated that the proactive and reactive coping styles in fish......, these fish provided an opportunity for verifying a method for sorting fish with respect to coping style by exposure to hypoxia. Groups consisting of 24 individually tagged fish, 12 HR and 12 LR were exposed to hypoxia in a two choice system. The system consisted of a “home” tank provided with cover connected...... to a second brightly “illuminated” tank via a closable doorway. During the experiment, the doorway between the two tanks was opened and hypoxic conditions were gradually induced in the “home” tank by bubbling with nitrogen. The latency time to move away from hypoxic conditions to normoxic conditions...

  1. The paradox of compassionate work: a mixed-methods study of satisfying and fatiguing experiences of animal health care providers.

    Science.gov (United States)

    Polachek, Alicia J; Wallace, Jean E

    2018-03-01

    Compassionate work appears paradoxical as it may provide great rewards, but may also come at great costs to care providers. This paper explores the paradox of compassionate work by examining what interactions contribute to compassion satisfaction and what interactions contribute to compassion fatigue. This mixed-methods, cross-sectional study uses qualitative interview data from animal health care providers (N = 20) to identify work interactions that they find satisfying or stressful. Quantitative survey data (N = 572) are used to test hypotheses generated from the interviews regarding predictors of compassion satisfaction and compassion fatigue. Interview transcripts were analyzed using a directed content analysis approach. Survey data were analyzed using ordinary least squares regression. The results highlight the complex nature of compassionate work. As hypothesized, making a difference to animals and building relationships with animal patients and human clients relate to greater compassion satisfaction. Human client barriers to animal care and witnessing client grief relate to greater compassion fatigue, as predicted. None of the predictors relate to less compassion fatigue, but forming relationships with animal patients relates to both greater compassion satisfaction and compassion fatigue. This paper enhances our understanding of provider-client-patient interactions and highlights the paradox of compassionate work.

  2. runjags: An R Package Providing Interface Utilities, Model Templates, Parallel Computing Methods and Additional Distributions for MCMC Models in JAGS

    Directory of Open Access Journals (Sweden)

    Matthew J. Denwood

    2016-07-01

    Full Text Available The runjags package provides a set of interface functions to facilitate running Markov chain Monte Carlo models in JAGS from within R. Automated calculation of appropriate convergence and sample length diagnostics, user-friendly access to commonly used graphical outputs and summary statistics, and parallelized methods of running JAGS are provided. Template model specifications can be generated using a standard lme4-style formula interface to assist users less familiar with the BUGS syntax. Automated simulation study functions are implemented to facilitate model performance assessment, as well as drop-k type cross-validation studies, using high performance computing clusters such as those provided by parallel. A module extension for JAGS is also included within runjags, providing the Pareto family of distributions and a series of minimally-informative priors including the DuMouchel and half-Cauchy priors. This paper outlines the primary functions of this package, and gives an illustration of a simulation study to assess the sensitivity of two equivalent model formulations to different prior distributions.

  3. Estimation of ecosystem respiration and its components by means of stable isotopes and improved closed-chamber methods

    DEFF Research Database (Denmark)

    Brændholt, Andreas

    Ecosystem respiration (Reco) is the second largest flux of CO2 between the biosphere and the atmosphere. It consists of several components, such as plant respiration and soil respiration (Rsoil), each of which may respond differently to abiotic factors, and thus to global climate change. Rsoil...... and abiotic factors, and before estimating Rsoil fluxes over longer time scales. The work also shows that artificial turbulent air mixing may provide a method to overcome the issue with overestimated fluxes, allowing for measurements even at low atmospheric turbulence. Furthermore, the results show...

  4. AUTOMATIC EXTRACTION OF ROCK JOINTS FROM LASER SCANNED DATA BY MOVING LEAST SQUARES METHOD AND FUZZY K-MEANS CLUSTERING

    Directory of Open Access Journals (Sweden)

    S. Oh

    2012-09-01

    Full Text Available Recent development of laser scanning device increased the capability of representing rock outcrop in a very high resolution. Accurate 3D point cloud model with rock joint information can help geologist to estimate stability of rock slope on-site or off-site. An automatic plane extraction method was developed by computing normal directions and grouping them in similar direction. Point normal was calculated by moving least squares (MLS method considering every point within a given distance to minimize error to the fitting plane. Normal directions were classified into a number of dominating clusters by fuzzy K-means clustering. Region growing approach was exploited to discriminate joints in a point cloud. Overall procedure was applied to point cloud with about 120,000 points, and successfully extracted joints with joint information. The extraction procedure was implemented to minimize number of input parameters and to construct plane information into the existing point cloud for less redundancy and high usability of the point cloud itself.

  5. Developing cluster strategy of apples dodol SMEs by integration K-means clustering and analytical hierarchy process method

    Science.gov (United States)

    Mustaniroh, S. A.; Effendi, U.; Silalahi, R. L. R.; Sari, T.; Ala, M.

    2018-03-01

    The purposes of this research were to determine the grouping of apples dodol small and medium enterprises (SMEs) in Batu City and to determine an appropriate development strategy for each cluster. The methods used for clustering SMEs was k-means. The Analytical Hierarchy Process (AHP) approach was then applied to determine the development strategy priority for each cluster. The variables used in grouping include production capacity per month, length of operation, investment value, average sales revenue per month, amount of SMEs assets, and the number of workers. Several factors were considered in AHP include industry cluster, government, as well as related and supporting industries. Data was collected using the methods of questionaire and interviews. SMEs respondents were selected among SMEs appels dodol in Batu City using purposive sampling. The result showed that two clusters were formed from five apples dodol SMEs. The 1stcluster of apples dodol SMEs, classified as small enterprises, included SME A, SME C, and SME D. The 2ndcluster of SMEs apples dodol, classified as medium enterprises, consisted of SME B and SME E. The AHP results indicated that the priority development strategy for the 1stcluster of apples dodol SMEs was improving quality and the product standardisation, while for the 2nd cluster was increasing the marketing access.

  6. Analysis of operational, institutional and international limitations for alternative fuel vehicles and technologies: Means/methods for implementing changes

    Energy Technology Data Exchange (ETDEWEB)

    1992-07-01

    This project focused upon the development of an approach to assist public fleet managers in evaluating the characteristics and availability of alternative fuels (AF`s) and alternative fuel vehicles (AFV`s) that will serve as possible replacements for vehicles currently serving the needs of various public entities. Also of concern were the institutional/international limitations for alternative fuels and alternative fuel vehicles. The City of Detroit and other public agencies in the Detroit area were the particular focus for the activities. As the development and initial stages of use of alternative fuels and alternative fuel vehicles proceeds, there will be an increasing need to provide information and guidance to decision-makers regarding differences in requirements and features of these fuels and vehicles. There wig be true differences in requirements for servicing, managing, and regulating. There will also be misunderstanding and misperception. There have been volumes of data collected on AFV`S, and as technology is improved, new data is constantly added. There are not, however, condensed and effective sources of information for public vehicle fleet managers on vehicle and equipment sources, characteristics, performance, costs, and environmental benefits. While theoretical modeling of public fleet requirements has been done, there do not seem to be readily available ``practical``. There is a need to provide the best possible information and means to minimize the problems for introducing the effective use of alternative fuels and alternative fuel vehicles.

  7. Minimal Subdermal Shaving by Means of Sclerotherapy Using Absolute Ethanol: A New Method for the Treatment of Axillary Osmidrosis

    Directory of Open Access Journals (Sweden)

    Hyung-Sup Shim

    2013-07-01

    Full Text Available BackgroundAxillary osmidrosis is characterized by unpleasant odors originating from the axillary apocrine glands, resulting in psychosocial stress. The main treatment modality is apocrine gland removal. Until now, of the various surgical techniques have sometimes caused serious complications. We describe herein the favorable outcomes of a new method for ablating apocrine glands by minimal subdermal shaving using sclerotherapy with absolute ethanol.MethodsA total of 12 patients underwent the procedure. The severity of osmidrosis was evaluated before surgery. Conventional subdermal shaving was performed on one side (control group and ablation by means of minimal subdermal shaving and absolute ethanol on the other side (study group. Postoperative outcomes were compared between the study and control groups.ResultsThe length of time to removal of the drain was 1 day shorter in the study group than in the control group. There were no serious complications, such as hematoma or seroma, in either group, but flap margin necrosis and flap desquamation occurred in the control group, and were successfully managed with conservative treatment. Six months after surgery, we and our patients were satisfied with the outcomes.ConclusionsSclerotherapy using absolute ethanol combined with minimal subdermal shaving may be useful for the treatment of axillary osmidrosis. It can reduce the incidence of seroma and hematoma and allow the skin flap to adhere to its recipient site. It can degrade and ablate the remaining apocrine glands and eliminate causative organisms. Furthermore, since this technique is relatively simple, it takes less time than the conventional method.

  8. Development of quality indicators for low-risk labor care provided by midwives using a RAND-modified Delphi method.

    Science.gov (United States)

    Ueda, Kayo; Ohtera, Shosuke; Kaso, Misato; Nakayama, Takeo

    2017-09-22

    In childbirth, most deliveries are low-risk, defined as spontaneous labor at full term without special high-risk facts or complications, especially in high-resource countries where maternal and perinatal mortality rates are very low. Indeed, the majority of mothers and infants have no serious conditions during labor. However, the quality of care provided is not assured, and performance may vary by birthing facility and provider. The overuse of technology in childbirth in some parts of the world is almost certainly based on assumptions like, "something can go wrong at any minute." There is a need to assess the quality of care provided for mothers and infants in low-risk labor. We aimed to develop specific quality indicators for low-risk labor care provided primarily by midwives in Japan. We used a RAND-modified Delphi method, which integrates evidence review with expert consensus development. The procedure comprises five steps: (1) literature review, including clinical practice guidelines, to extract and develop quality indicator candidates; (2) formation of a multidisciplinary panel; (3) independent panel ratings (Round 1); (4) panel meeting and independent panel ratings (Round 2); and (5) independent panel ratings (Round 3). The three independent panel ratings (Rounds 1-3) were held between July and December 2012. The assembled multidisciplinary panel comprised eight clinicians (two pediatricians, three obstetricians, and three midwives) and three mothers who were nonclinicians. Evidentiary review extracted 166 key recommendations from 32 clinical practice guidelines, and 31 existing quality indicators were added. After excluding duplicate recommendations and quality indicators, the panel discussed 25 candidate indicators. Of these, 18 were adopted, one was modified, six were not adopted, and four were added during the meeting, respectively. We established 23 quality indicators for low-risk labor care provided by midwives in labor units in Japan.

  9. A mixed-methods examination of communication between oncologists and primary care providers among primary care physicians in underserved communities.

    Science.gov (United States)

    Shen, Megan Johnson; Binz-Scharf, Maria; D'Agostino, Tom; Blakeney, Natasha; Weiss, Elisa; Michaels, Margo; Patel, Shilpa; McKee, M Diane; Bylund, Carma L

    2015-03-15

    Research has demonstrated that communication and care coordination improve cancer patient outcomes. To improve communication and care coordination, it is important to understand primary care providers' (PCPs') perceptions of communication with oncologists as well as PCPs' communication needs. A mixed-methods approach was used in the present study. In the qualitative phase of the study, 18 PCPs practicing in underserved, minority communities were interviewed about their experiences communicating with oncologists. In the quantitative phase of the study, 128 PCPs completed an online survey about their preferences, experiences, and satisfaction with communication with oncologists. Results indicated a PCP-oncologist gap in communication occurred between diagnosis and treatment. PCPs wanted more communication with oncologists, updates on their patients' prognosis throughout treatment, and to be contacted via telephone or email and saw their role as crucial in providing supportive care for their patients. Although PCPs recognize that they play a critical, proactive role in supporting patients throughout the continuum of their cancer care experience, existing norms regarding postreferral engagement and oncologist-PCP communication often hinder activation of this role among PCPs. Expected standards regarding the method, frequency, and quality of postreferral communication should be jointly articulated and made accountable between PCPs and oncologists to help improve cancer patients' quality of care, particularly in minority communities. © 2014 American Cancer Society.

  10. Daytime relapse of the mean radiant temperature based on the six-directional method under unobstructed solar radiation.

    Science.gov (United States)

    Kántor, Noémi; Lin, Tzu-Ping; Matzarakis, Andreas

    2014-09-01

    This study contributes to the knowledge about the capabilities of the popular "six-directional method" describing the radiation fields outdoors. In Taiwan, measurements were carried out with three orthogonally placed net radiometers to determine the mean radiant temperature (T(mrt)). The short- and long-wave radiation flux densities from the six perpendicular directions were recorded in the daylight hours of 12 days. During unobstructed direct irradiation, a specific daytime relapse was found in the temporal course of the T(mrt) values referring to the reference shapes of a standing man and also of a sphere. This relapse can be related to the short-wave fluxes reaching the body from the lateral directions. Through deeper analysis, an instrumental shortcoming of the six-directional technique was discovered. The pyranometer pairs of the same net radiometer have a 10-15-min long "blind spot" when the sun beams are nearly perpendicular to them. The blind-spot period is supposed to be shorter with steeper solar azimuth curve on the daylight period. This means that the locations with lower geographical latitude, and the summertime measurements, are affected less by this instrumental problem. A methodological shortcoming of the six-directional technique was also demonstrated. Namely, the sum of the short-wave flux densities from the lateral directions is sensitive to the orientation of the radiometers, and therefore by deviating from the original directions, the T(mrt) decrease on clear sunny days will occur in different times and will be different in extent.

  11. A nonparametric statistical method for determination of a confidence interval for the mean of a set of results obtained in a laboratory intercomparison

    International Nuclear Information System (INIS)

    Veglia, A.

    1981-08-01

    In cases where sets of data are obviously not normally distributed, the application of a nonparametric method for the estimation of a confidence interval for the mean seems to be more suitable than some other methods because such a method requires few assumptions about the population of data. A two-step statistical method is proposed which can be applied to any set of analytical results: elimination of outliers by a nonparametric method based on Tchebycheff's inequality, and determination of a confidence interval for the mean by a non-parametric method based on binominal distribution. The method is appropriate only for samples of size n>=10

  12. Transmission portal in vivo dosimetry by means of the Monte Carlo method and the mathematical programming language MATLAB

    International Nuclear Information System (INIS)

    BadraouiCuprova, K.

    2014-01-01

    Modern radiotherapy has increased demand for dose delivery verification. In this paper transmission portal dosimetry was considered. Portal detectors are a promising tool for 2D dosimetric verification and they are nowadays one of the most widely investigated topics. In this study an Electronic Portal Imaging Device (EPID) was positioned below the patient and the transmission images were captured during the irradiation. The principle of this verification consists of comparison of the acquired images with images predicted on the basis of the entrance fluence map and the tissue distribution in the patient. Such verification is not performed at any radiotherapy department in the Czech Republic. There is no system available for the prediction of transmission portal images. Even worldwide, there is still a lack of commercially available solutions. The aim of this paper is to present a new method of prediction of transmission portal images by means of the Monte Carlo (MC) method and the mathematical programming language MATLAB. The MC code EGSnrc (Electron Gamma Shower) was used. The validity of the presented method was verified by comparison of the predicted images with the acquired ones. The acquisition of EPID images was performed at the Hospital Na Bulovce. Three different validation tests were performed. In the first case, the EPID was irradiated by regular and irregular fields while there was nothing present in the beam path. In the second case, a water-equivalent phantom was added to the EPID and was irradiated by a number of irregular fields. In the third case, a real patient was present in the beam path and the EPID images were acquired during the patient's treatment. The patient was irradiated by 8 treatment fields and the portal images were acquired during 5 treatment fractions. All of the acquired images were compared with the MC predicted ones by gamma analysis with gamma criteria of 3%, 3 mm. The average gamma values were 0.31-0.4, 0.34-0.4 and 0.35-0.61 in

  13. Family building using embryo adoption: relationships and contact arrangements between provider and recipient families-a mixed-methods study.

    Science.gov (United States)

    Frith, Lucy; Blyth, Eric; Lui, Steve

    2017-05-01

    What contact arrangements are established between providers and recipients of embryos using Snowflakes® Embryo Adoption Program? Contact arrangements varied considerably and were generally positively described, although some challenges were acknowledged. Reproductive technologies create new and diverse family forms, and the ways in which families created by embryo adoption are negotiated in practice have not been extensively investigated. This exploratory, mixed-methods study had two phases: (i) an online survey (open May-September 2013) and (ii) qualitative semi-structured interviews by email (conducted between 2014 and 2015), exploring participants' experiences of contact with their embryo provider or recipient. Phase I included 17 providers (14 women and 3 men) and 28 recipients (27 women and 1 man). Phase II included 8 providers (5 women and 3 men) and 12 recipients (10 women and 2 men). All participants, except one, were located in the US. This study illustrates how embryo adoption in the US, as a form of conditional donation, can operate and how the participants define and negotiate these emerging relationships. All families were open with their children about how they were conceived and early contact between recipients and providers (frequently before birth) was valued. On the whole, participants were happy with the amount and type of contact they had, and where the current contact did not involve the children, it was seen as a way of keeping the channels open for future contact when the children were older. Participants often portrayed the opportunities for contact as being in the best interests of the child. The study participants are a particular group who had chosen to either receive or give their embryos via a conditional embryo adoption agency in the US and had established contact. Therefore, this is not a representative sample of those who provide or receive embryos for family building. This embryo adoption model clearly fulfils a need; some people

  14. An Investigation of Trace Elements in Marine and Lacustrine Deposits by Means of a Neutron Activation Method

    Energy Technology Data Exchange (ETDEWEB)

    Landstroem, O; Samsahl, K; Wenner, C G

    1967-10-15

    A neutron activation method for multi-elemental analysis was applied to argillaceous deposits from the Viskan Valley on the Swedish West Coast, an area in which transgressions and regressions of the sea have occurred during the postglacial time. These changes between fresh-water and marine stages are well known from earlier geologic investigations. Analysis could therefore be performed of samples of known marine (brackish) and lacustrine origin. In a preliminary test on four samples, taken from two marine layers and two lacustrine layers, altogether 30 elements were quantitatively determined, namely As, Br, Ca, Ce, Co, Cr, Cs, Eu, Fe, Ga, Hf, Hg, La, Lu, Mn, Na, Rb, Sb, Sc, Se, Sm, Sr, Ta, Tb, Th, U, W, Yb, Zn and Zr. Several elements showed a difference in concentration between the marine and the fresh-water layers. Br, Hg, Mn, Se, As and Sb were more thoroughly investigated in three boreholes from different sections of the valley. Br and Se had high means in the most pronounced marine samples of the fiord deposits. Moreover, Mn showed a fourfold increase just in the transition stage between the older sea fiord and the older lage stage.

  15. METHOD FOR SECURITY SPECIFICATION SOFTWARE REQUIREMENTS AS A MEANS FOR IMPLEMENTING A SOFTWARE DEVELOPMENT PROCESS SECURE - MERSEC

    Directory of Open Access Journals (Sweden)

    Castro Mecías, L.T.

    2015-06-01

    Full Text Available Often security incidents that have the object or use the software as a means of causing serious damage and legal, economic consequences, etc. Results of a survey by Kaspersky Lab reflectvulnerabilities in software are the main cause of security incidents in enterprises, the report shows that 85% of them have reported security incidents and vulnerabilities in software are the main reason is further estimated that incidents can cause significant losses estimated from 50,000 to $ 649.000. (1 In this regard academic and industry research focuses on proposals based on reducing vulnerabilities and failures of technology, with a positive influence on how the software is developed. A development process for improved safety practices and should include activities from the initial phases of the software; so that security needs are identified, manage risk and appropriate measures are implemented. This article discusses a method of analysis, acquisition and requirements specification of the software safety analysis on the basis of various proposals and deficiencies identified from participant observation in software development teams. Experiments performed using the proposed yields positive results regarding the reduction of security vulnerabilities and compliance with the safety objectives of the software.

  16. An Investigation of Trace Elements in Marine and Lacustrine Deposits by Means of a Neutron Activation Method

    International Nuclear Information System (INIS)

    Landstroem, O.; Samsahl, K.; Wenner, C.G.

    1967-10-01

    A neutron activation method for multi-elemental analysis was applied to argillaceous deposits from the Viskan Valley on the Swedish West Coast, an area in which transgressions and regressions of the sea have occurred during the postglacial time. These changes between fresh-water and marine stages are well known from earlier geologic investigations. Analysis could therefore be performed of samples of known marine (brackish) and lacustrine origin. In a preliminary test on four samples, taken from two marine layers and two lacustrine layers, altogether 30 elements were quantitatively determined, namely As, Br, Ca, Ce, Co, Cr, Cs, Eu, Fe, Ga, Hf, Hg, La, Lu, Mn, Na, Rb, Sb, Sc, Se, Sm, Sr, Ta, Tb, Th, U, W, Yb, Zn and Zr. Several elements showed a difference in concentration between the marine and the fresh-water layers. Br, Hg, Mn, Se, As and Sb were more thoroughly investigated in three boreholes from different sections of the valley. Br and Se had high means in the most pronounced marine samples of the fiord deposits. Moreover, Mn showed a fourfold increase just in the transition stage between the older sea fiord and the older lage stage

  17. Shannon Entropy and K-Means Method for Automatic Diagnosis of Broken Rotor Bars in Induction Motors Using Vibration Signals

    Directory of Open Access Journals (Sweden)

    David Camarena-Martinez

    2016-01-01

    Full Text Available For industry, the induction motors are essential elements in production chains. Despite the robustness of induction motors, they are susceptible to failures. The broken rotor bar (BRB fault in induction motors has received special attention since one of its characteristics is that the motor can continue operating with apparent normality; however, at certain point the fault may cause severe damage to the motor. In this work, a methodology to detect BRBs using vibration signals is proposed. The methodology uses the Shannon entropy to quantify the amount of information provided by the vibration signals, which changes due to the presence of new frequency components associated with the fault. For automatic diagnosis, the K-means cluster algorithm and a decision-making unit that looks for the nearest cluster through the Euclidian distance are applied. Unlike other reported works, the proposal can diagnose the BRB condition during startup transient and steady state regimes of operation. Additionally, the proposal is also implemented into a field programmable gate array in order to offer a low-cost and low-complex online monitoring system. The obtained results demonstrate the proposal effectiveness to diagnose half, one, and two BRBs.

  18. CHILD’S PLAY AS A MEANS OF expression AND A TEACHING METHOD DURING CLASSES OF PHYSICAL EDUCATION

    Directory of Open Access Journals (Sweden)

    Dragan Martinović

    2011-08-01

    Full Text Available The child’s play is a basic form of activity aimed at expressing children’s interests and the feeling of pleasure. By playing, children explore the environment and get their first-hand impressions of nature and its inimitable ways, which broadens their knowledge and experience. Throughout the game, as a child matures he develops his senses and emotions, gains independence, self-reliance and social maturity. It enriches his experience base, becoming the child’s inseparable companion throughout the childhood. This paper provides an insight into the influence of elementary games on the psychophysical development of school children, as well as some guidelines for teaching methods as a necessary prerequisite for the successful implementation of elementary games

  19. Determining the area of influence of depression cone in the vicinity of lignite mine by means of triangle method and LANDSAT TM/ETM+ satellite images.

    Science.gov (United States)

    Zawadzki, Jarosław; Przeździecki, Karol; Miatkowski, Zygmunt

    2016-01-15

    Problems with lowering of water table are common all over the world. Intensive pumping of water from aquifers for consumption, irrigation, industrial or mining purposes often causes groundwater depletion and results in the formation of cone of depression. This can severely decrease water pressure, even over vast areas, and can create severe problems such as degradation of agriculture or natural environment sometimes depriving people and animals of water supply. In this paper, the authors present a method for determining the area of influence of a groundwater depression cone resulting from prolonged drainage, by means of satellite images in optical, near infrared and thermal infrared bands from TM sensor (Thematic Mapper) and ETM+ sensor (Enhanced Thematic Mapper +) placed on Landsat 5 and Landsat 7 satellites. The research area was Szczercowska Valley (Pol. Kotlina Szczercowska), Central Poland, located within a range of influence of a groundwater drainage system of the lignite coal mine in Belchatow. It is the biggest lignite coal mine in Poland and one of the largest in Europe exerting an enormous impact on the environment. The main method of satellite data analysis for determining soil moisture, was the so-called triangle method. This method, based on TVDI (Temperature Vegetation Dryness Index) was supported by additional spatial analysis including ordinary kriging used in order to combine fragmentary information obtained from areas covered by meadows. The results obtained are encouraging and confirm the usefulness of the triangle method not only for soil moisture determination but also for assessment of the temporal and spatial changes in the area influenced by the groundwater depression cone. The range of impact of the groundwater depression cone determined by means of above-described remote sensing analysis shows good agreement with that determined by ground measurements. The developed satellite method is much faster and cheaper than in-situ measurements

  20. An analytical solution of Richards' equation providing the physical basis of SCS curve number method and its proportionality relationship

    Science.gov (United States)

    Hooshyar, Milad; Wang, Dingbao

    2016-08-01

    The empirical proportionality relationship, which indicates that the ratio of cumulative surface runoff and infiltration to their corresponding potentials are equal, is the basis of the extensively used Soil Conservation Service Curve Number (SCS-CN) method. The objective of this paper is to provide the physical basis of the SCS-CN method and its proportionality hypothesis from the infiltration excess runoff generation perspective. To achieve this purpose, an analytical solution of Richards' equation is derived for ponded infiltration in shallow water table environment under the following boundary conditions: (1) the soil is saturated at the land surface; and (2) there is a no-flux boundary which moves downward. The solution is established based on the assumptions of negligible gravitational effect, constant soil water diffusivity, and hydrostatic soil moisture profile between the no-flux boundary and water table. Based on the derived analytical solution, the proportionality hypothesis is a reasonable approximation for rainfall partitioning at the early stage of ponded infiltration in areas with a shallow water table for coarse textured soils.

  1. Evaluating the impact of healthcare provider training to improve tuberculosis management: a systematic review of methods and outcome indicators used.

    Science.gov (United States)

    Wu, Shishi; Roychowdhury, Imara; Khan, Mishal

    2017-03-01

    Developing human resources capacity is vital for tuberculosis (TB) control in low- and middle-income countries. Although investments in TB healthcare provider (HCP) training programmes have increased, it is unclear whether these are robustly evaluated. The objective of this systematic review was to synthesize the methods and outcome indicators used to assess TB HCP training programmes. A systematic scoping review of publications reporting on evaluations of training programmes for TB HCPs - including doctors, nurses, paramedics, and lay health workers - was conducted through a search in three electronic databases, Google Scholar, and five websites of non-profit organizations. Data on the study location, population trained, outcomes assessed, and evaluation approach were extracted. After screening 499 unique publications, 21 were eligible for inclusion in the analysis. The majority of evaluations were conducted in Africa. The most common evaluation methods were a review of patient records (n=8, 38%) and post-training interview with trainees (n=7, 33%). In terms of outcomes, more than half of the studies (n=12, 57%) evaluated knowledge acquisition of trainees, with only six (29%) assessing on-the-job behaviour change. Even though more funds have been invested in TB HCP training, publications from robust evaluations assessing the impact on quality of care and behaviour change are limited. Copyright © 2016. Published by Elsevier Ltd.

  2. Team dynamics, clinical work satisfaction, and patient care coordination between primary care providers: A mixed methods study.

    Science.gov (United States)

    Song, Hummy; Ryan, Molly; Tendulkar, Shalini; Fisher, Josephine; Martin, Julia; Peters, Antoinette S; Frolkis, Joseph P; Rosenthal, Meredith B; Chien, Alyna T; Singer, Sara J

    Team-based care is essential for delivering high-quality, comprehensive, and coordinated care. Despite considerable research about the effects of team-based care on patient outcomes, few studies have examined how team dynamics relate to provider outcomes. The aim of this study was to examine relationships among team dynamics, primary care provider (PCP) clinical work satisfaction, and patient care coordination between PCPs in 18 Harvard-affiliated primary care practices participating in Harvard's Academic Innovations Collaborative. First, we administered a cross-sectional survey to all 548 PCPs (267 attending clinicians, 281 resident physicians) working at participating practices; 65% responded. We assessed the relationship of team dynamics with PCPs' clinical work satisfaction and perception of patient care coordination between PCPs, respectively, and the potential mediating effect of patient care coordination on the relationship between team dynamics and work satisfaction. In addition, we embedded a qualitative evaluation within the quantitative evaluation to achieve a convergent mixed methods design to help us better understand our findings and illuminate relationships among key variables. Better team dynamics were positively associated with clinical work satisfaction and quality of patient care coordination between PCPs. Coordination partially mediated the relationship between team dynamics and satisfaction for attending clinicians, suggesting that higher satisfaction depends, in part, on better teamwork, yielding more coordinated patient care. We found no mediating effects for resident physicians. Qualitative results suggest that sources of satisfaction from positive team dynamics for PCPs may be most relevant to attending clinicians. Improving primary care team dynamics could improve clinical work satisfaction among PCPs and patient care coordination between PCPs. In addition to improving outcomes that directly concern health care providers, efforts to

  3. The mean magnetic field of the sun - Method of observation and relation to the interplanetary magnetic field

    Science.gov (United States)

    Scherrer, P. H.; Wilcox, J. M.; Kotov, V.; Severnyi, A. B.; Howard, R.

    1977-01-01

    The mean solar magnetic field as measured in integrated light has been observed since 1968. Since 1970 it has been observed both at Hale Observatories and at the Crimean Astrophysical Observatory. The observing procedures at both observatories and their implications for mean field measurements are discussed. A comparison of the two sets of daily observations shows that similar results are obtained at both observatories. A comparison of the mean field with the interplanetary magnetic polarity shows that the IMF sector structure has the same pattern as the mean field polarity.

  4. An Efficient Power Regeneration and Drive Method of an Induction Motor by Means of an Optimal Torque Derived by Variational Method

    Science.gov (United States)

    Inoue, Kaoru; Ogata, Kenji; Kato, Toshiji

    When the motor speed is reduced by using a regenerative brake, the mechanical energy of rotation is converted to the electrical energy. When the regenerative torque is large, the corresponding current increases so that the copper loss also becomes large. On the other hand, the damping effect of rotation increases according to the time elapse when the regenerative torque is small. In order to use the limited energy effectively, an optimal regenerative torque should be discussed in order to regenerate electrical energy as much as possible. This paper proposes a design methodology of a regenerative torque for an induction motor to maximize the regenerative electric energy by means of the variational method. Similarly, an optimal torque for acceleration is derived in order to minimize the energy to drive. Finally, an efficient motor drive system with the proposed optimal torque and the power storage system stabilizing the DC link voltage will be proposed. The effectiveness of the proposed methods are illustrated by both simulations and experiments.

  5. M-AMST: an automatic 3D neuron tracing method based on mean shift and adapted minimum spanning tree.

    Science.gov (United States)

    Wan, Zhijiang; He, Yishan; Hao, Ming; Yang, Jian; Zhong, Ning

    2017-03-29

    Understanding the working mechanism of the brain is one of the grandest challenges for modern science. Toward this end, the BigNeuron project was launched to gather a worldwide community to establish a big data resource and a set of the state-of-the-art of single neuron reconstruction algorithms. Many groups contributed their own algorithms for the project, including our mean shift and minimum spanning tree (M-MST). Although M-MST is intuitive and easy to implement, the MST just considers spatial information of single neuron and ignores the shape information, which might lead to less precise connections between some neuron segments. In this paper, we propose an improved algorithm, namely M-AMST, in which a rotating sphere model based on coordinate transformation is used to improve the weight calculation method in M-MST. Two experiments are designed to illustrate the effect of adapted minimum spanning tree algorithm and the adoptability of M-AMST in reconstructing variety of neuron image datasets respectively. In the experiment 1, taking the reconstruction of APP2 as reference, we produce the four difference scores (entire structure average (ESA), different structure average (DSA), percentage of different structure (PDS) and max distance of neurons' nodes (MDNN)) by comparing the neuron reconstruction of the APP2 and the other 5 competing algorithm. The result shows that M-AMST gets lower difference scores than M-MST in ESA, PDS and MDNN. Meanwhile, M-AMST is better than N-MST in ESA and MDNN. It indicates that utilizing the adapted minimum spanning tree algorithm which took the shape information of neuron into account can achieve better neuron reconstructions. In the experiment 2, 7 neuron image datasets are reconstructed and the four difference scores are calculated by comparing the gold standard reconstruction and the reconstructions produced by 6 competing algorithms. Comparing the four difference scores of M-AMST and the other 5 algorithm, we can conclude that

  6. Site Characterization in the Urban Area of Tijuana, B. C., Mexico by Means of: H/V Spectral Ratios, Spectral Analysis of Surface Waves, and Random Decrement Method

    Science.gov (United States)

    Tapia-Herrera, R.; Huerta-Lopez, C. I.; Martinez-Cruzado, J. A.

    2009-05-01

    Results of site characterization for an experimental site in the metropolitan area of Tijuana, B. C., Mexico are presented as part of the on-going research in which time series of earthquakes, ambient noise, and induced vibrations were processed with three different methods: H/V spectral ratios, Spectral Analysis of Surface Waves (SASW), and the Random Decrement Method, (RDM). Forward modeling using the wave propagation stiffness matrix method (Roësset and Kausel, 1981) was used to compute the theoretical SH/P, SV/P spectral ratios, and the experimental H/V spectral ratios were computed following the conventional concepts of Fourier analysis. The modeling/comparison between the theoretical and experimental H/V spectral ratios was carried out. For the SASW method the theoretical dispersion curves were also computed and compared with the experimental one, and finally the theoretical free vibration decay curve was compared with the experimental one obtained with the RDM. All three methods were tested with ambient noise, induced vibrations, and earthquake signals. Both experimental spectral ratios obtained with ambient noise as well as earthquake signals agree quite well with the theoretical spectral ratios, particularly at the fundamental vibration frequency of the recording site. Differences between the fundamental vibration frequencies are evident for sites located at alluvial fill (~0.6 Hz) and at sites located at conglomerate/sandstones fill (0.75 Hz). Shear wave velocities for the soft soil layers of the 4-layer discrete soil model ranges as low as 100 m/s and up to 280 m/s. The results with the SASW provided information that allows to identify low velocity layers, not seen before with the traditional seismic methods. The damping estimations obtained with the RDM are within the expected values, and the dominant frequency of the system also obtained with the RDM correlates within the range of plus-minus 20 % with the one obtained by means of the H/V spectral

  7. Evidence-based practice beliefs and behaviors of nurses providing cancer pain management: a mixed-methods approach.

    Science.gov (United States)

    Eaton, Linda H; Meins, Alexa R; Mitchell, Pamela H; Voss, Joachim; Doorenbos, Ardith Z

    2015-03-01

    To describe evidence-based practice (EBP) beliefs and behaviors of nurses who provide cancer pain management. Descriptive, cross-sectional with a mixed-methods approach. Two inpatient oncology units in the Pacific Northwest. 40 RNs.
 Data collected by interviews and web-based surveys. EBP beliefs, EBP implementation, evidence-based pain management. Nurses agreed with the positive aspects of EBP and their implementation ability, although implementation level was low. They were satisfied with their pain management practices. Oncology nursing certification was associated with innovativeness, and innovativeness was associated with EBP beliefs. Themes identified were (a) limited definition of EBP, (b) varied evidence-based pain management decision making, (c) limited identification of evidence-based pain management practices, and (d) integration of nonpharmacologic interventions into patient care. Nurses' low level of EBP implementation in the context of pain management was explained by their trust that standards of care and medical orders were evidence-based. Nurses' EBP beliefs and behaviors should be considered when developing strategies for sustaining evidence-based pain management practices. Implementation of the EBP process by nurses may not be realistic in the inpatient setting; therefore, hospital pain management policies need to be evidence-based and reinforced with nurses.

  8. Calculation of the mean path length of the Epstein frame under non-sinusoidal excitations using the double Epstein method

    International Nuclear Information System (INIS)

    Marketos, Philip; Zurek, Stan; Moses, Anthony J.

    2008-01-01

    This paper discusses the effect of non-sinusoidal excitation on the mean path length of the Epstein frame. Two different steels, a non-oriented (NO) steel and a high-permeability grain-oriented (HGO) electrical steel have been tested under pure sinusoidal and non-sinusoidal excitations and the mean path length of the Epstein frame has been re-calculated. Results indicate that the actual mean path of the Epstein frame depends not only on the material permeability and anisotropy but also on the peak flux density and magnetising frequency. The amount of distortion of the excitation frequency also has an effect on the value of the actual mean path length of the Epstein frame

  9. Superconducting and other phases in organic high polymers of polyacenic carbon skeletons. II. The mean field method

    International Nuclear Information System (INIS)

    Kimura, M.; Kawabe, H.; Nishikawa, K.; Aono, S.

    1986-01-01

    Ordered phases such as CDW, SDW, and the singlet superconductivity(SSC) are predicted by means of a mean field theory. The electronic Hamiltonian is linearized by introducing order parameters which are expected to arise, and these order parameters are determined self-consistently. The behaviors of gap, transition temperature, and condensation energy are greatly different from those of BCS theory. The coexistence of the various phases is discussed. Aside from a very special case the single phase is most stable

  10. Meanings for Sex and Commitment Among First Semester College Men and Women: A Mixed-Methods Analysis.

    Science.gov (United States)

    Olmstead, Spencer B; Anders, Kristin M; Conrad, Kathryn A

    2017-08-01

    The purpose of this study was to replicate and extend research on the meanings for sex and commitment using a sample of first semester college students (N = 268). We examined responses to a series of open-ended questions about participants' meanings for sex and how they described these meanings as connected with relationship commitment. Our qualitative analyses replicated those of Olmstead, Billen, Conrad, Pasley, and Fincham (2013). Our largest group was the Committers (sex is indicative of love and trust and occurs after commitment is developed in a relationship), followed by Flexibles (sex can hold deep personal meaning, but can also be purely for pleasure and isn't always connected with commitment), and then Recreationers (sex is a basic need or purely for pleasure and is not associated with commitment). Groups were then examined based on demographic characteristics and pre-college hookup experience. Groups were found to differ by gender, relationship status and type, religiosity, and pre-college hookup experience. For example, a greater proportion of women than men were in the Committers group, whereas a greater proportion of men than women were in the Flexibles and Recreationers groups. Those in the Committers group had fewer pre-college hookup partners than Flexibles and Recreationers; however, Flexibles and Recreationers did not differ in number of pre-college hookup partners. We then followed up (at the end of the semester) with a subsample (n = 73) of participants to examine whether meanings for sex and commitment remained stable or changed over a brief period of time. The majority (82.2 %) of participants' meanings remained stable. For those whose meanings shifted, meanings became more consistent with those of the Committers group than the other two groups. Implications for research and sexual and relationship education are discussed.

  11. Reconstruction of computed tomographic image from a few x-ray projections by means of accelerative gradient method

    International Nuclear Information System (INIS)

    Kobayashi, Fujio; Yamaguchi, Shoichiro

    1982-01-01

    A method of the reconstruction of computed tomographic images was proposed to reduce the exposure dose to X-ray. The method is the small number of X-ray projection method by accelerative gradient method. The procedures of computation are described. The algorithm of these procedures is simple, the convergence of the computation is fast, and the required memory capacity is small. Numerical simulation was carried out to conform the validity of this method. A sample of simple shape was considered, projection data were given, and the images were reconstructed from 6 views. Good results were obtained, and the method is considered to be useful. (Kato, T.)

  12. Meaning in couples relationships.

    Directory of Open Access Journals (Sweden)

    Rodrigues T.F.

    2014-09-01

    Full Text Available Based on psycholinguistics and L. Vygotsky’s (2007 theories on sign, meaning and sense categories, as later discussed by A. Leontiev (2004, 2009, we present a case study that focuses on the intricacies of a love relationship for a woman who remained in a painful marriage. Interview material is presented in a Relational-Historical Psychology theoretical framework to provide central categories of meaning and sense. This is understood as a privileged method for apprehending the uniqueness of a human being. To segment the qualitative material, we used the “Analysis of the Nuclei of Meanings for the Apprehension of the Constitution of Sense,” by Aguiar and Ozella (2006, 2013. This approach seeks to discriminate the meanings and senses that constitute the content of a speech sample.

  13. Definition of datum of materials lump size on conveyors by means of reflected gamma-radiation method

    International Nuclear Information System (INIS)

    Gal'yanov, A.V.; Antonov, V.A.; Laptev, Yu.V.

    2001-01-01

    A method of technological control of large-size lumps in conveyor-transported crushed material based on intensity measurement of X-ray and gamma radiation reflected from the material surface was suggested. The method was substantiated theoretically and as a result it was shown that dispersion of radiation intensity, multiply measured for short periods of time, can be analytic parameter of large-size lumps yield. Principled methodical and design recommendations on the method practical applications are given [ru

  14. A method to combine non-probability sample data with probability sample data in estimating spatial means of environmental variables

    NARCIS (Netherlands)

    Brus, D.J.; Gruijter, de J.J.

    2003-01-01

    In estimating spatial means of environmental variables of a region from data collected by convenience or purposive sampling, validity of the results can be ensured by collecting additional data through probability sampling. The precision of the pi estimator that uses the probability sample can be

  15. Holomorphic representation of constant mean curvature surfaces in Minkowski space: Consequences of non-compactness in loop group methods

    DEFF Research Database (Denmark)

    Brander, David; Rossman, Wayne; Schmitt, Nicholas

    2010-01-01

    We give an infinite dimensional generalized Weierstrass representation for spacelike constant mean curvature (CMC) surfaces in Minkowski 3-space $\\R^{2,1}$. The formulation is analogous to that given by Dorfmeister, Pedit and Wu for CMC surfaces in Euclidean space, replacing the group $SU_2$ with...

  16. Studies on the excretion of Zn-Bacitracin from organism of animals by means of radioactive labelling method

    International Nuclear Information System (INIS)

    Nowak, H.; Noweta, W.; Spychalski, E.; Maziarz, Z.; Niedworok, J.

    1980-01-01

    The results of studies on the excretion of Zinc-Bacitracin by means of labelling with radioactive chromium 51 are presented. The studies were performed on Wistar rats. Radioactivity of faeces and urine was determined for 10 days after the application of Zinc-Bacitracin once or for three consecutive days. (author)

  17. Weighted Mean of Signal Intensity for Unbiased Fiber Tracking of Skeletal Muscles: Development of a New Method and Comparison With Other Correction Techniques.

    Science.gov (United States)

    Giraudo, Chiara; Motyka, Stanislav; Weber, Michael; Resinger, Christoph; Thorsten, Feiweier; Traxler, Hannes; Trattnig, Siegfried; Bogner, Wolfgang

    2017-08-01

    The aim of this study was to investigate the origin of random image artifacts in stimulated echo acquisition mode diffusion tensor imaging (STEAM-DTI), assess the role of averaging, develop an automated artifact postprocessing correction method using weighted mean of signal intensities (WMSIs), and compare it with other correction techniques. Institutional review board approval and written informed consent were obtained. The right calf and thigh of 10 volunteers were scanned on a 3 T magnetic resonance imaging scanner using a STEAM-DTI sequence.Artifacts (ie, signal loss) in STEAM-based DTI, presumably caused by involuntary muscle contractions, were investigated in volunteers and ex vivo (ie, human cadaver calf and turkey leg using the same DTI parameters as for the volunteers). An automated postprocessing artifact correction method based on the WMSI was developed and compared with previous approaches (ie, iteratively reweighted linear least squares and informed robust estimation of tensors by outlier rejection [iRESTORE]). Diffusion tensor imaging and fiber tracking metrics, using different averages and artifact corrections, were compared for region of interest- and mask-based analyses. One-way repeated measures analysis of variance with Greenhouse-Geisser correction and Bonferroni post hoc tests were used to evaluate differences among all tested conditions. Qualitative assessment (ie, images quality) for native and corrected images was performed using the paired t test. Randomly localized and shaped artifacts affected all volunteer data sets. Artifact burden during voluntary muscle contractions increased on average from 23.1% to 77.5% but were absent ex vivo. Diffusion tensor imaging metrics (mean diffusivity, fractional anisotropy, radial diffusivity, and axial diffusivity) had a heterogeneous behavior, but in the range reported by literature. Fiber track metrics (number, length, and volume) significantly improved in both calves and thighs after artifact

  18. Study on the dominant reaction path in nucleosynthesis during stellar evolution by means of the Monte Carlo method

    International Nuclear Information System (INIS)

    Yamamoto, K.; Hashizume, K.; Wada, T.; Ohta, M.; Suda, T.; Nishimura, T.; Fujimoto, M. Y.; Kato, K.; Aikawa, M.

    2006-01-01

    We propose a Monte Carlo method to study the reaction paths in nucleosynthesis during stellar evolution. Determination of reaction paths is important to obtain the physical picture of stellar evolution. The combination of network calculation and our method gives us a better understanding of physical picture. We apply our method to the case of the helium shell flash model in the extremely metal poor star

  19. The two means method for the attenuation coefficient determination of archaeological ceramics from the North of Parana; Metodo dos dois meios para a determinacao do coeficiente de atenuacao de ceramicas arqueologicas do norte do Parana

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Richard Maximiliano Cunha e

    1998-12-31

    This work reports an alternative methodology for the linear attenuation coefficient determination ({mu} {rho}) of irregular form samples, in such a way that is not necessary to consider the sample thickness. With this methodology, indigenous archaeological ceramics fragments from the region of Londrina, north of Parana, were studied. These ceramics fragments belong to the Kaingaing and Tupiguarani traditions. The equation for the {mu} {rho} determination employing the two mean method was obtained and it was used for {mu} {rho} determination by the gamma ray beam attenuation if immersed ceramics, by turns, in two different means with known linear attenuation coefficient. By the other side, {mu} theoretical value was determined with the XCOM computer code. This code uses as input the ceramics chemistry composition and provides an energy versus mass attenuation coefficient table. In order to validate the two mean method validation, five ceramics samples of thickness 1.15 cm and 1.87 cm were prepared with homogeneous clay. Using these ceramics, {mu} {rho} was determined using the attenuation method, and the two mean method. The result obtained for {mu} {rho} and its respective deviation were compared for these samples, for the two methods. With the obtained results, it was concluded that the two means method is good for the linear attenuation coefficient determination of materials of irregular shape, what is suitable, specially, for archaeometric studies. (author) 25 refs., 29 figs., 28 tabs.

  20. The two means method for the attenuation coefficient determination of archaeological ceramics from the North of Parana; Metodo dos dois meios para a determinacao do coeficiente de atenuacao de ceramicas arqueologicas do norte do Parana

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Richard Maximiliano Cunha e

    1997-12-31

    This work reports an alternative methodology for the linear attenuation coefficient determination ({mu} {rho}) of irregular form samples, in such a way that is not necessary to consider the sample thickness. With this methodology, indigenous archaeological ceramics fragments from the region of Londrina, north of Parana, were studied. These ceramics fragments belong to the Kaingaing and Tupiguarani traditions. The equation for the {mu} {rho} determination employing the two mean method was obtained and it was used for {mu} {rho} determination by the gamma ray beam attenuation if immersed ceramics, by turns, in two different means with known linear attenuation coefficient. By the other side, {mu} theoretical value was determined with the XCOM computer code. This code uses as input the ceramics chemistry composition and provides an energy versus mass attenuation coefficient table. In order to validate the two mean method validation, five ceramics samples of thickness 1.15 cm and 1.87 cm were prepared with homogeneous clay. Using these ceramics, {mu} {rho} was determined using the attenuation method, and the two mean method. The result obtained for {mu} {rho} and its respective deviation were compared for these samples, for the two methods. With the obtained results, it was concluded that the two means method is good for the linear attenuation coefficient determination of materials of irregular shape, what is suitable, specially, for archaeometric studies. (author) 25 refs., 29 figs., 28 tabs.

  1. Solitary wave solutions to the modified form of Camassa-Holm equation by means of the homotopy analysis method

    International Nuclear Information System (INIS)

    Abbasbandy, S.

    2009-01-01

    Solitary wave solutions to the modified form of Camassa-Holm (CH) equation are sought. In this work, the homotopy analysis method (HAM), one of the most effective method, is applied to obtain the soliton wave solutions with and without continuity of first derivatives at crest

  2. Aspects of optimization of the means and methods for monitoring of the Kozloduy NPP personnel functional state

    International Nuclear Information System (INIS)

    Pandov, E.; Popandreeva, A.; Dincheva, E.

    1993-01-01

    Equipment and methods for testing and evaluation of the physiological and psychological condition of the nuclear power plant operators are the subject of the paper. Reaction-meter, mnemoperceptioscope and the apparatus 'Sredets' have been developed and used in order to test the sensory-motor reactions, the short-term memory and the operation-related memory according to a list of test completion periods and number of mistakes. The strain on the nuclear reactor operators has been found to be greater than that of the personnel in dozens of other professions tested by the same methods. For sustaining the operators efficiency it is considered necessary to develop and implement: 1) fast screening method and equipment for an initial functional condition testing on application for important jobs; 2) methods for current recovery evaluation in connection to the working shift; 3) methods and instruments for a fast incidental functional condition control of the operating personnel. (R.Ts.)

  3. A Novel Grouping Method for Lithium Iron Phosphate Batteries Based on a Fractional Joint Kalman Filter and a New Modified K-Means Clustering Algorithm

    Directory of Open Access Journals (Sweden)

    Xiaoyu Li

    2015-07-01

    Full Text Available This paper presents a novel grouping method for lithium iron phosphate batteries. In this method, a simplified electrochemical impedance spectroscopy (EIS model is utilized to describe the battery characteristics. Dynamic stress test (DST and fractional joint Kalman filter (FJKF are used to extract battery model parameters. In order to realize equal-number grouping of batteries, a new modified K-means clustering algorithm is proposed. Two rules are designed to equalize the numbers of elements in each group and exchange samples among groups. In this paper, the principles of battery model selection, physical meaning and identification method of model parameters, data preprocessing and equal-number clustering method for battery grouping are comprehensively described. Additionally, experiments for battery grouping and method validation are designed. This method is meaningful to application involving the grouping of fresh batteries for electric vehicles (EVs and screening of aged batteries for recycling.

  4. Quantification of the efficiency of segmentation methods on medical images by means of non-euclidean distances

    International Nuclear Information System (INIS)

    Pastore, J; Moler, E; Ballarin, V

    2007-01-01

    To quantify the efficiency of a segmentation method, it is necessary to do some validation experiments, consisting generally in comparing the result obtained against the expected result. The most direct method for validation is the comparison of a simple visual inspection between the automatic segmentation and a segmentation obtained manually by a specialist, but this method does not guarantee robustness. This work presents a new similarity parameter between a segmented object and a control object, that combines a measurement of spatial similarity through the Hausdorff metrics and the difference in the contour areas based on the symmetric difference between sets

  5. Variability in clinical data is often more useful than the mean: illustration of concept and simple methods of assessment

    NARCIS (Netherlands)

    Zwinderman, A. H.; Cleophas, T. J.

    2005-01-01

    BACKGROUND: Clinical investigators, although they are generally familiar with testing differences between averages, have difficulty testing differences between variabilities. OBJECTIVE: To give examples of situations where variability is more relevant than averages and to describe simple methods for

  6. A combined approach for the enhancement and segmentation of mammograms using modified fuzzy C-means method in wavelet domain

    OpenAIRE

    Srivastava, Subodh; Sharma, Neeraj; Singh, S. K.; Srivastava, R.

    2014-01-01

    In this paper, a combined approach for enhancement and segmentation of mammograms is proposed. In preprocessing stage, a contrast limited adaptive histogram equalization (CLAHE) method is applied to obtain the better contrast mammograms. After this, the proposed combined methods are applied. In the first step of the proposed approach, a two dimensional (2D) discrete wavelet transform (DWT) is applied to all the input images. In the second step, a proposed nonlinear complex diffusion based uns...

  7. Spatial selection of focal of underground nuclear explosion by means of directed investigation and a method of vibroseismic oscillation

    International Nuclear Information System (INIS)

    Voskobojnikova, G.M.; Sedukhina, G.F.; Khajretdinov, M.S.

    2006-01-01

    An approach to task solving on parameters localization and determination within focal area of underground nuclear explosion (UNE) by scanning the inspected area by vibroseismic translucent field is considered. For the method, which application has been justified for task solving on On-Site Inspection (OSI), results of numerical modeling of seismic antenna orientation specifications are given, results of experiments on directed method of vibroseismic oscillation is described, questions on practical application of On-Site Inspection tasks are discussed. (author)

  8. Methods and means for building a system of visual images forming in gis of critical important objects protection

    Directory of Open Access Journals (Sweden)

    Mykhailo Vasiukhin

    2013-12-01

    Full Text Available Requirements for the visualization of dynamic scenes in security systems for are increasing in recent years. This requires develop a methods and tools for visualization of dynamic scenes for monitoring and managing the system of security like “human-operator”. The paper presents a model map data from which is a base for building real time map data, and methods of real time visualization of moving characters in air.

  9. [Research on K-means clustering segmentation method for MRI brain image based on selecting multi-peaks in gray histogram].

    Science.gov (United States)

    Chen, Zhaoxue; Yu, Haizhong; Chen, Hao

    2013-12-01

    To solve the problem of traditional K-means clustering in which initial clustering centers are selected randomly, we proposed a new K-means segmentation algorithm based on robustly selecting 'peaks' standing for White Matter, Gray Matter and Cerebrospinal Fluid in multi-peaks gray histogram of MRI brain image. The new algorithm takes gray value of selected histogram 'peaks' as the initial K-means clustering center and can segment the MRI brain image into three parts of tissue more effectively, accurately, steadily and successfully. Massive experiments have proved that the proposed algorithm can overcome many shortcomings caused by traditional K-means clustering method such as low efficiency, veracity, robustness and time consuming. The histogram 'peak' selecting idea of the proposed segmentootion method is of more universal availability.

  10. Study of the tensor correlation in oxygen isotopes using mean-field-type and shell model methods

    International Nuclear Information System (INIS)

    Sugimoto, Satoru

    2007-01-01

    The tensor force plays important roles in nuclear structure. Recently, we have developed a mean-field-type model which can treat the two-particle-two-hole correlation induced by the tensor force. We applied the model to sub-closed-shell oxygen isotopes and found that an sizable attractive energy comes from the tensor force. We also studied the tensor correlation in 16O using a shell model including two-particle-two-hole configurations. In this case, quite a large attractive energy is obtained for the correlation energy from the tensor force

  11. Evaluation of errors in prior mean and variance in the estimation of integrated circuit failure rates using Bayesian methods

    Science.gov (United States)

    Fletcher, B. C.

    1972-01-01

    The critical point of any Bayesian analysis concerns the choice and quantification of the prior information. The effects of prior data on a Bayesian analysis are studied. Comparisons of the maximum likelihood estimator, the Bayesian estimator, and the known failure rate are presented. The results of the many simulated trails are then analyzed to show the region of criticality for prior information being supplied to the Bayesian estimator. In particular, effects of prior mean and variance are determined as a function of the amount of test data available.

  12. The Patient-Provider Relationship Is Associated with Hepatitis C Treatment Eligibility: A Prospective Mixed-Methods Cohort Study.

    Directory of Open Access Journals (Sweden)

    Shari S Rogal

    Full Text Available Hepatitis C virus (HCV treatment has the potential to cure the leading cause of cirrhosis and hepatocellular carcinoma. However, only those deemed eligible for treatment have the possibility of this cure. Therefore, understanding the determinants of HCV treatment eligibility is critical. Given that effective communication with and trust in healthcare providers significantly influences treatment eligibility decisions in other diseases, we aimed to understand patient-provider interactions in the HCV treatment eligibility process. This prospective cohort study was conducted in the VA Pittsburgh Healthcare System. Patients were recruited after referral for gastroenterology consultation for HCV treatment with interferon and ribavirin. Consented patients completed semi-structured interviews and validated measures of depression, substance and alcohol use, and HCV knowledge. Two coders analyzed the semi-structured interviews. Factors associated with patient eligibility for interferon-based therapy were assessed using multivariate logistic regression. Of 339 subjects included in this analysis, only 56 (16.5% were deemed eligible for HCV therapy by gastroenterology (GI providers. In the multivariate logistic regression, patients who were older (OR = 0.96, 95%CI = 0.92-0.99, p = .049, reported concerns about the GI provider (OR = 0.40, 95%CI = 0.10-0.87, p = 0.02 and had depression symptoms (OR = 0.32, 95%CI = 0.17-0.63, p = 0.001 were less likely to be eligible. Patients described barriers that included feeling stigmatized and poor provider interpersonal or communication skills. In conclusion, we found that patients' perceptions of the relationship with their GI providers were associated with treatment eligibility. Establishing trust and effective communication channels between patients and providers may lower barriers to potential HCV cure.

  13. Determination of the Critical Stress Associated with Dynamic Phase Transformation in Steels by Means of Free Energy Method

    Directory of Open Access Journals (Sweden)

    Clodualdo Aranas

    2018-05-01

    Full Text Available The double differentiation method overestimates the critical stress associated with the initiation of dynamic transformation (DT because significant amounts of the dynamic phase must be present in order for its effect on the work hardening rate to be detectable. In this work, an alternative method (referred to here as the free energy method is presented based on the thermodynamic condition that the driving force is equal to the total energy obstacle during the exact moment of transformation. The driving force is defined as the difference between the DT critical stress (measured in the single-phase austenite region and the yield stress of the fresh ferrite that takes its place. On the other hand, the energy obstacle consists of the free energy difference between austenite and ferrite, and the work of shear accommodation and dilatation associated with the phase transformation. Here, the DT critical stresses in a C-Mn steel were calculated using the free energy method at temperatures ranging from 870 °C to 1070 °C. The results show that the calculated critical stress using the present approach appears to be more accurate than the values measured by the double differentiation method.

  14. Development of a strain measurement method for non-plane specimens by means of computer picture processing

    International Nuclear Information System (INIS)

    Yoshioka, Akira; Soneda, Naoki; Yagawa, Genki; Miyoshi, Akio.

    1988-01-01

    Integrity Tests of the Fast Breeder Reactor components are often conducted at an elevated temperature, say 550deg C. Since high-temperature strain measurement using special strain gauges is costly and unappropriate for large and repeated strains, the authors have developed an optical strain measurement method and system based on computer picture processing and the triangulation principle. The present method enables us to measure the strain in specimen with curved surfaces. Its operation is also easy, because of the automatic distinction of marks from noises. The verification tests with a plate specimen and a cylindrical one are performed under elevated temperatures. The results show that the present method is very suitable to the tests under elevated temperatures and that the measurement error of strain is within 0.2 % (2000μ), which is reasonable considering the limitation of hardware. (author)

  15. Development and evaluation of a method for quantitative flow measurement in tissues by means of NMR-tomography

    International Nuclear Information System (INIS)

    Meindl, S.; Seelen, W. von; Hoffmann, K.P.; Emmert, K.

    1985-01-01

    Apart from the known parameters proton density, T1 and T2 the amplitude of an NMR signal is influenced by the movement of the nuclear spins. In NMR-tomography this leads to significant flow-dependent effects appearing differently in the images. Basing on these influences well-defined flow measurement can be carried out using special tomographic measuring programs. The applied phase encoding methods allow such measurements parallel to conventional imaging. Changes in perfusion of defined brain areas caused by neuronal activity were examined with this technique as well as a 2F-2D-glucose-tracer method. (orig.) With 51 refs., 19 figs [de

  16. The determination of reactivity at a compact core with low absorption reflector by means of the pulsed neutron method

    International Nuclear Information System (INIS)

    Hecker, R.; Drueke, V.; Ahmad, S.K.; Kacmary, S.; Paul, N.

    1976-09-01

    Pulsed measurements at a compact critical facility with low absorption reflector are described. By a number of such measurements at different points of the system a proper value for the reactivity can be determined, which allows a meaningful comparison with values calculated by static computer codes in spite of the presence of kinetic distortion in the system. A modified area ratio method is developed and applied to the measurements; furthermore a method is shown, which allows to suppress in this systems the kinetic distortion in the fundamental mode by application of special detectors. (orig.) [de

  17. A Method for Measuring Fast Time Evolutions of the Plasma Potential by Means of a Simple Emissive Probe

    DEFF Research Database (Denmark)

    Iizuka, S.; Michelsen, Poul; Juul Rasmussen, Jens

    1981-01-01

    potential is measured across a high resistance. During each sweep of the probe voltage, the changing of the sign of the probe current, which is sampled at a specific time, gives rise to a negative pulse, driving the pen-lift of an X-Y recorder. Since the real floating potential is measured where the probe......A method is presented for obtaining the temporal evolution of the plasma potential, which is assumed to be given by the floating potential of a simple emissive probe. The construction of the probe is also described. The method avoids the slow time response of the usual technique where the floating...

  18. MO-E-17A-04: Size-Specific Dose Estimate (SSDE) Provides a Simple Method to Calculate Organ Dose for Pediatric CT Examinations

    International Nuclear Information System (INIS)

    Moore, B; Brady, S; Kaufman, R; Mirro, A

    2014-01-01

    Purpose: Investigate the correlation of SSDE with organ dose in a pediatric population. Methods: Four anthropomorphic phantoms, representing a range of pediatric body habitus, were scanned with MOSFET dosimeters placed at 23 organ locations to determine absolute organ dosimetry. Phantom organ dosimetry was divided by phantom SSDE to determine correlation between organ dose and SSDE. Correlation factors were then multiplied by patient SSDE to estimate patient organ dose. Patient demographics consisted of 352 chest and 241 abdominopelvic CT examinations, 22 ± 15 kg (range 5−55 kg) mean weight, and 6 ± 5 years (range 4 mon to 23 years) mean age. Patient organ dose estimates were compared to published pediatric Monte Carlo study results. Results: Phantom effective diameters were matched with patient population effective diameters to within 4 cm. 23 organ correlation factors were determined in the chest and abdominopelvic region across nine pediatric weight subcategories. For organs fully covered by the scan volume, correlation in the chest (average 1.1; range 0.7−1.4) and abdominopelvic (average 0.9; range 0.7−1.3) was near unity. For organs that extended beyond the scan volume (i.e., skin, bone marrow, and bone surface), correlation was determined to be poor (average 0.3; range: 0.1−0.4) for both the chest and abdominopelvic regions, respectively. Pediatric organ dosimetry was compared to published values and was found to agree in the chest to better than an average of 5% (27.6/26.2) and in the abdominopelvic region to better than 2% (73.4/75.0). Conclusion: Average correlation of SSDE and organ dosimetry was found to be better than ± 10% for fully covered organs within the scan volume. This study provides a list of organ dose correlation factors for the chest and abdominopelvic regions, and describes a simple methodology to estimate individual pediatric patient organ dose based on patient SSDE

  19. MO-E-17A-04: Size-Specific Dose Estimate (SSDE) Provides a Simple Method to Calculate Organ Dose for Pediatric CT Examinations

    Energy Technology Data Exchange (ETDEWEB)

    Moore, B; Brady, S; Kaufman, R [St Jude Children' s Research Hospital, Memphis, TN (United States); Mirro, A [Washington University, St. Louis, MO (United States)

    2014-06-15

    Purpose: Investigate the correlation of SSDE with organ dose in a pediatric population. Methods: Four anthropomorphic phantoms, representing a range of pediatric body habitus, were scanned with MOSFET dosimeters placed at 23 organ locations to determine absolute organ dosimetry. Phantom organ dosimetry was divided by phantom SSDE to determine correlation between organ dose and SSDE. Correlation factors were then multiplied by patient SSDE to estimate patient organ dose. Patient demographics consisted of 352 chest and 241 abdominopelvic CT examinations, 22 ± 15 kg (range 5−55 kg) mean weight, and 6 ± 5 years (range 4 mon to 23 years) mean age. Patient organ dose estimates were compared to published pediatric Monte Carlo study results. Results: Phantom effective diameters were matched with patient population effective diameters to within 4 cm. 23 organ correlation factors were determined in the chest and abdominopelvic region across nine pediatric weight subcategories. For organs fully covered by the scan volume, correlation in the chest (average 1.1; range 0.7−1.4) and abdominopelvic (average 0.9; range 0.7−1.3) was near unity. For organs that extended beyond the scan volume (i.e., skin, bone marrow, and bone surface), correlation was determined to be poor (average 0.3; range: 0.1−0.4) for both the chest and abdominopelvic regions, respectively. Pediatric organ dosimetry was compared to published values and was found to agree in the chest to better than an average of 5% (27.6/26.2) and in the abdominopelvic region to better than 2% (73.4/75.0). Conclusion: Average correlation of SSDE and organ dosimetry was found to be better than ± 10% for fully covered organs within the scan volume. This study provides a list of organ dose correlation factors for the chest and abdominopelvic regions, and describes a simple methodology to estimate individual pediatric patient organ dose based on patient SSDE.

  20. A Post-Final Assignment for the Methods Course: Providing an Incentive to Professional Growth for Future Teachers.

    Science.gov (United States)

    Bentley, Michael L.

    This paper describes J. Rosengren's post-final assignment and M. Harmin's truth signs activity that were incorporated into a secondary science methods course for preservice teachers. The strength of the post-final assignment is that it is a strategy for extending student learning past the end of a course and even beyond the initial teaching…

  1. New Technologies Provide Quantum Changes in the Scale, Speed, and Success of SELEX Methods and Aptamer Characterization

    Directory of Open Access Journals (Sweden)

    Abdullah Ozer

    2014-01-01

    Full Text Available Single-stranded oligonucleotide aptamers have attracted great attention in the past decade because of their diagnostic and therapeutic potential. These versatile, high affinity and specificity reagents are selected by an iterative in vitro process called SELEX, Systematic Evolution of Ligands by Exponential Enrichment. Numerous SELEX methods have been developed for aptamer selections; some that are simple and straightforward, and some that are specialized and complicated. The method of SELEX is crucial for selection of an aptamer with desired properties; however, success also depends on the starting aptamer library, the target molecule, aptamer enrichment monitoring assays, and finally, the analysis and characterization of selected aptamers. Here, we summarize key recent developments in aptamer selection methods, as well as other aspects of aptamer selection that have significant impact on the outcome. We discuss potential pitfalls and limitations in the selection process with an eye to aid researchers in the choice of a proper SELEX strategy, and we highlight areas where further developments and improvements are desired. We believe carefully designed multiplexed selection methods, when complemented with high-throughput downstream analysis and characterization assays, will yield numerous high-affinity aptamers to protein and small molecule targets, and thereby generate a vast array of reagents for probing basic biological mechanisms and implementing new diagnostic and therapeutic applications in the near future.

  2. 47 CFR 52.31 - Deployment of long-term database methods for number portability by CMRS providers.

    Science.gov (United States)

    2010-10-01

    ... require software but not hardware changes to provide portability (“Hardware Capable Switches”), within 60... queries, so that they can deliver calls from their networks to any party that has retained its number after switching from one telecommunications carrier to another. (c) [Reserved] (d) In the event a...

  3. An optical device capable of providing a structural color, and a corresponding method of manufacturing such a device

    DEFF Research Database (Denmark)

    2014-01-01

    ) with respect to the average surface positions. The position, size, and randomness of the protrusions are arranged so as to provide, at least up to a maximum angle of incidence (A_in) with respect to a normal to the surface, an angle-independent substantially homogeneous structural color perception for a normal...

  4. Arguing for an immersive method: Reflexive meaning-making, the visible researcher, and moral responses to gameplay

    Directory of Open Access Journals (Sweden)

    Joanna Cuttell

    2015-06-01

    Full Text Available This article argues for the adoption of an immersive-participatory method when analysing interactive media. It builds upon and extends existing theorisations of immersion and applies them to the development of new methods of analysis. This paper theorises immersion during gameplay as an affective, embodied state, which is both active and passive and achieved via both visual and imaginative engagement with the game world and haptic communication with the player character. This article’s argument is fourfold: firstly, it situates and negotiates the tensions surrounding the major debates, discussions and analyses in the study of immersion, both within gaming and in wider contexts; secondly, it argues for the inclusion of a participatory immersive method to be undertaken by the researcher when analysing media (especially interactive media such as video games; thirdly, it outlines the ways in which this method could be implemented by researchers, and finally, it draws on examples from my own research journal and discusses the possibility of a moral habitus which allows the player to engage in violent gameplay without experiencing the moral dissonance that can disrupt immersive states. Ultimately, this article aims to render the position of the researcher visible in order that we might gain critical purchase on the immersive praxis of gaming and the ethical/political responses of the player. In so doing, it is hoped that this article will aid theoretical and methodological innovation in this field and provoke discussion in a wider media studies context.

  5. A method for carrying out radiolysis and chemical reactions by means of the radiations resulting from a thermonuclear reaction

    International Nuclear Information System (INIS)

    Gomberg, H.J.

    1974-01-01

    The invention relates to the use of the radiations resulting from thermonuclear reactions. It deals with a method comprising a combination of thermo-chemical and radiolytic reactions for treating a molecule having a high absorption rate, by the radiations of a thermonuclear reaction. This is applicable to the dissociation of water into oxygen and hydrogen [fr

  6. Revisiting liquid lubrication methods by means of a fully coupled approach combining plastic deformation and liquid lubrication

    DEFF Research Database (Denmark)

    Üstünyagiz, Esmeray; Christiansen, Peter; Nielsen, Chris Valentin

    2017-01-01

    This paper presents a new approach based on a fully coupled procedure in which the lubricant flow and the plasticdeformation of the metallic material in metal forming are solved simultaneously. The proposed method is an alternativeto conventional modelling techniques which allow studying the effect...... andanalytical model, and by variations in drawing speed. Good agreement is found with the experimental observations....

  7. The freezing of water bonded in the wheat (Triticum aestivum L.) grain studied by means protons magnetic relaxation method

    International Nuclear Information System (INIS)

    Haranczyk, H.; Jasinski, G.; Strzalka, K.

    1994-01-01

    Some biological aspects of water freezing in the wheat grain have been studied using NMR methods. Measuring of the relaxation times for freezing and liquid water shown absence of T 2 ∼100 μs and T 2 ∼1 ms separated components what pointed for some different way of water bonding

  8. Exploring Acculturation Experiences and Cultural Dialogues among Iranian Refugees in the Netherlands by Means of the Self-Confrontation Method

    NARCIS (Netherlands)

    Lindert, A. te; Korzilius, H.P.L.M.

    2008-01-01

    In this study we explored the most important topics of acculturation experiences among Iranian refugees in the Netherlands, using the Self-Confrontation Method (Hermans & Hermans-Jansen, 1995). We discussed the Dialogical Self Theory reffering to the multiple selves of people who have to deal with

  9. Determination of the shape factor of {sup 90}Sr by means of the cutoff energy yield method

    Energy Technology Data Exchange (ETDEWEB)

    Grau Carles, A. [Instituto de Matematicas y Fisica Fundamental (CSIC), Dcho. 211, C/Serrano 113b, 28006 Madrid (Spain)], E-mail: agrau@imaff.cfmac.csic.es; Kossert, K. [Physikalisch-Technische Bundesanstalt, Department 6.1, Bundesallee 100, D-38116 Braunschweig (Germany); Grau Malonda, A. [CIEMAT, Departamento de Proyectos Estrategicos, Avda. Complutense 22, 28040 Madrid (Spain)

    2008-06-15

    Usually, Kurie plots are used to analyze beta-spectra shape-factor functions measured by means of semiconductor and magnetic spectrometers. A drawback of these techniques is the occurrence of self-absorption within the samples through which the emission spectrum is altered. In liquid-scintillation samples self-absorption does not occur, but the poor energy resolution makes the analysis of the spectra difficult. To overcome this problem, two resolution-invariant observables are used for determining the shape-factor function of {sup 90}Sr: (1) the maximum point energy and (2) the cutoff energy yield. The measured shape-factor function of {sup 90}Sr agrees with the one which is predicted by theory for the first-forbidden unique transition.

  10. Planar ESPAR Array Design with Nonsymmetrical Pattern by Means of Finite-Element Method, Domain Decomposition, and Spherical Wave Expansion

    Directory of Open Access Journals (Sweden)

    Jesús García

    2012-01-01

    Full Text Available The application of a 3D domain decomposition finite-element and spherical mode expansion for the design of planar ESPAR (electronically steerable passive array radiator made with probe-fed circular microstrip patches is presented in this work. A global generalized scattering matrix (GSM in terms of spherical modes is obtained analytically from the GSM of the isolated patches by using rotation and translation properties of spherical waves. The whole behaviour of the array is characterized including all the mutual coupling effects between its elements. This procedure has been firstly validated by analyzing an array of monopoles on a ground plane, and then it has been applied to synthesize a prescribed radiation pattern optimizing the reactive loads connected to the feeding ports of the array of circular patches by means of a genetic algorithm.

  11. Construction of a Mean Square Error Adaptive Euler–Maruyama Method With Applications in Multilevel Monte Carlo

    KAUST Repository

    Hoel, Hakon

    2016-06-13

    A formal mean square error expansion (MSE) is derived for Euler-Maruyama numerical solutions of stochastic differential equations (SDE). The error expansion is used to construct a pathwise, a posteriori, adaptive time-stepping Euler-Maruyama algorithm for numerical solutions of SDE, and the resulting algorithm is incorporated into a multilevel Monte Carlo (MLMC) algorithm for weak approximations of SDE. This gives an efficient MSE adaptive MLMC algorithm for handling a number of low-regularity approximation problems. In low-regularity numerical example problems, the developed adaptive MLMC algorithm is shown to outperform the uniform time-stepping MLMC algorithm by orders of magnitude, producing output whose error with high probability is bounded by TOL > 0 at the near-optimal MLMC cost rate б(TOL log(TOL)) that is achieved when the cost of sample generation is б(1).

  12. Lorestan Bronze Plate Design Identification by Nondestructive Radiography Method and Image Processing by Means of Histogram Matching

    International Nuclear Information System (INIS)

    Yahaghi, E.; Movafeghi, A.; Ahmadi, S.; Rokrok, B.; Mohammadzadeh, N.; Rastkhah, N.

    2013-01-01

    Radiography is known as one of the oldest and most widely used nondestructive testing techniques, where it introduces the most appreciated technique by producing images which are acting as unique fingerprint records of samples of interest. Among the interesting applications of radiography are archaeological and art applications. In this research, radiography was implemented for identification of a damaged art-historical material. The sample was a brass plate belonging to Iran cultural heritage. The estimated age of the plate was about 3500 years. The plate was discovered in Lorestan province, where it is generally called L orestan bronze . The plate was damaged seriously due to serious corrosion environmental attacks, and recognition of the sample was considered as the major problem. The simple radiography method was quite helpful for the plate determination but the method suffered from some major drawbacks due to contrast and thickness measurements. The thickness measurement and corrosion/erosion evaluation were the vital components of the inspection. The image processing techniques and precise thickness measurement method were added to the digitized radiographs. For the digital image processing, a histogram matching algorithm and an edge detection method were used. After all, the resulted image showed an enhanced quality image of the original traces of the hammered design. The results showed that a good experimental setup of radiography along with the image processing technique can give a high quality radiographic image which is able to be used effectively for the identification of art antiques. The human evaluation results also confirmed the ability of the proposed method with a high degree of certainty.

  13. The Meaning of Meaning, Etc.

    Science.gov (United States)

    Nilsen, Don L. F.

    This paper attempts to dispel a number of misconceptions about the nature of meaning, namely that: (1) synonyms are words that have the same meanings, (2) antonyms are words that have opposite meanings, (3) homonyms are words that sound the same but have different spellings and meanings, (4) converses are antonyms rather than synonyms, (5)…

  14. An overview of filtration methods that can provide protection from the macrofouling zebra mussel at hydroelectric facilities

    Energy Technology Data Exchange (ETDEWEB)

    Smythe, A.G.; Short, T.M. [Acres International Corp., Amherst, NY (United States)

    1995-12-31

    The non-indigenous freshwater zebra and quagga mussels (Dreissena, spp.) threaten to foul freshwater conduits throughout much of the United States and southern Canada. Initially, many electric facilities within the lower Great Lakes drainage were fouled. More recently, other systems both in and out of the Great Lakes, have been exposed to infested water facilitated by canals and boat traffic and impacted by the mussels. Mussels have clogged conduits and fouled equipment and monitoring sensors in relatively distant regions including the Hudson River, the Mississippi River south to New Orleans, and the Arkansas River into Oklahoma. Chemicals can effectively control the mussels, however, filtration methods promise to be a relatively cost effective, environmentally safe alternative control approach. Information on traditional filtration methods will be presented in this paper along with recent research results for in-line filters.

  15. Simplified Qualitative Discrete Numerical Model to Determine Cracking Pattern in Brittle Materials by Means of Finite Element Method

    OpenAIRE

    Ochoa-Avendaño, J.; Garzon-Alvarado, D. A.; Linero, Dorian L.; Cerrolaza, M.

    2017-01-01

    This paper presents the formulation, implementation, and validation of a simplified qualitative model to determine the crack path of solids considering static loads, infinitesimal strain, and plane stress condition. This model is based on finite element method with a special meshing technique, where nonlinear link elements are included between the faces of the linear triangular elements. The stiffness loss of some link elements represents the crack opening. Three experimental tests of bending...

  16. Economic valuation of the ecosystem services provided by a protected area in the Brazilian Cerrado: application of the contingent valuation method.

    Science.gov (United States)

    Resende, F M; Fernandes, G W; Andrade, D C; Néder, H D

    2017-11-01

    Considering that the economic valuation of ecosystem services is a useful approach to support the conservation of natural areas, we aimed to estimate the monetary value of the benefits provided by a protected area in southeast Brazil, the Serra do Cipó National Park. We calculated the visitor's willingness to pay to conserve the ecosystems of the protected area using the contingent valuation method. Located in a region under intense anthropogenic pressure, the Serra do Cipó National Park is mostly composed of rupestrian grassland ecosystems, in addition to other Cerrado physiognomies. We conducted a survey consisting of 514 interviews with visitors of the region and found that the mean willingness to pay was R$ 7.16 year-1, which corresponds to a total of approximately R$ 716,000.00 year-1. We detected that per capita income, the household size, the level of interest in environmental issues and the place of origin influenced the likelihood that individuals are willing to contribute to the conservation of the park, as well as the value of the stated willingness to pay. This study conveys the importance of conserving rupestrian grassland and other Cerrado physiognomies to decision makers and society.

  17. Obtaining new composite biomaterials by means of mineralization of methacrylate hydrogels using the reaction–diffusion method

    International Nuclear Information System (INIS)

    Ramadan, Yousof; González-Sánchez, M. Isabel; Hawkins, Karl; Rubio-Retama, Jorge; Valero, Edelmira; Perni, Stefano; Prokopovich, Polina; López-Cabarcos, Enrique

    2014-01-01

    The present paper describes the synthesis and characterization of a new polymeric biomaterial mineralized with calcium phosphate using the reaction–diffusion method. The scaffold of this biomaterial was a hydrogel constituted by biocompatible polyethylene glycol methyl ether methacrylate (PEGMEM) and 2-(dimethylamino)ethyl methacrylate (DMAEM), which were cross-linked with N-N’-methylenebisacrylamide (BIS). The cross-linking content of the hydrogels was varied from 0.25% to 15% (w/w). The gels were used as matrix where two reactants (Na 2 HPO 4 and CaCl 2 ) diffused from both ends of the gel and upon encountering produced calcium phosphate crystals that precipitated within the polymer matrix forming bands. The shape of the crystals was tuned by modifying the matrix porosity in such a way that when the polymer matrix was slightly reticulated the diffusion reaction produced round calcium phosphate microcrystals, whilst when the polymer matrix was highly reticulated the reaction yielded flat calcium phosphate crystals. Selected area electron diffraction performed on the nanocrystals that constitute the microcrystals showed that they were formed by Brushite (CaHPO 4 .2H 2 O). This new composite material could be useful in medical and dentistry applications such as bone regeneration, bone repair or tissue engineering. - Highlights: • New polymeric biomaterial mineralized with calcium phosphate using the reaction-diffusion method.-Growing of brushite nanocrystals within a polymeric matrix. • Mineralization by reaction diffusion method controls the crystal growth within gels

  18. Identification and Decay Studies of New, Neutron-Rich Isotopes of Bismuth, Lead and Thallium by means of a Pulsed Release Element Selective Method

    CERN Multimedia

    Mills, A; Kugler, E; Van duppen, P L E; Lettry, J

    2002-01-01

    % IS354 \\\\ \\\\ It is proposed to produce, identify and investigate at ISOLDE new, neutron-rich isotopes of bismuth, lead and thallium at the mass numbers A=215 to A=218. A recently tested operation mode of the PS Booster-ISOLDE complex, taking an advantage of the unique pulsed proton beam structure, will be used together with a ThC target in order to increase the selectivity. The decay properties of new nuclides will be studied by means of $\\beta$-, $\\gamma$- and X- ray spectroscopy methods. The expected information on the $\\beta$-half-lives and excited states will be used for testing and developing the nuclear structure models ``south-east'' of $^{208}$Pb, and will provide input data for the description of the r-process path at very heavy nuclei. The proposed study of the yields and the decay properties of those heavy nuclei produced in the spallation of $^{232}$Th by a 1~GeV proton beam contributes also the data necessary for the simulations of a hybrid accelerator-reactor system.

  19. Methods for fitting of efficiency curves obtained by means of HPGe gamma rays spectrometers; Metodos de ajuste de curvas de eficiencia obtidas por meio de espectrometros de HPGe

    Energy Technology Data Exchange (ETDEWEB)

    Cardoso, Vanderlei

    2002-07-01

    The present work describes a few methodologies developed for fitting efficiency curves obtained by means of a HPGe gamma-ray spectrometer. The interpolated values were determined by simple polynomial fitting and polynomial fitting between the ratio of experimental peak efficiency and total efficiency, calculated by Monte Carlo technique, as a function of gamma-ray energy. Moreover, non-linear fitting has been performed using a segmented polynomial function and applying the Gauss-Marquardt method. For the peak area obtainment different methodologies were developed in order to estimate the background area under the peak. This information was obtained by numerical integration or by using analytical functions associated to the background. One non-calibrated radioactive source has been included in the curve efficiency in order to provide additional calibration points. As a by-product, it was possible to determine the activity of this non-calibrated source. For all fittings developed in the present work the covariance matrix methodology was used, which is an essential procedure in order to give a complete description of the partial uncertainties involved. (author)

  20. CLASSIFICATION OF IRANIAN NURSES ACCORDING TO THEIR MENTAL HEALTH OUTCOMES USING GHQ-12 QUESTIONNAIRE: A COMPARISON BETWEEN LATENT CLASS ANALYSIS AND K-MEANS CLUSTERING WITH TRADITIONAL SCORING METHOD.

    Science.gov (United States)

    Jamali, Jamshid; Ayatollahi, Seyyed Mohammad Taghi

    2015-10-01

    Nurses constitute the most providers of health care systems. Their mental health can affect the quality of services and patients' satisfaction. General Health Questionnaire (GHQ-12) is a general screening tool used to detect mental disorders. Scoring method and determining thresholds for this questionnaire are debatable and the cut-off points can vary from sample to sample. This study was conducted to estimate the prevalence of mental disorders among Iranian nurses using GHQ-12 and also compare Latent Class Analysis (LCA) and K-means clustering with traditional scoring method. A cross-sectional study was carried out in Fars and Bushehr provinces of southern Iran in 2014. Participants were 771 Iranian nurses, who filled out the GHQ-12 questionnaire. Traditional scoring method, LCA and K-means were used to estimate the prevalence of mental disorder among Iranian nurses. Cohen's kappa statistic was applied to assess the agreement between the LCA and K-means with traditional scoring method of GHQ-12. The nurses with mental disorder by scoring method, LCA and K-mean were 36.3% (n=280), 32.2% (n=248), and 26.5% (n=204), respectively. LCA and logistic regression revealed that the prevalence of mental disorder in females was significantly higher than males. Mental disorder in nurses was in a medium level compared to other people living in Iran. There was a little difference between prevalence of mental disorder estimated by scoring method, K-means and LCA. According to the advantages of LCA than K-means and different results in scoring method, we suggest LCA for classification of Iranian nurses according to their mental health outcomes using GHQ-12 questionnaire.