WorldWideScience

Sample records for methods provide high

  1. Method for providing a low density high strength polyurethane foam

    Science.gov (United States)

    Whinnery, Jr., Leroy L.; Goods, Steven H.; Skala, Dawn M.; Henderson, Craig C.; Keifer, Patrick N.

    2013-06-18

    Disclosed is a method for making a polyurethane closed-cell foam material exhibiting a bulk density below 4 lbs/ft.sup.3 and high strength. The present embodiment uses the reaction product of a modified MDI and a sucrose/glycerine based polyether polyol resin wherein a small measured quantity of the polyol resin is "pre-reacted" with a larger quantity of the isocyanate in a defined ratio such that when the necessary remaining quantity of the polyol resin is added to the "pre-reacted" resin together with a tertiary amine catalyst and water as a blowing agent, the polymerization proceeds slowly enough to provide a stable foam body.

  2. Incentives and provider payment methods.

    Science.gov (United States)

    Barnum, H; Kutzin, J; Saxenian, H

    1995-01-01

    The mode of payment creates powerful incentives affecting provider behavior and the efficiency, equity and quality outcomes of health finance reforms. This article examines provider incentives as well as administrative costs, and institutional conditions for successful implementation associated with provider payment alternatives. The alternatives considered are budget reforms, capitation, fee-for-service, and case-based reimbursement. We conclude that competition, whether through a regulated private sector or within a public system, has the potential to improve the performance of any payment method. All methods generate both adverse and beneficial incentives. Systems with mixed forms of provider payment can provide tradeoffs to offset the disadvantages of individual modes. Low-income countries should avoid complex payment systems requiring higher levels of institutional development.

  3. The copper intrauterine device for emergency contraception: an opportunity to provide the optimal emergency contraception method and transition to highly effective contraception.

    Science.gov (United States)

    Dermish, Amna I; Turok, David K

    2013-07-01

    Worldwide, 40% of all pregnancies are unintended. Widespread, over-the-counter availability of oral emergency contraception (EC) has not reduced unintended pregnancy rates. The EC visit presents an opportunity to initiate a highly effective method of contraception in a population at high risk of unintended pregnancy who are actively seeking to avoid pregnancy. The copper intrauterine device (IUD), the most effective method of EC, continues to provide contraception as effective as sterilization for up to 12 years, and it should be offered as the first-line method of EC wherever possible. Increased demand for and supply of the copper IUD for EC may have an important role in reducing rates of unintended pregnancy. The EC visit should include access to the copper IUD as optimal care but should ideally include access to all highly effective methods of contraception.

  4. Method for Providing Semiconductors Having Self-Aligned Ion Implant

    Science.gov (United States)

    Neudeck, Philip G. (Inventor)

    2014-01-01

    A method is disclosed that provides a self-aligned nitrogen-implant particularly suited for a Junction Field Effect Transistor (JFET) semiconductor device preferably comprised of a silicon carbide (SiC). This self-aligned nitrogen-implant allows for the realization of durable and stable electrical functionality of high temperature transistors such as JFETs. The method implements the self-aligned nitrogen-implant having predetermined dimensions, at a particular step in the fabrication process, so that the SiC junction field effect transistors are capable of being electrically operating continuously at 500.degree. C. for over 10,000 hours in an air ambient with less than a 10% change in operational transistor parameters.

  5. Methods for providing intermediates in the synthesis of atorvastatin.

    NARCIS (Netherlands)

    Dömling, Alexander Stephan Siegfried

    2016-01-01

    The invention relates to the field of medicinal chemistry, In particular, it relates to methods for providing intermediates in the synthesis of Atorvastatin, a competitive inhibitor of HMG-Co A reductase. Provided is a process for providing a compound having a Formula (I) or a pharmaceutically

  6. High frequency asymptotic methods

    International Nuclear Information System (INIS)

    Bouche, D.; Dessarce, R.; Gay, J.; Vermersch, S.

    1991-01-01

    The asymptotic methods allow us to compute the interaction of high frequency electromagnetic waves with structures. After an outline of their foundations with emphasis on the geometrical theory of diffraction, it is shown how to use these methods to evaluate the radar cross section (RCS) of complex tri-dimensional objects of great size compared to the wave-length. The different stages in simulating phenomena which contribute to the RCS are reviewed: physical theory of diffraction, multiple interactions computed by shooting rays, research for creeping rays. (author). 7 refs., 6 figs., 3 insets

  7. Method for providing uranium with a protective copper coating

    Science.gov (United States)

    Waldrop, Forrest B.; Jones, Edward

    1981-01-01

    The present invention is directed to a method for providing uranium metal with a protective coating of copper. Uranium metal is subjected to a conventional cleaning operation wherein oxides and other surface contaminants are removed, followed by etching and pickling operations. The copper coating is provided by first electrodepositing a thin and relatively porous flash layer of copper on the uranium in a copper cyanide bath. The resulting copper-layered article is then heated in an air or inert atmosphere to volatilize and drive off the volatile material underlying the copper flash layer. After the heating step an adherent and essentially non-porous layer of copper is electro-deposited on the flash layer of copper to provide an adherent, multi-layer copper coating which is essentially impervious to corrosion by most gases.

  8. System and Method for Providing a Climate Data Persistence Service

    Science.gov (United States)

    Schnase, John L. (Inventor); Ripley, III, William David (Inventor); Duffy, Daniel Q. (Inventor); Thompson, John H. (Inventor); Strong, Savannah L. (Inventor); McInerney, Mark (Inventor); Sinno, Scott (Inventor); Tamkin, Glenn S. (Inventor); Nadeau, Denis (Inventor)

    2018-01-01

    A system, method and computer-readable storage devices for providing a climate data persistence service. A system configured to provide the service can include a climate data server that performs data and metadata storage and management functions for climate data objects, a compute-storage platform that provides the resources needed to support a climate data server, provisioning software that allows climate data server instances to be deployed as virtual climate data servers in a cloud computing environment, and a service interface, wherein persistence service capabilities are invoked by software applications running on a client device. The climate data objects can be in various formats, such as International Organization for Standards (ISO) Open Archival Information System (OAIS) Reference Model Submission Information Packages, Archive Information Packages, and Dissemination Information Packages. The climate data server can enable scalable, federated storage, management, discovery, and access, and can be tailored for particular use cases.

  9. Providing a computing environment for a high energy physics workshop

    International Nuclear Information System (INIS)

    Nicholls, J.

    1991-03-01

    Although computing facilities have been provided at conferences and workshops remote from the hose institution for some years, the equipment provided has rarely been capable of providing for much more than simple editing and electronic mail over leased lines. This presentation describes the pioneering effort involved by the Computing Department/Division at Fermilab in providing a local computing facility with world-wide networking capability for the Physics at Fermilab in the 1990's workshop held in Breckenridge, Colorado, in August 1989, as well as the enhanced facilities provided for the 1990 Summer Study on High Energy Physics at Snowmass, Colorado, in June/July 1990. Issues discussed include type and sizing of the facilities, advance preparations, shipping, on-site support, as well as an evaluation of the value of the facility to the workshop participants

  10. Network Information Management: The Key To Providing High WAN Availability.

    Science.gov (United States)

    Tysdal, Craig

    1996-01-01

    Discusses problems associated with increasing corporate network complexity as a result of the proliferation of client/server applications at remote locations, and suggests the key to providing high WAN (wide area network) availability is relational databases used in an integrated management approach. (LRW)

  11. Geospatial methods provide timely and comprehensive urban forest information

    Science.gov (United States)

    Kathleen T. Ward; Gary R. Johnson

    2007-01-01

    Urban forests are unique and highly valued resources. However, trees in urban forests are often under greater stress than those in rural or undeveloped areas due to soil compaction, restricted growing spaces, high temperatures, and exposure to air and water pollution. In addition, conditions change more quickly in urban as opposed to rural and undeveloped settings....

  12. 32 CFR 199.14 - Provider reimbursement methods.

    Science.gov (United States)

    2010-07-01

    ... physicians. (6) All services provided by nurse anesthetists. (7) All services related to discharges involving... more accurate data became available. (v) No update for inflation. The children's hospital differential... considered lower volume hospitals. (B) Hospitals that subsequently become higher volume hospitals. In any...

  13. Methodical Approaches to Communicative Providing of Retailer Branding

    Directory of Open Access Journals (Sweden)

    Andrey Kataev

    2017-07-01

    Full Text Available The thesis is devoted to the rationalization of methodical approaches for provision of branding of retail trade enterprises. The article considers the features of brand perception by retail consumers and clarifies the specifics of customer reviews of stores for the procedures accompanying brand management. It is proved that besides traditional communication mix, the most important tool of communicative influence on buyers is the store itself as a place for comfortable shopping. The shop should have a stimulating effect on all five human senses, including sight, smell, hearing, touch, and taste, which shall help maximize consumer integration into the buying process.

  14. Development of a nested polymerase chain reaction for amplification of a sequence of the p57 gene of Renibacterium salmoninarum that provides a highly sensitive method for detection of the bacterium in salmonid kidney

    Science.gov (United States)

    Chase, D.M.; Pascho, R.J.

    1998-01-01

    Nucleic acid-based assays have shown promise for diagnosing Renibacterium salmoninarum in tissues and body fluids of salmonids. DeVelopment of a nested polymerase chain reaction (PCR) method to detect a 320 bp DNA segment of the gene encoding the p57 protein of R. salmoninarum is described. Whereas a conventional PCR for a 383 bp segment of the p57 gene reliably detected 1000 R. salmoninarum cells per reaction in kidney tissue, the nested PCR detected as few as 10 R. salmoninarum per reaction in kidney tissue. Two DNA extraction methods for the nested PCR were compared and the correlation between replicate samples was generally higher in samples extracted by the QIAamp system compared with those extracted by the phenol/chloroform method. The specificity of the nested PCR was confirmed by testing DNA extracts of common bacterial fish pathogens and a panel of bacterial species reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA) and the fluorescent antibody test (FAT) for R. salmoninarum. Kidney samples from 74 naturally infected chinook Salmon were examined by the nested PCR, the ELISA, and the FAT, and the detected prevalences of R. salmoninarum were 61, 47, and 43%, respectively.

  15. Position detectors, methods of detecting position, and methods of providing positional detectors

    Science.gov (United States)

    Weinberg, David M.; Harding, L. Dean; Larsen, Eric D.

    2002-01-01

    Position detectors, welding system position detectors, methods of detecting various positions, and methods of providing position detectors are described. In one embodiment, a welding system positional detector includes a base that is configured to engage and be moved along a curved surface of a welding work piece. At least one position detection apparatus is provided and is connected with the base and configured to measure angular position of the detector relative to a reference vector. In another embodiment, a welding system positional detector includes a weld head and at least one inclinometer mounted on the weld head. The one inclinometer is configured to develop positional data relative to a reference vector and the position of the weld head on a non-planar weldable work piece.

  16. Interconnection blocks: a method for providing reusable, rapid, multiple, aligned and planar microfluidic interconnections

    International Nuclear Information System (INIS)

    Sabourin, D; Snakenborg, D; Dufva, M

    2009-01-01

    In this paper a method is presented for creating 'interconnection blocks' that are re-usable and provide multiple, aligned and planar microfluidic interconnections. Interconnection blocks made from polydimethylsiloxane allow rapid testing of microfluidic chips and unobstructed microfluidic observation. The interconnection block method is scalable, flexible and supports high interconnection density. The average pressure limit of the interconnection block was near 5.5 bar and all individual results were well above the 2 bar threshold considered applicable to most microfluidic applications

  17. High Resolution Insights into Snow Distribution Provided by Drone Photogrammetry

    Science.gov (United States)

    Redpath, T.; Sirguey, P. J.; Cullen, N. J.; Fitzsimons, S.

    2017-12-01

    Dynamic in time and space, New Zealand's seasonal snow is largely confined to remote alpine areas, complicating ongoing in situ measurement and characterisation. Improved understanding and modeling of the seasonal snowpack requires fine scale resolution of snow distribution and spatial variability. The potential of remotely piloted aircraft system (RPAS) photogrammetry to resolve spatial and temporal variability of snow depth and water equivalent in a New Zealand alpine catchment is assessed in the Pisa Range, Central Otago. This approach yielded orthophotomosaics and digital surface models (DSM) at 0.05 and 0.15 m spatial resolution, respectively. An autumn reference DSM allowed mapping of winter (02/08/2016) and spring (10/09/2016) snow depth at 0.15 m spatial resolution, via DSM differencing. The consistency and accuracy of the RPAS-derived surface was assessed by comparison of snow-free regions of the spring and autumn DSMs, while accuracy of RPAS retrieved snow depth was assessed with 86 in situ snow probe measurements. Results show a mean vertical residual of 0.024 m between DSMs acquired in autumn and spring. This residual approximated a Laplace distribution, reflecting the influence of large outliers on the small overall bias. Propagation of errors associated with successive DSMs saw snow depth mapped with an accuracy of ± 0.09 m (95% c.l.). Comparing RPAS and in situ snow depth measurements revealed the influence of geo-location uncertainty and interactions between vegetation and the snowpack on snow depth uncertainty and bias. Semi-variogram analysis revealed that the RPAS outperformed systematic in situ measurements in resolving fine scale spatial variability. Despite limitations accompanying RPAS photogrammetry, this study demonstrates a repeatable means of accurately mapping snow depth for an entire, yet relatively small, hydrological basin ( 0.5 km2), at high resolution. Resolving snowpack features associated with re-distribution and preferential

  18. Methods for high yield production of terpenes

    Energy Technology Data Exchange (ETDEWEB)

    Kutchan, Toni; Higashi, Yasuhiro; Feng, Xiaohong

    2017-01-03

    Provided are enhanced high yield production systems for producing terpenes in plants via the expression of fusion proteins comprising various combinations of geranyl diphosphate synthase large and small subunits and limonene synthases. Also provided are engineered oilseed plants that accumulate monoterpene and sesquiterpene hydrocarbons in their seeds, as well as methods for producing such plants, providing a system for rapidly engineering oilseed crop production platforms for terpene-based biofuels.

  19. High throughput screening method for assessing heterogeneity of microorganisms

    NARCIS (Netherlands)

    Ingham, C.J.; Sprenkels, A.J.; van Hylckama Vlieg, J.E.T.; Bomer, Johan G.; de Vos, W.M.; van den Berg, Albert

    2006-01-01

    The invention relates to the field of microbiology. Provided is a method which is particularly powerful for High Throughput Screening (HTS) purposes. More specific a high throughput method for determining heterogeneity or interactions of microorganisms is provided.

  20. High School Child Development Courses Provide a Valuable Apprenticeship

    Science.gov (United States)

    McCombie, Sally M.

    2009-01-01

    The current media are laden with reports of the many significant problems facing today's youth. In fact, parenting has become a national topic of discussion. Parenting instruction, a responsibility that had previously rested in the home, has become part of educational curricula. Courses in child development are offered for high school students in…

  1. Pharmacists as providers: targeting pneumococcal vaccinations to high risk populations.

    Science.gov (United States)

    Taitel, Michael; Cohen, Ed; Duncan, Ian; Pegus, Cheryl

    2011-10-19

    Older adults and persons with chronic conditions are at increased risk for pneumococcal disease. Severe pneumococcal disease represents a substantial humanistic and economic burden to society. Although pneumococcal vaccination (PPSV) can decrease risk for serious consequences, vaccination rates are suboptimal. As more people seek annual influenza vaccinations at community pharmacies, pharmacists have the ability to identify at-risk patients and provide PPSV. The objective of this study was to evaluate the impact of pharmacists educating at-risk patients on the importance of receiving a pneumococcal vaccination. Using de-identified claims from a large, national pharmacy chain, all patients who had received an influenza vaccination between August 1, 2010 and November 14, 2010 and who were eligible for PPSV were identified for the analysis. Based on the Advisory Committee on Immunization Practices recommendations, at-risk patients were identified as over 65 years of age or as aged 2-64 with a comorbid conditions. A benchmark medical and pharmacy claims database of commercial and Medicare health plan members was used to derive a PPSV vaccination rate typical of traditional care delivery to compare to pharmacy-based vaccination. Period incidence of PPSV was calculated and compared. Among the 1.3 million at-risk patients who were vaccinated by a pharmacist during the study period, 65,598 (4.88%) also received a pneumococcal vaccine. This vaccination rate was significantly higher than the benchmark rate of 2.90% (34,917/1,204,104; pvaccination rate (6.60%; 26,430/400,454) of any age group. Pharmacists were successful at identifying at-risk patients and providing additional immunization services. Concurrent immunization of PPSV with influenza vaccination by pharmacists has potential to improve PPSV coverage. These results support the expanding role of community pharmacists in the provision of wellness and prevention services. Copyright © 2011 Elsevier Ltd. All rights

  2. High temperature superconductors and method

    International Nuclear Information System (INIS)

    Ruvalds, J.J.

    1977-01-01

    This invention comprises a superconductive compound having the formula: Ni/sub 1-x/M/sub x/Z/sub y/ wherein M is a metal which will destroy the magnetic character of nickel (preferably copper, silver or gold); Z is hydrogen or deuterium; x is 0.1 to 0.9; and y, correspondingly, 0.9 to 0.1, and method of conducting electric current with no resistance at relatively high temperature of T>1 0 K comprising a conductor consisting essentially of the superconducting compound noted above

  3. Prediction of high frequency core loss for electrical steel using the data provided by manufacturer

    Science.gov (United States)

    Roy, Rakesh; Dalal, Ankit; Kumar, Praveen

    2016-07-01

    This paper describes a technique to determine the core loss data, at high frequencies, using the loss data provided by the lamination manufacturer. Steinmetz equation is used in this proposed method to determine core loss at high frequency. This Steinmetz equation consists of static hysteresis and eddy current loss. The presented technique considers the coefficients of Steinmetz equation as variable with frequency and peak magnetic flux density. The high frequency core loss data, predicted using this model is compared with the catalogue data given by manufacturer and very good accuracy has been obtained for a wide range of frequency.

  4. A novel method of providing a library of n-mers or biopolymers

    DEFF Research Database (Denmark)

    2012-01-01

    The present invention relates to a method of providing a library of n-mer sequences, wherein the library is composed of an n-mer sequence. Also the invention concerns a method of providing a library of biopolymer sequences having one or more n-mers in common. Further provided are specific primers...

  5. ELV Recycling Service Provider Selection Using the Hybrid MCDM Method: A Case Application in China

    Directory of Open Access Journals (Sweden)

    Fuli Zhou

    2016-05-01

    Full Text Available With the rapid depletion of natural resources and undesired environmental changes globally, more interest has been shown in the research of green supply chain practices, including end-of-life vehicle (ELV recycling. The ELV recycling is mandatory for auto-manufacturers by legislation for the purpose of minimizing potential environmental damages. The purpose of the present research is to determine the best choice of ELV recycling service provider by employing an integrating hybrid multi-criteria decision making (MCDM method. In this research, economic, environmental and social factors are taken into consideration. The linguistic variables and trapezoidal fuzzy numbers (TFNs are applied into this evaluation to deal with the vague and qualitative information. With the combined weight calculation of criteria based on fuzzy aggregation and Shannon Entropy techniques, the normative multi-criteria optimization technique (FVIKOR method is applied to explore the best solution. An application was performed based on the proposed hybrid MCDM method, and sensitivity analysis was conducted on different decision making scenarios. The present study provides a decision-making approach on ELV recycling business selection under sustainability and green philosophy with high robustness and easy implementation.

  6. High Altitude Platforms for Disaster Recovery: Capabilities, Strategies, and Techniques for Providing Emergency Telecommunications

    Energy Technology Data Exchange (ETDEWEB)

    Juan D. Deaton

    2008-05-01

    Natural disasters and terrorist acts have significant potential to disrupt emergency communication systems. These emergency communication networks include first-responder, cellular, landline, and emergency answering services such as 911, 112, or 999. Without these essential emergency communications capabilities, search, rescue, and recovery operations during a catastrophic event will be severely debilitated. High altitude platforms could be fitted with telecommunications equipment and used to support these critical communications missions once the catastrophic event occurs. With the ability to be continuously on station, HAPs provide excellent options for providing emergency coverage over high-risk areas before catastrophic incidents occur. HAPs could also provide enhanced 911 capabilities using either GPS or reference stations. This paper proposes potential emergency communications architecture and presents a method for estimating emergency communications systems traffic patterns for a catastrophic event.

  7. Prediction of high frequency core loss for electrical steel using the data provided by manufacturer

    Energy Technology Data Exchange (ETDEWEB)

    Roy, Rakesh [National Institute of Technology Meghalaya, Shillong (India); Dalal, Ankit; Kumar, Praveen [Indian Institute of Technology Guwahati, Assam (India)

    2016-07-15

    This paper describes a technique to determine the core loss data, at high frequencies, using the loss data provided by the lamination manufacturer. Steinmetz equation is used in this proposed method to determine core loss at high frequency. This Steinmetz equation consists of static hysteresis and eddy current loss. The presented technique considers the coefficients of Steinmetz equation as variable with frequency and peak magnetic flux density. The high frequency core loss data, predicted using this model is compared with the catalogue data given by manufacturer and very good accuracy has been obtained for a wide range of frequency. - Highlights: • A curve fitting algorithm is proposed to predict core loss at high frequency. • The loss data given by the steel manufacturers are used in curve fitting algorithm. • The algorithm is tested on nine different material’s data set given by the manufacturer.

  8. Prediction of high frequency core loss for electrical steel using the data provided by manufacturer

    International Nuclear Information System (INIS)

    Roy, Rakesh; Dalal, Ankit; Kumar, Praveen

    2016-01-01

    This paper describes a technique to determine the core loss data, at high frequencies, using the loss data provided by the lamination manufacturer. Steinmetz equation is used in this proposed method to determine core loss at high frequency. This Steinmetz equation consists of static hysteresis and eddy current loss. The presented technique considers the coefficients of Steinmetz equation as variable with frequency and peak magnetic flux density. The high frequency core loss data, predicted using this model is compared with the catalogue data given by manufacturer and very good accuracy has been obtained for a wide range of frequency. - Highlights: • A curve fitting algorithm is proposed to predict core loss at high frequency. • The loss data given by the steel manufacturers are used in curve fitting algorithm. • The algorithm is tested on nine different material’s data set given by the manufacturer.

  9. System and Method for Providing Vertical Profile Measurements of Atmospheric Gases

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — A system and method for using an air collection device to collect a continuous air sample as the device descends through the atmosphere are provided. The air...

  10. Interconnection blocks: a method for providing reusable, rapid, multiple, aligned and planar microfluidic interconnections

    DEFF Research Database (Denmark)

    Sabourin, David; Snakenborg, Detlef; Dufva, Hans Martin

    2009-01-01

    In this paper a method is presented for creating 'interconnection blocks' that are re-usable and provide multiple, aligned and planar microfluidic interconnections. Interconnection blocks made from polydimethylsiloxane allow rapid testing of microfluidic chips and unobstructed microfluidic observ...

  11. Systems and methods for providing power to a load based upon a control strategy

    Science.gov (United States)

    Perisic, Milun; Kajouke, Lateef A; Ransom, Ray M

    2013-12-24

    Systems and methods are provided for an electrical system. The electrical system includes a load, an interface configured to receive a voltage from a voltage source, and a controller configured to receive the voltage from the voltage source through the interface and to provide a voltage and current to the load. Wherein, when the controller is in a constant voltage mode, the controller provides a constant voltage to the load, when the controller is in a constant current mode, the controller provides a constant current to the load, and when the controller is in a constant power mode, the controller provides a constant power to the load.

  12. Method and Apparatus Providing Deception and/or Altered Operation in an Information System Operating System

    Science.gov (United States)

    Cohen, Fred; Rogers, Deanna T.; Neagoe, Vicentiu

    2008-10-14

    A method and/or system and/or apparatus providing deception and/or execution alteration in an information system. In specific embodiments, deceptions and/or protections are provided by intercepting and/or modifying operation of one or more system calls of an operating system.

  13. Provider Payment Trends and Methods in the Massachusetts Health Care System

    OpenAIRE

    Allison Barrett; Timothy Lake

    2010-01-01

    This report investigates provider payment methods in Massachusetts. Payments include fee-for-service, the predominant model; global payments, which pay providers a single fee for all or most required services during a contract period; and pay-for-performance models, which layer quality incentives onto payments.

  14. 47 CFR 51.329 - Notice of network changes: Methods for providing notice.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 3 2010-10-01 2010-10-01 false Notice of network changes: Methods for providing notice. 51.329 Section 51.329 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED...) Filing a public notice with the Commission; or (2) Providing public notice through industry fora...

  15. High-frequency Rayleigh-wave method

    Science.gov (United States)

    Xia, J.; Miller, R.D.; Xu, Y.; Luo, Y.; Chen, C.; Liu, J.; Ivanov, J.; Zeng, C.

    2009-01-01

    High-frequency (???2 Hz) Rayleigh-wave data acquired with a multichannel recording system have been utilized to determine shear (S)-wave velocities in near-surface geophysics since the early 1980s. This overview article discusses the main research results of high-frequency surface-wave techniques achieved by research groups at the Kansas Geological Survey and China University of Geosciences in the last 15 years. The multichannel analysis of surface wave (MASW) method is a non-invasive acoustic approach to estimate near-surface S-wave velocity. The differences between MASW results and direct borehole measurements are approximately 15% or less and random. Studies show that simultaneous inversion with higher modes and the fundamental mode can increase model resolution and an investigation depth. The other important seismic property, quality factor (Q), can also be estimated with the MASW method by inverting attenuation coefficients of Rayleigh waves. An inverted model (S-wave velocity or Q) obtained using a damped least-squares method can be assessed by an optimal damping vector in a vicinity of the inverted model determined by an objective function, which is the trace of a weighted sum of model-resolution and model-covariance matrices. Current developments include modeling high-frequency Rayleigh-waves in near-surface media, which builds a foundation for shallow seismic or Rayleigh-wave inversion in the time-offset domain; imaging dispersive energy with high resolution in the frequency-velocity domain and possibly with data in an arbitrary acquisition geometry, which opens a door for 3D surface-wave techniques; and successfully separating surface-wave modes, which provides a valuable tool to perform S-wave velocity profiling with high-horizontal resolution. ?? China University of Geosciences (Wuhan) and Springer-Verlag GmbH 2009.

  16. System and Method for Providing a Climate Data Analytic Services Application Programming Interface Distribution Package

    Science.gov (United States)

    Schnase, John L. (Inventor); Duffy, Daniel Q. (Inventor); Tamkin, Glenn S. (Inventor)

    2016-01-01

    A system, method and computer-readable storage devices for providing a climate data analytic services application programming interface distribution package. The example system can provide various components. The system provides a climate data analytic services application programming interface library that enables software applications running on a client device to invoke the capabilities of a climate data analytic service. The system provides a command-line interface that provides a means of interacting with a climate data analytic service by issuing commands directly to the system's server interface. The system provides sample programs that call on the capabilities of the application programming interface library and can be used as templates for the construction of new client applications. The system can also provide test utilities, build utilities, service integration utilities, and documentation.

  17. Development of guidance and methodical documents for providing the decommissioning of radiation-hazardous objects

    International Nuclear Information System (INIS)

    Ermakov, A.

    2015-01-01

    Federal Center for Nuclear and Radiation Safety (JSC FCNRS) developed and approbated guidance and methodical documents for providing the facility to radiologically safe status in the course of Building B decommissioning activity at JSC VNIINM (A.A. Bochvar High-Technology Scientific Research Institute for Inorganic Materials). The scope of application of the documents developed is as follows: - preliminary segregation of radwaste into streams during its collection and preparation for removal from facilities/sites under decommissioning; - express assessment of specific activity (activity) of radwaste generated in the course of dismantling and decontamination activities; - radiological survey of premises and building structures following completion of dismantling and decontamination activities; - SRW processing (compaction, reduction in size), packaging, characterisation and containerisation in order to reduce risks of spread of radioactive contamination. Documents that have been developed can be used both at nuclear facilities/ sites similar to the JSC VNIINM Building B in terms of work stages and types of waste to be generated, and other facilities/ sites taking into consideration their peculiarities. (author)

  18. Configurable memory system and method for providing atomic counting operations in a memory device

    Science.gov (United States)

    Bellofatto, Ralph E.; Gara, Alan G.; Giampapa, Mark E.; Ohmacht, Martin

    2010-09-14

    A memory system and method for providing atomic memory-based counter operations to operating systems and applications that make most efficient use of counter-backing memory and virtual and physical address space, while simplifying operating system memory management, and enabling the counter-backing memory to be used for purposes other than counter-backing storage when desired. The encoding and address decoding enabled by the invention provides all this functionality through a combination of software and hardware.

  19. Method of immobilizing weapons plutonium to provide a durable, disposable waste product

    Science.gov (United States)

    Ewing, Rodney C.; Lutze, Werner; Weber, William J.

    1996-01-01

    A method of atomic scale fixation and immobilization of plutonium to provide a durable waste product. Plutonium is provided in the form of either PuO.sub.2 or Pu(NO.sub.3).sub.4 and is mixed with and SiO.sub.2. The resulting mixture is cold pressed and then heated under pressure to form (Zr,Pu)SiO.sub.4 as the waste product.

  20. Cloud Service Provider Methods for Managing Insider Threats: Analysis Phase 1

    Science.gov (United States)

    2013-11-01

    of Standards and Technology (NIST) Special Publication 800-145 (NIST SP 800-145) defines three types of cloud services : Software as a Service ( SaaS ...among these three models. NIST SP 800-145 describes the three service models as follows: SaaS —The capability provided to the consumer is to use the...Cloud Service Provider Methods for Managing Insider Threats: Analysis Phase I Greg Porter November 2013 TECHNICAL NOTE CMU/SEI-2013-TN-020

  1. Method for synthesis of high quality graphene

    Science.gov (United States)

    Lanzara, Alessandra [Piedmont, CA; Schmid, Andreas K [Berkeley, CA; Yu, Xiaozhu [Berkeley, CA; Hwang, Choonkyu [Albany, CA; Kohl, Annemarie [Beneditkbeuern, DE; Jozwiak, Chris M [Oakland, CA

    2012-03-27

    A method is described herein for the providing of high quality graphene layers on silicon carbide wafers in a thermal process. With two wafers facing each other in close proximity, in a first vacuum heating stage, while maintained at a vacuum of around 10.sup.-6 Torr, the wafer temperature is raised to about 1500.degree. C., whereby silicon evaporates from the wafer leaving a carbon rich surface, the evaporated silicon trapped in the gap between the wafers, such that the higher vapor pressure of silicon above each of the wafers suppresses further silicon evaporation. As the temperature of the wafers is raised to about 1530.degree. C. or more, the carbon atoms self assemble themselves into graphene.

  2. THIRD PARTY LOGISTIC SERVICE PROVIDER SELECTION USING FUZZY AHP AND TOPSIS METHOD

    Directory of Open Access Journals (Sweden)

    Golam Kabir

    2012-03-01

    Full Text Available The use of third party logistic(3PL services providers is increasing globally to accomplish the strategic objectives. In the increasingly competitive environment, logistics strategic management requires systematic and structured approach to have cutting edge over the rival. Logistics service provider selection is a complex multi-criteria decision making process; in which, decision makers have to deals with the optimization of conflicting objectives such as quality, cost, and delivery time. In this paper, fuzzy analytic hierarchy process (FAHP approach based on technique for order preference by similarity to ideal solution (TOPSIS method has been proposed for evaluating and selecting an appropriate logistics service provider, where the ratings of each alternative and importance weight of each criterion are expressed in triangular fuzzy numbers.

  3. A method of providing a barrier in a fracture-containing system

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention relates to a method of providing a barrier in a fracture-containing system, comprising: i) Providing a treatment fluid comprising: a) a base fluid; b) an elastomeric material, wherein said elastomeric material comprises at least one polymer capable of crosslinking into an el......The present invention relates to a method of providing a barrier in a fracture-containing system, comprising: i) Providing a treatment fluid comprising: a) a base fluid; b) an elastomeric material, wherein said elastomeric material comprises at least one polymer capable of crosslinking...... into an elastomer, and c) at least one crosslinking agent; ii) Placing the treatment fluid in a fracture-containing system; iii) Allowing the elastomeric material to crosslink with itself to form a barrier in said fracture-containing system; wherein the elastomeric material and/or the crosslinking agent...... are of neutral buoyancy with regard to the base fluid. The invention is contemplated to having utility not only in the oil-drilling industry but also in the plugging of fractures in sewer drains, pipelines etc....

  4. Gradient High Performance Liquid Chromatography Method ...

    African Journals Online (AJOL)

    Purpose: To develop a gradient high performance liquid chromatography (HPLC) method for the simultaneous determination of phenylephrine (PHE) and ibuprofen (IBU) in solid ..... nimesulide, phenylephrine. Hydrochloride, chlorpheniramine maleate and caffeine anhydrous in pharmaceutical dosage form. Acta Pol.

  5. Validated High Performance Liquid Chromatography Method for ...

    African Journals Online (AJOL)

    Purpose: To develop a simple, rapid and sensitive high performance liquid chromatography (HPLC) method for the determination of cefadroxil monohydrate in human plasma. Methods: Schimadzu HPLC with LC solution software was used with Waters Spherisorb, C18 (5 μm, 150mm × 4.5mm) column. The mobile phase ...

  6. Rainforest pharmacopeia in Madagascar provides high value for current local and prospective global uses.

    Directory of Open Access Journals (Sweden)

    Christopher D Golden

    Full Text Available Botanical diversity provides value to humans through carbon sequestration, air and water purification, and the provisioning of wild foods and ethnomedicines. Here we calculate the value of botanical ethnomedicines in a rainforest region of Madagascar, the Makira Protected Area, using a substitution method that combines replacement costs and choice modeling. The Makira watershed may comprise approximately 0.8% of global botanical diversity and possesses enormous value both in its ability to provision botanical ethnomedicines to local people and as a source of potentially novel pharmaceutical drugs for society as a whole. Approximately 241 locally-recognized species are used as ethnomedicines, including 113 agricultural or weed species. We equated each ethnomedicinal treatment to the monetary value of a comparable pharmaceutical treatment adjusted by personal preferences in perceived efficacy (rather than from known or assumed medicinal equivalency. The benefit value of these botanical ethnomedicines per individual is $5.40-7.90 per year when using the value of highly subsidized Malagasy pharmaceuticals and $100.60-287.40 when using the value of American pharmaceuticals. Using local pharmaceuticals as substitutes, the value per household is $30.24-44.30 per year, equivalent to 43-63% of median annual household income, demonstrating their local importance. Using the value of American pharmaceuticals, the amount is equivalent to 22-63% of the median annual health care expenditures for American adults under 45 in 2006. The potential for developing novel biomedicines from the Makira watershed's unique flora ranges in untapped benefit value from $0.3-5.7 billion for American pharmaceutical companies, non-inclusive of the importance of providing novel medicines and improved healthcare to society. This study provides evidence of the tremendous current local and prospective global value of botanical ethnomedicines and furthers arguments for the

  7. System and method of providing quick thermal comfort with reduced energy by using directed spot conditioning

    Science.gov (United States)

    Wang, Mingyu; Kadle, Prasad S.; Ghosh, Debashis; Zima, Mark J.; Wolfe, IV, Edward; Craig, Timothy D

    2016-10-04

    A heating, ventilation, and air conditioning (HVAC) system and a method of controlling a HVAC system that is configured to provide a perceived comfortable ambient environment to an occupant seated in a vehicle cabin. The system includes a nozzle configured to direct an air stream from the HVAC system to the location of a thermally sensitive portion of the body of the occupant. The system also includes a controller configured to determine an air stream temperature and an air stream flow rate necessary to establish the desired heat supply rate for the sensitive portion and provide a comfortable thermal environment by thermally isolating the occupant from the ambient vehicle cabin temperature. The system may include a sensor to determine the location of the sensitive portion. The nozzle may include a thermoelectric device to heat or cool the air stream.

  8. Method of App Selection for Healthcare Providers Based on Consumer Needs.

    Science.gov (United States)

    Lee, Jisan; Kim, Jeongeun

    2018-01-01

    Mobile device applications can be used to manage health. However, healthcare providers hesitate to use them because selection methods that consider the needs of health consumers and identify the most appropriate application are rare. This study aimed to create an effective method of identifying applications that address user needs. Women experiencing dysmenorrhea and premenstrual syndrome were the targeted users. First, we searched for related applications from two major sources of mobile applications. Brainstorming, mind mapping, and persona and scenario techniques were used to create a checklist of relevant criteria, which was used to rate the applications. Of the 2784 applications found, 369 were analyzed quantitatively. Of those, five of the top candidates were evaluated by three groups: application experts, clinical experts, and potential users. All three groups ranked one application the highest; however, the remaining rankings differed. The results of this study suggest that the method created is useful because it considers not only the needs of various users but also the knowledge of application and clinical experts. This study proposes a method for finding and using the best among existing applications and highlights the need for nurses who can understand and combine opinions of users and application and clinical experts.

  9. Discussion of a method for providing general risk information by linking with the nuclear information

    International Nuclear Information System (INIS)

    Shobu, Nobuhiro; Yokomizo, Shirou; Umezawa, Sayaka

    2004-06-01

    'Risk information navigator (http://www.ricotti.jp/risknavi/)', an internet tool for arousing public interest and fostering people's risk literacy, has been developed as the contents for the official website of Techno Community Square 'RICOTTI' (http://www.ricotti.jp) at TOKAI village. In this report we classified the risk information into the fields, Health/Daily Life', 'Society/Crime/Disaster' and Technology/Environment/Energy', for the internet tool contents. According to these categories we discussed a method for providing various risk information on general fields by linking with the information on nuclear field. The web contents are attached to this report with the CD-R media. (author)

  10. Particle identification methods in High Energy Physics

    Energy Technology Data Exchange (ETDEWEB)

    Va' Vra, J.

    2000-01-27

    This paper deals with two major particle identification methods: dE/dx and Cherenkov detection. In the first method, the authors systematically compare existing dE/dx data with various predictions available in the literature, such as the Particle Data group recommendation, and judge the overall consistency. To my knowledge, such comparison was not done yet in a published form for the gaseous detectors used in High-Energy physics. As far as the second method, there are two major Cherenkov light detection techniques: the threshold and the Ring imaging methods. The authors discuss the recent trend in these techniques.

  11. Improved methods for high resolution electron microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, J.R.

    1987-04-01

    Existing methods of making support films for high resolution transmission electron microscopy are investigated and novel methods are developed. Existing methods of fabricating fenestrated, metal reinforced specimen supports (microgrids) are evaluated for their potential to reduce beam induced movement of monolamellar crystals of C/sub 44/H/sub 90/ paraffin supported on thin carbon films. Improved methods of producing hydrophobic carbon films by vacuum evaporation, and improved methods of depositing well ordered monolamellar paraffin crystals on carbon films are developed. A novel technique for vacuum evaporation of metals is described which is used to reinforce microgrids. A technique is also developed to bond thin carbon films to microgrids with a polymer bonding agent. Unique biochemical methods are described to accomplish site specific covalent modification of membrane proteins. Protocols are given which covalently convert the carboxy terminus of papain cleaved bacteriorhodopsin to a free thiol. 53 refs., 19 figs., 1 tab.

  12. A method to provide rapid in situ determination of tip radius in dynamic atomic force microscopy

    International Nuclear Information System (INIS)

    Santos, Sergio; Guang Li; Souier, Tewfik; Gadelrab, Karim; Chiesa, Matteo; Thomson, Neil H.

    2012-01-01

    We provide a method to characterize the tip radius of an atomic force microscopy in situ by monitoring the dynamics of the cantilever in ambient conditions. The key concept is that the value of free amplitude for which transitions from the attractive to repulsive force regimes are observed, strongly depends on the curvature of the tip. In practice, the smaller the value of free amplitude required to observe a transition, the sharper the tip. This general behavior is remarkably independent of the properties of the sample and cantilever characteristics and shows the strong dependence of the transitions on the tip radius. The main advantage of this method is rapid in situ characterization. Rapid in situ characterization enables one to continuously monitor the tip size during experiments. Further, we show how to reproducibly shape the tip from a given initial size to any chosen larger size. This approach combined with the in situ tip size monitoring enables quantitative comparison of materials measurements between samples. These methods are set to allow quantitative data acquisition and make direct data comparison readily available in the community.

  13. Brayton Power Conversion Unit Tested: Provides a Path to Future High-Power Electric Propulsion Missions

    Science.gov (United States)

    Mason, Lee S.

    2003-01-01

    Closed-Brayton-cycle conversion technology has been identified as an excellent candidate for nuclear electric propulsion (NEP) power conversion systems. Advantages include high efficiency, long life, and high power density for power levels from about 10 kWe to 1 MWe, and beyond. An additional benefit for Brayton is the potential for the alternator to deliver very high voltage as required by the electric thrusters, minimizing the mass and power losses associated with the power management and distribution (PMAD). To accelerate Brayton technology development for NEP, the NASA Glenn Research Center is developing a low-power NEP power systems testbed that utilizes an existing 2- kWe Brayton power conversion unit (PCU) from previous solar dynamic technology efforts. The PCU includes a turboalternator, a recuperator, and a gas cooler connected by gas ducts. The rotating assembly is supported by gas foil bearings and consists of a turbine, a compressor, a thrust rotor, and an alternator on a single shaft. The alternator produces alternating-current power that is rectified to 120-V direct-current power by the PMAD unit. The NEP power systems testbed will be utilized to conduct future investigations of operational control methods, high-voltage PMAD, electric thruster interactions, and advanced heat rejection techniques. The PCU was tested in Glenn s Vacuum Facility 6. The Brayton PCU was modified from its original solar dynamic configuration by the removal of the heat receiver and retrofitting of the electrical resistance gas heater to simulate the thermal input of a steady-state nuclear source. Then, the Brayton PCU was installed in the 3-m test port of Vacuum Facility 6, as shown. A series of tests were performed between June and August of 2002 that resulted in a total PCU operational time of about 24 hr. An initial test sequence on June 17 determined that the reconfigured unit was fully operational. Ensuing tests provided the operational data needed to characterize PCU

  14. Method for providing slip energy control in permanent magnet electrical machines

    Science.gov (United States)

    Hsu, John S.

    2006-11-14

    An electric machine (40) has a stator (43), a permanent magnet rotor (38) with permanent magnets (39) and a magnetic coupling uncluttered rotor (46) for inducing a slip energy current in secondary coils (47). A dc flux can be produced in the uncluttered rotor when the secondary coils are fed with dc currents. The magnetic coupling uncluttered rotor (46) has magnetic brushes (A, B, C, D) which couple flux in through the rotor (46) to the secondary coils (47c, 47d) without inducing a current in the rotor (46) and without coupling a stator rotational energy component to the secondary coils (47c, 47d). The machine can be operated as a motor or a generator in multi-phase or single-phase embodiments and is applicable to the hybrid electric vehicle. A method of providing a slip energy controller is also disclosed.

  15. A model of sustainable development of scientific research health institutions, providing high-tech medical care

    Directory of Open Access Journals (Sweden)

    I. Yu. Bedoreva

    2017-01-01

    Full Text Available The issue of sustainability is relevant for all types of businesses and organizations. Long-term development has always been and remains one of the most difficult tasks faced by organizations. The implementation the provisions of international standards ISO series 9000 has proven to be effective. The ISO standards are concentrated on the global experience for sustainable success of organizations. The standards incorporated all the rational that has been accumulated in this field of knowledge and practice. These standards not only eliminate technical barriers in collaboration and have established standardized approaches, but also serve as a valuable source of international experience and ready management solutions. They became a practical guide for the creation of management systems for sustainable development in organizations of different spheres of activity.Problem and purpose. The article presents the author’s approach to the problem of sustainable development health of the organization. The purpose of this article is to examine the approaches to management for sustainable success of organizations and to describe a model of sustainable development applied in research healthcare institutions providing high-tech medical care.Methodology. The study used general scientific methods of empirical and theoretical knowledge, general logical methods and techniques and methods of system analysis, comparison, analogy, generalization, the materials research for the development of medical organizations.The main results of our work are to first develop the technique of complex estimation of activity of the scientific-research institutions of health and deploy key elements of the management system that allows the level of maturity of the management system of the institution to be set in order to identify its strengths and weaknesses, and to identify areas for improvements and innovation, and to set priorities for determining the sequence of action when

  16. Providing the physical basis of SCS curve number method and its proportionality relationship from Richards' equation

    Science.gov (United States)

    Hooshyar, M.; Wang, D.

    2016-12-01

    The empirical proportionality relationship, which indicates that the ratio of cumulative surface runoff and infiltration to their corresponding potentials are equal, is the basis of the extensively used Soil Conservation Service Curve Number (SCS-CN) method. The objective of this paper is to provide the physical basis of the SCS-CN method and its proportionality hypothesis from the infiltration excess runoff generation perspective. To achieve this purpose, an analytical solution of Richards' equation is derived for ponded infiltration in shallow water table environment under the following boundary conditions: 1) the soil is saturated at the land surface; and 2) there is a no-flux boundary which moves downward. The solution is established based on the assumptions of negligible gravitational effect, constant soil water diffusivity, and hydrostatic soil moisture profile between the no-flux boundary and water table. Based on the derived analytical solution, the proportionality hypothesis is a reasonable approximation for rainfall partitioning at the early stage of ponded infiltration in areas with a shallow water table for coarse textured soils.

  17. Content and Methods used to Train Tobacco Cessation Treatment Providers: An International Survey.

    Science.gov (United States)

    Kruse, Gina R; Rigotti, Nancy A; Raw, Martin; McNeill, Ann; Murray, Rachael; Piné-Abata, Hembadoon; Bitton, Asaf; McEwen, Andy

    2017-12-01

    There are limited existing data describing the training methods used to educate tobacco cessation treatment providers around the world. To measure the prevalence of tobacco cessation treatment content, skills training and teaching methods reported by tobacco treatment training programs across the world. Web-based survey in May-September 2013 among tobacco cessation training experts across six geographic regions and four World Bank income levels. Response rate was 73% (84 of 115 countries contacted). Of 104 individual programs from 84 countries, most reported teaching brief advice (78%) and one-to-one counseling (74%); telephone counseling was uncommon (33%). Overall, teaching of knowledge topics was more commonly reported than skills training. Programs in lower income countries less often reported teaching about medications, behavioral treatments and biomarkers and less often reported skills-based training about interviewing clients, medication management, biomarker measurement, assessing client outcomes, and assisting clients with co-morbidities. Programs reported a median 15 hours of training. Face-to-face training was common (85%); online programs were rare (19%). Almost half (47%) included no learner assessment. Only 35% offered continuing education. Nearly all programs reported teaching evidence-based treatment modalities in a face-to-face format. Few programs delivered training online or offered continuing education. Skills-based training was less common among low- and middle-income countries (LMICs). There is a large unmet need for tobacco treatment training protocols which emphasize practical skills, and which are more rapidly scalable than face-to-face training in LMICs.

  18. Validated high performance liquid chromatographic (HPLC) method ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-02-22

    Feb 22, 2010 ... specific and accurate high performance liquid chromatographic method for determination of ZER in micro-volumes ... tional medicine as a cure for swelling, sores, loss of appetite and ... Receptor Activator for Nuclear Factor κ B Ligand .... The effect of ... be suitable for preclinical pharmacokinetic studies. The.

  19. Method for providing uranium articles with a corrosion resistant anodized coating

    International Nuclear Information System (INIS)

    Waldrop, F.B.; Washington, C.A.

    1982-01-01

    Uranium articles are provided with anodized oxide coatings in an aqueous solution of an electrolyte selected from the group consisting of potassium phosphate, potassium hydroxide, ammonium hydroxide, and a mixture of potassium tetraborate and boric acid. The uranium articles are anodized at a temperature greater than about 75 degrees C. With a current flow of less than about 0.036 A/cm2 of surface area while the Ph of the solution is maintained in a range of about 2 to 11.5. The Ph values of the aqueous solution and the low current density utilized during the electrolysis prevent excessive dissolution of the uranium and porosity in the film or watering. The relatively high temperature of the electrolyte bath inhibits hydration and the attendant deleterious pitting so as to enhance corrosion resistance of the anodized coating

  20. Barriers to health education in adolescents: health care providers' perspectives compared to high school adolescents.

    Science.gov (United States)

    Abedian, Kobra; Shahhosseini, Zohreh

    2015-11-01

    Although adolescence is marked by profound and dynamic changes, it is virtually neglected by health care providers, by society, and even by most parents, teachers, and health professionals. The aim of this study was to investigate barriers to health education in adolescents from health care providers' views compared to teens. The study population consisted of 72 health care providers and 402 high school female students in Northern Iran in 2012. They completed a self-administered questionnaire about their views on barriers to adolescents' health education. It is revealed that the major barrier to adolescents' health education from a health care providers' perspective is "Lack of private room for adolescents' health education", while "Lack of adolescents' interest to content of educational programs" is a significantly greater barrier to health education among adolescents. The results suggest that for adolescent health education, specific strategies should be used in adolescent health promotion programs.

  1. The Effect of Health Information Technology on Health Care Provider Communication: A Mixed-Method Protocol.

    Science.gov (United States)

    Manojlovich, Milisa; Adler-Milstein, Julia; Harrod, Molly; Sales, Anne; Hofer, Timothy P; Saint, Sanjay; Krein, Sarah L

    2015-06-11

    Communication failures between physicians and nurses are one of the most common causes of adverse events for hospitalized patients, as well as a major root cause of all sentinel events. Communication technology (ie, the electronic medical record, computerized provider order entry, email, and pagers), which is a component of health information technology (HIT), may help reduce some communication failures but increase others because of an inadequate understanding of how communication technology is used. Increasing use of health information and communication technologies is likely to affect communication between nurses and physicians. The purpose of this study is to describe, in detail, how health information and communication technologies facilitate or hinder communication between nurses and physicians with the ultimate goal of identifying how we can optimize the use of these technologies to support effective communication. Effective communication is the process of developing shared understanding between communicators by establishing, testing, and maintaining relationships. Our theoretical model, based in communication and sociology theories, describes how health information and communication technologies affect communication through communication practices (ie, use of rich media; the location and availability of computers) and work relationships (ie, hierarchies and team stability). Therefore we seek to (1) identify the range of health information and communication technologies used in a national sample of medical-surgical acute care units, (2) describe communication practices and work relationships that may be influenced by health information and communication technologies in these same settings, and (3) explore how differences in health information and communication technologies, communication practices, and work relationships between physicians and nurses influence communication. This 4-year study uses a sequential mixed-methods design, beginning with a

  2. A method for analyzing the business case for provider participation in the National Cancer Institute's Community Clinical Oncology Program and similar federally funded, provider-based research networks.

    Science.gov (United States)

    Reiter, Kristin L; Song, Paula H; Minasian, Lori; Good, Marjorie; Weiner, Bryan J; McAlearney, Ann Scheck

    2012-09-01

    The Community Clinical Oncology Program (CCOP) plays an essential role in the efforts of the National Cancer Institute (NCI) to increase enrollment in clinical trials. Currently, there is little practical guidance in the literature to assist provider organizations in analyzing the return on investment (ROI), or business case, for establishing and operating a provider-based research network (PBRN) such as the CCOP. In this article, the authors present a conceptual model of the business case for PBRN participation, a spreadsheet-based tool and advice for evaluating the business case for provider participation in a CCOP organization. A comparative, case-study approach was used to identify key components of the business case for hospitals attempting to support a CCOP research infrastructure. Semistructured interviews were conducted with providers and administrators. Key themes were identified and used to develop the financial analysis tool. Key components of the business case included CCOP start-up costs, direct revenue from the NCI CCOP grant, direct expenses required to maintain the CCOP research infrastructure, and incidental benefits, most notably downstream revenues from CCOP patients. The authors recognized the value of incidental benefits as an important contributor to the business case for CCOP participation; however, currently, this component is not calculated. The current results indicated that providing a method for documenting the business case for CCOP or other PBRN involvement will contribute to the long-term sustainability and expansion of these programs by improving providers' understanding of the financial implications of participation. Copyright © 2011 American Cancer Society.

  3. Recovering method for high level radioactive material

    International Nuclear Information System (INIS)

    Fukui, Toshiki

    1998-01-01

    Offgas filters such as of nuclear fuel reprocessing facilities and waste control facilities are burnt, and the burnt ash is melted by heating, and then the molten ashes are brought into contact with a molten metal having a low boiling point to transfer the high level radioactive materials in the molten ash to the molten metal. Then, only the molten metal is evaporated and solidified by drying, and residual high level radioactive materials are recovered. According to this method, the high level radioactive materials in the molten ashes are transferred to the molten metal and separated by the difference of the distribution rate of the molten ash and the molten metal. Subsequently, the molten metal to which the high level radioactive materials are transferred is heated to a temperature higher than the boiling point so that only the molten metal is evaporated and dried to be removed, and residual high level radioactive materials are recovered easily. On the other hand, the molten ash from which the high level radioactive material is removed can be discarded as ordinary industrial wastes as they are. (T.M.)

  4. A mixed methods study of patient-provider communication about opioid analgesics.

    Science.gov (United States)

    Hughes, Helen Kinsman; Korthuis, Philip Todd; Saha, Somnath; Eggly, Susan; Sharp, Victoria; Cohn, Jonathan; Moore, Richard; Beach, Mary Catherine

    2015-04-01

    To describe patient-provider communication about opioid pain medicine and explore how these discussions affect provider attitudes toward patients. We audio-recorded 45 HIV providers and 423 patients in routine outpatient encounters at four sites across the country. Providers completed post-visit questionnaires assessing their attitudes toward patients. We identified discussions about opioid pain management and analyzed them qualitatively. We used logistic regression to assess the association between opioid discussion and providers' attitudes toward patients. 48 encounters (11% of the total sample) contained substantive discussion of opioid-related pain management. Most conversations were initiated by patients (n=28, 58%) and ended by the providers (n=36, 75%). Twelve encounters (25%) contained dialog suggesting a difference of opinion or conflict. Providers more often agreed than disagreed to give the prescription (50% vs. 23%), sometimes reluctantly; in 27% (n=13) of encounters, no decision was made. Fewer than half of providers (n=20, 42%) acknowledged the patient's experience of pain. Providers had a lower odds of positive regard for the patient (adjusted OR=0.51, 95% CI: 0.27-0.95) when opioids were discussed. Pain management discussions are common in routine outpatient HIV encounters and providers may regard patients less favorably if opioids are discussed during visits. The sometimes-adversarial nature of these discussions may negatively affect provider attitudes toward patients. Empathy and pain acknowledgment are tools that clinicians can use to facilitate productive discussions of pain management. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  5. Devices and methods of operation thereof for providing stable flow for centrifugal compressors

    Science.gov (United States)

    Skoch, Gary J. (Inventor); Stevens, Mark A. (Inventor); Jett, Thomas A. (Inventor)

    2008-01-01

    Centrifugal compressor flow stabilizing devices and methods of operation thereof are disclosed that act upon the flow field discharging from the impeller of a centrifugal compressor and modify the flow field ahead of the diffuser vanes such that flow conditions contributing to rotating stall and surge are reduced or even eliminated. In some embodiments, shaped rods and methods of operation thereof are disclosed, whereas in other embodiments reverse-tangent air injection devices and methods are disclosed.

  6. ELABORATION OF HIGH-VOLTAGE PULSE INSTALLATIONS AND PROVIDING THEIR OPERATION PROTECTIVE MEASURES

    Directory of Open Access Journals (Sweden)

    А. М. Hashimov

    2016-01-01

    Full Text Available The article presents design engineering methods for the high-voltage pulse installations of technological purpose for disinfection of drinking water, sewage, and edible liquids by high field micro- and nanosecond pulsing exposure. Designing potentialities are considered of the principal elements of the high-voltage part and the discharge circuit of the installations towards assuring the best efficient on-load utilization of the source energy and safe operation of the high-voltage equipment. The study shows that for disinfection of drinking water and sewage it is expedient to apply microsecond pulse actions causing the electrohydraulic effect in aqueous media with associated complex of physical processes (ultraviolet emission, generation of ozone and atomic oxygen, mechanical compression waves, etc. having detrimental effect on life activity of the microorganisms. In case of disinfecting edible liquids it is recommended to use the nanosecond pulses capable of straight permeating the biological cell nucleus, inactivating it. Meanwhile, the nutritive and biological values of the foodstuffs are saved and their organoleptic properties are improved. It is noted that in elaboration process of high-frequency pulse installations special consideration should be given to issues of the operating personnel safety discipline and securing conditions for the entire installation uninterrupted performance. With this objective in view the necessary requirements should be fulfilled on shielding the high- and low-voltage installation parts against high-frequency electromagnetic emissions registered by special differential sensors. Simultaneously, the abatement measures should be applied on the high-voltage equipment operational noise level. The authors offer a technique for noise abatement to admissible levels (lower than 80 dB A by means of coating the inside surface with shielded enclosure of densely-packed abutting sheets of porous electro-acoustic insulating

  7. Provider perceptions of barriers and facilitators of HPV vaccination in a high-risk community.

    Science.gov (United States)

    Javanbakht, Marjan; Stahlman, Shauna; Walker, Susan; Gottlieb, Sami; Markowitz, Lauri; Liddon, Nicole; Plant, Aaron; Guerry, Sarah

    2012-06-22

    Maximizing HPV vaccine uptake among those at highest risk for cervical cancer is critical. We explored healthcare provider perspectives on factors influencing HPV vaccination among adolescent girls in a community with high cervical cancer rates. From March to May 2009, we conducted in-depth interviews with 21 medical staff providing care to adolescent girls at two clinics in Los Angeles, CA, serving a predominantly Hispanic population with high cervical cancer rates. Interviews were recorded and transcribed data were reviewed for coding and thematic content related to potential barriers and facilitators of HPV vaccination. Providers and medical staff overwhelmingly focused on parental beliefs as barriers to HPV vaccination. Perceived parental misconceptions acting as barriers included the belief that adolescents do not need vaccinations and that no-cost vaccine programs like Vaccines for Children are only available for younger children. Perceived parental concerns that the vaccine will promote sexual activity were prevalent, which prompted providers to frame HPV vaccine as a "routine" vaccine. However, the medical staff felt mothers with a friend or relative supportive of HPV vaccination were more likely to request the vaccine. The staff also noted that for Hispanic parents the "preferred" source of information is peers; if the "right people" in the community were supportive of HPV vaccine, parents were more willing to vaccinate. Other barriers included lack of immunization records among immigrant parents and a difficult-to-reach, mobile clientele. Providers noted a number of barriers to HPV vaccination, including some perceived parental misconceptions that could be addressed with education about the need for adolescent vaccines and available free vaccine programs. Because community support appears particularly important to Hispanic parents, the use of promotoras - peer liaisons between health organizations and the community - may increase HPV vaccine uptake in

  8. Advanced Analysis Methods in High Energy Physics

    Energy Technology Data Exchange (ETDEWEB)

    Pushpalatha C. Bhat

    2001-10-03

    During the coming decade, high energy physics experiments at the Fermilab Tevatron and around the globe will use very sophisticated equipment to record unprecedented amounts of data in the hope of making major discoveries that may unravel some of Nature's deepest mysteries. The discovery of the Higgs boson and signals of new physics may be around the corner. The use of advanced analysis techniques will be crucial in achieving these goals. The author discusses some of the novel methods of analysis that could prove to be particularly valuable for finding evidence of any new physics, for improving precision measurements and for exploring parameter spaces of theoretical models.

  9. Unsafe abortion in urban and rural Tanzania: method, provider and consequences

    DEFF Research Database (Denmark)

    Rasch, Vibeke; Kipingili, Rose

    2009-01-01

    OBJECTIVE: To describe unsafe abortion methods and associated health consequences in Tanzania, where induced abortion is restricted by law but common and known to account for a disproportionate share of hospital admissions. METHOD: Cross-sectional study of women admitted with alleged miscarriage...

  10. Examining the Highs and Lows of the Collaborative Relationship Between Technical Assistance Providers and Prevention Implementers.

    Science.gov (United States)

    Chilenski, Sarah M; Welsh, Janet; Olson, Jonathan; Hoffman, Lesa; Perkins, Daniel F; Feinberg, Mark E

    2018-02-01

    The PROSPER model uses a three-tiered community partnership, university researcher, and Cooperative Extension-based technical assistance system to support the delivery of evidence-based interventions in communities. This study examines the trajectory and predictors of the collaborative relationship between technical assistance providers and community teams across the three phases of organization, implementation, and sustainability. Members of 14 PROmoting School-university-community Partnerships to Enhance Resilience (PROSPER) community teams and directors of local agencies rated communities' levels of readiness and adolescent substance use norms. Technical assistance providers rated their collaborative relationship with their teams at 14 occasions across 4.5 years. Results from mixed models show that levels of collaboration were stable until the sustainability phase, when they increased significantly. Team differences in change were significant during the implementation phase. Community readiness predicted levels of the collaborative relationship over time: high community readiness was associated with a high level of collaboration during organization, but a decline in collaboration during implementation. These results provide a more nuanced understanding of the relationship between technical assistance provision and community prevention teams and lead to recommendations to improve dissemination models to achieve a greater public health impact.

  11. Development of quality indicators for low-risk labor care provided by midwives using a RAND-modified Delphi method.

    Science.gov (United States)

    Ueda, Kayo; Ohtera, Shosuke; Kaso, Misato; Nakayama, Takeo

    2017-09-22

    In childbirth, most deliveries are low-risk, defined as spontaneous labor at full term without special high-risk facts or complications, especially in high-resource countries where maternal and perinatal mortality rates are very low. Indeed, the majority of mothers and infants have no serious conditions during labor. However, the quality of care provided is not assured, and performance may vary by birthing facility and provider. The overuse of technology in childbirth in some parts of the world is almost certainly based on assumptions like, "something can go wrong at any minute." There is a need to assess the quality of care provided for mothers and infants in low-risk labor. We aimed to develop specific quality indicators for low-risk labor care provided primarily by midwives in Japan. We used a RAND-modified Delphi method, which integrates evidence review with expert consensus development. The procedure comprises five steps: (1) literature review, including clinical practice guidelines, to extract and develop quality indicator candidates; (2) formation of a multidisciplinary panel; (3) independent panel ratings (Round 1); (4) panel meeting and independent panel ratings (Round 2); and (5) independent panel ratings (Round 3). The three independent panel ratings (Rounds 1-3) were held between July and December 2012. The assembled multidisciplinary panel comprised eight clinicians (two pediatricians, three obstetricians, and three midwives) and three mothers who were nonclinicians. Evidentiary review extracted 166 key recommendations from 32 clinical practice guidelines, and 31 existing quality indicators were added. After excluding duplicate recommendations and quality indicators, the panel discussed 25 candidate indicators. Of these, 18 were adopted, one was modified, six were not adopted, and four were added during the meeting, respectively. We established 23 quality indicators for low-risk labor care provided by midwives in labor units in Japan.

  12. International Conference on Spectral and High-Order Methods

    CERN Document Server

    Dumont, Ney; Hesthaven, Jan

    2017-01-01

    This book features a selection of high-quality papers chosen from the best presentations at the International Conference on Spectral and High-Order Methods (2016), offering an overview of the depth and breadth of the activities within this important research area. The carefully reviewed papers provide a snapshot of the state of the art, while the extensive bibliography helps initiate new research directions.

  13. runjags: An R Package Providing Interface Utilities, Model Templates, Parallel Computing Methods and Additional Distributions for MCMC Models in JAGS

    Directory of Open Access Journals (Sweden)

    Matthew J. Denwood

    2016-07-01

    Full Text Available The runjags package provides a set of interface functions to facilitate running Markov chain Monte Carlo models in JAGS from within R. Automated calculation of appropriate convergence and sample length diagnostics, user-friendly access to commonly used graphical outputs and summary statistics, and parallelized methods of running JAGS are provided. Template model specifications can be generated using a standard lme4-style formula interface to assist users less familiar with the BUGS syntax. Automated simulation study functions are implemented to facilitate model performance assessment, as well as drop-k type cross-validation studies, using high performance computing clusters such as those provided by parallel. A module extension for JAGS is also included within runjags, providing the Pareto family of distributions and a series of minimally-informative priors including the DuMouchel and half-Cauchy priors. This paper outlines the primary functions of this package, and gives an illustration of a simulation study to assess the sensitivity of two equivalent model formulations to different prior distributions.

  14. Do high-volume hospitals and surgeons provide better care in urologic oncology?

    Science.gov (United States)

    Eastham, James A

    2009-01-01

    Studies focusing primarily on hospital or surgical volume as a surrogate for surgical experience have found substantial variations in outcomes. Increasing surgical experience has been shown to improve outcomes after multiple procedures, including esophagectomy, pancreatectomy, and primary surgery for colon and breast cancer. More recently, evidence has been presented that surgical volume/experience affects quality of life and cancer control outcomes after urologic oncology procedures. Although most of these data pertain to radical prostatectomy, similar conclusions have been reached for radical cystectomy, retroperitoneal lymph node dissection, and management of renal cell carcinoma. This review highlights data indicating that high-volume surgeons and hospitals provide better care for radical prostatectomy.

  15. Compositions and methods for providing plants with tolerance to abiotic stress conditions

    KAUST Repository

    Hirt, Heribert; De Zelicourt, Axel; Saad, Maged

    2017-01-01

    It has been discovered that the desert endophytic bacterium SA187 SA187 can provide resistance or tolerance to abiotic stress conditions to seeds or plants. Compositions containing SA187 can be used to enhance plant development and yield under

  16. Methods for very high temperature design

    International Nuclear Information System (INIS)

    Blass, J.J.; Corum, J.M.; Chang, S.J.

    1989-01-01

    Design rules and procedures for high-temperature, gas-cooled reactor components are being formulated as an ASME Boiler and Pressure Vessel Code Case. A draft of the Case, patterned after Code Case N-47, and limited to Inconel 617 and temperatures of 982/degree/C (1800/degree/F) or less, will be completed in 1989 for consideration by relevant Code committees. The purpose of this paper is to provide a synopsis of the significant differences between the draft Case and N-47, and to provide more complete accounts of the development of allowable stress and stress rupture values and the development of isochronous stress vs strain curves, in both of which Oak Ridge National Laboratory (ORNL) played a principal role. The isochronous curves, which represent average behavior for many heats of Inconel 617, were based in part on a unified constitutive model developed at ORNL. Details are also provided of this model of inelastic deformation behavior, which does not distinguish between rate-dependent plasticity and time-dependent creep, along with comparisons between calculated and observed results of tests conducted on a typical heat of Inconel 617 by the General Electric Company for the Department of Energy. 4 refs., 15 figs., 1 tab

  17. Highly sensitive high resolution Raman spectroscopy using resonant ionization methods

    International Nuclear Information System (INIS)

    Owyoung, A.; Esherick, P.

    1984-05-01

    In recent years, the introduction of stimulated Raman methods has offered orders of magnitude improvement in spectral resolving power for gas phase Raman studies. Nevertheless, the inherent weakness of the Raman process suggests the need for significantly more sensitive techniques in Raman spectroscopy. In this we describe a new approach to this problem. Our new technique, which we call ionization-detected stimulated Raman spectroscopy (IDSRS), combines high-resolution SRS with highly-sensitive resonant laser ionization to achieve an increase in sensitivity of over three orders of magnitude. The excitation/detection process involves three sequential steps: (1) population of a vibrationally excited state via stimulated Raman pumping; (2) selective ionization of the vibrationally excited molecule with a tunable uv source; and (3) collection of the ionized species at biased electrodes where they are detected as current in an external circuit

  18. Method of providing extended life expectancy for components of boiling water reactors

    International Nuclear Information System (INIS)

    Niedrach, L.W.

    1992-01-01

    This patent describes a containment for a boiling water nuclear reactor, a stainless steel containment, the containment having a deposit of a metal of the platinum group of metals on the surfaces thereof exposed to high temperature, high pressure water of the boiling water nuclear reactor

  19. Method of high purity silane preparation

    Science.gov (United States)

    Tsuo, Y. Simon; Belov, Eugene P.; Gerlivanov, Vadim G.; Zadde, Vitali V.; Kleschevnikova, Solomonida I.; Korneev, Nikolai N.; Lebedev, Eugene N.; Pinov, Akhsarbek B.; Ryabenko, Eugene A.; Strebkov, Dmitry S.; Chernyshev, Eugene A.

    2000-01-01

    A process for the preparation of high purity silane, suitable for forming thin layer silicon structures in various semiconductor devices and high purity poly- and single crystal silicon for a variety of applications, is provided. Synthesis of high-purity silane starts with a temperature assisted reaction of metallurgical silicon with alcohol in the presence of a catalyst. Alcoxysilanes formed in the silicon-alcohol reaction are separated from other products and purified. Simultaneous reduction and oxidation of alcoxysilanes produces gaseous silane and liquid secondary products, including, active part of a catalyst, tetra-alcoxysilanes, and impurity compounds having silicon-hydrogen bonds. Silane is purified by an impurity adsorption technique. Unreacted alcohol is extracted and returned to the reaction with silicon. Concentrated mixture of alcoxysilanes undergoes simultaneous oxidation and reduction in the presence of a catalyst at the temperature -20.degree. C. to +40.degree. C. during 1 to 50 hours. Tetra-alcoxysilane extracted from liquid products of simultaneous oxidation and reduction reaction is directed to a complete hydrolysis. Complete hydrolysis of tetra-alcoxysilane results in formation of industrial silica sol and alcohol. Alcohol is dehydrated by tetra-alcoxysilane and returned to the reaction with silicon.

  20. Defining the essential anatomical coverage provided by military body armour against high energy projectiles.

    Science.gov (United States)

    Breeze, John; Lewis, E A; Fryer, R; Hepper, A E; Mahoney, Peter F; Clasper, Jon C

    2016-08-01

    Body armour is a type of equipment worn by military personnel that aims to prevent or reduce the damage caused by ballistic projectiles to structures within the thorax and abdomen. Such injuries remain the leading cause of potentially survivable deaths on the modern battlefield. Recent developments in computer modelling in conjunction with a programme to procure the next generation of UK military body armour has provided the impetus to re-evaluate the optimal anatomical coverage provided by military body armour against high energy projectiles. A systematic review of the literature was undertaken to identify those anatomical structures within the thorax and abdomen that if damaged were highly likely to result in death or significant long-term morbidity. These structures were superimposed upon two designs of ceramic plate used within representative body armour systems using a computerised representation of human anatomy. Those structures requiring essential medical coverage by a plate were demonstrated to be the heart, great vessels, liver and spleen. For the 50th centile male anthropometric model used in this study, the front and rear plates from the Enhanced Combat Body Armour system only provide limited coverage, but do fulfil their original requirement. The plates from the current Mark 4a OSPREY system cover all of the structures identified in this study as requiring coverage except for the abdominal sections of the aorta and inferior vena cava. Further work on sizing of plates is recommended due to its potential to optimise essential medical coverage. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  1. Providing high-quality care in primary care settings: how to make trade-offs.

    Science.gov (United States)

    Beaulieu, Marie-Dominique; Geneau, Robert; Del Grande, Claudio; Denis, Jean-Louis; Hudon, Eveline; Haggerty, Jeannie L; Bonin, Lucie; Duplain, Réjean; Goudreau, Johanne; Hogg, William

    2014-05-01

    To gain a deeper understanding of how primary care (PC) practices belonging to different models manage resources to provide high-quality care. Multiple-case study embedded in a cross-sectional study of a random sample of 37 practices. Three regions of Quebec. Health care professionals and staff of 5 PC practices. Five cases showing above-average results on quality-of-care indicators were purposefully selected to contrast on region, practice size, and PC model. Data were collected using an organizational questionnaire; the Team Climate Inventory, which was completed by health care professionals and staff; and 33 individual interviews. Detailed case histories were written and thematic analysis was performed. The core common feature of these practices was their ongoing effort to make trade-offs to deliver services that met their vision of high-quality care. These compromises involved the same 3 areas, but to varying degrees depending on clinic characteristics: developing a shared vision of high-quality care; aligning resource use with that vision; and balancing professional aspirations and population needs. The leadership of the physician lead was crucial. The external environment was perceived as a source of pressure and dilemmas rather than as a source of support in these matters. Irrespective of their models, PC practices' pursuit of high-quality care is based on a vision in which accessibility is a key component, balanced by appropriate management of available resources and of external environment expectations. Current PC reforms often create tensions rather than support PC practices in their pursuit of high-quality care. Copyright© the College of Family Physicians of Canada.

  2. NMR system and method having a permanent magnet providing a rotating magnetic field

    Science.gov (United States)

    Schlueter, Ross D [Berkeley, CA; Budinger, Thomas F [Berkeley, CA

    2009-05-19

    Disclosed herein are systems and methods for generating a rotating magnetic field. The rotating magnetic field can be used to obtain rotating-field NMR spectra, such as magic angle spinning spectra, without having to physically rotate the sample. This result allows magic angle spinning NMR to be conducted on biological samples such as live animals, including humans.

  3. The duty to provide information in the case of neuroradiological examination methods

    International Nuclear Information System (INIS)

    Deutsch, E.

    1987-01-01

    The author gives a survey on the judicial decisions concerning the obligation to give information in the case of neuroradiological examination methods. The scope and content of the medical explanation depends inter alia on the urgency and the necessity of the medical diagnosis and on the understanding of the patient. (WG) [de

  4. Vehicle Tracking System, Vehicle Infrastructure Provided with Vehicle Tracking System and Method for Tracking

    NARCIS (Netherlands)

    Papp, Z.; Doodeman, G.J.N.; Nelisse, M.W.; Sijs, J.; Theeuwes, J.A.C.; Driessen, B.J.F.

    2010-01-01

    A vehicle tracking system is described comprising - a plurality of sensor nodes (10) that each provide a message (D) indicative for an occupancy status of a detection area of an vehicle infrastructure monitored by said sensor node, said sensor nodes (10) being arranged in the vehicle infrastructure

  5. Compositions and methods for providing plants with tolerance to abiotic stress conditions

    KAUST Repository

    Hirt, Heribert

    2017-07-27

    It has been discovered that the desert endophytic bacterium SA187 SA187 can provide resistance or tolerance to abiotic stress conditions to seeds or plants. Compositions containing SA187 can be used to enhance plant development and yield under environmental stress conditions.

  6. Sanitation methods using high energy electron beams

    International Nuclear Information System (INIS)

    Levaillant, C.; Gallien, C.L.

    1979-01-01

    Short recycling of waste water and the use of liquid or dehydrated sludge as natural manure for agriculture or animal supplement feed is of great economical and ecological interest. It implies strong biological and chemical disinfection. Ionizing radiations produced by radioactive elements or linear accelerators can be used as a complement of conventional methods in the treatment of liquid and solid waste. An experiment conducted with high-energy electron-beam linear accelerators is presented. Degradation of undesirable metabolites in water occurs for a dose of 50 kRad. Undesirable seeds present in sludge are destroyed with a 200 kRad dose. A 300 kRad dose is sufficient for parasitic and bacterial disinfection (DL 90). Destruction of polio virus (DL 90) is obtained for 400 kRad. Higher doses (1000 to 2000 kRad) produce mineralization of toxic organic mercury, reduce some chemical toxic pollutants present in sludge and improve flocculation. (author)

  7. A Novel Resource Management Method of Providing Operating System as a Service for Mobile Transparent Computing

    Directory of Open Access Journals (Sweden)

    Yonghua Xiong

    2014-01-01

    Full Text Available This paper presents a framework for mobile transparent computing. It extends the PC transparent computing to mobile terminals. Since resources contain different kinds of operating systems and user data that are stored in a remote server, how to manage the network resources is essential. In this paper, we apply the technologies of quick emulator (QEMU virtualization and mobile agent for mobile transparent computing (MTC to devise a method of managing shared resources and services management (SRSM. It has three layers: a user layer, a manage layer, and a resource layer. A mobile virtual terminal in the user layer and virtual resource management in the manage layer cooperate to maintain the SRSM function accurately according to the user’s requirements. An example of SRSM is used to validate this method. Experiment results show that the strategy is effective and stable.

  8. A novel resource management method of providing operating system as a service for mobile transparent computing.

    Science.gov (United States)

    Xiong, Yonghua; Huang, Suzhen; Wu, Min; Zhang, Yaoxue; She, Jinhua

    2014-01-01

    This paper presents a framework for mobile transparent computing. It extends the PC transparent computing to mobile terminals. Since resources contain different kinds of operating systems and user data that are stored in a remote server, how to manage the network resources is essential. In this paper, we apply the technologies of quick emulator (QEMU) virtualization and mobile agent for mobile transparent computing (MTC) to devise a method of managing shared resources and services management (SRSM). It has three layers: a user layer, a manage layer, and a resource layer. A mobile virtual terminal in the user layer and virtual resource management in the manage layer cooperate to maintain the SRSM function accurately according to the user's requirements. An example of SRSM is used to validate this method. Experiment results show that the strategy is effective and stable.

  9. METHODS OF PROVIDING NOISE IMMUNITY IN AUTOMOBILE ANTI-THEFT SYSTEM CONTROL

    Directory of Open Access Journals (Sweden)

    Frolov, V.

    2013-06-01

    Full Text Available In modern ani-theft systems they use frequency and phase modulation. Since the width of the signal is limited, it is possible to intercept the signal and then switch off the alarm at the right time.To ensure the noise immunity and secrecy manufacturers use more sophisticated codes using the methods of cryptography. Significant increase in noise immunity in modern ani-theft systems is possible using broadband signals.

  10. System and Method for Providing Web-Based Remote Application Service

    OpenAIRE

    Shuen-Tai Wang; Yu-Ching Lin; Hsi-Ya Chang

    2017-01-01

    With the development of virtualization technologies, a new type of service named cloud computing service is produced. Cloud users usually encounter the problem of how to use the virtualized platform easily over the web without requiring the plug-in or installation of special software. The object of this paper is to develop a system and a method enabling process interfacing within an automation scenario for accessing remote application by using the web browser. To meet this challenge, we have ...

  11. Cloud Service Provider Methods for Managing Insider Threats: Analysis Phase 2, Expanded Analysis and Recommendations

    Science.gov (United States)

    2014-01-01

    and software as a service ( SaaS )) for staff’s abnormal behavior that may indicate an insider incident. As mentioned above, combining SIEM data...Mellon Software Engineering Institute, contacted commercial and government cloud service providers (CSPs) to better understand the administrative and...availability services . We have observed a number of scenarios in which a customer leaves a CSP’s IaaS, PaaS, or SaaS , but its data remains online for some

  12. Sand quarry wetlands provide high-quality habitat for native amphibians

    Directory of Open Access Journals (Sweden)

    M. Sievers

    2017-05-01

    Full Text Available Anthropogenic disturbances to habitats influence the fitness of individual animals, the abundance of their populations, and the composition of their communities. Wetlands in particular are frequently degraded and destroyed, impacting the animals that inhabit these important ecosystems. The creation of wetlands during and following sand extraction processes is inevitable, and thus, sand quarries have the potential to support aquatic animals. To determine how amphibians utilise these wetlands, I conducted nocturnal call surveys at wetlands within the Kables Sands quarry, New South Wales, Australia, and within surrounding reference wetlands, and quantified levels of developmental instability (DI as a proxy for fitness. Whilst quarry and reference wetlands were largely similar in terms of environmental characteristics, quarry wetlands consistently harboured more amphibian species and individuals. Using unsigned asymmetry as a measure of DI, frogs from the quarry sites exhibited significantly lower levels of DI compared to reference wetlands, indicating that quarry wetlands may be comparatively higher quality. Levels of DI within quarry wetlands also compared favourably to data from healthy frog populations extracted from the literature. Further enhancing the suitability of quarry wetlands would require minimal effort, with potentially significant increases in local and regional biodiversity. Documenting species presence and quantifying individual fitness by measuring limb lengths is an economically and logistically feasible method to assess the health of quarry wetlands. Overall, the methods outlined here provide a powerful, yet simple, tool to assess the overall health and suitability of quarry wetlands that could be easily adopted at quarries throughout the world.

  13. Sports Cardiology: Core Curriculum for Providing Cardiovascular Care to Competitive Athletes and Highly Active People.

    Science.gov (United States)

    Baggish, Aaron L; Battle, Robert W; Beckerman, James G; Bove, Alfred A; Lampert, Rachel J; Levine, Benjamin D; Link, Mark S; Martinez, Matthew W; Molossi, Silvana M; Salerno, Jack; Wasfy, Meagan M; Weiner, Rory B; Emery, Michael S

    2017-10-10

    The last few decades have seen substantial growth in the populations of competitive athletes and highly active people (CAHAP). Although vigorous physical exercise is an effective way to reduce the risk of cardiovascular (CV) disease, CAHAP remain susceptible to inherited and acquired CV disease, and may be most at risk for adverse CV outcomes during intense physical activity. Traditionally, multidisciplinary teams comprising athletic trainers, physical therapists, primary care sports medicine physicians, and orthopedic surgeons have provided clinical care for CAHAP. However, there is increasing recognition that a care team including qualified CV specialists optimizes care delivery for CAHAP. In recognition of the increasing demand for CV specialists competent in the care of CAHAP, the American College of Cardiology has recently established a Sports and Exercise Council. An important primary objective of this council is to define the essential skills necessary to practice effective sports cardiology. Copyright © 2017. Published by Elsevier Inc.

  14. Genetic data provide evidence for wind-mediated transmission of highly pathogenic avian influenza.

    Science.gov (United States)

    Ypma, Rolf J F; Jonges, Marcel; Bataille, Arnaud; Stegeman, Arjan; Koch, Guus; van Boven, Michiel; Koopmans, Marion; van Ballegooijen, W Marijn; Wallinga, Jacco

    2013-03-01

    Outbreaks of highly pathogenic avian influenza in poultry can cause severe economic damage and represent a public health threat. Development of efficient containment measures requires an understanding of how these influenza viruses are transmitted between farms. However, the actual mechanisms of interfarm transmission are largely unknown. Dispersal of infectious material by wind has been suggested, but never demonstrated, as a possible cause of transmission between farms. Here we provide statistical evidence that the direction of spread of avian influenza A(H7N7) is correlated with the direction of wind at date of infection. Using detailed genetic and epidemiological data, we found the direction of spread by reconstructing the transmission tree for a large outbreak in the Netherlands in 2003. We conservatively estimate the contribution of a possible wind-mediated mechanism to the total amount of spread during this outbreak to be around 18%.

  15. CESAME: Providing High Quality Professional Development in Science and Mathematics for K-12 Teachers

    Science.gov (United States)

    Hickman, Paul

    2002-04-01

    It is appropriate that after almost half a century of Science and Mathematics education reform we take a look back and a peek forward to understand the present state of this wonderfully complex system. Each of the components of this system including teaching, professional development, assessment, content and the district K-12 curriculum all need to work together if we hope to provide quality science, mathematics and technology education for ALL students. How do the state and national standards drive the system? How do state policies on student testing and teacher licensure come into play? How do we improve the preparation, retention and job satisfaction of our K-12 teachers? What initiatives have made or are making a difference? What else needs to be done? What can the physics community do to support local efforts? This job is too big for any single organization or individual but we each can contribute to the effort. Our Center at Northeastern University, with support from the National Science Foundation, has a sharply defined focus: to get high quality, research-based instructional materials into the hands of K-12 classroom teachers and provide the support they need to use the materials effectively in their classrooms.

  16. Evaluation of Two Statistical Methods Provides Insights into the Complex Patterns of Alternative Polyadenylation Site Switching

    Science.gov (United States)

    Li, Jie; Li, Rui; You, Leiming; Xu, Anlong; Fu, Yonggui; Huang, Shengfeng

    2015-01-01

    Switching between different alternative polyadenylation (APA) sites plays an important role in the fine tuning of gene expression. New technologies for the execution of 3’-end enriched RNA-seq allow genome-wide detection of the genes that exhibit significant APA site switching between different samples. Here, we show that the independence test gives better results than the linear trend test in detecting APA site-switching events. Further examination suggests that the discrepancy between these two statistical methods arises from complex APA site-switching events that cannot be represented by a simple change of average 3’-UTR length. In theory, the linear trend test is only effective in detecting these simple changes. We classify the switching events into four switching patterns: two simple patterns (3’-UTR shortening and lengthening) and two complex patterns. By comparing the results of the two statistical methods, we show that complex patterns account for 1/4 of all observed switching events that happen between normal and cancerous human breast cell lines. Because simple and complex switching patterns may convey different biological meanings, they merit separate study. We therefore propose to combine both the independence test and the linear trend test in practice. First, the independence test should be used to detect APA site switching; second, the linear trend test should be invoked to identify simple switching events; and third, those complex switching events that pass independence testing but fail linear trend testing can be identified. PMID:25875641

  17. Physicians' opinions about partner notification methods: case reporting, patient referral, and provider referral.

    Science.gov (United States)

    Hogben, M; St Lawrence, J S; Montaño, D E; Kasprzyk, D; Leichliter, J S; Phillips, W R

    2004-02-01

    The United States has relied upon partner notification strategies to help break the chain of infection and re-infection for sexually transmitted diseases (STD). Physicians are a vital link in the system of STD control, but little is known of physician opinions about partner notification strategies. We collected opinions about partner notification from a national probability sample of physicians in specialties diagnosing STDs. Physicians responded to 17 questions about three relevant forms of STD partner notification: patient based referral, provider based referral, and case reporting. Exploratory factor analyses showed that responses for each form of partner notification could be grouped into four categories: perceived practice norms, infection control, patient relationships, and time/money. Multivariate analyses of the factors showed that physicians endorsed patient based referral most favourably and provider based referral least favourably. Physicians' opinions about partner notification strategies appear to reflect objective reality in some areas, but not in others. Strategies that improve the fit between physicians' opinions and effective notification are needed: some are discussed here.

  18. Neural interface methods and apparatus to provide artificial sensory capabilities to a subject

    Energy Technology Data Exchange (ETDEWEB)

    Buerger, Stephen P.; Olsson, III, Roy H.; Wojciechowski, Kenneth E.; Novick, David K.; Kholwadwala, Deepesh K.

    2017-01-24

    Embodiments of neural interfaces according to the present invention comprise sensor modules for sensing environmental attributes beyond the natural sensory capability of a subject, and communicating the attributes wirelessly to an external (ex-vivo) portable module attached to the subject. The ex-vivo module encodes and communicates the attributes via a transcutaneous inductively coupled link to an internal (in-vivo) module implanted within the subject. The in-vivo module converts the attribute information into electrical neural stimuli that are delivered to a peripheral nerve bundle within the subject, via an implanted electrode. Methods and apparatus according to the invention incorporate implantable batteries to power the in-vivo module allowing for transcutaneous bidirectional communication of low voltage (e.g. on the order of 5 volts) encoded signals as stimuli commands and neural responses, in a robust, low-error rate, communication channel with minimal effects to the subjects' skin.

  19. A Statistical Method for Aggregated Wind Power Plants to Provide Secondary Frequency Control

    DEFF Research Database (Denmark)

    Hu, Junjie; Ziras, Charalampos; Bindner, Henrik W.

    2017-01-01

    curtailment for aggregated wind power plants providing secondary frequency control (SFC) to the power system. By using historical SFC signals and wind speed data, we calculate metrics for the reserve provision error as a function of the scheduled wind power. We show that wind curtailment can be significantly......The increasing penetration of wind power brings significant challenges to power system operators due to the wind’s inherent uncertainty and variability. Traditionally, power plants and more recently demand response have been used to balance the power system. However, the use of wind power...... as a balancing-power source has also been investigated, especially for wind power dominated power systems such as Denmark. The main drawback is that wind power must be curtailed by setting a lower operating point, in order to offer upward regulation. We propose a statistical approach to reduce wind power...

  20. Pediatric primary care providers' perspectives regarding hospital discharge communication: a mixed methods analysis.

    Science.gov (United States)

    Leyenaar, JoAnna K; Bergert, Lora; Mallory, Leah A; Engel, Richard; Rassbach, Caroline; Shen, Mark; Woehrlen, Tess; Cooperberg, David; Coghlin, Daniel

    2015-01-01

    Effective communication between inpatient and outpatient providers may mitigate risks of adverse events associated with hospital discharge. However, there is an absence of pediatric literature defining effective discharge communication strategies at both freestanding children's hospitals and general hospitals. The objectives of this study were to assess associations between pediatric primary care providers' (PCPs) reported receipt of discharge communication and referral hospital type, and to describe PCPs' perspectives regarding effective discharge communication and areas for improvement. We administered a questionnaire to PCPs referring to 16 pediatric hospital medicine programs nationally. Multivariable models were developed to assess associations between referral hospital type and receipt and completeness of discharge communication. Open-ended questions asked respondents to describe effective strategies and areas requiring improvement regarding discharge communication. Conventional qualitative content analysis was performed to identify emergent themes. Responses were received from 201 PCPs, for a response rate of 63%. Although there were no differences between referral hospital type and PCP-reported receipt of discharge communication (relative risk 1.61, 95% confidence interval 0.97-2.67), PCPs referring to general hospitals more frequently reported completeness of discharge communication relative to those referring to freestanding children's hospitals (relative risk 1.78, 95% confidence interval 1.26-2.51). Analysis of free text responses yielded 4 major themes: 1) structured discharge communication, 2) direct personal communication, 3) reliability and timeliness of communication, and 4) communication for effective postdischarge care. This study highlights potential differences in the experiences of PCPs referring to general hospitals and freestanding children's hospitals, and presents valuable contextual data for future quality improvement initiatives

  1. Processing method for high resolution monochromator

    International Nuclear Information System (INIS)

    Kiriyama, Koji; Mitsui, Takaya

    2006-12-01

    A processing method for high resolution monochromator (HRM) has been developed at Japanese Atomic Energy Agency/Quantum Beam Science Directorate/Synchrotron Radiation Research unit at SPring-8. For manufacturing a HRM, a sophisticated slicing machine and X-ray diffractometer have been installed for shaping a crystal ingot and orienting precisely the surface of a crystal ingot, respectively. The specification of the slicing machine is following; Maximum size of a diamond blade is φ 350mm in diameter, φ 38.1mm in the spindle diameter, and 2mm in thickness. A large crystal such as an ingot with 100mm in diameter, 200mm in length can be cut. Thin crystal samples such as a wafer can be also cut using by another sample holder. Working distance of a main shaft with the direction perpendicular to working table in the machine is 350mm at maximum. Smallest resolution of the main shaft with directions of front-and-back and top-and-bottom are 0.001mm read by a digital encoder. 2mm/min can set for cutting samples in the forward direction. For orienting crystal faces relative to the blade direction adjustment, a one-circle goniometer and 2-circle segment are equipped on the working table in the machine. A rotation and a tilt of the stage can be done by manual operation. Digital encoder in a turn stage is furnished and has angle resolution of less than 0.01 degrees. In addition, a hand drill as a supporting device for detailed processing of crystal is prepared. Then, an ideal crystal face can be cut from crystal samples within an accuracy of about 0.01 degrees. By installation of these devices, a high energy resolution monochromator crystal for inelastic x-ray scattering and a beam collimator are got in hand and are expected to be used for nanotechnology studies. (author)

  2. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  3. Analysis of methods of providing anonymity in facial photographs; a randomised controlled study.

    LENUS (Irish Health Repository)

    Clover, A J P

    2010-09-01

    Clinical images are invaluable in medical teaching and research publications. In the past efforts to conceal patient identity, if any, were limited to a black bar concealing the eyes. However, there is no consensus on this among major journals and publishing houses. This research analyses the effectiveness of blacking out the eyes in facial photographs and evaluates alternative techniques. 126 questionnaires were completed. The average numbers of correct responses out of 30 was 24.64 (82.13%) in the control group, 20.59 (68.63%) in the eyes, 20.42 (68.07%) in the eyes and nose group, and 17.53 (58.43%) in the T-shaped group (eyes, nose and mouth). The traditional method of covering the eyes does significantly decrease recognition, however it is only as effective as covering the nose and mouth. The more of the face that is covered the less likely it is that the person is recognised. However, there are people who remain identifiable no matter how much of the face is covered. This work highlights the importance of obtaining consent prior to publication as well as attempting to hide identity.

  4. Early Primary Care Provider Follow-up and Readmission After High-Risk Surgery

    Science.gov (United States)

    Brooke, Benjamin S.; Stone, David H.; Cronenwett, Jack L.; Nolan, Brian; DeMartino, Randall R.; MacKenzie, Todd A.; Goodman, David C.; Goodney, Philip P.

    2014-01-01

    IMPORTANCE Follow-up with a primary care provider (PCP) in addition to the surgical team is routinely recommended to patients discharged after major surgery despite no clear evidence that it improves outcomes. OBJECTIVE To test whether PCP follow-up is associated with lower 30-day readmission rates after open thoracic aortic aneurysm (TAA) repair and ventral hernia repair (VHR), surgical procedures known to have a high and low risk of readmission, respectively. DESIGN, SETTING, AND PARTICIPANTS In a cohort of Medicare beneficiaries discharged to home after open TAA repair (n = 12 679) and VHR (n = 52 807) between 2003 to 2010, we compared 30-day readmission rates between patients seen and not seen by a PCP within 30 days of discharge and across tertiles of regional primary care use. We stratified our analysis by the presence of complications during the surgical (index) admission. MAIN OUTCOMES AND MEASURES Thirty-day readmission rate. RESULTS Overall, 2619 patients (20.6%) undergoing open TAA repair and 4927 patients (9.3%) undergoing VHR were readmitted within 30 days after surgery. Complications occurred in 4649 patients (36.6%) undergoing open TAA repair and 4528 patients (8.6%) undergoing VHR during their surgical admission. Early follow-up with a PCP significantly reduced the risk of readmission among open TAA patients who experienced perioperative complications, from 35.0% (without follow-up) to 20.4% (with follow-up) (P < .001). However, PCP follow-up made no significant difference in patients whose hospital course was uncomplicated (19.4% with follow-up vs 21.9% without follow-up; P = .31). In comparison, early follow-up with a PCP after VHR did not reduce the risk of readmission, regardless of complications. In adjusted regional analyses, undergoing open TAA repair in regions with high compared with low primary care use was associated with an 18% lower likelihood of 30-day readmission (odds ratio, 0.82; 95% CI, 0.71–0.96; P = .02), whereas no significant

  5. Gamma Knife radiosurgery of olfactory groove meningiomas provides a method to preserve subjective olfactory function.

    Science.gov (United States)

    Gande, Abhiram; Kano, Hideyuki; Bowden, Gregory; Mousavi, Seyed H; Niranjan, Ajay; Flickinger, John C; Lunsford, L Dade

    2014-02-01

    Anosmia is a common outcome after resection of olfactory groove meningioma(s) (OGM) and for some patients represents a significant disability. To evaluate long term tumor control rates and preservation of subjective olfaction after Gamma Knife (GK) stereotactic radiosurgery (SRS) of OGM. We performed a retrospective chart review and telephone assessments of 41 patients who underwent GK SRS between 1987 and 2008. Clinical outcomes were stratified by full, partial or no subjective olfaction, whereas tumor control was assessed by changes in volume greater or lesser than 25%. The median clinical and imaging follow-up were 76 and 65 months, respectively. Prior to SRS, 19 (46%) patients had surgical resections and two (5%) had received fractionated radiation therapy. Twenty four patients (59%) reported a normal sense of smell, 12 (29%) reported a reduced sense of smell and five (12%) had complete anosmia. The median tumor volume was 8.5 cm(3) (range 0.6-56.1), the mean radiation dose at the tumor margin was 13 Gy (range 10-20) and the median estimated dose to the olfactory nerve was 5.1 Gy (range 1.1-18.1). At follow-up, 27 patients (66%) reported intact olfaction (three (7%) described return to a normal sense of smell), nine (22%) described partial anosmia, and five (12%) had complete anosmia. No patient reported deterioration in olfaction after SRS. Thirteen patients (32%) showed significant tumor regression, 26 (63%) had no further growth and two (5%) had progressed. The progression free tumor control rates were 97% at 1 year and 95% at 2, 10 and 20 years. Symptomatic adverse radiation effects occurred in three (7%) patients. Stereotactic radiosurgery provided both long term tumor control and preservation of olfaction.

  6. Benchmarking with high-order nodal diffusion methods

    International Nuclear Information System (INIS)

    Tomasevic, D.; Larsen, E.W.

    1993-01-01

    Significant progress in the solution of multidimensional neutron diffusion problems was made in the late 1970s with the introduction of nodal methods. Modern nodal reactor analysis codes provide significant improvements in both accuracy and computing speed over earlier codes based on fine-mesh finite difference methods. In the past, the performance of advanced nodal methods was determined by comparisons with fine-mesh finite difference codes. More recently, the excellent spatial convergence of nodal methods has permitted their use in establishing reference solutions for some important bench-mark problems. The recent development of the self-consistent high-order nodal diffusion method and its subsequent variational formulation has permitted the calculation of reference solutions with one node per assembly mesh size. In this paper, we compare results for four selected benchmark problems to those obtained by high-order response matrix methods and by two well-known state-of-the-art nodal methods (the open-quotes analyticalclose quotes and open-quotes nodal expansionclose quotes methods)

  7. New Potentiometric Wireless Chloride Sensors Provide High Resolution Information on Chemical Transport Processes in Streams

    Directory of Open Access Journals (Sweden)

    Keith Smettem

    2017-07-01

    Full Text Available Quantifying the travel times, pathways, and dispersion of solutes moving through stream environments is critical for understanding the biogeochemical cycling processes that control ecosystem functioning. Validation of stream solute transport and exchange process models requires data obtained from in-stream measurement of chemical concentration changes through time. This can be expensive and time consuming, leading to a need for cheap distributed sensor arrays that respond instantly and record chemical transport at points of interest on timescales of seconds. To meet this need we apply new, low-cost (in the order of a euro per sensor potentiometric chloride sensors used in a distributed array to obtain data with high spatial and temporal resolution. The application here is to monitoring in-stream hydrodynamic transport and dispersive mixing of an injected chemical, in this case NaCl. We present data obtained from the distributed sensor array under baseflow conditions for stream reaches in Luxembourg and Western Australia. The reaches were selected to provide a range of increasingly complex in-channel flow patterns. Mid-channel sensor results are comparable to data obtained from more expensive electrical conductivity meters, but simultaneous acquisition of tracer data at several positions across the channel allows far greater spatial resolution of hydrodynamic mixing processes and identification of chemical ‘dead zones’ in the study reaches.

  8. DJFS: Providing Highly Reliable and High‐Performance File System with Small‐Sized

    Directory of Open Access Journals (Sweden)

    Junghoon Kim

    2017-11-01

    Full Text Available File systems and applications try to implement their own update protocols to guarantee data consistency, which is one of the most crucial aspects of computing systems. However, we found that the storage devices are substantially under‐utilized when preserving data consistency because they generate massive storage write traffic with many disk cache flush operations and force‐unit‐access (FUA commands. In this paper, we present DJFS (Delta‐Journaling File System that provides both a high level of performance and data consistency for different applications. We made three technical contributions to achieve our goal. First, to remove all storage accesses with disk cache flush operations and FUA commands, DJFS uses small‐sized NVRAM for a file system journal. Second, to reduce the access latency and space requirements of NVRAM, DJFS attempts to journal compress the differences in the modified blocks. Finally, to relieve explicit checkpointing overhead, DJFS aggressively reflects the checkpoint transactions to file system area in the unit of the specified region. Our evaluation on TPC‐C SQLite benchmark shows that, using our novel optimization schemes, DJFS outperforms Ext4 by up to 64.2 times with only 128 MB of NVRAM.

  9. Private providers' knowledge, attitudes and misconceptions related to long-acting and permanent contraceptive methods: a case study in Bangladesh.

    Science.gov (United States)

    Ugaz, Jorge; Banke, Kathryn; Rahaim, Stephen; Chowdhury, Wahiduzzaman; Williams, Julie

    2016-11-01

    In Bangladesh, use of long-acting and permanent methods of contraception (LAPMs) remains stagnant. Providers' limited knowledge and biases may be a factor. We assessed private providers' knowledge, misconceptions and general attitudes towards LAPM in two urban areas. The ultimate goal is to shape programs and interventions to overcome these obstacles and improve full method choice in Bangladesh. Trained data collectors interviewed a convenience sample of 235 female doctors (obstetricians-gynecologists and general practitioners) and 150 female nurses from 194 commercial (for-profit) health care facilities in Chittagong City Corporation and Dhaka district. Data were collected on the nature of the practice, training received, knowledge about modern contraceptives and attitudes towards LAPM [including intrauterine device (IUDs), implants, female and male sterilization]. All providers, and especially doctors, lacked adequate knowledge regarding side effects for all LAPMs, particularly female and male sterilization. Providers had misconceptions about the effectiveness and convenience of LAPMs compared to short-acting contraceptive methods. Implants and IUDs were generally perceived more negatively than other methods. The majority of providers believed that husbands favor short-acting methods rather than LAPMs and that women should not use a method that their husbands do not approve of. Our findings document knowledge and attitudinal barriers among private for-profit providers in urban areas affecting their provision of accurate information about LAPM choices. Practitioners should be offered the necessary tools to provide women full access to all modern methods, especially LAPMs, in order to contribute to decreasing unmet need and improving full method choice in Bangladesh. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Articles for high temperature service and methods for their manufacture

    Science.gov (United States)

    Sarrafi-Nour, Reza; Meschter, Peter Joel; Johnson, Curtis Alan; Luthra, Krishan Lal; Rosenzweig, Larry Steven

    2016-06-14

    An article for use in aggressive environments is presented. In one embodiment, the article comprises a substrate and a self-sealing and substantially hermetic sealing layer comprising an alkaline-earth aluminosilicate disposed over the bondcoat. The substrate may be any high-temperature material, including, for instance, silicon-bearing ceramics and ceramic matrix composites. A method for making such articles is also presented. The method comprises providing a substrate; disposing a self-sealing alkaline-earth aluminosilicate layer over the substrate; and heating the sealing layer to a sealing temperature at which at least a portion of the sealing layer will flow.

  11. Team dynamics, clinical work satisfaction, and patient care coordination between primary care providers: A mixed methods study.

    Science.gov (United States)

    Song, Hummy; Ryan, Molly; Tendulkar, Shalini; Fisher, Josephine; Martin, Julia; Peters, Antoinette S; Frolkis, Joseph P; Rosenthal, Meredith B; Chien, Alyna T; Singer, Sara J

    Team-based care is essential for delivering high-quality, comprehensive, and coordinated care. Despite considerable research about the effects of team-based care on patient outcomes, few studies have examined how team dynamics relate to provider outcomes. The aim of this study was to examine relationships among team dynamics, primary care provider (PCP) clinical work satisfaction, and patient care coordination between PCPs in 18 Harvard-affiliated primary care practices participating in Harvard's Academic Innovations Collaborative. First, we administered a cross-sectional survey to all 548 PCPs (267 attending clinicians, 281 resident physicians) working at participating practices; 65% responded. We assessed the relationship of team dynamics with PCPs' clinical work satisfaction and perception of patient care coordination between PCPs, respectively, and the potential mediating effect of patient care coordination on the relationship between team dynamics and work satisfaction. In addition, we embedded a qualitative evaluation within the quantitative evaluation to achieve a convergent mixed methods design to help us better understand our findings and illuminate relationships among key variables. Better team dynamics were positively associated with clinical work satisfaction and quality of patient care coordination between PCPs. Coordination partially mediated the relationship between team dynamics and satisfaction for attending clinicians, suggesting that higher satisfaction depends, in part, on better teamwork, yielding more coordinated patient care. We found no mediating effects for resident physicians. Qualitative results suggest that sources of satisfaction from positive team dynamics for PCPs may be most relevant to attending clinicians. Improving primary care team dynamics could improve clinical work satisfaction among PCPs and patient care coordination between PCPs. In addition to improving outcomes that directly concern health care providers, efforts to

  12. The place of highly accurate methods by RNAA in metrology

    International Nuclear Information System (INIS)

    Dybczynski, R.; Danko, B.; Polkowska-Motrenko, H.; Samczynski, Z.

    2006-01-01

    With the introduction of physical metrological concepts to chemical analysis which require that the result should be accompanied by uncertainty statement written down in terms of Sl units, several researchers started to consider lD-MS as the only method fulfilling this requirement. However, recent publications revealed that in certain cases also some expert laboratories using lD-MS and analyzing the same material, produced results for which their uncertainty statements did not overlap, what theoretically should not have taken place. This shows that no monopoly is good in science and it would be desirable to widen the set of methods acknowledged as primary in inorganic trace analysis. Moreover, lD-MS cannot be used for monoisotopic elements. The need for searching for other methods having similar metrological quality as the lD-MS seems obvious. In this paper, our long-time experience on devising highly accurate ('definitive') methods by RNAA for the determination of selected trace elements in biological materials is reviewed. The general idea of definitive methods based on combination of neutron activation with the highly selective and quantitative isolation of the indicator radionuclide by column chromatography followed by gamma spectrometric measurement is reminded and illustrated by examples of the performance of such methods when determining Cd, Co, Mo, etc. lt is demonstrated that such methods are able to provide very reliable results with very low levels of uncertainty traceable to Sl units

  13. High resolution x-ray CMT: Reconstruction methods

    Energy Technology Data Exchange (ETDEWEB)

    Brown, J.K.

    1997-02-01

    This paper qualitatively discusses the primary characteristics of methods for reconstructing tomographic images from a set of projections. These reconstruction methods can be categorized as either {open_quotes}analytic{close_quotes} or {open_quotes}iterative{close_quotes} techniques. Analytic algorithms are derived from the formal inversion of equations describing the imaging process, while iterative algorithms incorporate a model of the imaging process and provide a mechanism to iteratively improve image estimates. Analytic reconstruction algorithms are typically computationally more efficient than iterative methods; however, analytic algorithms are available for a relatively limited set of imaging geometries and situations. Thus, the framework of iterative reconstruction methods is better suited for high accuracy, tomographic reconstruction codes.

  14. Supersaturation induced by Itraconazole/Soluplus® micelles provided high GI absorption in vivo

    Directory of Open Access Journals (Sweden)

    Yue Zhong

    2016-04-01

    Full Text Available To investigate the effect of supersaturation induced by micelle formation during dissolution on the bioavailability of itraconazole (ITZ/Soluplus® solid dispersion. Solid dispersions prepared by hot melt extrusion (HME were compressed into tablets directly with other excipients. Dissolution behavior of ITZ tablets was studied by dissolution testing and the morphology of micelles in dissolution media was studied using transmission electron microscopy (TEM. Drug transferring from stomach into intestine was simulated to obtain a supersaturated drug solution. Bioavailability studies were performed on the ITZ tablets and Sporanox® in beagle dogs. The morphology of micelles in the dissolution media was observed to be spherical in shape, with an average size smaller than 100 nm. The supersaturated solutions formed by Soluplus® micelles were stable and no precipitation took place over a period of 180 min. Compared with Sporanox®, ITZ tablets exhibited a 2.50-fold increase in the AUC(0–96 of ITZ and a 1.95-fold increase in its active metabolite hydroxyitraconazole (OH-ITZ in the plasma of beagle dogs. The results obtained provided clear evidence that not only the increase in the dissolution rate in the stomach, but also the supersaturation produced by micelles in the small intestine may be of great assistance in the successful development of poorly water-soluble drugs. The micelles formed by Soluplus® enwrapped the molecular ITZ inside the core which promoted the amount of free drug in the intestinal cavity and carried ITZ through the aqueous boundary layer (ABL, resulting in high absorption by passive transportation across biological membranes. The uptake of intact micelles through pinocytosis together with the inhibition of P-glycoprotein-mediated drug efflux in intestinal epithelia contributed to the absorption of ITZ in the gastrointestinal tract. These results indicate that HME with Soluplus®, which can induce supersaturation by micelle

  15. Spectral method and its high performance implementation

    KAUST Repository

    Wu, Zedong

    2014-01-01

    We have presented a new method that can be dispersion free and unconditionally stable. Thus the computational cost and memory requirement will be reduced a lot. Based on this feature, we have implemented this algorithm on GPU based CUDA for the anisotropic Reverse time migration. There is almost no communication between CPU and GPU. For the prestack wavefield extrapolation, it can combine all the shots together to migration. However, it requires to solve a bigger dimensional problem and more meory which can\\'t fit into one GPU cards. In this situation, we implement it based on domain decomposition method and MPI for distributed memory system.

  16. Creating Highly Qualified Teachers: Maximizing University Resources to Provide Professional Development in Rural Areas

    Science.gov (United States)

    Mollenkopf, Dawn L.

    2009-01-01

    The "highly qualified teacher" requirement of No Child Left Behind has put pressure on rural school districts to recruit and retain highly qualified regular and special education teachers. If necessary, they may utilize uncertified, rural teachers with provisional certification; however, these teachers may find completing the necessary…

  17. Training Physicians to Provide High-Value, Cost-Conscious Care A Systematic Review

    NARCIS (Netherlands)

    Stammen, L.A.; Stalmeijer, R.E.; Paternotte, E.; Pool, A.O.; Driessen, E.W.; Scheele, F.; Stassen, L.P.S.

    2015-01-01

    Importance Increasing health care expenditures are taxing the sustainability of the health care system. Physicians should be prepared to deliver high-value, cost-conscious care. Objective To understand the circumstances in which the delivery of high-value, cost-conscious care is learned, with a goal

  18. High Repetition Rate Thermometry System And Method

    KAUST Repository

    Chrystie, Robin

    2015-05-14

    A system and method for rapid thermometry using intrapulse spectroscopy can include a laser for propagating pulses of electromagnetic radiation to a region. Each of the pulses can be chirped. The pulses from the region can be detected. An intrapulse absorbance spectrum can be determined from the pulses. An instantaneous temperature of the region based on the intrapulse absorbance spectrum can be determined.

  19. High Repetition Rate Thermometry System And Method

    KAUST Repository

    Chrystie, Robin; Farooq, Aamir

    2015-01-01

    A system and method for rapid thermometry using intrapulse spectroscopy can include a laser for propagating pulses of electromagnetic radiation to a region. Each of the pulses can be chirped. The pulses from the region can be detected. An intrapulse absorbance spectrum can be determined from the pulses. An instantaneous temperature of the region based on the intrapulse absorbance spectrum can be determined.

  20. High accuracy mantle convection simulation through modern numerical methods

    KAUST Repository

    Kronbichler, Martin

    2012-08-21

    Numerical simulation of the processes in the Earth\\'s mantle is a key piece in understanding its dynamics, composition, history and interaction with the lithosphere and the Earth\\'s core. However, doing so presents many practical difficulties related to the numerical methods that can accurately represent these processes at relevant scales. This paper presents an overview of the state of the art in algorithms for high-Rayleigh number flows such as those in the Earth\\'s mantle, and discusses their implementation in the Open Source code Aspect (Advanced Solver for Problems in Earth\\'s ConvecTion). Specifically, we show how an interconnected set of methods for adaptive mesh refinement (AMR), higher order spatial and temporal discretizations, advection stabilization and efficient linear solvers can provide high accuracy at a numerical cost unachievable with traditional methods, and how these methods can be designed in a way so that they scale to large numbers of processors on compute clusters. Aspect relies on the numerical software packages deal.II and Trilinos, enabling us to focus on high level code and keeping our implementation compact. We present results from validation tests using widely used benchmarks for our code, as well as scaling results from parallel runs. © 2012 The Authors Geophysical Journal International © 2012 RAS.

  1. Method for fabrication of high temperature superconductors

    Science.gov (United States)

    Balachandran, Uthamalingam [Hinsdale, IL; Ma, Beihai [Naperville, IL; Miller, Dean [Darien, IL

    2009-07-14

    A layered article of manufacture and a method of manufacturing same is disclosed. A substrate has a biaxially textured MgO crystalline layer having the c-axes thereof inclined with respect to the plane of the substrate deposited thereon. A layer of one or more of YSZ or Y.sub.2O.sub.3 and then a layer of CeO.sub.2 is deposited on the MgO. A crystalline superconductor layer with the c-axes thereof normal to the plane of the substrate is deposited on the CeO.sub.2 layer. Deposition of the MgO layer on the substrate is by the inclined substrate deposition method developed at Argonne National Laboratory. Preferably, the MgO has the c-axes thereof inclined with respect to the normal to the substrate in the range of from about 10.degree. to about 40.degree. and YBCO superconductors are used.

  2. Highly Robust Methods in Data Mining

    Czech Academy of Sciences Publication Activity Database

    Kalina, Jan

    2013-01-01

    Roč. 8, č. 1 (2013), s. 9-24 ISSN 1452-4864 Institutional support: RVO:67985807 Keywords : data mining * robust statistics * high-dimensional data * cluster analysis * logistic regression * neural networks Subject RIV: BB - Applied Statistics, Operational Research

  3. Validated High Performance Liquid Chromatography Method for ...

    African Journals Online (AJOL)

    Purpose: To develop a simple, rapid and sensitive high performance liquid ... response, tailing factor and resolution of six replicate injections was < 3 %. ... Cefadroxil monohydrate, Human plasma, Pharmacokinetics Bioequivalence ... Drug-free plasma was obtained from the local .... Influence of probenicid on the renal.

  4. THE SIMULATION DIAGNOSTIC METHODS AND REGENERATION WAYS OF REINFORCED - CONCRETE CONSTRUCTIONS OF BRIDGES IN PROVIDING THEIR OPERATING RELIABILITY AND LONGEVITY

    Directory of Open Access Journals (Sweden)

    B. V. Savchinskiy

    2010-03-01

    Full Text Available On the basis of analysis of existing diagnostic methods and regeneration ways of reinforced-concrete constructions of bridges the recommendations on introduction of new modern technologies of renewal of reinforced-concrete constructions of bridges in providing their operating reliability and longevity are offered.

  5. THE SIMULATION DIAGNOSTIC METHODS AND REGENERATION WAYS OF REINFORCED - CONCRETE CONSTRUCTIONS OF BRIDGES IN PROVIDING THEIR OPERATING RELIABILITY AND LONGEVITY

    OpenAIRE

    B. V. Savchinskiy

    2010-01-01

    On the basis of analysis of existing diagnostic methods and regeneration ways of reinforced-concrete constructions of bridges the recommendations on introduction of new modern technologies of renewal of reinforced-concrete constructions of bridges in providing their operating reliability and longevity are offered.

  6. A Mixed-Methods Investigation of Early Childhood Professional Development for Providers and Recipients in the United States

    Science.gov (United States)

    Linder, Sandra M.; Rembert, Kellye; Simpson, Amber; Ramey, M. Deanna

    2016-01-01

    This multi-phase mixed-methods study explores provider and recipient perceptions of the current state of early childhood professional development in a southeastern area of the United States. Professional development for the early childhood workforce has been shown to positively influence the quality of early childhood classrooms. This study…

  7. Perceptions of vaginal microbicides as an HIV prevention method among health care providers in KwaZulu-Natal, South Africa

    Directory of Open Access Journals (Sweden)

    Mantell Joanne E

    2007-03-01

    Full Text Available Abstract Background The promise of microbicides as an HIV prevention method will not be realized if not supported by health care providers. They are the primary source of sexual health information for potential users, in both the public and private health sectors. Therefore, the aim of this study was to determine perceptions of vaginal microbicides as a potential HIV prevention method among health care providers in Durban and Hlabisa, South Africa, using a combination of quantitative and qualitative methods. Results During 2004, semi structured interviews with 149 health care providers were conducted. Fifty seven percent of hospital managers, 40% of pharmacists and 35% of nurses possessed some basic knowledge of microbicides, such as the product being used intra-vaginally before sex to prevent HIV infection. The majority of them were positive about microbicides and were willing to counsel users regarding potential use. Providers from both public and private sectors felt that an effective microbicide should be available to all people, regardless of HIV status. Providers felt that the product should be accessed over-the-counter in pharmacies and in retail stores. They also felt a need for potential microbicides to be available free of charge, and packaged with clear instructions. The media was seen by health care providers as being an effective strategy for promoting microbicides. Conclusion Overall, health care providers were very positive about the possible introduction of an effective microbicide for HIV prevention. The findings generated by this study illustrated the need for training health care providers prior to making the product accessible, as well as the importance of addressing the potential barriers to use of the product by women. These are important concerns in the health care community, and this study also served to educate them for the day when research becomes reality.

  8. Calculation of the energy provided by a PV generator. Comparative study: Conventional methods vs. artificial neural networks

    International Nuclear Information System (INIS)

    Almonacid, F.; Rus, C.; Perez-Higueras, P.; Hontoria, L.

    2011-01-01

    The use of photovoltaics for electricity generation purposes has recorded one of the largest increases in the field of renewable energies. The energy production of a grid-connected PV system depends on various factors. In a wide sense, it is considered that the annual energy provided by a generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. However, a range of factors is influencing the expected outcome by reducing the generation of energy. The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network developed by the R and D Group for Solar and Automatic Energy at the University of Jaen. The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study, mainly due to the fact that this method takes also into account some second order effects, such as low irradiance, angular and spectral effects. -- Research highlights: → It is considered that the annual energy provided by a PV generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. → A range of factors are influencing the expected outcome by reducing the generation of energy (mismatch losses, dirt and dust, Ohmic losses,.). → The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network. → The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study. While classical methods have only taken into account temperature losses, the method based in

  9. Development of a high performance liquid chromatography method ...

    African Journals Online (AJOL)

    Development of a high performance liquid chromatography method for simultaneous ... Purpose: To develop and validate a new low-cost high performance liquid chromatography (HPLC) method for ..... Several papers have reported the use of ...

  10. Teachers Providing Social and Emotional Support: A Study of Advisor Role Enactment in Small High Schools

    Science.gov (United States)

    Phillippo, Kate L.

    2010-01-01

    Background/Context: This study investigates the teacher's role in the student advisory process, which to date has generated limited research literature. Teachers who serve as student advisors assume a role that extends beyond the more traditional instructional role, and includes implied or explicit expectations to provide student advisees with…

  11. Photodiode array for position-sensitive detection using high X-ray flux provided by synchrotron radiation

    Science.gov (United States)

    Jucha, A.; Bonin, D.; Dartyge, E.; Flank, A. M.; Fontaine, A.; Raoux, D.

    1984-09-01

    Synchrotron radiation provides a high intensity source over a large range of wavelengths. This is the prominent quality that has laid the foundations of the EXAFS development (Extended X-ray Absorption Fine Structure). EXAFS data can be collected in different ways. A full scan requires 5 to 10 min, compared to the one-day data collection of a conventional Bremsstrahlung X-ray tube. Recently, by using the new photodiode array (R 1024 SFX) manufactured by Reticon, it has been possible to reduce the data collection time to less than 100 ms. The key elements of this new EXAFS method are a dispersive optics combined with a position sensitive detector able to work under very high flux conditions. The total aperture of 2500 μm × 25 μm for each pixel is well suited to spectroscopic applications. Besides its high dynamic range (> 10 4) and its linearity, the rapidity of the readout allows a flux of 10 9-10 10 photons/s over the 1024 sensing elements.

  12. Genetic Data Provide Evidence for Wind-Mediated Transmission of Highly Pathogenic Avian Influenza

    NARCIS (Netherlands)

    Ypma, R.J.F.; Jonges, M.; Bataille, A.M.A.; Stegeman, J.A.; Koch, G.; van Boven, R.M.; Koopmans, M.; van Ballegooijen, W.M.; Wallinga, J.

    2013-01-01

    Outbreaks of highly pathogenic avian influenza in poultry can cause severe economic damage and represent a public health threat. Development of efficient containment measures requires an understanding of how these influenza viruses are transmitted between farms. However, the actual mechanisms of

  13. New Policies Allow High School Child Development Programs to Provide CDA Licensure

    Science.gov (United States)

    Langlais, Amanda G.

    2012-01-01

    Recent changes made by the Council for Professional Recognition to the Child Development Associate (CDA) credentialing program create an opportunity to redesign high school child development programs. On April 1, 2011, the Council for Professional Recognition lifted the age restriction in the CDA credentialing requirements, now allowing students…

  14. Alkali activated slag mortars provide high resistance to chloride-induced corrosion of steel

    Science.gov (United States)

    Criado, Maria; Provis, John L.

    2018-06-01

    The pore solutions of alkali-activated slag cements and Portland-based cements are very different in terms of their chemical and redox characteristics, particularly due to the high alkalinity and high sulfide content of alkali-activated slag cement. Therefore, differences in corrosion mechanisms of steel elements embedded in these cements could be expected, with important implications for the durability of reinforced concrete elements. This study assesses the corrosion behaviour of steel embedded in alkali-activated blast furnace slag (BFS) mortars exposed to alkaline solution, alkaline chloride-rich solution, water, and standard laboratory conditions, using electrochemical techniques. White Portland cement (WPC) mortars and blended cement mortars (white Portland cement and blast furnace slag) were also tested for comparative purposes. The steel elements embedded in immersed alkali-activated slag mortars presented very negative redox potentials and high apparent corrosion current values; the presence of sulfide reduced the redox potential, and the oxidation of the reduced sulfur-containing species within the cement itself gave an electrochemical signal that classical electrochemical tests for reinforced concrete durability would interpret as being due to steel corrosion processes. However, the actual observed resistance to chloride-induced corrosion was very high, as measured by extraction and characterisation of the steel at the end of a 9-month exposure period, whereas the steel embedded in white Portland cement mortars was significantly damaged under the same conditions.

  15. High-resolution phylogeny providing insights towards the epidemiology, zoonotic aspects and taxonomy of sapoviruses

    NARCIS (Netherlands)

    Barry, A.F.; Durães-Carvalho, R.; Oliveira-Filho, Edmilson F.; Alfieri, A.; Poel, Van der W.H.M.

    2017-01-01

    The evolution, epidemiology and zoonotic aspects of Sapoviruses (SaV) are still not well explored. In this study, we applied high-resolution phylogeny to investigate the epidemiological and zoonotic origins as well as taxonomic classification of animal and human SaV. Bayesian framework analyses

  16. High-mountain lakes provide a seasonal niche for migrant American dippers

    Science.gov (United States)

    J. M. Garwood; K. L. Pope; R. M. Bourque; M. D. Larson

    2009-01-01

    We studied summer use of high elevation lakes by American Dippers (Cinclus mexicanus) in the Trinity Alps Wilderness, California by conducting repeated point-count surveys at 16 study lakes coupled with a 5-year detailed survey of all available aquatic habitats in a single basin. We observed American Dippers during 36% of the point-count surveys...

  17. Method of measuring the polarization of high momentum proton beams

    International Nuclear Information System (INIS)

    Underwood, D.G.

    1976-01-01

    A method of measuring the polarization of high momentum proton beams is proposed. This method utilizes the Primakoff effect and relates asymmetries at high energy to large asymmetries already measured at low energy. Such a new method is essential for the success of future experiments at energies where present methods are no longer feasible

  18. A combined usage of stochastic and quantitative risk assessment methods in the worksites: Application on an electric power provider

    International Nuclear Information System (INIS)

    Marhavilas, P.K.; Koulouriotis, D.E.

    2012-01-01

    An individual method cannot build either a realistic forecasting model or a risk assessment process in the worksites, and future perspectives should focus on the combined forecasting/estimation approach. The main purpose of this paper is to gain insight into a risk prediction and estimation methodological framework, using the combination of three different methods, including the proportional quantitative-risk-assessment technique (PRAT), the time-series stochastic process (TSP), and the method of estimating the societal-risk (SRE) by F–N curves. In order to prove the usefulness of the combined usage of stochastic and quantitative risk assessment methods, an application on an electric power provider industry is presented to, using empirical data.

  19. Hybrid RANS-LES using high order numerical methods

    Science.gov (United States)

    Henry de Frahan, Marc; Yellapantula, Shashank; Vijayakumar, Ganesh; Knaus, Robert; Sprague, Michael

    2017-11-01

    Understanding the impact of wind turbine wake dynamics on downstream turbines is particularly important for the design of efficient wind farms. Due to their tractable computational cost, hybrid RANS/LES models are an attractive framework for simulating separation flows such as the wake dynamics behind a wind turbine. High-order numerical methods can be computationally efficient and provide increased accuracy in simulating complex flows. In the context of LES, high-order numerical methods have shown some success in predictions of turbulent flows. However, the specifics of hybrid RANS-LES models, including the transition region between both modeling frameworks, pose unique challenges for high-order numerical methods. In this work, we study the effect of increasing the order of accuracy of the numerical scheme in simulations of canonical turbulent flows using RANS, LES, and hybrid RANS-LES models. We describe the interactions between filtering, model transition, and order of accuracy and their effect on turbulence quantities such as kinetic energy spectra, boundary layer evolution, and dissipation rate. This work was funded by the U.S. Department of Energy, Exascale Computing Project, under Contract No. DE-AC36-08-GO28308 with the National Renewable Energy Laboratory.

  20. Software project estimation the fundamentals for providing high quality information to decision makers

    CERN Document Server

    Abran, Alain

    2015-01-01

    Software projects are often late and over-budget and this leads to major problems for software customers. Clearly, there is a serious issue in estimating a realistic, software project budget. Furthermore, generic estimation models cannot be trusted to provide credible estimates for projects as complex as software projects. This book presents a number of examples using data collected over the years from various organizations building software. It also presents an overview of the non-for-profit organization, which collects data on software projects, the International Software Benchmarking Stan

  1. EMODNet Bathymetry - building and providing a high resolution digital bathymetry for European seas

    Science.gov (United States)

    Schaap, D.

    2016-12-01

    Access to marine data is a key issue for the EU Marine Strategy Framework Directive and the EU Marine Knowledge 2020 agenda and includes the European Marine Observation and Data Network (EMODnet) initiative. The EMODnet Bathymetry project develops and publishes Digital Terrain Models (DTM) for the European seas. These are produced from survey and aggregated data sets that are indexed with metadata by adopting from SeaDataNet the Common Data Index (CDI) data discovery and access service and the Sextant data products catalogue service. SeaDataNet is a network of major oceanographic data centres around the European seas that manage, operate and further develop a pan-European infrastructure for marine and ocean data management. SeaDataNet is also setting and governing marine data standards, and exploring and establishing interoperability solutions to connect to other e-infrastructures on the basis of standards such as ISO and OGC. The SeaDataNet portal provides users a number of interrelated meta directories, an extensive range of controlled vocabularies, and the various SeaDataNet standards and tools. SeaDataNet at present gives overview and access to more than 1.8 million data sets for physical oceanography, chemistry, geology, geophysics, bathymetry and biology from more than 100 connected data centres from 34 countries riparian to European seas. The latest EMODnet Bathymetry DTM has a resolution of 1/8 arcminute * 1/8 arcminute and covers all European sea regions. Use is made of available and gathered surveys and already more than 13.000 surveys have been indexed by 27 European data providers from 15 countries. Also use is made of composite DTMs as generated and maintained by several data providers for their areas of interest. Already 44 composite DTMs are included in the Sextant data products catalogue. For areas without coverage use is made of the latest global DTM of GEBCO who is partner in the EMODnet Bathymetry project. In return GEBCO integrates the EMODnet

  2. EMODNet Bathymetry - building and providing a high resolution digital bathymetry for European seas

    Science.gov (United States)

    Schaap, Dick M. A.

    2016-04-01

    Access to marine data is a key issue for the EU Marine Strategy Framework Directive and the EU Marine Knowledge 2020 agenda and includes the European Marine Observation and Data Network (EMODNet) initiative. EMODNet aims at assembling European marine data, data products and metadata from diverse sources in a uniform way. The EMODNet data infrastructure is developed through a stepwise approach in three major phases. Currently EMODNet is entering its 3rd phase with operational portals providing access to marine data for bathymetry, geology, physics, chemistry, biology, seabed habitats and human activities, complemented by checkpoint projects, analyzing the fitness for purpose of data provision. The EMODNet Bathymetry project develops and publishes Digital Terrain Models (DTM) for the European seas. These are produced from survey and aggregated data sets that are indexed with metadata by adopting from SeaDataNet the Common Data Index (CDI) data discovery and access service and the Sextant data products catalogue service. SeaDataNet is a network of major oceanographic data centers around the European seas that manage, operate and further develop a pan-European infrastructure for marine and ocean data management. SeaDataNet is also setting and governing marine data standards, and exploring and establishing interoperability solutions to connect to other e-infrastructures on the basis of standards such as ISO and OGC. The SeaDataNet portal provides users a number of interrelated meta directories, an extensive range of controlled vocabularies, and the various SeaDataNet standards and tools. SeaDataNet at present gives overview and access to more than 1.8 million data sets for physical oceanography, chemistry, geology, geophysics, bathymetry and biology from more than 100 connected data centers from 34 countries riparian to European seas. The latest EMODNet Bathymetry DTM has a resolution of 1/8 arc minute * 1/8 arc minute and covers all European sea regions. Use is made of

  3. Method and apparatus to provide power conversion with high power factor

    Energy Technology Data Exchange (ETDEWEB)

    Perreault, David J.; Lim, Seungbum; Otten, David M.

    2017-05-23

    A power converter circuit rectifies a line voltage and applies the rectified voltage to a stack of capacitors. Voltages on the capacitors are coupled to a plurality of regulating converters to be converted to regulated output signals. The regulated output signals are combined and converted to a desired DC output voltage of the power converter. Input currents of the regulating converters are modulated in a manner that enhances the power factor of the power converter.

  4. Attitudes of High School Students Regarding Intimate Relationships and Gender Norms in New Providence, The Bahamas

    Directory of Open Access Journals (Sweden)

    Donna Nicolls

    2014-09-01

    Full Text Available This paper reports the attitudes and actions on relationships with the opposite sex of 1,002 Grade 10 and Grade 12 students in New Providence. Girls were more likely than boys to use aggressive behaviours in teen relationships. Some of the behaviours noted in teen relationships informed expectations of marital relationships, such as restricted access to friends of the opposite sex. The students endorsed a number of sex-related stereotypes, such as a man being the head of the household. Both male and female students indicated that it was acceptable for men to control their wives. Participation in aggressive and controlling behaviours by teens points to the need to educate students about how to develop more respectful relationships.

  5. Attitudes of high school students regarding intimate relationships and gender norms in New Providence, The Bahamas

    Directory of Open Access Journals (Sweden)

    Nicolls, Donna

    2014-10-01

    Full Text Available This paper reports the attitudes and actions on relationships with the opposite sex of 1,002 Grade 10 and Grade 12 students in New Providence. Girls were more likely than boys to use aggressive behaviours in teen relationships. Some of the behaviours noted in teen relationships informed expectations of marital relationships, such as restricted access to friends of the opposite sex. The students endorsed a number of sex-related stereotypes, such as a man being the head of the household. Both male and female students indicated that it was acceptable for men to control their wives. Participation in aggressive and controlling behaviours by teens points to the need to educate students about how to develop more respectful relationships.

  6. EMODNet Bathymetry - building and providing a high resolution digital bathymetry for European seas

    Science.gov (United States)

    Schaap, Dick M. A.

    2015-04-01

    Access to marine data is a key issue for the implementation of the EU Marine Strategy Framework Directive (MSFD). The EU communication 'Marine Knowledge 2020' underpins the importance of data availability and harmonising access to marine data from different sources. The European Marine Observation and Data Network (EMODnet) is a long term marine data initiative from the European Commission Directorate-General for Maritime Affairs and Fisheries (DG MARE) underpinning the Marine Knowledge 2020 strategy. EMODnet is a consortium of organisations assembling European marine data, data products and metadata from diverse sources in a uniform way. The main purpose of EMODnet is to unlock fragmented and hidden marine data resources and to make these available to individuals and organisations (public and private), and to facilitate investment in sustainable coastal and offshore activities through improved access to quality-assured, standardised and harmonised marine data which are interoperable and free of restrictions on use. The EMODnet data infrastructure is developed through a stepwise approach in three major phases. Currently EMODnet is in the 2nd phase of development with seven sub-portals in operation that provide access to marine data from the following themes: bathymetry, geology, physics, chemistry, biology, seabed habitats and human activities. EMODnet development is a dynamic process so new data, products and functionality are added regularly while portals are continuesly improved to make the service more fit for purpose and user friendly with the help of users and stakeholders. The EMODnet Bathymetry project develops and publishes Digital Terrain Models (DTM) for the European seas. These are produced from survey and aggregated data sets, that are indexed with metadata by adopting the SeaDataNet Common Data Index (CDI) data discovery and access service and the SeaDataNet Sextant data products catalogue service. The new EMODnet DTM will have a resolution of 1

  7. Bio-Inspired Supramolecular Chemistry Provides Highly Concentrated Dispersions of Carbon Nanotubes in Polythiophene

    Directory of Open Access Journals (Sweden)

    Yen-Ting Lin

    2016-06-01

    Full Text Available In this paper we report the first observation, through X-ray diffraction, of noncovalent uracil–uracil (U–U dimeric π-stacking interactions in carbon nanotube (CNT–based supramolecular assemblies. The directionally oriented morphology determined using atomic force microscopy revealed highly organized behavior through π-stacking of U moieties in a U-functionalized CNT derivative (CNT–U. We developed a dispersion system to investigate the bio-inspired interactions between an adenine (A-terminated poly(3-adeninehexyl thiophene (PAT and CNT–U. These hybrid CNT–U/PAT materials interacted through π-stacking and multiple hydrogen bonding between the U moieties of CNT–U and the A moieties of PAT. Most importantly, the U···A multiple hydrogen bonding interactions between CNT–U and PAT enhanced the dispersion of CNT–U in a high-polarity solvent (DMSO. The morphology of these hybrids, determined using transmission electron microscopy, featured grape-like PAT bundles wrapped around the CNT–U surface; this tight connection was responsible for the enhanced dispersion of CNT–U in DMSO.

  8. Evaluation of protection factors provided by full-face masks using man-test method at workplace

    International Nuclear Information System (INIS)

    Izumi, Yukio; Kinouchi, Nobuyuki; Ikezawa, Yoshio.

    1994-01-01

    From a practical angle of view to estimate the protection factors (PFs) provided by full-face masks, a number of protection factors were measured with a man-test apparatus just before the wearers started to do radiation work in radiation controlled area. PFs of the total number of 2,279 cases were measured under five simulated working conditions. The measured PFs were widely distributed from 2.3 to 6,700. About 95% of workers obtained PFs more than 50, and about 64% showed much higher PFs more than 1,000 due to good fitting. In the case of some persons, the measured PFs irregularly varied and changed to a large degree. This method is a reliable technique that has been confirmed to protect unexpected internal exposure. From the results obtained, the method should be necessary to provide a better mask and higher PF for each worker. (author)

  9. New Technologies Provide Quantum Changes in the Scale, Speed, and Success of SELEX Methods and Aptamer Characterization

    Directory of Open Access Journals (Sweden)

    Abdullah Ozer

    2014-01-01

    Full Text Available Single-stranded oligonucleotide aptamers have attracted great attention in the past decade because of their diagnostic and therapeutic potential. These versatile, high affinity and specificity reagents are selected by an iterative in vitro process called SELEX, Systematic Evolution of Ligands by Exponential Enrichment. Numerous SELEX methods have been developed for aptamer selections; some that are simple and straightforward, and some that are specialized and complicated. The method of SELEX is crucial for selection of an aptamer with desired properties; however, success also depends on the starting aptamer library, the target molecule, aptamer enrichment monitoring assays, and finally, the analysis and characterization of selected aptamers. Here, we summarize key recent developments in aptamer selection methods, as well as other aspects of aptamer selection that have significant impact on the outcome. We discuss potential pitfalls and limitations in the selection process with an eye to aid researchers in the choice of a proper SELEX strategy, and we highlight areas where further developments and improvements are desired. We believe carefully designed multiplexed selection methods, when complemented with high-throughput downstream analysis and characterization assays, will yield numerous high-affinity aptamers to protein and small molecule targets, and thereby generate a vast array of reagents for probing basic biological mechanisms and implementing new diagnostic and therapeutic applications in the near future.

  10. A METHOD AND AN APPARATUS FOR PROVIDING TIMING SIGNALS TO A NUMBER OF CIRCUITS, AN INTEGRATED CIRCUIT AND A NODE

    DEFF Research Database (Denmark)

    2006-01-01

    A method of providing or transporting a timing signal between a number of circuits, electrical or optical, where each circuit is fed by a node. The nodes forward timing signals between each other, and at least one node is adapted to not transmit a timing signal before having received a timing...... signal from at least two nodes. In this manner, the direction of the timing skew between nodes and circuits is known and data transport between the circuits made easier....

  11. Peel and pulp of baru (Dipteryx Alata Vog. provide high fiber, phenolic content and antioxidant capacity

    Directory of Open Access Journals (Sweden)

    Gabriela de Lima SANTIAGO

    2018-03-01

    Full Text Available Abstract Baru (Dipteryx alata Vog. is a native fruit of the Brazilian Savannah that can be used in the food industry and may contribute to the economy of the Brazilian Midwest. The proximate composition, the phenolic content and the antioxidant capacity of the peel, pulp and raw and roasted baru almond were examined and compared. Peel showed higher concentrations of dietary fibers (24.1 g/100 g followed by pulp and roasted almond (18 g/100 g and 16 g/100 g, respectively, and raw almond (12.0 g/100 g. However, the almonds presented the highest lipid and protein concentrations compared to baru peel and pulp. In addition, raw almond showed the highest total phenolic contents (1,107.0 mg GAE/100 g and antioxidant capacity, but the roasted almond, and baru peel with its pulp, also presented high phenolic contents. The correlation coefficients between phenolic content and antioxidant capacity (via ABTS and FRAP were strong and significant. The chemical composition of baru peel has not previously been reported. The results showed promising prospects for the consumption of baru pulp with its peel, the fruit component richest in fiber, whose phenolic content and antioxidant capacity are comparable to those of the baru almond.

  12. New techniques provide low-cost X-ray inspection of highly attenuating materials

    International Nuclear Information System (INIS)

    Stupin, D.M.; Mueller, K.H.; Viskoe, D.A.; Howard, B.; Poland, R.W.; Schneberk, D.; Dolan, K.; Thompson, K.; Stoker, G.

    1995-01-01

    As a result of an arms reduction treaty between the United States and the Russian Federation, both countries will each be storing over 40,000 containers of plutonium. To help detect any deterioration of the containers and prevent leakage, the authors are designing a digital radiography and computed tomography system capable of handling this volume reliably, efficiently, and at a lower cost. The materials to be stored have very high x-ray attenuations, and, in the past, were inspected using 1- to 24-MV x-ray sources. This inspection system, however, uses a new scintillating (Lockheed) glass and an integrating CCD camera. Preliminary experiments show that this will permit the use of a 450-kV x-ray source. This low-energy system will cost much less than others designed to use a higher-energy x-ray source because it will require a less expensive source, less shielding, and less floor space. Furthermore, they can achieve a tenfold improvement in spatial resolution by using their knowledge of the point-spread function of the x-ray imaging system and a least-squares fitting technique

  13. The IceCube MasterClass: providing high school students an authentic research experience

    Science.gov (United States)

    Bravo Gallart, Silvia; Bechtol, Ellen; Schultz, David; Madsen, Megan; Demerit, Jean; IceCube Collaboration

    2017-01-01

    In May 2014, the first one-day long IceCube Masterclass for high school students was offered. The program was inspired by the masterclasses started in 2005 by the International Particle Physics Outreach Group and supported in the U.S. by QuarkNet. Participation in the IceCube masterclasses has grown each year, with a total of over 500 students in three U.S states and three European countries after three editions. In a masterclass, students join an IceCube research team to learn about astrophysics and replicate the results of a published paper, such as the discovery of astrophysical neutrinos or a measurement of the cosmic ray flux. We will discuss both the scientific and educational goals of the program as well as the organizational challenges. Data from the program evaluation will be used to support the need of educational activities based on actual research as a powerful approach for motivating more students to pursue STEM college programs, making science and scientists more approachable to teenagers, and helping students envision a career in science.

  14. High-flow, low-head pumps provide safe passage for Pacific salmon

    International Nuclear Information System (INIS)

    Anon

    2004-01-01

    The installation of 29 ultra-low head, high capacity submersible pump and auxiliary equipment at the Rocky Reach Dam in Washington State to allow juvenile salmon safe passage on their journey down the Columbia River to the Pacific Ocean is described. The reputed cost of the project is US$160 million; its purpose is to get juvenile salmon safely around the Rocky Reach Dam without interfering with the dam's original mission of generating electric power. The project is the most expensive fish bypass on any Columbia River dam. Getting the salmon safely around the dam is intended to reduce the impact of hydroelectric power projects on the basin's salmon stocks which are now estimated at less than 10 per cent of their historic size, despite major hatchery programs. The Columbia River has the second largest volume flow of any river in the United States, and millions of people depend on it for employment in water-related industries, and for transportation. The new horizontally installed propeller pump was developed by ITT Flygt; it utilizes planetary gear reduced to match the motor speed with the propeller rpm. Each 90 kW propeller pump has a flow rate of seven cubic meters per second at a head of 0.55 metres. The auxiliary equipment includes 10 racks of flap gates to prevent reverse flow, electric controls, remote supervision, testing, installation and maintenance facilities. It is anticipated that the new bypass will allow the Chelan County Public Utility Department, owners of the facility, to phase out all current spills, except for a 16 per cent spill for 40 days each spring for Sockeye salmon which tend to travel too deep to use the bypass. Prior to installation of this new facility, 60 to 70 per cent of average daily flow in the spring and summer had to be sacrificed to accommodate all species of salmon and steelhead, with corresponding losses of power generating capacity

  15. A Similarity-Ranking Method on Semantic Computing for Providing Information-Services in Station-Concierge System

    Directory of Open Access Journals (Sweden)

    Motoki Yokoyama

    2017-07-01

    Full Text Available The prevalence of smartphones and wireless broadband networks have been progressing as a new Railway infomration environment. According to the spread of such devices and information technology, various types of information can be obtained from databases connected to the Internet. One scenario of obtaining such a wide variety of information resources is in the phase of user’s transportation. This paper proposes an information provision system, named the Station Concierge System that matches the situation and intention of passengers. The purpose of this system is to estimate the needs of passengers like station staff or hotel concierge and to provide information resources that satisfy user’s expectations dynamically. The most important module of the system is constructed based on a new information ranking method for passenger intention prediction and service recommendation. This method has three main features, which are (1 projecting a user to semantic vector space by using her current context, (2 predicting the intention of a user based on selecting a semantic vector subspace, and (3 ranking the services by a descending order of relevant scores to the user’ intention. By comparing the predicted results of our method with those of two straightforward computation methods, the experimental studies show the effectiveness and efficiency of the proposed method. Using this system, users can obtain transit information and service map that dynamically matches their context.

  16. The potential of high resolution ultrasonic in-situ methods

    International Nuclear Information System (INIS)

    Schuster, K.

    2010-01-01

    Document available in extended abstract form only. In the framework of geomechanical assessment of final repository underground openings the knowledge of geophysical rock parameters are of importance. Ultrasonic methods proved to be good geophysical tools to provide appropriate high resolution parameters for the characterisation of rock. In this context the detection and characterisation of rock heterogeneities at different scales, including the Excavation Damaged/disturbed Zone (EDZ/EdZ) features, play an important role. Especially, kinematic and dynamic parameters derived from ultrasonic measurements can be linked very close to rock mechanic investigations and interpretations. BGR uses high resolution ultrasonic methods, starting with emitted frequencies of about 1 kHz (seismic) and going up to about 100 kHz. The method development is going on and appropriate research and investigations are performed since many years at different European radioactive waste disposal related underground research laboratories in different potential host rocks. The most frequented are: Mont Terri Rock Laboratory, Switzerland (Opalinus Clay, OPA), Underground Research Laboratory Meuse/Haute- Marne, France (Callovo-Oxfordian, COX), Underground Research Facility Mol, Belgium (Boom Clay, BC), Aespoe Hard Rock Laboratory, Sweden (granites), Rock Laboratory Grimsel, Switzerland (granites) and Asse salt mine, Germany (rock salt). The methods can be grouped into borehole based methods and noninvasive methods like refraction and reflection methods, which are performed in general from the drift wall. Additionally, as a combination of these both methods a sort of vertical seismic profiling (VSP) is applied. The best qualified method, or a combination of methods, have to be chosen according to the scientific questions and the local site conditions. The degree of spatial resolution of zones of interest or any kind of anomaly depends strongly on the distance of these objects to the ultrasonic

  17. High-rise housing construction as a way of solving the problem of providing people with comfortable habitation

    Science.gov (United States)

    Misailovov, Andrey

    2018-03-01

    The article analyzes the role of high-rise construction in solving the problem of providing people with comfortable habitation. High-rise construction is considered as a part of urban environment of big cities, a way of effective land use and development of entrepreneurship, including small and medium-sized enterprises. The economic efficiency of high-rise construction, an increase in budgetary financing and the number of introduced innovations are discussed.

  18. Behavioural responses to hypoxia provide a non-invasive method for distinguishing between stress coping styles in fish

    DEFF Research Database (Denmark)

    Laursen, Danielle Caroline; Olsén, Hanna L.; Ruiz-Gomez, Maria de Lourdes

    2011-01-01

    . These individual differences may result in suboptimal production and compromised welfare in aquaculture. An approach to overcome these problems could be to sort fish and optimise rearing conditions according to coping style. It has been previously demonstrated that the proactive and reactive coping styles in fish......, these fish provided an opportunity for verifying a method for sorting fish with respect to coping style by exposure to hypoxia. Groups consisting of 24 individually tagged fish, 12 HR and 12 LR were exposed to hypoxia in a two choice system. The system consisted of a “home” tank provided with cover connected...... to a second brightly “illuminated” tank via a closable doorway. During the experiment, the doorway between the two tanks was opened and hypoxic conditions were gradually induced in the “home” tank by bubbling with nitrogen. The latency time to move away from hypoxic conditions to normoxic conditions...

  19. The paradox of compassionate work: a mixed-methods study of satisfying and fatiguing experiences of animal health care providers.

    Science.gov (United States)

    Polachek, Alicia J; Wallace, Jean E

    2018-03-01

    Compassionate work appears paradoxical as it may provide great rewards, but may also come at great costs to care providers. This paper explores the paradox of compassionate work by examining what interactions contribute to compassion satisfaction and what interactions contribute to compassion fatigue. This mixed-methods, cross-sectional study uses qualitative interview data from animal health care providers (N = 20) to identify work interactions that they find satisfying or stressful. Quantitative survey data (N = 572) are used to test hypotheses generated from the interviews regarding predictors of compassion satisfaction and compassion fatigue. Interview transcripts were analyzed using a directed content analysis approach. Survey data were analyzed using ordinary least squares regression. The results highlight the complex nature of compassionate work. As hypothesized, making a difference to animals and building relationships with animal patients and human clients relate to greater compassion satisfaction. Human client barriers to animal care and witnessing client grief relate to greater compassion fatigue, as predicted. None of the predictors relate to less compassion fatigue, but forming relationships with animal patients relates to both greater compassion satisfaction and compassion fatigue. This paper enhances our understanding of provider-client-patient interactions and highlights the paradox of compassionate work.

  20. DETECTION OF REPORTS FALSIFICATION PROVIDED TO A BANK BY A BORROWER USING THE METHOD OF DYNAMIC PARAMETERS ANALYSIS

    Directory of Open Access Journals (Sweden)

    M. S. Lyuft

    2015-01-01

    Full Text Available Summary. The main stop-factors in a landing were formed in the article according to the procedure of the European Bank for Reconstruction and Development by the means of questioning the leading Russian banks that finance small-scale business. It is given the description of this method, also it is identified the main weaknesses of the EBRD methodology. There is a description of the main methods of the borrowing company’s analytical balance and thereupon it is made the conclusion about the necessity of the analysis of the balance’s principal factors across time. The analysis of indicators and factors in the dynamics enables us to see trends in the development of the company, and to identify deviations in the coefficients. Either materiality or difference from normal values of these coefficients may indicate the factors of the borrowers’ misconduct, and in particular it gives evidence concerning falsification of reports provided to a bank. There are stages of information processing for falsification’s detection, excluding the interest from decision-makers about the possibility of lending in the results of a transaction. The formula that determinates the value of net profit falsification has been made on basis of dynamic parameters of the analytical balance and the connection with the administrative profit-and-loss report. Further, the article provides the second method of a determination of the net profit falsification already based on data of the parameters in dynamics namely business profitability rate. The process of calculation Payment To Income - payment to income - an indicator, in order to obtain good data on who falsify net income. Are key strengths of this method of identifying and conclusions paragraph article.

  1. Digital photography provides a fast, reliable, and noninvasive method to estimate anthocyanin pigment concentration in reproductive and vegetative plant tissues.

    Science.gov (United States)

    Del Valle, José C; Gallardo-López, Antonio; Buide, Mª Luisa; Whittall, Justen B; Narbona, Eduardo

    2018-03-01

    Anthocyanin pigments have become a model trait for evolutionary ecology as they often provide adaptive benefits for plants. Anthocyanins have been traditionally quantified biochemically or more recently using spectral reflectance. However, both methods require destructive sampling and can be labor intensive and challenging with small samples. Recent advances in digital photography and image processing make it the method of choice for measuring color in the wild. Here, we use digital images as a quick, noninvasive method to estimate relative anthocyanin concentrations in species exhibiting color variation. Using a consumer-level digital camera and a free image processing toolbox, we extracted RGB values from digital images to generate color indices. We tested petals, stems, pedicels, and calyces of six species, which contain different types of anthocyanin pigments and exhibit different pigmentation patterns. Color indices were assessed by their correlation to biochemically determined anthocyanin concentrations. For comparison, we also calculated color indices from spectral reflectance and tested the correlation with anthocyanin concentration. Indices perform differently depending on the nature of the color variation. For both digital images and spectral reflectance, the most accurate estimates of anthocyanin concentration emerge from anthocyanin content-chroma ratio, anthocyanin content-chroma basic, and strength of green indices. Color indices derived from both digital images and spectral reflectance strongly correlate with biochemically determined anthocyanin concentration; however, the estimates from digital images performed better than spectral reflectance in terms of r 2 and normalized root-mean-square error. This was particularly noticeable in a species with striped petals, but in the case of striped calyces, both methods showed a comparable relationship with anthocyanin concentration. Using digital images brings new opportunities to accurately quantify the

  2. A Simple Method for High-Lift Propeller Conceptual Design

    Science.gov (United States)

    Patterson, Michael; Borer, Nick; German, Brian

    2016-01-01

    In this paper, we present a simple method for designing propellers that are placed upstream of the leading edge of a wing in order to augment lift. Because the primary purpose of these "high-lift propellers" is to increase lift rather than produce thrust, these props are best viewed as a form of high-lift device; consequently, they should be designed differently than traditional propellers. We present a theory that describes how these props can be designed to provide a relatively uniform axial velocity increase, which is hypothesized to be advantageous for lift augmentation based on a literature survey. Computational modeling indicates that such propellers can generate the same average induced axial velocity while consuming less power and producing less thrust than conventional propeller designs. For an example problem based on specifications for NASA's Scalable Convergent Electric Propulsion Technology and Operations Research (SCEPTOR) flight demonstrator, a propeller designed with the new method requires approximately 15% less power and produces approximately 11% less thrust than one designed for minimum induced loss. Higher-order modeling and/or wind tunnel testing are needed to verify the predicted performance.

  3. High-throughput characterization methods for lithium batteries

    Directory of Open Access Journals (Sweden)

    Yingchun Lyu

    2017-09-01

    Full Text Available The development of high-performance lithium ion batteries requires the discovery of new materials and the optimization of key components. By contrast with traditional one-by-one method, high-throughput method can synthesize and characterize a large number of compositionally varying samples, which is able to accelerate the pace of discovery, development and optimization process of materials. Because of rapid progress in thin film and automatic control technologies, thousands of compounds with different compositions could be synthesized rapidly right now, even in a single experiment. However, the lack of rapid or combinatorial characterization technologies to match with high-throughput synthesis methods, limit the application of high-throughput technology. Here, we review a series of representative high-throughput characterization methods used in lithium batteries, including high-throughput structural and electrochemical characterization methods and rapid measuring technologies based on synchrotron light sources.

  4. A mixed-methods examination of communication between oncologists and primary care providers among primary care physicians in underserved communities.

    Science.gov (United States)

    Shen, Megan Johnson; Binz-Scharf, Maria; D'Agostino, Tom; Blakeney, Natasha; Weiss, Elisa; Michaels, Margo; Patel, Shilpa; McKee, M Diane; Bylund, Carma L

    2015-03-15

    Research has demonstrated that communication and care coordination improve cancer patient outcomes. To improve communication and care coordination, it is important to understand primary care providers' (PCPs') perceptions of communication with oncologists as well as PCPs' communication needs. A mixed-methods approach was used in the present study. In the qualitative phase of the study, 18 PCPs practicing in underserved, minority communities were interviewed about their experiences communicating with oncologists. In the quantitative phase of the study, 128 PCPs completed an online survey about their preferences, experiences, and satisfaction with communication with oncologists. Results indicated a PCP-oncologist gap in communication occurred between diagnosis and treatment. PCPs wanted more communication with oncologists, updates on their patients' prognosis throughout treatment, and to be contacted via telephone or email and saw their role as crucial in providing supportive care for their patients. Although PCPs recognize that they play a critical, proactive role in supporting patients throughout the continuum of their cancer care experience, existing norms regarding postreferral engagement and oncologist-PCP communication often hinder activation of this role among PCPs. Expected standards regarding the method, frequency, and quality of postreferral communication should be jointly articulated and made accountable between PCPs and oncologists to help improve cancer patients' quality of care, particularly in minority communities. © 2014 American Cancer Society.

  5. Leveraging long read sequencing from a single individual to provide a comprehensive resource for benchmarking variant calling methods.

    Science.gov (United States)

    Mu, John C; Tootoonchi Afshar, Pegah; Mohiyuddin, Marghoob; Chen, Xi; Li, Jian; Bani Asadi, Narges; Gerstein, Mark B; Wong, Wing H; Lam, Hugo Y K

    2015-09-28

    A high-confidence, comprehensive human variant set is critical in assessing accuracy of sequencing algorithms, which are crucial in precision medicine based on high-throughput sequencing. Although recent works have attempted to provide such a resource, they still do not encompass all major types of variants including structural variants (SVs). Thus, we leveraged the massive high-quality Sanger sequences from the HuRef genome to construct by far the most comprehensive gold set of a single individual, which was cross validated with deep Illumina sequencing, population datasets, and well-established algorithms. It was a necessary effort to completely reanalyze the HuRef genome as its previously published variants were mostly reported five years ago, suffering from compatibility, organization, and accuracy issues that prevent their direct use in benchmarking. Our extensive analysis and validation resulted in a gold set with high specificity and sensitivity. In contrast to the current gold sets of the NA12878 or HS1011 genomes, our gold set is the first that includes small variants, deletion SVs and insertion SVs up to a hundred thousand base-pairs. We demonstrate the utility of our HuRef gold set to benchmark several published SV detection tools.

  6. High speed infrared radiation thermometer, system, and method

    Science.gov (United States)

    Markham, James R.

    2002-01-01

    The high-speed radiation thermometer has an infrared measurement wavelength band that is matched to the infrared wavelength band of near-blackbody emittance of ceramic components and ceramic thermal barrier coatings used in turbine engines. It is comprised of a long wavelength infrared detector, a signal amplifier, an analog-to-digital converter, an optical system to collect radiation from the target, an optical filter, and an integral reference signal to maintain a calibrated response. A megahertz range electronic data acquisition system is connected to the radiation detector to operate on raw data obtained. Because the thermometer operates optimally at 8 to 12 .mu.m, where emittance is near-blackbody for ceramics, interferences to measurements performed in turbine engines are minimized. The method and apparatus are optimized to enable mapping of surface temperatures on fast moving ceramic elements, and the thermometer can provide microsecond response, with inherent self-diagnostic and calibration-correction features.

  7. Family building using embryo adoption: relationships and contact arrangements between provider and recipient families-a mixed-methods study.

    Science.gov (United States)

    Frith, Lucy; Blyth, Eric; Lui, Steve

    2017-05-01

    What contact arrangements are established between providers and recipients of embryos using Snowflakes® Embryo Adoption Program? Contact arrangements varied considerably and were generally positively described, although some challenges were acknowledged. Reproductive technologies create new and diverse family forms, and the ways in which families created by embryo adoption are negotiated in practice have not been extensively investigated. This exploratory, mixed-methods study had two phases: (i) an online survey (open May-September 2013) and (ii) qualitative semi-structured interviews by email (conducted between 2014 and 2015), exploring participants' experiences of contact with their embryo provider or recipient. Phase I included 17 providers (14 women and 3 men) and 28 recipients (27 women and 1 man). Phase II included 8 providers (5 women and 3 men) and 12 recipients (10 women and 2 men). All participants, except one, were located in the US. This study illustrates how embryo adoption in the US, as a form of conditional donation, can operate and how the participants define and negotiate these emerging relationships. All families were open with their children about how they were conceived and early contact between recipients and providers (frequently before birth) was valued. On the whole, participants were happy with the amount and type of contact they had, and where the current contact did not involve the children, it was seen as a way of keeping the channels open for future contact when the children were older. Participants often portrayed the opportunities for contact as being in the best interests of the child. The study participants are a particular group who had chosen to either receive or give their embryos via a conditional embryo adoption agency in the US and had established contact. Therefore, this is not a representative sample of those who provide or receive embryos for family building. This embryo adoption model clearly fulfils a need; some people

  8. Providing High Quality Care in Low-Income Areas of Maryland: Definitions, Resources, and Challenges from Parents and Child Care Providers' Perspectives. Publication #2012-45

    Science.gov (United States)

    Forry, Nicole; Simkin, Shana; Wessel, Julia; Rodrigues, Katherine

    2012-01-01

    Early life experiences are critical to a child's development. Research has shown that, for a variety of reasons, children born into low-income families are at a disadvantage when compared to their higher-income peers. Fortunately, research has also shown a positive association between high quality child care and the academic and social-emotional…

  9. Statistical learning methods in high-energy and astrophysics analysis

    Energy Technology Data Exchange (ETDEWEB)

    Zimmermann, J. [Forschungszentrum Juelich GmbH, Zentrallabor fuer Elektronik, 52425 Juelich (Germany) and Max-Planck-Institut fuer Physik, Foehringer Ring 6, 80805 Munich (Germany)]. E-mail: zimmerm@mppmu.mpg.de; Kiesling, C. [Max-Planck-Institut fuer Physik, Foehringer Ring 6, 80805 Munich (Germany)

    2004-11-21

    We discuss several popular statistical learning methods used in high-energy- and astro-physics analysis. After a short motivation for statistical learning we present the most popular algorithms and discuss several examples from current research in particle- and astro-physics. The statistical learning methods are compared with each other and with standard methods for the respective application.

  10. Statistical learning methods in high-energy and astrophysics analysis

    International Nuclear Information System (INIS)

    Zimmermann, J.; Kiesling, C.

    2004-01-01

    We discuss several popular statistical learning methods used in high-energy- and astro-physics analysis. After a short motivation for statistical learning we present the most popular algorithms and discuss several examples from current research in particle- and astro-physics. The statistical learning methods are compared with each other and with standard methods for the respective application

  11. Methods of making high performance compacts and products

    International Nuclear Information System (INIS)

    Fey, M.G.; Iyer, N.C.; Male, A.T.; Lovic, W.R.

    1990-01-01

    This patent describes a method of forming a pressed, dense compact. It comprises: providing a compactable particulate combination of: Class 1 metals selected from the group consisting of Ag, Cu, Al, and mixtures thereof, with material selected from the class consisting of CdO, SnO, SnO 2 , C, Co, Ni, Fe, Cr, Cr 3 C 2 , Cr 7 C 3 , W, WC, W 2 C, WB, Mo, Mo 2 C, MoB, Mo 2 B, TiC, TiN, TiB 2 , Si, SiC, Si 3 N 4 , and mixtures thereof; uniaxially pressing the particulate combination to provide a compact; placing at least one compact in an open pan; evacuating air from the pan; sealing the open top portion of the pan; stacking the pans next to each other, with plates having a high electrical resistance disposed between each pan so that the pans and plates alternate with each other, where a layer of thermally conductive, granular, pressure transmitting material is disposed between each pan and plate, which granular material acts to provide heat transfer and uniform mechanical loading to the compacts in the pans upon subsequent pressing; placing the stack in a press, passing an electrical current through the pans and high electrical resistance plates to cause a heating effect on the compacts in the pans, and uniaxial pressing the alternating pans and plates; cooling and releasing pressure on the alternating pans and plates; and separating the pans from the plates and the compacts from the pans

  12. An analytical solution of Richards' equation providing the physical basis of SCS curve number method and its proportionality relationship

    Science.gov (United States)

    Hooshyar, Milad; Wang, Dingbao

    2016-08-01

    The empirical proportionality relationship, which indicates that the ratio of cumulative surface runoff and infiltration to their corresponding potentials are equal, is the basis of the extensively used Soil Conservation Service Curve Number (SCS-CN) method. The objective of this paper is to provide the physical basis of the SCS-CN method and its proportionality hypothesis from the infiltration excess runoff generation perspective. To achieve this purpose, an analytical solution of Richards' equation is derived for ponded infiltration in shallow water table environment under the following boundary conditions: (1) the soil is saturated at the land surface; and (2) there is a no-flux boundary which moves downward. The solution is established based on the assumptions of negligible gravitational effect, constant soil water diffusivity, and hydrostatic soil moisture profile between the no-flux boundary and water table. Based on the derived analytical solution, the proportionality hypothesis is a reasonable approximation for rainfall partitioning at the early stage of ponded infiltration in areas with a shallow water table for coarse textured soils.

  13. Evaluating the impact of healthcare provider training to improve tuberculosis management: a systematic review of methods and outcome indicators used.

    Science.gov (United States)

    Wu, Shishi; Roychowdhury, Imara; Khan, Mishal

    2017-03-01

    Developing human resources capacity is vital for tuberculosis (TB) control in low- and middle-income countries. Although investments in TB healthcare provider (HCP) training programmes have increased, it is unclear whether these are robustly evaluated. The objective of this systematic review was to synthesize the methods and outcome indicators used to assess TB HCP training programmes. A systematic scoping review of publications reporting on evaluations of training programmes for TB HCPs - including doctors, nurses, paramedics, and lay health workers - was conducted through a search in three electronic databases, Google Scholar, and five websites of non-profit organizations. Data on the study location, population trained, outcomes assessed, and evaluation approach were extracted. After screening 499 unique publications, 21 were eligible for inclusion in the analysis. The majority of evaluations were conducted in Africa. The most common evaluation methods were a review of patient records (n=8, 38%) and post-training interview with trainees (n=7, 33%). In terms of outcomes, more than half of the studies (n=12, 57%) evaluated knowledge acquisition of trainees, with only six (29%) assessing on-the-job behaviour change. Even though more funds have been invested in TB HCP training, publications from robust evaluations assessing the impact on quality of care and behaviour change are limited. Copyright © 2016. Published by Elsevier Ltd.

  14. Final Report of the National Black Health Providers Task Force on High Blood Pressure Education and Control.

    Science.gov (United States)

    Public Health Service (DHHS), Rockville, MD.

    This is the final report of National Black Health Providers Task Force (NBHPTF) on High Blood Pressure Education and Control. The first chapter of the report recounts the history of the NBHPTF and its objectives. In the second chapter epidemiological evidence is presented to demonstrate the need for a suggested 20 year plan aimed at controlling…

  15. The Perceptions of Principals and Teachers Regarding Mental Health Providers' Impact on Student Achievement in High Poverty Schools

    Science.gov (United States)

    Perry, Teresa

    2012-01-01

    This study examined the perceptions of principals and teachers regarding mental health provider's impact on student achievement and behavior in high poverty schools using descriptive statistics, t-test, and two-way ANOVA. Respondents in this study shared similar views concerning principal and teacher satisfaction and levels of support for the…

  16. Using Early Learning Standards to Provide High-Quality Education for All Children: The Early Learning Guidelines Toolkit

    Science.gov (United States)

    Flores, Roseanne L.; Curby, Timothy W.; Coleman, Hardin; Melo, Kristan

    2016-01-01

    Today with the rise in the number of 3- to 6-year-old children enrolled in center-based early childhood programs, and a focus on program quality, it becomes imperative for educators to have a better understanding of the role research plays in establishing high-quality programs as these programs provide much of the foundation that supports early…

  17. Organizational and provider level factors in implementation of trauma-informed care after a city-wide training: an explanatory mixed methods assessment.

    Science.gov (United States)

    Damian, April Joy; Gallo, Joseph; Leaf, Philip; Mendelson, Tamar

    2017-11-21

    While there is increasing support for training youth-serving providers in trauma-informed care (TIC) as a means of addressing high prevalence of U.S. childhood trauma, we know little about the effects of TIC training on organizational culture and providers' professional quality of life. This mixed-methods study evaluated changes in organizational- and provider-level factors following participation in a citywide TIC training. Government workers and nonprofit professionals (N = 90) who participated in a nine-month citywide TIC training completed a survey before and after the training to assess organizational culture and professional quality of life. Survey data were analyzed using multiple regression analyses. A subset of participants (n = 16) was interviewed using a semi-structured format, and themes related to organizational and provider factors were identified using qualitative methods. Analysis of survey data indicated significant improvements in participants' organizational culture and professional satisfaction at training completion. Participants' perceptions of their own burnout and secondary traumatic stress also increased. Four themes emerged from analysis of the interview data, including "Implementation of more flexible, less-punitive policies towards clients," "Adoption of trauma-informed workplace design," "Heightened awareness of own traumatic stress and need for self-care," and "Greater sense of camaraderie and empathy for colleagues." Use of a mixed-methods approach provided a nuanced understanding of the impact of TIC training and suggested potential benefits of the training on organizational and provider-level factors associated with implementation of trauma-informed policies and practices. Future trainings should explicitly address organizational factors such as safety climate and morale, managerial support, teamwork climate and collaboration, and individual factors including providers' compassion satisfaction, burnout, and secondary

  18. High School Graduation Rates:Alternative Methods and Implications

    Directory of Open Access Journals (Sweden)

    Jing Miao

    2004-10-01

    Full Text Available The No Child Left Behind Act has brought great attention to the high school graduation rate as one of the mandatory accountability measures for public school systems. However, there is no consensus on how to calculate the high school graduation rate given the lack of longitudinal databases that track individual students. This study reviews literature on and practices in reporting high school graduation rates, compares graduation rate estimates yielded from alternative methods, and estimates discrepancies between alternative results at national, state, and state ethnic group levels. Despite the graduation rate method used, results indicate that high school graduation rates in the U.S. have been declining in recent years and that graduation rates for black and Hispanic students lag substantially behind those of white students. As to graduation rate method preferred, this study found no evidence that the conceptually more complex methods yield more accurate or valid graduation rate estimates than the simpler methods.

  19. Method for critical software event execution reliability in high integrity software

    Energy Technology Data Exchange (ETDEWEB)

    Kidd, M.E. [Sandia National Labs., Albuquerque, NM (United States)

    1997-11-01

    This report contains viewgraphs on a method called SEER, which provides a high level of confidence that critical software driven event execution sequences faithfully exceute in the face of transient computer architecture failures in both normal and abnormal operating environments.

  20. A new method of removing the high value feedback resistor in the charge sensitive preamplifier

    International Nuclear Information System (INIS)

    Xi Deming

    1993-01-01

    A new method of removing the high value feedback resistor in the charge sensitive preamplifier is introduced. The circuit analysis of this novel design is described and the measured performances of a practical circuit are provided

  1. ANALYSIS OF METHODS PROVIDING ACCURACY FOR TOOLS AND TECHNIQUES VIBRATION MEASUREMENT IN THE PROCESS OF MAINTAINING AIRWORTHINESS OF AIRCRAFT

    Directory of Open Access Journals (Sweden)

    Anatoliy Alexandrovich Bogoyavlenskiy

    2017-01-01

    Full Text Available On the basis of system approach the structure of the aviation activity areas on air transport related to monitoring and measurements of vibration parameters is presented.The technology analysis of laboratory tests of the onboard equipment control of vibration parameters is carried out. The issues related to ensuring the unity of measurements of vibration parameters are researched and summarized.While dealing with the works on metrological certification described in the article, the risks arising from aviation activity on air transport are taken into account. The certification methods of measuring channels of vibration parametersused on stands for testing GTE at the repairing of aircraft engines are developed. The methods are implemented when con- ducting initial and periodic certifications of test benches for twelve types of aircraft GTE in repair organizations. The reliability of the results of the conducted research due to the fact that they were carried out with the use of certified measure- ment equipment, included in the State register of measuring instruments. The research is conducted for a sufficiently high statistical confidence level with the boundaries 0.95. The studies have shown that running on air transport measurements of vibration parameters are metrologically se- cured, the unity of measurements and their traceability from the national primary reference to special measuring instru- ments, test equipment, and onboard controls of the aircraft is maintained.

  2. Applications of Nuclear Analytical Methods for High Tech Industry

    International Nuclear Information System (INIS)

    Hossain, T.

    2013-01-01

    Silicon based semiconductor chip manufacturing is a worldwide high technology industry with numerous measurement issues. One of the major concerns in the semiconductor manufacturing is contamination such as the trace metal impurities. This concern is vividly illustrated by the fact that the manufacturing in this industry is done in ultra clean environment where the entire manufacturing facility or “Fab” is a clean room facility or each and every manufacturing tool is enclosed in a mini-environment Although semiconductor devices are fabricated on the surface of the Si wafers contamination in the bulk material is a major concern. Nuclear methods of analysis are uniquely suited for the contamination analysis in such a matrix. Many opportunities in the semiconductor manufacturing field exist for the nuclear methods to provide support services. Contamination analysis by NAA, depth profiles by NDP and prompt gamma analysis of H in thin films are a few examples. These needs are on-going and require commitment from the lab so that a manufacturing operation can rely on the delivery of these services when required

  3. A method for sampling microbial aerosols using high altitude balloons.

    Science.gov (United States)

    Bryan, N C; Stewart, M; Granger, D; Guzik, T G; Christner, B C

    2014-12-01

    Owing to the challenges posed to microbial aerosol sampling at high altitudes, very little is known about the abundance, diversity, and extent of microbial taxa in the Earth-atmosphere system. To directly address this knowledge gap, we designed, constructed, and tested a system that passively samples aerosols during ascent through the atmosphere while tethered to a helium-filled latex sounding balloon. The sampling payload is ~ 2.7 kg and comprised of an electronics box and three sampling chambers (one serving as a procedural control). Each chamber is sealed with retractable doors that can be commanded to open and close at designated altitudes. The payload is deployed together with radio beacons that transmit GPS coordinates (latitude, longitude and altitude) in real time for tracking and recovery. A cut mechanism separates the payload string from the balloon at any desired altitude, returning all equipment safely to the ground on a parachute. When the chambers are opened, aerosol sampling is performed using the Rotorod® collection method (40 rods per chamber), with each rod passing through 0.035 m3 per km of altitude sampled. Based on quality control measurements, the collection of ~ 100 cells rod(-1) provided a 3-sigma confidence level of detection. The payload system described can be mated with any type of balloon platform and provides a tool for characterizing the vertical distribution of microorganisms in the troposphere and stratosphere. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Organizational and provider level factors in implementation of trauma-informed care after a city-wide training: an explanatory mixed methods assessment

    Directory of Open Access Journals (Sweden)

    April Joy Damian

    2017-11-01

    Full Text Available Abstract Background While there is increasing support for training youth-serving providers in trauma-informed care (TIC as a means of addressing high prevalence of U.S. childhood trauma, we know little about the effects of TIC training on organizational culture and providers’ professional quality of life. This mixed-methods study evaluated changes in organizational- and provider-level factors following participation in a citywide TIC training. Methods Government workers and nonprofit professionals (N = 90 who participated in a nine-month citywide TIC training completed a survey before and after the training to assess organizational culture and professional quality of life. Survey data were analyzed using multiple regression analyses. A subset of participants (n = 16 was interviewed using a semi-structured format, and themes related to organizational and provider factors were identified using qualitative methods. Results Analysis of survey data indicated significant improvements in participants’ organizational culture and professional satisfaction at training completion. Participants’ perceptions of their own burnout and secondary traumatic stress also increased. Four themes emerged from analysis of the interview data, including “Implementation of more flexible, less-punitive policies towards clients,” “Adoption of trauma-informed workplace design,” “Heightened awareness of own traumatic stress and need for self-care,” and “Greater sense of camaraderie and empathy for colleagues.” Conclusion Use of a mixed-methods approach provided a nuanced understanding of the impact of TIC training and suggested potential benefits of the training on organizational and provider-level factors associated with implementation of trauma-informed policies and practices. Future trainings should explicitly address organizational factors such as safety climate and morale, managerial support, teamwork climate and collaboration, and

  5. A method for generating high resolution satellite image time series

    Science.gov (United States)

    Guo, Tao

    2014-10-01

    There is an increasing demand for satellite remote sensing data with both high spatial and temporal resolution in many applications. But it still is a challenge to simultaneously improve spatial resolution and temporal frequency due to the technical limits of current satellite observation systems. To this end, much R&D efforts have been ongoing for years and lead to some successes roughly in two aspects, one includes super resolution, pan-sharpen etc. methods which can effectively enhance the spatial resolution and generate good visual effects, but hardly preserve spectral signatures and result in inadequate analytical value, on the other hand, time interpolation is a straight forward method to increase temporal frequency, however it increase little informative contents in fact. In this paper we presented a novel method to simulate high resolution time series data by combing low resolution time series data and a very small number of high resolution data only. Our method starts with a pair of high and low resolution data set, and then a spatial registration is done by introducing LDA model to map high and low resolution pixels correspondingly. Afterwards, temporal change information is captured through a comparison of low resolution time series data, and then projected onto the high resolution data plane and assigned to each high resolution pixel according to the predefined temporal change patterns of each type of ground objects. Finally the simulated high resolution data is generated. A preliminary experiment shows that our method can simulate a high resolution data with a reasonable accuracy. The contribution of our method is to enable timely monitoring of temporal changes through analysis of time sequence of low resolution images only, and usage of costly high resolution data can be reduces as much as possible, and it presents a highly effective way to build up an economically operational monitoring solution for agriculture, forest, land use investigation

  6. Applicable technical method for freeze-substitution of high pressure ...

    African Journals Online (AJOL)

    bmshsj

    2011-11-02

    Quintana, 1994) are available for the microscopic visualization of intracellular organelles. Cryo- fixation, plunge freezing, propane jet freezing, cold metal block freezing, and high pressure freezing provide advantages over chemical ...

  7. High-throughput method for optimum solubility screening for homogeneity and crystallization of proteins

    Science.gov (United States)

    Kim, Sung-Hou [Moraga, CA; Kim, Rosalind [Moraga, CA; Jancarik, Jamila [Walnut Creek, CA

    2012-01-31

    An optimum solubility screen in which a panel of buffers and many additives are provided in order to obtain the most homogeneous and monodisperse protein condition for protein crystallization. The present methods are useful for proteins that aggregate and cannot be concentrated prior to setting up crystallization screens. A high-throughput method using the hanging-drop method and vapor diffusion equilibrium and a panel of twenty-four buffers is further provided. Using the present methods, 14 poorly behaving proteins have been screened, resulting in 11 of the proteins having highly improved dynamic light scattering results allowing concentration of the proteins, and 9 were crystallized.

  8. Improving maternal and neonatal departments in high and low resource settings: the opinion of local health providers.

    Science.gov (United States)

    Trevisanuto, Daniele; Bavuusuren, Bayasgalantai; Wickramasinghe, Chandani S; Dharmaratne, Saminda M; Doglioni, Nicoletta; Giordan, Alessia; Zanardo, Vincenzo; Carlo, Waldemar A

    2011-10-01

    We compared local health caregivers' opinions regarding the priority areas for improving the maternal and neonatal departments in low and high resource countries. Personnel involved in maternal and neonatal care operating in level III, teaching hospitals in four countries (Sri Lanka, Mongolia, USA, and Italy) were asked to fill out an anonymous, written questionnaire. The questionnaire was completed by 1112 out of 1265 (87.9%) participants. "Personnel's education" was classified as the first most important intervention by health providers working in high (49.0%) as well as in low (29.9%) resource countries, respectively. Improvement in salary, equipment, internet access, and organizational protocols were considered as the most important interventions by a significantly larger percentage of personnel from low resource countries in comparison with those from high resource countries. Health providers from high resource countries considered organizational aspects (to define specific roles and responsibilities) as a priority more frequently than their colleagues from low resource countries. Although education of personnel was valued as the highest priority for improving maternal and neonatal departments there are substantial differences in priorities associated with the working setting. Local caregivers' opinion may contribute to better design interventions in settings with high or limited resources.

  9. Evidence-based practice beliefs and behaviors of nurses providing cancer pain management: a mixed-methods approach.

    Science.gov (United States)

    Eaton, Linda H; Meins, Alexa R; Mitchell, Pamela H; Voss, Joachim; Doorenbos, Ardith Z

    2015-03-01

    To describe evidence-based practice (EBP) beliefs and behaviors of nurses who provide cancer pain management. Descriptive, cross-sectional with a mixed-methods approach. Two inpatient oncology units in the Pacific Northwest. 40 RNs.
 Data collected by interviews and web-based surveys. EBP beliefs, EBP implementation, evidence-based pain management. Nurses agreed with the positive aspects of EBP and their implementation ability, although implementation level was low. They were satisfied with their pain management practices. Oncology nursing certification was associated with innovativeness, and innovativeness was associated with EBP beliefs. Themes identified were (a) limited definition of EBP, (b) varied evidence-based pain management decision making, (c) limited identification of evidence-based pain management practices, and (d) integration of nonpharmacologic interventions into patient care. Nurses' low level of EBP implementation in the context of pain management was explained by their trust that standards of care and medical orders were evidence-based. Nurses' EBP beliefs and behaviors should be considered when developing strategies for sustaining evidence-based pain management practices. Implementation of the EBP process by nurses may not be realistic in the inpatient setting; therefore, hospital pain management policies need to be evidence-based and reinforced with nurses.

  10. Unfolding methods in high-energy physics experiments

    International Nuclear Information System (INIS)

    Blobel, V.

    1985-01-01

    Distributions measured in high-energy physics experiments are often distorted or transformed by limited acceptance and finite resolution of the detectors. The unfolding of measured distributions is an important, but due to inherent instabilities a very difficult problem. Methods for unfolding, applicable for the analysis of high-energy physics experiments, and their properties are discussed. An introduction is given to the method of regularization. (orig.)

  11. Unfolding methods in high-energy physics experiments

    International Nuclear Information System (INIS)

    Blobel, V.

    1984-12-01

    Distributions measured in high-energy physics experiments are often distorted or transformed by limited acceptance and finite resolution of the detectors. The unfolding of measured distributions is an important, but due to inherent instabilities a very difficult problem. Methods for unfolding, applicable for the analysis of high-energy physics experiments, and their properties are discussed. An introduction is given to the method of regularization. (orig.)

  12. System and method for high precision isotope ratio destructive analysis

    Science.gov (United States)

    Bushaw, Bruce A; Anheier, Norman C; Phillips, Jon R

    2013-07-02

    A system and process are disclosed that provide high accuracy and high precision destructive analysis measurements for isotope ratio determination of relative isotope abundance distributions in liquids, solids, and particulate samples. The invention utilizes a collinear probe beam to interrogate a laser ablated plume. This invention provides enhanced single-shot detection sensitivity approaching the femtogram range, and isotope ratios that can be determined at approximately 1% or better precision and accuracy (relative standard deviation).

  13. Irregular grid methods for pricing high-dimensional American options

    NARCIS (Netherlands)

    Berridge, S.J.

    2004-01-01

    This thesis proposes and studies numerical methods for pricing high-dimensional American options; important examples being basket options, Bermudan swaptions and real options. Four new methods are presented and analysed, both in terms of their application to various test problems, and in terms of

  14. Buffer-Free High Performance Liquid Chromatography Method for ...

    African Journals Online (AJOL)

    Purpose: To develop and validate a simple, economical and reproducible high performance liquid chromatographic (HPLC) method for the determination of theophylline in pharmaceutical dosage forms. Method: Caffeine was used as the internal standard and reversed phase C-18 column was used to elute the drug and ...

  15. The Method of High School English Word Learning

    Institute of Scientific and Technical Information of China (English)

    吴博涵

    2016-01-01

    Most Chinese students are not interested in English learning, especially English words. In this paper, I focus on English vocabulary learning, for example, the study of high school students English word learning method, and also introduce several ways to make vocabulary memory becomes more effective. The purpose is to make high school students grasp more English word learning skills.

  16. Beam shaping to provide round and square-shaped beams in optical systems of high-power lasers

    Science.gov (United States)

    Laskin, Alexander; Laskin, Vadim

    2016-05-01

    Optical systems of modern high-power lasers require control of irradiance distribution: round or square-shaped flat-top or super-Gaussian irradiance profiles are optimum for amplification in MOPA lasers and for thermal load management while pumping of crystals of solid-state ultra-short pulse lasers to control heat and minimize its impact on the laser power and beam quality while maximizing overall laser efficiency, variable profiles are also important in irradiating of photocathode of Free Electron lasers (FEL). It is suggested to solve the task of irradiance re-distribution using field mapping refractive beam shapers like piShaper. The operational principle of these devices presumes transformation of laser beam intensity from Gaussian to flat-top one with high flatness of output wavefront, saving of beam consistency, providing collimated output beam of low divergence, high transmittance, extended depth of field, negligible residual wave aberration, and achromatic design provides capability to work with ultra-short pulse lasers having broad spectrum. Using the same piShaper device it is possible to realize beams with flat-top, inverse Gauss or super Gauss irradiance distribution by simple variation of input beam diameter, and the beam shape can be round or square with soft edges. This paper will describe some design basics of refractive beam shapers of the field mapping type and optical layouts of their applying in optical systems of high-power lasers. Examples of real implementations and experimental results will be presented as well.

  17. A high throughput DNA extraction method with high yield and quality

    Directory of Open Access Journals (Sweden)

    Xin Zhanguo

    2012-07-01

    Full Text Available Abstract Background Preparation of large quantity and high quality genomic DNA from a large number of plant samples is a major bottleneck for most genetic and genomic analyses, such as, genetic mapping, TILLING (Targeting Induced Local Lesion IN Genome, and next-generation sequencing directly from sheared genomic DNA. A variety of DNA preparation methods and commercial kits are available. However, they are either low throughput, low yield, or costly. Here, we describe a method for high throughput genomic DNA isolation from sorghum [Sorghum bicolor (L. Moench] leaves and dry seeds with high yield, high quality, and affordable cost. Results We developed a high throughput DNA isolation method by combining a high yield CTAB extraction method with an improved cleanup procedure based on MagAttract kit. The method yielded large quantity and high quality DNA from both lyophilized sorghum leaves and dry seeds. The DNA yield was improved by nearly 30 fold with 4 times less consumption of MagAttract beads. The method can also be used in other plant species, including cotton leaves and pine needles. Conclusion A high throughput system for DNA extraction from sorghum leaves and seeds was developed and validated. The main advantages of the method are low cost, high yield, high quality, and high throughput. One person can process two 96-well plates in a working day at a cost of $0.10 per sample of magnetic beads plus other consumables that other methods will also need.

  18. High School Graduation Rates:Alternative Methods and Implications

    OpenAIRE

    Jing Miao; Walt Haney

    2004-01-01

    The No Child Left Behind Act has brought great attention to the high school graduation rate as one of the mandatory accountability measures for public school systems. However, there is no consensus on how to calculate the high school graduation rate given the lack of longitudinal databases that track individual students. This study reviews literature on and practices in reporting high school graduation rates, compares graduation rate estimates yielded from alternative methods, and estimates d...

  19. Apparatus and method for generating high density pulses of electrons

    International Nuclear Information System (INIS)

    Lee, C.; Oettinger, P.E.

    1981-01-01

    An apparatus and method are described for the production of high density pulses of electrons using a laser energized emitter. Caesium atoms from a low pressure vapour atmosphere are absorbed on and migrate from a metallic target rapidly heated by a laser to a high temperature. Due to this heating time being short compared with the residence time of the caesium atoms adsorbed on the target surface, copious electrons are emitted which form a high current density pulse. (U.K.)

  20. Design methods for high temperature power plant structures

    International Nuclear Information System (INIS)

    Townley, C.H.A.

    1984-01-01

    The subject is discussed under the headings: introduction (scope of paper - reviews of design methods and design criteria currently in use for both nuclear and fossil fuelled power plant; examples chosen are (a) BS 1113, representative of design codes employed for power station boiler plant; (b) ASME Code Case N47, which is being developed for high temperature nuclear reactors, especially the liquid metal fast breeder reactor); design codes for power station boilers; Code Case N47 (design in the absence of thermal shock and thermal fatigue; design against cyclic loading at high temperature; further research in support of high temperature design methods and criteria for LMFBRs); concluding remarks. (U.K.)

  1. A Comparison of Machine Learning Methods in a High-Dimensional Classification Problem

    OpenAIRE

    Zekić-Sušac, Marijana; Pfeifer, Sanja; Šarlija, Nataša

    2014-01-01

    Background: Large-dimensional data modelling often relies on variable reduction methods in the pre-processing and in the post-processing stage. However, such a reduction usually provides less information and yields a lower accuracy of the model. Objectives: The aim of this paper is to assess the high-dimensional classification problem of recognizing entrepreneurial intentions of students by machine learning methods. Methods/Approach: Four methods were tested: artificial neural networks, CART ...

  2. High speed manyframe optical methods for plasma diagnostics

    International Nuclear Information System (INIS)

    Erokhin, A.A.; Shikanov, A.S.; Sklizkov, G.V.; Zakharenkov, Yu.A.; Zorev, N.N.

    1979-01-01

    A complex of active optical plasma and strong ionized shock wave diagnostics is described. The complex consisted of a specially developed high speed manyframe systems of shadow, schlieren and interferometric photography. The comparison of results obtained by a simultaneous registration of investigated object by means of different optical methods allowed us to determine optimal employment range for the methods. The sensitivity, temporal and space resolution of each optical method under conditions of high probe radiation refraction are discussed. The application boundaries of these methods for ionized shock wave investigation were found to depend on the shock wave front width. The methods described were used for the study of laser-produced plasma phenomena, occuring in the experiments on powerful nine-channel laser installation ''Kalmar''. (author)

  3. A simple high performance liquid chromatography method for analyzing paraquat in soil solution samples.

    Science.gov (United States)

    Ouyang, Ying; Mansell, Robert S; Nkedi-Kizza, Peter

    2004-01-01

    A high performance liquid chromatography (HPLC) method with UV detection was developed to analyze paraquat (1,1'-dimethyl-4,4'-dipyridinium dichloride) herbicide content in soil solution samples. The analytical method was compared with the liquid scintillation counting (LSC) method using 14C-paraquat. Agreement obtained between the two methods was reasonable. However, the detection limit for paraquat analysis was 0.5 mg L(-1) by the HPLC method and 0.05 mg L(-1) by the LSC method. The LSC method was, therefore, 10 times more precise than the HPLC method for solution concentrations less than 1 mg L(-1). In spite of the high detection limit, the UC (nonradioactive) HPLC method provides an inexpensive and environmentally safe means for determining paraquat concentration in soil solution compared with the 14C-LSC method.

  4. Quantitative fluorescence kinetic analysis of NADH and FAD in human plasma using three- and four-way calibration methods capable of providing the second-order advantage

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Chao [School of Chemistry and Chemical Engineering, Guizhou University, Guiyang 550025 (China); Wu, Hai-Long, E-mail: hlwu@hnu.edu.cn [State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Hunan University, Changsha 410082 (China); Zhou, Chang; Xiang, Shou-Xia; Zhang, Xiao-Hua; Yu, Yong-Jie; Yu, Ru-Qin [State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Hunan University, Changsha 410082 (China)

    2016-03-03

    The metabolic coenzymes reduced nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FAD) are the primary electron donor and acceptor respectively, participate in almost all biological metabolic pathways. This study develops a novel method for the quantitative kinetic analysis of the degradation reaction of NADH and the formation reaction of FAD in human plasma containing an uncalibrated interferent, by using three-way calibration based on multi-way fluorescence technique. In the three-way analysis, by using the calibration set in a static manner, we directly predicted the concentrations of both analytes in the mixture at any time after the start of their reactions, even in the presence of an uncalibrated spectral interferent and a varying background interferent. The satisfactory quantitative results indicate that the proposed method allows one to directly monitor the concentration of each analyte in the mixture as the function of time in real-time and nondestructively, instead of determining the concentration after the analytical separation. Thereafter, we fitted the first-order rate law to their concentration data throughout their reactions. Additionally, a four-way calibration procedure is developed as an alternative for highly collinear systems. The results of the four-way analysis confirmed the results of the three-way analysis and revealed that both the degradation reaction of NADH and the formation reaction of FAD in human plasma fit the first-order rate law. The proposed methods could be expected to provide promising tools for simultaneous kinetic analysis of multiple reactions in complex systems in real-time and nondestructively. - Highlights: • A novel three-way calibration method for the quantitative kinetic analysis of NADH and FAD in human plasma is proposed. • The method can directly monitor the concentration of each analyte in the reaction in real-time and nondestructively. • The method has the second-order advantage. • A

  5. Quantitative fluorescence kinetic analysis of NADH and FAD in human plasma using three- and four-way calibration methods capable of providing the second-order advantage

    International Nuclear Information System (INIS)

    Kang, Chao; Wu, Hai-Long; Zhou, Chang; Xiang, Shou-Xia; Zhang, Xiao-Hua; Yu, Yong-Jie; Yu, Ru-Qin

    2016-01-01

    The metabolic coenzymes reduced nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FAD) are the primary electron donor and acceptor respectively, participate in almost all biological metabolic pathways. This study develops a novel method for the quantitative kinetic analysis of the degradation reaction of NADH and the formation reaction of FAD in human plasma containing an uncalibrated interferent, by using three-way calibration based on multi-way fluorescence technique. In the three-way analysis, by using the calibration set in a static manner, we directly predicted the concentrations of both analytes in the mixture at any time after the start of their reactions, even in the presence of an uncalibrated spectral interferent and a varying background interferent. The satisfactory quantitative results indicate that the proposed method allows one to directly monitor the concentration of each analyte in the mixture as the function of time in real-time and nondestructively, instead of determining the concentration after the analytical separation. Thereafter, we fitted the first-order rate law to their concentration data throughout their reactions. Additionally, a four-way calibration procedure is developed as an alternative for highly collinear systems. The results of the four-way analysis confirmed the results of the three-way analysis and revealed that both the degradation reaction of NADH and the formation reaction of FAD in human plasma fit the first-order rate law. The proposed methods could be expected to provide promising tools for simultaneous kinetic analysis of multiple reactions in complex systems in real-time and nondestructively. - Highlights: • A novel three-way calibration method for the quantitative kinetic analysis of NADH and FAD in human plasma is proposed. • The method can directly monitor the concentration of each analyte in the reaction in real-time and nondestructively. • The method has the second-order advantage. • A

  6. Development of Thin Film Amorphous Silicon Tandem Junction Based Photocathodes Providing High Open-Circuit Voltages for Hydrogen Production

    Directory of Open Access Journals (Sweden)

    F. Urbain

    2014-01-01

    Full Text Available Hydrogenated amorphous silicon thin film tandem solar cells (a-Si:H/a-Si:H have been developed with focus on high open-circuit voltages for the direct application as photocathodes in photoelectrochemical water splitting devices. By temperature variation during deposition of the intrinsic a-Si:H absorber layers the band gap energy of a-Si:H absorber layers, correlating with the hydrogen content of the material, can be adjusted and combined in a way that a-Si:H/a-Si:H tandem solar cells provide open-circuit voltages up to 1.87 V. The applicability of the tandem solar cells as photocathodes was investigated in a photoelectrochemical cell (PEC measurement set-up. With platinum as a catalyst, the a-Si:H/a-Si:H based photocathodes exhibit a high photocurrent onset potential of 1.76 V versus the reversible hydrogen electrode (RHE and a photocurrent of 5.3 mA/cm2 at 0 V versus RHE (under halogen lamp illumination. Our results provide evidence that a direct application of thin film silicon based photocathodes fulfills the main thermodynamic requirements to generate hydrogen. Furthermore, the presented approach may provide an efficient and low-cost route to solar hydrogen production.

  7. High power ring methods and accelerator driven subcritical reactor application

    Energy Technology Data Exchange (ETDEWEB)

    Tahar, Malek Haj [Univ. of Grenoble (France)

    2016-08-07

    High power proton accelerators allow providing, by spallation reaction, the neutron fluxes necessary in the synthesis of fissile material, starting from Uranium 238 or Thorium 232. This is the basis of the concept of sub-critical operation of a reactor, for energy production or nuclear waste transmutation, with the objective of achieving cleaner, safer and more efficient process than today’s technologies allow. Designing, building and operating a proton accelerator in the 500-1000 MeV energy range, CW regime, MW power class still remains a challenge nowadays. There is a limited number of installations at present achieving beam characteristics in that class, e.g., PSI in Villigen, 590 MeV CW beam from a cyclotron, SNS in Oakland, 1 GeV pulsed beam from a linear accelerator, in addition to projects as the ESS in Europe, a 5 MW beam from a linear accelerator. Furthermore, coupling an accelerator to a sub-critical nuclear reactor is a challenging proposition: some of the key issues/requirements are the design of a spallation target to withstand high power densities as well as ensure the safety of the installation. These two domains are the grounds of the PhD work: the focus is on the high power ring methods in the frame of the KURRI FFAG collaboration in Japan: upgrade of the installation towards high intensity is crucial to demonstrate the high beam power capability of FFAG. Thus, modeling of the beam dynamics and benchmarking of different codes was undertaken to validate the simulation results. Experimental results revealed some major losses that need to be understood and eventually overcome. By developing analytical models that account for the field defects, one identified major sources of imperfection in the design of scaling FFAG that explain the important tune variations resulting in the crossing of several betatron resonances. A new formula is derived to compute the tunes and properties established that characterize the effect of the field imperfections on the

  8. The costs and cost-efficiency of providing food through schools in areas of high food insecurity.

    Science.gov (United States)

    Gelli, Aulo; Al-Shaiba, Najeeb; Espejo, Francisco

    2009-03-01

    The provision of food in and through schools has been used to support the education, health, and nutrition of school-aged children. The monitoring of financial inputs into school health and nutrition programs is critical for a number of reasons, including accountability, transparency, and equity. Furthermore, there is a gap in the evidence on the costs, cost-efficiency, and cost-effectiveness of providing food through schools, particularly in areas of high food insecurity. To estimate the programmatic costs and cost-efficiency associated with providing food through schools in food-insecure, developing-country contexts, by analyzing global project data from the World Food Programme (WFP). Project data, including expenditures and number of schoolchildren covered, were collected through project reports and validated through WFP Country Office records. Yearly project costs per schoolchild were standardized over a set number of feeding days and the amount of energy provided by the average ration. Output metrics, such as tonnage, calories, and micronutrient content, were used to assess the cost-efficiency of the different delivery mechanisms. The average yearly expenditure per child, standardized over a 200-day on-site feeding period and an average ration, excluding school-level costs, was US$21.59. The costs varied substantially according to choice of food modality, with fortified biscuits providing the least costly option of about US$11 per year and take-home rations providing the most expensive option at approximately US$52 per year. Comparisons across the different food modalities suggested that fortified biscuits provide the most cost-efficient option in terms of micronutrient delivery (particularly vitamin A and iodine), whereas on-site meals appear to be more efficient in terms of calories delivered. Transportation and logistics costs were the main drivers for the high costs. The choice of program objectives will to a large degree dictate the food modality

  9. High order spectral difference lattice Boltzmann method for incompressible hydrodynamics

    Science.gov (United States)

    Li, Weidong

    2017-09-01

    This work presents a lattice Boltzmann equation (LBE) based high order spectral difference method for incompressible flows. In the present method, the spectral difference (SD) method is adopted to discretize the convection and collision term of the LBE to obtain high order (≥3) accuracy. Because the SD scheme represents the solution as cell local polynomials and the solution polynomials have good tensor-product property, the present spectral difference lattice Boltzmann method (SD-LBM) can be implemented on arbitrary unstructured quadrilateral meshes for effective and efficient treatment of complex geometries. Thanks to only first oder PDEs involved in the LBE, no special techniques, such as hybridizable discontinuous Galerkin method (HDG), local discontinuous Galerkin method (LDG) and so on, are needed to discrete diffusion term, and thus, it simplifies the algorithm and implementation of the high order spectral difference method for simulating viscous flows. The proposed SD-LBM is validated with four incompressible flow benchmarks in two-dimensions: (a) the Poiseuille flow driven by a constant body force; (b) the lid-driven cavity flow without singularity at the two top corners-Burggraf flow; and (c) the unsteady Taylor-Green vortex flow; (d) the Blasius boundary-layer flow past a flat plate. Computational results are compared with analytical solutions of these cases and convergence studies of these cases are also given. The designed accuracy of the proposed SD-LBM is clearly verified.

  10. High viscosity fluid simulation using particle-based method

    KAUST Repository

    Chang, Yuanzhang

    2011-03-01

    We present a new particle-based method for high viscosity fluid simulation. In the method, a new elastic stress term, which is derived from a modified form of the Hooke\\'s law, is included in the traditional Navier-Stokes equation to simulate the movements of the high viscosity fluids. Benefiting from the Lagrangian nature of Smoothed Particle Hydrodynamics method, large flow deformation can be well handled easily and naturally. In addition, in order to eliminate the particle deficiency problem near the boundary, ghost particles are employed to enforce the solid boundary condition. Compared with Finite Element Methods with complicated and time-consuming remeshing operations, our method is much more straightforward to implement. Moreover, our method doesn\\'t need to store and compare to an initial rest state. The experimental results show that the proposed method is effective and efficient to handle the movements of highly viscous flows, and a large variety of different kinds of fluid behaviors can be well simulated by adjusting just one parameter. © 2011 IEEE.

  11. An unfolding method for high energy physics experiments

    International Nuclear Information System (INIS)

    Blobel, V.

    2002-06-01

    Finite detector resolution and limited acceptance require one to apply unfolding methods in high energy physics experiments. Information on the detector resolution is usually given by a set of Monte Carlo events. Based on the experience with a widely used unfolding program (RUN) a modified method has been developed. The first step of the method is a maximum likelihood fit of the Monte Carlo distributions to the measured distribution in one, two or three dimensions; the finite statistics of the Monte Carlo events is taken into account by the use of Barlow's method with a new method of solution. A clustering method is used before combining bins in sparsely populated areas. In the second step a regularization is applied to the solution, which introduces only a small bias. The regularization parameter is determined from the data after a diagonalization and rotation procedure. (orig.)

  12. A high-order SPH method by introducing inverse kernels

    Directory of Open Access Journals (Sweden)

    Le Fang

    2017-02-01

    Full Text Available The smoothed particle hydrodynamics (SPH method is usually expected to be an efficient numerical tool for calculating the fluid-structure interactions in compressors; however, an endogenetic restriction is the problem of low-order consistency. A high-order SPH method by introducing inverse kernels, which is quite easy to be implemented but efficient, is proposed for solving this restriction. The basic inverse method and the special treatment near boundary are introduced with also the discussion of the combination of the Least-Square (LS and Moving-Least-Square (MLS methods. Then detailed analysis in spectral space is presented for people to better understand this method. Finally we show three test examples to verify the method behavior.

  13. The perceptions of teachers and principals toward providing additional compensation to teachers in high-need subject areas

    Science.gov (United States)

    Longing, Jeffrey Lucian

    The purpose of this study was to determine possible differences in the perceptions of teachers teaching in high-need areas (i.e., math, science, special education, etc.) and teachers not teaching in high-need areas, (i.e., business education, physical education, etc.) as defined by the states of Arkansas and Louisiana, regarding higher compensation for high-need teachers. In addition, possible perception differences among principals and teachers were determined. The independent variables consisted of gender, position held, years of certified experience, and certification areas. The dependent variable was the perceptions of the participants on providing higher compensation for high-need teachers in order to attract and retain them. The data for all variables were collected using the Teacher Compensation Survey. The sample for this study was limited to teachers, grades 9 through 12, and principals of public high schools in south Arkansas and north Louisiana. Forty-four school districts in south Arkansas (Arkansas Department of Education, 2008a) and north Louisiana (Louisiana Department of Education, 2008a) met the criteria for this study. Twenty-two superintendents gave permission for their districts to participate in the research. A sample of 849 teachers and 38 principals were identified in these districts. Surveys were returned from 350 teachers, creating a 41% response rate. When the 31 principals that returned surveys were added to the total population, the response rate increased to 43% with 381 of the 887 surveyed responding. However, 42 of the teachers and two of the principals skipped some of the questions on the survey and were not included in the study. The researcher used a One-Way ANOVA and independent t-tests to determine the presence of statistical differences at the .05 level. The data showed that most math and science teachers agreed that high-need teachers should be compensated at a higher rate than teachers not teaching in high-need areas. The data

  14. Stable, fertile, high polyhydroxyalkanoate producing plants and methods of producing them

    Energy Technology Data Exchange (ETDEWEB)

    Bohmert-Tatarev, Karen; McAvoy, Susan; Peoples, Oliver P.; Snell, Kristi D.

    2015-08-04

    Transgenic plants that produce high levels of polyhydroxybutyrate and methods of producing them are provided. In a preferred embodiment the transgenic plants are produced using plastid transformation technologies and utilize genes which are codon optimized. Stably transformed plants able to produce greater than 10% dwt PHS in tissues are also provided.

  15. High-resolution method for evolving complex interface networks

    Science.gov (United States)

    Pan, Shucheng; Hu, Xiangyu Y.; Adams, Nikolaus A.

    2018-04-01

    In this paper we describe a high-resolution transport formulation of the regional level-set approach for an improved prediction of the evolution of complex interface networks. The novelty of this method is twofold: (i) construction of local level sets and reconstruction of a global level set, (ii) local transport of the interface network by employing high-order spatial discretization schemes for improved representation of complex topologies. Various numerical test cases of multi-region flow problems, including triple-point advection, single vortex flow, mean curvature flow, normal driven flow, dry foam dynamics and shock-bubble interaction show that the method is accurate and suitable for a wide range of complex interface-network evolutions. Its overall computational cost is comparable to the Semi-Lagrangian regional level-set method while the prediction accuracy is significantly improved. The approach thus offers a viable alternative to previous interface-network level-set method.

  16. High-resolution imaging methods in array signal processing

    DEFF Research Database (Denmark)

    Xenaki, Angeliki

    in active sonar signal processing for detection and imaging of submerged oil contamination in sea water from a deep-water oil leak. The submerged oil _eld is modeled as a uid medium exhibiting spatial perturbations in the acoustic parameters from their mean ambient values which cause weak scattering...... of the incident acoustic energy. A highfrequency active sonar is selected to insonify the medium and receive the backscattered waves. High-frequency acoustic methods can both overcome the optical opacity of water (unlike methods based on electromagnetic waves) and resolve the small-scale structure...... of the submerged oil field (unlike low-frequency acoustic methods). The study shows that high-frequency acoustic methods are suitable not only for large-scale localization of the oil contamination in the water column but also for statistical characterization of the submerged oil field through inference...

  17. Medical School Anatomy and Pathology Workshops for High School Students Enhance Learning and Provide Inspiration for Careers in Medicine

    Science.gov (United States)

    Fenderson, Bruce A.; Veloski, J. Jon; Livesey, Michael; Wojdon-Smith, Tracey

    2016-01-01

    “Anatomy and Pathology Workshop” is a cadaver-based outreach program that models medical education to large groups of high school students. This study was designed to evaluate the impact of this program on students’ knowledge of anatomy and interest in biomedical science. A total of 144 high school students participated in the workshop in 2015. Preworkshop and postworkshop assessments were administered to assess students’ learning. A postworkshop survey was conducted to solicit students’ reflections and feedback. It was found that student performance in the postworkshop examination (mean 78%) had significantly improved when compared to the performance in the preexamination (mean 54%), indicating that this program enhances learning. Students were also inspired to consider opportunities in medicine and allied health professions—97% indicated that they had a better understanding of medical education; 95% agreed that they had better understanding of the human body; 84% thought anatomy was interesting and exciting; and 62% of the students indicated that they looked forward to studying medicine or another health profession. Students rated the instructors highly—95% agreed that the instructors were professional and served as role models. Medical/graduate student instructors were also highly regarded by the high school students—96% thought it was valuable to have student instructors and 94% thought that student instructors were caring and enthusiastic about teaching. In summary, this study demonstrates that outreach programs provided by medical schools help young adults during their formative years by modeling professionalism, providing role models, enhancing learning, and encouraging many to consider opportunities in the health professions. PMID:28725784

  18. Methods of analytical check for highly pure tungsten

    International Nuclear Information System (INIS)

    Miklin, D.G.; Karpov, Yu.A.; Orlova, V.A.

    1993-01-01

    The review is devoted to the methods of high-purity tungsten analysis. Current trends in the development of this branch of analytical chemistry are considered. Application of both instrument mass-spectrometry analysis and optico-spectral, activation methods and mass-spectrometry ones with inductively-bound plasma in combination with preliminary isolation of the basis and impurity concentration is expected to be the most actual

  19. Strategy on review method for JENDL High Energy File

    Energy Technology Data Exchange (ETDEWEB)

    Yamano, Naoki [Sumitomo Atomic Energy Industries Ltd., Tokyo (Japan)

    1998-11-01

    Status on review method and problems for a High Energy File of Japanese Evaluated Nuclear Data Library (JENDL-HE File) has been described. Measurements on differential and integral data relevant to the review work for the JENDL-HE File have been examined from a viewpoint of data quality and applicability. In order to achieve the work effectively, strategy on development of standard review method has been discussed as well as necessity of tools to be used in the review scheme. (author)

  20. HiRadMat at CERN/SPS - A dedicated facility providing high intensity beam pulses to material samples

    CERN Multimedia

    Charitonidis, N; Efthymiopoulos, I

    2014-01-01

    HiRadMat (High Radiation to Materials), constructed in 2011, is a facility at CERN designed to provide high‐intensity pulsed beams to an irradiation area where material samples as well as accelerator component assemblies (e.g. vacuum windows, high power beam targets, collimators…) can be tested. The facility uses a 440 GeV proton beam extracted from the CERN SPS with a pulse length of up to 7.2 us, and with a maximum pulse energy of 3.4 MJ (3xE13 proton/pulse). In addition to protons, ion beams with energy of 440 GeV/charge and total pulse energy of 21 kJ can be provided. The beam parameters can be tuned to match the needs of each experiment. HiRadMat is not an irradiation facility where large doses on equipment can be accumulated. It is rather a test area designed to perform single pulse experiments to evaluate the effect of high‐intensity pulsed beams on materials or accelerator component assemblies in a controlled environment. The fa‐ cility is designed for a maximum of 1E16 protons per year, dist...

  1. Computational methods for high-energy source shielding

    International Nuclear Information System (INIS)

    Armstrong, T.W.; Cloth, P.; Filges, D.

    1983-01-01

    The computational methods for high-energy radiation transport related to shielding of the SNQ-spallation source are outlined. The basic approach is to couple radiation-transport computer codes which use Monte Carlo methods and discrete ordinates methods. A code system is suggested that incorporates state-of-the-art radiation-transport techniques. The stepwise verification of that system is briefly summarized. The complexity of the resulting code system suggests a more straightforward code specially tailored for thick shield calculations. A short guide line to future development of such a Monte Carlo code is given

  2. Size-specific dose estimate (SSDE) provides a simple method to calculate organ dose for pediatric CT examinations

    Energy Technology Data Exchange (ETDEWEB)

    Moore, Bria M.; Brady, Samuel L., E-mail: samuel.brady@stjude.org; Kaufman, Robert A. [Department of Radiological Sciences, St Jude Children' s Research Hospital, Memphis, Tennessee 38105 (United States); Mirro, Amy E. [Department of Biomedical Engineering, Washington University, St Louis, Missouri 63130 (United States)

    2014-07-15

    Purpose: To investigate the correlation of size-specific dose estimate (SSDE) with absorbed organ dose, and to develop a simple methodology for estimating patient organ dose in a pediatric population (5–55 kg). Methods: Four physical anthropomorphic phantoms representing a range of pediatric body habitus were scanned with metal oxide semiconductor field effect transistor (MOSFET) dosimeters placed at 23 organ locations to determine absolute organ dose. Phantom absolute organ dose was divided by phantom SSDE to determine correlation between organ dose and SSDE. Organ dose correlation factors (CF{sub SSDE}{sup organ}) were then multiplied by patient-specific SSDE to estimate patient organ dose. The CF{sub SSDE}{sup organ} were used to retrospectively estimate individual organ doses from 352 chest and 241 abdominopelvic pediatric CT examinations, where mean patient weight was 22 kg ± 15 (range 5–55 kg), and mean patient age was 6 yrs ± 5 (range 4 months to 23 yrs). Patient organ dose estimates were compared to published pediatric Monte Carlo study results. Results: Phantom effective diameters were matched with patient population effective diameters to within 4 cm; thus, showing appropriate scalability of the phantoms across the entire pediatric population in this study. IndividualCF{sub SSDE}{sup organ} were determined for a total of 23 organs in the chest and abdominopelvic region across nine weight subcategories. For organs fully covered by the scan volume, correlation in the chest (average 1.1; range 0.7–1.4) and abdominopelvic region (average 0.9; range 0.7–1.3) was near unity. For organ/tissue that extended beyond the scan volume (i.e., skin, bone marrow, and bone surface), correlation was determined to be poor (average 0.3; range: 0.1–0.4) for both the chest and abdominopelvic regions, respectively. A means to estimate patient organ dose was demonstrated. Calculated patient organ dose, using patient SSDE and CF{sub SSDE}{sup organ}, was compared to

  3. Method and apparatus for generating highly luminous flame

    Energy Technology Data Exchange (ETDEWEB)

    Gitman, G.M.

    1992-05-12

    A combustion process and apparatus are provided for generating a variable high temperature, highly luminous flame with low NOx emission by burning gaseous and liquid materials with oxygen and air. More particularly, the invention provides a process in which there is initial control of fuel, oxygen, and air flows and the delivery of the oxidizers to a burner as two oxidizing gases having different oxygen concentrations (for example, pure oxygen and air, or oxygen and oxygen-enriched air). A first oxidizing gas containing a high oxygen concentration is injected as a stream into the central zone of a combustion tunnel or chamber, and part of the fuel (preferably the major part) is injected into the central pyrolysis zone to mix with the first oxidizing gas to create a highly luminous high-temperature flame core containing microparticles of carbon of the proper size for maximum luminosity and high temperature, and a relatively small amount of hydrocarbon radicals. In addition, part of the fuel (preferably the minor part) is injected in a plurality of streams about the flame core to mix with a second oxidizing gas (containing a lower oxygen concentration than the first oxidizing gas) and injecting the second oxidizing mixture about the flame core and the minor fuel flow to mix with the minor fuel flow. This creates a plurality of fuel-lean (oxygen-rich) flames which are directed toward the luminous flame core to form a final flame pattern having high temperature, high luminosity, and low NOx content. 6 figs.

  4. Dose Tc-99m MIBI scintimammography provide more information additive to contrast enhanced MRI in highly suspected breast cancer patients?

    International Nuclear Information System (INIS)

    Kim, Seong Jang; Kim, In Ju; Kim, Yong Ki; Bae, Young Tae

    2000-01-01

    The aim of this study was to investigate whether Tc-99m MIBI scintimammography (SMM) provide more information than contrast enhanced MRI in highly suspected breast cancer patients. This study included 32 breast lesions of 29 highly suspected patients having breast cancer. All patients were performed SMM and contrast enhanced MRI. The SMMs and contrast enhanced MRI were correlated with histopathologic results. Thirty breast lesions were diagnosed malignant diseases and 2 were diagnosed benign diseases. SMM showed 29 true positives (TP), 1 true negative (TN), 1 false positive (FP), and 1 false negative (FN). The sensitivity was 96.6%. Contrast enhanced MRI revealed 24 TP, 0 TN, 1 FP, 3 FN and 4 indeterminate cases. The sensitivity was 88.8%. In the assessment of axillary lymph node metastasis, SMM showed 9 TP, 10 TN, 0 FP, and 3 FN. The sensitivity and specificity were 75% and 100%. Contrast enhanced MRI revealed 6 TP, 9 TN, 1 FP, and 6 FN. The sensitivity and specificity were 50% and 90%. Among 4 indeterminate cases with MRI findings, SMM correctly diagnosed malignant breast diseases in 3 lesions. However, SMM showed false positive in 1 lesion. SMM could correctly diagnosed malignant breast diseases more 5 lesions than contrast enhanced MRI. SMM revealed higher sensitivity in detection of primary breast cancer and axillary LN metastasis than contrast enhanced MRI. SMMs could correctly diagnosed malignant breast diseases even if the MRI showed indeterminate findings. In highly suspected patients having breast cancer, SMM may provide additive information in detection of breast cancer if contrast enhanced MRI showed indeterminate findings but this is to be determined later by large population based study

  5. The Patient-Provider Relationship Is Associated with Hepatitis C Treatment Eligibility: A Prospective Mixed-Methods Cohort Study.

    Directory of Open Access Journals (Sweden)

    Shari S Rogal

    Full Text Available Hepatitis C virus (HCV treatment has the potential to cure the leading cause of cirrhosis and hepatocellular carcinoma. However, only those deemed eligible for treatment have the possibility of this cure. Therefore, understanding the determinants of HCV treatment eligibility is critical. Given that effective communication with and trust in healthcare providers significantly influences treatment eligibility decisions in other diseases, we aimed to understand patient-provider interactions in the HCV treatment eligibility process. This prospective cohort study was conducted in the VA Pittsburgh Healthcare System. Patients were recruited after referral for gastroenterology consultation for HCV treatment with interferon and ribavirin. Consented patients completed semi-structured interviews and validated measures of depression, substance and alcohol use, and HCV knowledge. Two coders analyzed the semi-structured interviews. Factors associated with patient eligibility for interferon-based therapy were assessed using multivariate logistic regression. Of 339 subjects included in this analysis, only 56 (16.5% were deemed eligible for HCV therapy by gastroenterology (GI providers. In the multivariate logistic regression, patients who were older (OR = 0.96, 95%CI = 0.92-0.99, p = .049, reported concerns about the GI provider (OR = 0.40, 95%CI = 0.10-0.87, p = 0.02 and had depression symptoms (OR = 0.32, 95%CI = 0.17-0.63, p = 0.001 were less likely to be eligible. Patients described barriers that included feeling stigmatized and poor provider interpersonal or communication skills. In conclusion, we found that patients' perceptions of the relationship with their GI providers were associated with treatment eligibility. Establishing trust and effective communication channels between patients and providers may lower barriers to potential HCV cure.

  6. The design of a high-efficiency neutron counter for waste drums to provide optimized sensitivity for plutonium assay

    Energy Technology Data Exchange (ETDEWEB)

    Menlove, H.O.; Beddingfield, D.H.; Pickrell, M.M. [Los Alamos National Lab., NM (United States)] [and others

    1997-11-01

    An advanced passive neutron counter has been designed to improve the accuracy and sensitivity for the nondestructive assay of plutonium in scrap and waste containers. The High-Efficiency Neutron Counter (HENC) was developed under a Cooperative Research Development Agreement between the Los Alamos National Laboratory and Canberra Industries. The primary goal of the development was to produce a passive assay system for 200-L drums that has detectability limits and multiplicity counting features that are superior to previous systems. A detectability limit figure of merit (FOM) was defined that included the detector efficiency, the neutron die-away time, and the detector`s active volume and density that determine the cosmic-ray background. Monte Carlo neutron calculations were performed to determine the parameters to provide an optimum FOM. The system includes the {sup 252}Cf {open_quotes}add-a-source{close_quotes} feature to improve the accuracy as well as statistical filters to reduce the cosmic-ray spallation neutron background. The final decision gave an efficiency of 32% for plutonium with a detector {sup 3}He tube volume that is significantly smaller than for previous high-efficiency systems for 200-L drums. Because of the high efficiency of the HENC, we have incorporated neutron multiplicity counting for matrix corrections for those cases where the plutonium is localized in nonuniform hydrogenous materials. The paper describes the design and performance testing of the advanced system. 5 refs., 8 figs., 3 tabs.

  7. The design of a high-efficiency neutron counter for waste drums to provide optimized sensitivity for plutonium assay

    International Nuclear Information System (INIS)

    Menlove, H.O.; Beddingfield, D.H.; Pickrell, M.M.

    1997-01-01

    An advanced passive neutron counter has been designed to improve the accuracy and sensitivity for the nondestructive assay of plutonium in scrap and waste containers. The High-Efficiency Neutron Counter (HENC) was developed under a Cooperative Research Development Agreement between the Los Alamos National Laboratory and Canberra Industries. The primary goal of the development was to produce a passive assay system for 200-L drums that has detectability limits and multiplicity counting features that are superior to previous systems. A detectability limit figure of merit (FOM) was defined that included the detector efficiency, the neutron die-away time, and the detector's active volume and density that determine the cosmic-ray background. Monte Carlo neutron calculations were performed to determine the parameters to provide an optimum FOM. The system includes the 252 Cf open-quotes add-a-sourceclose quotes feature to improve the accuracy as well as statistical filters to reduce the cosmic-ray spallation neutron background. The final decision gave an efficiency of 32% for plutonium with a detector 3 He tube volume that is significantly smaller than for previous high-efficiency systems for 200-L drums. Because of the high efficiency of the HENC, we have incorporated neutron multiplicity counting for matrix corrections for those cases where the plutonium is localized in nonuniform hydrogenous materials. The paper describes the design and performance testing of the advanced system. 5 refs., 8 figs., 3 tabs

  8. Photosynthesis-dependent H2O2 transfer from chloroplasts to nuclei provides a high-light signalling mechanism.

    Science.gov (United States)

    Exposito-Rodriguez, Marino; Laissue, Pierre Philippe; Yvon-Durocher, Gabriel; Smirnoff, Nicholas; Mullineaux, Philip M

    2017-06-29

    Chloroplasts communicate information by signalling to nuclei during acclimation to fluctuating light. Several potential operating signals originating from chloroplasts have been proposed, but none have been shown to move to nuclei to modulate gene expression. One proposed signal is hydrogen peroxide (H 2 O 2 ) produced by chloroplasts in a light-dependent manner. Using HyPer2, a genetically encoded fluorescent H 2 O 2 sensor, we show that in photosynthetic Nicotiana benthamiana epidermal cells, exposure to high light increases H 2 O 2 production in chloroplast stroma, cytosol and nuclei. Critically, over-expression of stromal ascorbate peroxidase (H 2 O 2 scavenger) or treatment with DCMU (photosynthesis inhibitor) attenuates nuclear H 2 O 2 accumulation and high light-responsive gene expression. Cytosolic ascorbate peroxidase over-expression has little effect on nuclear H 2 O 2 accumulation and high light-responsive gene expression. This is because the H 2 O 2 derives from a sub-population of chloroplasts closely associated with nuclei. Therefore, direct H 2 O 2 transfer from chloroplasts to nuclei, avoiding the cytosol, enables photosynthetic control over gene expression.Multiple plastid-derived signals have been proposed but not shown to move to the nucleus to promote plant acclimation to fluctuating light. Here the authors use a fluorescent hydrogen peroxide sensor to provide evidence that H 2 O 2 is transferred directly from chloroplasts to nuclei to control nuclear gene expression.

  9. Sensitive high performance liquid chromatographic method for the ...

    African Journals Online (AJOL)

    A new simple, sensitive, cost-effective and reproducible high performance liquid chromatographic (HPLC) method for the determination of proguanil (PG) and its metabolites, cycloguanil (CG) and 4-chlorophenylbiguanide (4-CPB) in urine and plasma is described. The extraction procedure is a simple three-step process ...

  10. Method to fabricate block fuel elements for high temperature reactors

    International Nuclear Information System (INIS)

    Hrovat, M.; Rachor, L.

    1977-01-01

    The fabrication of block fuel elements for gas-cooled high temperature reactors can be improved upon by adding 0.2 to 2 wt.% of a hydrocarbon compound to the lubricating mixture prior to pressing. Hexanol or octanol are named as substances. The dimensional accuracy of the block is thus improved. 2 examples illustrate the method. (RW) [de

  11. Method to fabricate block fuel elements for high temperature reactors

    International Nuclear Information System (INIS)

    Hrovat, M.; Rachor, L.

    1978-01-01

    The fabrication of block fuel elements for gas-cooled high temperature reactors can be improved upon by adding 0.2 to 2 wt.% of a hydrocarbon compound to the lubricating mixture prior to pressing. Hexanol or octanol are named as substances. The dimensional accuracy of the block is thus improved. 2 examples illustrate the method. (orig./PW)

  12. HIGH YIELD AND RAPID SYNTHESES METHODS FOR PRODUCING METALLO-ORGANIC SALTS

    DEFF Research Database (Denmark)

    2005-01-01

    A new method for preparing salts of metal cations and organic acids, especially divalent salts of alkaline earth metal ions from group II of the periodic system and carboxylic acids. The method comprising the use of a high temperature (about 90° or more) and, optionally. high pressure, in order...... to obtain a higher yield, purity and faster reaction speed than obtained with known synthesis methods. In particular, the present invention relates to the production of strontium salts of carboxylic acids. Novel strontium salts are also provided by the present method....

  13. On the peculiarities of LDA method in two-phase flows with high concentrations of particles

    Science.gov (United States)

    Poplavski, S. V.; Boiko, V. M.; Nesterov, A. U.

    2016-10-01

    Popular applications of laser Doppler anemometry (LDA) in gas dynamics are reviewed. It is shown that the most popular method cannot be used in supersonic flows and two-phase flows with high concentrations of particles. A new approach to implementation of the known LDA method based on direct spectral analysis, which offers better prospects for such problems, is presented. It is demonstrated that the method is suitable for gas-liquid jets. Owing to the progress in laser engineering, digital recording of spectra, and computer processing of data, the method is implemented at a higher technical level and provides new prospects of diagnostics of high-velocity dense two-phase flows.

  14. Evaluation of a scattering correction method for high energy tomography

    Science.gov (United States)

    Tisseur, David; Bhatia, Navnina; Estre, Nicolas; Berge, Léonie; Eck, Daniel; Payan, Emmanuel

    2018-01-01

    One of the main drawbacks of Cone Beam Computed Tomography (CBCT) is the contribution of the scattered photons due to the object and the detector. Scattered photons are deflected from their original path after their interaction with the object. This additional contribution of the scattered photons results in increased measured intensities, since the scattered intensity simply adds to the transmitted intensity. This effect is seen as an overestimation in the measured intensity thus corresponding to an underestimation of absorption. This results in artifacts like cupping, shading, streaks etc. on the reconstructed images. Moreover, the scattered radiation provides a bias for the quantitative tomography reconstruction (for example atomic number and volumic mass measurement with dual-energy technique). The effect can be significant and difficult in the range of MeV energy using large objects due to higher Scatter to Primary Ratio (SPR). Additionally, the incident high energy photons which are scattered by the Compton effect are more forward directed and hence more likely to reach the detector. Moreover, for MeV energy range, the contribution of the photons produced by pair production and Bremsstrahlung process also becomes important. We propose an evaluation of a scattering correction technique based on the method named Scatter Kernel Superposition (SKS). The algorithm uses a continuously thickness-adapted kernels method. The analytical parameterizations of the scatter kernels are derived in terms of material thickness, to form continuously thickness-adapted kernel maps in order to correct the projections. This approach has proved to be efficient in producing better sampling of the kernels with respect to the object thickness. This technique offers applicability over a wide range of imaging conditions and gives users an additional advantage. Moreover, since no extra hardware is required by this approach, it forms a major advantage especially in those cases where

  15. Air-stable magnesium nanocomposites provide rapid and high-capacity hydrogen storage without using heavy-metal catalysts

    Science.gov (United States)

    Jeon, Ki-Joon; Moon, Hoi Ri; Ruminski, Anne M.; Jiang, Bin; Kisielowski, Christian; Bardhan, Rizia; Urban, Jeffrey J.

    2011-04-01

    Hydrogen is a promising alternative energy carrier that can potentially facilitate the transition from fossil fuels to sources of clean energy because of its prominent advantages such as high energy density (142 MJ kg-1 ref. 1), great variety of potential sources (for example water, biomass, organic matter), light weight, and low environmental impact (water is the sole combustion product). However, there remains a challenge to produce a material capable of simultaneously optimizing two conflicting criteria—absorbing hydrogen strongly enough to form a stable thermodynamic state, but weakly enough to release it on-demand with a small temperature rise. Many materials under development, including metal-organic frameworks, nanoporous polymers, and other carbon-based materials, physisorb only a small amount of hydrogen (typically 1-2 wt%) at room temperature. Metal hydrides were traditionally thought to be unsuitable materials because of their high bond formation enthalpies (for example MgH2 has a ΔHf˜75 kJ mol-1), thus requiring unacceptably high release temperatures resulting in low energy efficiency. However, recent theoretical calculations and metal-catalysed thin-film studies have shown that microstructuring of these materials can enhance the kinetics by decreasing diffusion path lengths for hydrogen and decreasing the required thickness of the poorly permeable hydride layer that forms during absorption. Here, we report the synthesis of an air-stable composite material that consists of metallic Mg nanocrystals (NCs) in a gas-barrier polymer matrix that enables both the storage of a high density of hydrogen (up to 6 wt% of Mg, 4 wt% for the composite) and rapid kinetics (loading in <30 min at 200 °C). Moreover, nanostructuring of the Mg provides rapid storage kinetics without using expensive heavy-metal catalysts.

  16. A high-throughput multiplex method adapted for GMO detection.

    Science.gov (United States)

    Chaouachi, Maher; Chupeau, Gaëlle; Berard, Aurélie; McKhann, Heather; Romaniuk, Marcel; Giancola, Sandra; Laval, Valérie; Bertheau, Yves; Brunel, Dominique

    2008-12-24

    A high-throughput multiplex assay for the detection of genetically modified organisms (GMO) was developed on the basis of the existing SNPlex method designed for SNP genotyping. This SNPlex assay allows the simultaneous detection of up to 48 short DNA sequences (approximately 70 bp; "signature sequences") from taxa endogenous reference genes, from GMO constructions, screening targets, construct-specific, and event-specific targets, and finally from donor organisms. This assay avoids certain shortcomings of multiplex PCR-based methods already in widespread use for GMO detection. The assay demonstrated high specificity and sensitivity. The results suggest that this assay is reliable, flexible, and cost- and time-effective for high-throughput GMO detection.

  17. A Post-Final Assignment for the Methods Course: Providing an Incentive to Professional Growth for Future Teachers.

    Science.gov (United States)

    Bentley, Michael L.

    This paper describes J. Rosengren's post-final assignment and M. Harmin's truth signs activity that were incorporated into a secondary science methods course for preservice teachers. The strength of the post-final assignment is that it is a strategy for extending student learning past the end of a course and even beyond the initial teaching…

  18. A new high-resolution electromagnetic method for subsurface imaging

    Science.gov (United States)

    Feng, Wanjie

    For most electromagnetic (EM) geophysical systems, the contamination of primary fields on secondary fields ultimately limits the capability of the controlled-source EM methods. Null coupling techniques were proposed to solve this problem. However, the small orientation errors in the null coupling systems greatly restrict the applications of these systems. Another problem encountered by most EM systems is the surface interference and geologic noise, which sometimes make the geophysical survey impossible to carry out. In order to solve these problems, the alternating target antenna coupling (ATAC) method was introduced, which greatly removed the influence of the primary field and reduced the surface interference. But this system has limitations on the maximum transmitter moment that can be used. The differential target antenna coupling (DTAC) method was proposed to allow much larger transmitter moments and at the same time maintain the advantages of the ATAC method. In this dissertation, first, the theoretical DTAC calculations were derived mathematically using Born and Wolf's complex magnetic vector. 1D layered and 2D blocked earth models were used to demonstrate that the DTAC method has no responses for 1D and 2D structures. Analytical studies of the plate model influenced by conductive and resistive backgrounds were presented to explain the physical phenomenology behind the DTAC method, which is the magnetic fields of the subsurface targets are required to be frequency dependent. Then, the advantages of the DTAC method, e.g., high-resolution, reducing the geologic noise and insensitive to surface interference, were analyzed using surface and subsurface numerical examples in the EMGIMA software. Next, the theoretical advantages, such as high resolution and insensitive to surface interference, were verified by designing and developing a low-power (moment of 50 Am 2) vertical-array DTAC system and testing it on controlled targets and scaled target coils. At last, a

  19. 47 CFR 52.31 - Deployment of long-term database methods for number portability by CMRS providers.

    Science.gov (United States)

    2010-10-01

    ... require software but not hardware changes to provide portability (“Hardware Capable Switches”), within 60... queries, so that they can deliver calls from their networks to any party that has retained its number after switching from one telecommunications carrier to another. (c) [Reserved] (d) In the event a...

  20. An optical device capable of providing a structural color, and a corresponding method of manufacturing such a device

    DEFF Research Database (Denmark)

    2014-01-01

    ) with respect to the average surface positions. The position, size, and randomness of the protrusions are arranged so as to provide, at least up to a maximum angle of incidence (A_in) with respect to a normal to the surface, an angle-independent substantially homogeneous structural color perception for a normal...

  1. District health manager and mid-level provider perceptions of practice environments in acute obstetric settings in Tanzania: a mixed-method study.

    Science.gov (United States)

    Ng'ang'a, Njoki; Byrne, Mary Woods; Kruk, Margaret E; Shemdoe, Aloisia; de Pinho, Helen

    2016-08-08

    In sub-Saharan Africa, the capacity of human resources for health (HRH) managers to create positive practice environments that enable motivated, productive, and high-performing HRH is weak. We implemented a unique approach to examining HRH management practices by comparing perspectives offered by mid-level providers (MLPs) of emergency obstetric care (EmOC) in Tanzania to those presented by local health authorities, known as council health management teams (CHMTs). This study was guided by the basic strategic human resources management (SHRM) component model. A convergent mixed-method design was utilized to assess qualitative and quantitative data from the Health Systems Strengthening for Equity: The Power and Potential of Mid-Level Providers project. Survey data was obtained from 837 mid-level providers, 83 of whom participated in a critical incident interview whose aim was to elicit negative events in the practice environment that induced intention to leave their job. HRH management practices were assessed quantitatively in 48 districts with 37 members of CHMTs participating in semi-structured interviews. The eight human resources management practices enumerated in the basic SHRM component model were implemented unevenly. On the one hand, members of CHMTs and mid-level providers agreed that there were severe shortages of health workers, deficient salaries, and an overwhelming workload. On the other hand, members of CHMTs and mid-level providers differed in their perspectives on rewards and allocation of opportunities for in-service training. Although written standards of performance and supervision requirements were available in most districts, they did not reflect actual duties. Members of CHMTs reported high levels of autonomy in key HRH management practices, but mid-level providers disputed the degree to which the real situation on the ground was factored into job-related decision-making by CHMTs. The incongruence in perspectives offered by members of CHMTs

  2. IEEE 802.15.4 Frame Aggregation Enhancement to Provide High Performance in Life-Critical Patient Monitoring Systems.

    Science.gov (United States)

    Akbar, Muhammad Sajjad; Yu, Hongnian; Cang, Shuang

    2017-01-28

    In wireless body area sensor networks (WBASNs), Quality of Service (QoS) provision for patient monitoring systems in terms of time-critical deadlines, high throughput and energy efficiency is a challenging task. The periodic data from these systems generates a large number of small packets in a short time period which needs an efficient channel access mechanism. The IEEE 802.15.4 standard is recommended for low power devices and widely used for many wireless sensor networks applications. It provides a hybrid channel access mechanism at the Media Access Control (MAC) layer which plays a key role in overall successful transmission in WBASNs. There are many WBASN's MAC protocols that use this hybrid channel access mechanism in variety of sensor applications. However, these protocols are less efficient for patient monitoring systems where life critical data requires limited delay, high throughput and energy efficient communication simultaneously. To address these issues, this paper proposes a frame aggregation scheme by using the aggregated-MAC protocol data unit (A-MPDU) which works with the IEEE 802.15.4 MAC layer. To implement the scheme accurately, we develop a traffic patterns analysis mechanism to understand the requirements of the sensor nodes in patient monitoring systems, then model the channel access to find the performance gap on the basis of obtained requirements, finally propose the design based on the needs of patient monitoring systems. The mechanism is initially verified using numerical modelling and then simulation is conducted using NS2.29, Castalia 3.2 and OMNeT++. The proposed scheme provides the optimal performance considering the required QoS.

  3. Application of unsupervised learning methods in high energy physics

    Energy Technology Data Exchange (ETDEWEB)

    Koevesarki, Peter; Nuncio Quiroz, Adriana Elizabeth; Brock, Ian C. [Physikalisches Institut, Universitaet Bonn, Bonn (Germany)

    2011-07-01

    High energy physics is a home for a variety of multivariate techniques, mainly due to the fundamentally probabilistic behaviour of nature. These methods generally require training based on some theory, in order to discriminate a known signal from a background. Nevertheless, new physics can show itself in ways that previously no one thought about, and in these cases conventional methods give little or no help. A possible way to discriminate between known processes (like vector bosons or top-quark production) or look for new physics is using unsupervised machine learning to extract the features of the data. A technique was developed, based on the combination of neural networks and the method of principal curves, to find a parametrisation of the non-linear correlations of the data. The feasibility of the method is shown on ATLAS data.

  4. High sensitivity phase retrieval method in grating-based x-ray phase contrast imaging

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Zhao; Gao, Kun; Chen, Jian; Wang, Dajiang; Wang, Shenghao; Chen, Heng; Bao, Yuan; Shao, Qigang; Wang, Zhili, E-mail: wangnsrl@ustc.edu.cn [National Synchrotron Radiation Laboratory, University of Science and Technology of China, Hefei 230029 (China); Zhang, Kai [Institute of High Energy Physics, Chinese Academy of Sciences, Beijing 100049 (China); Zhu, Peiping; Wu, Ziyu, E-mail: wuzy@ustc.edu.cn [National Synchrotron Radiation Laboratory, University of Science and Technology of China, Hefei 230029, China and Institute of High Energy Physics, Chinese Academy of Sciences, Beijing 100049 (China)

    2015-02-15

    Purpose: Grating-based x-ray phase contrast imaging is considered as one of the most promising techniques for future medical imaging. Many different methods have been developed to retrieve phase signal, among which the phase stepping (PS) method is widely used. However, further practical implementations are hindered, due to its complex scanning mode and high radiation dose. In contrast, the reverse projection (RP) method is a novel fast and low dose extraction approach. In this contribution, the authors present a quantitative analysis of the noise properties of the refraction signals retrieved by the two methods and compare their sensitivities. Methods: Using the error propagation formula, the authors analyze theoretically the signal-to-noise ratios (SNRs) of the refraction images retrieved by the two methods. Then, the sensitivities of the two extraction methods are compared under an identical exposure dose. Numerical experiments are performed to validate the theoretical results and provide some quantitative insight. Results: The SNRs of the two methods are both dependent on the system parameters, but in different ways. Comparison between their sensitivities reveals that for the refraction signal, the RP method possesses a higher sensitivity, especially in the case of high visibility and/or at the edge of the object. Conclusions: Compared with the PS method, the RP method has a superior sensitivity and provides refraction images with a higher SNR. Therefore, one can obtain highly sensitive refraction images in grating-based phase contrast imaging. This is very important for future preclinical and clinical implementations.

  5. High sensitivity phase retrieval method in grating-based x-ray phase contrast imaging

    International Nuclear Information System (INIS)

    Wu, Zhao; Gao, Kun; Chen, Jian; Wang, Dajiang; Wang, Shenghao; Chen, Heng; Bao, Yuan; Shao, Qigang; Wang, Zhili; Zhang, Kai; Zhu, Peiping; Wu, Ziyu

    2015-01-01

    Purpose: Grating-based x-ray phase contrast imaging is considered as one of the most promising techniques for future medical imaging. Many different methods have been developed to retrieve phase signal, among which the phase stepping (PS) method is widely used. However, further practical implementations are hindered, due to its complex scanning mode and high radiation dose. In contrast, the reverse projection (RP) method is a novel fast and low dose extraction approach. In this contribution, the authors present a quantitative analysis of the noise properties of the refraction signals retrieved by the two methods and compare their sensitivities. Methods: Using the error propagation formula, the authors analyze theoretically the signal-to-noise ratios (SNRs) of the refraction images retrieved by the two methods. Then, the sensitivities of the two extraction methods are compared under an identical exposure dose. Numerical experiments are performed to validate the theoretical results and provide some quantitative insight. Results: The SNRs of the two methods are both dependent on the system parameters, but in different ways. Comparison between their sensitivities reveals that for the refraction signal, the RP method possesses a higher sensitivity, especially in the case of high visibility and/or at the edge of the object. Conclusions: Compared with the PS method, the RP method has a superior sensitivity and provides refraction images with a higher SNR. Therefore, one can obtain highly sensitive refraction images in grating-based phase contrast imaging. This is very important for future preclinical and clinical implementations

  6. An overview of filtration methods that can provide protection from the macrofouling zebra mussel at hydroelectric facilities

    Energy Technology Data Exchange (ETDEWEB)

    Smythe, A.G.; Short, T.M. [Acres International Corp., Amherst, NY (United States)

    1995-12-31

    The non-indigenous freshwater zebra and quagga mussels (Dreissena, spp.) threaten to foul freshwater conduits throughout much of the United States and southern Canada. Initially, many electric facilities within the lower Great Lakes drainage were fouled. More recently, other systems both in and out of the Great Lakes, have been exposed to infested water facilitated by canals and boat traffic and impacted by the mussels. Mussels have clogged conduits and fouled equipment and monitoring sensors in relatively distant regions including the Hudson River, the Mississippi River south to New Orleans, and the Arkansas River into Oklahoma. Chemicals can effectively control the mussels, however, filtration methods promise to be a relatively cost effective, environmentally safe alternative control approach. Information on traditional filtration methods will be presented in this paper along with recent research results for in-line filters.

  7. FDG-PET status following chemoradiotherapy provides high management impact and powerful prognostic stratification in oesophageal cancer

    International Nuclear Information System (INIS)

    Duong, Cuong P.; Thomas, Robert J.S.; Hicks, Rodney J.; Drummond, Elizabeth; Weih, LeAnn; Leong, Trevor; Michael, Michael

    2006-01-01

    The purpose of this study was to evaluate the impact of FDG-PET following chemoradiotherapy (CRT) on treatment planning and survival in patients with oesophageal cancer (OC). Fifty-three consecutive OC patients had a post-treatment PET scan to evaluate tumour response to CRT prior to possible surgery. Baseline pre-CRT PET was performed in 33 patients. Prospectively recorded post-CRT management plans were compared with post-PET treatment. High impact was defined as a change in treatment intent or modality. Survival was analysed using the Kaplan-Meier product limit method and Cox proportional hazards regression model. After completion of CRT, 23/53 patients (43%) achieved complete metabolic response (CMR), as compared with only four (8%) with complete response on computed tomography. High PET impact was observed in 19 patients (36%). CMR was strongly predictive of survival (p<0.008) on multivariate analysis. CMR patients in whom resection was not performed had comparable survival to those (CMR and non-CMR) who underwent resection. The use of post-treatment FDG-PET for assessment of tumour response after CRT changed the clinical management of more than one-third of OC patients. CMR status as assessed by PET powerfully stratified prognosis. Even in the absence of a baseline study, normalisation of uptake at all sites of known tumoral involvement carries a good medium-term prognosis. (orig.)

  8. Detecting Android Malwares with High-Efficient Hybrid Analyzing Methods

    Directory of Open Access Journals (Sweden)

    Yu Liu

    2018-01-01

    Full Text Available In order to tackle the security issues caused by malwares of Android OS, we proposed a high-efficient hybrid-detecting scheme for Android malwares. Our scheme employed different analyzing methods (static and dynamic methods to construct a flexible detecting scheme. In this paper, we proposed some detecting techniques such as Com+ feature based on traditional Permission and API call features to improve the performance of static detection. The collapsing issue of traditional function call graph-based malware detection was also avoided, as we adopted feature selection and clustering method to unify function call graph features of various dimensions into same dimension. In order to verify the performance of our scheme, we built an open-access malware dataset in our experiments. The experimental results showed that the suggested scheme achieved high malware-detecting accuracy, and the scheme could be used to establish Android malware-detecting cloud services, which can automatically adopt high-efficiency analyzing methods according to the properties of the Android applications.

  9. Evaluation of Effective Factors on e-Loyalty in Organizations Providing Electronic Services using Fuzzy AHP Method

    Directory of Open Access Journals (Sweden)

    fatemeh mohammadi

    2012-12-01

    Full Text Available In today's business world, proper identification of customer’s requirements and a quick response to these requirements is a key to commercial success. Increasing customer loyalty affects the profitability and organizations can ensure their long-term interests by means of planning. In today's competitive world, the services provided by the competing company have to be more similar to each other and can be hard to surprise customers within completely new service in the long term, because the newest services are quickly imitated by competitors and marketed. Hence investment in customer loyalty is an effective and profitable investment for companies. One criticism that has entered into the e-service is customer loyalty. In order to study the causes of e-loyalty for organization providing e-services, this research identified the factors affecting customer loyalty in e-services and with questionnaire prepared and by using fuzzy hierarchical decision-making process acquires the weight of each factor and ultimately rank them. The results show that the quality of service provided to e-services customers is the most important factor in creating e-loyalty.

  10. On High-Order Upwind Methods for Advection

    Science.gov (United States)

    Huynh, Hung T.

    2017-01-01

    Scheme III (piecewise linear) and V (piecewise parabolic) of Van Leer are shown to yield identical solutions provided the initial conditions are chosen in an appropriate manner. This result is counter intuitive since it is generally believed that piecewise linear and piecewise parabolic methods cannot produce the same solutions due to their different degrees of approximation. The result also shows a key connection between the approaches of discontinuous and continuous representations.

  11. Optimized high-throughput microRNA expression profiling provides novel biomarker assessment of clinical prostate and breast cancer biopsies

    Directory of Open Access Journals (Sweden)

    Fedele Vita

    2006-06-01

    Full Text Available Abstract Background Recent studies indicate that microRNAs (miRNAs are mechanistically involved in the development of various human malignancies, suggesting that they represent a promising new class of cancer biomarkers. However, previously reported methods for measuring miRNA expression consume large amounts of tissue, prohibiting high-throughput miRNA profiling from typically small clinical samples such as excision or core needle biopsies of breast or prostate cancer. Here we describe a novel combination of linear amplification and labeling of miRNA for highly sensitive expression microarray profiling requiring only picogram quantities of purified microRNA. Results Comparison of microarray and qRT-PCR measured miRNA levels from two different prostate cancer cell lines showed concordance between the two platforms (Pearson correlation R2 = 0.81; and extension of the amplification, labeling and microarray platform was successfully demonstrated using clinical core and excision biopsy samples from breast and prostate cancer patients. Unsupervised clustering analysis of the prostate biopsy microarrays separated advanced and metastatic prostate cancers from pooled normal prostatic samples and from a non-malignant precursor lesion. Unsupervised clustering of the breast cancer microarrays significantly distinguished ErbB2-positive/ER-negative, ErbB2-positive/ER-positive, and ErbB2-negative/ER-positive breast cancer phenotypes (Fisher exact test, p = 0.03; as well, supervised analysis of these microarray profiles identified distinct miRNA subsets distinguishing ErbB2-positive from ErbB2-negative and ER-positive from ER-negative breast cancers, independent of other clinically important parameters (patient age; tumor size, node status and proliferation index. Conclusion In sum, these findings demonstrate that optimized high-throughput microRNA expression profiling offers novel biomarker identification from typically small clinical samples such as breast

  12. Organisational and environmental characteristics of residential aged care units providing highly person-centred care: a cross sectional study.

    Science.gov (United States)

    Sjögren, Karin; Lindkvist, Marie; Sandman, Per-Olof; Zingmark, Karin; Edvardsson, David

    2017-01-01

    Few studies have empirically investigated factors that define residential aged care units that are perceived as being highly person-centred. The purpose of this study was to explore factors characterising residential aged care units perceived as being highly person-centred, with a focus on organisational and environmental variables, as well as residents' and staff' characteristics. A cross-sectional design was used. Residents ( n  = 1460) and staff ( n  = 1213) data from 151 residential care units were collected, as well as data relating to characteristics of the organisation and environment, and data measuring degree of person-centred care. Participating staff provided self-reported data and conducted proxy ratings on residents . Descriptive and comparative statistics, independent samples t-test, Chi 2 test, Eta Squared and Phi coefficient were used to analyse data. Highly person-centred residential aged care units were characterized by having a shared philosophy of care, a satisfactory leadership, interdisciplinary collaboration and social support from colleagues and leaders, a dementia-friendly physical environment, staff having time to spend with residents, and a smaller unit size. Residential aged care units with higher levels of person-centred care had a higher proportion of staff with continuing education in dementia care, and a higher proportion of staff receiving regular supervision, compared to units with lower levels of person-centred care. It is important to target organisational and environmental factors, such as a shared philosophy of care, staff use of time, the physical environment, interdisciplinary support, and support from leaders and colleagues, to improve person-centred care in residential care units. Managers and leaders seeking to facilitate person-centred care in daily practice need to consider their own role in supporting, encouraging, and supervising staff.

  13. Method of making highly sinterable lanthanum chromite powder

    Science.gov (United States)

    Richards, Von L.; Singhal, Subhash C.

    1992-01-01

    A highly sinterable powder consisting essentially of LaCrO.sub.3, containing from 5 weight % to 20 weight % of a chromite of dopant Ca, Sr, Co, Ba, or Mg and a coating of a chromate of dopant Ca, Sr, Co, Ba, or Mg; is made by (1) forming a solution of La, Cr, and dopant; (2) heating their solutions; (3) forming a combined solution having a desired ratio of La, Cr, and dopant and heating to reduce solvent; (4) forming a foamed mass under vacuum; (5) burning off organic components and forming a charred material; (6) grinding the charred material; (7) heating the char at from 590.degree. C. to 950 C. in inert gas containing up to 50,000 ppm O.sub.2 to provide high specific surface area particles; (8) adding that material to a mixture of a nitrate of Cr and dopant to form a slurry; (9) grinding the particles in the slurry; (10) freeze or spray drying the slurry to provide a coating of nitrates on the particles; and (11) heating the coated particles to convert the nitrate coating to a chromate coating and provide a highly sinterable material having a high specific surface area of over 7 m.sup.2 /g.

  14. Formal Solutions for Polarized Radiative Transfer. II. High-order Methods

    Energy Technology Data Exchange (ETDEWEB)

    Janett, Gioele; Steiner, Oskar; Belluzzi, Luca, E-mail: gioele.janett@irsol.ch [Istituto Ricerche Solari Locarno (IRSOL), 6605 Locarno-Monti (Switzerland)

    2017-08-20

    When integrating the radiative transfer equation for polarized light, the necessity of high-order numerical methods is well known. In fact, well-performing high-order formal solvers enable higher accuracy and the use of coarser spatial grids. Aiming to provide a clear comparison between formal solvers, this work presents different high-order numerical schemes and applies the systematic analysis proposed by Janett et al., emphasizing their advantages and drawbacks in terms of order of accuracy, stability, and computational cost.

  15. Mixed Methods Survey of Zoonotic Disease Awareness and Practice among Animal and Human Healthcare Providers in Moshi, Tanzania.

    Directory of Open Access Journals (Sweden)

    Helen L Zhang

    2016-03-01

    Full Text Available Zoonoses are common causes of human and livestock illness in Tanzania. Previous studies have shown that brucellosis, leptospirosis, and Q fever account for a large proportion of human febrile illness in northern Tanzania, yet they are infrequently diagnosed. We conducted this study to assess awareness and knowledge regarding selected zoonoses among healthcare providers in Moshi, Tanzania; to determine what diagnostic and treatment protocols are utilized; and obtain insights into contextual factors contributing to the apparent under-diagnosis of zoonoses.We conducted a questionnaire about zoonoses knowledge, case reporting, and testing with 52 human health practitioners and 10 livestock health providers. Immediately following questionnaire administration, we conducted semi-structured interviews with 60 of these respondents, using the findings of a previous fever etiology study to prompt conversation. Sixty respondents (97% had heard of brucellosis, 26 (42% leptospirosis, and 20 (32% Q fever. Animal sector respondents reported seeing cases of animal brucellosis (4, rabies (4, and anthrax (3 in the previous 12 months. Human sector respondents reported cases of human brucellosis (15, 29%, rabies (9, 18% and anthrax (6, 12%. None reported leptospirosis or Q fever cases. Nineteen respondents were aware of a local diagnostic test for human brucellosis. Reports of tests for human leptospirosis or Q fever, or for any of the study pathogens in animals, were rare. Many respondents expressed awareness of malaria over-diagnosis and zoonoses under-diagnosis, and many identified low knowledge and testing capacity as reasons for zoonoses under-diagnosis.This study revealed differences in knowledge of different zoonoses and low case report frequencies of brucellosis, leptospirosis, and Q fever. There was a lack of known diagnostic services for leptospirosis and Q fever. These findings emphasize a need for improved diagnostic capacity alongside healthcare

  16. Survey of Processing Methods for High Strength High Conductivity Wires for High Field Magnet Applications

    Energy Technology Data Exchange (ETDEWEB)

    Han, K.; Embury, J.D.

    1998-10-01

    This paper will deal with the basic concepts of attaining combination of high strength and high conductivity in pure materials, in-situ composites and macrocomposites. It will survey current attainments, and outline where some future developments may lie in developing wire products that are close to the theoretical strength of future magnet applications.

  17. Survey of Processing Methods for High Strength High Conductivity Wires for High Field Magnet Applications

    International Nuclear Information System (INIS)

    Han, K.; Embury, J.D.

    1998-01-01

    This paper will deal with the basic concepts of attaining combination of high strength and high conductivity in pure materials, in-situ composites and macrocomposites. It will survey current attainments, and outline where some future developments may lie in developing wire products that are close to the theoretical strength of future magnet applications

  18. Method And Apparatus For Evaluatin Of High Temperature Superconductors

    Science.gov (United States)

    Fishman, Ilya M.; Kino, Gordon S.

    1996-11-12

    A technique for evaluation of high-T.sub.c superconducting films and single crystals is based on measurement of temperature dependence of differential optical reflectivity of high-T.sub.c materials. In the claimed method, specific parameters of the superconducting transition such as the critical temperature, anisotropy of the differential optical reflectivity response, and the part of the optical losses related to sample quality are measured. The apparatus for performing this technique includes pump and probe sources, cooling means for sweeping sample temperature across the critical temperature and polarization controller for controlling a state of polarization of a probe light beam.

  19. A modified Rietveld method to model highly anisotropic ceramics

    International Nuclear Information System (INIS)

    Tutuncu, G.; Motahari, M.; Daymond, M.R.; Ustundag, E.

    2012-01-01

    High energy X-ray diffraction was employed to probe the complex constitutive behavior of a polycrystalline ferroelectric material in various sample orientations. Pb(Zn,Nb)O 3 –Pb(Zr,Ti)O 3 (PZN–PZT) ceramics were subjected to a cyclic bipolar electric field while diffraction patterns were taken. Using transmission geometry and a two-dimensional detector, lattice strain and texture evolution (domain switching) were measured in multiple sample directions simultaneously. In addition, texture analysis suggests that non-180° domain switching is coupled with lattice strain evolution during uniaxial electrical loading. As a result of this material’s high strain anisotropy, the full-pattern Rietveld method was inadequate to analyze the diffraction data. Instead, a modified Rietveld method, which includes an elastic anisotropy term, yielded significant improvements in the data analysis results.

  20. High-speed and high-fidelity system and method for collecting network traffic

    Science.gov (United States)

    Weigle, Eric H [Los Alamos, NM

    2010-08-24

    A system is provided for the high-speed and high-fidelity collection of network traffic. The system can collect traffic at gigabit-per-second (Gbps) speeds, scale to terabit-per-second (Tbps) speeds, and support additional functions such as real-time network intrusion detection. The present system uses a dedicated operating system for traffic collection to maximize efficiency, scalability, and performance. A scalable infrastructure and apparatus for the present system is provided by splitting the work performed on one host onto multiple hosts. The present system simultaneously addresses the issues of scalability, performance, cost, and adaptability with respect to network monitoring, collection, and other network tasks. In addition to high-speed and high-fidelity network collection, the present system provides a flexible infrastructure to perform virtually any function at high speeds such as real-time network intrusion detection and wide-area network emulation for research purposes.

  1. Mosasauroid phylogeny under multiple phylogenetic methods provides new insights on the evolution of aquatic adaptations in the group.

    Directory of Open Access Journals (Sweden)

    Tiago R Simões

    Full Text Available Mosasauroids were a successful lineage of squamate reptiles (lizards and snakes that radiated during the Late Cretaceous (95-66 million years ago. They can be considered one of the few lineages in the evolutionary history of tetrapods to have acquired a fully aquatic lifestyle, similarly to whales, ichthyosaurs and plesiosaurs. Despite a long history of research on this group, their phylogenetic relationships have only been tested so far using traditional (unweighted maximum parsimony. However, hypotheses of mosasauroid relationships and the recently proposed multiple origins of aquatically adapted pelvic and pedal features in this group can be more thoroughly tested by methods that take into account variation in branch lengths and evolutionary rates. In this study, we present the first mosasauroid phylogenetic analysis performed under different analytical methods, including maximum likelihood, Bayesian inference, and implied weighting maximum parsimony. The results indicate a lack of congruence in the topological position of halisaurines and Dallasaurus. Additionally, the genus Prognathodon is paraphyletic under all hypotheses. Interestingly, a number of traditional mosasauroid clades become weakly supported, or unresolved, under Bayesian analyses. The reduced resolutions in some consensus trees create ambiguities concerning the evolution of fully aquatic pelvic/pedal conditions under many analyses. However, when enough resolution was obtained, reversals of the pelvic/pedal conditions were favoured by parsimony and likelihood ancestral state reconstructions instead of independent origins of aquatic features in mosasauroids. It is concluded that most of the observed discrepancies among the results can be associated with different analytical procedures, but also due to limited postcranial data on halisaurines, yaguarasaurines and Dallasaurus.

  2. Mosasauroid phylogeny under multiple phylogenetic methods provides new insights on the evolution of aquatic adaptations in the group

    Science.gov (United States)

    Vernygora, Oksana; Paparella, Ilaria; Jimenez-Huidobro, Paulina; Caldwell, Michael W.

    2017-01-01

    Mosasauroids were a successful lineage of squamate reptiles (lizards and snakes) that radiated during the Late Cretaceous (95–66 million years ago). They can be considered one of the few lineages in the evolutionary history of tetrapods to have acquired a fully aquatic lifestyle, similarly to whales, ichthyosaurs and plesiosaurs. Despite a long history of research on this group, their phylogenetic relationships have only been tested so far using traditional (unweighted) maximum parsimony. However, hypotheses of mosasauroid relationships and the recently proposed multiple origins of aquatically adapted pelvic and pedal features in this group can be more thoroughly tested by methods that take into account variation in branch lengths and evolutionary rates. In this study, we present the first mosasauroid phylogenetic analysis performed under different analytical methods, including maximum likelihood, Bayesian inference, and implied weighting maximum parsimony. The results indicate a lack of congruence in the topological position of halisaurines and Dallasaurus. Additionally, the genus Prognathodon is paraphyletic under all hypotheses. Interestingly, a number of traditional mosasauroid clades become weakly supported, or unresolved, under Bayesian analyses. The reduced resolutions in some consensus trees create ambiguities concerning the evolution of fully aquatic pelvic/pedal conditions under many analyses. However, when enough resolution was obtained, reversals of the pelvic/pedal conditions were favoured by parsimony and likelihood ancestral state reconstructions instead of independent origins of aquatic features in mosasauroids. It is concluded that most of the observed discrepancies among the results can be associated with different analytical procedures, but also due to limited postcranial data on halisaurines, yaguarasaurines and Dallasaurus. PMID:28467456

  3. High sensitive quench detection method using an integrated test wire

    International Nuclear Information System (INIS)

    Fevrier, A.; Tavergnier, J.P.; Nithart, H.; Kiblaire, M.; Duchateau, J.L.

    1981-01-01

    A high sensitive quench detection method which works even in the presence of an external perturbing magnetic field is reported. The quench signal is obtained from the difference in voltages at the superconducting winding terminals and at the terminals at a secondary winding strongly coupled to the primary. The secondary winding could consist of a ''zero-current strand'' of the superconducting cable not connected to one of the winding terminals or an integrated normal test wire inside the superconducting cable. Experimental results on quench detection obtained by this method are described. It is shown that the integrated test wire method leads to efficient and sensitive quench detection, especially in the presence of an external perturbing magnetic field

  4. CHOREOGRAPHIC METHODS FOR CREATING NOVEL, HIGH QUALITY DANCE

    Directory of Open Access Journals (Sweden)

    David Kirsh

    2016-02-01

    Full Text Available We undertook a detailed ethnographic study of the dance creation process of a noted choreographer and his distinguished troupe. All choreographer dancer interactions were videoed, the choreographer and dancers were interviewed extensively each day, as well as other observations and tests performed. The choreographer used three main methods to produce high quality and novel content: showing, making-on, and tasking. We present, analyze and evaluate these methods, and show how these approaches allow the choreographer to increase the creative output of the dancers and him. His methods, although designed for dance, apply more generally to other creative endeavors, especially where brainstorming is involved, and where the creative process is distributed over many individuals. His approach is also a case study in multi-modal direction, owing to the range of mechanisms he uses to communicate and direct.

  5. The various correction methods to the high precision aeromagnetic data

    International Nuclear Information System (INIS)

    Xu Guocang; Zhu Lin; Ning Yuanli; Meng Xiangbao; Zhang Hongjian

    2014-01-01

    In the airborne geophysical survey, an outstanding achievement first depends on the measurement precision of the instrument, and the choice of measurement conditions, the reliability of data collection, followed by the correct method of measurement data processing, the rationality of the data interpretation. Obviously, geophysical data processing is an important task for the comprehensive interpretation of the measurement results, processing method is correct or not directly related to the quality of the final results. we have developed a set of personal computer software to aeromagnetic and radiometric survey data processing in the process of actual production and scientific research in recent years, and successfully applied to the production. The processing methods and flowcharts to the high precision aromagnetic data were simply introduced in this paper. However, the mathematical techniques of the various correction programes to IGRF and flying height and magnetic diurnal variation were stressily discussed in the paper. Their processing effectness were illustrated by taking an example as well. (authors)

  6. High dimensional model representation method for fuzzy structural dynamics

    Science.gov (United States)

    Adhikari, S.; Chowdhury, R.; Friswell, M. I.

    2011-03-01

    Uncertainty propagation in multi-parameter complex structures possess significant computational challenges. This paper investigates the possibility of using the High Dimensional Model Representation (HDMR) approach when uncertain system parameters are modeled using fuzzy variables. In particular, the application of HDMR is proposed for fuzzy finite element analysis of linear dynamical systems. The HDMR expansion is an efficient formulation for high-dimensional mapping in complex systems if the higher order variable correlations are weak, thereby permitting the input-output relationship behavior to be captured by the terms of low-order. The computational effort to determine the expansion functions using the α-cut method scales polynomically with the number of variables rather than exponentially. This logic is based on the fundamental assumption underlying the HDMR representation that only low-order correlations among the input variables are likely to have significant impacts upon the outputs for most high-dimensional complex systems. The proposed method is first illustrated for multi-parameter nonlinear mathematical test functions with fuzzy variables. The method is then integrated with a commercial finite element software (ADINA). Modal analysis of a simplified aircraft wing with fuzzy parameters has been used to illustrate the generality of the proposed approach. In the numerical examples, triangular membership functions have been used and the results have been validated against direct Monte Carlo simulations. It is shown that using the proposed HDMR approach, the number of finite element function calls can be reduced without significantly compromising the accuracy.

  7. Method for strontium isolation from high-mineralized water

    International Nuclear Information System (INIS)

    Evzhanov, Kh.; Andriyasova, G.M.

    1983-01-01

    A method to isolate strontium from high-mineralized waters containing sodium, magnesium, calcium and strontium chlorides, which differ from the prototype method in a considerable decrease in energy consumption with the preservation of a high degree of Sr, Mg and Ca isolation selectivity, has been suggested. According to the method suggested mineralized waters are treated with alkali (NaOH) in the amount of 95-97% of stoichiometry by magnesium, then after separation of magnesium hydroxide precipitate mother liquor is treated with sodium carbonate in the amount of 50-60% of stoichiometry by calcium. After separation of calcium carbonate precipitate mother liquor is treated with NaOH in the amount of 130-135% of stoichiometry by calcium. After separation of calcium hydroxide precipitate from mother liquor by means of sodium carbonate introduction strontium carbonate is isolated. The degree of strontium extraction in the form of SrCO 3 constitutes 90.5% of its content in the initial solution. The method presented can be used for strontium separation from natural and waste waters

  8. A high order regularisation method for solving the Poisson equation and selected applications using vortex methods

    DEFF Research Database (Denmark)

    Hejlesen, Mads Mølholm

    ring dynamics is presented based on the alignment of the vorticity vector with the principal axis of the strain rate tensor.A novel iterative implementation of the Brinkman penalisation method is introduced for the enforcement of a fluid-solid interface in re-meshed vortex methods. The iterative scheme...... is included to explicitly fulfil the kinematic constraints of the flow field. The high order, unbounded particle-mesh based vortex method is used to simulate the instability, transition to turbulence and eventual destruction of a single vortex ring. From the simulation data, a novel analysis on the vortex...

  9. Comparison of high efficiency particulate filter testing methods

    International Nuclear Information System (INIS)

    1985-01-01

    High Efficiency Particulate Air (HEPA) filters are used for the removal of submicron size particulates from air streams. In nuclear industry they are used as an important engineering safeguard to prevent the release of air borne radioactive particulates to the environment. HEPA filters used in the nuclear industry should therefore be manufactured and operated under strict quality control. There are three levels of testing HEPA filters: i) testing of the filter media; ii) testing of the assembled filter including filter media and filter housing; and iii) on site testing of the complete filter installation before putting into operation and later for the purpose of periodic control. A co-ordinated research programme on particulate filter testing methods was taken up by the Agency and contracts were awarded to the Member Countries, Belgium, German Democratic Republic, India and Hungary. The investigations carried out by the participants of the present co-ordinated research programme include the results of the nowadays most frequently used HEPA filter testing methods both for filter medium test, rig test and in-situ test purposes. Most of the experiments were carried out at ambient temperature and humidity, but indications were given to extend the investigations to elevated temperature and humidity in the future for the purpose of testing the performance of HEPA filter under severe conditions. A major conclusion of the co-ordinated research programme was that it was not possible to recommend one method as a reference method for in situ testing of high efficiency particulate air filters. Most of the present conventional methods are adequate for current requirements. The reasons why no method is to be recommended were multiple, ranging from economical aspects, through incompatibility of materials to national regulations

  10. Perceptions of health care providers and patients on quality of care in maternal and neonatal health in fourteen Bangladesh government healthcare facilities: a mixed-method study.

    Science.gov (United States)

    Islam, Farzana; Rahman, Aminur; Halim, Abdul; Eriksson, Charli; Rahman, Fazlur; Dalal, Koustuv

    2015-06-19

    Bangladesh has achieved remarkable progress in healthcare with a steady decline in maternal and under-5 child mortality rates in efforts to achieve Millennium Development Goals 4 and 5. However, the mortality rates are still very high compared with high-income countries. The quality of healthcare needs improve to reduce mortality rates further. It is essential to investigate the current quality of healthcare before implementing any interventions. The study was conducted to explore the perception of healthcare providers about the quality of maternal and neonatal health (MNH) care. The study also investigated patient satisfaction with the MNH care received from district and sub-district hospitals. Both qualitative and quantitative methods were used in the study. Two district and 12 sub-district hospitals in Thakurgaon and Jamalpur in Bangladesh were the study settings. Fourteen group discussions and 56 in-depth interviews were conducted among the healthcare providers. Client exit interviews were conducted with 112 patients and their attendants from maternity, labor, and neonatal wards before being discharged from the hospitals. Eight physicians and four anthropologists collected data between November and December 2011 using pretested guidelines. The hospital staff identified several key factors that affected the quality of patient care: shortage of staff and logistics; lack of laboratory support; under use of patient-management protocols; a lack of training; and insufficient supervision. Doctors were unable to provide optimal care because of the high volume of patients. The exit interviews revealed that 85 % of respondents were satisfied with the hospital services received. Seven out of 14 respondents were satisfied with the cleanliness of the hospital facilities. More than half of the respondents were satisfied with the drugs they received. In half of the facilities, patients did not get an opportunity to ask the healthcare providers questions about their health

  11. Methods of erection of high-rise buildings

    Directory of Open Access Journals (Sweden)

    Cherednichenko Nadezhda

    2018-01-01

    Full Text Available The article contains the factors determining the choice of methods for organizing the construction and production of construction and installation work for the construction of high-rise buildings. There are also indicated specific features of their underground parts, characterized by powerful slab-pile foundations, large volumes of earthworks, reinforced bases and foundations for assembly cranes. The work cycle is considered when using reinforced concrete, steel and combined skeletons of high-rise buildings; the areas of application of flow, separate and complex methods are being disclosed. The main conditions for the erection of high-rise buildings and their components are singled out: the choice of formwork systems, delivery and lifting of concrete mixes, installation of reinforcement, the formation of lifting and transporting and auxiliary equipment. The article prescribes the reserves of reduction in the duration of construction due to the creation of: complex mechanized technologies for the efficient construction of foundations in various soil conditions, including in the heaving, swelling, hindered, subsidence, bulk, water-saturated forms; complex mechanized technologies for the erection of monolithic reinforced concrete structures, taking into account the winter conditions of production and the use of mobile concrete-laying complexes and new generation machines; modular formwork systems, distinguished by their versatility, ease, simplicity in operation suitable for complex high-rise construction; more perfect methodology and the development of a set of progressive organizational and technological solutions that ensure a rational relationship between the processes of production and their maximum overlap in time and space.

  12. Methods of erection of high-rise buildings

    Science.gov (United States)

    Cherednichenko, Nadezhda; Oleinik, Pavel

    2018-03-01

    The article contains the factors determining the choice of methods for organizing the construction and production of construction and installation work for the construction of high-rise buildings. There are also indicated specific features of their underground parts, characterized by powerful slab-pile foundations, large volumes of earthworks, reinforced bases and foundations for assembly cranes. The work cycle is considered when using reinforced concrete, steel and combined skeletons of high-rise buildings; the areas of application of flow, separate and complex methods are being disclosed. The main conditions for the erection of high-rise buildings and their components are singled out: the choice of formwork systems, delivery and lifting of concrete mixes, installation of reinforcement, the formation of lifting and transporting and auxiliary equipment. The article prescribes the reserves of reduction in the duration of construction due to the creation of: complex mechanized technologies for the efficient construction of foundations in various soil conditions, including in the heaving, swelling, hindered, subsidence, bulk, water-saturated forms; complex mechanized technologies for the erection of monolithic reinforced concrete structures, taking into account the winter conditions of production and the use of mobile concrete-laying complexes and new generation machines; modular formwork systems, distinguished by their versatility, ease, simplicity in operation suitable for complex high-rise construction; more perfect methodology and the development of a set of progressive organizational and technological solutions that ensure a rational relationship between the processes of production and their maximum overlap in time and space.

  13. Decomposition of pilocarpine eye drops assessed by a highly efficient high pressure liquid chromatographic method

    NARCIS (Netherlands)

    Kuks, P. F.; Weekers, L. E.; Goldhoorn, P. B.

    1990-01-01

    A rapid high-resolution high pressure liquid chromatographic method was developed for assaying pilocarpine. Pilocarpine in ophthalmic solutions decomposes fairly rapidly to give isopilocarpine, pilocarpic acid and isopilocarpic acid. The quality of an ophthalmic solution can be assessed by assaying

  14. Development of automatic image analysis methods for high-throughput and high-content screening

    NARCIS (Netherlands)

    Di, Zi

    2013-01-01

    This thesis focuses on the development of image analysis methods for ultra-high content analysis of high-throughput screens where cellular phenotype responses to various genetic or chemical perturbations that are under investigation. Our primary goal is to deliver efficient and robust image analysis

  15. Reduced basis ANOVA methods for partial differential equations with high-dimensional random inputs

    Energy Technology Data Exchange (ETDEWEB)

    Liao, Qifeng, E-mail: liaoqf@shanghaitech.edu.cn [School of Information Science and Technology, ShanghaiTech University, Shanghai 200031 (China); Lin, Guang, E-mail: guanglin@purdue.edu [Department of Mathematics & School of Mechanical Engineering, Purdue University, West Lafayette, IN 47907 (United States)

    2016-07-15

    In this paper we present a reduced basis ANOVA approach for partial deferential equations (PDEs) with random inputs. The ANOVA method combined with stochastic collocation methods provides model reduction in high-dimensional parameter space through decomposing high-dimensional inputs into unions of low-dimensional inputs. In this work, to further reduce the computational cost, we investigate spatial low-rank structures in the ANOVA-collocation method, and develop efficient spatial model reduction techniques using hierarchically generated reduced bases. We present a general mathematical framework of the methodology, validate its accuracy and demonstrate its efficiency with numerical experiments.

  16. Probabilistic Methods for Processing High-Throughput Sequencing Signals

    DEFF Research Database (Denmark)

    Sørensen, Lasse Maretty

    High-throughput sequencing has the potential to answer many of the big questions in biology and medicine. It can be used to determine the ancestry of species, to chart complex ecosystems and to understand and diagnose disease. However, going from raw sequencing data to biological or medical insig....... By estimating the genotypes on a set of candidate variants obtained from both a standard mapping-based approach as well as de novo assemblies, we are able to find considerably more structural variation than previous studies...... for reconstructing transcript sequences from RNA sequencing data. The method is based on a novel sparse prior distribution over transcript abundances and is markedly more accurate than existing approaches. The second chapter describes a new method for calling genotypes from a fixed set of candidate variants....... The method queries the reads using a graph representation of the variants and hereby mitigates the reference-bias that characterise standard genotyping methods. In the last chapter, we apply this method to call the genotypes of 50 deeply sequencing parent-offspring trios from the GenomeDenmark project...

  17. Efficiency of High Order Spectral Element Methods on Petascale Architectures

    KAUST Repository

    Hutchinson, Maxwell; Heinecke, Alexander; Pabst, Hans; Henry, Greg; Parsani, Matteo; Keyes, David E.

    2016-01-01

    High order methods for the solution of PDEs expose a tradeoff between computational cost and accuracy on a per degree of freedom basis. In many cases, the cost increases due to higher arithmetic intensity while affecting data movement minimally. As architectures tend towards wider vector instructions and expect higher arithmetic intensities, the best order for a particular simulation may change. This study highlights preferred orders by identifying the high order efficiency frontier of the spectral element method implemented in Nek5000 and NekBox: the set of orders and meshes that minimize computational cost at fixed accuracy. First, we extract Nek’s order-dependent computational kernels and demonstrate exceptional hardware utilization by hardware-aware implementations. Then, we perform productionscale calculations of the nonlinear single mode Rayleigh-Taylor instability on BlueGene/Q and Cray XC40-based supercomputers to highlight the influence of the architecture. Accuracy is defined with respect to physical observables, and computational costs are measured by the corehour charge of the entire application. The total number of grid points needed to achieve a given accuracy is reduced by increasing the polynomial order. On the XC40 and BlueGene/Q, polynomial orders as high as 31 and 15 come at no marginal cost per timestep, respectively. Taken together, these observations lead to a strong preference for high order discretizations that use fewer degrees of freedom. From a performance point of view, we demonstrate up to 60% full application bandwidth utilization at scale and achieve ≈1PFlop/s of compute performance in Nek’s most flop-intense methods.

  18. Efficiency of High Order Spectral Element Methods on Petascale Architectures

    KAUST Repository

    Hutchinson, Maxwell

    2016-06-14

    High order methods for the solution of PDEs expose a tradeoff between computational cost and accuracy on a per degree of freedom basis. In many cases, the cost increases due to higher arithmetic intensity while affecting data movement minimally. As architectures tend towards wider vector instructions and expect higher arithmetic intensities, the best order for a particular simulation may change. This study highlights preferred orders by identifying the high order efficiency frontier of the spectral element method implemented in Nek5000 and NekBox: the set of orders and meshes that minimize computational cost at fixed accuracy. First, we extract Nek’s order-dependent computational kernels and demonstrate exceptional hardware utilization by hardware-aware implementations. Then, we perform productionscale calculations of the nonlinear single mode Rayleigh-Taylor instability on BlueGene/Q and Cray XC40-based supercomputers to highlight the influence of the architecture. Accuracy is defined with respect to physical observables, and computational costs are measured by the corehour charge of the entire application. The total number of grid points needed to achieve a given accuracy is reduced by increasing the polynomial order. On the XC40 and BlueGene/Q, polynomial orders as high as 31 and 15 come at no marginal cost per timestep, respectively. Taken together, these observations lead to a strong preference for high order discretizations that use fewer degrees of freedom. From a performance point of view, we demonstrate up to 60% full application bandwidth utilization at scale and achieve ≈1PFlop/s of compute performance in Nek’s most flop-intense methods.

  19. A highly accurate method for determination of dissolved oxygen: Gravimetric Winkler method

    International Nuclear Information System (INIS)

    Helm, Irja; Jalukse, Lauri; Leito, Ivo

    2012-01-01

    Highlights: ► Probably the most accurate method available for dissolved oxygen concentration measurement was developed. ► Careful analysis of uncertainty sources was carried out and the method was optimized for minimizing all uncertainty sources as far as practical. ► This development enables more accurate calibration of dissolved oxygen sensors for routine analysis than has been possible before. - Abstract: A high-accuracy Winkler titration method has been developed for determination of dissolved oxygen concentration. Careful analysis of uncertainty sources relevant to the Winkler method was carried out and the method was optimized for minimizing all uncertainty sources as far as practical. The most important improvements were: gravimetric measurement of all solutions, pre-titration to minimize the effect of iodine volatilization, accurate amperometric end point detection and careful accounting for dissolved oxygen in the reagents. As a result, the developed method is possibly the most accurate method of determination of dissolved oxygen available. Depending on measurement conditions and on the dissolved oxygen concentration the combined standard uncertainties of the method are in the range of 0.012–0.018 mg dm −3 corresponding to the k = 2 expanded uncertainty in the range of 0.023–0.035 mg dm −3 (0.27–0.38%, relative). This development enables more accurate calibration of electrochemical and optical dissolved oxygen sensors for routine analysis than has been possible before.

  20. 24 CFR 1000.54 - What procedures apply to complaints arising out of any of the methods of providing for Indian...

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false What procedures apply to complaints arising out of any of the methods of providing for Indian preference? 1000.54 Section 1000.54 Housing and... ACTIVITIES General § 1000.54 What procedures apply to complaints arising out of any of the methods of...

  1. Screening halogenated environmental contaminants in biota based on isotopic pattern and mass defect provided by high resolution mass spectrometry profiling

    Energy Technology Data Exchange (ETDEWEB)

    Cariou, Ronan, E-mail: laberca@oniris-nantes.fr; Omer, Elsa; Léon, Alexis; Dervilly-Pinel, Gaud; Le Bizec, Bruno

    2016-09-14

    In the present work, we addressed the question of global seeking/screening organohalogenated compounds in a large panel of complex biological matrices, with a particular focus on unknown chemicals that may be considered as potential emerging hazards. A fishing strategy was developed based on untargeted profiling among full scan acquisition datasets provided by high resolution mass spectrometry. Since large datasets arise from such profiling, filtering useful information stands as a central question. In this way, we took advantage of the exact mass differences between Cl and Br isotopes. Indeed, our workflow involved an innovative Visual Basic for Applications script aiming at pairing features according to this mass difference, in order to point out potential organohalogenated clusters, preceded by an automated peak picking step based on the centWave function (xcms package of open access R programming environment). Then, H/Cl-scale mass defect plots were used to visualize the datasets before and after filtering. The filtering script was successfully applied to a dataset generated upon liquid chromatography coupled to ESI(−)-HRMS measurement from one eel muscle extract, allowing for realistic manual investigations of filtered clusters. Starting from 9789 initial obtained features, 1994 features were paired in 589 clusters. Hexabromocyclododecane, chlorinated paraffin series and various other compounds have been identified or tentatively identified, allowing thus broad screening of organohalogenated compounds in this extract. Although realistic, manual review of paired clusters remains time consuming and much effort should be devoted to automation. - Highlights: • We address the screening of halogenated compounds in large Full Scan HRMS datasets. • The workflow involves peak picking, pairing script and review of paired features. • The pairing script is based on exact mass differences between Cl and Br isotopes. • H/Cl scale mass defect plots are used to

  2. Screening halogenated environmental contaminants in biota based on isotopic pattern and mass defect provided by high resolution mass spectrometry profiling

    International Nuclear Information System (INIS)

    Cariou, Ronan; Omer, Elsa; Léon, Alexis; Dervilly-Pinel, Gaud; Le Bizec, Bruno

    2016-01-01

    In the present work, we addressed the question of global seeking/screening organohalogenated compounds in a large panel of complex biological matrices, with a particular focus on unknown chemicals that may be considered as potential emerging hazards. A fishing strategy was developed based on untargeted profiling among full scan acquisition datasets provided by high resolution mass spectrometry. Since large datasets arise from such profiling, filtering useful information stands as a central question. In this way, we took advantage of the exact mass differences between Cl and Br isotopes. Indeed, our workflow involved an innovative Visual Basic for Applications script aiming at pairing features according to this mass difference, in order to point out potential organohalogenated clusters, preceded by an automated peak picking step based on the centWave function (xcms package of open access R programming environment). Then, H/Cl-scale mass defect plots were used to visualize the datasets before and after filtering. The filtering script was successfully applied to a dataset generated upon liquid chromatography coupled to ESI(−)-HRMS measurement from one eel muscle extract, allowing for realistic manual investigations of filtered clusters. Starting from 9789 initial obtained features, 1994 features were paired in 589 clusters. Hexabromocyclododecane, chlorinated paraffin series and various other compounds have been identified or tentatively identified, allowing thus broad screening of organohalogenated compounds in this extract. Although realistic, manual review of paired clusters remains time consuming and much effort should be devoted to automation. - Highlights: • We address the screening of halogenated compounds in large Full Scan HRMS datasets. • The workflow involves peak picking, pairing script and review of paired features. • The pairing script is based on exact mass differences between Cl and Br isotopes. • H/Cl scale mass defect plots are used to

  3. Impact of High-Fidelity Simulation and Pharmacist-Specific Didactic Lectures in Addition to ACLS Provider Certification on Pharmacy Resident ACLS Performance.

    Science.gov (United States)

    Bartel, Billie J

    2014-08-01

    This pilot study explored the use of multidisciplinary high-fidelity simulation and additional pharmacist-focused training methods in training postgraduate year 1 (PGY1) pharmacy residents to provide Advanced Cardiovascular Life Support (ACLS) care. Pharmacy resident confidence and comfort level were assessed after completing these training requirements. The ACLS training requirements for pharmacy residents were revised to include didactic instruction on ACLS pharmacology and rhythm recognition and participation in multidisciplinary high-fidelity simulation ACLS experiences in addition to ACLS provider certification. Surveys were administered to participating residents to assess the impact of this additional education on resident confidence and comfort level in cardiopulmonary arrest situations. The new ACLS didactic and simulation training requirements resulted in increased resident confidence and comfort level in all assessed functions. Residents felt more confident in all areas except providing recommendations for dosing and administration of medications and rhythm recognition after completing the simulation scenarios than with ACLS certification training and the didactic components alone. All residents felt the addition of lectures and simulation experiences better prepared them to function as a pharmacist in the ACLS team. Additional ACLS training requirements for pharmacy residents increased overall awareness of pharmacist roles and responsibilities and greatly improved resident confidence and comfort level in performing most essential pharmacist functions during ACLS situations. © The Author(s) 2013.

  4. RCS Leak Rate Calculation with High Order Least Squares Method

    International Nuclear Information System (INIS)

    Lee, Jeong Hun; Kang, Young Kyu; Kim, Yang Ki

    2010-01-01

    As a part of action items for Application of Leak before Break(LBB), RCS Leak Rate Calculation Program is upgraded in Kori unit 3 and 4. For real time monitoring of operators, periodic calculation is needed and corresponding noise reduction scheme is used. This kind of study was issued in Korea, so there have upgraded and used real time RCS Leak Rate Calculation Program in UCN unit 3 and 4 and YGN unit 1 and 2. For reduction of the noise in signals, Linear Regression Method was used in those programs. Linear Regression Method is powerful method for noise reduction. But the system is not static with some alternative flow paths and this makes mixed trend patterns of input signal values. In this condition, the trend of signal and average of Linear Regression are not entirely same pattern. In this study, high order Least squares Method is used to follow the trend of signal and the order of calculation is rearranged. The result of calculation makes reasonable trend and the procedure is physically consistence

  5. High-performance liquid chromatographic method for guanylhydrazone compounds.

    Science.gov (United States)

    Cerami, C; Zhang, X; Ulrich, P; Bianchi, M; Tracey, K J; Berger, B J

    1996-01-12

    A high-performance liquid chromatographic method has been developed for a series of aromatic guanylhydrazones that have demonstrated therapeutic potential as anti-inflammatory agents. The compounds were separated using octadecyl or diisopropyloctyl reversed-phase columns, with an acetonitrile gradient in water containing heptane sulfonate, tetramethylammonium chloride, and phosphoric acid. The method was used to reliably quantify levels of analyte as low as 785 ng/ml, and the detector response was linear to at least 50 micrograms/ml using a 100 microliters injection volume. The assay system was used to determine the basic pharmacokinetics of a lead compound, CNI-1493, from serum concentrations following a single intravenous injection in rats.

  6. Application of the Oslo method to high resolution gamma spectra

    Science.gov (United States)

    Simon, A.; Guttormsen, M.; Larsen, A. C.; Beausang, C. W.; Humby, P.

    2015-10-01

    Hauser-Feshbach statistical model is a widely used tool for calculation of the reaction cross section, in particular for astrophysical processes. The HF model requires as an input an optical potential, gamma-strength function (GSF) and level density (LD) to properly model the statistical properties of the nucleus. The Oslo method is a well established technique to extract GSFs and LDs from experimental data, typically used for gamma-spectra obtained with scintillation detectors. Here, the first application of the Oslo method to high-resolution data obtained using the Ge detectors of the STARLITER setup at TAMU is discussed. The GSFs and LDs extracted from (p,d) and (p,t) reactions on 152154 ,Sm targets will be presented.

  7. Hydrodynamic characteristics of high speed settling clarifiers by radiotracer method

    International Nuclear Information System (INIS)

    Griffith Martinez, J.; Flores Juan, P.; Cuesta Borges, J.; Damera Martinez, A.; Ramos Espinosa, K. A

    2005-01-01

    Results achieved in the evaluation of two high-speed settling cane juice Clarifiers, one denominated ICINAZ The Express and the other one with Low Residence Time (BTR), both located at the sugar factory Orlando Gonzalez employing the well established radiotracer method (Tc-99m) are presented. Several trials performed at the two Clarifiers demonstrated that the one identified as BTR was capable to assimilate the whole flow capacity of the factory with adequate characteristic of the pattern flux and residence time in the environment of 1 hour. In the other side, ICINAZ The Express Clarifier could only work at relative low flow capacity of the factory with residence time closely to the two hours and achieving occasionally a pattern flux seriously affected by fluctuations in the milling process. The radiotracer method was able to detect certain differences between the two clear juice outlet of the BTR Clarifier, probably due some problems in the construction of this equipment

  8. High purity zirconium obtainment through the iodine compounds transport method

    International Nuclear Information System (INIS)

    Bolcich, J.C.; Zuzek, E.; Dutrus, S.M.; Corso, H.L.

    1987-01-01

    This paper describes the experimental method and the equipment designed, constructed and actually applied for the high purity zirconium obtainment from a zirconium sponge of the nuclear type. The mechanism of purification is based on the impure metal attack with gaseous iodine (at 200 deg C) to obtain zirconium tetra iodine as main product which is then transformed into a pure zirconium base (at 1000-1300 deg C), precipitating the metallic zirconium and releasing the gaseous iodine. From the first experiences carried out, pure zirconium has been obtained from an initial filament of 0.5 mm of diameter as well as wires up to 2.5 mm of diameter. This work presents the results from the studies and analysis made to characterize the material obtained. Finally, the refining methods to which the zirconium produced may be submitted so as to optimize the final purity are discussed. (Author)

  9. Thermally stimulated current method applied to highly irradiated silicon diodes

    CERN Document Server

    Pintilie, I; Pintilie, I; Moll, Michael; Fretwurst, E; Lindström, G

    2002-01-01

    We propose an improved method for the analysis of Thermally Stimulated Currents (TSC) measured on highly irradiated silicon diodes. The proposed TSC formula for the evaluation of a set of TSC spectra obtained with different reverse biases leads not only to the concentration of electron and hole traps visible in the spectra but also gives an estimation for the concentration of defects which not give rise to a peak in the 30-220 K TSC temperature range (very shallow or very deep levels). The method is applied to a diode irradiated with a neutron fluence of phi sub n =1.82x10 sup 1 sup 3 n/cm sup 2.

  10. Raising awareness of carrier testing for hereditary haemoglobinopathies in high-risk ethnic groups in the Netherlands: a pilot study among the general public and primary care providers

    Directory of Open Access Journals (Sweden)

    Cornel Martina C

    2009-09-01

    Full Text Available Abstract Background In the Netherlands no formal recommendations exist concerning preconceptional or antenatal testing for carriership of hereditary haemoglobinopathies. Those at highest risk may be unaware of the possibility of carrier screening. While universal newborn screening has recently been introduced, neither preconceptional nor antenatal carrier testing is routinely offered by health care services to the general public. A municipal health service and a foundation for public information on medical genetics undertook a pilot project with the aim of increasing knowledge and encouraging informed choice. Two groups were targeted: members of the public from ethnic groups at increased risk, and primary health care providers. This study examines the effectiveness of culturally specific 'infotainment' to inform high-risk ethnic groups about their increased risk for haemoglobinopathies. In addition, the study explores attitudes and intentions of primary care providers towards haemoglobinopathy carrier testing of their patients from high-risk ethnic groups. Methods Informational sessions tailored to the public or professionals were organised in Amsterdam, and evaluated for their effect. Psychological parameters were measured using structured questionnaires based on the Theory of Planned Behaviour. Results The pre-test/post-test questionnaire showed that members of the public gained understanding of inheritance and carriership of haemoglobinopathies from the "infotainment" session (p Conclusion The "infotainment" programme may have a positive effect on people from high-risk groups, but informed general practitioners and midwives were reluctant to facilitate their patients' getting tested. Additional initiatives are needed to motivate primary care providers to facilitate haemoglobinopathy carrier testing for their patients from high-risk backgrounds.

  11. Determination of vanadium in high grade carbons by radioanalytical methods

    International Nuclear Information System (INIS)

    Jinno, K.; Sato, M.; Amemiya, S.; Katoh, T.

    1980-01-01

    The present work deals with the determination of vanadium in high grade carbons by three radioanalytical methods, viz. thermal neutron activation analysis with an accelerator, thermal neutron activation analysis with a reactor and proton induced X-ray emission analysis with an accelerator. It is shown that thermal neutron activation with an accelerator is more convenient for the rapid and non-destructive analysis of ppm-level vanadium in bulk carbons than thermal neutron activation analysis with a reactor. Proton-induced X-ray emission is less useful for the analysis of bulk samples. (author)

  12. Improved beam jitter control methods for high energy laser systems

    OpenAIRE

    Frist, Duane C.

    2009-01-01

    Approved for public release, distribution unlimited The objective of this research was to develop beam jitter control methods for a High Energy Laser (HEL) testbed. The first step was to characterize the new HEL testbed at NPS. This included determination of natural frequencies and component models which were used to create a Matlab/Simulink model of the testbed. Adaptive filters using Filtered-X Least Mean Squares (FX-LMS) and Filtered-X Recursive Least Square (FX-RLS) were then implement...

  13. An objective method for High Dynamic Range source content selection

    DEFF Research Database (Denmark)

    Narwaria, Manish; Mantel, Claire; Da Silva, Matthieu Perreira

    2014-01-01

    With the aim of improving the immersive experience of the end user, High Dynamic Range (HDR) imaging has been gaining popularity. Therefore, proper validation and performance benchmarking of HDR processing algorithms is a key step towards standardization and commercial deployment. A crucial...... component of such validation studies is the selection of a challenging and balanced set of source (reference) HDR content. In order to facilitate this, we present an objective method based on the premise that a more challenging HDR scene encapsulates higher contrast, and as a result will show up more...

  14. A new method for detecting the contribution of high Rydberg states to electron-ion recombination

    International Nuclear Information System (INIS)

    Orban, I; Boehm, S; Fogle, M; Paal, A; Schuch, R

    2007-01-01

    A position sensitive detector for measuring field ionized electrons in the fringe field of a dipole magnet is presented. The detector provides a means to study, in a state selective fashion, recombination into high Rydberg states and offers a new method to investigate recombination enhancement effects. Several experimental considerations and possibilities are discussed in the text

  15. Systems and Methods for Implementing High-Temperature Tolerant Supercapacitors

    Science.gov (United States)

    Brandon, Erik J. (Inventor); West, William C. (Inventor); Bugga, Ratnakumar V. (Inventor)

    2016-01-01

    Systems and methods in accordance with embodiments of the invention implement high-temperature tolerant supercapacitors. In one embodiment, a high-temperature tolerant super capacitor includes a first electrode that is thermally stable between at least approximately 80C and approximately 300C; a second electrode that is thermally stable between at least approximately 80C and approximately 300C; an ionically conductive separator that is thermally stable between at least approximately 80C and 300C; an electrolyte that is thermally stable between approximately at least 80C and approximately 300C; where the first electrode and second electrode are separated by the separator such that the first electrode and second electrode are not in physical contact; and where each of the first electrode and second electrode is at least partially immersed in the electrolyte solution.

  16. Method for creating high carbon content products from biomass oil

    Science.gov (United States)

    Parker, Reginald; Seames, Wayne

    2012-12-18

    In a method for producing high carbon content products from biomass, a biomass oil is added to a cracking reactor vessel. The biomass oil is heated to a temperature ranging from about 100.degree. C. to about 800.degree. C. at a pressure ranging from about vacuum conditions to about 20,700 kPa for a time sufficient to crack the biomass oil. Tar is separated from the cracked biomass oil. The tar is heated to a temperature ranging from about 200.degree. C. to about 1500.degree. C. at a pressure ranging from about vacuum conditions to about 20,700 kPa for a time sufficient to reduce the tar to a high carbon content product containing at least about 50% carbon by weight.

  17. Development of a high velocity rain erosion test method

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Dong Teak; Jin, Doo Han [Korea University of Technology and Education, Cheonan (Korea, Republic of); Kang, Hyung [Agency for Defense Development, Daejeon (Korea, Republic of)

    2009-07-01

    The nose of a missile, flying through raining region with a supersonic speed, is subjected to the rain erosion because the nose is made of a brittle ceramic material. A simple yet very effective rain erosion test method is developed. The sabot assembly similar to the hypodermic syringe carries specific amount of water is launched by a low pressure air gun. After the stopper stop the sabot assembly by impact, the steel plunger continues moving toward to squeeze the silicon rubber in front. The pressurized silicon rubber then is squeezed through the orifice in front of the sabot at high velocity, thus, accelerates the water droplet to higher velocity. The droplet velocity up to 800m/s is successfully attained using a low pressure air gun. The ceramic specimen assembly is placed in front of the high speed water droplet and the rain erosion damage on the surface of the specimen is observed.

  18. Methods and applications in high flux neutron imaging

    International Nuclear Information System (INIS)

    Ballhausen, H.

    2007-01-01

    This treatise develops new methods for high flux neutron radiography and high flux neutron tomography and describes some of their applications in actual experiments. Instead of single images, time series can be acquired with short exposure times due to the available high intensity. To best use the increased amount of information, new estimators are proposed, which extract accurate results from the recorded ensembles, even if the individual piece of data is very noisy and in addition severely affected by systematic errors such as an influence of gamma background radiation. The spatial resolution of neutron radiographies, usually limited by beam divergence and inherent resolution of the scintillator, can be significantly increased by scanning the sample with a pinhole-micro-collimator. This technique circumvents any limitations in present detector design and, due to the available high intensity, could be successfully tested. Imaging with scattered neutrons as opposed to conventional total attenuation based imaging determines separately the absorption and scattering cross sections within the sample. For the first time even coherent angle dependent scattering could be visualized space-resolved. New applications of high flux neutron imaging are presented, such as materials engineering experiments on innovative metal joints, time-resolved tomography on multilayer stacks of fuel cells under operation, and others. A new implementation of an algorithm for the algebraic reconstruction of tomography data executes even in case of missing information, such as limited angle tomography, and returns quantitative reconstructions. The setup of the world-leading high flux radiography and tomography facility at the Institut Laue-Langevin is presented. A comprehensive appendix covers the physical and technical foundations of neutron imaging. (orig.)

  19. High resolution mass spectrometry method and system for analysis of whole proteins and other large molecules

    Science.gov (United States)

    Reilly, Peter T. A. [Knoxville, TN; Harris, William A [Naperville, IL

    2010-03-02

    A matrix assisted laser desorption/ionization (MALDI) method and related system for analyzing high molecular weight analytes includes the steps of providing at least one matrix-containing particle inside an ion trap, wherein at least one high molecular weight analyte molecule is provided within the matrix-containing particle, and MALDI on the high molecular weight particle while within the ion trap. A laser power used for ionization is sufficient to completely vaporize the particle and form at least one high molecular weight analyte ion, but is low enough to avoid fragmenting the high molecular weight analyte ion. The high molecular weight analyte ion is extracted out from the ion trap, and is then analyzed using a detector. The detector is preferably a pyrolyzing and ionizing detector.

  20. Teaching fluid mechanics to high schoolers: methods, challenges, and outcome

    Science.gov (United States)

    Manikantan, Harishankar

    2017-11-01

    This talk will summarize the goals, methods, and both short- and long-term feedback from two high-school-level courses in fluid mechanics involving 43 students and cumulatively spanning over 100 hours of instruction. The goals of these courses were twofold: (a) to spark an interest in science and engineering and attract a more diverse demographic into college-level STEM programs; and (b) to train students in a `college-like' method of approaching the physics of common phenomena, with fluid mechanics as the context. The methods of instruction included classes revolving around the idea of dispelling misconceptions, group activities, `challenge' rounds and mock design projects to use fluid mechanics phenomena to achieve a specified goal, and simple hands-on experiments. The feedback during instruction was overwhelmingly positive, particularly in terms of a changing and favorable attitude towards math and engineering. Long after the program, a visible impact lies in a diverse group of students acknowledging that the course had a positive effect in their decision to choose an engineering or science major in a four-year college.

  1. A novel propulsion method for high- Tc superconducting maglev vehicle

    Science.gov (United States)

    Ma, Guangtong; Wang, Jiasu; Wang, Suyu; Liu, Minxian; Jing, Hua; Lu, Yiyun; Lin, Qunxu

    2008-01-01

    High-Tc superconducting (HTS) maglev is considered as a perfect transportation type because of its unique inherent stability. A direct current (DC) linear motor using the permanent magnet guideway (PMG) as the stator and the on-board coil as the rotor instead of the present inductive or synchronous alternate current (AC) linear motor which has an economic disadvantage due to the necessity to lay primary coil along the guideway is proposed in this paper. In order to modulate the magnetic field under the PMG, an inverse E shape ferromagnetic device (IESFD) core is designed. The possible winding method for the on-board coil is listed, and the analytical result shows that a considerable net ampere force and thus the propulsion force can be generated by this special structure. The influence of the concentrated effect of the IESFD on the maglev performance of HTS bulk is studied by a numerical program, and the results show that the levitation force with the IESFD is 90% of that without. It is also indicated that the load capability and lateral performance of the maglev vehicle combined this propulsion method can be improved thanks to the attractive effect between the IESFD and PMG. The cost of the HTS maglev vehicle will be remarkably reduced and then shorten the distance to practical application with this propulsion method.

  2. High spin exotic states and new method for pairing energy

    International Nuclear Information System (INIS)

    Molique, H.

    1996-01-01

    We present a new method called 'PSY-MB', initially developed in the framework of abstract group theory for the solution of the problem of strongly interacting multi-fermionic systems with particular to systems in an external rotating field. The validity of the new method (PSY-MB) is tested on model Hamiltonians. A detailed comparison between the obtained solutions and the exact ones is performed. The new method is used in the study of realistic nuclear Hamiltonians based on the Woods-Saxon potential within the cranking approximation to study the influence of residual monopole pairing interactions in the rare-earth mass region. In parallel with this new technique we present original results obtained with the Woods-Saxon mean-field and the self-consistent Hartree-Fock approximation in order to investigate such exotic effects as octupole deformations and hexadecapole C 4 -polarizing deformations in the framework of high-spin physics. By developing these three approaches in one single work we prepare the ground for the nuclear structure calculations of the new generation - where the residual two-body interactions are taken into account also in the weak pairing limit. (author)

  3. Multi-element probabilistic collocation method in high dimensions

    International Nuclear Information System (INIS)

    Foo, Jasmine; Karniadakis, George Em

    2010-01-01

    We combine multi-element polynomial chaos with analysis of variance (ANOVA) functional decomposition to enhance the convergence rate of polynomial chaos in high dimensions and in problems with low stochastic regularity. Specifically, we employ the multi-element probabilistic collocation method MEPCM and so we refer to the new method as MEPCM-A. We investigate the dependence of the convergence of MEPCM-A on two decomposition parameters, the polynomial order μ and the effective dimension ν, with ν<< N, and N the nominal dimension. Numerical tests for multi-dimensional integration and for stochastic elliptic problems suggest that ν≥μ for monotonic convergence of the method. We also employ MEPCM-A to obtain error bars for the piezometric head at the Hanford nuclear waste site under stochastic hydraulic conductivity conditions. Finally, we compare the cost of MEPCM-A against Monte Carlo in several hundred dimensions, and we find MEPCM-A to be more efficient for up to 600 dimensions for a specific multi-dimensional integration problem involving a discontinuous function.

  4. Hydrodynamic characteristics of high speed settling clarifiers by radiotracer method

    International Nuclear Information System (INIS)

    Griffith Martinez, Jose; Damera Martinez, A.; Ramos Espinosa, K.

    2003-01-01

    Results achieved in the evaluation of two high-speed settling cane juice Clarifiers, one denominated ICINAZ The Express and the other one a modified SRI, both located at the sugar factory Orlando Gonzalez employing the well established radiotracer method (Tc-99m) are presented Several trials performed simultaneously at the two Clarifiers demonstrated that the modified SRI was capable to assimilate the whole flow capacity of the factory with adequate characteristic of the pattern flux and residence time in the environment of 1 hour. In the other side, ICINAZ The Express Clarifier could only work at relative low flow capacity of the factory with residence time closely to the two hours and achieving occasionally a pattern flux seriously affected by fluctuations in the milling process. The non-availability of a flow meter did not allow to extract more information related to some pattern flux anomalies, nevertheless, the radiotracer method was able to detect certain differences between the two clear juice outlet of the modified SRI Clarifier, probably due some problems in the construction of this equipment. This fact so as other goals achieved in this work, show once more the potentiality of the radiotracer method for this type of study related to the hydrodynamic characteristics of industrial facilities. (Author)

  5. Dissolution-recrystallization method for high efficiency perovskite solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Han, Fei; Luo, Junsheng; Wan, Zhongquan; Liu, Xingzhao; Jia, Chunyang, E-mail: cyjia@uestc.edu.cn

    2017-06-30

    Highlights: • Dissolution-recrystallization method can improve perovskite crystallization. • Dissolution-recrystallization method can improve TiO{sub 2}/perovskite interface. • The optimal perovskite solar cell obtains the champion PCE of 16.76%. • The optimal devices are of high reproducibility. - Abstract: In this work, a dissolution-recrystallization method (DRM) with chlorobenzene and dimethylsulfoxide treating the perovskite films during the spin-coating process is reported. This is the first time that DRM is used to control perovskite crystallization and improve the device performance. Furthermore, the DRM is good for reducing defects and grain boundaries, improving perovskite crystallization and even improving TiO{sub 2}/perovskite interface. By optimizing, the DRM2-treated perovskite solar cell (PSC) obtains the best photoelectric conversion efficiency (PCE) of 16.76% under AM 1.5 G illumination (100 mW cm{sup −2}) with enhanced J{sub sc} and V{sub oc} compared to CB-treated PSC.

  6. Highly efficient DNA extraction method from skeletal remains

    Directory of Open Access Journals (Sweden)

    Irena Zupanič Pajnič

    2011-03-01

    Full Text Available Background: This paper precisely describes the method of DNA extraction developed to acquire high quality DNA from the Second World War skeletal remains. The same method is also used for molecular genetic identification of unknown decomposed bodies in routine forensic casework where only bones and teeth are suitable for DNA typing. We analysed 109 bones and two teeth from WWII mass graves in Slovenia. Methods: We cleaned the bones and teeth, removed surface contaminants and ground the bones into powder, using liquid nitrogen . Prior to isolating the DNA in parallel using the BioRobot EZ1 (Qiagen, the powder was decalcified for three days. The nuclear DNA of the samples were quantified by real-time PCR method. We acquired autosomal genetic profiles and Y-chromosome haplotypes of the bones and teeth with PCR amplification of microsatellites, and mtDNA haplotypes 99. For the purpose of traceability in the event of contamination, we prepared elimination data bases including genetic profiles of the nuclear and mtDNA of all persons who have been in touch with the skeletal remains in any way. Results: We extracted up to 55 ng DNA/g of the teeth, up to 100 ng DNA/g of the femurs, up to 30 ng DNA/g of the tibias and up to 0.5 ng DNA/g of the humerus. The typing of autosomal and YSTR loci was successful in all of the teeth, in 98 % dekalof the femurs, and in 75 % to 81 % of the tibias and humerus. The typing of mtDNA was successful in all of the teeth, and in 96 % to 98 % of the bones. Conclusions: We managed to obtain nuclear DNA for successful STR typing from skeletal remains that were over 60 years old . The method of DNA extraction described here has proved to be highly efficient. We obtained 0.8 to 100 ng DNA/g of teeth or bones and complete genetic profiles of autosomal DNA, Y-STR haplotypes, and mtDNA haplotypes from only 0.5g bone and teeth samples.

  7. Standardized Method for High-throughput Sterilization of Arabidopsis Seeds.

    Science.gov (United States)

    Lindsey, Benson E; Rivero, Luz; Calhoun, Chistopher S; Grotewold, Erich; Brkljacic, Jelena

    2017-10-17

    Arabidopsis thaliana (Arabidopsis) seedlings often need to be grown on sterile media. This requires prior seed sterilization to prevent the growth of microbial contaminants present on the seed surface. Currently, Arabidopsis seeds are sterilized using two distinct sterilization techniques in conditions that differ slightly between labs and have not been standardized, often resulting in only partially effective sterilization or in excessive seed mortality. Most of these methods are also not easily scalable to a large number of seed lines of diverse genotypes. As technologies for high-throughput analysis of Arabidopsis continue to proliferate, standardized techniques for sterilizing large numbers of seeds of different genotypes are becoming essential for conducting these types of experiments. The response of a number of Arabidopsis lines to two different sterilization techniques was evaluated based on seed germination rate and the level of seed contamination with microbes and other pathogens. The treatments included different concentrations of sterilizing agents and times of exposure, combined to determine optimal conditions for Arabidopsis seed sterilization. Optimized protocols have been developed for two different sterilization methods: bleach (liquid-phase) and chlorine (Cl2) gas (vapor-phase), both resulting in high seed germination rates and minimal microbial contamination. The utility of these protocols was illustrated through the testing of both wild type and mutant seeds with a range of germination potentials. Our results show that seeds can be effectively sterilized using either method without excessive seed mortality, although detrimental effects of sterilization were observed for seeds with lower than optimal germination potential. In addition, an equation was developed to enable researchers to apply the standardized chlorine gas sterilization conditions to airtight containers of different sizes. The protocols described here allow easy, efficient, and

  8. Reforming High School Science for Low-Performing Students Using Inquiry Methods and Communities of Practice

    Science.gov (United States)

    Bolden, Marsha Gail

    Some schools fall short of the high demand to increase science scores on state exams because low-performing students enter high school unprepared for high school science. Low-performing students are not successful in high school for many reasons. However, using inquiry methods have improved students' understanding of science concepts. The purpose of this qualitative research study was to investigate the teachers' lived experiences with using inquiry methods to motivate low-performing high school science students in an inquiry-based program called Xtreem Science. Fifteen teachers were selected from the Xtreem Science program, a program designed to assist teachers in motivating struggling science students. The research questions involved understanding (a) teachers' experiences in using inquiry methods, (b) challenges teachers face in using inquiry methods, and (c) how teachers describe student's response to inquiry methods. Strategy of data collection and analysis included capturing and understanding the teachers' feelings, perceptions, and attitudes in their lived experience of teaching using inquiry method and their experience in motivating struggling students. Analysis of interview responses revealed teachers had some good experiences with inquiry and expressed that inquiry impacted their teaching style and approach to topics, and students felt that using inquiry methods impacted student learning for the better. Inquiry gave low-performing students opportunities to catch up and learn information that moved them to the next level of science courses. Implications for positive social change include providing teachers and school district leaders with information to help improve performance of the low performing science students.

  9. Medicare Provider Data - Hospice Providers

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Hospice Utilization and Payment Public Use File provides information on services provided to Medicare beneficiaries by hospice providers. The Hospice PUF...

  10. Introducing a novel gravitation-based high-velocity compaction analysis method for pharmaceutical powders.

    Science.gov (United States)

    Tanner, Timo; Antikainen, Osmo; Ehlers, Henrik; Yliruusi, Jouko

    2017-06-30

    With modern tableting machines large amounts of tablets are produced with high output. Consequently, methods to examine powder compression in a high-velocity setting are in demand. In the present study, a novel gravitation-based method was developed to examine powder compression. A steel bar is dropped on a punch to compress microcrystalline cellulose and starch samples inside the die. The distance of the bar is being read by a high-accuracy laser displacement sensor which provides a reliable distance-time plot for the bar movement. In-die height and density of the compact can be seen directly from this data, which can be examined further to obtain information on velocity, acceleration and energy distribution during compression. The energy consumed in compact formation could also be seen. Despite the high vertical compression speed, the method was proven to be cost-efficient, accurate and reproducible. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Perceptions of methicillin-resistant Staphylococcus aureus and hand hygiene provider training and patient education: results of a mixed method study of health care providers in Department of Veterans Affairs spinal cord injury and disorder units.

    Science.gov (United States)

    Hill, Jennifer N; Hogan, Timothy P; Cameron, Kenzie A; Guihan, Marylou; Goldstein, Barry; Evans, Martin E; Evans, Charlesnika T

    2014-08-01

    The goal of this study was to assess current practices for training of spinal cord injury and disorder (SCI/D) health care workers and education of veterans with SCI/D in Department of Veterans Affairs (VA) spinal cord injury (SCI) centers on methicillin-resistant Staphylococcus aureus (MRSA) prevention. Mixed methods. A Web-based survey was distributed to 673 VA SCI/D providers across 24 SCI centers; 21 acute care and 1 long-term care facility participated. There were 295 that responded, 228 had complete data and were included in this analysis. Semistructured interviews were conducted with 30 SCI/D providers across 9 SCI centers. Nurses, physicians, and therapists represent most respondents (92.1%, n = 210); over half (56.6%, n = 129) were nurses. Of providers, 75.9% (n = 173) reported receiving excellent or good training on how to educate patients about MRSA. However, nurses were more likely to report having excellent or good training for how to educate patients about MRSA (P = .005). Despite this, only 63.6% (n = 82) of nurses perceived the education they provide patients on how MRSA is transmitted as excellent or good. Despite health care workers reporting receiving excellent or good training on MRSA-related topics, this did not translate to excellent or good education for patients, suggesting that health care workers need additional training for educating patients. Population-specific MRSA prevention educational materials may also assist providers in educating patients about MRSA prevention for individuals with SCI/D. Published by Mosby, Inc.

  12. High-resolution, time-resolved MRA provides superior definition of lower-extremity arterial segments compared to 2D time-of-flight imaging.

    Science.gov (United States)

    Thornton, F J; Du, J; Suleiman, S A; Dieter, R; Tefera, G; Pillai, K R; Korosec, F R; Mistretta, C A; Grist, T M

    2006-08-01

    To evaluate a novel time-resolved contrast-enhanced (CE) projection reconstruction (PR) magnetic resonance angiography (MRA) method for identifying potential bypass graft target vessels in patients with Class II-IV peripheral vascular disease. Twenty patients (M:F = 15:5, mean age = 58 years, range = 48-83 years), were recruited from routine MRA referrals. All imaging was performed on a 1.5 T MRI system with fast gradients (Signa LX; GE Healthcare, Waukesha, WI). Images were acquired with a novel technique that combined undersampled PR with a time-resolved acquisition to yield an MRA method with high temporal and spatial resolution. The method is called PR hyper time-resolved imaging of contrast kinetics (PR-hyperTRICKS). Quantitative and qualitative analyses were used to compare two-dimensional (2D) time-of-flight (TOF) and PR-hyperTRICKS in 13 arterial segments per lower extremity. Statistical analysis was performed with the Wilcoxon signed-rank test. Fifteen percent (77/517) of the vessels were scored as missing or nondiagnostic with 2D TOF, but were scored as diagnostic with PR-hyperTRICKS. Image quality was superior with PR-hyperTRICKS vs. 2D TOF (on a four-point scale, mean rank = 3.3 +/- 1.2 vs. 2.9 +/- 1.2, P < 0.0001). PR-hyperTRICKS produced images with high contrast-to-noise ratios (CNR) and high spatial and temporal resolution. 2D TOF images were of inferior quality due to moderate spatial resolution, inferior CNR, greater flow-related artifacts, and absence of temporal resolution. PR-hyperTRICKS provides superior preoperative assessment of lower limb ischemia compared to 2D TOF.

  13. Development of high frequency tungsten inert gas welding method

    International Nuclear Information System (INIS)

    Morisada, Yoshiaki; Fujii, Hidetoshi; Inagaki, Fuminori; Kamai, Masayoshi

    2013-01-01

    Highlights: ► A new ultrasonic wave TIG welding method was developed. ► The area of the blowholes decreased to less than about 1/8 in the normal TIG weld. ► The number of blowholes decreased with the decreasing frequency. ► The number of blowholes increased when the frequency was less than 15 kHz. ► The microstructure of the weld was refined by ultrasonic wave. -- Abstract: A new welding method, called high frequency tungsten inert gas (TIG) welding, was developed to decrease blowholes in a weld. A1050 aluminum alloy plates (100 mm l × 50 mm w × 5 mm t ) were welded at a frequency from 10 to 40 kHz. An Ar-1% hydrogen mixture was used as the shielding gas to generate blowholes in the experiments. The welding was performed in the horizontal position so that the blowholes can easily be a problem. For comparison, a normal TIG welding was also performed at 60 Hz. After welding, the distribution of the blowholes in the welds was observed in order to evaluate the effect of the sonic wave. The number of blowholes changed with the frequency. A frequency near 15 kHz is the most suitable to decrease the blowholes. Using this new method, the area of blowholes is decreased to less than about 1/8 of the normal TIG weld. This method is much more effective for decreasing the number of blowholes, compared with an ultrasonic wave vibrator which is directly fixed to the sample.

  14. Environmental High-content Fluorescence Microscopy (e-HCFM) of Tara Oceans Samples Provides a View of Global Ocean Protist Biodiversity

    Science.gov (United States)

    Coelho, L. P.; Colin, S.; Sunagawa, S.; Karsenti, E.; Bork, P.; Pepperkok, R.; de Vargas, C.

    2016-02-01

    Protists are responsible for much of the diversity in the eukaryotic kingdomand are crucial to several biogeochemical processes of global importance (e.g.,the carbon cycle). Recent global investigations of these organisms have reliedon sequence-based approaches. These methods do not, however, capture thecomplex functional morphology of these organisms nor can they typically capturephenomena such as interactions (except indirectly through statistical means).Direct imaging of these organisms, can therefore provide a valuable complementto sequencing and, when performed quantitatively, provide measures ofstructures and interaction patterns which can then be related back to sequencebased measurements. Towards this end, we developed a framework, environmentalhigh-content fluorescence microscopy (e-HCFM) which can be applied toenvironmental samples composed of mixed communities. This strategy is based ongeneral purposes dyes that stain major structures in eukaryotes. Samples areimaged using scanning confocal microscopy, resulting in a three-dimensionalimage-stack. High-throughput can be achieved using automated microscopy andcomputational analysis. Standard bioimage informatics segmentation methodscombined with feature computation and machine learning results in automatictaxonomic assignments to the objects that are imaged in addition to severalbiochemically relevant measurements (such as biovolumes, fluorescenceestimates) per organism. We provide results on 174 image acquisition from TaraOcean samples, which cover organisms from 5 to 180 microns (82 samples in the5-20 fraction, 96 in the 20-180 fraction). We show a validation of the approachboth on technical grounds (demonstrating the high accuracy of automatedclassification) and provide results obtain from image analysis and fromintegrating with other data, such as associated environmental parametersmeasured in situ as well as perspectives on integration with sequenceinformation.

  15. Advanced methods and algorithm for high precision astronomical imaging

    International Nuclear Information System (INIS)

    Ngole-Mboula, Fred-Maurice

    2016-01-01

    One of the biggest challenges of modern cosmology is to gain a more precise knowledge of the dark energy and the dark matter nature. Fortunately, the dark matter can be traced directly through its gravitational effect on galaxies shapes. The European Spatial Agency Euclid mission will precisely provide data for such a purpose. A critical step is analyzing these data will be to accurately model the instrument Point Spread Function (PSF), which the focus of this thesis.We developed non parametric methods to reliably estimate the PSFs across an instrument field-of-view, based on unresolved stars images and accounting for noise, under sampling and PSFs spatial variability. At the core of these contributions, modern mathematical tools and concepts such as sparsity. An important extension of this work will be to account for the PSFs wavelength dependency. (author) [fr

  16. Substructure method in high-speed monorail dynamic problems

    Science.gov (United States)

    Ivanchenko, I. I.

    2008-12-01

    The study of actions of high-speed moving loads on bridges and elevated tracks remains a topical problem for transport. In the present study, we propose a new method for moving load analysis of elevated tracks (monorail structures or bridges), which permits studying the interaction between two strained objects consisting of rod systems and rigid bodies with viscoelastic links; one of these objects is the moving load (monorail rolling stock), and the other is the carrying structure (monorail elevated track or bridge). The methods for moving load analysis of structures were developed in numerous papers [1-15]. At the first stage, when solving the problem about a beam under the action of the simplest moving load such as a moving weight, two fundamental methods can be used; the same methods are realized for other structures and loads. The first method is based on the use of a generalized coordinate in the expansion of the deflection in the natural shapes of the beam, and the problem is reduced to solving a system of ordinary differential equations with variable coefficients [1-3]. In the second method, after the "beam-weight" system is decomposed, just as in the problem with the weight impact on the beam [4], solving the problem is reduced to solving an integral equation for the dynamic weight reaction [6, 7]. In [1-3], an increase in the number of retained forms leads to an increase in the order of the system of equations; in [6, 7], difficulties arise when solving the integral equations related to the conditional stability of the step procedures. The method proposed in [9, 14] for beams and rod systems combines the above approaches and eliminates their drawbacks, because it permits retaining any necessary number of shapes in the deflection expansion and has a resolving system of equations with an unconditionally stable integration scheme and with a minimum number of unknowns, just as in the method of integral equations [6, 7]. This method is further developed for

  17. Mixed Methods for Implementation Research: Application to Evidence-Based Practice Implementation and Staff Turnover in Community Based Organizations Providing Child Welfare Services

    Science.gov (United States)

    Aarons, Gregory A.; Fettes, Danielle L.; Sommerfeld, David H.; Palinkas, Lawrence

    2013-01-01

    Many public sector services systems and provider organizations are in some phase of learning about or implementing evidence-based interventions. Child welfare service systems represent a context where implementation spans system, management, and organizational concerns. Research utilizing mixed methods that combine qualitative and quantitative design, data collection, and analytic approaches are particularly well-suited to understanding both the process and outcomes of dissemination and implementation efforts in child welfare systems. This paper describes the process of using mixed methods in implementation research and provides an applied example of an examination of factors impacting staff retention during an evidence-based intervention implementation in a statewide child welfare system. We integrate qualitative data with previously published quantitative analyses of job autonomy and staff turnover during this statewide implementation project in order to illustrate the utility of mixed method approaches in providing a more comprehensive understanding of opportunities and challenges in implementation research. PMID:22146861

  18. Mixed methods for implementation research: application to evidence-based practice implementation and staff turnover in community-based organizations providing child welfare services.

    Science.gov (United States)

    Aarons, Gregory A; Fettes, Danielle L; Sommerfeld, David H; Palinkas, Lawrence A

    2012-02-01

    Many public sector service systems and provider organizations are in some phase of learning about or implementing evidence-based interventions. Child welfare service systems represent a context where implementation spans system, management, and organizational concerns. Research utilizing mixed methods that combine qualitative and quantitative design, data collection, and analytic approaches are particularly well suited to understanding both the process and outcomes of dissemination and implementation efforts in child welfare systems. This article describes the process of using mixed methods in implementation research and provides an applied example of an examination of factors impacting staff retention during an evidence-based intervention implementation in a statewide child welfare system. The authors integrate qualitative data with previously published quantitative analyses of job autonomy and staff turnover during this statewide implementation project in order to illustrate the utility of mixed method approaches in providing a more comprehensive understanding of opportunities and challenges in implementation research.

  19. Capacity building of nurses providing neonatal care in Rio de Janeiro, Brazil: methods for the POINTS of care project to enhance nursing education and reduce adverse neonatal outcomes

    Directory of Open Access Journals (Sweden)

    Darlow Brian A

    2012-03-01

    Full Text Available Abstract Background Increased survival of preterm infants in developing countries has often been accompanied by increased morbidity. A previous study found rates of severe retinopathy of prematurity varied widely between different neonatal units in Rio de Janeiro. Nurses have a key role in the care of high-risk infants but often do not have access to ongoing education programmes. We set out to design a quality improvement project that would provide nurses with the training and tools to decrease neonatal mortality and morbidity. The purpose of this report is to describe the methods and make the teaching package (POINTS of care--six modules addressing Pain control; optimal Oxygenation; Infection control; Nutrition interventions; Temperature control; Supportive care available to others. Methods/Design Six neonatal units, caring for 40% of preterm infants in Rio de Janeiro were invited to participate. In Phase 1 of the study multidisciplinary workshops were held in each neonatal unit to identify the neonatal morbidities of interest and to plan for data collection. In Phase 2 the teaching package was developed and tested. Phase 3 consisted of 12 months data collection utilizing a simple tick-sheet for recording. In Phase 4 (the Intervention all nurses were asked to complete all six modules of the POINTS of care package, which was supplemented by practical demonstrations. Phase 5 consisted of a further 12 months data collection. In Phase 1 it was agreed to include inborn infants with birthweight ≤ 1500 g or gestational age of ≤ 34 weeks. The primary outcome was death before discharge and secondary outcomes included retinopathy of prematurity and bronchopulmonary dysplasia. Assuming 400-450 infants in both pre- and post-intervention periods the study had 80% power at p = Discussion The results of the POINTS of Care intervention will be presented in a separate publication. Trial registration Current Controlled Trials: ISRCTN83110114

  20. Predicting High School Completion Using Student Performance in High School Algebra: A Mixed Methods Research Study

    Science.gov (United States)

    Chiado, Wendy S.

    2012-01-01

    Too many of our nation's youth have failed to complete high school. Determining why so many of our nation's students fail to graduate is a complex, multi-faceted problem and beyond the scope of any one study. The study presented herein utilized a thirteen-step mixed methods model developed by Leech and Onwuegbuzie (2007) to demonstrate within a…

  1. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, November 2013

    International Nuclear Information System (INIS)

    De Saint Jean, C.; Dupont, E.; ); Dyrda, J.; Hursin, M.; Pelloni, S.; Ishikawa, M.; Ivanov, E.; Ivanova, T.; Kim, D.H.; Ee, Y.O.; Kodeli, I.; Leal, L.; Leichtle, D.; Palmiotti, G.; Salvatores, M.; Pronyaev, V.; Simakov, S.; )

    2013-11-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the first formal Subgroup 39 meeting held at the NEA, Issy-les-Moulineaux, France, on 28-29 November 2013. It comprises a Summary Record of the meeting and all the available presentations (slides) given by the participants: A - Recent data adjustments performances and trends: 1 - Recommendations from ADJ2010 adjustment (M. Ishikawa); 2 - Feedback on CIELO isotopes from ENDF/B-VII.0 adjustment (G. Palmiotti); 3 - Sensitivity and uncertainty results on FLATTOP-Pu (I. Kodeli); 4 - SG33 benchmark: Comparative adjustment results (S. Pelloni) 5 - Integral benchmarks for data assimilation: selection of a consistent set and establishment of integral correlations (E. Ivanov); 6 - PROTEUS experimental data (M. Hursin); 7 - Additional information on High Conversion Light Water Reactor (HCLWR aka FDWR-II) experiments (14 January 2014); 8 - Data assimilation of benchmark experiments for homogenous thermal/epithermal uranium systems (J. Dyrda); B - Methodology issues: 1 - Adjustment methodology issues (G. Palmiotti); 2 - Marginalisation, methodology issues and nuclear data parameter adjustment (C. De Saint Jean); 3 - Nuclear data parameter adjustment (G. Palmiotti). A list of issues and actions conclude the document

  2. Study on highly efficient seismic data acquisition and processing methods based on sparsity constraint

    Science.gov (United States)

    Wang, H.; Chen, S.; Tao, C.; Qiu, L.

    2017-12-01

    is useful for acquisition efficiency raise and cost decrease, (2) the data reconstruction method can provide us with highly precise reconstruction results for the following data processing procedures. It indicate a very broad application prospects of the theoretical framework in the future.

  3. High voltage semiconductor devices and methods of making the devices

    Energy Technology Data Exchange (ETDEWEB)

    Matocha, Kevin; Chatty, Kiran; Banerjee, Sujit

    2018-01-23

    A multi-cell MOSFET device including a MOSFET cell with an integrated Schottky diode is provided. The MOSFET includes n-type source regions formed in p-type well regions which are formed in an n-type drift layer. A p-type body contact region is formed on the periphery of the MOSFET. The source metallization of the device forms a Schottky contact with an n-type semiconductor region adjacent the p-type body contact region of the device. Vias can be formed through a dielectric material covering the source ohmic contacts and/or Schottky region of the device and the source metallization can be formed in the vias. The n-type semiconductor region forming the Schottky contact and/or the n-type source regions can be a single continuous region or a plurality of discontinuous regions alternating with discontinuous p-type body contact regions. The device can be a SiC device. Methods of making the device are also provided.

  4. System, apparatus and methods to implement high-speed network analyzers

    Science.gov (United States)

    Ezick, James; Lethin, Richard; Ros-Giralt, Jordi; Szilagyi, Peter; Wohlford, David E

    2015-11-10

    Systems, apparatus and methods for the implementation of high-speed network analyzers are provided. A set of high-level specifications is used to define the behavior of the network analyzer emitted by a compiler. An optimized inline workflow to process regular expressions is presented without sacrificing the semantic capabilities of the processing engine. An optimized packet dispatcher implements a subset of the functions implemented by the network analyzer, providing a fast and slow path workflow used to accelerate specific processing units. Such dispatcher facility can also be used as a cache of policies, wherein if a policy is found, then packet manipulations associated with the policy can be quickly performed. An optimized method of generating DFA specifications for network signatures is also presented. The method accepts several optimization criteria, such as min-max allocations or optimal allocations based on the probability of occurrence of each signature input bit.

  5. Study on the partner selecting method of strategic alliance in high and new technology enterprises

    Institute of Scientific and Technical Information of China (English)

    王宏起; 唐宇; 迟运领

    2004-01-01

    A successful and effective strategic alliance involves many factors, of which selecting a proper partner is the most important factor to achieve the success of the alliance. In view of the characteristics of strategic alliance in high and new technology enterprises and according to the analysis on the standards of partner selecting and the factors of the success of alliance, this paper does some deeper research on the partner selecting and the alliance evaluation process from the perspective of different strategic levels by using a fuzzy comprehensive evaluating method, thus providing a method to select the alliance partner for high and new technology enterprises in China.

  6. New method for evaluating high-quality fog protective coatings

    Science.gov (United States)

    Czeremuszkin, Grzegorz; Latreche, Mohamed; Mendoza-Suarez, Guillermo

    2011-05-01

    Fogging is commonly observed when humid-warm air contacts the cold surface of a transparent substrate, i.e. eyewear lenses, making the observed image blurred and hazy. To protect from fogging, the lens inner surfaces are protected with Anti-Fog coatings, which render them hydrophilic and induce water vapor condensation as a smooth, thin and invisible film, which uniformly flows down on the lens as the condensation progresses. Coatings differ in protection level, aging kinetics, and susceptibility to contamination. Some perform acceptably in limited conditions, beyond which the condensing water film becomes unstable, nonuniform, and scatters light or shows refractory distortions, both affecting the observed image. Quantifying the performance of Anti-Fog coated lenses is difficult: they may not show classical fogging and the existing testing methods, based on fog detection, are therefore inapplicable. The presented method for evaluating and quantifying AF properties is based on characterizing light scattering on lenses exposed to controlled humidity and temperature. Changes in intensity of laser light scattered at low angles (1, 2 4 and 8 degrees), observed during condensation of water on lenses, provide information on the swelling of Anti-Fog coatings, formation of uniform water film, going from an unstable to a steady state, and on the coalescence of discontinuous films. Real time observations/measurements allow for better understanding of factors controlling fogging and fog preventing phenomena. The method is especially useful in the development of new coatings for military-, sport-, and industrial protective eyewear as well as for medical and automotive applications. It allows for differentiating between coatings showing acceptable, good, and excellent performance.

  7. Accuracy of the visual estimation method as a predictor of food intake in Alzheimer's patients provided with different types of food.

    Science.gov (United States)

    Amano, Nobuko; Nakamura, Tomiyo

    2018-02-01

    The visual estimation method is commonly used in hospitals and other care facilities to evaluate food intake through estimation of plate waste. In Japan, no previous studies have investigated the validity and reliability of this method under the routine conditions of a hospital setting. The present study aimed to evaluate the validity and reliability of the visual estimation method, in long-term inpatients with different levels of eating disability caused by Alzheimer's disease. The patients were provided different therapeutic diets presented in various food types. This study was performed between February and April 2013, and 82 patients with Alzheimer's disease were included. Plate waste was evaluated for the 3 main daily meals, for a total of 21 days, 7 consecutive days during each of the 3 months, originating a total of 4851 meals, from which 3984 were included. Plate waste was measured by the nurses through the visual estimation method, and by the hospital's registered dietitians through the actual measurement method. The actual measurement method was first validated to serve as a reference, and the level of agreement between both methods was then determined. The month, time of day, type of food provided, and patients' physical characteristics were considered for analysis. For the 3984 meals included in the analysis, the level of agreement between the measurement methods was 78.4%. Disagreement of measurements consisted of 3.8% of underestimation and 17.8% of overestimation. Cronbach's α (0.60, P visual estimation method was within the acceptable range. The visual estimation method was found to be a valid and reliable method for estimating food intake in patients with different levels of eating impairment. The successful implementation and use of the method depends upon adequate training and motivation of the nurses and care staff involved. Copyright © 2017 European Society for Clinical Nutrition and Metabolism. Published by Elsevier Ltd. All rights reserved.

  8. High temperature sealing method : induction brazing for SOFCs

    Energy Technology Data Exchange (ETDEWEB)

    Heo, Y.H.; Lee, S.B.; Song, R.H.; Shin, D.R. [Korea Inst. of Energy Research, Daejeon (Korea, Republic of); Lim, T.H. [Korea Inst. of Energy Research, Daejeon (Korea, Republic of). Advanced Fuel Cell Research Center

    2009-07-01

    This study examined the use of induction brazing as a high temperature sealing method for solid oxide fuel cells (SOFCs). Nickel-based brazing alloys were modified using reactive titanium-hydride (TiH2). The gas sealing properties of the induction brazing process on anode-supported tubular SOFCs and ferritic stainless steel were evaluated. Brazing alloys BNi-2 and BNi-4 were not wetted in a yttria-silica-zircon (YSZ) electrolyte. The brazing alloy with added TiH2 showed good wettability with the YSZ electrolyte as a result of the formation of a TiOX layer. Only the BNi-4 alloy joined with the YSZ electrolyte. An open circuit voltage (OCV) value was used to estimate the gas tightness of the brazed cell. It was concluded that the BNi-4 TiH2 modified alloy is a suitable sealing material for SOFCs operating in temperatures up to 750 degrees C.

  9. Thermopower measurement under high pressure using 'seesaw heating method'

    International Nuclear Information System (INIS)

    Hedo, M; Nakamura, D; Takaesu, Y; Yagasaki, K; Nakama, T; Fujiwara, T; Uchima, K

    2010-01-01

    We have developed a set-up with modified 'seesaw heating method' for the thermopower measurement under pressures P up to 3 GPa at the temperature range between 2 K and 300 K. By using this set-up, the thermopower and electrical resistivity of the single crystalline YbMn 2 Ge 2 under high pressure were measured with enough accuracy. S(T) curve shows the characteristic feature at the magnetic transition in all pressure range, while no evidence of the magnetic phase transition is observed in ρ(T) at P > 1.25 GPa. The measurement results indicate that the simultaneous measurement of the thermopower and electrical resistivity is a useful tool to study the pressure-induced phase transitions.

  10. High power RF window deposition apparatus, method, and device

    Science.gov (United States)

    Ives, Lawrence R.; Lucovsky, Gerald; Zeller, Daniel

    2017-07-04

    A process for forming a coating for an RF window which has improved secondary electron emission and reduced multipactor for high power RF waveguides is formed from a substrate with low loss tangent and desirable mechanical characteristics. The substrate has an RPAO deposition layer applied which oxygenates the surface of the substrate to remove carbon impurities, thereafter has an RPAN deposition layer applied to nitrogen activate the surface of the substrate, after which a TiN deposition layer is applied using Titanium tert-butoxide. The TiN deposition layer is capped with a final RPAN deposition layer of nitridation to reduce the bound oxygen in the TiN deposition layer. The resulting RF window has greatly improved titanium layer adhesion, reduced multipactor, and is able to withstand greater RF power levels than provided by the prior art.

  11. Underground excavation methods for a high-level waste repository

    International Nuclear Information System (INIS)

    Peshel, J.; Gupta, D.; Nataraja, M.

    1990-01-01

    This paper reports on rock excavation methods for a High-Level Waste repository that should be selected to limit the potential for creating preferential pathways for groundwater to travel to the waste packages or for radionuclides to migrate to the accessible environment. The use of water and other foreign substances should be controlled so that the repository performance is not compromised. The excavated openings should remain stable so that operations can be carried out safely and the retrievability option maintained. As per the current conceptual designs presented by the Department of Energy, the exploratory shaft facility becomes a part of the repository if the Yucca Mountain site is found suitable for repository development. Therefore, the methods of constructing the underground openings should be compatible with the performance requirements for the repository. Also, the degree of damage to the rock surrounding the openings and the extent of the damage zone should not preclude adequate site characterization. The ESf construction and operation should be compatible with the site data gathering activities, such as geological, thermomechanical, hydrological and geochemical testing

  12. Low melting high lithia glass compositions and methods

    Science.gov (United States)

    Jantzen, Carol M.; Pickett, John B.; Cicero-Herman, Connie A.; Marra, James C.

    2000-01-01

    The invention relates to methods of vitrifying waste and for lowering the melting point of glass forming systems by including lithia formers in the glass forming composition in significant amounts, typically from about 0.16 wt % to about 11 wt %, based on the total glass forming oxides. The lithia is typically included as a replacement for alkali oxide glass formers that would normally be present in a particular glass forming system. Replacement can occur on a mole percent or weight percent basis, and typically results in a composition wherein lithia forms about 10 wt % to about 100 wt % of the alkali oxide glass formers present in the composition. The present invention also relates to the high lithia glass compositions formed by these methods. The invention is useful for stabilization of numerous types of waste materials, including aqueous waste streams, sludge solids, mixtures of aqueous supernate and sludge solids, combinations of spent filter aids from waste water treatment and waste sludges, supernate alone, incinerator ash, incinerator offgas blowdown, or combinations thereof, geological mine tailings and sludges, asbestos, inorganic filter media, cement waste forms in need of remediation, spent or partially spent ion exchange resins or zeolites, contaminated soils, lead paint, etc. The decrease in melting point achieved by the present invention desirably prevents volatilization of hazardous or radioactive species during vitrification.

  13. a High Precision dem Extraction Method Based on Insar Data

    Science.gov (United States)

    Wang, Xinshuang; Liu, Lingling; Shi, Xiaoliang; Huang, Xitao; Geng, Wei

    2018-04-01

    In the 13th Five-Year Plan for Geoinformatics Business, it is proposed that the new InSAR technology should be applied to surveying and mapping production, which will become the innovation driving force of geoinformatics industry. This paper will study closely around the new outline of surveying and mapping and then achieve the TerraSAR/TanDEM data of Bin County in Shaanxi Province in X band. The studying steps are as follows; Firstly, the baseline is estimated from the orbital data; Secondly, the interferometric pairs of SAR image are accurately registered; Thirdly, the interferogram is generated; Fourth, the interferometric correlation information is estimated and the flat-earth phase is removed. In order to solve the phase noise and the discontinuity phase existing in the interferometric image of phase, a GAMMA adaptive filtering method is adopted. Aiming at the "hole" problem of missing data in low coherent area, the interpolation method of low coherent area mask is used to assist the phase unwrapping. Then, the accuracy of the interferometric baseline is estimated from the ground control points. Finally, 1 : 50000 DEM is generated, and the existing DEM data is used to verify the accuracy through statistical analysis. The research results show that the improved InSAR data processing method in this paper can obtain the high-precision DEM of the study area, exactly the same with the topography of reference DEM. The R2 can reach to 0.9648, showing a strong positive correlation.

  14. A High School Counselor's Leadership in Providing School-Wide Screenings for Depression and Enhancing Suicide Awareness

    Science.gov (United States)

    Erickson, Anne; Abel, Nicholas R.

    2013-01-01

    The prevalence of mental health issues and suicidal thoughts and actions among school-aged children and adolescents is a serious issue. This article examines the scope of the problem nationwide and provides a brief overview of the literature regarding the effectiveness of school-wide screening programs for depression and suicide risk. The authors…

  15. Microwave Wire Interrogation Method Mapping Pressure under High Temperatures

    Directory of Open Access Journals (Sweden)

    Xiaoyong Chen

    2017-12-01

    Full Text Available It is widely accepted that wireless reading for in-situ mapping of pressure under high-temperature environments is the most feasible method, because it is not subject to frequent heterogeneous jointing failures and electrical conduction deteriorating, or even disappearing, under heat load. However, in this article, we successfully demonstrate an in-situ pressure sensor with wire interrogation for high-temperature applications. In this proof-of-concept study of the pressure sensor, we used a microwave resonator as a pressure-sensing component and a microwave transmission line as a pressure characteristic interrogation tunnel. In the sensor, the line and resonator are processed into a monolith, avoiding a heterogeneous jointing failure; further, microwave signal transmission does not depend on electrical conduction, and consequently, the sensor does not suffer from the heat load. We achieve pressure monitoring under 400 °C when employing the sensor simultaneously. Our sensor avoids restrictions that exist in wireless pressure interrogations, such as environmental noise and interference, signal leakage and security, low transfer efficiency, and so on.

  16. High temperature spectral emissivity measurement using integral blackbody method

    Science.gov (United States)

    Pan, Yijie; Dong, Wei; Lin, Hong; Yuan, Zundong; Bloembergen, Pieter

    2016-10-01

    Spectral emissivity is a critical material's thermos-physical property for heat design and radiation thermometry. A prototype instrument based upon an integral blackbody method was developed to measure material's spectral emissivity above 1000 °. The system was implemented with an optimized commercial variable-high-temperature blackbody, a high speed linear actuator, a linear pyrometer, and an in-house designed synchronization circuit. A sample was placed in a crucible at the bottom of the blackbody furnace, by which the sample and the tube formed a simulated blackbody which had an effective total emissivity greater than 0.985. During the measurement, the sample was pushed to the end opening of the tube by a graphite rod which was actuated through a pneumatic cylinder. A linear pyrometer was used to monitor the brightness temperature of the sample surface through the measurement. The corresponding opto-converted voltage signal was fed and recorded by a digital multi-meter. A physical model was proposed to numerically evaluate the temperature drop along the process. Tube was discretized as several isothermal cylindrical rings, and the temperature profile of the tube was measurement. View factors between sample and rings were calculated and updated along the whole pushing process. The actual surface temperature of the sample at the end opening was obtained. Taking advantages of the above measured voltage profile and the calculated true temperature, spectral emissivity under this temperature point was calculated.

  17. Development of spraying methods for high density bentonite barriers. Part 3. Field investigation of spraying methods

    International Nuclear Information System (INIS)

    Tanaka, Toshiyuki; Nakajima, Makoto; Kobayashi, Ichizo; Toida, Masaru; Fukuda, Katsumi; Sato, Tatsuro; Nonaka, Katsumi; Gozu, Keisuke

    2007-01-01

    The authors have developed a new method of constructing high density bentonite barriers by means of a wet spraying method. Using this method, backfill material can be placed in narrow upper and side parts in a low-level radioactive waste disposal facility. Using a new supplying machine for bentonite, spraying tests were conducted to investigate the conditions during construction. On the basis of the test results, the various parameters for the spraying method were investigated. The test results are summarized as follows: 1. The new machine supplied about twice the weight of material supplied by a screw conveyor. A dry density of spraying bentonite 0.05 Mg/m 3 higher than that of a screw conveyor with the same water content could be achieved. 2. The dry density of sprayed bentonite at a boundary with concrete was the same as that at the center of the cross section. 3. The variation in densities of bentonite sprayed in the vertical downward and horizontal directions was small. Also, density reduction due to rebound during spraying was not seen. 4. Bentonite controlled by water content could be sprayed smoothly in the horizontal direction by a small machine. Also rebound could be collected by a machine conveying air. (author)

  18. High resolution and high sensitivity methods for oligosaccharide mapping and characterization by normal phase high performance liquid chromatography following derivatization with highly fluorescent anthranilic acid.

    Science.gov (United States)

    Anumula, K R; Dhume, S T

    1998-07-01

    Facile labeling of oligosaccharides (acidic and neutral) in a nonselective manner was achieved with highly fluorescent anthranilic acid (AA, 2-aminobenzoic acid) (more than twice the intensity of 2-aminobenzamide, AB) for specific detection at very high sensitivity. Quantitative labeling in acetate-borate buffered methanol (approximately pH 5.0) at 80 degreesC for 60 min resulted in negligible or no desialylation of the oligosaccharides. A high resolution high performance liquid chromatographic method was developed for quantitative oligosaccharide mapping on a polymeric-NH2bonded (Astec) column operating under normal phase and anion exchange (NP-HPAEC) conditions. For isolation of oligosaccharides from the map by simple evaporation, the chromatographic conditions developed use volatile acetic acid-triethylamine buffer (approximately pH 4.0) systems. The mapping and characterization technology was developed using well characterized standard glycoproteins. The fluorescent oligosaccharide maps were similar to the maps obtained by the high pH anion-exchange chromatography with pulsed amperometric detection (HPAEC-PAD), except that the fluorescent maps contained more defined peaks. In the map, the oligosaccharides separated into groups based on charge, size, linkage, and overall structure in a manner similar to HPAEC-PAD with contribution of -COOH function from the label, anthranilic acid. However, selectivity of the column for sialic acid linkages was different. A second dimension normal phase HPLC (NP-HPLC) method was developed on an amide column (TSK Gel amide-80) for separation of the AA labeled neutral complex type and isomeric structures of high mannose type oligosaccharides. The oligosaccharides labeled with AA are compatible with biochemical and biophysical techniques, and use of matrix assisted laser desorption mass spectrometry for rapid determination of oligosaccharide mass map of glycoproteins is demonstrated. High resolution of NP-HPAEC and NP-HPLC methods

  19. High viscosity fluid simulation using particle-based method

    KAUST Repository

    Chang, Yuanzhang; Bao, Kai; Zhu, Jian; Wu, Enhua

    2011-01-01

    the boundary, ghost particles are employed to enforce the solid boundary condition. Compared with Finite Element Methods with complicated and time-consuming remeshing operations, our method is much more straightforward to implement. Moreover, our method doesn

  20. Local regression type methods applied to the study of geophysics and high frequency financial data

    Science.gov (United States)

    Mariani, M. C.; Basu, K.

    2014-09-01

    In this work we applied locally weighted scatterplot smoothing techniques (Lowess/Loess) to Geophysical and high frequency financial data. We first analyze and apply this technique to the California earthquake geological data. A spatial analysis was performed to show that the estimation of the earthquake magnitude at a fixed location is very accurate up to the relative error of 0.01%. We also applied the same method to a high frequency data set arising in the financial sector and obtained similar satisfactory results. The application of this approach to the two different data sets demonstrates that the overall method is accurate and efficient, and the Lowess approach is much more desirable than the Loess method. The previous works studied the time series analysis; in this paper our local regression models perform a spatial analysis for the geophysics data providing different information. For the high frequency data, our models estimate the curve of best fit where data are dependent on time.

  1. Development of high performance liquid chromatography method for miconazole analysis in powder sample

    Science.gov (United States)

    Hermawan, D.; Suwandri; Sulaeman, U.; Istiqomah, A.; Aboul-Enein, H. Y.

    2017-02-01

    A simple high performance liquid chromatography (HPLC) method has been developed in this study for the analysis of miconazole, an antifungal drug, in powder sample. The optimized HPLC system using C8 column was achieved using mobile phase composition containing methanol:water (85:15, v/v), a flow rate of 0.8 mL/min, and UV detection at 220 nm. The calibration graph was linear in the range from 10 to 50 mg/L with r 2 of 0.9983. The limit of detection (LOD) and limit of quantitation (LOQ) obtained were 2.24 mg/L and 7.47 mg/L, respectively. The present HPLC method is applicable for the determination of miconazole in the powder sample with a recovery of 101.28 % (RSD = 0.96%, n = 3). The developed HPLC method provides short analysis time, high reproducibility and high sensitivity.

  2. Pixel-Wise Classification Method for High Resolution Remote Sensing Imagery Using Deep Neural Networks

    Directory of Open Access Journals (Sweden)

    Rui Guo

    2018-03-01

    Full Text Available Considering the classification of high spatial resolution remote sensing imagery, this paper presents a novel classification method for such imagery using deep neural networks. Deep learning methods, such as a fully convolutional network (FCN model, achieve state-of-the-art performance in natural image semantic segmentation when provided with large-scale datasets and respective labels. To use data efficiently in the training stage, we first pre-segment training images and their labels into small patches as supplements of training data using graph-based segmentation and the selective search method. Subsequently, FCN with atrous convolution is used to perform pixel-wise classification. In the testing stage, post-processing with fully connected conditional random fields (CRFs is used to refine results. Extensive experiments based on the Vaihingen dataset demonstrate that our method performs better than the reference state-of-the-art networks when applied to high-resolution remote sensing imagery classification.

  3. Statistical modelling and RCS detrending methods provide similar estimates of long-term trend in radial growth of common beech in north-eastern France

    OpenAIRE

    Bontemps , Jean-Daniel; Esper , Jan

    2011-01-01

    International audience; Dendrochronological methods have greatly contributed to the documentation of past long-term trends in forest growth. These methods primarily focus on the high-frequency signals of tree ring chronologies. They require the removal of the ageing trend in tree growth, known as 'standardisation' or 'detrending', as a prerequisite to the estimation of such trends. Because the approach is sequential, it may however absorb part of the low-frequency historical signal. In this s...

  4. Impact of an online medical internet site on knowledge and practice of health care providers: a mixed methods study of the Spinal Cord Injury Rehabilitation Evidence project.

    Science.gov (United States)

    Eng, Janice J; Noonan, Vanessa K; Townson, Andrea F; Higgins, Caroline E; Rogers, Jess; Wolfe, Dalton L

    2014-12-23

    It is not known whether ongoing access to a broad-based Internet knowledge resource can influence the practice of health care providers. We undertook a study to evaluate the impact of a Web-based knowledge resource on increasing access to evidence and facilitating best practice of health care providers. The objective of this study was to evaluate (1) the impact of the Spinal Cord Injury Rehabilitation Evidence (SCIRE) project on access to information for health care providers and researchers and (2) how SCIRE influenced health care providers' management of clients. A 4-part mixed methods evaluation was undertaken: (1) monitoring website traffic and utilization using Google Analytics, (2) online survey of users who accessed the SCIRE website, (3) online survey of targeted end-users, that is, rehabilitation health care providers known to work with spinal cord injury (SCI) clients, as well as researchers, and (4) focus groups with health care providers who had previously accessed SCIRE. The online format allowed the content for a relatively specialized field to have far reach (eg, 26 countries and over 6500 users per month). The website survey and targeted end-user survey confirmed that health care providers, as well as researchers perceived that the website increased their access to SCI evidence. Access to SCIRE not only improved knowledge of SCI evidence but helped inform changes to the health providers' clinical practice and improved their confidence in treating SCI clients. The SCIRE information directly influenced the health providers' clinical decision making, in terms of choice of intervention, equipment needs, or assessment tool. A Web-based knowledge resource may be a relatively inexpensive method to increase access to evidence-based information, increase knowledge of the evidence, inform changes to the health providers' practice, and influence their clinical decision making.

  5. Test performance and acceptability of self- versus provider-collected swabs for high-risk HPV DNA testing in female-to-male trans masculine patients.

    Science.gov (United States)

    Reisner, Sari L; Deutsch, Madeline B; Peitzmeier, Sarah M; White Hughto, Jaclyn M; Cavanaugh, Timothy P; Pardee, Dana J; McLean, Sarah A; Panther, Lori A; Gelman, Marcy; Mimiaga, Matthew J; Potter, Jennifer E

    2018-01-01

    endorsed a preference for the self-collected vaginal swab over provider-collected cervical swab. Self-collected vaginal swabs are highly acceptable to TM as a means to test for hrHPV DNA. Test performance of this self-collection method for hrHPV detection in TM is consistent with previous studies in cisgender females. Self-collected vaginal swab testing for hrHPV DNA represents a reasonable and patient-centered strategy for primary cervical cancer screening in TM patients unwilling to undergo provider collection of specimens via speculum exam.

  6. Deep ice and salty oceans of icy worlds, how high pressures influence their thermodynamics and provide constrains on extraterrestrial habitability

    Science.gov (United States)

    Journaux, B.; Brown, J. M.; Bollengier, O.; Abramson, E.

    2017-12-01

    As in Earth arctic and Antarctic regions, suspected extraterrestrial deep oceans in icy worlds (i.e. icy moons and water-rich exoplanets) chemistry and thermodynamic state will strongly depend on their equilibrium with H2O ice and present solutes. Na-Mg-Cl-SO4 salt species are currently the main suspected ionic solutes to be present in deep oceans based on remote sensing, magnetic field measurements, cryovolcanism ice grains chemical analysis and chondritic material aqueous alteration chemical models. Unlike on our planet, deep extraterrestrial ocean might also be interacting at depth with high pressure ices (e.g. III, V, VI, VI, X) which have different behavior compared to ice Ih. Unfortunately, the pressures and temperatures inside these hydrospheres differ significantly from the one found in Earth aqueous environments, so most of our current thermodynamic databases do not cover the range of conditions relevant for modeling realistically large icy worlds interiors. Recent experimental results have shown that the presence of solutes, and more particularly salts, in equilibrium with high pressure ices have large effects on the stability, buoyancy and chemistry of all the phases present at these extreme conditions. High pressure in-situ measurements using diamond anvil cell apparatus were operated both at the University of washington and at the European Synchrotron Radiation Facility on aqueous systems phase diagrams with Na-Mg-Cl-SO4 species, salt incorporation in high pressure ices and density inversions between the solid and the fluids. These results suggest a more complex picture of the interior structure, dynamic and chemical evolution of large icy worlds hydrospheres when solutes are taken into account, compared to current models mainly using pure water. Based on our in-situ experimental measurements, we propose the existence of new liquid environments at greater depths and the possibility of solid state transport of solute through the high pressure ices

  7. TOLERANCE OF REGIONAL HIGH SCHOOL STUDENTS: ASSESSMENT AND DEVELOPMENT METHODS

    Directory of Open Access Journals (Sweden)

    Elena V. Kalachinskaya

    2015-01-01

    Full Text Available The purpose of the investigation is to define the quality and tolerance level among students; and generalize pedagogical experience of intercultural tolerance formation (as exemplified in Vladivostok State University of Economics and Service.Methods. Theoretical methods of research involve analysis of approaches and results of tolerance among young people; Practical methods – content analysis of the essay content on a given topic, questioning. An empirical case study, described in this article, was carried out by questionnaire survey of 200 VSUES (Vladivostok State University of Economics and Service students from 2–3 courses of various undergraduate training areas.Scientific novelty. The level of students’ tolerant attitude to a series of countries and their residents is specified; combined with the respondents’ knowledge on these countries. Most distinctive students’ views on the «tolerance» concept and reasons for their intolerant behavior are analyzed and presented in this article. Pedagogical and educational technologies used by University for the youth tolerance formation are summarized.Results. Based on the survey, the issues such as limits of applicability of “tolerance” concept in students’ perception, declarative and real tolerance level, and tolerance level to certain countries, as well as in business are investigated. According to the survey, the author makes the conclusion of correlation existence between level of tolerance towards country (nation and level of awareness of it. The author has analysed the students’ essays on tolerance problems; and it was found out that international relations are the most relevant aspect to respondents of tolerant or intolerant behavior. Results of students’ sociological research are compared with results of surveys on similar topics made by All-Russia Public Opinion Research Center and other researchers. Implemented VSUES projects aimed at creating and promoting tolerance

  8. A Comparison of Machine Learning Methods in a High-Dimensional Classification Problem

    Directory of Open Access Journals (Sweden)

    Zekić-Sušac Marijana

    2014-09-01

    Full Text Available Background: Large-dimensional data modelling often relies on variable reduction methods in the pre-processing and in the post-processing stage. However, such a reduction usually provides less information and yields a lower accuracy of the model. Objectives: The aim of this paper is to assess the high-dimensional classification problem of recognizing entrepreneurial intentions of students by machine learning methods. Methods/Approach: Four methods were tested: artificial neural networks, CART classification trees, support vector machines, and k-nearest neighbour on the same dataset in order to compare their efficiency in the sense of classification accuracy. The performance of each method was compared on ten subsamples in a 10-fold cross-validation procedure in order to assess computing sensitivity and specificity of each model. Results: The artificial neural network model based on multilayer perceptron yielded a higher classification rate than the models produced by other methods. The pairwise t-test showed a statistical significance between the artificial neural network and the k-nearest neighbour model, while the difference among other methods was not statistically significant. Conclusions: Tested machine learning methods are able to learn fast and achieve high classification accuracy. However, further advancement can be assured by testing a few additional methodological refinements in machine learning methods.

  9. Short-term moderate intensive high volume training program provides aerobic endurance benefit in wheelchair basketball players.

    Science.gov (United States)

    Skucas, Kestutis; Pokvytyte, Vaida

    2017-04-01

    The aim of this paper was to investigate the effect of short-term period, moderate intensity and high volume endurance training on physiological variables in elite wheelchair basketball players. Eight wheelchair basketball players were examined. The subjects participated in a two-week intervention program of mainly two training types: wheelchair basketball and wheelchair driving endurance training. The subjects performed the continuously increasing cycling exercise (CCE) at the constant 60 rpm arm cranking speed at the beginning of the program and after two weeks of the program. The initial workload was 20 W, then the workload was increased by 2 W every 5 seconds until fatigue. The post training of the wheelchair basketball group in the study showed a significant improvement in the peak oxygen uptake (VO2peak) and the peak power output (POpeak). VO2peak increased by 9% from 2.32±0.16 L/min to 2.53±0.2 L/min (Pbasketball squad had relatively high levels of aerobic fitness prior to participating in the endurance training program. Nevertheless, the high-volume, moderate-intensity, short-term training program, which evolved over the two-weeks period, resulted in the improvement of the athlete's aerobic endurance. The ventilatory threshold (VT) and the second ventilatory threshold (VT2) are good markers for aerobic capacity of wheelchair athletes.

  10. Challenges in providing counselling to MSM in highly stigmatized contexts: results of a qualitative study from Kenya.

    Directory of Open Access Journals (Sweden)

    Miriam Taegtmeyer

    Full Text Available The role of men who have sex with men (MSM in the African HIV epidemic is gaining recognition yet capacity to address the HIV prevention needs of this group is limited. HIV testing and counselling is not only a critical entry point for biomedical HIV prevention interventions, such as pre-exposure prophylaxis, rectal microbicides and early treatment initiation, but is also an opportunity for focused risk reduction counselling that can support individuals living in difficult circumstances. For prevention efforts to succeed, however, MSM need to access services and they will only do so if these are non-judgmental, informative, focused on their needs, and of clear benefit. This study aimed to understand Kenyan providers' attitudes towards and experiences with counselling MSM in a research clinic targeting this group for HIV prevention. We used in-depth interviews to explore values, attitudes and cognitive and social constructs of 13 counsellors and 3 clinicians providing services to MSM at this clinic. Service providers felt that despite their growing experience, more targeted training would have been helpful to improve their effectiveness in MSM-specific risk reduction counselling. They wanted greater familiarity with MSM in Kenya to better understand the root causes of MSM risk-taking (e.g., poverty, sex work, substance abuse, misconceptions about transmission, stigma, and sexual desire and felt frustrated at the perceived intractability of some of their clients' issues. In addition, they identified training needs on how to question men about specific risk behaviours, improved strategies for negotiating risk reduction with counselling clients, and improved support supervision from senior counsellors. This paper describes the themes arising from these interviews and makes practical recommendations on training and support supervision systems for nascent MSM HIV prevention programmes in Africa.

  11. Challenges in providing counselling to MSM in highly stigmatized contexts: results of a qualitative study from Kenya.

    Science.gov (United States)

    Taegtmeyer, Miriam; Davies, Alun; Mwangome, Mary; van der Elst, Elisabeth M; Graham, Susan M; Price, Matt A; Sanders, Eduard J

    2013-01-01

    The role of men who have sex with men (MSM) in the African HIV epidemic is gaining recognition yet capacity to address the HIV prevention needs of this group is limited. HIV testing and counselling is not only a critical entry point for biomedical HIV prevention interventions, such as pre-exposure prophylaxis, rectal microbicides and early treatment initiation, but is also an opportunity for focused risk reduction counselling that can support individuals living in difficult circumstances. For prevention efforts to succeed, however, MSM need to access services and they will only do so if these are non-judgmental, informative, focused on their needs, and of clear benefit. This study aimed to understand Kenyan providers' attitudes towards and experiences with counselling MSM in a research clinic targeting this group for HIV prevention. We used in-depth interviews to explore values, attitudes and cognitive and social constructs of 13 counsellors and 3 clinicians providing services to MSM at this clinic. Service providers felt that despite their growing experience, more targeted training would have been helpful to improve their effectiveness in MSM-specific risk reduction counselling. They wanted greater familiarity with MSM in Kenya to better understand the root causes of MSM risk-taking (e.g., poverty, sex work, substance abuse, misconceptions about transmission, stigma, and sexual desire) and felt frustrated at the perceived intractability of some of their clients' issues. In addition, they identified training needs on how to question men about specific risk behaviours, improved strategies for negotiating risk reduction with counselling clients, and improved support supervision from senior counsellors. This paper describes the themes arising from these interviews and makes practical recommendations on training and support supervision systems for nascent MSM HIV prevention programmes in Africa.

  12. A Novel Method for Decoding Any High-Order Hidden Markov Model

    Directory of Open Access Journals (Sweden)

    Fei Ye

    2014-01-01

    Full Text Available This paper proposes a novel method for decoding any high-order hidden Markov model. First, the high-order hidden Markov model is transformed into an equivalent first-order hidden Markov model by Hadar’s transformation. Next, the optimal state sequence of the equivalent first-order hidden Markov model is recognized by the existing Viterbi algorithm of the first-order hidden Markov model. Finally, the optimal state sequence of the high-order hidden Markov model is inferred from the optimal state sequence of the equivalent first-order hidden Markov model. This method provides a unified algorithm framework for decoding hidden Markov models including the first-order hidden Markov model and any high-order hidden Markov model.

  13. Separation and determination of high-carbon alcohols using method of column chromatographic and gas-chromatographic analysis

    International Nuclear Information System (INIS)

    Kang Zhongrong; Li Biping; Zeng Yongchang

    1988-01-01

    This paper describes the separation and determination of high-carbon alcohols from amine extractant by using the method of column chromatography of aluminium oxide and gas-chromatographic analysis. The total conent of high-carbon alcohols is determined by the method of column chromatography, while the components of the high-carbon alcohols and their relative contents are determined by the method of gas-chromatography. A simple reliable and practical method is provided for the analysis of high-carbon alcohol from the amine extractant in this paper

  14. Light extinction method on high-pressure diesel injection

    Science.gov (United States)

    Su, Tzay-Fa; El-Beshbeeshy, Mahmound S.; Corradini, Michael L.; Farrell, Patrick V.

    1995-09-01

    A two dimensional optical diagnostic technique based on light extinction was improved and demonstrated in an investigation of diesel spray characteristics at high injection pressures. Traditional light extinction methods require the spray image to be perpendicular to the light path. In the improved light extinction scheme, a tilted spray image which has an angle with the light path is still capable of being processed. This technique utilizes high speed photography and digital image analysis to obtain qualitative and quantitative information of the spray characteristics. The injection system used was an electronically controlled common rail unit injector system with injection pressures up to 100 MPa. The nozzle of the injector was a mini-sac type with six holes on the nozzle tip. Two different injection angle nozzles, 125 degree(s) and 140 degree(s), producing an in-plane tilted spray and an out of plane tilted spray were investigated. The experiments were conducted on a constant volume spray chamber with the injector mounted tilted at an angle of 62.5 degree(s)$. Only one spray plume was viewed, and other sprays were free to inject to the chamber. The spray chamber was pressurized with argon and air under room temperature to match the combustion chamber density at the start of the injection. The experimental results show that the difference in the spray tip penetration length, spray angle, and overall average Sauter mean diameter is small between the in- plane tilted spray and the out of plane tilted spray. The results also show that in-plane tilted spray has a slightly larger axial cross- section Sauter mean diameter than the out of plane tilted spray.

  15. Metaphysics methods development for high temperature gas cooled reactor analysis

    International Nuclear Information System (INIS)

    Seker, V.; Downar, T. J.

    2007-01-01

    Gas cooled reactors have been characterized as one of the most promising nuclear reactor concepts in the Generation-IV technology road map. Considerable research has been performed on the design and safety analysis of these reactors. However, the calculational tools being used to perform these analyses are not state-of-the-art and are not capable of performing detailed three-dimensional analyses. This paper presents the results of an effort to develop an improved thermal-hydraulic solver for the pebble bed type high temperature gas cooled reactors. The solution method is based on the porous medium approach and the momentum equation including the modified Ergun's resistance model for pebble bed is solved in three-dimensional geometry. The heat transfer in the pebble bed is modeled considering the local thermal non-equilibrium between the solid and gas, which results in two separate energy equations for each medium. The effective thermal conductivity of the pebble-bed can be calculated both from Zehner-Schluender and Robold correlations. Both the fluid flow and the heat transfer are modeled in three dimensional cylindrical coordinates and can be solved in steady-state and time dependent. The spatial discretization is performed using the finite volume method and the theta-method is used in the temporal discretization. A preliminary verification was performed by comparing the results with the experiments conducted at the SANA test facility. This facility is located at the Institute for Safety Research and Reactor Technology (ISR), Julich, Germany. Various experimental cases are modeled and good agreement in the gas and solid temperatures is observed. An on-going effort is to model the control rod ejection scenarios as described in the OECD/NEA/NSC PBMR-400 benchmark problem. In order to perform these analyses PARCS reactor simulator code will be coupled with the new thermal-hydraulic solver. Furthermore, some of the other anticipated accident scenarios in the benchmark

  16. Validation of a new method for testing provider clinical quality in rural settings in low- and middle-income countries: the observed simulated patient.

    Directory of Open Access Journals (Sweden)

    Tin Aung

    Full Text Available BACKGROUND: Assessing the quality of care provided by individual health practitioners is critical to identifying possible risks to the health of the public. However, existing assessment methods can be inaccurate, expensive, or infeasible in many developing country settings, particularly in rural areas and especially for children. Following an assessment of the strengths and weaknesses of the existing methods for provider assessment, we developed a synthesis method combining components of direct observation, clinical vignettes, and medical mannequins which we have termed "Observed Simulated Patient" or OSP. An OSP assessment involves a trained actor playing the role of a 'mother', a life-size doll representing a 5-year old boy, and a trained observer. The provider being assessed was informed in advance of the role-playing, and told to conduct the diagnosis and treatment as he normally would while verbally describing the examinations. METHODOLOGY/PRINCIPAL FINDINGS: We tested the validity of OSP by conducting parallel scoring of medical providers in Myanmar, assessing the quality of their diagnosis and treatment of pediatric malaria, first by direct observation of true patients and second by OSP. Data were collected from 20 private independent medical practitioners in Mon and Kayin States, Myanmar between December 26, 2010 and January 12, 2011. All areas of assessment showed agreement between OSP and direct observation above 90% except for history taking related to past experience with malaria medicines. In this area, providers did not ask questions of the OSP to the same degree that they questioned real patients (agreement 82.8%. CONCLUSIONS/SIGNIFICANCE: The OSP methodology may provide a valuable option for quality assessment of providers in places, or for health conditions, where other assessment tools are unworkable.

  17. A high precision extrapolation method in multiphase-field model for simulating dendrite growth

    Science.gov (United States)

    Yang, Cong; Xu, Qingyan; Liu, Baicheng

    2018-05-01

    The phase-field method coupling with thermodynamic data has become a trend for predicting the microstructure formation in technical alloys. Nevertheless, the frequent access to thermodynamic database and calculation of local equilibrium conditions can be time intensive. The extrapolation methods, which are derived based on Taylor expansion, can provide approximation results with a high computational efficiency, and have been proven successful in applications. This paper presents a high precision second order extrapolation method for calculating the driving force in phase transformation. To obtain the phase compositions, different methods in solving the quasi-equilibrium condition are tested, and the M-slope approach is chosen for its best accuracy. The developed second order extrapolation method along with the M-slope approach and the first order extrapolation method are applied to simulate dendrite growth in a Ni-Al-Cr ternary alloy. The results of the extrapolation methods are compared with the exact solution with respect to the composition profile and dendrite tip position, which demonstrate the high precision and efficiency of the newly developed algorithm. To accelerate the phase-field and extrapolation computation, the graphic processing unit (GPU) based parallel computing scheme is developed. The application to large-scale simulation of multi-dendrite growth in an isothermal cross-section has demonstrated the ability of the developed GPU-accelerated second order extrapolation approach for multiphase-field model.

  18. Population Trends of Central European Montane Birds Provide Evidence for Adverse Impacts of Climate Change on High-Altitude Species.

    Directory of Open Access Journals (Sweden)

    Jiří Flousek

    Full Text Available Climate change is among the most important global threats to biodiversity and mountain areas are supposed to be under especially high pressure. Although recent modelling studies suggest considerable future range contractions of montane species accompanied with increased extinction risk, data allowing to test actual population consequences of the observed climate changes and identifying traits associated to their adverse impacts are very scarce. To fill this knowledge gap, we estimated long-term population trends of montane birds from 1984 to 2011 in a central European mountain range, the Giant Mountains (Krkonoše, where significant warming occurred over this period. We then related the population trends to several species' traits related to the climate change effects. We found that the species breeding in various habitats at higher altitudes had more negative trends than species breeding at lower altitudes. We also found that the species moved upwards as a response to warming climate, and these altitudinal range shifts were associated with more positive population trends at lower altitudes than at higher altitudes. Moreover, long-distance migrants declined more than residents or species migrating for shorter distances. Taken together, these results indicate that the climate change, besides other possible environmental changes, already influences populations of montane birds with particularly adverse impacts on high-altitude species such as water pipit (Anthus spinoletta. It is evident that the alpine species, predicted to undergo serious climatically induced range contractions due to warming climate in the future, already started moving along this trajectory.

  19. Barley HvPAPhy_a as transgene provides high and stable phytase activities in mature barley straw and in grains.

    Science.gov (United States)

    Holme, Inger Baeksted; Dionisio, Giuseppe; Madsen, Claus Krogh; Brinch-Pedersen, Henrik

    2017-04-01

    The phytase purple acid phosphatase (HvPAPhy_a) expressed during barley seed development was evaluated as transgene for overexpression in barley. The phytase was expressed constitutively driven by the cauliflower mosaic virus 35S-promoter, and the phytase activity was measured in the mature grains, the green leaves and in the dry mature vegetative plant parts left after harvest of the grains. The T 2 -generation of HvPAPhy_a transformed barley showed phytase activity increases up to 19-fold (29 000 phytase units (FTU) per kg in mature grains). Moreover, also in green leaves and mature dry straw, phytase activities were increased significantly by 110-fold (52 000 FTU/kg) and 57-fold (51 000 FTU/kg), respectively. The HvPAPhy_a-transformed barley plants with high phytase activities possess triple potential utilities for the improvement of phosphate bioavailability. First of all, the utilization of the mature grains as feed to increase the release of bio-available phosphate and minerals bound to the phytate of the grains; secondly, the utilization of the powdered straw either directly or phytase extracted hereof as a supplement to high phytate feed or food; and finally, the use of the stubble to be ploughed into the soil for mobilizing phytate-bound phosphate for plant growth. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  20. Methods for Probing New Physics at High Energies

    Science.gov (United States)

    Denton, Peter B.

    This dissertation covers two broad topics. The title, " Methods for Probing New Physics at High Energies," hopefully encompasses both of them. The first topic is located in part I of this work and is about integral dispersion relations. This is a technique to probe for new physics at energy scales near to the machine energy of a collider. For example, a hadron collider taking data at a given energy is typically only sensitive to new physics occurring at energy scales about a factor of five to ten beneath the actual machine energy due to parton distribution functions. This technique is sensitive to physics happening directly beneath the machine energy in addition to the even more interesting case: directly above. Precisely where this technique is sensitive is one of the main topics of this area of research. The other topic is located in part II and is about cosmic ray anisotropy at the highest energies. The unanswered questions about cosmic rays at the highest energies are numerous and interconnected in complicated ways. What may be the first piece of the puzzle to fall into place is determining their sources. This work looks to determine if and when the use of spherical harmonics becomes sensitive enough to determine these sources. The completed papers for this work can be found online. For part I on integral dispersion relations see reference published in Physical Review D. For part II on cosmic ray anisotropy, there are conference proceedings published in the Journal of Physics: Conference Series. The analysis of the location of an experiment on anisotropy reconstruction is, and the comparison of different experiments' abilities to reconstruct anisotropies is published in The Astrophysical Journal and the Journal of High Energy Astrophysics respectively. While this dissertation is focused on three papers completed with Tom Weiler at Vanderbilt University, other papers were completed at the same time. The first was with Nicusor Arsene, Lauretiu Caramete, and

  1. Recursive regularization step for high-order lattice Boltzmann methods

    Science.gov (United States)

    Coreixas, Christophe; Wissocq, Gauthier; Puigt, Guillaume; Boussuge, Jean-François; Sagaut, Pierre

    2017-09-01

    A lattice Boltzmann method (LBM) with enhanced stability and accuracy is presented for various Hermite tensor-based lattice structures. The collision operator relies on a regularization step, which is here improved through a recursive computation of nonequilibrium Hermite polynomial coefficients. In addition to the reduced computational cost of this procedure with respect to the standard one, the recursive step allows to considerably enhance the stability and accuracy of the numerical scheme by properly filtering out second- (and higher-) order nonhydrodynamic contributions in under-resolved conditions. This is first shown in the isothermal case where the simulation of the doubly periodic shear layer is performed with a Reynolds number ranging from 104 to 106, and where a thorough analysis of the case at Re=3 ×104 is conducted. In the latter, results obtained using both regularization steps are compared against the Bhatnagar-Gross-Krook LBM for standard (D2Q9) and high-order (D2V17 and D2V37) lattice structures, confirming the tremendous increase of stability range of the proposed approach. Further comparisons on thermal and fully compressible flows, using the general extension of this procedure, are then conducted through the numerical simulation of Sod shock tubes with the D2V37 lattice. They confirm the stability increase induced by the recursive approach as compared with the standard one.

  2. High-integrity software, computation and the scientific method

    International Nuclear Information System (INIS)

    Hatton, L.

    2012-01-01

    Computation rightly occupies a central role in modern science. Datasets are enormous and the processing implications of some algorithms are equally staggering. With the continuing difficulties in quantifying the results of complex computations, it is of increasing importance to understand its role in the essentially Popperian scientific method. In this paper, some of the problems with computation, for example the long-term unquantifiable presence of undiscovered defect, problems with programming languages and process issues will be explored with numerous examples. One of the aims of the paper is to understand the implications of trying to produce high-integrity software and the limitations which still exist. Unfortunately Computer Science itself suffers from an inability to be suitably critical of its practices and has operated in a largely measurement-free vacuum since its earliest days. Within computer science itself, this has not been so damaging in that it simply leads to unconstrained creativity and a rapid turnover of new technologies. In the applied sciences however which have to depend on computational results, such unquantifiability significantly undermines trust. It is time this particular demon was put to rest. (author)

  3. Accessing High Spatial Resolution in Astronomy Using Interference Methods

    Science.gov (United States)

    Carbonel, Cyril; Grasset, Sébastien; Maysonnave, Jean

    2018-04-01

    In astronomy, methods such as direct imaging or interferometry-based techniques (Michelson stellar interferometry for example) are used for observations. A particular advantage of interferometry is that it permits greater spatial resolution compared to direct imaging with a single telescope, which is limited by diffraction owing to the aperture of the instrument as shown by Rueckner et al. in a lecture demonstration. The focus of this paper, addressed to teachers and/or students in high schools and universities, is to easily underline both an application of interferometry in astronomy and stress its interest for resolution. To this end very simple optical experiments are presented to explain all the concepts. We show how an interference pattern resulting from the combined signals of two telescopes allows us to measure the distance between two stars with a resolution beyond the diffraction limit. Finally this work emphasizes the breathtaking resolution obtained in state-of-the-art instruments such as the VLTi (Very Large Telescope interferometer).

  4. Schistosomiasis mansoni incidence data in Rwanda can improve prevalence assessments, by providing high-resolution hotspot and risk factors identification.

    Science.gov (United States)

    Nyandwi, E; Veldkamp, A; Amer, S; Karema, C; Umulisa, I

    2017-10-25

    Schistosomiasis mansoni constitutes a significant public health problem in Rwanda. The nationwide prevalence mapping conducted in 2007-2008 revealed that prevalence per district ranges from 0 to 69.5% among school children. In response, mass drug administration campaigns were initiated. However, a few years later some additional small-scale studies revealed the existence of areas of high transmission in districts formerly classified as low endemic suggesting the need for a more accurate methodology for identification of hotspots. This study investigated if confirmed cases of schistosomiasis recorded at health facility level can be used to, next to existing prevalence data, detect geographically more accurate hotspots of the disease and its associated risk factors. A GIS-based spatial and statistical analysis was carried out. Confirmed cases, recorded at primary health facilities level, were combined with demographic data to calculate incidence rates for each of 367 health facility service area. Empirical Bayesian smoothing was used to deal with rate instability. Incidence rates were compared with prevalence data to identify their level of agreement. Spatial autocorrelation of the incidence rates was analyzed using Moran's Index, to check if spatial clustering occurs. Finally, the spatial relationship between schistosomiasis distribution and potential risk factors was assessed using multiple regression. Incidence rates for 2007-2008 were highly correlated with prevalence values (R 2  = 0.79), indicating that in the case of Rwanda incidence data can be used as a proxy for prevalence data. We observed a focal distribution of schistosomiasis with a significant spatial autocorrelation (Moran's I > 0: 0,05-0.20 and p ≤ 0,05), indicating the occurrence of hotspots. Regarding risk factors, it was identified that the spatial pattern of schistosomiasis is significantly associated with wetland conditions and rice cultivation. In Rwanda the high density of health

  5. Prospects for application of high-temperature helium reactor (HTHR) to provide for power needs in refineries and petrochemical plants

    International Nuclear Information System (INIS)

    Feigin, E.A.; Raud, E.A.; Romanova, E.G.; Panasenko, P.A.; Nikitin, V.N.

    1990-01-01

    An analysis performed shows that heat supply from High Temperature Helium Reactor (HTHR) located several miles from crude oil refining units, operating at 360-400 deg. C, can be arranged to use organic heat-carriers. At higher operating temperatures most acceptable are saline carriers. However the final choice of heat carries requires extra research including that on a large scale basis in order to improve the technology and equipment of the heat-supply system. The following problems can be solved by implementing HTHRs at the crude oil processing and petrochemical plants: improving pollution control, making more hydrocarbon fuel available for other uses, intensifying the operation of process units, and making them less fire hazardous, increasing the power efficiency of process plants

  6. Quinoa (Chenopodium quinoa W.) and amaranth (Amaranthus caudatus L.) provide dietary fibres high in pectic substances and xyloglucans.

    Science.gov (United States)

    Lamothe, Lisa M; Srichuwong, Sathaporn; Reuhs, Bradley L; Hamaker, Bruce R

    2015-01-15

    Dietary fibre of quinoa and amaranth was analysed for its insoluble and soluble fibre content, composition, and structure. Total dietary fibre content was 10% for quinoa and 11% for amaranth. For both pseudocereals, 78% of its dietary fibre was insoluble. Insoluble fibre (IDF) from quinoa and amaranth was mainly composed of galacturonic acid, arabinose, galactose, xylose and glucose. Linkage analysis indicated that IDF was composed of homogalacturonans and rhamnogalacturonan-I with arabinan side-chains (∼55-60%), as well as highly branched xyloglucans (∼30%) and cellulose. For both pseudocereals, 22% of total dietary fibre was soluble; a higher proportion than that found in wheat and maize (∼15%). The soluble fibre (SDF) was composed of glucose, galacturonic acid and arabinose; for amaranth, xylose was also a major constituent. Xyloglucans made up ∼40-60% of the SDF and arabinose-rich pectic polysaccharides represented ∼34-55%. Copyright © 2014. Published by Elsevier Ltd.

  7. Barley HvPAPhy_a as transgene provides high and stable phytase activities in mature barley straw and in grains

    DEFF Research Database (Denmark)

    Holme, Inger; Dionisio, Giuseppe; Madsen, Claus Krogh

    2017-01-01

    The phytase purple acid phosphatase (HvPAPhy_a) expressed during barley seed development was evaluated as transgene for overexpression in barley. The phytase was expressed constitutively driven by the cauliflower mosaic virus 35S-promoter, and the phytase activity was measured in the mature grains......, the green leaves and in the dry mature vegetative plant parts left after harvest of the grains. The T2-generation of HvPAPhy_a transformed barley showed phytase activity increases up to 19-fold (29 000 phytase units (FTU) per kg in mature grains). Moreover, also in green leaves and mature dry straw, phytase...... activities were increased significantly by 110-fold (52 000 FTU/kg) and 57-fold (51 000 FTU/kg), respectively. The HvPAPhy_a-transformed barley plants with high phytase activities possess triple potential utilities for the improvement of phosphate bioavailability. First of all, the utilization of the mature...

  8. A Critical Subset Model Provides a Conceptual Basis for the High Antiviral Activity of Major HIV Drugs**

    Science.gov (United States)

    Shen, Lin; Rabi, S. Alireza; Sedaghat, Ahmad R.; Shan, Liang; Lai, Jun; Xing, Sifei; Siliciano, Robert F.

    2012-01-01

    Control of HIV-1 replication was first achieved with regimens that included a nonnucleoside reverse transcriptase inhibitor (NNRTI) or a protease inhibitor (PI); however, an explanation for the high antiviral activity of these drugs has been lacking. Indeed, conventional pharmacodynamic measures like IC50 (drug concentration causing 50% inhibition) do not differentiate NNRTIs and PIs from less active nucleoside reverse transcriptase inhibitors (NRTIs). Drug inhibitory potential depends on the slope of the dose-response curve (m), which represents how inhibition increases as a function of increasing drug concentration and is related to the Hill coefficient, a measure of intramolecular cooperativity in ligand binding to a multivalent receptor. Although NNRTIs and PIs bind univalent targets, they unexpectedly exhibit cooperative dose-response curves (m > 1). We show that this cooperative inhibition can be explained by a model in which infectivity requires participation of multiple copies of a drug target in an individual life cycle stage. A critical subset of these target molecules must be in the unbound state. Consistent with experimental observations, this model predicts m > 1 for NNRTIs and PIs and m = 1 in situations where a single drug target/virus mediates a step in the life cycle, as is the case with NRTIs and integrase strand transfer inhibitors. This model was tested experimentally by modulating the number of functional drug targets per virus, and dose-response curves for modulated virus populations fit model predictions. This model explains the high antiviral activity of two drug classes important for successful HIV-1 treatment and defines a characteristic of good targets for antiviral drugs in general, namely, intermolecular cooperativity. PMID:21753122

  9. Application of the photoelastic experimental hybrid method with new numerical method to the high stress distribution

    International Nuclear Information System (INIS)

    Hawong, Jai Sug; Lee, Dong Hun; Lee, Dong Ha; Tche, Konstantin

    2004-01-01

    In this research, the photoelastic experimental hybrid method with Hook-Jeeves numerical method has been developed: This method is more precise and stable than the photoelastic experimental hybrid method with Newton-Rapson numerical method with Gaussian elimination method. Using the photoelastic experimental hybrid method with Hook-Jeeves numerical method, we can separate stress components from isochromatics only and stress intensity factors and stress concentration factors can be determined. The photoelastic experimental hybrid method with Hook-Jeeves had better be used in the full field experiment than the photoelastic experimental hybrid method with Newton-Rapson with Gaussian elimination method

  10. A highly accurate method to solve Fisher's equation

    Indian Academy of Sciences (India)

    The solution of the Helmholtz equation was approximated by a sixth-order compact finite difference. (CFD6) method in [29]. In [30], a CFD6 scheme has been presented to ... efficiency of the proposed method are reported in §3. Finally .... our discussion, one can apply the proposed method to solve the more general problem.

  11. Simulating elastic light scattering using high performance computing methods

    NARCIS (Netherlands)

    Hoekstra, A.G.; Sloot, P.M.A.; Verbraeck, A.; Kerckhoffs, E.J.H.

    1993-01-01

    The Coupled Dipole method, as originally formulated byPurcell and Pennypacker, is a very powerful method tosimulate the Elastic Light Scattering from arbitraryparticles. This method, which is a particle simulationmodel for Computational Electromagnetics, has one majordrawback: if the size of the

  12. Usability testing of a prototype Phone Oximeter with healthcare providers in high- and low-medical resource environments.

    Science.gov (United States)

    Hudson, J; Nguku, S M; Sleiman, J; Karlen, W; Dumont, G A; Petersen, C L; Warriner, C B; Ansermino, J M

    2012-09-01

    To increase the use of pulse oximetry by capitalise on the wide availability of mobile phones, we have designed, developed and evaluated a prototype pulse oximeter interfaced to a mobile phone. Usability of this Phone Oximeter was tested as part of a rapid prototyping process. Phase 1 of the study (20 subjects) was performed in Canada. Users performed 23 tasks, while thinking aloud. Time for completion of tasks and analysis of user response to a mobile phone usability questionnaire were used to evaluate usability. Five interface improvements were made to the prototype before evaluation in Phase 2 (15 subjects) in Uganda. The lack of previous pulse oximetry experience and mobile phone use increased median (IQR [range]) time taken to perform tasks from 219 (160-247 [118-274]) s in Phase 1 to 228 (151-501 [111-2661]) s in Phase 2. User feedback was positive and overall usability high (Phase 1--82%, Phase 2--78%). Anaesthesia © 2012 The Association of Anaesthetists of Great Britain and Ireland.

  13. A different interpretation of Einstein's viscosity equation provides accurate representations of the behavior of hydrophilic solutes to high concentrations.

    Science.gov (United States)

    Zavitsas, Andreas A

    2012-08-23

    Viscosities of aqueous solutions of many highly soluble hydrophilic solutes with hydroxyl and amino groups are examined with a focus on improving the concentration range over which Einstein's relationship between solution viscosity and solute volume, V, is applicable accurately. V is the hydrodynamic effective volume of the solute, including any water strongly bound to it and acting as a single entity with it. The widespread practice is to relate the relative viscosity of solute to solvent, η/η(0), to V/V(tot), where V(tot) is the total volume of the solution. For solutions that are not infinitely dilute, it is shown that the volume ratio must be expressed as V/V(0), where V(0) = V(tot) - V. V(0) is the volume of water not bound to the solute, the "free" water solvent. At infinite dilution, V/V(0) = V/V(tot). For the solutions examined, the proportionality constant between the relative viscosity and volume ratio is shown to be 2.9, rather than the 2.5 commonly used. To understand the phenomena relating to viscosity, the hydrodynamic effective volume of water is important. It is estimated to be between 54 and 85 cm(3). With the above interpretations of Einstein's equation, which are consistent with his stated reasoning, the relation between the viscosity and volume ratio remains accurate to much higher concentrations than those attainable with any of the other relations examined that express the volume ratio as V/V(tot).

  14. A Secure Web Application Providing Public Access to High-Performance Data Intensive Scientific Resources - ScalaBLAST Web Application

    International Nuclear Information System (INIS)

    Curtis, Darren S.; Peterson, Elena S.; Oehmen, Chris S.

    2008-01-01

    This work presents the ScalaBLAST Web Application (SWA), a web based application implemented using the PHP script language, MySQL DBMS, and Apache web server under a GNU/Linux platform. SWA is an application built as part of the Data Intensive Computer for Complex Biological Systems (DICCBS) project at the Pacific Northwest National Laboratory (PNNL). SWA delivers accelerated throughput of bioinformatics analysis via high-performance computing through a convenient, easy-to-use web interface. This approach greatly enhances emerging fields of study in biology such as ontology-based homology, and multiple whole genome comparisons which, in the absence of a tool like SWA, require a heroic effort to overcome the computational bottleneck associated with genome analysis. The current version of SWA includes a user account management system, a web based user interface, and a backend process that generates the files necessary for the Internet scientific community to submit a ScalaBLAST parallel processing job on a dedicated cluster

  15. Modernization of the High Flux Isotope Reactor (HFIR) to Provide a Cold Neutron Source and Experimentation Facility

    International Nuclear Information System (INIS)

    Rothrock, Benjamin G.; Farrar, Mike B.

    2009-01-01

    In June 1961, construction was started on the High Flux Isotope Reactor (HFIR) facility inside the Oak Ridge National Laboratory (ORNL), at the recommendation of the U.S. Atomic Energy Commission (AEC) Division of Research. Construction was completed in early 1965 with criticality achieved on August 25, 19651. From the first full power operating cycle beginning in September 1966, the HFIR has achieved an outstanding record of service to the scientific community. In early 1995, the ORNL deputy director formed a group to examine the need for upgrades to the HFIR following the cancellation of the Advanced Neutron Source Project by DOE. This group indicated that there was an immediate need for the installation of a cold neutron source facility in the HFIR to produce cold neutrons for neutron scattering research uses. Cold neutrons have long wavelengths in the range of 4-12 angstroms. Cold neutrons are ideal for research applications with long length-scale molecular structures such as polymers, nanophase materials, and biological samples. These materials require large scale examination (and therefore require a longer wavelength neutron). These materials represent particular areas of science are at the forefront of current research initiatives that have a potentially significant impact on the materials we use in our everyday lives and our knowledge of biology and medicine. This paper discusses the installation of a cold neutron source at HFIR with respect to the project as a modernization of the facility. The paper focuses on why the project was required, the scope of the cold source project with specific emphasis on the design, and project management information.

  16. A comparison of high-order polynomial and wave-based methods for Helmholtz problems

    Science.gov (United States)

    Lieu, Alice; Gabard, Gwénaël; Bériot, Hadrien

    2016-09-01

    The application of computational modelling to wave propagation problems is hindered by the dispersion error introduced by the discretisation. Two common strategies to address this issue are to use high-order polynomial shape functions (e.g. hp-FEM), or to use physics-based, or Trefftz, methods where the shape functions are local solutions of the problem (typically plane waves). Both strategies have been actively developed over the past decades and both have demonstrated their benefits compared to conventional finite-element methods, but they have yet to be compared. In this paper a high-order polynomial method (p-FEM with Lobatto polynomials) and the wave-based discontinuous Galerkin method are compared for two-dimensional Helmholtz problems. A number of different benchmark problems are used to perform a detailed and systematic assessment of the relative merits of these two methods in terms of interpolation properties, performance and conditioning. It is generally assumed that a wave-based method naturally provides better accuracy compared to polynomial methods since the plane waves or Bessel functions used in these methods are exact solutions of the Helmholtz equation. Results indicate that this expectation does not necessarily translate into a clear benefit, and that the differences in performance, accuracy and conditioning are more nuanced than generally assumed. The high-order polynomial method can in fact deliver comparable, and in some cases superior, performance compared to the wave-based DGM. In addition to benchmarking the intrinsic computational performance of these methods, a number of practical issues associated with realistic applications are also discussed.

  17. NK sensitivity of neuroblastoma cells determined by a highly sensitive coupled luminescent method

    International Nuclear Information System (INIS)

    Ogbomo, Henry; Hahn, Anke; Geiler, Janina; Michaelis, Martin; Doerr, Hans Wilhelm; Cinatl, Jindrich

    2006-01-01

    The measurement of natural killer (NK) cells toxicity against tumor or virus-infected cells especially in cases with small blood samples requires highly sensitive methods. Here, a coupled luminescent method (CLM) based on glyceraldehyde-3-phosphate dehydrogenase release from injured target cells was used to evaluate the cytotoxicity of interleukin-2 activated NK cells against neuroblastoma cell lines. In contrast to most other methods, CLM does not require the pretreatment of target cells with labeling substances which could be toxic or radioactive. The effective killing of tumor cells was achieved by low effector/target ratios ranging from 0.5:1 to 4:1. CLM provides highly sensitive, safe, and fast procedure for measurement of NK cell activity with small blood samples such as those obtained from pediatric patients

  18. New method for eliminating the statistical bias in highly turbulent flow measurements

    International Nuclear Information System (INIS)

    Nakao, S.I.; Terao, Y.; Hirata, K.I.; Kitakyushu Industrial Research Institute, Fukuoka, Japan)

    1987-01-01

    A simple method was developed for eliminating statistical bias which can be applied to highly turbulent flows with the sparse and nonuniform seeding conditions. Unlike the method proposed so far, a weighting function was determined based on the idea that the statistical bias could be eliminated if the asymmetric form of the probability density function of the velocity data were corrected. Moreover, the data more than three standard deviations away from the mean were discarded to remove the apparent turbulent intensity resulting from noise. The present method was applied to data obtained in the wake of a block, which provided local turbulent intensities up to about 120 percent, it was found to eliminate the statistical bias with high accuracy. 9 references

  19. Hot-spot analysis applied to the identification of potential high and low regulating, providing and cultural ecosystem services in Vilnius Region (Lithuania)

    Science.gov (United States)

    Pereira, Paulo; Daniel, Depellegrin; Egarter-Vigl, Lukas; Cerda, Artemi; Estebaranz, Ferran; Misiune, Ieva

    2017-04-01

    Ecosystem services (ES) potential assessment is crucial for a correct territorial planning at different scales of analysis (Depellegrin et al., 2016). In urban and peri-urban areas, sprawl, grazing and unsustainable agriculture practices contributed to land degradation and de decrease of the quality and quantity of the services provided by these areas (Eldridge and Delgado-Baquerizo, 2017; Favretto et al., 2017). In order to understand the spatial pattern of these impacts, mapping ES potential is key to understand the areas that need to be restored and protected for an unsustainable use (Brevik et al., 2016; Egarter-Vigl et al., 2017; Pereira et al., 2017). Hot-spot analysis is a good method to identify clusters of areas with high and low capacity for ES capacity. This analysis is very useful to detect homogeneous areas, where ES have high or low quality. The objective of this work is to apply a hot-spot analysis to detect areas with high/low capacity for Regulating, Provision, Cultural and Total ES in Vilnius region. ES potential was carried out based on the matrix developed by Burkhard et al. (2009), which ranks ES capacity from 0= no capacity to 5=very high relevant capacity to a different land use type. The results showed that regulating, providing and cultural and total ES have a significant dispersed (low-clustered) pattern: Regulating (Z-score=-19.28, pInternational Journal of Sustainable Development and World Ecology, 23, 441-455. Egarter-Vigl, L., Depellegrin, D., Pereira, P., De Groot, D., Tappeiner, U. (2017) Mapping the ecosystem service delivery chain: Capacity, flow, and demand pertaining to aesthetic experiences in mountain landscapes, Science of the Total Environment, 574, 442-436. Eldridge, D.J., Delgado-Baquerizo, M. (2017) Continental-scale impacts of livestock grazing on ecosystem supporting and regulating services. Land Degradation and Development. DOI: 10.1002/ldr.2668 Favretto, N., Lueding, E., Stringer, L., Dougill, A.J. (2017) Valuing

  20. PROVIDING STRINGENT STAR FORMATION RATE LIMITS OF z ∼ 2 QSO HOST GALAXIES AT HIGH ANGULAR RESOLUTION

    Energy Technology Data Exchange (ETDEWEB)

    Vayner, Andrey; Wright, Shelley A. [Department of Astronomy and Astrophysics, University of Toronto, 50 St. George Street, Toronto, ON, M5S 3H4 (Canada); Do, Tuan [Dunlap Institute for Astronomy and Astrophysics, University of Toronto, 50 St. George Street, Toronto, ON, M5S 3H4 (Canada); Larkin, James E. [Department of Physics and Astronomy, University of California, Los Angeles, CA 90095 (United States); Armus, Lee [Spitzer Science Center, California Institute of Technology, 1200 E. California Boulevard, Pasadena, CA 91125 (United States); Gallagher, S. C. [Department of Physics and Astronomy, The University of Western Ontario, London, ON N6A 3K7 (Canada)

    2016-04-10

    We present integral field spectrograph (IFS) with laser guide star adaptive optics (LGS-AO) observations of z ∼ 2 quasi-stellar objects (QSOs) designed to resolve extended nebular line emission from the host galaxy. Our data was obtained with W. M. Keck and Gemini North Observatories, using OSIRIS and NIFS coupled with the LGS-AO systems, respectively. We have conducted a pilot survey of five QSOs, three observed with NIFS+AO and two observed with OSIRIS+AO at an average redshift of z = 2.2. We demonstrate that the combination of AO and IFSs provides the necessary spatial and spectral resolutions required to separate QSO emission from its host. We present our technique for generating a point-spread function (PSF) from the broad-line region of the QSO and performing PSF subtraction of the QSO emission to detect the host galaxy emission at a separation of ∼0.″2 (∼1.4 kpc). We detect Hα narrow-line emission for two sources, SDSS J1029+6510 (z{sub Hα} = 2.182) and SDSS J0925+0655 (z{sub Hα} = 2.197), that have evidence for both star formation and extended narrow-line emission. Assuming that the majority of narrow-line Hα emission is from star formation, we infer a star formation rate (SFR) for SDSS J1029+6510 of 78.4 M{sub ⊙} yr{sup −1} originating from a compact region that is kinematically offset by 290–350 km s{sup −1}. For SDSS J0925+0655 we infer a SFR of 29 M{sub ⊙} yr{sup −1} distributed over three clumps that are spatially offset by ∼7 kpc. The null detections on three of the QSOs are used to infer surface brightness limits and we find that at 1.4 kpc from the QSO the un-reddened star formation limit is ≲0.3 M{sub ⊙} yr{sup −1} kpc{sup −2}. If we assume typical extinction values for z = 2 type-1 QSOs, the dereddened SFR for our null detections would be ≲0.6 M{sub ⊙} yr{sup −1} kpc{sup −2}. These IFS observations indicate that while the central black hole is accreting mass at 10%–40% of the Eddington rate, if

  1. Plasmonic color metasurfaces fabricated by a high speed roll-to-roll method

    DEFF Research Database (Denmark)

    Murthy, Swathi; Pranov, Henrik; Feidenhans'l, Nikolaj Agentoft

    2017-01-01

    Lab-scale plasmonic color printing using nano-structured and subsequently metallized surfaces have been demonstrated to provide vivid colors. However, upscaling these structures for large area manufacturing is extremely challenging due to the requirement of nanometer precision of metal thickness....... In this study, we have investigated a plasmonic color meta-surface design that can be easily upscaled. We have demonstrated the feasibility of fabrication of these plasmonic color surfaces by a high-speed roll-to-roll method, comprising roll-to-roll extrusion coating at 10 m min-1 creating a polymer foil having...... 100 nm deep pits of varying sub-wavelength diameter and pitch length. Subsequently this polymer foil was metallized and coated also by high-speed roll-to-roll methods. The perceived colors have high tolerance towards the thickness of the metal layer, when this thickness exceeds the depths of the pits...

  2. Level set methods for detonation shock dynamics using high-order finite elements

    Energy Technology Data Exchange (ETDEWEB)

    Dobrev, V. A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Grogan, F. C. [Univ. of California, San Diego, CA (United States); Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Kolev, T. V. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Rieben, R [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Tomov, V. Z. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2017-05-26

    Level set methods are a popular approach to modeling evolving interfaces. We present a level set ad- vection solver in two and three dimensions using the discontinuous Galerkin method with high-order nite elements. During evolution, the level set function is reinitialized to a signed distance function to maintain ac- curacy. Our approach leads to stable front propagation and convergence on high-order, curved, unstructured meshes. The ability of the solver to implicitly track moving fronts lends itself to a number of applications; in particular, we highlight applications to high-explosive (HE) burn and detonation shock dynamics (DSD). We provide results for two- and three-dimensional benchmark problems as well as applications to DSD.

  3. In-Service Teacher Training to Provide Psychosocial Support and Care in High-Risk and High-Need Schools: School-Based Intervention Partnerships

    Science.gov (United States)

    Ebersöhn, Liesel; Loots, Tilda; Eloff, Irma; Ferreira, Ronél

    2015-01-01

    This article uses a South African case study to argue that postcolonial, emerging economy societies in transition often contain schools characterised as high risk and high need. Such schools require teachers to adapt to roles other than facilitating learning, such as psychosocial support and care, and which requires additional professional…

  4. Research on Horizontal Accuracy Method of High Spatial Resolution Remotely Sensed Orthophoto Image

    Science.gov (United States)

    Xu, Y. M.; Zhang, J. X.; Yu, F.; Dong, S.

    2018-04-01

    At present, in the inspection and acceptance of high spatial resolution remotly sensed orthophoto image, the horizontal accuracy detection is testing and evaluating the accuracy of images, which mostly based on a set of testing points with the same accuracy and reliability. However, it is difficult to get a set of testing points with the same accuracy and reliability in the areas where the field measurement is difficult and the reference data with high accuracy is not enough. So it is difficult to test and evaluate the horizontal accuracy of the orthophoto image. The uncertainty of the horizontal accuracy has become a bottleneck for the application of satellite borne high-resolution remote sensing image and the scope of service expansion. Therefore, this paper proposes a new method to test the horizontal accuracy of orthophoto image. This method using the testing points with different accuracy and reliability. These points' source is high accuracy reference data and field measurement. The new method solves the horizontal accuracy detection of the orthophoto image in the difficult areas and provides the basis for providing reliable orthophoto images to the users.

  5. Method to fabricate high performance tubular solid oxide fuel cells

    Science.gov (United States)

    Chen, Fanglin; Yang, Chenghao; Jin, Chao

    2013-06-18

    In accordance with the present disclosure, a method for fabricating a solid oxide fuel cell is described. The method includes forming an asymmetric porous ceramic tube by using a phase inversion process. The method further includes forming an asymmetric porous ceramic layer on a surface of the asymmetric porous ceramic tube by using a phase inversion process. The tube is co-sintered to form a structure having a first porous layer, a second porous layer, and a dense layer positioned therebetween.

  6. Systems and methods for advanced ultra-high-performance InP solar cells

    Science.gov (United States)

    Wanlass, Mark

    2017-03-07

    Systems and Methods for Advanced Ultra-High-Performance InP Solar Cells are provided. In one embodiment, an InP photovoltaic device comprises: a p-n junction absorber layer comprising at least one InP layer; a front surface confinement layer; and a back surface confinement layer; wherein either the front surface confinement layer or the back surface confinement layer forms part of a High-Low (HL) doping architecture; and wherein either the front surface confinement layer or the back surface confinement layer forms part of a heterointerface system architecture.

  7. Acceptability of multipurpose human papillomavirus vaccines among providers and mothers of adolescent girls: A mixed-methods study in five countries

    Directory of Open Access Journals (Sweden)

    Nadja A. Vielot

    2017-06-01

    Full Text Available Introduction: Multipurpose vaccines (MPVs could be formulated to prevent multiple sexually transmitted infections simultaneously. Little is known about acceptability of MPVs among vaccine health care providers (HCPs or mothers of adolescent girls. Methods: 151 adolescent vaccine providers and 118 mothers of adolescent girls aged 9–14 were recruited from five geographically-diverse countries: Argentina, Malaysia, South Africa, South Korea, and Spain. We assessed providers’ preferences for single-purpose human papillomavirus (HPV vaccine versus MPVs (including HPV+herpes simplex virus (HSV−2, HPV+HIV, or HPV+HSV-2+HIV via quantitative surveys. Maternal MPV attitudes were assessed in four focus group discussions (FGDs in each country. Results: Most providers preferred MPVs over single-purpose HPV vaccination, with preference ranging from 61% in Malaysia to 96% in South Africa. HPV+HSV-2+HIV was the most preferred MPV formulation (56–82%. Overall, 53% of the mothers preferred MPVs over single-purpose HPV vaccines, with strongest support in South Africa (90% and lowest support in South Korea (29%. Convenience and trust in the health care system were commonly-cited reasons for MPV acceptability. Safety and efficacy concerns were common barriers to accepting MPVs, though specific concerns differed by country. Across FGDs, additional safety and efficacy information on MPVs were requested, particularly from trusted sources like HCPs. Conclusions: Though maternal acceptability of MPVs varied by country, MPV acceptability would be enhanced by having HCPs provide parents with additional MPV vaccine safety and efficacy information. While most providers preferred MPVs, future health behavior research should identify acceptability barriers, and targeted provider interventions should equip providers to improve vaccination discussions with parents. Keywords: Vaccines, Acceptability, Multipurpose, Human papillomavirus, Sexually transmitted

  8. A highly efficient method for Agrobacterium mediated transformation ...

    African Journals Online (AJOL)

    An Agrobacterium mediated transformation method was developed for the Thai rice variety, Pathumthani 1 (PT1), and the Indian rice variety, Pokkali (PKL). Various aspects of the transformation method, including callus induction, callus age, Agrobacterium concentration and co-cultivation period were examined, in order to ...

  9. Cheap arbitrary high order methods for single integrand SDEs

    DEFF Research Database (Denmark)

    Debrabant, Kristian; Kværnø, Anne

    2017-01-01

    For a particular class of Stratonovich SDE problems, here denoted as single integrand SDEs, we prove that by applying a deterministic Runge-Kutta method of order $p_d$ we obtain methods converging in the mean-square and weak sense with order $\\lfloor p_d/2\\rfloor$. The reason is that the B-series...

  10. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, December 2015

    International Nuclear Information System (INIS)

    Cabellos, Oscar; De Saint Jean, Cyrille; Hursin, Mathieu; Pelloni, Sandro; Ivanov, Evgeny; Kodeli, Ivan; Leconte, Pierre; Palmiotti, Giuseppe; Salvatores, Massimo; Sobes, Vladimir; Yokoyama, Kenji

    2015-12-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the fifth formal Subgroup 39 meeting held at the Institute Curie, Paris, France, on 4 December 2015. It comprises a Summary Record of the meeting, and all the available presentations (slides) given by the participants: A - Sensitivity methods: - 1: Short update on deliverables (K. Yokoyama); - 2: Does one shot Bayesian is equivalent to successive update? Bayesian inference: some matrix linear algebra (C. De Saint Jean); - 3: Progress in Methodology (G. Palmiotti); - SG39-3: Use of PIA approach. Possible application to neutron propagation experiments (S. Pelloni); - 4: Update on sensitivity coefficient methods (E. Ivanov); - 5: Stress test for U-235 fission (H. Wu); - 6: Methods and approaches development at ORNL for providing feedback from integral benchmark experiments for improvement of nuclear data files (V. Sobes); B - Integral experiments: - 7a: Update on SEG analysis (G. Palmiotti); - 7b:Status of MANTRA (G. Palmiotti); - 7c: Possible new experiments at NRAD (G. Palmiotti); - 8: B-eff experiments (I. Kodeli); - 9: On going CEA activities related to dedicated integral experiments for nuclear date validation in the Fast energy range (P. Leconte); - 10: PROTEUS Experiments: an update (M. Hursin); - 11: Short updates on neutron propagation experiments, STEK, CIELO status (O. Cabellos)

  11. Obtaining of bilateral high voltage epitaxial p—i—n Si structures by LPE method

    Directory of Open Access Journals (Sweden)

    Vakiv N. M.

    2013-12-01

    Full Text Available Silicon p—i—n-structures are usually obtained using conventional diffusion method or liquid phase epitaxy (LPE. In both cases, the formation of p- and n-layers occurs in two stages. This technological approach is quite complex. Moreover, when forming bilateral high-voltage epitaxial layers, their parameters significantly deteriorate as a result of prolonged heat treatment of active high-resistivity layer. Besides, when using diffusion method, it is impossible to provide good reproducibility of the process. In this paper a technique of growing bilateral high-voltage silicon p—i—n-structures by LPE in a single process is proposed. The authors have obtained the optimum compounds of silicon-undersaturated molten solutions for highly doped (5•1018 cm–3 contact layers: 0.4—0.8 at. % aluminum in gallium melt for growing p-Si-layers and 0.03—0.15 at. % ytterbium in tin melt for n-Si-layers. Parameters of such structures provide for manufacturing of high-voltage diodes on their basis. Such diodes can be used in navigational equipment, communication systems for household and special purposes, on-board power supply systems, radar systems, medical equipment, etc.

  12. Presentations provided

    Energy Technology Data Exchange (ETDEWEB)

    Hashemian, H; Beverly, D [Analysis and Measurement Services Corp., Knoxville, TN (United States)

    1999-12-31

    The following topics covered in detail at the workshop included: temperature instrumentation; pressure instrumentation; in-situ calibration and response time testing of RTDs and pressure transmitters; on-line performance monitoring and preventive maintenance of critical equipment; automated measurement of critical parameters; nuclear power plant infrastructure, management and Quality Assurance issues and recent developments for WWER and RBMK reactors. Conclusions drawn were: aging can adversely affect the performance of nuclear plant pressure transmitters; current testing interval of once in every fuel cycle is adequate for aging management; in-situ response time measurements and on-line calibration testing methods have been developed and validated for nuclear plant pressure transmitters; NUREG/CR-5851 should be taken into account for details of aging research on pressure transmitters

  13. Presentations provided

    International Nuclear Information System (INIS)

    Hashemian, H.; Beverly, D.

    1998-01-01

    The following topics covered in detail at the workshop included: temperature instrumentation; pressure instrumentation; in-situ calibration and response time testing of RTDs and pressure transmitters; on-line performance monitoring and preventive maintenance of critical equipment; automated measurement of critical parameters; nuclear power plant infrastructure, management and Quality Assurance issues and recent developments for WWER and RBMK reactors. Conclusions drawn were: aging can adversely affect the performance of nuclear plant pressure transmitters; current testing interval of once in every fuel cycle is adequate for aging management; in-situ response time measurements and on-line calibration testing methods have been developed and validated for nuclear plant pressure transmitters; NUREG/CR-5851 should be taken into account for details of aging research on pressure transmitters

  14. Motivation or demotivation of health workers providing maternal health services in rural areas in Vietnam: findings from a mixed-methods study.

    Science.gov (United States)

    Thu, Nguyen Thi Hoai; Wilson, Andrew; McDonald, Fiona

    2015-12-02

    Motivation is an important driver for health professionals to maintain their professional competencies, continue in the workforce and make a positive contribution to their workplace. While there is some research about the motivation of health workers in low- to middle-income countries, maternal morbidity and mortality remains high and this can be lowered by improving the quality of maternal health services and the training and maintenance of the skills of maternal health workers. This study examines the impact of motivation on maintenance of professional competence among maternal health workers in Vietnam using mixed methods. The study consisted of a survey using a self-administered questionnaire of 240 health workers in five districts across two Vietnamese provinces and in-depth interviews with 43 health workers and health managers at the commune, district and provincial level to explore external factors that influenced motivation. The questionnaire includes a 23-item motivation instrument based on the Kenyan health context, modified for Vietnamese language and culture. The 240 responses represented an estimated 95% of the target sample. Multivariate analysis showed that three factors contributed to the motivation of health workers: access to training (β = -0.14, P = 0.03), ability to perform key tasks (β = 0.22, P = 0.001) and shift schedule (β = -0.13, P = 0.05). Motivation was higher in health workers self-identifying as competent or who were enabled to provide more maternal care services. Motivation was lower in those who worked more frequent night shifts and those who had received training in the last 12 months. The interviews identified that the latter was because they felt the training was irrelevant to them, and in some cases, they do not have the opportunity to practice their learnt skills. The qualitative data also showed other factors relating to service context and organisational management practices contributed to

  15. High Frequency Acoustic Propagation using Level Set Methods

    Science.gov (United States)

    2007-01-01

    solution of the high frequency approximation to the wave equation. Traditional solutions to the Eikonal equation in high frequency acoustics are...the Eikonal equation derived from the high frequency approximation to the wave equation, ucuH ∇±=∇ )(),( xx , with the nonnegative function c(x...For simplicity, we only consider the case ucuH ∇+=∇ )(),( xx . Two difficulties must be addressed when solving the Eikonal equation in a fixed

  16. High sensitivity neutron activation analysis using coincidence counting method

    International Nuclear Information System (INIS)

    Suzuki, Shogo; Okada, Yukiko; Hirai, Shoji

    1999-01-01

    Four kinds of standard samples such as river sediment (NIES CRM No.16), Typical Japanese Diet, otoliths and river water were irradiated by TRIGA-II (100 kW, 3.7x10 12 n cm -2 s -1 ) for 6 h. After irradiation and cooling, they were analyzed by the coincidence counting method and a conventional γ-ray spectrometry. Se, Ba and Hf were determined by 75 Se 265 keV, 131 Ba 496 keV and 181 Hf 482 keV. On the river sediment sample, Ba and Hf showed the same values by two methods, but Se value contained Ta by the conventional method, although the coincidence counting method could analyze Se. On Typical Japanese Diet and otoliths, Se could be determined by two methods and Ba and Hf determined by the coincidence counting method but not determined by the conventional method. Se value in the river water agreed with the authorization value. (S.Y.)

  17. Highly efficient vitrification method for cryopreservation of human oocytes.

    Science.gov (United States)

    Kuwayama, Masashige; Vajta, Gábor; Kato, Osamu; Leibo, Stanley P

    2005-09-01

    Two experiments were performed to develop a method to cryopreserve MII human oocytes. In the first experiment, three vitrification methods were compared using bovine MII oocytes with regard to their developmental competence after cryopreservation: (i) vitrification within 0.25-ml plastic straws followed by in-straw dilution after warming (ISD method); (ii) vitrification in open-pulled straws (OPS method); and (iii) vitrification in plastic handle (Cryotop method). In the second experiment, the Cryotop method, which had yielded the best results, was used to vitrify human oocytes. Out of 64 vitrified oocytes, 58 (91%) exhibited normal morphology after warming. After intracytoplasmic sperm injection, 52 became fertilized, and 32 (50%) developed to the blastocyst stage in vitro. Analysis by fluorescence in-situ hybridization of five blastocysts showed that all were normal diploid embryos. Twenty-nine embryo transfers with a mean number of 2.2 embryos per transfer on days 2 and 5 resulted in 12 initial pregnancies, seven healthy babies and three ongoing pregnancies. The results suggest that vitrification using the Cryotop is the most efficient method for human oocyte cryopreservation.

  18. New high order FDTD method to solve EMC problems

    Directory of Open Access Journals (Sweden)

    N. Deymier

    2015-10-01

    Full Text Available In electromagnetic compatibility (EMC context, we are interested in developing new ac- curate methods to solve efficiently and accurately Maxwell’s equations in the time domain. Indeed, usual methods such as FDTD or FVTD present im- portant dissipative and/or dispersive errors which prevent to obtain a good numerical approximation of the physical solution for a given industrial scene unless we use a mesh with a very small cell size. To avoid this problem, schemes like the Discontinuous Galerkin (DG method, based on higher order spa- tial approximations, have been introduced and stud- ied on unstructured meshes. However the cost of this kind of method can become prohibitive accord- ing to the mesh used. In this paper, we first present a higher order spatial approximation method on carte- sian meshes. It is based on a finite element ap- proach and recovers at the order 1 the well-known Yee’s schema. Next, to deal with EMC problem, a non-oriented thin wire formalism is proposed for this method. Finally, several examples are given to present the benefits of this new method by compar- ison with both Yee’s schema and DG approaches.

  19. Discrete ordinates transport methods for problems with highly forward-peaked scattering

    International Nuclear Information System (INIS)

    Pautz, S.D.

    1998-04-01

    The author examines the solutions of the discrete ordinates (S N ) method for problems with highly forward-peaked scattering kernels. He derives conditions necessary to obtain reasonable solutions in a certain forward-peaked limit, the Fokker-Planck (FP) limit. He also analyzes the acceleration of the iterative solution of such problems and offer improvements to it. He extends the analytic Fokker-Planck limit analysis to the S N equations. This analysis shows that in this asymptotic limit the S N solution satisfies a pseudospectral discretization of the FP equation, provided that the scattering term is handled in a certain way (which he describes) and that the analytic transport solution satisfies an analytic FP equation. Similar analyses of various spatially discretized S N equations reveal that they too produce solutions that satisfy discrete FP equations, given the same provisions. Numerical results agree with these theoretical predictions. He defines a multidimensional angular multigrid (ANMG) method to accelerate the iterative solution of highly forward-peaked problems. The analyses show that a straightforward application of this scheme is subject to high-frequency instabilities. However, by applying a diffusive filter to the ANMG corrections he is able to stabilize this method. Fourier analyses of model problems show that the resulting method is effective at accelerating the convergence rate when the scattering is forward-peaked. The numerical results demonstrate that these analyses are good predictors of the actual performance of the ANMG method

  20. Providing affinity

    DEFF Research Database (Denmark)

    Guglielmi, Michel; Johannesen, Hl

    2004-01-01

    , Essex, Hertfordshire, Norfolk and Suffolk. Research found that there was a lack of identity or sense of belonging and nothing anchoring people to the region as a whole. Common affinity is somehow forced to the people of East England and thereby we came to the conclusion that a single landmark...... and potential situations but also virtual events that calls for an undeterminated process of resolution. This process is activated by the user who co-produces the actualisation as an answer to a virtual reality that we defined at the first place. The potential situations or the possible it is a fantomatic real....... The possible is like the real. It is determinated and it only lakes existence. While the possible is already made, the virtual is like a problematic which needs to be resolved and actualized. Our installations are based on high tech interactivity where we use sensors and remote communication to offer a sense...

  1. A Geographic Method for High Resolution Spatial Heat Planning

    DEFF Research Database (Denmark)

    Nielsen, Steffen

    2014-01-01

    more detailed modelling that takes the geographic placement of buildings and the differences among DH systems into account. In the present article, a method for assessing the costs of DH expansions has been developed. The method was applied in a geographic information system (GIS) model that consists...... are considering distribution costs based on the geographic properties of each area and assessing transmission costs based on an iterative process that examines expansion potentials gradually. The GIS model is only applicable to a Danish context, but the method itself can be applied to other countries....... of three parts and assesses the costs of heat production, distribution, and transmission. The model was also applied to an actual case in order to show how it can be used. The model shows many improvements in the method for the assessment of distribution costs and transmission costs. Most notable...

  2. Introduction to quantum calculation methods in high resolution NMR

    International Nuclear Information System (INIS)

    Goldman, M.

    1996-01-01

    New techniques as for instance the polarization transfer, the coherence with several quanta and the double Fourier transformation have appeared fifteen years ago. These techniques constitute a considerable advance in NMR. Indeed, they allow to study more complex molecules than it was before possible. But with these advances, the classical description of the NMR is not enough to understand precisely the physical phenomena induced by these methods. It is then necessary to resort to quantum calculation methods. The aim of this work is to present these calculation methods. After some recalls of quantum mechanics, the author describes the NMR with the density matrix, reviews the main methods of double Fourier transformation and then gives the principle of the relaxation times calculation. (O.M.)

  3. Application of Rapid Prototyping Methods to High-Speed Wind Tunnel Testing

    Science.gov (United States)

    Springer, A. M.

    1998-01-01

    This study was undertaken in MSFC's 14-Inch Trisonic Wind Tunnel to determine if rapid prototyping methods could be used in the design and manufacturing of high speed wind tunnel models in direct testing applications, and if these methods would reduce model design/fabrication time and cost while providing models of high enough fidelity to provide adequate aerodynamic data, and of sufficient strength to survive the test environment. Rapid prototyping methods utilized to construct wind tunnel models in a wing-body-tail configuration were: fused deposition method using both ABS plastic and PEEK as building materials, stereolithography using the photopolymer SL-5170, selective laser sintering using glass reinforced nylon, and laminated object manufacturing using plastic reinforced with glass and 'paper'. This study revealed good agreement between the SLA model, the metal model with an FDM-ABS nose, an SLA nose, and the metal model for most operating conditions, while the FDM-ABS data diverged at higher loading conditions. Data from the initial SLS model showed poor agreement due to problems in post-processing, resulting in a different configuration. A second SLS model was tested and showed relatively good agreement. It can be concluded that rapid prototyping models show promise in preliminary aerodynamic development studies at subsonic, transonic, and supersonic speeds.

  4. HIGH THROUGHPUT SCREENING METHOD AND APPARATUS FOR ANALYSING INTERACTIONS BETWEEN SURFACES WITH DIFFERENT TOPOGRAPHY AND THE ENVIRONMENT

    NARCIS (Netherlands)

    de Boer, Jan; van Blitterswijk, Clemens; Unadkat, H.V.; Stamatialis, Dimitrios; Papenburg, B.J.; Wessling, Matthias

    2009-01-01

    The invention is directed to a high throughput screening method for analysing and interaction between a surface of a material and an environment. The screening method of the invention comprises: providing a micro-array comprising said material and having a multitude of units at least part of which

  5. Method for high temperature mercury capture from gas streams

    Science.gov (United States)

    Granite, Evan J [Wexford, PA; Pennline, Henry W [Bethel Park, PA

    2006-04-25

    A process to facilitate mercury extraction from high temperature flue/fuel gas via the use of metal sorbents which capture mercury at ambient and high temperatures. The spent sorbents can be regenerated after exposure to mercury. The metal sorbents can be used as pure metals (or combinations of metals) or dispersed on an inert support to increase surface area per gram of metal sorbent. Iridium and ruthenium are effective for mercury removal from flue and smelter gases. Palladium and platinum are effective for mercury removal from fuel gas (syngas). An iridium-platinum alloy is suitable for metal capture in many industrial effluent gas streams including highly corrosive gas streams.

  6. Wiring assembly and method of forming a channel in a wiring assembly for receiving conductor and providing separate regions of conductor contact with the channel

    Energy Technology Data Exchange (ETDEWEB)

    Stelzer, Gerald; Meinke, Rainer; Senti, Mark

    2018-03-06

    A conductor assembly and method for constructing an assembly of the type which, when conducting current, generates a magnetic field or which, in the presence of a changing magnetic field, induces a voltage. In one embodiment the method provides a first insulative layer tubular in shape and including a surface along which a conductor segment may be positioned. A channel formed in the surface of the insulative layer defines a first conductor path and includes a surface of first contour in cross section along a first plane transverse to the conductor path. A segment of conductor having a surface of second contour in cross section is positioned at least partly in the channel and extends along the conductor path. Along the first plane, contact between the conductor surface of second contour and the channel surface of first contour includes at least two separate regions of contact.

  7. Human rights versus societal norms: a mixed methods study among healthcare providers on social stigma related to adolescent abortion and contraceptive use in Kisumu, Kenya.

    Science.gov (United States)

    Håkansson, Miranda; Oguttu, Monica; Gemzell-Danielsson, Kristina; Makenzius, Marlene

    2018-01-01

    Adolescent pregnancy represents a serious public health issue in sub-Saharan Africa, and stigmatising attitudes are contributing factors. This study investigates stigmatising attitudes related to adolescent pregnancy, abortion and contraceptive use among healthcare providers working with postabortion care (PAC) in a low-resource setting in Kenya. A mixed methods approach in a convergent design was utilised to capture attitudes related to abortion and contraceptive use among 86 (f=62; m=19) PAC providers in Kisumu, Kenya. Two Likert-scale questionnaires were used: the 18-item Stigmatising Attitudes, Beliefs and Actions Scale (SABAS) and the 7-item Contraceptive Use Stigma Scale (CUSS). 74 PAC providers responded to the SABAS, 44 to the CUSS and 12 participated in two focus group discussions. Descriptive statistics, psychometric tests of instruments and qualitative content analysis were conducted and reported in accordance with Consolidated Criteria for Reporting Qualitative Research. Cronbach's α coefficients for the total instrument was 0.88 (SABAS) and 0.84 (CUSS). The majority, 92% (68/74) agreed that a woman who has had an abortion should be treated equally to everyone else, 27% (20/74) considered abortion a sin and 30% (22/74) believed she will make abortion a habit. Contraceptive use among adolescent women was associated with promiscuity (39%; 17/44), hence contraceptives should only be available to married women (36%; 16/44), and 20% (9/44) believed that contraceptive use causes infertility. The providers encouraged women's autonomy and their rights to sexual and reproductive health; however, unclear regulations reinforce religious and cultural beliefs, which hampers implementation of evidence-based contraceptive counselling. Stigmatising attitudes towards young women in need of abortion and contraception is common among PAC providers. Their work is characterised by a conflict between human rights and societal norms, thus highlighting the need for

  8. Development of a reject classification method, applied to the diagnotic of a nuclear reactor core: processing of thermal signals providing from out-of-reactor simulation

    International Nuclear Information System (INIS)

    Smolarz, A.

    1982-07-01

    Development of an evolution detection algorithm which aim is to extend the application field of the form recognition analysis to the diagnosis and follow-up of a complex system: study of the data from the out-of-reactor test loop with forced convection in sodium, study and description of a reject classification algorithm developed in the general point of view of evolution detection. This method is tested with theoretical data and with experimental data provided by the second test loop ISIS [fr

  9. Method and apparatus of highly linear optical modulation

    Science.gov (United States)

    DeRose, Christopher; Watts, Michael R.

    2016-05-03

    In a new optical intensity modulator, a nonlinear change in refractive index is used to balance the nonlinearities in the optical transfer function in a way that leads to highly linear optical intensity modulation.

  10. A calculation method of cracking moment for the high strength ...

    Indian Academy of Sciences (India)

    mal stress and crack width for the tensional behaviour of concrete and has been proposed by ... stresses. To calculate concrete stress in a cross section of high strength concrete beams, failure strain is ..... American Concrete. Institute, Detroit.

  11. An Improved, Highly Efficient Method for the Synthesis of Bisphenols

    Directory of Open Access Journals (Sweden)

    L. S. Patil

    2011-01-01

    Full Text Available An efficient synthesis of bisphenols is described by condensation of substituted phenols with corresponding cyclic ketones in presence of cetyltrimethylammonium chloride and 3-mercaptopropionic acid as a catalyst in extremely high purity and yields.

  12. New methods for moisture control of high-performance concrete

    DEFF Research Database (Denmark)

    Kovler, Konstantin; Jensen, Ole Mejlhede; Falikman, Vyacheslav

    2005-01-01

    Curing of concrete by both external (conventional) and internal methods is reviewed and analyzed. The focus is given on the mitigation of autogenous shrinkage of low water-to-cementitious materials ratio concrete by means of internal curing. The concepts of internal curing are based on using pre......-soaked lightweight aggregate, super-absorbent polymers or water-soluble chemicals, which reduce water evaporation (so called "internal sealing"). These concepts have been suggested in the 90s, but still are not popular among users, engineers, contractors, concrete suppliers, researchers, and the rest...... of professionals who work for them. The differences between conventional methods of external curing and novel methods of internal curing are described. It is concluded that proper curing is a key factor to achieve durable concrete....

  13. Methods and systems for fabricating high quality superconducting tapes

    Science.gov (United States)

    Majkic, Goran; Selvamanickam, Venkat

    2018-02-13

    An MOCVD system fabricates high quality superconductor tapes with variable thicknesses. The MOCVD system can include a gas flow chamber between two parallel channels in a housing. A substrate tape is heated and then passed through the MOCVD housing such that the gas flow is perpendicular to the tape's surface. Precursors are injected into the gas flow for deposition on the substrate tape. In this way, superconductor tapes can be fabricated with variable thicknesses, uniform precursor deposition, and high critical current densities.

  14. BNFL assessment of methods of attaining high burnup MOX fuel

    International Nuclear Information System (INIS)

    Brown, C.; Hesketh, K.W.; Palmer, I.D.

    1998-01-01

    It is clear that in order to maintain competitiveness with UO 2 fuel, the burnups achievable in MOX fuel must be enhanced beyond the levels attainable today. There are two aspects which require attention when studying methods of increased burnups - cladding integrity and fuel performance. Current irradiation experience indicates that one of the main performance issues for MOX fuel is fission gas retention. MOX, with its lower thermal conductivity, runs at higher temperatures than UO 2 fuel; this can result in enhanced fission gas release. This paper explores methods of effectively reducing gas release and thereby improving MOX burnup potential. (author)

  15. Quality Evaluation of Potentilla fruticosa L. by High Performance Liquid Chromatography Fingerprinting Associated with Chemometric Methods.

    Science.gov (United States)

    Liu, Wei; Wang, Dongmei; Liu, Jianjun; Li, Dengwu; Yin, Dongxue

    2016-01-01

    The present study was performed to assess the quality of Potentilla fruticosa L. sampled from distinct regions of China using high performance liquid chromatography (HPLC) fingerprinting coupled with a suite of chemometric methods. For this quantitative analysis, the main active phytochemical compositions and the antioxidant activity in P. fruticosa were also investigated. Considering the high percentages and antioxidant activities of phytochemicals, P. fruticosa samples from Kangding, Sichuan were selected as the most valuable raw materials. Similarity analysis (SA) of HPLC fingerprints, hierarchical cluster analysis (HCA), principle component analysis (PCA), and discriminant analysis (DA) were further employed to provide accurate classification and quality estimates of P. fruticosa. Two principal components (PCs) were collected by PCA. PC1 separated samples from Kangding, Sichuan, capturing 57.64% of the variance, whereas PC2 contributed to further separation, capturing 18.97% of the variance. Two kinds of discriminant functions with a 100% discrimination ratio were constructed. The results strongly supported the conclusion that the eight samples from different regions were clustered into three major groups, corresponding with their morphological classification, for which HPLC analysis confirmed the considerable variation in phytochemical compositions and that P. fruticosa samples from Kangding, Sichuan were of high quality. The results of SA, HCA, PCA, and DA were in agreement and performed well for the quality assessment of P. fruticosa. Consequently, HPLC fingerprinting coupled with chemometric techniques provides a highly flexible and reliable method for the quality evaluation of traditional Chinese medicines.

  16. Quality Evaluation of Potentilla fruticosa L. by High Performance Liquid Chromatography Fingerprinting Associated with Chemometric Methods

    Science.gov (United States)

    Liu, Wei; Wang, Dongmei; Liu, Jianjun; Li, Dengwu; Yin, Dongxue

    2016-01-01

    The present study was performed to assess the quality of Potentilla fruticosa L. sampled from distinct regions of China using high performance liquid chromatography (HPLC) fingerprinting coupled with a suite of chemometric methods. For this quantitative analysis, the main active phytochemical compositions and the antioxidant activity in P. fruticosa were also investigated. Considering the high percentages and antioxidant activities of phytochemicals, P. fruticosa samples from Kangding, Sichuan were selected as the most valuable raw materials. Similarity analysis (SA) of HPLC fingerprints, hierarchical cluster analysis (HCA), principle component analysis (PCA), and discriminant analysis (DA) were further employed to provide accurate classification and quality estimates of P. fruticosa. Two principal components (PCs) were collected by PCA. PC1 separated samples from Kangding, Sichuan, capturing 57.64% of the variance, whereas PC2 contributed to further separation, capturing 18.97% of the variance. Two kinds of discriminant functions with a 100% discrimination ratio were constructed. The results strongly supported the conclusion that the eight samples from different regions were clustered into three major groups, corresponding with their morphological classification, for which HPLC analysis confirmed the considerable variation in phytochemical compositions and that P. fruticosa samples from Kangding, Sichuan were of high quality. The results of SA, HCA, PCA, and DA were in agreement and performed well for the quality assessment of P. fruticosa. Consequently, HPLC fingerprinting coupled with chemometric techniques provides a highly flexible and reliable method for the quality evaluation of traditional Chinese medicines. PMID:26890416

  17. High efficient plastic solar cells fabricated with a high-throughput gravure printing method

    Energy Technology Data Exchange (ETDEWEB)

    Kopola, P.; Jin, H.; Tuomikoski, M.; Maaninen, A.; Hast, J. [VTT, Kaitovaeylae 1, FIN-90571 Oulu (Finland); Aernouts, T. [IMEC, Organic PhotoVoltaics, Polymer and Molecular Electronics, Kapeldreef 75, B-3001 Leuven (Belgium); Guillerez, S. [CEA-INES RDI, 50 Avenue Du Lac Leman, 73370 Le Bourget Du Lac (France)

    2010-10-15

    We report on polymer-based solar cells prepared by the high-throughput roll-to-roll gravure printing method. The engravings of the printing plate, along with process parameters like printing speed and ink properties, are studied to optimise the printability of the photoactive as well as the hole transport layer. For the hole transport layer, the focus is on testing different formulations to produce thorough wetting of the indium-tin-oxide (ITO) substrate. The challenge for the photoactive layer is to form a uniform layer with optimal nanomorphology in the poly-3-hexylthiophene (P3HT) and [6,6]-phenyl-C61-butyric acid methyl ester (PCBM) blend. This results in a power conversion efficiency of 2.8% under simulated AM1.5G solar illumination for a solar cell device with gravure-printed hole transport and a photoactive layer. (author)

  18. High throughput screening method for identification of new lipofection reagents.

    Science.gov (United States)

    Regelin, A E; Fernholz, E; Krug, H F; Massing, U

    2001-08-01

    Lipofection, the transfer of genetic material into cells by means of cationic lipids, is of growing interest for in vitro and in vivo approaches. In order to identify ideal lipofection reagents in a HTS, we have developed an automated lipofection method for the transfer of reporter genes into cells and for determination of the lipofection results. The method has specifically been designed and optimized for 96-well microtiter plates and can successfully be carried out by a pipetting robot with accessory equipment. It consists of two separate parts: (1) pretransfection (preparation of liposomes, formation of lipoplexes, and lipoplex transfer to the cells) and (2) posttransfection (determination of the reporter enzyme activity and the protein content of the transfected cells). Individual steps of the lipofection method were specifically optimized - for example, lipoplex formation and incubation time as well as cell lysis, cell cultivating, and the reporter gene assay. The HTS method facilitates characterization of the transfection properties (efficiency and cytotoxicity) of large numbers of (cationic) lipids in various adherent cell types.

  19. A method for high accuracy determination of equilibrium relative humidity

    DEFF Research Database (Denmark)

    Jensen, O.M.

    2012-01-01

    This paper treats a new method for measuring equilibrium relative humidity and equilibrium dew-point temperature of a material sample. The developed measuring device is described – a Dew-point Meter – which by means of so-called Dynamic Dew-point Analysis permits quick and very accurate...

  20. Highly accurate adaptive TOF determination method for ultrasonic thickness measurement

    Science.gov (United States)

    Zhou, Lianjie; Liu, Haibo; Lian, Meng; Ying, Yangwei; Li, Te; Wang, Yongqing

    2018-04-01

    Determining the time of flight (TOF) is very critical for precise ultrasonic thickness measurement. However, the relatively low signal-to-noise ratio (SNR) of the received signals would induce significant TOF determination errors. In this paper, an adaptive time delay estimation method has been developed to improve the TOF determination’s accuracy. An improved variable step size adaptive algorithm with comprehensive step size control function is proposed. Meanwhile, a cubic spline fitting approach is also employed to alleviate the restriction of finite sampling interval. Simulation experiments under different SNR conditions were conducted for performance analysis. Simulation results manifested the performance advantage of proposed TOF determination method over existing TOF determination methods. When comparing with the conventional fixed step size, and Kwong and Aboulnasr algorithms, the steady state mean square deviation of the proposed algorithm was generally lower, which makes the proposed algorithm more suitable for TOF determination. Further, ultrasonic thickness measurement experiments were performed on aluminum alloy plates with various thicknesses. They indicated that the proposed TOF determination method was more robust even under low SNR conditions, and the ultrasonic thickness measurement accuracy could be significantly improved.

  1. Accessing High Spatial Resolution in Astronomy Using Interference Methods

    Science.gov (United States)

    Carbonel, Cyril; Grasset, Sébastien; Maysonnave, Jean

    2018-01-01

    In astronomy, methods such as direct imaging or interferometry-based techniques (Michelson stellar interferometry for example) are used for observations. A particular advantage of interferometry is that it permits greater spatial resolution compared to direct imaging with a single telescope, which is limited by diffraction owing to the aperture of…

  2. On the solution of high order stable time integration methods

    Czech Academy of Sciences Publication Activity Database

    Axelsson, Owe; Blaheta, Radim; Sysala, Stanislav; Ahmad, B.

    2013-01-01

    Roč. 108, č. 1 (2013), s. 1-22 ISSN 1687-2770 Institutional support: RVO:68145535 Keywords : evolution equations * preconditioners for quadratic matrix polynomials * a stiffly stable time integration method Subject RIV: BA - General Mathematics Impact factor: 0.836, year: 2013 http://www.boundaryvalueproblems.com/content/2013/1/108

  3. An Automatic High Efficient Method for Dish Concentrator Alignment

    Directory of Open Access Journals (Sweden)

    Yong Wang

    2014-01-01

    for the alignment of faceted solar dish concentrator. The isosceles triangle configuration of facet’s footholds determines a fixed relation between light spot displacements and foothold movements, which allows an automatic determination of the amount of adjustments. Tests on a 25 kW Stirling Energy System dish concentrator verify the feasibility, accuracy, and efficiency of our method.

  4. High-resolution methods for fluorescence retrieval from space

    NARCIS (Netherlands)

    Mazzoni, M.; Falorni, P.; Verhoef, W.

    2010-01-01

    The retrieval from space of a very weak fluorescence signal was studied in the O2A and O2B oxygen atmospheric absorption bands. The accuracy of the method was tested for the retrieval of the chlorophyll fluorescence and reflectance terms contributing to the sensor signal. The radiance at the top of

  5. The Development of High Order Methods for Real World Applications

    Science.gov (United States)

    2015-12-03

    system created by Kitware.[89] VTK wraps the underlying graphics APIs , simplifying cross-platform development while provid- ing a capable...Investigation of the Wake behind a Sphere at Low Reynolds Numbers. Journal of the Physical Society of Japan 11, 1104 . [96] V. Heuveline, R. R., 2003. Duality

  6. Assessment of high-resolution methods for numerical simulations of compressible turbulence with shock waves

    International Nuclear Information System (INIS)

    Johnsen, Eric; Larsson, Johan; Bhagatwala, Ankit V.; Cabot, William H.; Moin, Parviz; Olson, Britton J.; Rawat, Pradeep S.; Shankar, Santhosh K.; Sjoegreen, Bjoern; Yee, H.C.; Zhong Xiaolin; Lele, Sanjiva K.

    2010-01-01

    Flows in which shock waves and turbulence are present and interact dynamically occur in a wide range of applications, including inertial confinement fusion, supernovae explosion, and scramjet propulsion. Accurate simulations of such problems are challenging because of the contradictory requirements of numerical methods used to simulate turbulence, which must minimize any numerical dissipation that would otherwise overwhelm the small scales, and shock-capturing schemes, which introduce numerical dissipation to stabilize the solution. The objective of the present work is to evaluate the performance of several numerical methods capable of simultaneously handling turbulence and shock waves. A comprehensive range of high-resolution methods (WENO, hybrid WENO/central difference, artificial diffusivity, adaptive characteristic-based filter, and shock fitting) and suite of test cases (Taylor-Green vortex, Shu-Osher problem, shock-vorticity/entropy wave interaction, Noh problem, compressible isotropic turbulence) relevant to problems with shocks and turbulence are considered. The results indicate that the WENO methods provide sharp shock profiles, but overwhelm the physical dissipation. The hybrid method is minimally dissipative and leads to sharp shocks and well-resolved broadband turbulence, but relies on an appropriate shock sensor. Artificial diffusivity methods in which the artificial bulk viscosity is based on the magnitude of the strain-rate tensor resolve vortical structures well but damp dilatational modes in compressible turbulence; dilatation-based artificial bulk viscosity methods significantly improve this behavior. For well-defined shocks, the shock fitting approach yields good results.

  7. The new high resolution method of Godunov`s type for 3D viscous flow calculations

    Energy Technology Data Exchange (ETDEWEB)

    Yershov, S.V.; Rusanov, A.V. [Ukranian National Academy of Sciences, Kahrkov (Ukraine)

    1996-12-31

    The numerical method is suggested for the calculations of the 3D viscous compressible flows described by the thin-layer Reynolds-averaged Navier-Stokes equations. The method is based on the Godunov`s finite-difference scheme and it uses the ENO reconstruction suggested by Harten to achieve the uniformly high-order accuracy. The computational efficiency is provided with the simplified multi grid approach and the implicit step written in {delta} -form. The turbulent effects are simulated with the Baldwin - Lomax turbulence model. The application package FlowER is developed to calculate the 3D turbulent flows within complex-shape channels. The numerical results for the 3D flow around a cylinder and through the complex-shaped channels show the accuracy and the reliability of the suggested method. (author)

  8. The new high resolution method of Godunov`s type for 3D viscous flow calculations

    Energy Technology Data Exchange (ETDEWEB)

    Yershov, S V; Rusanov, A V [Ukranian National Academy of Sciences, Kahrkov (Ukraine)

    1997-12-31

    The numerical method is suggested for the calculations of the 3D viscous compressible flows described by the thin-layer Reynolds-averaged Navier-Stokes equations. The method is based on the Godunov`s finite-difference scheme and it uses the ENO reconstruction suggested by Harten to achieve the uniformly high-order accuracy. The computational efficiency is provided with the simplified multi grid approach and the implicit step written in {delta} -form. The turbulent effects are simulated with the Baldwin - Lomax turbulence model. The application package FlowER is developed to calculate the 3D turbulent flows within complex-shape channels. The numerical results for the 3D flow around a cylinder and through the complex-shaped channels show the accuracy and the reliability of the suggested method. (author)

  9. Applications versus properties of Mg–Al layered double hydroxides provided by their syntheses methods: Alkoxide and alkoxide-free sol–gel syntheses and hydrothermal precipitation

    KAUST Repository

    Chubar, Natalia

    2013-12-01

    A tremendous number of studies have examined layered double hydroxides (LDH) for their technological applications in the ion exchange removal of toxic ions, recovery of valuable substances, catalysis, CO2 capture, as a layered host for storage/delivery of biologically active molecules, additives to plastics and building materials, and other functions. Numerous publications always conclude that the materials (prepared, as a rule, using the oldest synthesis method) are very promising for each investigated application; however, the main chemical industries producing these materials advertise them mainly (or only) as plastic additives. The authors performed extensive research using many of the appropriate methods to compare the structure, surface and adsorptive properties of three Mg-Al LHDs produced by advanced synthesis methods. One industrial sample (by Sasol, Germany) prepared by the alkoxide sol-gel method and two novel Mg-Al LDHs synthesised in-house by alkoxide-free sol-gel and hydrothermal precipitation approaches were investigated. Reasons for the very different adsorptive selectivity of the three LDHs towards arsenate, selenate, phosphate, arsenite and selenite have been provided, highlighting the role of speciation of the interlayer carbonate, aluminium, magnesium, interlayer hydration and moisture content in the adsorptive selectivity towards each toxic anion. This work is the first report presenting the regularities of the LDHs structure, surface and anion exchange properties as a function of their syntheses method. It establishes the links to potential technological applications of each investigated LDH and explains the necessary properties required to make the technological application cost-effective and efficient. The paper might accelerate industrial applications of these advanced materials. © 2013 Elsevier B.V.

  10. The use of microbead-based spoligotyping for Mycobacterium tuberculosis complex to evaluate the quality of the conventional method: Providing guidelines for Quality Assurance when working on membranes

    Directory of Open Access Journals (Sweden)

    Garzelli Carlo

    2011-04-01

    Full Text Available Abstract Background The classical spoligotyping technique, relying on membrane reverse line-blot hybridization of the spacers of the Mycobacterium tuberculosis CRISPR locus, is used world-wide (598 references in Pubmed on April 8th, 2011. However, until now no inter-laboratory quality control study had been undertaken to validate this technique. We analyzed the quality of membrane-based spoligotyping by comparing it to the recently introduced and highly robust microbead-based spoligotyping. Nine hundred and twenty-seven isolates were analyzed totaling 39,861 data points. Samples were received from 11 international laboratories with a worldwide distribution. Methods The high-throughput microbead-based Spoligotyping was performed on CTAB and thermolyzate DNA extracted from isolated Mycobacterium tuberculosis complex (MTC strains coming from the genotyping participating centers. Information regarding how the classical Spoligotyping method was performed by center was available. Genotype discriminatory analyses were carried out by comparing the spoligotypes obtained by both methods. The non parametric U-Mann Whitney homogeneity test and the Spearman rank correlation test were performed to validate the observed results. Results Seven out of the 11 laboratories (63 %, perfectly typed more than 90% of isolates, 3 scored between 80-90% and a single center was under 80% reaching 51% concordance only. However, this was mainly due to discordance in a single spacer, likely having a non-functional probe on the membrane used. The centers using thermolyzate DNA performed as well as centers using the more extended CTAB extraction procedure. Few centers shared the same problematic spacers and these problematic spacers were scattered over the whole CRISPR locus (Mostly spacers 15, 14, 18, 37, 39, 40. Conclusions We confirm that classical spoligotyping is a robust method with generally a high reliability in most centers. The applied DNA extraction procedure (CTAB

  11. Methods and systems for fabricating high quality superconducting tapes

    Energy Technology Data Exchange (ETDEWEB)

    Majkic, Goran; Selvamanickam, Venkat

    2018-02-13

    An MOCVD system fabricates high quality superconductor tapes with variable thicknesses. The MOCVD system can include a gas flow chamber between two parallel channels in a housing. A substrate tape is heated and then passed through the MOCVD housing such that the gas flow is perpendicular to the tape's surface. Precursors are injected into the gas flow for deposition on the substrate tape. In this way, superconductor tapes can be fabricated with variable thicknesses, uniform precursor deposition, and high critical current densities.

  12. Development of methods to extralt and solidify highly radioactive waste

    International Nuclear Information System (INIS)

    Arnek, R.; Persson, A.; Faelth, L.; Annehed, H.

    1977-06-01

    Zeolites are proposed as selective ion exchange materials to extract highly radioactive fission products as cesium 137 and strontium 90, and corrosion products. The zeolites 13X, F and PC showed a high adsorption capacity for cesium and strontium. A heat treatment at 800-1300 degrees C for about two hours gave a vitrified material. The chemical resistance of the heat treated zeolites was tested in a soxhlets-apparatus, were a streaming solution at 100 degrees C was in contact with the zeolite for 1-2 days. For all cases, the amount of dissolved strontium was below the detection threshold.(L.K.)

  13. Patient-provider communication styles in HIV treatment programs in Bamako, Mali: A mixed-methods study to define dimensions and measure patient preferences

    Directory of Open Access Journals (Sweden)

    Emily A. Hurley

    2017-12-01

    Full Text Available Effective patient-provider communication (PPC promotes patient adherence and retention in long-term care. Sub-Saharan Africa faces unprecedented demand for chronic care for HIV patients on antiretroviral therapy (ART, yet adherence and retention remain challenging. In high-income countries, research describing patient preferences for different PPC styles has guided interventions to improve PPC and patient outcomes. However, research on PPC preferences in sub-Saharan Africa is limited. We sought to define PPC dimensions relevant to ART programs in Bamako, Mali through recordings of clinical interactions, in-depth interviews and focus-group discussions with 69 patients and 17 providers. To assess preferences toward contrasting PPC styles within dimensions, we conducted a vignette-based survey with 141 patients across five ART facilities. Qualitative analysis revealed two PPC dimensions similar to those described in the literature on patient-centered communication (level of psychosocial regard, balance of power, and one unique dimension that emerged from the data (guiding patient behavior: easy/tough/sharp. Significantly more survey participants chose the vignette demonstrating high psychosocial regard (52.2% compared to a biomedical style (22.5% (p<0.001. Within balance of power, a statistically similar proportion of participants chose the vignette demonstrating shared power (40.2% compared to a provider-dominated style (35.8%. In guiding patient behavior, a similar proportion of participants preferred the vignette depicting the “easy” (38.4% and/or “tough” style (40.6%, but significantly fewer preferred the “sharp” style (14.5% (p<0.001. Highly educated participants chose biomedical and shared power styles more frequently, while less educated participants more frequently indicated “no preference”. Working to understand, develop, and tailor PPC styles to patients in chronic care may help support patient retention and ultimately

  14. A Method of High Throughput Monitoring Crop Physiology Using Chlorophyll Fluorescence and Multispectral Imaging.

    Science.gov (United States)

    Wang, Heng; Qian, Xiangjie; Zhang, Lan; Xu, Sailong; Li, Haifeng; Xia, Xiaojian; Dai, Liankui; Xu, Liang; Yu, Jingquan; Liu, Xu

    2018-01-01

    We present a high throughput crop physiology condition monitoring system and corresponding monitoring method. The monitoring system can perform large-area chlorophyll fluorescence imaging and multispectral imaging. The monitoring method can determine the crop current condition continuously and non-destructively. We choose chlorophyll fluorescence parameters and relative reflectance of multispectral as the indicators of crop physiological status. Using tomato as experiment subject, the typical crop physiological stress, such as drought, nutrition deficiency and plant disease can be distinguished by the monitoring method. Furthermore, we have studied the correlation between the physiological indicators and the degree of stress. Besides realizing the continuous monitoring of crop physiology, the monitoring system and method provide the possibility of machine automatic diagnosis of the plant physiology. Highlights: A newly designed high throughput crop physiology monitoring system and the corresponding monitoring method are described in this study. Different types of stress can induce distinct fluorescence and spectral characteristics, which can be used to evaluate the physiological status of plants.

  15. An improved high throughput sequencing method for studying oomycete communities

    DEFF Research Database (Denmark)

    Sapkota, Rumakanta; Nicolaisen, Mogens

    2015-01-01

    the usefulness of the method not only in soil DNA but also in a plant DNA background. In conclusion, we demonstrate a successful approach for pyrosequencing of oomycete communities using ITS1 as the barcode sequence with well-known primers for oomycete DNA amplification....... communities. Thewell-known primer sets ITS4, ITS6 and ITS7were used in the study in a semi-nested PCR approach to target the internal transcribed spacer (ITS) 1 of ribosomal DNA in a next generation sequencing protocol. These primers have been used in similar studies before, butwith limited success.......Wewere able to increase the proportion of retrieved oomycete sequences dramaticallymainly by increasing the annealing temperature during PCR. The optimized protocol was validated using three mock communities and the method was further evaluated using total DNA from 26 soil samples collected from different...

  16. Development of High Flux Isotope Reactor (HFIR) subcriticality monitoring methods

    International Nuclear Information System (INIS)

    Rothrock, R.B.

    1991-01-01

    Use of subcritical source multiplication measurements during refueling has been investigated as a possible replacement for out-of-reactor subcriticality measurements formerly made on fresh HFIR fuel elements at the ORNL Critical Experiment Facility. These measurements have been used in the past for preparation of estimated critical rod positions, and as a partial verification, prior to reactor startup, that the requirements for operational shutdown margin would be met. Results of subcritical count rate data collection during recent HFIR refuelings and supporting calculations are described illustrating the intended measurement method and its expected uncertainty. These results are compared to historical uses of the out-of-reactor core measurements and their accuracy requirements, and a planned in-reactor test is described which will establish the sensitivity of the method and calibrate it for future routine use during HFIR refueling. 2 refs., 1 fig., 2 tabs

  17. High capacity adsorption media and method of producing

    Science.gov (United States)

    Tranter, Troy J.; Mann, Nicholas R.; Todd, Terry A.; Herbst, Ronald S.

    2010-10-05

    A method of producing an adsorption medium to remove at least one constituent from a feed stream. The method comprises dissolving and/or suspending at least one metal compound in a solvent to form a metal solution, dissolving polyacrylonitrile into the metal solution to form a PAN-metal solution, and depositing the PAN-metal solution into a quenching bath to produce the adsorption medium. The at least one constituent, such as arsenic, selenium, or antimony, is removed from the feed stream by passing the feed stream through the adsorption medium. An adsorption medium having an increased metal loading and increased capacity for arresting the at least one constituent to be removed is also disclosed. The adsorption medium includes a polyacrylonitrile matrix and at least one metal hydroxide incorporated into the polyacrylonitrile matrix.

  18. Releasable, high-pressure seal and method of forming same

    International Nuclear Information System (INIS)

    Holman, R.R.; Turkail, D.N.

    1980-01-01

    An inexpensive releaseable, high-pressure seal was developed, which can withstand pressures over 70 atm, and is particularly useful for nuclear reactors where remote-handling equipment must be used to access the flanged connections. It is smaller than existing high-pressure seals and does not require as many bolts. The fail-safe quality of the seal does not depend on close tolerances or high-quality surface finishes. The seal comprises two conduits through which the high-pressure fluid flows, each fitted with flanges. The second flange has a periphery attached to the second conduit. Each flange has a central opening for the fluid to flow through. The second flange is frustoconical in shape and is resilient so that a portion of it near its central opening can be resiliently biased towards the first flange. A seal ring between the end flanges seals the interior of the conduits from the exterior. A force is applied to the seal ring which acts nearly parallel to the axis of the conduits and varies as a function of the fluid pressure inside of the conduits. The flanges are attached to each other with peripheral collars via a circumferential clamp. (DN)

  19. Effects of Providing High-Fat versus High-Carbohydrate Meals on Daily and Postprandial Physical Activity and Glucose Patterns: a Randomised Controlled Trial

    Directory of Open Access Journals (Sweden)

    Evelyn B. Parr

    2018-04-01

    Full Text Available We determined the effects of altering meal timing and diet composition on temporal glucose homeostasis and physical activity measures. Eight sedentary, overweight/obese men (mean ± SD, age: 36 ± 4 years; BMI: 29.8 ± 1.8 kg/m2 completed two × 12-day (12-d measurement periods, including a 7-d habitual period, and then 5 d of each diet (high-fat diet [HFD]: 67:15:18% fat:carbohydrate:protein versus high-carbohydrate diet [HCD]: 67:15:18% carbohydrate:fat:protein of three meals/d at ±30 min of 0800 h, 1230 h, and 1800 h, in a randomised order with an 8-d washout. Energy intake (EI, the timing of meal consumption, blood glucose regulation (continuous glucose monitor system (CGMS, and activity patterns (accelerometer and inclinometer were assessed across each 12-d period. Meal provision did not alter the patterns of reduced physical activity, and increased sedentary behaviour following dinner, compared with following breakfast and lunch. The HCD increased peak (+1.6 mmol/L, p < 0.001, mean (+0.5 mmol/L, p = 0.001, and total area under the curve (+670 mmol/L/min, p = 0.001, as well as 3-h postprandial meal glucose concentrations (all p < 0.001 compared with the HFD. In overweight/obese males, the provision of meals did not alter physical activity patterns, but did affect glycaemic control. Greater emphasis on meal timing and composition is required in diet and/or behaviour intervention studies to ensure relevance to real-world behaviours.

  20. Examining inequalities in uptake of maternal health care and choice of provider in underserved urban areas of Mumbai, India: a mixed methods study.

    Science.gov (United States)

    Alcock, Glyn; Das, Sushmita; Shah More, Neena; Hate, Ketaki; More, Sharda; Pantvaidya, Shanti; Osrin, David; Houweling, Tanja A J

    2015-09-28

    Discussions of maternity care in developing countries tend to emphasise service uptake and overlook choice of provider. Understanding how families choose among health providers is essential to addressing inequitable access to care. Our objectives were to quantify the determinants and choice of maternity care provider in Mumbai's informal urban settlements, and to explore the reasons underlying their choices. The study was conducted in informal urban communities in eastern Mumbai. We developed regression models using data from a census of married women aged 15-49 to test for associations between maternal characteristics and uptake of care and choice of provider. We then conducted seven focus group discussions and 16 in-depth interviews with purposively selected participants, and used grounded theory methods to examine the reasons for their choices. Three thousand eight hundred forty-eight women who had given birth in the preceding 2 years were interviewed in the census. The odds of institutional prenatal and delivery care increased with education, economic status, and duration of residence in Mumbai, and decreased with parity. Tertiary public hospitals were the commonest site of care, but there was a preference for private hospitals with increasing socio-economic status. Women were more likely to use tertiary public hospitals for delivery if they had fewer children and were Hindu. The odds of delivery in the private sector increased with maternal education, wealth, age, recent arrival in Mumbai, and Muslim faith. Four processes were identified in choosing a health care provider: exploring the options, defining a sphere of access, negotiating autonomy, and protective reasoning. Women seeking a positive health experience and outcome adopted strategies to select the best or most suitable, accessible provider. In Mumbai's informal settlements, institutional maternity care is the norm, except among recent migrants. Poor perceptions of primary public health facilities

  1. High-density 3D graphene-based monolith and related materials, methods, and devices

    Energy Technology Data Exchange (ETDEWEB)

    Worsley, Marcus A.; Baumann, Theodore F.; Biener, Juergen; Charnvanichborikarn, Supakit; Kucheyev, Sergei; Montalvo, Elizabeth; Shin, Swanee; Tylski, Elijah

    2017-03-21

    A composition comprising at least one high-density graphene-based monolith, said monolith comprising a three-dimensional structure of graphene sheets crosslinked by covalent carbon bonds and having a density of at least 0.1 g/cm.sup.3. Also provided is a method comprising: preparing a reaction mixture comprising a suspension and at least one catalyst, said suspension selected from a graphene oxide (GO) suspension and a carbon nanotube suspension; curing the reaction mixture to produce a wet gel; drying the wet gel to produce a dry gel, said drying step is substantially free of supercritical drying and freeze drying; and pyrolyzing the dry gel to produce a high-density graphene-based monolith. Exceptional combinations of properties are achieved including high conductive and mechanical properties.

  2. Glass-solidification method for high level radioactive liquid waste

    International Nuclear Information System (INIS)

    Kawamura, Kazuhiro; Kometani, Masayuki; Sasage, Ken-ichi.

    1996-01-01

    High level liquid wastes are removed with precipitates mainly comprising Mo and Zr, thereafter, the high level liquid wastes are mixed with a glass raw material comprising a composition having a B 2 O 3 /SiO 2 ratio of not less than 0.41, a ZnO/Li 2 O ratio of not less than 1.00, and an Al 2 O 3 /Li 2 O ratio of not less than 2.58, and they are melted and solidified into glass-solidification products. The liquid waste content in the glass-solidification products can be increased up to about 45% by using the glass raw material having such a predetermined composition. In addition, deposition of a yellow phase does not occur, and a leaching rate identical with that in a conventional case can be maintained. (T.M.)

  3. Method for making a high current fiber brush collector

    Science.gov (United States)

    Scuro, S. J.

    1986-05-01

    An axial-type homopolar motor having high density, high current fiber brush collectors affording efficient, low contact resistance and low operating temperatures is discussed. The collectors include a ring of concentric row of brushes in equally spaced beveled holes soldered in place using a fixture for heating the ring to just below the solder melting point at a soldering iron for the local application of additional heat at each brush. Prior to soldering, an oxide film is formed on the surfaces of the brushes and ring, and the bevels are burnished to form a wetting surface. Flux applied with the solder at each bevel removes to an effective soldering depth the oxide film on the brushes and the holes.

  4. Divertor, thermonuclear device and method of neutralizing high temperature plasma

    International Nuclear Information System (INIS)

    Ikegami, Hideo.

    1995-01-01

    The thermonuclear device comprises a thermonuclear reactor for taking place fusion reactions to emit fusion plasmas, and a divertor made of a hydrogen occluding material, and the divertor is disposed at a position being in contact with the fusion plasmas after nuclear fusion reaction. The divertor is heated by fusion plasmas after nuclear fusion reaction, and hydrogen is released from the hydrogen occluding material as a constituent material. A gas blanket is formed by the released hydrogen to cool and neutralize the supplied high temperature nuclear fusion plasmas. This prevents the high temperature plasmas from hitting against the divertor, elimination of the divertor by melting and evaporation, and solve a problem of processing a divertor activated by neutrons. In addition, it is possible to utilize hydrogen isotopes of fuels effectively and remove unnecessary helium. Inflow of impurities from out of the system can also be prevented. (N.H.)

  5. NUMERICAL METHODS FOR THE SIMULATION OF HIGH INTENSITY HADRON SYNCHROTRONS.

    Energy Technology Data Exchange (ETDEWEB)

    LUCCIO, A.; D' IMPERIO, N.; MALITSKY, N.

    2005-09-12

    Numerical algorithms for PIC simulation of beam dynamics in a high intensity synchrotron on a parallel computer are presented. We introduce numerical solvers of the Laplace-Poisson equation in the presence of walls, and algorithms to compute tunes and twiss functions in the presence of space charge forces. The working code for the simulation here presented is SIMBAD, that can be run as stand alone or as part of the UAL (Unified Accelerator Libraries) package.

  6. High-Throughput Sequencing Based Methods of RNA Structure Investigation

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz Jan

    In this thesis we describe the development of four related methods for RNA structure probing that utilize massive parallel sequencing. Using them, we were able to gather structural data for multiple, long molecules simultaneously. First, we have established an easy to follow experimental...... and computational protocol for detecting the reverse transcription termination sites (RTTS-Seq). This protocol was subsequently applied to hydroxyl radical footprinting of three dimensional RNA structures to give a probing signal that correlates well with the RNA backbone solvent accessibility. Moreover, we applied...

  7. A high precision method for normalization of cross sections

    International Nuclear Information System (INIS)

    Aguilera R, E.F.; Vega C, J.J.; Martinez Q, E.; Kolata, J.J.

    1988-08-01

    It was developed a system of 4 monitors and a program to eliminate, in the process of normalization of cross sections, the dependence of the alignment of the equipment and those condition of having centered of the beam. It was carried out a series of experiments with the systems 27 Al + 70, 72, 74, 76 Ge, 35 Cl + 58 Ni, 37 Cl + 58, 60, 62, 64 Ni and ( 81 Br, 109 Rh) + 60 Ni. For these experiments the typical precision of 1% was obtained in the normalization. It is demonstrated theoretical and experimentally the advantage of this method on those that use 1 or 2 monitors. (Author)

  8. Dating methods enter high-school physics curriculum

    International Nuclear Information System (INIS)

    Beck, L.

    2002-01-01

    The new curriculum of physics of the upper forms in French grammar schools includes a part dedicated to ''nuclear transformations''. One of the applications most often considered in manuals is isotopic dating and generally several methods are explained to pupils: carbon 14 dating, potassium-argon dating (used for dating ancient lava layers) and uranium-thorium dating (used for dating corals). The author reviews with a critical eye the content of manuals and laments through concrete examples the lack of exactness and accuracy of some presentations. (A.C.)

  9. PDF methods for combustion in high-speed turbulent flows

    Science.gov (United States)

    Pope, Stephen B.

    1995-01-01

    This report describes the research performed during the second year of this three-year project. The ultimate objective of the project is extend the applicability of probability density function (pdf) methods from incompressible to compressible turbulent reactive flows. As described in subsequent sections, progress has been made on: (1) formulation and modelling of pdf equations for compressible turbulence, in both homogeneous and inhomogeneous inert flows; and (2) implementation of the compressible model in various flow configurations, namely decaying isotropic turbulence, homogeneous shear flow and plane mixing layer.

  10. A Comparison of Methods for Estimating the Determinant of High-Dimensional Covariance Matrix

    KAUST Repository

    Hu, Zongliang

    2017-09-27

    The determinant of the covariance matrix for high-dimensional data plays an important role in statistical inference and decision. It has many real applications including statistical tests and information theory. Due to the statistical and computational challenges with high dimensionality, little work has been proposed in the literature for estimating the determinant of high-dimensional covariance matrix. In this paper, we estimate the determinant of the covariance matrix using some recent proposals for estimating high-dimensional covariance matrix. Specifically, we consider a total of eight covariance matrix estimation methods for comparison. Through extensive simulation studies, we explore and summarize some interesting comparison results among all compared methods. We also provide practical guidelines based on the sample size, the dimension, and the correlation of the data set for estimating the determinant of high-dimensional covariance matrix. Finally, from a perspective of the loss function, the comparison study in this paper may also serve as a proxy to assess the performance of the covariance matrix estimation.

  11. A Comparison of Methods for Estimating the Determinant of High-Dimensional Covariance Matrix.

    Science.gov (United States)

    Hu, Zongliang; Dong, Kai; Dai, Wenlin; Tong, Tiejun

    2017-09-21

    The determinant of the covariance matrix for high-dimensional data plays an important role in statistical inference and decision. It has many real applications including statistical tests and information theory. Due to the statistical and computational challenges with high dimensionality, little work has been proposed in the literature for estimating the determinant of high-dimensional covariance matrix. In this paper, we estimate the determinant of the covariance matrix using some recent proposals for estimating high-dimensional covariance matrix. Specifically, we consider a total of eight covariance matrix estimation methods for comparison. Through extensive simulation studies, we explore and summarize some interesting comparison results among all compared methods. We also provide practical guidelines based on the sample size, the dimension, and the correlation of the data set for estimating the determinant of high-dimensional covariance matrix. Finally, from a perspective of the loss function, the comparison study in this paper may also serve as a proxy to assess the performance of the covariance matrix estimation.

  12. A Comparison of Methods for Estimating the Determinant of High-Dimensional Covariance Matrix

    KAUST Repository

    Hu, Zongliang; Dong, Kai; Dai, Wenlin; Tong, Tiejun

    2017-01-01

    The determinant of the covariance matrix for high-dimensional data plays an important role in statistical inference and decision. It has many real applications including statistical tests and information theory. Due to the statistical and computational challenges with high dimensionality, little work has been proposed in the literature for estimating the determinant of high-dimensional covariance matrix. In this paper, we estimate the determinant of the covariance matrix using some recent proposals for estimating high-dimensional covariance matrix. Specifically, we consider a total of eight covariance matrix estimation methods for comparison. Through extensive simulation studies, we explore and summarize some interesting comparison results among all compared methods. We also provide practical guidelines based on the sample size, the dimension, and the correlation of the data set for estimating the determinant of high-dimensional covariance matrix. Finally, from a perspective of the loss function, the comparison study in this paper may also serve as a proxy to assess the performance of the covariance matrix estimation.

  13. Laboratory-scale method for enzymatic saccharification of lignocellulosic biomass at high-solids loadings

    Directory of Open Access Journals (Sweden)

    Dibble Clare J

    2009-11-01

    Full Text Available Abstract Background Screening new lignocellulosic biomass pretreatments and advanced enzyme systems at process relevant conditions is a key factor in the development of economically viable lignocellulosic ethanol. Shake flasks, the reaction vessel commonly used for screening enzymatic saccharifications of cellulosic biomass, do not provide adequate mixing at high-solids concentrations when shaking is not supplemented with hand mixing. Results We identified roller bottle reactors (RBRs as laboratory-scale reaction vessels that can provide adequate mixing for enzymatic saccharifications at high-solids biomass loadings without any additional hand mixing. Using the RBRs, we developed a method for screening both pretreated biomass and enzyme systems at process-relevant conditions. RBRs were shown to be scalable between 125 mL and 2 L. Results from enzymatic saccharifications of five biomass pretreatments of different severities and two enzyme preparations suggest that this system will work well for a variety of biomass substrates and enzyme systems. A study of intermittent mixing regimes suggests that mass transfer limitations of enzymatic saccharifications at high-solids loadings are significant but can be mitigated with a relatively low amount of mixing input. Conclusion Effective initial mixing to promote good enzyme distribution and continued, but not necessarily continuous, mixing is necessary in order to facilitate high biomass conversion rates. The simplicity and robustness of the bench-scale RBR system, combined with its ability to accommodate numerous reaction vessels, will be useful in screening new biomass pretreatments and advanced enzyme systems at high-solids loadings.

  14. High-order polygonal discontinuous Petrov-Galerkin (PolyDPG) methods using ultraweak formulations

    Science.gov (United States)

    Vaziri Astaneh, Ali; Fuentes, Federico; Mora, Jaime; Demkowicz, Leszek

    2018-04-01

    This work represents the first endeavor in using ultraweak formulations to implement high-order polygonal finite element methods via the discontinuous Petrov-Galerkin (DPG) methodology. Ultraweak variational formulations are nonstandard in that all the weight of the derivatives lies in the test space, while most of the trial space can be chosen as copies of $L^2$-discretizations that have no need to be continuous across adjacent elements. Additionally, the test spaces are broken along the mesh interfaces. This allows one to construct conforming polygonal finite element methods, termed here as PolyDPG methods, by defining most spaces by restriction of a bounding triangle or box to the polygonal element. The only variables that require nontrivial compatibility across elements are the so-called interface or skeleton variables, which can be defined directly on the element boundaries. Unlike other high-order polygonal methods, PolyDPG methods do not require ad hoc stabilization terms thanks to the crafted stability of the DPG methodology. A proof of convergence of the form $h^p$ is provided and corroborated through several illustrative numerical examples. These include polygonal meshes with $n$-sided convex elements and with highly distorted concave elements, as well as the modeling of discontinuous material properties along an arbitrary interface that cuts a uniform grid. Since PolyDPG methods have a natural a posteriori error estimator a polygonal adaptive strategy is developed and compared to standard adaptivity schemes based on constrained hanging nodes. This work is also accompanied by an open-source $\\texttt{PolyDPG}$ software supporting polygonal and conventional elements.

  15. Health care providers' perceived barriers to and need for the implementation of a national integrated health care standard on childhood obesity in the Netherlands - a mixed methods approach.

    Science.gov (United States)

    Schalkwijk, Annemarie A H; Nijpels, Giel; Bot, Sandra D M; Elders, Petra J M

    2016-03-08

    In 2010, a national integrated health care standard for (childhood) obesity was published and disseminated in the Netherlands. The aim of this study is to gain insight into the needs of health care providers and the barriers they face in terms of implementing this integrated health care standard. A mixed-methods approach was applied using focus groups, semi-structured, face-to-face interviews and an e-mail-based internet survey. The study's participants included: general practitioners (GPs) (focus groups); health care providers in different professions (face-to-face interviews) and health care providers, including GPs; youth health care workers; pediatricians; dieticians; psychologists and physiotherapists (survey). First, the transcripts from the focus groups were analyzed thematically. The themes identified in this process were then used to analyze the interviews. The results of the analysis of the qualitative data were used to construct the statements used in the e-mail-based internet survey. Responses to items were measured on a 5-point Likert scale and were categorized into three outcomes: 'agree' or 'important' (response categories 1 and 2), 'disagree' or 'not important'. Twenty-seven of the GPs that were invited (51 %) participated in four focus groups. Seven of the nine health care professionals that were invited (78 %) participated in the interviews and 222 questionnaires (17 %) were returned and included in the analysis. The following key barriers were identified with regard to the implementation of the integrated health care standard: reluctance to raise the subject; perceived lack of motivation and knowledge on the part of the parents; previous negative experiences with lifestyle programs; financial constraints and the lack of a structured multidisciplinary approach. The main needs identified were: increased knowledge and awareness on the part of both health care providers and parents/children; a social map of effective intervention; structural

  16. Review and Response to the Final Report of the National Black Health Providers Task Force on High Blood Pressure Education and Control.

    Science.gov (United States)

    Public Health Service (DHHS), Rockville, MD.

    This report presents the National Heart, Lung, and Blood Institute's (NHLBI) review of and response to the final report of the National Black Health Providers Task Force on High Blood Pressure Education and Control. The response includes a statement of NHLBI's involvement in health research, and descriptions of what steps can be taken to solve the…

  17. Polylysine as a vehicle for extracellular matrix-targeted local drug delivery, providing high accumulation and long-term retention within the vascular wall

    NARCIS (Netherlands)

    Sakharov, D.V.; Jie, A.F.H.; Bekkers, M.E.A.; Emeis, J.J.; Rijken, D.C.

    2001-01-01

    We present the first steps in the elaboration of an approach of extracellular matrix-targeted local drug delivery (ECM-LDD), designed to provide a high concentration, ubiquitous distribution, and long-term retention of a drug within the vessel wall after local intravascular delivery. The approach is

  18. Bioassessment of a Drinking Water Reservoir Using Plankton: High Throughput Sequencing vs. Traditional Morphological Method

    Directory of Open Access Journals (Sweden)

    Wanli Gao

    2018-01-01

    Full Text Available Drinking water safety is increasingly perceived as one of the top global environmental issues. Plankton has been commonly used as a bioindicator for water quality in lakes and reservoirs. Recently, DNA sequencing technology has been applied to bioassessment. In this study, we compared the effectiveness of the 16S and 18S rRNA high throughput sequencing method (HTS and the traditional optical microscopy method (TOM in the bioassessment of drinking water quality. Five stations reflecting different habitats and hydrological conditions in Danjiangkou Reservoir, one of the largest drinking water reservoirs in Asia, were sampled May 2016. Non-metric multi-dimensional scaling (NMDS analysis showed that plankton assemblages varied among the stations and the spatial patterns revealed by the two methods were consistent. The correlation between TOM and HTS in a symmetric Procrustes analysis was 0.61, revealing overall good concordance between the two methods. Procrustes analysis also showed that site-specific differences between the two methods varied among the stations. Station Heijizui (H, a site heavily influenced by two tributaries, had the largest difference while station Qushou (Q, a confluence site close to the outlet dam, had the smallest difference between the two methods. Our results show that DNA sequencing has the potential to provide consistent identification of taxa, and reliable bioassessment in a long-term biomonitoring and assessment program for drinking water reservoirs.

  19. Modifications Of Discrete Ordinate Method For Computations With High Scattering Anisotropy: Comparative Analysis

    Science.gov (United States)

    Korkin, Sergey V.; Lyapustin, Alexei I.; Rozanov, Vladimir V.

    2012-01-01

    A numerical accuracy analysis of the radiative transfer equation (RTE) solution based on separation of the diffuse light field into anisotropic and smooth parts is presented. The analysis uses three different algorithms based on the discrete ordinate method (DOM). Two methods, DOMAS and DOM2+, that do not use the truncation of the phase function, are compared against the TMS-method. DOMAS and DOM2+ use the Small-Angle Modification of RTE and the single scattering term, respectively, as an anisotropic part. The TMS method uses Delta-M method for truncation of the phase function along with the single scattering correction. For reference, a standard discrete ordinate method, DOM, is also included in analysis. The obtained results for cases with high scattering anisotropy show that at low number of streams (16, 32) only DOMAS provides an accurate solution in the aureole area. Outside of the aureole, the convergence and accuracy of DOMAS, and TMS is found to be approximately similar: DOMAS was found more accurate in cases with coarse aerosol and liquid water cloud models, except low optical depth, while the TMS showed better results in case of ice cloud.

  20. Algorithms and Methods for High-Performance Model Predictive Control

    DEFF Research Database (Denmark)

    Frison, Gianluca

    routines employed in the numerical tests. The main focus of this thesis is on linear MPC problems. In this thesis, both the algorithms and their implementation are equally important. About the implementation, a novel implementation strategy for the dense linear algebra routines in embedded optimization...... is proposed, aiming at improving the computational performance in case of small matrices. About the algorithms, they are built on top of the proposed linear algebra, and they are tailored to exploit the high-level structure of the MPC problems, with special care on reducing the computational complexity....

  1. Data analysis in high energy physics. A practical guide to statistical methods

    International Nuclear Information System (INIS)

    Behnke, Olaf; Schoerner-Sadenius, Thomas; Kroeninger, Kevin; Schott, Gregory

    2013-01-01

    This practical guide covers the essential tasks in statistical data analysis encountered in high energy physics and provides comprehensive advice for typical questions and problems. The basic methods for inferring results from data are presented as well as tools for advanced tasks such as improving the signal-to-background ratio, correcting detector effects, determining systematics and many others. Concrete applications are discussed in analysis walkthroughs. Each chapter is supplemented by numerous examples and exercises and by a list of literature and relevant links. The book targets a broad readership at all career levels - from students to senior researchers.

  2. A high-throughput method for quantifying metabolically active yeast cells

    DEFF Research Database (Denmark)

    Nandy, Subir Kumar; Knudsen, Peter Boldsen; Rosenkjær, Alexander

    2015-01-01

    By redesigning the established methylene blue reduction test for bacteria and yeast, we present a cheap and efficient methodology for quantitative physiology of eukaryotic cells applicable for high-throughput systems. Validation of themethod in fermenters and highthroughput systems proved....... The drop in metabolic activity associated with the diauxic shift in yeast proved more pronounced for the MBRT-derived curve compared with OD curves, consistent with a dramatic shift in the ratio between live and dead cells at this metabolic event. This method provides a tool with numerous applications, e.......g. characterizing the death phase of stationary phase cultures, or in drug screens with pathogenic yeasts....

  3. High voltage MOSFET devices and methods of making the devices

    Science.gov (United States)

    Banerjee, Sujit; Matocha, Kevin; Chatty, Kiran

    2018-06-05

    A SiC MOSFET device having low specific on resistance is described. The device has N+, P-well and JFET regions extended in one direction (Y-direction) and P+ and source contacts extended in an orthogonal direction (X-direction). The polysilicon gate of the device covers the JFET region and is terminated over the P-well region to minimize electric field at the polysilicon gate edge. In use, current flows vertically from the drain contact at the bottom of the structure into the JFET region and then laterally in the X direction through the accumulation region and through the MOSFET channels into the adjacent N+ region. The current flowing out of the channel then flows along the N+ region in the Y-direction and is collected by the source contacts and the final metal. Methods of making the device are also described.

  4. High voltage MOSFET devices and methods of making the devices

    Science.gov (United States)

    Banerjee, Sujit; Matocha, Kevin; Chatty, Kiran

    2015-12-15

    A SiC MOSFET device having low specific on resistance is described. The device has N+, P-well and JFET regions extended in one direction (Y-direction) and P+ and source contacts extended in an orthogonal direction (X-direction). The polysilicon gate of the device covers the JFET region and is terminated over the P-well region to minimize electric field at the polysilicon gate edge. In use, current flows vertically from the drain contact at the bottom of the structure into the JFET region and then laterally in the X direction through the accumulation region and through the MOSFET channels into the adjacent N+ region. The current flowing out of the channel then flows along the N+ region in the Y-direction and is collected by the source contacts and the final metal. Methods of making the device are also described.

  5. Variational methods for high-order multiphoton processes

    International Nuclear Information System (INIS)

    Gao, B.; Pan, C.; Liu, C.; Starace, A.F.

    1990-01-01

    Methods for applying the variationally stable procedure for Nth-order perturbative transition matrix elements of Gao and Starace [Phys. Rev. Lett. 61, 404 (1988); Phys. Rev. A 39, 4550 (1989)] to multiphoton processes involving systems other than atomic H are presented. Three specific cases are discussed: one-electron ions or atoms in which the electron--ion interaction is described by a central potential; two-electron ions or atoms in which the electronic states are described by the adiabatic hyperspherical representation; and closed-shell ions or atoms in which the electronic states are described by the multiconfiguration Hartree--Fock representation. Applications are made to the dynamic polarizability of He and the two-photon ionization cross section of Ar

  6. A Saliency Guided Semi-Supervised Building Change Detection Method for High Resolution Remote Sensing Images

    Directory of Open Access Journals (Sweden)

    Bin Hou

    2016-08-01

    Full Text Available Characterizations of up to date information of the Earth’s surface are an important application providing insights to urban planning, resources monitoring and environmental studies. A large number of change detection (CD methods have been developed to solve them by utilizing remote sensing (RS images. The advent of high resolution (HR remote sensing images further provides challenges to traditional CD methods and opportunities to object-based CD methods. While several kinds of geospatial objects are recognized, this manuscript mainly focuses on buildings. Specifically, we propose a novel automatic approach combining pixel-based strategies with object-based ones for detecting building changes with HR remote sensing images. A multiresolution contextual morphological transformation called extended morphological attribute profiles (EMAPs allows the extraction of geometrical features related to the structures within the scene at different scales. Pixel-based post-classification is executed on EMAPs using hierarchical fuzzy clustering. Subsequently, the hierarchical fuzzy frequency vector histograms are formed based on the image-objects acquired by simple linear iterative clustering (SLIC segmentation. Then, saliency and morphological building index (MBI extracted on difference images are used to generate a pseudo training set. Ultimately, object-based semi-supervised classification is implemented on this training set by applying random forest (RF. Most of the important changes are detected by the proposed method in our experiments. This study was checked for effectiveness using visual evaluation and numerical evaluation.

  7. Methods for Estimating Environmental Effects and Constraints on NexGen: High Density Case Study

    Science.gov (United States)

    Augustine, S.; Ermatinger, C.; Graham, M.; Thompson, T.

    2010-01-01

    This document provides a summary of the current methods developed by Metron Aviation for the estimate of environmental effects and constraints on the Next Generation Air Transportation System (NextGen). This body of work incorporates many of the key elements necessary to achieve such an estimate. Each section contains the background and motivation for the technical elements of the work, a description of the methods used, and possible next steps. The current methods described in this document were selected in an attempt to provide a good balance between accuracy and fairly rapid turn around times to best advance Joint Planning and Development Office (JPDO) System Modeling and Analysis Division (SMAD) objectives while also supporting the needs of the JPDO Environmental Working Group (EWG). In particular this document describes methods applied to support the High Density (HD) Case Study performed during the spring of 2008. A reference day (in 2006) is modeled to describe current system capabilities while the future demand is applied to multiple alternatives to analyze system performance. The major variables in the alternatives are operational/procedural capabilities for airport, terminal, and en route airspace along with projected improvements to airframe, engine and navigational equipment.

  8. A gas trapping method for high-throughput metabolic experiments.

    Science.gov (United States)

    Krycer, James R; Diskin, Ciana; Nelson, Marin E; Zeng, Xiao-Yi; Fazakerley, Daniel J; James, David E

    2018-01-01

    Research into cellular metabolism has become more high-throughput, with typical cell-culture experiments being performed in multiwell plates (microplates). This format presents a challenge when trying to collect gaseous products, such as carbon dioxide (CO2), which requires a sealed environment and a vessel separate from the biological sample. To address this limitation, we developed a gas trapping protocol using perforated plastic lids in sealed cell-culture multiwell plates. We used this trap design to measure CO2 production from glucose and fatty acid metabolism, as well as hydrogen sulfide production from cysteine-treated cells. Our data clearly show that this gas trap can be applied to liquid and solid gas-collection media and can be used to study gaseous product generation by both adherent cells and cells in suspension. Since our gas traps can be adapted to multiwell plates of various sizes, they present a convenient, cost-effective solution that can accommodate the trend toward high-throughput measurements in metabolic research.

  9. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, December 2016

    International Nuclear Information System (INIS)

    Cabellos, Oscar; ); PELLONI, Sandro; Ivanov, Evgeny; Sobes, Vladimir; Fukushima, M.; Yokoyama, Kenji; Palmiotti, Giuseppe; Kodeli, Ivo

    2016-12-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the eighth Subgroup 39 meeting, held at the OECD NEA, Boulogne-Billancourt, France, on 1-2 December 2016. It comprises all the available presentations (slides) given by the participants: A - Presentations: Welcome and actions review (Oscar CABELLOS); B - Methods: - Detailed comparison of Progressive Incremental Adjustment (PIA) sequence results involving adjustments of spectral indices and coolant density effects on the basis of the SG33 benchmark (Sandro PELLONI); - ND assessment alternatives: Validation matrix vs XS adjustment (Evgeny IVANOV); - Implementation of Resonance Parameter Sensitivity Coefficients Calculation in CE TSUNAMI-3D (Vladimir SOBES); C - Experiment analysis, sensitivity calculations and benchmarks: - Benchmark tests of ENDF/B-VIII.0 beta 1 using sodium void reactivity worth of FCA-XXVII-1 assembly (M. FUKUSHIMA, Kenji YOKOYAMA); D - Adjustments: - Cross-section adjustment based on JENDL-4.0 using new experiments on the basis of the SG33 benchmark (Kenji YOKOYAMA); - Comparison of adjustment trends with the Cielo evaluation (Sandro PELLONI); - Expanded adjustment in support of CIELO initiative (Giuseppe PALMIOTTI); - First preliminary results of the adjustment exercise using ASPIS Fe88 and SNEAK-7A/7B k_e_f_f and b_e_f_f benchmarks (Ivo KODELI); E - Future actions, deliverables: - Discussion on future of SG39 and possible new subgroup (Giuseppe PALMIOTTI); - WPEC sub-group proposal: Investigation of Covariance Data in

  10. Elastic SCAD as a novel penalization method for SVM classification tasks in high-dimensional data.

    Science.gov (United States)

    Becker, Natalia; Toedt, Grischa; Lichter, Peter; Benner, Axel

    2011-05-09

    Classification and variable selection play an important role in knowledge discovery in high-dimensional data. Although Support Vector Machine (SVM) algorithms are among the most powerful classification and prediction methods with a wide range of scientific applications, the SVM does not include automatic feature selection and therefore a number of feature selection procedures have been developed. Regularisation approaches extend SVM to a feature selection method in a flexible way using penalty functions like LASSO, SCAD and Elastic Net.We propose a novel penalty function for SVM classification tasks, Elastic SCAD, a combination of SCAD and ridge penalties which overcomes the limitations of each penalty alone.Since SVM models are extremely sensitive to the choice of tuning parameters, we adopted an interval search algorithm, which in comparison to a fixed grid search finds rapidly and more precisely a global optimal solution. Feature selection methods with combined penalties (Elastic Net and Elastic SCAD SVMs) are more robust to a change of the model complexity than methods using single penalties. Our simulation study showed that Elastic SCAD SVM outperformed LASSO (L1) and SCAD SVMs. Moreover, Elastic SCAD SVM provided sparser classifiers in terms of median number of features selected than Elastic Net SVM and often better predicted than Elastic Net in terms of misclassification error.Finally, we applied the penalization methods described above on four publicly available breast cancer data sets. Elastic SCAD SVM was the only method providing robust classifiers in sparse and non-sparse situations. The proposed Elastic SCAD SVM algorithm provides the advantages of the SCAD penalty and at the same time avoids sparsity limitations for non-sparse data. We were first to demonstrate that the integration of the interval search algorithm and penalized SVM classification techniques provides fast solutions on the optimization of tuning parameters.The penalized SVM

  11. High Work Output Ni-Ti-Pt High Temperature Shape Memory Alloys and Associated Processing Methods

    Science.gov (United States)

    Noebe, Ronald D. (Inventor); Draper, Susan L. (Inventor); Nathal, Michael V. (Inventor); Garg, Anita (Inventor)

    2009-01-01

    According to the invention, compositions of Ni-Ti-Pt high temperature, high force, shape memory alloys are disclosed that have transition temperatures above 100 C.; have narrow hysteresis; and produce a high specific work output.

  12. IMPLEMENTATION OF SIMPLE ADDITIVE WEIGHTING (SAW METHODE IN DETERMINING HIGH SCHOOL STUDENT’S INTEREST

    Directory of Open Access Journals (Sweden)

    Prind Triajeng Pungkasanti

    2017-09-01

    Full Text Available The Ministry of Research, Technology, and Higher Education of Republic of Indonesia has set a regulation about curriculum applied in education field named Kurikulum 2013. One of the subsections in the Kurikulum 2013 regulates all requirements of majoring in high school. High school students determine their major based on Kurrikulum 2013 as they are on the 10th grade. The purpose of the majoring in education is to allow children development based on their skills and interests, because before, majoring have been done based on scores obtained. The main problem is the majoring requirements considered are admission test score and Junior High School National Test score. Both scores are not sufficient enough to determine the students major therefore academic aptitude test score is required. In term of weighting, the school has not been imposed the weighting system so the scores obtained is the average of admission test score and national test score. Based on the issue above, a solution required to solve the issue using a method. Method used in this research is Simple Additive Weighting (SAW, wherein this methode is looking for the weighted sum of performance rate on every alternative of atributes. This research provides the information about which potential students is suitable to enter the science major and social major so this results can be used as consideration of school decisions.

  13. Quality assurance requirements and methods for high level waste package acceptability

    International Nuclear Information System (INIS)

    1992-12-01

    This document should serve as guidance for assigning the necessary items to control the conditioning process in such a way that waste packages are produced in compliance with the waste acceptance requirements. It is also provided to promote the exchange of information on quality assurance requirements and on the application of quality assurance methods associated with the production of high level waste packages, to ensure that these waste packages comply with the requirements for transportation, interim storage and waste disposal in deep geological formations. The document is intended to assist both the operators of conditioning facilities and repositories as well as national authorities and regulatory bodies, involved in the licensing of the conditioning of high level radioactive wastes or in the development of deep underground disposal systems. The document recommends the quality assurance requirements and methods which are necessary to generate data for these parameters identified in IAEA-TECDOC-560 on qualitative acceptance criteria, and indicates where and when the control methods can be applied, e.g. in the operation or commissioning of a process or in the development of a waste package design. Emphasis is on the control of the process and little reliance is placed on non-destructive or destructive testing. Qualitative criteria, relevant to disposal of high level waste, are repository dependent and are not addressed here. 37 refs, 3 figs, 2 tabs

  14. Optically triggered high voltage switch network and method for switching a high voltage

    Science.gov (United States)

    El-Sharkawi, Mohamed A.; Andexler, George; Silberkleit, Lee I.

    1993-01-19

    An optically triggered solid state switch and method for switching a high voltage electrical current. A plurality of solid state switches (350) are connected in series for controlling electrical current flow between a compensation capacitor (112) and ground in a reactive power compensator (50, 50') that monitors the voltage and current flowing through each of three distribution lines (52a, 52b and 52c), which are supplying three-phase power to one or more inductive loads. An optical transmitter (100) controlled by the reactive power compensation system produces light pulses that are conveyed over optical fibers (102) to a switch driver (110') that includes a plurality of series connected optical triger circuits (288). Each of the optical trigger circuits controls a pair of the solid state switches and includes a plurality of series connected resistors (294, 326, 330, and 334) that equalize or balance the potential across the plurality of trigger circuits. The trigger circuits are connected to one of the distribution lines through a trigger capacitor (340). In each switch driver, the light signals activate a phototransistor (300) so that an electrical current flows from one of the energy reservoir capacitors through a pulse transformer (306) in the trigger circuit, producing gate signals that turn on the pair of serially connected solid state switches (350).

  15. Optically triggered high voltage switch network and method for switching a high voltage

    Energy Technology Data Exchange (ETDEWEB)

    El-Sharkawi, Mohamed A. (Renton, WA); Andexler, George (Everett, WA); Silberkleit, Lee I. (Mountlake Terrace, WA)

    1993-01-19

    An optically triggered solid state switch and method for switching a high voltage electrical current. A plurality of solid state switches (350) are connected in series for controlling electrical current flow between a compensation capacitor (112) and ground in a reactive power compensator (50, 50') that monitors the voltage and current flowing through each of three distribution lines (52a, 52b and 52c), which are supplying three-phase power to one or more inductive loads. An optical transmitter (100) controlled by the reactive power compensation system produces light pulses that are conveyed over optical fibers (102) to a switch driver (110') that includes a plurality of series connected optical triger circuits (288). Each of the optical trigger circuits controls a pair of the solid state switches and includes a plurality of series connected resistors (294, 326, 330, and 334) that equalize or balance the potential across the plurality of trigger circuits. The trigger circuits are connected to one of the distribution lines through a trigger capacitor (340). In each switch driver, the light signals activate a phototransistor (300) so that an electrical current flows from one of the energy reservoir capacitors through a pulse transformer (306) in the trigger circuit, producing gate signals that turn on the pair of serially connected solid state switches (350).

  16. A highly sensitive method for quantification of iohexol

    DEFF Research Database (Denmark)

    Schulz, A.; Boeringer, F.; Swifka, J.

    2014-01-01

    -chromatography-electrospray-massspectrometry (LC-ESI-MS) approach using the multiple reaction monitoring mode for iohexol quantification. In order to test whether a significantly decreased amount of iohexol is sufficient for reliable quantification, a LC-ESI-MS approach was assessed. We analyzed the kinetics of iohexol in rats after application...... of different amounts of iohexol (15 mg to 150 1.tg per rat). Blood sampling was conducted at four time points, at 15, 30, 60, and 90 min, after iohexol injection. The analyte (iohexol) and the internal standard (iotha(amic acid) were separated from serum proteins using a centrifugal filtration device...... with a cut-off of 3 kDa. The chromatographic separation was achieved on an analytical Zorbax SB C18 column. The detection and quantification were performed on a high capacity trap mass spectrometer using positive ion ESI in the multiple reaction monitoring (MRM) mode. Furthermore, using real-time polymerase...

  17. On the efficiency of high-energy particle identification statistical methods

    International Nuclear Information System (INIS)

    Chilingaryan, A.A.

    1982-01-01

    An attempt is made to analyze the statistical methods of making decisions on the high-energy particle identification. The Bayesian approach is shown to provide the most complete account of the primary discriminative information between the particles of various tupes. It does not impose rigid requirements on the density form of the probability function and ensures the account of the a priori information as compared with the Neyman-Pearson approach, the mimimax technique and the heristic rules of the decision limits construction in the variant region of the specially chosen parameter. The methods based on the concept of the nearest neighbourhood are shown to be the most effective one among the local methods of the probability function density estimation. The probability distances between the training sample classes are suggested to make a decision on selecting the high-energy particle detector optimal parameters. The method proposed and the software constructed are tested on the problem of the cosmic radiation hadron identification by means of transition radiation detectors (the ''PION'' experiment)

  18. Validation and application of an high-order spectral difference method for flow induced noise simulation

    KAUST Repository

    Parsani, Matteo

    2011-09-01

    The main goal of this paper is to develop an efficient numerical algorithm to compute the radiated far field noise provided by an unsteady flow field from bodies in arbitrary motion. The method computes a turbulent flow field in the near fields using a high-order spectral difference method coupled with large-eddy simulation approach. The unsteady equations are solved by advancing in time using a second-order backward difference formulae scheme. The nonlinear algebraic system arising from the time discretization is solved with the nonlinear lowerupper symmetric GaussSeidel algorithm. In the second step, the method calculates the far field sound pressure based on the acoustic source information provided by the first step simulation. The method is based on the Ffowcs WilliamsHawkings approach, which provides noise contributions for monopole, dipole and quadrupole acoustic sources. This paper will focus on the validation and assessment of this hybrid approach using different test cases. The test cases used are: a laminar flow over a two-dimensional (2D) open cavity at Re = 1.5 × 10 3 and M = 0.15 and a laminar flow past a 2D square cylinder at Re = 200 and M = 0.5. In order to show the application of the numerical method in industrial cases and to assess its capability for sound field simulation, a three-dimensional turbulent flow in a muffler at Re = 4.665 × 10 4 and M = 0.05 has been chosen as a third test case. The flow results show good agreement with numerical and experimental reference solutions. Comparison of the computed noise results with those of reference solutions also shows that the numerical approach predicts noise accurately. © 2011 IMACS.

  19. The "Performance of Rotavirus and Oral Polio Vaccines in Developing Countries" (PROVIDE) study: description of methods of an interventional study designed to explore complex biologic problems.

    Science.gov (United States)

    Kirkpatrick, Beth D; Colgate, E Ross; Mychaleckyj, Josyf C; Haque, Rashidul; Dickson, Dorothy M; Carmolli, Marya P; Nayak, Uma; Taniuchi, Mami; Naylor, Caitlin; Qadri, Firdausi; Ma, Jennie Z; Alam, Masud; Walsh, Mary Claire; Diehl, Sean A; Petri, William A

    2015-04-01

    Oral vaccines appear less effective in children in the developing world. Proposed biologic reasons include concurrent enteric infections, malnutrition, breast milk interference, and environmental enteropathy (EE). Rigorous study design and careful data management are essential to begin to understand this complex problem while assuring research subject safety. Herein, we describe the methodology and lessons learned in the PROVIDE study (Dhaka, Bangladesh). A randomized clinical trial platform evaluated the efficacy of delayed-dose oral rotavirus vaccine as well as the benefit of an injectable polio vaccine replacing one dose of oral polio vaccine. This rigorous infrastructure supported the additional examination of hypotheses of vaccine underperformance. Primary and secondary efficacy and immunogenicity measures for rotavirus and polio vaccines were measured, as well as the impact of EE and additional exploratory variables. Methods for the enrollment and 2-year follow-up of a 700 child birth cohort are described, including core laboratory, safety, regulatory, and data management practices. Intense efforts to standardize clinical, laboratory, and data management procedures in a developing world setting provide clinical trials rigor to all outcomes. Although this study infrastructure requires extensive time and effort, it allows optimized safety and confidence in the validity of data gathered in complex, developing country settings. © The American Society of Tropical Medicine and Hygiene.

  20. Human resources for health strategies adopted by providers in resource-limited settings to sustain long-term delivery of ART: a mixed-methods study from Uganda.

    Science.gov (United States)

    Zakumumpa, Henry; Taiwo, Modupe Oladunni; Muganzi, Alex; Ssengooba, Freddie

    2016-10-19

    Human resources for health (HRH) constraints are a major barrier to the sustainability of antiretroviral therapy (ART) scale-up programs in Sub-Saharan Africa. Many prior approaches to HRH constraints have taken a top-down trend of generalized global strategies and policy guidelines. The objective of the study was to examine the human resources for health strategies adopted by front-line providers in Uganda to sustain ART delivery beyond the initial ART scale-up phase between 2004 and 2009. A two-phase mixed-methods approach was adopted. In the first phase, a survey of a nationally representative sample of health facilities (n = 195) across Uganda was conducted. The second phase involved in-depth interviews (n = 36) with ART clinic managers and staff of 6 of the 195 health facilities purposively selected from the first study phase. Quantitative data was analysed based on descriptive statistics, and qualitative data was analysed by coding and thematic analysis. The identified strategies were categorized into five themes: (1) providing monetary and non-monetary incentives to health workers on busy ART clinic days; (2) workload reduction through spacing ART clinic appointments; (3) adopting training workshops in ART management as a motivation strategy for health workers; (4) adopting non-physician-centred staffing models; and (5) devising ART program leadership styles that enhanced health worker commitment. Facility-level strategies for responding to HRH constraints are feasible and can contribute to efforts to increase country ownership of HIV programs in resource-limited settings. Consideration of the human resources for health strategies identified in the study by ART program planners and managers could enhance the long-term sustainment of ART programs by providers in resource-limited settings.

  1. Usability evaluation of pharmacogenomics clinical decision support aids and clinical knowledge resources in a computerized provider order entry system: a mixed methods approach.

    Science.gov (United States)

    Devine, Emily Beth; Lee, Chia-Ju; Overby, Casey L; Abernethy, Neil; McCune, Jeannine; Smith, Joe W; Tarczy-Hornoch, Peter

    2014-07-01

    Pharmacogenomics (PGx) is positioned to have a widespread impact on the practice of medicine, yet physician acceptance is low. The presentation of context-specific PGx information, in the form of clinical decision support (CDS) alerts embedded in a computerized provider order entry (CPOE) system, can aid uptake. Usability evaluations can inform optimal design, which, in turn, can spur adoption. The study objectives were to: (1) evaluate an early prototype, commercial CPOE system with PGx-CDS alerts in a simulated environment, (2) identify potential improvements to the system user interface, and (3) understand the contexts under which PGx knowledge embedded in an electronic health record is useful to prescribers. Using a mixed methods approach, we presented seven cardiologists and three oncologists with five hypothetical clinical case scenarios. Each scenario featured a drug for which a gene encoding drug metabolizing enzyme required consideration of dosage adjustment. We used Morae(®) to capture comments and on-screen movements as participants prescribed each drug. In addition to PGx-CDS alerts, 'Infobutton(®)' and 'Evidence' icons provided participants with clinical knowledge resources to aid decision-making. Nine themes emerged. Five suggested minor improvements to the CPOE user interface; two suggested presenting PGx information through PGx-CDS alerts using an 'Infobutton' or 'Evidence' icon. The remaining themes were strong recommendations to provide succinct, relevant guidelines and dosing recommendations of phenotypic information from credible and trustworthy sources; any more information was overwhelming. Participants' median rating of PGx-CDS system usability was 2 on a Likert scale ranging from 1 (strongly agree) to 7 (strongly disagree). Usability evaluation results suggest that participants considered PGx information important for improving prescribing decisions; and that they would incorporate PGx-CDS when information is presented in relevant and

  2. High-speed thermal cycling system and method of use

    Science.gov (United States)

    Hansen, A.D.A.; Jaklevic, J.M.

    1996-04-16

    A thermal cycling system and method of use are described. The thermal cycling system is based on the circulation of temperature-controlled water directly to the underside of thin-walled polycarbonate plates. The water flow is selected from a manifold fed by pumps from heated reservoirs. The plate wells are loaded with typically 15-20 microliters of reagent mix for the PCR process. Heat transfer through the thin polycarbonate is sufficiently rapid that the contents reach thermal equilibrium with the water in less than 15 seconds. Complete PCR amplification runs of 40 three-step cycles have been performed in as little as 14.5 minutes, with the results showing substantially enhanced specificity compared to conventional technology requiring run times in excess of 100 minutes. The plate clamping station is designed to be amenable to robotic loading and unloading of the system. It includes a heated lid, thus eliminating the need for mineral oil overlay of the reactants. The present system includes three or more plate holder stations, fed from common reservoirs but operating with independent switching cycles. The system can be modularly expanded. 13 figs.

  3. Methods for qualification of highly reliable software - international procedure

    International Nuclear Information System (INIS)

    Kersken, M.

    1997-01-01

    Despite the advantages of computer-assisted safety technology, there still is some uneasyness to be observed with respect to the novel processes, resulting from absence of a body of generally accepted and uncontentious qualification guides (regulatory provisions, standards) for safety evaluation of the computer codes applied. Warranty of adequate protection of the population, operators or plant components is an essential aspect in this context, too - as it is in general with reliability and risk assessment of novel technology - so that, due to appropriate legislation still missing, there currently is a licensing risk involved in the introduction of digital safety systems. Nevertheless, there is some extent of agreement within the international community and utility operators about what standards and measures should be applied for qualification of software of relevance to plant safety. The standard IEC 880/IEC 86/ in particular, in its original version, or national documents based on this standard, are applied in all countries using or planning to install those systems. A novel supplement to this standard, document /IEC 96/, is in the process of finalization and defines the requirements to be met by modern methods of software engineering. (orig./DG) [de

  4. Geophysical insights on the GIA process provided by high-quality constraints from peripheral regions: An outlook on perspectives from North America and from the Mediterranean basin

    Science.gov (United States)

    Roy, K.; Peltier, W. R.

    2017-12-01

    Our understanding of the Earth-Ice-Ocean interactions that have accompanied the large glaciation-deglaciation process characteristic of the last half of the Pleistocene has benefited significantly from the development of high-quality models of the Glacial Isostatic Adjustment (GIA) process. These models provide fundamental insight on the large changes in sea level and land ice cover over this time period, as well as key constraints on the viscosity structure of the Earth's interior. Their development has benefited from the recent availability of high-quality constraints from regions of forebulge collapse. In particular, over North America, the joint use of high-quality sea level data from the U.S. East coast, together with the vast network of precise space-geodetic observations of crustal motion existing over most of the interior of the continent, has led to the latest ICE-7G_NA (VM7) model (Roy & Peltier, GJI, 2017). In this paper, exciting opportunities provided by such high-quality observations related to the GIA process will be discussed, not only in the context of the continuing effort to refine global models of this phenomenon, but also in terms of the fundamental insight they may provide on outstanding issues in high-pressure geophysics, paleoclimatology or hydrogeology. Specific examples where such high-quality observations can be used (either separately, or using a combination of independent sources) will be presented, focusing particularly on constraints from the North American continent and from the Mediterranean basin. This work will demonstrate that, given the high-quality of currently available constraints on the GIA process, considerable further geophysical insight can be obtained based upon the use of spherically-symmetric models of the viscosity structure of the planet.

  5. Using data mining techniques to explore physicians' therapeutic decisions when clinical guidelines do not provide recommendations: methods and example for type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Toussi Massoud

    2009-06-01

    Full Text Available Abstract Background Clinical guidelines carry medical evidence to the point of practice. As evidence is not always available, many guidelines do not provide recommendations for all clinical situations encountered in practice. We propose an approach for identifying knowledge gaps in guidelines and for exploring physicians' therapeutic decisions with data mining techniques to fill these knowledge gaps. We demonstrate our method by an example in the domain of type 2 diabetes. Methods We analyzed the French national guidelines for the management of type 2 diabetes to identify clinical conditions that are not covered or those for which the guidelines do not provide recommendations. We extracted patient records corresponding to each clinical condition from a database of type 2 diabetic patients treated at Avicenne University Hospital of Bobigny, France. We explored physicians' prescriptions for each of these profiles using C5.0 decision-tree learning algorithm. We developed decision-trees for different levels of detail of the therapeutic decision, namely the type of treatment, the pharmaco-therapeutic class, the international non proprietary name, and the dose of each medication. We compared the rules generated with those added to the guidelines in a newer version, to examine their similarity. Results We extracted 27 rules from the analysis of a database of 463 patient records. Eleven rules were about the choice of the type of treatment and thirteen rules about the choice of the pharmaco-therapeutic class of each drug. For the choice of the international non proprietary name and the dose, we could extract only a few rules because the number of patient records was too low for these factors. The extracted rules showed similarities with those added to the newer version of the guidelines. Conclusion Our method showed its usefulness for completing guidelines recommendations with rules learnt automatically from physicians' prescriptions. It could be used

  6. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, November 2014

    International Nuclear Information System (INIS)

    Aufiero, Manuele; Ivanov, Evgeny; Hoefer, Axel; Yokoyama, Kenji; Da Cruz, Dirceu Ferreira; KODELI, Ivan-Alexander; Hursin, Mathieu; Pelloni, Sandro; Palmiotti, Giuseppe; Salvatores, Massimo; Barnes, Andrew; Cabellos De Francisco, Oscar; ); Ivanova, Tatiana; )

    2014-11-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the third formal Subgroup meeting held at the NEA, Issy-les-Moulineaux, France, on 27-28 November 2014. It comprises a Summary Record of the meeting and all the available presentations (slides) given by the participants: A - Sensitivity methods: 1 - Perturbation/sensitivity calculations with Serpent (M. Aufiero); 2 - Comparison of deterministic and Monte Carlo sensitivity analysis of SNEAK-7A and FLATTOP-Pu Benchmarks (I. Kodeli); B - Integral experiments: 1 - PROTEUS experiments: selected experiments sensitivity profiles and availability, (M. Hursin, M. Salvatores - PROTEUS Experiments, HCLWR configurations); 2 - SINBAD Benchmark Database and FNS/JAEA Liquid Oxygen TOF Experiment Analysis (I. Kodeli); 3 - STEK experiment Opportunity for Validation of Fission Products Nuclear Data (D. Da Cruz); 4 - SEG (tailored adjoint flux shapes) (M. Savatores - comments) 5 - IPPE transmission experiments (Fe, 238 U) (T. Ivanova); 6 - RPI semi-integral (Fe, 238 U) (G. Palmiotti - comments); 7 - New experiments, e.g. in connection with the new NSC Expert Group on 'Improvement of Integral Experiments Data for Minor Actinide Management' (G. Palmiotti - Some comments from the Expert Group) 8 - Additional PSI adjustment studies accounting for nonlinearity (S. Pelloni); 9 - Adjustment methodology issues (G. Palmiotti); C - Am-241 and fission product issues: 1 - Am-241 validation for criticality-safety calculations (A. Barnes - Visio

  7. High oleic sunflower biodiesel: quality control and different purification methods

    Directory of Open Access Journals (Sweden)

    Pighinelli, Anna L.M.T.

    2011-06-01

    Full Text Available The objective of the present work is to evaluate the production of biodiesel using ethanol and sunflower oil. The extraction of the sunflower oil was evaluated first. An experimental design was used to estimate the influence of the independent variables grain temperature (25º to 110ºC and expeller rotation (85 to 119rpm on the crude oil. The best result obtained was 68.38%, achieved with a rotation from 100 to 115rpm, grain temperature ranging from 25º to 30ºC and moisture content of around 7%. The next study consisted of transesterification, evaluating the influence of the ethanol, oil molar ratio and the catalyst concentration (sodium methylate on the ester-rich phase yield. The highest yield was 98.39% obtained with a molar ratio of 9:1 and 3% catalyst. An experiment was then carried out on a small reactor and the biodiesel produced was purified by three different methods: acidified water, silica and distillation. The quality aspects of the purified biodiesel samples were evaluated according to the Brazilian specifications for biodiesel, and distillation was shown to be the best method of purification.

    El objetivo del presente trabajo es evaluar la producción de biodiesel usando etanol y aceite de girasol. La extracción del aceite de girasol fue evaluada primero. Un diseño experimental fue usado para estimar la influencia de las variables independientes: temperatura del grano (25º a 110ºC y rotación del expeller (85 a 119 rpm en la obtención del aceite crudo. El mejor resultado obtenido fue un 68,38%, conseguido con una rotación de 100 a 115 rpm, una temperatura del grano de 25º a 30ºC y un contenido de humedad de alrededor del 7%. El siguiente estudio mediante transesterificación, evaluó la influencia de la relación molar etanol: aceite y concentración de catalizador (metilato sódico en el rendimiento de la fase rica en esteres. El rendimiento más alto fue 98,39% obtenido con una relación molar de 9.1 y 3% de

  8. Method and apparatus for high-efficiency direct contact condensation

    Science.gov (United States)

    Bharathan, Desikan; Parent, Yves; Hassani, A. Vahab

    1999-01-01

    A direct contact condenser having a downward vapor flow chamber and an upward vapor flow chamber, wherein each of the vapor flow chambers includes a plurality of cooling liquid supplying pipes and a vapor-liquid contact medium disposed thereunder to facilitate contact and direct heat exchange between the vapor and cooling liquid. The contact medium includes a plurality of sheets arranged to form vertical interleaved channels or passageways for the vapor and cooling liquid streams. The upward vapor flow chamber also includes a second set of cooling liquid supplying pipes disposed beneath the vapor-liquid contact medium which operate intermittently in response to a pressure differential within the upward vapor flow chamber. The condenser further includes separate wells for collecting condensate and cooling liquid from each of the vapor flow chambers. In alternate embodiments, the condenser includes a cross-current flow chamber and an upward flow chamber, a plurality of upward flow chambers, or a single upward flow chamber. The method of use of the direct contact condenser of this invention includes passing a vapor stream sequentially through the downward and upward vapor flow chambers, where the vapor is condensed as a result of heat exchange with the cooling liquid in the contact medium. The concentration of noncondensable gases in the resulting condensate-liquid mixtures can be minimized by controlling the partial pressure of the vapor, which depends in part upon the geometry of the vapor-liquid contact medium. In another aspect of this invention, the physical and chemical performance of a direct contact condenser can be predicted based on the vapor and coolant compositions, the condensation conditions. and the geometric properties of the contact medium.

  9. Fuel removing method for high burnup fuel and device therefor

    International Nuclear Information System (INIS)

    Terakado, Shogo; Owada, Isao; Kanno, Yoshio; Aizawa, Sakue; Yamahara, Takeshi.

    1993-01-01

    A through hole is perforated at the center of a fuel rod in a cladding tube by a diamond drill in a water vessel. Further, the through hole is enlarged by the diamond drill. A pellet removing tool is attached to a drill chuck instead of the diamond drill. Then, the thin cylindrical fuel pellet remaining on the inner surface of the cladding tube is removed by using a pellet removing tool while applying vibrations. Subsequently, a wire brush having a slightly larger diameter than that of the inner diameter of the cladding tube is attached to the drill chuck and rotated to finish the inner surface, so that a small amount of pellets remained on the inner surface of the cladding tube is removed. Pellet powders in the water vessel are collected and recovered to the water container. This can remove high burnup fuels which are firmly sticked to the cladding tube, without giving thermal or mechanical influences on the cladding tube. (I.N.)

  10. Survey of industry methods for producing highly reliable software

    International Nuclear Information System (INIS)

    Lawrence, J.D.; Persons, W.L.

    1994-11-01

    The Nuclear Reactor Regulation Office of the US Nuclear Regulatory Commission is charged with assessing the safety of new instrument and control designs for nuclear power plants which may use computer-based reactor protection systems. Lawrence Livermore National Laboratory has evaluated the latest techniques in software reliability for measurement, estimation, error detection, and prediction that can be used during the software life cycle as a means of risk assessment for reactor protection systems. One aspect of this task has been a survey of the software industry to collect information to help identify the design factors used to improve the reliability and safety of software. The intent was to discover what practices really work in industry and what design factors are used by industry to achieve highly reliable software. The results of the survey are documented in this report. Three companies participated in the survey: Computer Sciences Corporation, International Business Machines (Federal Systems Company), and TRW. Discussions were also held with NASA Software Engineering Lab/University of Maryland/CSC, and the AIAA Software Reliability Project

  11. Method of synthesis of abstract images with high self-similarity

    Science.gov (United States)

    Matveev, Nikolay V.; Shcheglov, Sergey A.; Romanova, Galina E.; Koneva, Ð.¢atiana A.

    2017-06-01

    Abstract images with high self-similarity could be used for drug-free stress therapy. This based on the fact that a complex visual environment has a high affective appraisal. To create such an image we can use the setup based on the three laser sources of small power and different colors (Red, Green, Blue), the image is the pattern resulting from the reflecting and refracting by the complicated form object placed into the laser ray paths. The images were obtained experimentally which showed the good therapy effect. However, to find and to choose the object which gives needed image structure is very difficult and requires many trials. The goal of the work is to develop a method and a procedure of finding the object form which if placed into the ray paths can provide the necessary structure of the image In fact the task means obtaining the necessary irradiance distribution on the given surface. Traditionally such problems are solved using the non-imaging optics methods. In the given case this task is very complicated because of the complicated structure of the illuminance distribution and its high non-linearity. Alternative way is to use the projected image of a mask with a given structure. We consider both ways and discuss how they can help to speed up the synthesis procedure for the given abstract image of the high self-similarity for the setups of drug-free therapy.

  12. Extraction method for high free radical scavenging activity of Siamese neem tree flowers

    Directory of Open Access Journals (Sweden)

    Worarat Chaisawangwong

    2009-10-01

    Full Text Available Siamese neem tree (Azadirachta indica A. Juss. var. siamensis Valeton is a medicinal plant found in Thailand. Youngleaves and young flowers of this plant are commonly consumed as a bitter tonic vegetable. The flowers are also used fortreatment of fever. The flower extract has been reported to exhibit in vitro free radical scavenging activity and can inhibitlipid peroxidation of bronchogenic cancer cell line. Active compounds in the flowers are flavonoids such as rutin andquercetin. The content of these compounds in the crude extract depends on the method of extraction. Therefore, the appropriateextraction method promoting high yield of total flavonoids and high free radical scavenging activity was investigated inthis study. Six different extraction methods, i.e. maceration, percolation, decoction, soxhlet extraction, ultrasonic extraction(UE, and microwave assisted extraction (MA were carried out for extracting dried powder of Siamese neem tree young flowers. The solvent used for maceration, percolation, and soxhlet extraction was 50% ethanol, while distilled water was used for decoction and MA, and both solvents were used for UE. The content of crude extract, free radical scavenging activity, and total flavonoids content of each extract were investigated and compared. Comparing the various extraction methods, decoction provided an extract containing a high amount of total flavonoids (17.54 mgRE/g extract and promoting the highest scavenging activity at EC50 11.36 g/ml. Decoction is also simple, cheap, and convenient and could be used in developing countries. Thus, it should be the recommended extraction method for the flowers of Siamese neem tree for furtherdevelopment of antioxidant pharmaceutical preparations.

  13. A fluorescence high throughput screening method for the detection of reactive electrophiles as potential skin sensitizers

    Energy Technology Data Exchange (ETDEWEB)

    Avonto, Cristina; Chittiboyina, Amar G. [National Center for Natural Products Research, Research Institute of Pharmaceutical Sciences, School of Pharmacy, The University of Mississippi, University, MS 38677 (United States); Rua, Diego [The Center for Food Safety and Applied Nutrition, US Food and Drug Administration, College Park, MD 20740 (United States); Khan, Ikhlas A., E-mail: ikhan@olemiss.edu [National Center for Natural Products Research, Research Institute of Pharmaceutical Sciences, School of Pharmacy, The University of Mississippi, University, MS 38677 (United States); Division of Pharmacognosy, Department of BioMolecular Sciences, School of Pharmacy, The University of Mississippi, University, MS 38677 (United States)

    2015-12-01

    Skin sensitization is an important toxicological end-point in the risk assessment of chemical allergens. Because of the complexity of the biological mechanisms associated with skin sensitization, integrated approaches combining different chemical, biological and in silico methods are recommended to replace conventional animal tests. Chemical methods are intended to characterize the potential of a sensitizer to induce earlier molecular initiating events. The presence of an electrophilic mechanistic domain is considered one of the essential chemical features to covalently bind to the biological target and induce further haptenation processes. Current in chemico assays rely on the quantification of unreacted model nucleophiles after incubation with the candidate sensitizer. In the current study, a new fluorescence-based method, ‘HTS-DCYA assay’, is proposed. The assay aims at the identification of reactive electrophiles based on their chemical reactivity toward a model fluorescent thiol. The reaction workflow enabled the development of a High Throughput Screening (HTS) method to directly quantify the reaction adducts. The reaction conditions have been optimized to minimize solubility issues, oxidative side reactions and increase the throughput of the assay while minimizing the reaction time, which are common issues with existing methods. Thirty-six chemicals previously classified with LLNA, DPRA or KeratinoSens™ were tested as a proof of concept. Preliminary results gave an estimated 82% accuracy, 78% sensitivity, 90% specificity, comparable to other in chemico methods such as Cys-DPRA. In addition to validated chemicals, six natural products were analyzed and a prediction of their sensitization potential is presented for the first time. - Highlights: • A novel fluorescence-based method to detect electrophilic sensitizers is proposed. • A model fluorescent thiol was used to directly quantify the reaction products. • A discussion of the reaction workflow

  14. A fluorescence high throughput screening method for the detection of reactive electrophiles as potential skin sensitizers

    International Nuclear Information System (INIS)

    Avonto, Cristina; Chittiboyina, Amar G.; Rua, Diego; Khan, Ikhlas A.

    2015-01-01

    Skin sensitization is an important toxicological end-point in the risk assessment of chemical allergens. Because of the complexity of the biological mechanisms associated with skin sensitization, integrated approaches combining different chemical, biological and in silico methods are recommended to replace conventional animal tests. Chemical methods are intended to characterize the potential of a sensitizer to induce earlier molecular initiating events. The presence of an electrophilic mechanistic domain is considered one of the essential chemical features to covalently bind to the biological target and induce further haptenation processes. Current in chemico assays rely on the quantification of unreacted model nucleophiles after incubation with the candidate sensitizer. In the current study, a new fluorescence-based method, ‘HTS-DCYA assay’, is proposed. The assay aims at the identification of reactive electrophiles based on their chemical reactivity toward a model fluorescent thiol. The reaction workflow enabled the development of a High Throughput Screening (HTS) method to directly quantify the reaction adducts. The reaction conditions have been optimized to minimize solubility issues, oxidative side reactions and increase the throughput of the assay while minimizing the reaction time, which are common issues with existing methods. Thirty-six chemicals previously classified with LLNA, DPRA or KeratinoSens™ were tested as a proof of concept. Preliminary results gave an estimated 82% accuracy, 78% sensitivity, 90% specificity, comparable to other in chemico methods such as Cys-DPRA. In addition to validated chemicals, six natural products were analyzed and a prediction of their sensitization potential is presented for the first time. - Highlights: • A novel fluorescence-based method to detect electrophilic sensitizers is proposed. • A model fluorescent thiol was used to directly quantify the reaction products. • A discussion of the reaction workflow

  15. A NEW HIGH RESOLUTION OPTICAL METHOD FOR OBTAINING THE TOPOGRAPHY OF FRACTURE SURFACES IN ROCKS

    Directory of Open Access Journals (Sweden)

    Steven Ogilvie

    2011-05-01

    Full Text Available Surface roughness plays a major role in the movement of fluids through fracture systems. Fracture surface profiling is necessary to tune the properties of numerical fractures required in fluid flow modelling to those of real rock fractures. This is achieved using a variety of (i mechanical and (ii optical techniques. Stylus profilometry is a popularly used mechanical method and can measure surface heights with high precision, but only gives a good horizontal resolution in one direction on the fracture plane. This method is also expensive and simultaneous coverage of the surface is not possible. Here, we describe the development of an optical method which images cast copies of rough rock fractures using in-house developed hardware and image analysis software (OptiProf™ that incorporates image improvement and noise suppression features. This technique images at high resolutions, 15-200 μm for imaged areas of 10 × 7.5 mm and 100 × 133 mm, respectively and a similar vertical resolution (15 μm for a maximum topography of 4 mm. It uses in-house developed hardware and image analysis (OptiProf™ software and is cheap and non-destructive, providing continuous coverage of the fracture surface. The fracture models are covered with dye and fluid thicknesses above the rough surfaces converted into topographies using the Lambert-Beer Law. The dye is calibrated using 2 devices with accurately known thickness; (i a polycarbonate tile with wells of different depths and (ii a wedge-shaped vial made from silica glass. The data from each of the two surfaces can be combined to provide an aperture map of the fracture for the scenario where the surfaces touch at a single point or any greater mean aperture. The topography and aperture maps are used to provide data for the generation of synthetic fractures, tuned to the original fracture and used in numerical flow modelling.

  16. A highly efficient nonchemical method for isolating live nematodes (Caenorhabditis elegans) from soil during toxicity assays.

    Science.gov (United States)

    Kim, Shin Woong; Moon, Jongmin; An, Youn-Joo

    2015-01-01

    The success of soil toxicity tests using Caenorhabditis elegans may depend in large part on recovering the organisms from the soil. However, it can be difficult to learn the International Organization for Standardization/ASTM International recovery process that uses the colloidal silica flotation method. The present study determined that a soil-agar isolation method provides a highly efficient and less technically demanding alternative to the colloidal silica flotation method. Test soil containing C. elegans was arranged on an agar plate in a donut shape, a linear shape, or a C curve; and microbial food was placed outside the soil to encourage the nematodes to leave the soil. The effects of ventilation and the presence of food on nematode recovery were tested to determine the optimal conditions for recovery. A linear arrangement of soil on an agar plate that was sprinkled with microbial food produced nearly 83% and 90% recovery of live nematodes over a 3-h and a 24-h period, respectively, without subjecting the nematodes to chemical stress. The method was tested using copper (II) chloride dihydrate, and the resulting recovery rate was comparable to that obtained using colloidal silica flotation. The soil-agar isolation method portrayed in the present study enables live nematodes to be isolated with minimal additional physicochemical stress, making it a valuable option for use in subsequent sublethal tests where live nematodes are required. © 2014 SETAC.

  17. A highly scalable massively parallel fast marching method for the Eikonal equation

    Science.gov (United States)

    Yang, Jianming; Stern, Frederick

    2017-03-01

    The fast marching method is a widely used numerical method for solving the Eikonal equation arising from a variety of scientific and engineering fields. It is long deemed inherently sequential and an efficient parallel algorithm applicable to large-scale practical applications is not available in the literature. In this study, we present a highly scalable massively parallel implementation of the fast marching method using a domain decomposition approach. Central to this algorithm is a novel restarted narrow band approach that coordinates the frequency of communications and the amount of computations extra to a sequential run for achieving an unprecedented parallel performance. Within each restart, the narrow band fast marching method is executed; simple synchronous local exchanges and global reductions are adopted for communicating updated data in the overlapping regions between neighboring subdomains and getting the latest front status, respectively. The independence of front characteristics is exploited through special data structures and augmented status tags to extract the masked parallelism within the fast marching method. The efficiency, flexibility, and applicability of the parallel algorithm are demonstrated through several examples. These problems are extensively tested on six grids with up to 1 billion points using different numbers of processes ranging from 1 to 65536. Remarkable parallel speedups are achieved using tens of thousands of processes. Detailed pseudo-codes for both the sequential and parallel algorithms are provided to illustrate the simplicity of the parallel implementation and its similarity to the sequential narrow band fast marching algorithm.

  18. The hands in metabolic skeletal diseases 1. A method of high-detailed contact radiography

    International Nuclear Information System (INIS)

    Shotemor, Sh.Sh.; Tret'yakov, A.E.

    1982-01-01

    A method of high-detailed contact radiography of the hands consists in the the screenless x-ray on the fine grained technical film employing microfocus with consecutive optical enlargement of the appearance. Various specimens of home-made tecinical film have been tried, the best results were obtained with the PT-5 film type (an opportunity of 7-fold optical magnification without interfering effect of the emulsion granularity). The method provides for a significant diagnostic advantage, affording to reveal minimal manifestations of subperiosteal, intracortical, and enosteal bone tissue resorption, as well as tiny calcinates in soft tissues. Pathological bone disorders were discovered in 63 out of 142 examined patients, suspected of metabolic diseases of the skeleton [ru

  19. Review of Congestion Management Methods for Distribution Networks with High Penetration of Distributed Energy Resources

    DEFF Research Database (Denmark)

    Huang, Shaojun; Wu, Qiuwei; Liu, Zhaoxi

    2014-01-01

    This paper reviews the existing congestion management methods for distribution networks with high penetration of DERs documented in the recent research literatures. The congestion management methods for distribution networks reviewed can be grouped into two categories – market methods and direct...... control methods. The market methods consist of dynamic tariff, distribution capacity market, shadow price and flexible service market. The direct control methods are comprised of network reconfiguration, reactive power control and active power control. Based on the review of the existing methods...

  20. Data analysis in high energy physics a practical guide to statistical methods

    CERN Document Server

    Behnke, Olaf; Kröninger, Kevin; Schott, Grégory; Schörner-Sadenius, Thomas

    2013-01-01

    This practical guide covers the most essential statistics-related tasks and problems encountered in high-energy physics data analyses. It addresses both advanced students entering the field of particle physics as well as researchers looking for a reliable source on optimal separation of signal and background, determining signals or estimating upper limits, correcting the data for detector effects and evaluating systematic uncertainties. Each chapter is dedicated to a single topic and supplemented by a substantial number of both paper and computer exercises related to real experiments, with the solutions provided at the end of the book along with references. A special feature of the book are the analysis walk-throughs used to illustrate the application of the methods discussed beforehand. The authors give examples of data analysis, referring to real problems in HEP, and display the different stages of data analysis in a descriptive manner. The accompanying website provides more algorithms as well as up-to-date...