WorldWideScience

Sample records for methods provide complementary

  1. JNC's experience of complementary accesses provided by the additional protocol

    International Nuclear Information System (INIS)

    Miura, Yasushi

    2001-01-01

    JNC (Japan Nuclear Cycle Development Institute) examined problems on implementation of the Additional Protocol to Japan/IAEA Safeguards Agreement with the Government of Japan and International Atomic Energy Agency through trials performed at Oarai Engineering Center before it entered into force. On December 16th 1999, the Additional Protocol entered into force, and in last January JNC provided the first JNC site information to STA. Then our Government provided it of all Japan to IAEA in last June. Also in this January, we sent the additional information changed from old one to MEXT (Ministry of Education, Culture, Sports, Science and Technology). The first Complementary Access of not only JNC but also Japan was implemented on JNC Ningyo-Toge Environmental Engineering Center on the end of last November. Since then, we have had over 10 times experience of Complementary Accesses for about one year especially on Tokai works and Ningyo-Toge. JNC's experience of Complementary Accesses will be introduced. (author)

  2. Complementary arsenic speciation methods: A review

    Energy Technology Data Exchange (ETDEWEB)

    Nearing, Michelle M., E-mail: michelle.nearing@rmc.ca; Koch, Iris, E-mail: koch-i@rmc.ca; Reimer, Kenneth J., E-mail: reimer-k@rmc.ca

    2014-09-01

    The toxicity of arsenic greatly depends on its chemical form and oxidation state (speciation) and therefore accurate determination of arsenic speciation is a crucial step in understanding its chemistry and potential risk. High performance liquid chromatography with inductively coupled mass spectrometry (HPLC–ICP-MS) is the most common analysis used for arsenic speciation but it has two major limitations: it relies on an extraction step (usually from a solid sample) that can be incomplete or alter the arsenic compounds; and it provides no structural information, relying on matching sample peaks to standard peaks. The use of additional analytical methods in a complementary manner introduces the ability to address these disadvantages. The use of X-ray absorption spectroscopy (XAS) with HPLC–ICP-MS can be used to identify compounds not extracted for HPLC–ICP-MS and provide minimal processing steps for solid state analysis that may help preserve labile compounds such as those containing arsenic-sulfur bonds, which can degrade under chromatographic conditions. On the other hand, HPLC–ICP-MS is essential in confirming organoarsenic compounds with similar white line energies seen by using XAS, and identifying trace arsenic compounds that are too low to be detected by XAS. The complementary use of electrospray mass spectrometry (ESI–MS) with HPLC–ICP-MS provides confirmation of arsenic compounds identified during the HPLC–ICP-MS analysis, identification of unknown compounds observed during the HPLC–ICP-MS analysis and further resolves HPLC–ICP-MS by identifying co-eluting compounds. In the complementary use of HPLC–ICP-MS and ESI–MS, HPLC–ICP-MS helps to focus the ESI–MS selection of ions. Numerous studies have shown that the information obtained from HPLC–ICP-MS analysis can be greatly enhanced by complementary approaches. - Highlights: • HPLC–ICP-MS is the most common method used for arsenic speciation. • HPLC limitations include

  3. Complementary arsenic speciation methods: A review

    International Nuclear Information System (INIS)

    Nearing, Michelle M.; Koch, Iris; Reimer, Kenneth J.

    2014-01-01

    The toxicity of arsenic greatly depends on its chemical form and oxidation state (speciation) and therefore accurate determination of arsenic speciation is a crucial step in understanding its chemistry and potential risk. High performance liquid chromatography with inductively coupled mass spectrometry (HPLC–ICP-MS) is the most common analysis used for arsenic speciation but it has two major limitations: it relies on an extraction step (usually from a solid sample) that can be incomplete or alter the arsenic compounds; and it provides no structural information, relying on matching sample peaks to standard peaks. The use of additional analytical methods in a complementary manner introduces the ability to address these disadvantages. The use of X-ray absorption spectroscopy (XAS) with HPLC–ICP-MS can be used to identify compounds not extracted for HPLC–ICP-MS and provide minimal processing steps for solid state analysis that may help preserve labile compounds such as those containing arsenic-sulfur bonds, which can degrade under chromatographic conditions. On the other hand, HPLC–ICP-MS is essential in confirming organoarsenic compounds with similar white line energies seen by using XAS, and identifying trace arsenic compounds that are too low to be detected by XAS. The complementary use of electrospray mass spectrometry (ESI–MS) with HPLC–ICP-MS provides confirmation of arsenic compounds identified during the HPLC–ICP-MS analysis, identification of unknown compounds observed during the HPLC–ICP-MS analysis and further resolves HPLC–ICP-MS by identifying co-eluting compounds. In the complementary use of HPLC–ICP-MS and ESI–MS, HPLC–ICP-MS helps to focus the ESI–MS selection of ions. Numerous studies have shown that the information obtained from HPLC–ICP-MS analysis can be greatly enhanced by complementary approaches. - Highlights: • HPLC–ICP-MS is the most common method used for arsenic speciation. • HPLC limitations include

  4. Optimizing Usability Studies by Complementary Evaluation Methods

    NARCIS (Netherlands)

    Schmettow, Martin; Bach, Cedric; Scapin, Dominique

    2014-01-01

    This paper examines combinations of complementary evaluation methods as a strategy for efficient usability problem discovery. A data set from an earlier study is re-analyzed, involving three evaluation methods applied to two virtual environment applications. Results of a mixed-effects logistic

  5. Complementary and conventional providers in cancer care: experience of communication with patients and steps to improve communication with other providers.

    Science.gov (United States)

    Stub, Trine; Quandt, Sara A; Arcury, Thomas A; Sandberg, Joanne C; Kristoffersen, Agnete E

    2017-06-08

    Effective interdisciplinary communication is important to achieve better quality in health care. The aims of this study were to compare conventional and complementary providers' experience of communication about complementary therapies and conventional medicine with their cancer patients, and to investigate how they experience interdisciplinary communication and cooperation. This study analyzed data from a self-administrated questionnaire. A total of 606 different health care providers, from four counties in Norway, completed the questionnaire. The survey was developed to describe aspects of the communication pattern among oncology doctors, nurses, family physicians and complementary therapists (acupuncturists, massage therapists and reflexologists/zone-therapists). Between-group differences were analyzed using chi-square, ANOVA and Fisher's exact tests. Significance level was defined as p communication with their cancer patients regarding complementary therapies. While complementary therapists advised their patients to apply both complementary and conventional modalities, medical doctors were less supportive of their patients' use of complementary therapies. Of conventional providers, nurses expressed more positive attitudes toward complementary therapies. Opportunities to improve communication between conventional and complementary providers were most strongly supported by complementary providers and nurses; medical doctors were less supportive of such attempts. A number of doctors showed lack of respect for complementary therapists, but asked for more research, guidelines for complementary modalities and training in conventional medicine for complementary therapists. For better quality of care, greater communication about complementary therapy use is needed between cancer patients and their conventional and complementary providers. In addition, more communication between conventional and complementary providers is needed. Nurses may have a crucial role in

  6. Complementary methods of transverse emittance measurement

    Energy Technology Data Exchange (ETDEWEB)

    Zagel, James; Hu, Martin; Jansson, Andreas; Thurman-Keup, Randy; Yan, Ming-Jen; /Fermilab

    2008-05-01

    Several complementary transverse emittance monitors have been developed and used at the Fermilab accelerator complex. These include Ionization profile Monitors (IPM), Flying Wires, Schottky detectors and a Synchrotron Light Monitor (Synchlite). Mechanical scrapers have also been used for calibration purposes. This paper describes the various measurement devices by examining their basic features, calibration requirements, systematic uncertainties, and applications to collider operation. A comparison of results from different kinds of measurements is also presented.

  7. Chinese Cyber Espionage: A Complementary Method to Aid PLA Modernization

    Science.gov (United States)

    2015-12-01

    COMPLEMENTARY METHOD TO AID PLA MODERNIZATION by Jamie M. Ellis December 2015 Thesis Advisor: Wade L. Huntley Second Reader: Christopher R. Twomey THIS...Master’s Thesis 4. TITLE AND SUBTITLE CHINESE CYBER ESPIONAGE: A COMPLEMENTARY METHOD TO AID PLA MODERNIZATION 5. FUNDING NUMBERS 6. AUTHOR(S) Jamie M...DISTRIBUTION CODE A 13. ABSTRACT (maximum 200 words) In 2013, Mandiant published a report linking one People’s Liberation Army ( PLA ) unit to the

  8. Talking about Complementary and Alternative Medicine with Your Health Care Providers: A Workbook and Tips

    Science.gov (United States)

    ... 422-6237) and mention the book title or inventory number (P042). Office of Cancer Complementary and Alternative ... Plus provides access to reliable health information, including articles, organizations, directories, and answers to health questions. Visit: ...

  9. Talking about Complementary and Alternative Medicine with your Health Care Provider: A workbook and tips

    Science.gov (United States)

    A workbook to help patients and doctors talk about the use of complementary and alternative medicine(CAM) during and after cancer care. Worksheets, tips, and resources are provided for patients and doctors to help track CAM use.

  10. Talking about Complementary and Alternative Medicine with Health Care Providers: A Workbook and Tips

    Science.gov (United States)

    A workbook to help patients and doctors talk about the use of complementary and alternative medicine(CAM) during and after cancer care. Worksheets, tips, and resources are provided for patients and doctors to help track CAM use.

  11. Talking about Complementary and Alternative Medicine with Health Care Provider: A Workbook and Tips

    Science.gov (United States)

    A workbook to help patients and doctors talk about the use of complementary and alternative medicine(CAM) during and after cancer care. Worksheets, tips, and resources are provided for patients and doctors to help track CAM use.

  12. Complementary and Alternative Medicine Methods in Chronic Renal Failure

    Directory of Open Access Journals (Sweden)

    Zeynep Erdogan

    2014-08-01

    Full Text Available Despite its long history, use of complementary and alternative medicine (CAM methods has increased dramatically only after 1990s. Up to 57% of patients with chronic renal use CAM methods.These patienys use CAM methods to overcome hypertension, fatigue, constipation, leg edema, pain, cramps, anxiety, depression, sleep disorders, to cope with symptoms such as itching, to stop the progression of kidney disease and to improve their quality of life. Methods used are herbal products and food supplements, acupressure, acupuncture, homeopathy, exercise, aromatherapy, yoga and reflexology. Nephrotoxic effect of several CAM therapies used in patients with renal impairment could disturb hemodynamics by reducing the glomerular filtration rate. For this reason, health care providers should question patients about used of CAM, methods. Communication with patients should be clear and should not act judgmental. Health care personnel should learn more about CAM methods in order to avoid unwanted situations that could develop after the application of CAM methods. Patients should be informed correctly and scientifically about these methods to avoid harmful and unnecessary uses. [Archives Medical Review Journal 2014; 23(4.000: 770-786

  13. Perception of risk and communication among conventional and complementary health care providers involving cancer patients' use of complementary therapies: a literature review.

    Science.gov (United States)

    Stub, Trine; Quandt, Sara A; Arcury, Thomas A; Sandberg, Joanne C; Kristoffersen, Agnete E; Musial, Frauke; Salamonsen, Anita

    2016-09-08

    Communication between different health care providers (conventional and complementary) and cancer patients about their use of complementary therapies affects the health and safety of the patients. The aim of this study was to examine the qualitative research literature on the perception of and communication about the risk of complementary therapies between different health care providers and cancer patients. Systematic searches in six medical databases covering literature from 2000 to 2015 were performed. The studies were accessed according to the level of evidence and summarized into different risk situations. Qualitative content analysis was used to analyze the text data, and the codes were defined before and during the data analysis. Twenty-nine papers were included in the primary analysis and five main themes were identified and discussed. The main risk situations identified were 1. Differences in treatment concepts and philosophical values among complementary and conventional health care providers. 2. Adverse effects from complementary products and herbs due to their contamination/toxicity and interactions with conventional cancer treatment. 3. Health care physicians and oncologists find it difficult to recommend many complementary modalities due to the lack of scientific evidence for their effect. 4. Lack of knowledge and information about complementary and conventional cancer treatments among different health care providers. The risk of consuming herbs and products containing high level of toxins is a considerable threat to patient safety (direct risk). At the same time, the lack of scientific evidence of effect for many complementary therapies and differences in treatment philosophy among complementary and conventional health care providers potentially hinder effective communication about these threats with mutual patients (indirect risk). As such, indirect risk may pose an additional risk to patients who want to combine complementary therapies with

  14. What Patients and Providers Want to Know About Complementary and Integrative Health Therapies.

    Science.gov (United States)

    Taylor, Stephanie L; Giannitrapani, Karleen F; Yuan, Anita; Marshall, Nell

    2018-01-01

    We conducted a quality improvement project to determine (1) what information providers and patients most wanted to learn about complementary and integrative health (CIH) therapies and (2) in what format they wanted to receive this information. The overall aim was to develop educational materials to facilitate the CIH therapy decision-making processes. We used mixed methods to iteratively pilot test and revise provider and patient educational materials on yoga and meditation. We conducted semistructured interviews with 11 medical providers and held seven focus groups and used feedback forms with 52 outpatients. We iteratively developed and tested three versions of both provider and patient materials. Activities were conducted at four Veterans Administration medical facilities (two large medical centers and two outpatient clinics). Patients want educational materials with clearly stated basic information about: (1) what mindfulness and yoga are, (2) what a yoga/meditation class entails and how classes can be modified to suit different abilities, (3) key benefits to health and wellness, and (4) how to find classes at the hospital/clinic. Diverse media (videos, handouts, pocket guides) appealed to different Veterans. Videos should depict patients speaking to patients and demonstrating the CIH therapy. Written materials should be one to three pages with colors, and images and messages targeting a variety of patients. Providers wanted a concise (one-page) sheet in black and white font with no images listing the scientific evidence for CIH therapies from high-impact journals, organized by either type of CIH or health condition to use during patient encounters, and including practical information about how to refer patients. Providers and patients want to learn more about CIH therapies, but want the information in succinct, targeted formats. The information learned and materials developed in this study can be used by others to educate patients and providers on CIH

  15. Multiple genetic interaction experiments provide complementary information useful for gene function prediction.

    Directory of Open Access Journals (Sweden)

    Magali Michaut

    Full Text Available Genetic interactions help map biological processes and their functional relationships. A genetic interaction is defined as a deviation from the expected phenotype when combining multiple genetic mutations. In Saccharomyces cerevisiae, most genetic interactions are measured under a single phenotype - growth rate in standard laboratory conditions. Recently genetic interactions have been collected under different phenotypic readouts and experimental conditions. How different are these networks and what can we learn from their differences? We conducted a systematic analysis of quantitative genetic interaction networks in yeast performed under different experimental conditions. We find that networks obtained using different phenotypic readouts, in different conditions and from different laboratories overlap less than expected and provide significant unique information. To exploit this information, we develop a novel method to combine individual genetic interaction data sets and show that the resulting network improves gene function prediction performance, demonstrating that individual networks provide complementary information. Our results support the notion that using diverse phenotypic readouts and experimental conditions will substantially increase the amount of gene function information produced by genetic interaction screens.

  16. Breaking Boundaries: Complementary and Alternative Medicine Provider Framing of Preventive Care.

    Science.gov (United States)

    Agarwal, Vinita

    2017-11-01

    This textual examination extends understandings of how complementary and alternative medicine (CAM) providers constitute preventive care in their discourse by identifying the frame of breaking boundaries referencing relational, structural, and philosophical orientations in their practice with their clients. Analysis of semistructured, in-depth interviews with CAM providers ( n = 17) reveals that the frame of breaking boundaries was comprised of three themes: finding one's own strength; I don't prescribe, so I'm exploring; and ground yourself, and have an escape route. The themes describe preventive care by identifying how CAM providers negotiate their relational positionality in connecting with clients, structural positionality within the field of health care, and philosophical positionality within the ontological understandings that guide how health is defined and conceptualized. The study contributes toward enhancing diverse understandings of constituting preventive care in practice and suggests pragmatic implications for addressing biomedical provider communication with their patients seeking CAM care alongside conventional treatments.

  17. Incentives and provider payment methods.

    Science.gov (United States)

    Barnum, H; Kutzin, J; Saxenian, H

    1995-01-01

    The mode of payment creates powerful incentives affecting provider behavior and the efficiency, equity and quality outcomes of health finance reforms. This article examines provider incentives as well as administrative costs, and institutional conditions for successful implementation associated with provider payment alternatives. The alternatives considered are budget reforms, capitation, fee-for-service, and case-based reimbursement. We conclude that competition, whether through a regulated private sector or within a public system, has the potential to improve the performance of any payment method. All methods generate both adverse and beneficial incentives. Systems with mixed forms of provider payment can provide tradeoffs to offset the disadvantages of individual modes. Low-income countries should avoid complex payment systems requiring higher levels of institutional development.

  18. Transport methods as complementary tools for speciation purposes

    International Nuclear Information System (INIS)

    Fourest, B.; Sladkov, V.

    2005-01-01

    Transport methods, and especially capillary electrophoresis, are shown to bring with a high simplicity and efficiently useful complementary data to solve some speciation problems. Their application in this aim is particularly interesting in the case of actinides or solutions resulting from the radioactive waste management. In the present article, three examples are proposed to illustrate this point. In the first one, the open-end capillary method is applied to point out the hydrolyzed species of Pa(V) over a wide pH range. The difficulties overcome in this case are related to the very low concentration and specific properties of the element under consideration. The second illustration concerns the complexation of uranyl by the anionic forms of some long-lived fission products (MO x n- , with M=I and Se). For the study of these systems, capillary electrophoresis appears to be a method particularly simple and efficient. The last example deals with the quantification of selenate and selenite ions in the presence of nitrate. Capillary electrophoresis is found to be especially appropriate to the simultaneous determination of these two anionic species in such media. (orig.)

  19. Microindentation as a complementary method for phase identification

    Science.gov (United States)

    Zupanič, Franc

    2011-12-01

    This work investigates the possibility of using microindentation as a complementary tool for phase identification, especially in heterogeneous microstructures. Five phases present in alloys Al64Cu23Fe13 and Al94Mn2Be2Cu2 were indented in the microindentation region. A load of 20 mN was found to be convenient for testing because it was too low to produce cracks around indents, yet high enough to avoid too large scattering of the results, occurring at smaller loads. It allowed testing of particles as small as 10 μm in the lateral direction and 3 μm in thickness. Some phases can be distinguished from others by specific characteristics of indentation curves. Otherwise, a single quantitative parameter or combinations of several indentation parameters (defined in EN ISO 14577-1) sufficed. The microindentation can considerably help by phase identification; however, a wider application will require a database, providing indentation properties for a particular phase at different loads and taking into account the indentation size effect.

  20. Behaviors of providers of traditional korean medicine therapy and complementary and alternative medicine therapy for the treatment of cancer patients.

    Science.gov (United States)

    Yu, Jun-Sang; Kim, Chun-Bae; Kim, Ki-Kyong; Lee, Ji-Eun; Kim, Min-Young

    2015-03-01

    In Korea, cancer is one of the most important causes of death. Cancer patients have sought alternative methods, like complementary and alternative medicine (CAM) together with Western medicine, to treat cancer. Also, there are many kinds of providers of CAM therapy, including providers of Korean oriental medicine therapy. The purpose of this study is to identify the behaviors of Korean oriental medicine therapy and CAM therapy providers who treat cancer patients and to provide background knowledge for establishing a new policy with the management and quality control of CAM. Structured and well organized questionnaires were made, and 350 persons were surveyed concerning the providers of CAM or Korean oriental medicine. The questionnaires were collected and analyzed. The questionnaires (182) were collected. The questionnaires identified a total of 73 known providers, such as medicinal professionals or other providers of CAM suppliers, 35.6% of whom had had experience with treating cancer patients (52.6% vs. 29.6%). The treatment methods were a little different: alternative therapy and nutritional therapy being preferred by medicinal professionals and mind body modulation therapy and alternative therapy being preferred by other CAM providers. Four patients (7.4%) experienced side effects, and 6 patients (12.5%) experienced legal problems. As the method for managing the therapy, CAM providers, medicinal professionals, and other CAM providers had different viewpoints. For example, some CAM providers stated that both legislation and an official education on CAM or a national examination were needed as a first step to establish the provider's qualifications and that as a second step, a license test was needed for quality control. To the contrary, medicinal professionals stated that a license test was needed before legislation. Adequate management and quality control of CAM providers is thought to involve both education and legislation.

  1. PUBLIC AND PRIVATE HIGHER EDUCATION INSTITUTIONS IN MALAYSIA: COMPETING, COMPLEMENTARY OR CROSSBREEDS AS EDUCATION PROVIDERS

    Directory of Open Access Journals (Sweden)

    Wan Chang Da

    2007-01-01

    Full Text Available Delivery of higher education used to be exclusive to the public sector in Malaysia. However, legislative changes made in 1996 led to the coexistence of public and private higher education institutions. In 2007, there were 20 public universities compared to more than 500 private institutions, of which 30 are currently categorised as universities or university colleges. Looking at their respective roles as higher education providers, public and private institutions display characteristics of being substitutes while at the same time serving complementary roles to one another. This dichotomy between public and private higher education institutions can, in fact, be seen as inclining towards a hybrid model that allows both to operate within a single system of higher education provision in the country. Such a hybrid model is evident in how the clientele is being divided between public and private higher institutions. It is also evident in the different roles played by the respective faculty members as well as in the programmes being made available in either type of institutions.

  2. Research methods in complementary and alternative medicine: an integrative review.

    Science.gov (United States)

    de Almeida Andrade, Fabiana; Schlechta Portella, Caio Fabio

    2018-01-01

    The scientific literature presents a modest amount of evidence in the use of complementary and alternative medicine (CAM). On the other hand, in practice, relevant results are common. The debates among CAM practitioners about the quality and execution of scientific research are important. Therefore, the aim of this review is to gather, synthesize and describe the differentiated methodological models that encompass the complexity of therapeutic interventions. The process of bringing evidence-based medicine into clinical practice in CAM is essential for the growth and strengthening of complementary medicines worldwide. Copyright © 2017 Shanghai Changhai Hospital. Published by Elsevier B.V. All rights reserved.

  3. Measures of phylogenetic differentiation provide robust and complementary insights into microbial communities.

    Science.gov (United States)

    Parks, Donovan H; Beiko, Robert G

    2013-01-01

    High-throughput sequencing techniques have made large-scale spatial and temporal surveys of microbial communities routine. Gaining insight into microbial diversity requires methods for effectively analyzing and visualizing these extensive data sets. Phylogenetic β-diversity measures address this challenge by allowing the relationship between large numbers of environmental samples to be explored using standard multivariate analysis techniques. Despite the success and widespread use of phylogenetic β-diversity measures, an extensive comparative analysis of these measures has not been performed. Here, we compare 39 measures of phylogenetic β diversity in order to establish the relative similarity of these measures along with key properties and performance characteristics. While many measures are highly correlated, those commonly used within microbial ecology were found to be distinct from those popular within classical ecology, and from the recently recommended Gower and Canberra measures. Many of the measures are surprisingly robust to different rootings of the gene tree, the choice of similarity threshold used to define operational taxonomic units, and the presence of outlying basal lineages. Measures differ considerably in their sensitivity to rare organisms, and the effectiveness of measures can vary substantially under alternative models of differentiation. Consequently, the depth of sequencing required to reveal underlying patterns of relationships between environmental samples depends on the selected measure. Our results demonstrate that using complementary measures of phylogenetic β diversity can further our understanding of how communities are phylogenetically differentiated. Open-source software implementing the phylogenetic β-diversity measures evaluated in this manuscript is available at http://kiwi.cs.dal.ca/Software/ExpressBetaDiversity.

  4. Disclosure of Complementary and Alternative Medicine to Conventional Medical Providers: Variation by Race/Ethnicity and Type of CAM

    Science.gov (United States)

    Chao, Maria T.; Wade, Christine; Kronenberg, Fredi

    2009-01-01

    Background Complementary and alternative medicine (CAM) is often used alongside conventional medical care, yet fewer than half of patients disclose CAM use to medical doctors. CAM disclosure is particularly low among racial/ethnic minorities, but reasons for differences, such as type of CAM used or quality of conventional healthcare, have not been explored. Objective We tested the hypotheses that disclosure of CAM use to medical doctors is higher for provider-based CAM and among non-Hispanic whites, and that access to and quality of conventional medical care account for racial/ethnic differences in CAM disclosure. Methods Bivariate and multiple variable analyses of the 2002 National Health Interview Survey and 2001 Health Care Quality Survey were performed. Results Disclosure of CAM use to medical providers was higher for provider-based than self-care CAM. Disclosure of any CAM was associated with access to and quality of conventional care and higher among non-Latino whites relative to minorities. Having a regular doctor and quality patient–provider relationship mitigated racial/ethnic differences in CAM disclosure. Conclusion Insufficient disclosure of CAM use to conventional providers, particularly for self-care practices and among minority populations, represents a serious challenge in medical encounter communications. Efforts to improve disclosure of CAM use should be aimed at improving consistency of care and patient–physician communication across racial/ethnic groups. PMID:19024232

  5. Complementary variational principle method applied to thermal conductivities of a plasma in a uniform magnetic field

    Energy Technology Data Exchange (ETDEWEB)

    Sehgal, A K; Gupta, S C [Punjabi Univ., Patiala (India). Dept. of Physics

    1982-12-14

    The complementary variational principles method (CVP) is applied to the thermal conductivities of a plasma in a uniform magnetic field. The results of computations show that the CVP derived results are very useful.

  6. Emergy and exergy analyses: Complementary methods or irreducible ideological options?

    International Nuclear Information System (INIS)

    Sciubba, Enrico; Ulgiati, Sergio

    2005-01-01

    The paper discusses the similarities and the incompatibilities between two forms of Energy Analysis (exergy and emergy, 'EXA' and 'EMA' in the following), both of which try to represent the behavior of physical systems by means of cumulative energy input/output methods that result in a double integration over space and time domains. Theoretical background, definitions and balance algebra are discussed first, in a 'statement-counterstatement' format that helps pinpointing differences and similarities. A significant, albeit simplified, benchmark case (ethanol production from corn) is used to compare the results and analytically assess the merits of each approach as well as possible synergic aspects. Corn production, transport and industrial conversion to ethanol are included in the analysis. First, mass balance and energy accounting are performed in each step of the process, then, exergy and emergy evaluations are carried out separately to lead to a set of performance indicators, the meaning of which is discussed with reference to their proper scale of application. The Authors underline that each method has its own preferred field of application and conclude that the two approaches appear to be characterized not much as different (and therefore competing) tools, but as different paradigms, whose meta-levels (their 'philosophies') substantially differ. In particular, EXA is found to provide the most correct and insightful assessment of thermodynamic features of any process and to offer a clear quantitative indication of both the irreversibilities and the degree of matching between the used resources and the end-use material or energy flows. EXA combined with costing considerations results in Thermo-Economics (TE), presently the best engineering method for System optimization. One of EXA recent extensions, Extended Exergy Accounting (EEA) includes all externalities in the exergy resource accounting, thus providing a more complete picture of how a process is interacting

  7. VALIDATION OF THE ASSR TEST THROUGH COMPLEMENTARY AUDIOLOGYICAL METHODS

    Directory of Open Access Journals (Sweden)

    C. Mârtu

    2016-04-01

    Full Text Available Introduction: Auditory Steady State Response (ASSR is an objective method for determining the auditive threshold, applicable and necessary especially in children. The test is extremely important for recommending cochlear implant in children. The aim of the study was to compare pure tone audiometry responses and auditory steady-state thresholds. Materials and method: The study was performed on a group including both patients with normal hearing and with hearing loss. The main inclusion criteria accepted only patients with normal otomicroscopic aspect, normal tympanogram, capable to respond to pure tone audiometry, and with ear conduction thresholds between 0 and 80 dB NHL. The patients with suppurative otic processes or ear malformations were excluded. The research protocol was followed, the tests being performed in soundproofed rooms, starting with pure tone audiometry followed, after a pause, by ASSR determinations at frequencies of 0.5, 1.2 and 4 KHz. The audiological instruments were provided by a single manufacturer. ASSR was recorded at least two times for both borderline intensities, namely the one defining the auditory threshold and the first no-response intensity. The recorded responses were stored in a database and further processed in Excel. Discussion: The differences observed between pure tone audiometry and ASSR thresholds are important at 500 Hz and insignificant at the other frequencies. When approaching the PTA-ASSR relation, whatever the main characteristic between the PTA and ASSR thresholds in one ear, the profile of the lines gap maintains the same shape on the opposite ear. Conclusions: ASSR is a confident objective test, maintaining attention to low frequencies, where some differences might occur.

  8. Designing, Teaching, and Evaluating Two Complementary Mixed Methods Research Courses

    Science.gov (United States)

    Christ, Thomas W.

    2009-01-01

    Teaching mixed methods research is difficult. This longitudinal explanatory study examined how two classes were designed, taught, and evaluated. Curriculum, Research, and Teaching (EDCS-606) and Mixed Methods Research (EDCS-780) used a research proposal generation process to highlight the importance of the purpose, research question and…

  9. Integrative health care method based on combined complementary ...

    African Journals Online (AJOL)

    Background: There are various models of health care, such as the ... sociological, economic, systemic of Neuman, cognitive medicine or ecological, ayurvedic, ... 2013, with a comprehensive approach in 64 patients using the clinical method.

  10. Critical insights into nuclear collectivity from complementary nuclear spectroscopic methods

    Science.gov (United States)

    Garrett, P. E.; Wood, J. L.; Yates, S. W.

    2018-06-01

    Low-energy collectivity of nuclei has been, and is being, characterized in a critical manner using data from a variety of spectroscopic methods, including Coulomb excitation, β decay, inelastic scattering of charged and uncharged particles, transfer reactions, etc. In addition to level energies and spins, transition multipolarities and intensities, lifetimes, and nuclear moments are available. The totality of information from these probes must be considered in achieving an accurate vision of the excitations in nuclei and determining the applicability of nuclear models. From these data, major changes in our view of low-energy collectivity in nuclei have emerged; most notable is the demise of the long-held view of low-energy quadrupole collectivity near closed shells as due to vibrations about a spherical equilibrium shape. In this contribution, we focus on the basic predictions of the spherical harmonic vibrator limit of the Bohr Hamiltonian. Properties such as B(E2) values, quadrupole moments, E0 strengths, etc are outlined. Using the predicted properties as a guide, evidence is cited for and against the existence of vibrational states, and especially multi-phonon states, in nuclei that are, or historically were considered to be, spherical or have a nearly spherical shape in their ground state. It is found that very few of the nuclei that were identified in the last major survey seeking nearly spherical harmonic vibrators satisfy the more stringent guidelines presented herein. Details of these fundamental shifts in our view of low-energy collectivity in nuclei are presented.

  11. PUBLIC AND PRIVATE HIGHER EDUCATION INSTITUTIONS IN MALAYSIA: COMPETING, COMPLEMENTARY OR CROSSBREEDS AS EDUCATION PROVIDERS

    OpenAIRE

    Wan Chang Da

    2007-01-01

    Delivery of higher education used to be exclusive to the public sector in Malaysia. However, legislative changes made in 1996 led to the coexistence of public and private higher education institutions. In 2007, there were 20 public universities compared to more than 500 private institutions, of which 30 are currently categorised as universities or university colleges. Looking at their respective roles as higher education providers, public and private institutions display characteristics of be...

  12. Why don't we ask? A complementary method for assessing the status of great apes.

    Directory of Open Access Journals (Sweden)

    Erik Meijaard

    Full Text Available Species conservation is difficult. Threats to species are typically high and immediate. Effective solutions for counteracting these threats, however, require synthesis of high quality evidence, appropriately targeted activities, typically costly implementation, and rapid re-evaluation and adaptation. Conservation management can be ineffective if there is insufficient understanding of the complex ecological, political, socio-cultural, and economic factors that underlie conservation threats. When information about these factors is incomplete, conservation managers may be unaware of the most urgent threats or unable to envision all consequences of potential management strategies. Conservation research aims to address the gap between what is known and what knowledge is needed for effective conservation. Such research, however, generally addresses a subset of the factors that underlie conservation threats, producing a limited, simplistic, and often biased view of complex, real world situations. A combination of approaches is required to provide the complete picture necessary to engage in effective conservation. Orangutan conservation (Pongo spp. offers an example: standard conservation assessments employ survey methods that focus on ecological variables, but do not usually address the socio-cultural factors that underlie threats. Here, we evaluate a complementary survey method based on interviews of nearly 7,000 people in 687 villages in Kalimantan, Indonesia. We address areas of potential methodological weakness in such surveys, including sampling and questionnaire design, respondent biases, statistical analyses, and sensitivity of resultant inferences. We show that interview-based surveys can provide cost-effective and statistically robust methods to better understand poorly known populations of species that are relatively easily identified by local people. Such surveys provide reasonably reliable estimates of relative presence and relative

  13. Microstructure evaluation of dermally applicable liquid crystals as a function of water content and temperature: Can electron paramagnetic resonance provide complementary data?

    Science.gov (United States)

    Matjaž, Mirjam Gosenca; Mravljak, Janez; Rogač, Marija Bešter; Šentjurc, Marjeta; Gašperlin, Mirjana; Pobirk, Alenka Zvonar

    2017-11-30

    Insight into the microstructure of lyotropic liquid crystals (LCs) is of crucial importance for development of novel dermal delivery systems. Our aim was to evaluate the phase behaviour of dermally applicable LCs composed of isopropyl myristate/Tween 80/lecithin/water, along the dilution line, where phase transitions are predominantly driven by increased water content. Additionally, identification of LC temperature dependence is of great importance for skin application. Selected LCs were evaluated using electron paramagnetic resonance (EPR) plus conventionally used methods of polarization microscopy, small-angle X-ray scattering, differential scanning calorimetry, and rheological measurements. Depending on water content, LCs formed diverse microstructures, from (pseudo)hexagonal (LC1) and lamellar (LC2-LC7) liquid crystalline phases that possibly co-exist with rod-like micelles (LC4-LC7), to a transitional micellar phase (LC8). Furthermore, the LCs microstructure remained unaltered within the tested temperature range. EPR was shown to detect microstructural transitions of LCs and to provide complementary data to other techniques. These data thus confirm the applicability of EPR as a complementary technique for better understanding of LC microstructural transitions that are expected to contribute greatly to studies oriented towards the drug release characteristics from such systems. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. A combination of small bowel imaging methods: conventional enteroclysis with complementary magnetic resonance enteroclysis

    Energy Technology Data Exchange (ETDEWEB)

    Akman, C. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Korman, U. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey)]. E-mail: ugurk9@istanbul.edu.tr; Oguet, G. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Kurugoglu, S. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Urger, E. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Ulus, S. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Esen, G. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Tasci, I. [Department of Surgery, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey)

    2005-07-01

    AIM: The aim of this prospective study was to evaluate the overall findings of conventional enteroclysis (CE) with complementary magnetic resonance enteroclysis (MRE) in small bowel disease. METHODS: The study included 32 patients referred from various clinical departments, with known or suspected small bowel disease and abnormalities on CE. Immediately after CE, true fast imaging with steady-state precession (true FISP), and unenhanced and gadolinium-enhanced T1-weighted fast low-angle shot (FLASH) sequences with fat saturation were obtained. Mucosal, mural and luminal changes of the small bowel were evaluated by each technique. In addition, bowel wall thickening, bowel wall enhancement and perienteric changes were assessed by MRE. The radiological findings obtained were evaluated together as a combination, and the role of MRE in the determination of the activity and complications of the small bowel disease was assessed. Radiological findings were correlated with clinical evaluation and follow-up in all cases, including endoscopy in 14 cases and surgery in 5 cases. RESULTS: MRE provided important supplementary mural and extramural information, including degree of pathological wall thickness, mural enhancement pattern associated with disease activity, perivisceral collection, abscess formation, mesenteric fibrofatty proliferation, lymphadenopathy and increase in perienteric vascularity. Short strictures were not revealed on MRE; however, for patients with a history of abdominal malignancy, MRE helped characterize the level of any obstruction and the extent of the disease. CONCLUSION: We recommend MRE for patients who have findings of advanced inflammatory bowel disease or neoplasm on CE examination. The combination of these two techniques can provide important information on the degree and extent of the disorder.

  15. Knowledge about food classification systems and value attributes provides insight for understanding complementary food choices in Mexican working mothers.

    Science.gov (United States)

    Rodriguez-Oliveros, Maria Guadalupe; Bisogni, Carole A; Frongillo, Edward A

    2014-12-01

    Knowledge about mothers' perceptions of food classification and values about complementary feeding is necessary for designing educational and food supply interventions targeted to young children. To determine classification, attributes, and consumption/preparation routines of key complementary foods, 44 mothers of children right for toddlers. Chicken liver was considered nutritious but dirty and bitter. Egg and fish were viewed as a vitamin source but potentially allergenic. Mothers valued vitamin content, flavor, and convenience of processed foods, but some were suspicious about expiration date, chemical and excessive sugar content and overall safety of these foods. Mothers' perceptions and values may differ from those of nutritionists and program designers, and should be addressed when promoting opportune introduction of complementary foods in social programs. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Quality control of roll-to-roll processed polymer solar modules by complementary imaging methods

    DEFF Research Database (Denmark)

    Rösch, R.; Krebs, Frederik C; Tanenbaum, D.M.

    2012-01-01

    We applied complementary imaging methods to investigate processing failures of roll-to-roll solution processed polymer solar modules based on polymer:fullerene bulk heterojunctions. For investigation of processing deficiencies in solar modules we employed dark lock-in thermography (DLIT......), electroluminescence (ELI) and photoluminescence/reflection imaging (PLI/RI) complemented by optical imaging (OI). The combination of all high resolution images allowed us to allocate the origin of processing errors to a specific deposition process, i.e. the insufficient coverage of an electrode interlayer...

  17. Legislation should support optimal breastfeeding practices and access to low-cost, high-quality complementary foods: Indonesia provides a case study.

    Science.gov (United States)

    Soekarjo, Damayanti; Zehner, Elizabeth

    2011-10-01

    It is important to support women to exclusively breastfeed for 6 months and continue breastfeeding for 24 months and beyond. It is also necessary to provide the poor with access to affordable ways to improve the quality of complementary foods. Currently, many countries do not have the legal and policy environment necessary to support exclusive and continued breastfeeding. Legislative and policy changes are also necessary for introducing complementary food supplements, allowing them to be marketed to those who need them, and ensuring that marketing remains appropriate and in full compliance with the International Code of Marketing of Breastmilk Substitutes. This paper aims to illustrate the above with examples from Indonesia and to identify legislative requirements for supporting breastfeeding and enabling appropriate access to high-quality complementary food supplements for children 6-24 months of age. Requirements include improved information, training, monitoring and enforcement systems for the International Code of Marketing of Breastmilk Substitutes; implementation and monitoring of the Baby-Friendly Hospital Initiative; establishment of a registration category for complementary food supplements to enhance availability of high-quality, low-cost fortified products to help improve young child feeding; clear identification and marketing of these products as complementary food supplements for 6-24-month-olds so as to promote proper use and not interfere with breastfeeding. © 2011 Blackwell Publishing Ltd.

  18. Estimation of land-surface evaporation at four forest sites across Japan with the new nonlinear complementary method

    DEFF Research Database (Denmark)

    Ai, Zhipin; Wang, Qinxue; Yang, Yonghui

    2017-01-01

    Evaporation from land surfaces is a critical component of the Earth water cycle and of water management strategies. The complementary method originally proposed by Bouchet, which describes a linear relation between actual evaporation (E), potential evaporation (Epo) and apparent potential...... evaporation (Epa) based on routinely measured weather data, is one of the various methods for evaporation calculation. This study evaluated the reformulated version of the original method, as proposed by Brutsaert, for forest land cover in Japan. The new complementary method is nonlinear and based on boundary...

  19. Transmuted Complementary Weibull Geometric Distribution

    Directory of Open Access Journals (Sweden)

    Ahmed Z. A…fify

    2014-12-01

    Full Text Available This paper provides a new generalization of the complementary Weibull geometric distribution that introduced by Tojeiro et al. (2014, using the quadratic rank transmutation map studied by Shaw and Buckley (2007. The new distribution is referred to as transmuted complementary Weibull geometric distribution (TCWGD. The TCWG distribution includes as special cases the complementary Weibull geometric distribution (CWGD, complementary exponential geometric distribution(CEGD,Weibull distribution (WD and exponential distribution (ED. Various structural properties of the new distribution including moments, quantiles, moment generating function and RØnyi entropy of the subject distribution are derived. We proposed the method of maximum likelihood for estimating the model parameters and obtain the observed information matrix. A real data set are used to compare the ‡exibility of the transmuted version versus the complementary Weibull geometric distribution.

  20. Using a mixed methods research design to investigate complementary alternative medicine (CAM) use among women with breast cancer in Ireland.

    Science.gov (United States)

    Fox, Patricia; Butler, Michelle; Coughlan, Barbara; Murray, Mary; Boland, Noreen; Hanan, Terry; Murphy, Hilary; Forrester, Pauline; O' Brien, Marie; O' Sullivan, Nollaig

    2013-08-01

    To investigate complementary and alternative medicine (CAM) use among women with breast cancer in Ireland using a mixed methods modified sequential explanatory design. Semi-structured interviews were conducted with oncology professionals (n = 20) and CAM practitioners (n = 20) and this was followed by a survey of 406 women with breast cancer using the 'Use of Complementary and Alternative Therapies Survey' questionnaire (UCATS) (Lengacher et al., 2003). Follow up interviews were subsequently undertaken with a subset of this survey sample (n = 31). Over half of those surveyed (55.7%, n = 226) used some form of CAM since diagnosis. The most frequently used therapies were massage, herbal supplements (including herbs with oestrogenic properties), antioxidants, relaxation, counselling, health supplements, reflexology, reiki and support groups. Dietary interventions were used primarily to reduce symptoms and/or side effects while reduction of psychological stress was the primary reason for use of stress-reducing therapies. Most respondents reported that the CAM therapies they had used were helpful. The qualitative data elaborated on and provided clarification of the survey results. Similar to international studies, CAM is popular among women with breast cancer in Ireland. As such, the challenge for Irish oncology professionals is to identify low risk CAM therapies that are likely to benefit patients while educating patients and themselves on therapies which may be of concern. This study clearly illustrates the benefits of using a mixed methods approach to enhance our understanding of a complex clinical issue and thus we recommend that this method should be the method of choice when planning health services research. Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. A Novel Complementary Method for the Point-Scan Nondestructive Tests Based on Lamb Waves

    Directory of Open Access Journals (Sweden)

    Rahim Gorgin

    2014-01-01

    Full Text Available This study presents a novel area-scan damage identification method based on Lamb waves which can be used as a complementary method for point-scan nondestructive techniques. The proposed technique is able to identify the most probable locations of damages prior to point-scan test which lead to decreasing the time and cost of inspection. The test-piece surface was partitioned with some smaller areas and the damage probability presence of each area was evaluated. A0 mode of Lamb wave was generated and collected using a mobile handmade transducer set at each area. Subsequently, a damage presence probability index (DPPI based on the energy of captured responses was defined for each area. The area with the highest DPPI value highlights the most probable locations of damages in test-piece. Point-scan nondestructive methods can then be used once these areas are found to identify the damage in detail. The approach was validated by predicting the most probable locations of representative damages including through-thickness hole and crack in aluminum plates. The obtained experimental results demonstrated the high potential of developed method in defining the most probable locations of damages in structures.

  2. Complementary and alternative medicine (CAM) providers' views of chronic low back pain patients' expectations of CAM therapies: a qualitative study.

    Science.gov (United States)

    Schafer, Lisa M; Hsu, Clarissa; Eaves, Emery Rose; Ritenbaugh, Cheryl; Turner, Judith; Cherkin, Daniel C; Sims, Colette; Sherman, Karen J

    2012-11-27

    Some researchers think that patients with higher expectations for CAM therapies experience better outcomes and that enthusiastic providers can enhance treatment outcomes. This is in contrast to evidence suggesting conventional medical providers often reorient patient expectations to better match what providers believe to be realistic. However, there is a paucity of research on CAM providers' views of their patients' expectations regarding CAM therapy and the role of these expectations in patient outcomes. To better understand how CAM providers view and respond to their patients' expectations of a particular therapy, we conducted 32 semi-structured, qualitative interviews with acupuncturists, chiropractors, massage therapists and yoga instructors identified through convenience sampling. Interviews were recorded, transcribed and analyzed thematically using Atlas ti version 6.1. CAM providers reported that they attempt to ensure that their patients' expectations are realistic. Providers indicated they manage their patients' expectations in a number of domains- roles and responsibilities of providers and patients, treatment outcomes, timeframe for improvement, and treatment experience. Providers reported that patients' expectations change over time and that they need to continually manage these expectations to enhance patient engagement and satisfaction with treatment. Providers of four types of CAM therapies viewed patients' expectations as an important component of their experiences with CAM therapy and indicated that they try to align patient expectations with reality. These findings suggest that CAM providers are similar in this respect to conventional medical providers.

  3. Use of provider-based complementary and alternative medicine by adult smokers in the United States: Comparison from the 2002 and 2007 NHIS survey.

    Science.gov (United States)

    Hamm, Eric; Muramoto, Myra L; Howerter, Amy; Floden, Lysbeth; Govindarajan, Lubna

    2014-01-01

    To provide a snapshot of provider-based complementary and alternative medicine (pbCAM) use among adult smokers and assess the opportunity for these providers to deliver tobacco cessation interventions. Cross-sectional analysis of data from the 2002 and 2007 National Health Interview Surveys. Nationally representative sample. A total of 54,437 (31,044 from 2002; 23,393 from 2007) adults 18 years and older. The analysis focuses on 10 types of pbCAM, including acupuncture, Ayurveda, biofeedback, chelation therapy, chiropractic care, energy therapy, folk medicine, hypnosis, massage, and naturopathy. The proportions of current smokers using any pbCAM as well as specific types of pbCAM in 2002 and 2007 are compared using SAS SURVEYLOGISTIC. Between 2002 and 2007, the percentage of recent users of any pbCAM therapy increased from 12.5% to 15.4% (p = .001). The largest increases occurred in massage, chiropractic, and acupuncture. Despite a decrease in the national average of current smokers (22.0% to 19.4%; p = .001), proportions of smokers within specific pbCAM disciplines remained consistent. Complementary and alternative medicine (CAM) practitioners, particularly those in chiropractic, acupuncture, and massage, represent new cohorts in the health care community to promote tobacco cessation. There is an opportunity to provide brief tobacco intervention training to CAM practitioners and engage them in public health efforts to reduce the burden of tobacco use in the United States.

  4. A critical review of benefits and limitations of magnetic resonance imaging as a complementary method in the diagnosis of fetal malformations

    Energy Technology Data Exchange (ETDEWEB)

    Ximenes, Renato Luis da Silveira; Ximenes, Andrea Regina da Silveira [Centrus - Centro de Ultra-Sonografia e Medicina Fetal de Campinas, Campinas, SP (Brazil); Szejnfeld, Jacob; Zanderigo, Valdir [Cura - Diagnostico e Imagem, Sao Paulo, SP (Brazil)

    2008-09-15

    Objective: The present study was aimed at evaluating by means of magnetic resonance imaging a series of fetuses with sonographic diagnosis of malformation, establishing the diagnostic benefits and limitations of fetal magnetic resonance imaging as compared with ultrasonography. Materials and methods: Forty women between 15-35 gestational weeks and previously diagnosed with fetal abnormality by ultrasonography were referred to undergo complementary fetal magnetic resonance imaging, particularly for evaluating abnormalities in the fetal central nervous system, thorax, abdomen, renal system, skeletal system, and tumors. The whole evaluation process included a review of the fetal ultrasonography and magnetic resonance images, postnatal follow-up, laboratory tests, imaging studies and necropsy. Results: The present study has demonstrated that complementary magnetic resonance imaging did provide further information in 60% of cases, with the following benefits: improved information on the fetus as a whole, with a large field of view, higher anatomic resolution provided by fast sequences, superior soft tissue contrast resolution, besides the fact that the visualization of the fetus is not significantly affected by maternal obesity or oligohydramnios. Limitations of the method include contraindication in the first gestational trimester and in cases of maternal claustrophobia, sensitivity to fetal motion, low sensitivity for detecting cardiovascular and skeletal malformations. Conclusion: Fetal magnetic resonance imaging plays a significant role as a complementary method for the diagnosis of fetal anomalies. (author)

  5. A critical review of benefits and limitations of magnetic resonance imaging as a complementary method in the diagnosis of fetal malformations

    International Nuclear Information System (INIS)

    Ximenes, Renato Luis da Silveira; Ximenes, Andrea Regina da Silveira; Szejnfeld, Jacob; Zanderigo, Valdir

    2008-01-01

    Objective: The present study was aimed at evaluating by means of magnetic resonance imaging a series of fetuses with sonographic diagnosis of malformation, establishing the diagnostic benefits and limitations of fetal magnetic resonance imaging as compared with ultrasonography. Materials and methods: Forty women between 15-35 gestational weeks and previously diagnosed with fetal abnormality by ultrasonography were referred to undergo complementary fetal magnetic resonance imaging, particularly for evaluating abnormalities in the fetal central nervous system, thorax, abdomen, renal system, skeletal system, and tumors. The whole evaluation process included a review of the fetal ultrasonography and magnetic resonance images, postnatal follow-up, laboratory tests, imaging studies and necropsy. Results: The present study has demonstrated that complementary magnetic resonance imaging did provide further information in 60% of cases, with the following benefits: improved information on the fetus as a whole, with a large field of view, higher anatomic resolution provided by fast sequences, superior soft tissue contrast resolution, besides the fact that the visualization of the fetus is not significantly affected by maternal obesity or oligohydramnios. Limitations of the method include contraindication in the first gestational trimester and in cases of maternal claustrophobia, sensitivity to fetal motion, low sensitivity for detecting cardiovascular and skeletal malformations. Conclusion: Fetal magnetic resonance imaging plays a significant role as a complementary method for the diagnosis of fetal anomalies. (author)

  6. Thermal Analysis: A Complementary Method to Study the Shurijeh Clay Minerals

    Directory of Open Access Journals (Sweden)

    Golnaz Jozanikohan

    2015-06-01

    Full Text Available Clay minerals are considered the most important components of clastic reservoir rock evaluation studies. The Shurijeh gas reservoir Formation, represented by shaly sandstones of the Late Jurassic-Early Cretaceous age, is the main reservoir rock in the Eastern Kopet-Dagh sedimentary Basin, NE Iran. In this study, X-ray diffraction (XRD, X-ray fluorescence (XRF, scanning electron microscopic (SEM studies, and thermal analysis including differential thermal analysis (DTA, and thermogravimetric analysis (TGA techniques were utilized in the characterization of the Shurijeh clay minerals in ten representative samples. The XRF studies showed that silica and aluminum oxides are present quantities. The XRD test was then used to determine the mineralogical composition of bulk components, as well as the clay fraction. The XRD patterns indicated the presence of dominant amount of quartz and plagioclase, with moderate to minor amounts of alkali feldspar, anhydrite, carbonates (calcite and dolomite, hematite and clay minerals. The most common clays in the Shurijeh Formation were illite, chlorite, and kaolinite. However, in very few samples, glauconite, smectite, and mixed layer clay minerals of both illite-smectite and chlorite-smectite types were also recognized. The XRD results were quantified, using the elemental information from the XRF test, showing that each Shurijeh exhibited low to moderate amounts of clay minerals, typically up to 21%. The amount of illite, the most dominant clay mineral, reached maximum of 13.5%, while the other clay types were significantly smaller. Based on the use of SEM and thermal data, the results of the identification of clay minerals, corresponded with the powder X-ray diffraction analysis, which can be taken into account as an evidence of the effectiveness of the thermal analysis technique in clay typing, as a complementary method besides the XRD.

  7. Which Domains of Thyroid-Related Quality of Life Are Most Relevant? Patients and Clinicians Provide Complementary Perspectives

    DEFF Research Database (Denmark)

    Watt, Torquil; Hegedüs, Laszlo; Rasmussen, Åse Krogh

    2007-01-01

    , 17 thyroid-associated ophthalmopathy, and 16 primary hypothyroidism) were interviewed. METHODS: The relevance of 138 thyroid disease-related issues was rated during interviews. For each issue, three relevance measures were obtained: a diagnosis-specific patient rating, a diagnosis-specific expert...

  8. Estimation of land-surface evaporation at four forest sites across Japan with the new nonlinear complementary method.

    Science.gov (United States)

    Ai, Zhipin; Wang, Qinxue; Yang, Yonghui; Manevski, Kiril; Zhao, Xin; Eer, Deni

    2017-12-19

    Evaporation from land surfaces is a critical component of the Earth water cycle and of water management strategies. The complementary method originally proposed by Bouchet, which describes a linear relation between actual evaporation (E), potential evaporation (E po ) and apparent potential evaporation (E pa ) based on routinely measured weather data, is one of the various methods for evaporation calculation. This study evaluated the reformulated version of the original method, as proposed by Brutsaert, for forest land cover in Japan. The new complementary method is nonlinear and based on boundary conditions with strictly physical considerations. The only unknown parameter (α e ) was for the first time determined for various forest covers located from north to south across Japan. The values of α e ranged from 0.94 to 1.10, with a mean value of 1.01. Furthermore, the calculated evaporation with the new method showed a good fit with the eddy-covariance measured values, with a determination coefficient of 0.78 and a mean bias of 4%. Evaluation results revealed that the new nonlinear complementary relation performs better than the original linear relation in describing the relationship between E/E pa and E po /E pa , and also in depicting the asymmetry variation between E pa /E po and E/E po .

  9. Knowledge about complementary, alternative and integrative medicine (CAM among registered health care providers in Swedish surgical care: a national survey among university hospitals

    Directory of Open Access Journals (Sweden)

    Bjerså Kristofer

    2012-04-01

    Full Text Available Abstract Background Previous studies show an increased interest and usage of complementary and alternative medicine (CAM in the general population and among health care workers both internationally and nationally. CAM usage is also reported to be common among surgical patients. Earlier international studies have reported that a large amount of surgical patients use it prior to and after surgery. Recent publications indicate a weak knowledge about CAM among health care workers. However the current situation in Sweden is unknown. The aim of this study was therefore to explore perceived knowledge about CAM among registered healthcare professions in surgical departments at Swedish university hospitals. Method A questionnaire was distributed to 1757 registered physicians, nurses and physiotherapists in surgical wards at the seven university hospitals in Sweden from spring 2010 to spring 2011. The questionnaire included classification of 21 therapies into conventional, complementary, alternative and integrative, and whether patients were recommended these therapies. Questions concerning knowledge, research, and patient communication about CAM were also included. Result A total of 737 (42.0% questionnaires were returned. Therapies classified as complementary; were massage, manual therapies, yoga and acupuncture. Alternative therapies; were herbal medicine, dietary supplements, homeopathy and healing. Classification to integrative therapy was low, and unfamiliar therapies were Bowen therapy, iridology and Rosen method. Therapies recommended by > 40% off the participants were massage and acupuncture. Knowledge and research about CAM was valued as minor or none at all by 95.7% respectively 99.2%. Importance of possessing knowledge about it was valued as important by 80.9%. It was believed by 61.2% that more research funding should be addressed to CAM research, 72.8% were interested in reading CAM-research results, and 27.8% would consider taking part in

  10. Experiences and meanings of integration of TCAM (Traditional, Complementary and Alternative Medical) providers in three Indian states: results from a cross-sectional, qualitative implementation research study.

    Science.gov (United States)

    Nambiar, D; Narayan, V V; Josyula, L K; Porter, J D H; Sathyanarayana, T N; Sheikh, K

    2014-11-25

    Efforts to engage Traditional, Complementary and Alternative Medical (TCAM) practitioners in the public health workforce have growing relevance for India's path to universal health coverage. We used an action-centred framework to understand how policy prescriptions related to integration were being implemented in three distinct Indian states. Health departments and district-level primary care facilities in the states of Kerala, Meghalaya and Delhi. In each state, two or three districts were chosen that represented a variation in accessibility and distribution across TCAM providers (eg, small or large proportions of local health practitioners, Homoeopaths, Ayurvedic and/or Unani practitioners). Per district, two blocks or geographical units were selected. TCAM and allopathic practitioners, administrators and representatives of the community at the district and state levels were chosen based on publicly available records from state and municipal authorities. A total of 196 interviews were carried out: 74 in Kerala, and 61 each in Delhi and Meghalaya. We sought to understand experiences and meanings associated with integration across stakeholders, as well as barriers and facilitators to implementing policies related to integration of Traditional, Complementary and Alternative (TCA) providers at the systems level. We found that individual and interpersonal attributes tended to facilitate integration, while system features and processes tended to hinder it. Collegiality, recognition of stature, as well as exercise of individual personal initiative among TCA practitioners and of personal experience of TCAM among allopaths enabled integration. The system, on the other hand, was characterised by the fragmentation of jurisdiction and facilities, intersystem isolation, lack of trust in and awareness of TCA systems, and inadequate infrastructure and resources for TCA service delivery. State-tailored strategies that routinise interaction, reward individual and system

  11. The Correlation between Providing Complementary Food and Breast-Feeding with the Growth and Development of Children under the Age of Five Years Old (6-24 months

    Directory of Open Access Journals (Sweden)

    Dwi Cahya Rahmadiyah

    2015-12-01

    Full Text Available A toddler is a group on the stage of human development that is vulnerable to the risk affecting their health specifically about their growth and development. Providing the appropriate nutrition to toddlers during this risky age of 6 to 24 months is crucial in promoting a proper growth and development. The proper nourishment for toddlers at the age of 6 to 24 months includes breast-feeding and complimentary solid foods. The objective of this study was to determine the correlation between the specific characteristics of a family or a household and the provision of complementary feeding about the growth and development of children (6-24 months in the village of Curug Cimanggis, Depok. This study used a descriptive correlational, cross-sectional approach using a sample that consisted of 102 children aged 6-24 months, which were collected using a proportional cluster sampling. Based on the Chi Square test, the researchers found no correlation between the provision of complementary feeding with a child’s growth and development. This is because breast-feeding as the source of nourishment is still the major factor that directly influences the growth and development of any toddler between the age of 6-24 months. However, by applying better financial management in conjunction with the ability to modify the practices of how families feed their toddlers, a family may raise and nurture their toddlers so they may grow according to the proper stages of development. The results of this study are expected to serve as an input in improving toddlers’ health care concerning their growth and development by promoting the importance of providing the appropriate complimentary food by the proper guidelines while continuing to breast feed toddlers between the age of 6 to 24 months.

  12. Knowledge about complementary, alternative and integrative medicine (CAM) among registered health care providers in Swedish surgical care: a national survey among university hospitals.

    Science.gov (United States)

    Bjerså, Kristofer; Stener Victorin, Elisabet; Fagevik Olsén, Monika

    2012-04-12

    Previous studies show an increased interest and usage of complementary and alternative medicine (CAM) in the general population and among health care workers both internationally and nationally. CAM usage is also reported to be common among surgical patients. Earlier international studies have reported that a large amount of surgical patients use it prior to and after surgery. Recent publications indicate a weak knowledge about CAM among health care workers. However the current situation in Sweden is unknown. The aim of this study was therefore to explore perceived knowledge about CAM among registered healthcare professions in surgical departments at Swedish university hospitals. A questionnaire was distributed to 1757 registered physicians, nurses and physiotherapists in surgical wards at the seven university hospitals in Sweden from spring 2010 to spring 2011. The questionnaire included classification of 21 therapies into conventional, complementary, alternative and integrative, and whether patients were recommended these therapies. Questions concerning knowledge, research, and patient communication about CAM were also included. A total of 737 (42.0%) questionnaires were returned. Therapies classified as complementary; were massage, manual therapies, yoga and acupuncture. Alternative therapies; were herbal medicine, dietary supplements, homeopathy and healing. Classification to integrative therapy was low, and unfamiliar therapies were Bowen therapy, iridology and Rosen method. Therapies recommended by > 40% off the participants were massage and acupuncture. Knowledge and research about CAM was valued as minor or none at all by 95.7% respectively 99.2%. Importance of possessing knowledge about it was valued as important by 80.9%. It was believed by 61.2% that more research funding should be addressed to CAM research, 72.8% were interested in reading CAM-research results, and 27.8% would consider taking part in such research. Half of the participants (55.8%) were

  13. Complementary Methods for the Characterization of Corrosion Products on a Plant-Exposed Superheater Tube

    DEFF Research Database (Denmark)

    Okoro, Sunday Chukwudi; Nießen, Frank; Villa, Matteo

    2017-01-01

    In this work, complex corrosion products on a superheater tube exposed to biomass firing were characterized by the complementary use of energy-dispersive synchrotron diffraction, electron microscopy, and energy-dispersive X-ray spectroscopy. Non-destructive synchrotron diffraction in transmission......-rich austenite phase to selective removal of Fe and Cr from the alloy, via a KCl-induced corrosion mechanism. Compositional variations were related to diffraction results and revealed a qualitative influence of the spinel cation concentration on the observed diffraction lines.......In this work, complex corrosion products on a superheater tube exposed to biomass firing were characterized by the complementary use of energy-dispersive synchrotron diffraction, electron microscopy, and energy-dispersive X-ray spectroscopy. Non-destructive synchrotron diffraction in transmission...... geometry measuring with a small gauge volume from the sample surface through the corrosion product allowed depth-resolved phase identification and revealed the presence of (Fe,Cr)2O3 and FeCr2O4. This was supplemented by microstructural and elemental analysis correlating the additional presence of a Ni...

  14. Determinants of use of care provided by complementary and alternative health care practitioners to pregnant women in primary midwifery care : A prospective cohort study

    NARCIS (Netherlands)

    Feijen-de Jong, Esther I.; Jansen, Danielle E. M. C.; Baarveld, Frank; Spelten, Evelien; Schellevis, Francois; Reijneveld, Sijmen A.

    2015-01-01

    Background: Pregnant women visit complementary/alternative health care practitioners in addition to regular maternal health care practitioners. A wide variation has been reported with regard to rates and determinants of use of complementary/alternative medicine (CAM), which may be due to

  15. Acupuncture as a Complementary Method of Traditional Psoriasis Treatment: Myth or Reality?

    Science.gov (United States)

    Mahović, Darija; Mrsić, Fanika

    2016-08-01

    Dear Editor, the practitioners of traditional Chinese medicine described psoriasis some 2000 years ago (1). Psoriasis vulgaris is a common, chronic inflammatory skin disease whose worldwide prevalence ranges from 0.1-3% (2,3). Understanding the role of the immune system in psoriasis and the interplay between the innate and adaptive immune system has helped to manage this complex disease, which affects patients far beyond the skin changes themselves (2). In addition to the usual and widely accepted methods of treatment of psoriasis, including topical therapies, phototherapy, and conventional and biological systemic therapies, data can be found in the literature that suggest a favorable effect of acupuncture on the course of psoriasis (4,5). Despite that, this complementary method of traditional treatment of various diseases is not yet widely accepted worldwide. According to the World Health Organization (WHO), acupuncture has been an officially recognized method of treatment for more than 50 diseases from 1979 (5). At the Department of Neurology at the University Hospital Center Zagreb, acupuncture has been used since 2011 for the treatment of various types of headaches, trigeminal neuralgia, and spinal pain syndromes. We report the case of a patient with a known history of psoriasis who was treated for chronic migraines with acupuncture. The 49-year-old female patient was examined for headache of a pulsating character that she had had for 16 years. The headache was mainly located on the left side of head and accompanied by nausea, vomiting, and both photophobia and phonophobia, and there was a worsening of symptoms upon exertion. The headaches were occurring once a week with an average duration of 2-3 continuous days. The patient also had frequent mild headaches. Additionally, the patient was diagnosed with psoriasis at the age of 29 and was occasionally treated with phototherapy. Systemic therapy for psoriasis had not been given to the patient thus far. After the

  16. MARKOWITZ' MODEL WITH FUNDAMENTAL AND TECHNICAL ANALYSIS – COMPLEMENTARY METHODS OR NOT

    Directory of Open Access Journals (Sweden)

    Branka Marasović

    2011-02-01

    Full Text Available As it is well known there are few “starting points” in portfolio optimization process, i.e. in the stock selection process. Famous Markowitz’ optimization model is unavoidable in this job. On the other side, someone may say that the indicators of the fundamental analysis must be the starting point. Beside that, the suggestions of the technical analysis must be taken into consideration. There are really numerous studies of the each approach separately, but it is almost impossible to find researches combining these approaches in logic and efficient unity. The main task of the paper is to find out if these approaches are complementary and if they are, how to apply them as efficient unit process. The empirical part of the study uses share sample from the Croatian stock market. Beside Markowitz’ MV model, fundamental and technical analysis, big role in the paper has an original multi-criterion approach.

  17. Complementary data on four methods for sampling free-living ticks in the Brazilian Pantanal

    Directory of Open Access Journals (Sweden)

    Vanessa do Nascimento Ramos

    2014-12-01

    Full Text Available In this study, four methods for sampling free-living ticks that are used in ecological and human tick-bite risk studies were evaluated. Cloth dragging, carbon dioxide traps and visual searches and inspection of plant litter on the ground were used in field and forest areas within the Brazilian Pantanal. Among the three tick species collected, Amblyomma sculptum predominated, followed by Amblyomma parvum and Amblyomma ovale. Dragging, a cheap and simple technique, yielded the highest numbers of ticks, particularly nymphs. The visual search detected a high number of adult ticks and provided information on tick questing height. Even though laborious, plant litter examination showed that large numbers of ticks may use this stratum. Carbon dioxide (CO2 traps are expensive and difficult to handle, but they are highly efficient for adult ticks, especially A. parvum. These data indicate that one method alone is incapable of providing a representative sample of the tick fauna in a particular area and that multiple techniques should be used for tick population studies.

  18. A comparison of alternative methods of calculating complementary cumulative distribution functions of health effects following an atmospheric radioactive release

    International Nuclear Information System (INIS)

    Ponting, A.C.; Nair, S.

    1984-04-01

    A concept extensively used in studying the consequences of accidental atmospheric radioactive releases is that of the Complementary Cumulative Distribution Function, CCDF. Various methods of calculating CCDFs have been developed with particular applications in putting degraded core accidents in perspective and in identifying release sequences leading to high risks. This note compares three methods with specific reference to their accuracy and computational efficiency. For two of the methods (that used in the US Reactor Safety Study code CRAC2 and extended version of that method), the effects of varying the sector width and considering site-specific population distributions have been determined. For the third method it is only necessary to consider the effects of site-specific population distributions. (author)

  19. Methods for providing intermediates in the synthesis of atorvastatin.

    NARCIS (Netherlands)

    Dömling, Alexander Stephan Siegfried

    2016-01-01

    The invention relates to the field of medicinal chemistry, In particular, it relates to methods for providing intermediates in the synthesis of Atorvastatin, a competitive inhibitor of HMG-Co A reductase. Provided is a process for providing a compound having a Formula (I) or a pharmaceutically

  20. Diverse landscapes have a higher abundance and species richness of spring wild bees by providing complementary floral resources over bees’ foraging periods

    Science.gov (United States)

    Landscape simplification and natural habitat loss can negatively affect wild bees. Alternatively, anthropogenic land-use change can potentially diversify landscapes to create complementary habitats that increase overall resource continuity and diversity. We examined the effects of landscape composit...

  1. Methods for reducing interference in the Complementary Learning Systems model: oscillating inhibition and autonomous memory rehearsal.

    Science.gov (United States)

    Norman, Kenneth A; Newman, Ehren L; Perotte, Adler J

    2005-11-01

    The stability-plasticity problem (i.e. how the brain incorporates new information into its model of the world, while at the same time preserving existing knowledge) has been at the forefront of computational memory research for several decades. In this paper, we critically evaluate how well the Complementary Learning Systems theory of hippocampo-cortical interactions addresses the stability-plasticity problem. We identify two major challenges for the model: Finding a learning algorithm for cortex and hippocampus that enacts selective strengthening of weak memories, and selective punishment of competing memories; and preventing catastrophic forgetting in the case of non-stationary environments (i.e. when items are temporarily removed from the training set). We then discuss potential solutions to these problems: First, we describe a recently developed learning algorithm that leverages neural oscillations to find weak parts of memories (so they can be strengthened) and strong competitors (so they can be punished), and we show how this algorithm outperforms other learning algorithms (CPCA Hebbian learning and Leabra at memorizing overlapping patterns. Second, we describe how autonomous re-activation of memories (separately in cortex and hippocampus) during REM sleep, coupled with the oscillating learning algorithm, can reduce the rate of forgetting of input patterns that are no longer present in the environment. We then present a simple demonstration of how this process can prevent catastrophic interference in an AB-AC learning paradigm.

  2. CT-based texture analysis potentially provides prognostic information complementary to interim fdg-pet for patients with hodgkin's and aggressive non-hodgkin's lymphomas

    International Nuclear Information System (INIS)

    Ganeshan, B.; Miles, K.A.; Shortman, R.; Afaq, A.; Ardeshna, K.M.; Groves, A.M.; Kayani, I.; Babikir, S.

    2017-01-01

    The purpose of this study was to investigate the ability of computed tomography texture analysis (CTTA) to provide additional prognostic information in patients with Hodgkin's lymphoma (HL) and high-grade non-Hodgkin's lymphoma (NHL). This retrospective, pilot-study approved by the IRB comprised 45 lymphoma patients undergoing routine 18F-FDG-PET-CT. Progression-free survival (PFS) was determined from clinical follow-up (mean-duration: 40 months; range: 10-62 months). Non-contrast-enhanced low-dose CT images were submitted to CTTA comprising image filtration to highlight features of different sizes followed by histogram-analysis using kurtosis. Prognostic value of CTTA was compared to PET FDG-uptake value, tumour-stage, tumour-bulk, lymphoma-type, treatment-regime, and interim FDG-PET (iPET) status using Kaplan-Meier analysis. Cox regression analysis determined the independence of significantly prognostic imaging and clinical features. A total of 27 patients had aggressive NHL and 18 had HL. Mean PFS was 48.5 months. There was no significant difference in pre-treatment CTTA between the lymphoma sub-types. Kaplan-Meier analysis found pre-treatment CTTA (medium feature scale, p=0.010) and iPET status (p<0.001) to be significant predictors of PFS. Cox analysis revealed that an interaction between pre-treatment CTTA and iPET status was the only independent predictor of PFS (HR: 25.5, 95% CI: 5.4-120, p<0.001). Specifically, pre-treatment CTTA risk stratified patients with negative iPET. CTTA can potentially provide prognostic information complementary to iPET for patients with HL and aggressive NHL. (orig.)

  3. Preferred delivery method and acceptability of Wheat-Soy Blend (WSB++) as a daily complementary food supplement in northwest Bangladesh.

    Science.gov (United States)

    Shamim, Abu Ahmed; Hanif, Abu A M; Merrill, Rebecca D; Campbell, Rebecca K; Kumkum, Mehnaz Alam; Shaikh, Saijuddin; de Pee, Saskia; Ahmed, Tahmeed; Parveen, Monira; Mehra, Sucheta; Klemm, Rolf D W; Labrique, Alain B; West, Keith P; Christian, Parul

    2015-01-01

    Fortified blended foods (FBFs) are widely used to prevent undernutrition in early childhood in food-insecure settings. We field tested enhanced Wheat Soy Blend (WSB++)-a FBF fortified with micronutrients, milk powder, sugar, and oil-in preparation for a complementary food supplement (CFS) trial in rural northwestern Bangladesh. Formative work was conducted to determine the optimal delivery method (cooked vs. not) for this CFS, to examine mothers' child feeding practices with and acceptance of the WSB++, and to identify potential barriers to adherence. Our results suggest WSB++ is an acceptable CFS in rural Bangladesh and the requirement for mothers to cook WSB++ at home is unlikely to be a barrier to its daily use as a CFS in this population.

  4. Efficient free energy calculations by combining two complementary tempering sampling methods.

    Science.gov (United States)

    Xie, Liangxu; Shen, Lin; Chen, Zhe-Ning; Yang, Mingjun

    2017-01-14

    Although energy barriers can be efficiently crossed in the reaction coordinate (RC) guided sampling, this type of method suffers from identification of the correct RCs or requirements of high dimensionality of the defined RCs for a given system. If only the approximate RCs with significant barriers are used in the simulations, hidden energy barriers with small to medium height would exist in other degrees of freedom (DOFs) relevant to the target process and consequently cause the problem of insufficient sampling. To address the sampling in this so-called hidden barrier situation, here we propose an effective approach to combine temperature accelerated molecular dynamics (TAMD), an efficient RC-guided sampling method, with the integrated tempering sampling (ITS), a generalized ensemble sampling method. In this combined ITS-TAMD method, the sampling along the major RCs with high energy barriers is guided by TAMD and the sampling of the rest of the DOFs with lower but not negligible barriers is enhanced by ITS. The performance of ITS-TAMD to three systems in the processes with hidden barriers has been examined. In comparison to the standalone TAMD or ITS approach, the present hybrid method shows three main improvements. (1) Sampling efficiency can be improved at least five times even if in the presence of hidden energy barriers. (2) The canonical distribution can be more accurately recovered, from which the thermodynamic properties along other collective variables can be computed correctly. (3) The robustness of the selection of major RCs suggests that the dimensionality of necessary RCs can be reduced. Our work shows more potential applications of the ITS-TAMD method as the efficient and powerful tool for the investigation of a broad range of interesting cases.

  5. Potato tuber proteomics: Comparison of two complementary extraction methods designed for 2-DE of acidic proteins

    NARCIS (Netherlands)

    Delaplace, P.; Wal, van der F.; Dierick, J.F.; Cordewener, J.H.G.; Fauconnier, M.L.; Jardin, du P.; America, A.H.P.

    2006-01-01

    Two protein extraction procedures were tested in order to remove interfering compounds prior to 2-DE of potato tubers. These methods using SDS lysis buffer and phenol-phase extraction were compared regarding the quality of the resulting 2-D gel. While the resolution of SDS extracts on

  6. A complementary marriage of perspectives: understanding organizational social context using mixed methods

    OpenAIRE

    Beidas, Rinad S; Wolk, Courtney L Benjamin; Walsh, Lucia M; Evans, Arthur C; Hurford, Matthew O; Barg, Frances K

    2014-01-01

    Background Organizational factors impact the delivery of mental health services in community settings. Mixed-methods analytic approaches have been recommended, though little research within implementation science has explicitly compared inductive and deductive perspectives to understand their relative value in understanding the same constructs. The purpose of our study is to use two different paradigmatic approaches to deepen our understanding of organizational social context. We accomplish t...

  7. Can qualitative and quantitative methods serve complementary purposes for policy research?

    OpenAIRE

    Maxwell, Daniel G.

    1998-01-01

    Qualitative and quantitative methods in social science research have long been separate spheres with little overlap. However, recent innovations have highlighted the complementarity of qualitative and quantitative approaches. The Accra Food and Nutrition Security Study was designed to incorporate the participation of a variety of constituencies in the research, and to rely on a variety of approaches — both qualitative and quantitative — to data collection and analysis. This paper reviews the ...

  8. Novel asymmetrically localizing components of human centrosomes identified by complementary proteomics methods

    DEFF Research Database (Denmark)

    Jakobsen, Lis; Vanselow, Katja; Skogs, Marie

    2011-01-01

    by identifying a novel set of five proteins preferentially associated with mother or daughter centrioles, comprising genes implicated in cell polarity. Pulsed labelling demonstrates a remarkable variation in the stability of centrosomal protein complexes. These spatiotemporal proteomics data provide leads......Centrosomes in animal cells are dynamic organelles with a proteinaceous matrix of pericentriolar material assembled around a pair of centrioles. They organize the microtubule cytoskeleton and the mitotic spindle apparatus. Mature centrioles are essential for biogenesis of primary cilia that mediate...

  9. Benzoic acid derivatives: Evaluation of thermochemical properties with complementary experimental and computational methods

    International Nuclear Information System (INIS)

    Verevkin, Sergey P.; Zaitsau, Dzmitry H.; Emeĺyanenko, Vladimir N.; Stepurko, Elena N.; Zherikova, Kseniya V.

    2015-01-01

    Highlights: • Vapor pressures of benzoic acid derivatives were measured. • Sublimation enthalpies were derived and compared with the literature. • Thermochemical data tested for consistency using additivity rules and computations. • Contradiction between available enthalpies of sublimation was resolved. • Pairwise interactions of substituents on the benzene ring were derived. - Abstract: Molar sublimation enthalpies of the methyl- and methoxybenzoic acids were derived from the transpiration method, static method, and TGA. Thermochemical data available in the literature were collected, evaluated, and combined with own experimental results. This collection together with the new experimental results reported here has helped to resolve contradictions in the available enthalpy data and to recommend sets of sublimation and formation enthalpies for the benzoic acid derivatives. Gas-phase enthalpies of formation calculated with the G4 quantum-chemical method were in agreement with the experiment. Pairwise interactions of the methyl, methoxy, and carboxyl substituents on the benzene ring were derived and used for the development of simple group-additivity procedures for estimation of the vaporization enthalpies, gas-phase, and liquid-phase enthalpies of formation of substituted benzenes.

  10. Benzoic acid derivatives: Evaluation of thermochemical properties with complementary experimental and computational methods

    Energy Technology Data Exchange (ETDEWEB)

    Verevkin, Sergey P., E-mail: sergey.verevkin@uni-rostock.de [Department of Physical Chemistry and Department “Science and Technology of Life, Light and Matter”, University of Rostock, D-18059 Rostock (Germany); Department of Physical Chemistry, Kazan Federal University, 420008 Kazan (Russian Federation); Zaitsau, Dzmitry H. [Department of Physical Chemistry, Kazan Federal University, 420008 Kazan (Russian Federation); Emeĺyanenko, Vladimir N. [Department of Physical Chemistry and Department “Science and Technology of Life, Light and Matter”, University of Rostock, D-18059 Rostock (Germany); Stepurko, Elena N. [Chemistry Faculty and Research Institute for Physical Chemical Problems, Belarusian State University, 220030 Minsk (Belarus); Zherikova, Kseniya V. [Nikolaev Institute of Inorganic Chemistry of Siberian Branch of Russian Academy of Sciences, 630090 Novosibirsk (Russian Federation)

    2015-12-20

    Highlights: • Vapor pressures of benzoic acid derivatives were measured. • Sublimation enthalpies were derived and compared with the literature. • Thermochemical data tested for consistency using additivity rules and computations. • Contradiction between available enthalpies of sublimation was resolved. • Pairwise interactions of substituents on the benzene ring were derived. - Abstract: Molar sublimation enthalpies of the methyl- and methoxybenzoic acids were derived from the transpiration method, static method, and TGA. Thermochemical data available in the literature were collected, evaluated, and combined with own experimental results. This collection together with the new experimental results reported here has helped to resolve contradictions in the available enthalpy data and to recommend sets of sublimation and formation enthalpies for the benzoic acid derivatives. Gas-phase enthalpies of formation calculated with the G4 quantum-chemical method were in agreement with the experiment. Pairwise interactions of the methyl, methoxy, and carboxyl substituents on the benzene ring were derived and used for the development of simple group-additivity procedures for estimation of the vaporization enthalpies, gas-phase, and liquid-phase enthalpies of formation of substituted benzenes.

  11. Complementary, alternative, and other noncomplete decongestive therapy treatment methods in the management of lymphedema: a systematic search and review.

    Science.gov (United States)

    Rodrick, Julia R; Poage, Ellen; Wanchai, Ausanee; Stewart, Bob R; Cormier, Janice N; Armer, Jane M

    2014-03-01

    (1) To provide a critical analysis of the contemporary published research that pertains to complementary, alternative, and other noncomplete decongestive therapies for treatment of lymphedema (LE), and (2) to provide practical applications of that evidence to improve care of patients with or at risk for LE. TYPE: This study meets the defining criteria as a systematic search and review because it includes varied study types. All studies that met the inclusion criteria were evaluated for weight of evidence and value. The systematic search and review includes articles published in the contemporary literature (2004-2012). Publications published from 2004-2011 were retrieved from 11 major medical indices by using search terms for LE and management approaches. Literature archives were examined through 2012. Data extraction included study design, objectives pertaining to LE, number and characteristics of participants, interventions, and outcomes. Study strengths and weaknesses were summarized. Study evidence was categorized according to the Oncology Nursing Society Putting Evidence into Practice level-of-evidence guidelines after achieving consensus among the authors. No authors participated in development of nor benefitted from the review of these modality methods or devices. Extracted data from 85 studies were reviewed in 4 subcategories: botanical, pharmaceutical, physical agent modality, and modalities of contemporary value. After review, 47 articles were excluded, which left 16 articles on botanicals and pharmaceuticals and 22 articles for physical agent modality and/or modalities of contemporary value. Pharmaceuticals were later excluded. The authors concluded that botanicals had generated sufficient studies to support a second, more specific systematic review; thus, botanicals are reported elsewhere. It was found that limited high-level evidence was available for all categories. Well-constructed randomized controlled trials related specifically to LE were limited

  12. A complementary marriage of perspectives: understanding organizational social context using mixed methods.

    Science.gov (United States)

    Beidas, Rinad S; Wolk, Courtney L Benjamin; Walsh, Lucia M; Evans, Arthur C; Hurford, Matthew O; Barg, Frances K

    2014-11-23

    Organizational factors impact the delivery of mental health services in community settings. Mixed-methods analytic approaches have been recommended, though little research within implementation science has explicitly compared inductive and deductive perspectives to understand their relative value in understanding the same constructs. The purpose of our study is to use two different paradigmatic approaches to deepen our understanding of organizational social context. We accomplish this by using a mixed-methods approach in an investigation of organizational social context in community mental health clinics. Nineteen agencies, representing 23 sites, participated. Enrolled participants included 130 therapists, 36 supervisors, and 22 executive administrators. Quantitative data was obtained via the Organizational Social Context (OSC) measure. Qualitative data, comprised of direct observation with spot sampling generated from agency visits, was coded using content analysis and grounded theory. The present study examined elements of organizational social context that would have been missed if only quantitative data had been obtained and utilized mixed methods to investigate if stratifying observations based on quantitative ratings from the OSC resulted in the emergence of differential themes. Four of the six OSC constructs were commonly observed in field observations (i.e., proficiency, rigidity, functionality, stress), while the remaining two constructs were not frequently observed (i.e., resistance, engagement). Constructs emerged related to organizational social context that may have been missed if only quantitative measurement was employed, including those around the physical environment, commentary about evidence-based practice initiatives, leadership, cultural diversity, distrust, and affect. Stratifying agencies by "best," "average," and "worst" organizational social context impacted interpretation for three constructs (affect, stress, and leadership). Results

  13. Coherent states with classical motion: from an analytic method complementary to group theory

    International Nuclear Information System (INIS)

    Nieto, M.M.

    1982-01-01

    From the motivation of Schroedinger, that of finding states which follow the motion which a classical particle would have in a given potential, we discuss generalizations of the coherent states of the harmonic oscillator. We focus on a method which is the analytic complement to the group theory point of view. It uses a minimum uncertainty formalism as its basis. We discuss the properties and time evolution of these states, always keeping in mind the desire to find quantum states which follow the classical motion

  14. Method for providing uranium with a protective copper coating

    Science.gov (United States)

    Waldrop, Forrest B.; Jones, Edward

    1981-01-01

    The present invention is directed to a method for providing uranium metal with a protective coating of copper. Uranium metal is subjected to a conventional cleaning operation wherein oxides and other surface contaminants are removed, followed by etching and pickling operations. The copper coating is provided by first electrodepositing a thin and relatively porous flash layer of copper on the uranium in a copper cyanide bath. The resulting copper-layered article is then heated in an air or inert atmosphere to volatilize and drive off the volatile material underlying the copper flash layer. After the heating step an adherent and essentially non-porous layer of copper is electro-deposited on the flash layer of copper to provide an adherent, multi-layer copper coating which is essentially impervious to corrosion by most gases.

  15. System and Method for Providing a Climate Data Persistence Service

    Science.gov (United States)

    Schnase, John L. (Inventor); Ripley, III, William David (Inventor); Duffy, Daniel Q. (Inventor); Thompson, John H. (Inventor); Strong, Savannah L. (Inventor); McInerney, Mark (Inventor); Sinno, Scott (Inventor); Tamkin, Glenn S. (Inventor); Nadeau, Denis (Inventor)

    2018-01-01

    A system, method and computer-readable storage devices for providing a climate data persistence service. A system configured to provide the service can include a climate data server that performs data and metadata storage and management functions for climate data objects, a compute-storage platform that provides the resources needed to support a climate data server, provisioning software that allows climate data server instances to be deployed as virtual climate data servers in a cloud computing environment, and a service interface, wherein persistence service capabilities are invoked by software applications running on a client device. The climate data objects can be in various formats, such as International Organization for Standards (ISO) Open Archival Information System (OAIS) Reference Model Submission Information Packages, Archive Information Packages, and Dissemination Information Packages. The climate data server can enable scalable, federated storage, management, discovery, and access, and can be tailored for particular use cases.

  16. Particle induced X-ray emission and complementary nuclear methods for trace element determination; Plenary lecture

    Energy Technology Data Exchange (ETDEWEB)

    Johansson, S A.E. [Lund Univ. (Sweden). Dept. of Nuclear Physics

    1992-03-01

    In this review the state-of-the-art of particle induced X-ray emission (PIXE) methods for the determination of trace elements is described. The developmental work has mostly been carried out in nuclear physics laboratories, where accelerators are available, but now the increased interest has led to the establishment of other dedicated PIXE facilities. The reason for this interest is the versatility, high sensitivity and multi-element capability of PIXE analysis. A further very important advantage is that PIXE can be combined with the microbeam technique, which makes elemental mapping with a spatial resolution of about 1 {mu}m possible. As a technique, PIXE can also be combined with other nuclear reactions such as elastic scattering and particle-induced gamma emission, so that light elements can be determined. The usefulness of PIXE is illustrated by a number of typical applications in biology, medicine, geology, air pollution research, archaeology and the arts. (author).

  17. Video-lectures: An effective complementary teaching method at business college

    Directory of Open Access Journals (Sweden)

    Jaka Vadnjal

    2017-05-01

    Full Text Available A new teaching methodology was tested at a private college, which delivers business studyprograms on the undergraduate and graduate level. The combination of video-lectures with live classactivities (discussions, case study solving was used in the course which provides studentscompetences for managing growing small and medium-sized business. Full- and part-time studentsparticipated in the two separated classes with identical study program and the same methodologicalapproach was applied to assess the teaching approach. The main objective of the study was toexamine the possible differences between the two groups of studies. In total 126 students participatedin the study and the data collection was done with a survey. Several statistically significantdifferences were revealed. The most important finding is that part-time students were much lessenthusiastic for the delivered teaching approach. It looks like they appreciated more the liveinteraction with other students and with the teacher and probably saw the opportunity of activeparticipation as the main added value of the studies. The implication of the study is that coursedesign, which includes video, should carefully take into account the two types of students addressed.

  18. Power Doppler Ultrasonography and Shear Wave Elastography as Complementary Imaging Methods for Suspected Local Breast Cancer Recurrence.

    Science.gov (United States)

    Jales, Rodrigo Menezes; Dória, Maira Teixeira; Serra, Kátia Piton; Miranda, Mila Meneguelli; Menossi, Carlos Alberto; Schumacher, Klaus; Sarian, Luis Otávio

    2018-06-01

    To prospectively investigate the diagnostic accuracy and clinical consequences of power Doppler morphologic criteria and shear wave elastography (SWE) as complementary imaging methods for evaluation of suspected local breast cancer recurrence in the ipsilateral breast or chest wall. Thirty-two breast masses with a suspicion of local breast cancer recurrence on B-mode ultrasonography underwent complementary power Doppler and SWE evaluations. Power Doppler morphologic criteria were classified as avascular, hypovascular, or hypervascular. Shear wave elastography was classified according to a 5-point scale (SWE score) and SWE maximum elasticity. Diagnostic accuracy was assessed by the sensitivity, specificity, and area under the curve. A decision curve analysis assessed clinical consequences of each method. The reference standard for diagnosis was defined as core needle or excisional biopsy. Histopathologic examinations revealed 9 (28.2%) benign and 23 (71.8%) malignant cases. Power Doppler ultrasonography (US) had sensitivity of 34.8% (95% confidence interval [CI], 6.6%-62.9%) and specificity of 45.4% (95% CI, 19.3%-71.5%). The SWE score (≥3) had sensitivity of 87.0% (95% CI, 66.4%-97.2%) and specificity of 44.4% (95% CI, 13.7%-78.8%). The SWE maximum elasticity (velocity > 6.5cm/s) had sensitivity of 87% (95% CI, 66.4%-97.2%) and specificity of 77.8% (95% CI, 40.0% to 97.2%). The areas under the curves for the SWE score and SWE maximum elasticity were 0.71 (95% CI, 0.53-0.87) and 0.82 (95% CI, 0.64-0.93), respectively (P = .32). Power Doppler US is unsuitable for discrimination between local breast cancer recurrence and fibrosis. Although the SWE score and SWE maximum elasticity can make this discrimination, the use of these methods to determine biopsy may lead to poorer clinical outcomes than the current practice of performing biopsies of all suspicious masses. © 2017 by the American Institute of Ultrasound in Medicine.

  19. Method for Providing Semiconductors Having Self-Aligned Ion Implant

    Science.gov (United States)

    Neudeck, Philip G. (Inventor)

    2014-01-01

    A method is disclosed that provides a self-aligned nitrogen-implant particularly suited for a Junction Field Effect Transistor (JFET) semiconductor device preferably comprised of a silicon carbide (SiC). This self-aligned nitrogen-implant allows for the realization of durable and stable electrical functionality of high temperature transistors such as JFETs. The method implements the self-aligned nitrogen-implant having predetermined dimensions, at a particular step in the fabrication process, so that the SiC junction field effect transistors are capable of being electrically operating continuously at 500.degree. C. for over 10,000 hours in an air ambient with less than a 10% change in operational transistor parameters.

  20. Method for providing a low density high strength polyurethane foam

    Science.gov (United States)

    Whinnery, Jr., Leroy L.; Goods, Steven H.; Skala, Dawn M.; Henderson, Craig C.; Keifer, Patrick N.

    2013-06-18

    Disclosed is a method for making a polyurethane closed-cell foam material exhibiting a bulk density below 4 lbs/ft.sup.3 and high strength. The present embodiment uses the reaction product of a modified MDI and a sucrose/glycerine based polyether polyol resin wherein a small measured quantity of the polyol resin is "pre-reacted" with a larger quantity of the isocyanate in a defined ratio such that when the necessary remaining quantity of the polyol resin is added to the "pre-reacted" resin together with a tertiary amine catalyst and water as a blowing agent, the polymerization proceeds slowly enough to provide a stable foam body.

  1. Complementary methods to estimate population size of Antillean Manatees (Sirenia: Trichechidae at Cienaga de Paredes, Santander, Colombia

    Directory of Open Access Journals (Sweden)

    G.K. Arevalo-Gonzalez

    2014-06-01

    Full Text Available Information on manatee population size in Colombia is limited. This study was aimed at determining manatee population size in the Cienaga de Paredes (Colombia by three different methods: boat-based surveys, side-scan Sonar (SSS surveys and local interviews. Manatees were counted during breathing events by direct observation during the dry season, with the number of sightings per hour (NSH and maximum number of simultaneous sightings (MNSS used as occurrence indices. In 2002, we obtained an average NSH of 27.62 (SD=12.34 and the MNSS was 18; in 2010 the values were 55.71 (SD=29.79 and four respectively. Using linear-transect SSS data we estimated a population size of 12 individuals (%CV=27.3. The local community claimed that no hunting or entanglements had taken place in the area for over 20 years. These methods have pros and cons in terms of investment, effort, efficiency and community involvement, and their efficiency may vary in different seasons. Applying them in a complementary way and at greater spatial and temporal scales could enhance the accuracy of results.

  2. HIGH-PRECISION ATTITUDE ESTIMATION METHOD OF STAR SENSORS AND GYRO BASED ON COMPLEMENTARY FILTER AND UNSCENTED KALMAN FILTER

    Directory of Open Access Journals (Sweden)

    C. Guo

    2017-07-01

    Full Text Available Determining the attitude of satellite at the time of imaging then establishing the mathematical relationship between image points and ground points is essential in high-resolution remote sensing image mapping. Star tracker is insensitive to the high frequency attitude variation due to the measure noise and satellite jitter, but the low frequency attitude motion can be determined with high accuracy. Gyro, as a short-term reference to the satellite’s attitude, is sensitive to high frequency attitude change, but due to the existence of gyro drift and integral error, the attitude determination error increases with time. Based on the opposite noise frequency characteristics of two kinds of attitude sensors, this paper proposes an on-orbit attitude estimation method of star sensors and gyro based on Complementary Filter (CF and Unscented Kalman Filter (UKF. In this study, the principle and implementation of the proposed method are described. First, gyro attitude quaternions are acquired based on the attitude kinematics equation. An attitude information fusion method is then introduced, which applies high-pass filtering and low-pass filtering to the gyro and star tracker, respectively. Second, the attitude fusion data based on CF are introduced as the observed values of UKF system in the process of measurement updating. The accuracy and effectiveness of the method are validated based on the simulated sensors attitude data. The obtained results indicate that the proposed method can suppress the gyro drift and measure noise of attitude sensors, improving the accuracy of the attitude determination significantly, comparing with the simulated on-orbit attitude and the attitude estimation results of the UKF defined by the same simulation parameters.

  3. Complementary role of critical integral experiment and power reactor start-up experiments for LMFBR neutronics data and method validation

    International Nuclear Information System (INIS)

    Salvatores, M.

    1986-09-01

    Both critical experiments and power reactor results play at present a complementary role in reducing the uncertainties in Key design parameters for LMFBR, which can be relevant for the economic performances of this type of reactors

  4. Two-Level Chebyshev Filter Based Complementary Subspace Method: Pushing the Envelope of Large-Scale Electronic Structure Calculations.

    Science.gov (United States)

    Banerjee, Amartya S; Lin, Lin; Suryanarayana, Phanish; Yang, Chao; Pask, John E

    2018-06-12

    We describe a novel iterative strategy for Kohn-Sham density functional theory calculations aimed at large systems (>1,000 electrons), applicable to metals and insulators alike. In lieu of explicit diagonalization of the Kohn-Sham Hamiltonian on every self-consistent field (SCF) iteration, we employ a two-level Chebyshev polynomial filter based complementary subspace strategy to (1) compute a set of vectors that span the occupied subspace of the Hamiltonian; (2) reduce subspace diagonalization to just partially occupied states; and (3) obtain those states in an efficient, scalable manner via an inner Chebyshev filter iteration. By reducing the necessary computation to just partially occupied states and obtaining these through an inner Chebyshev iteration, our approach reduces the cost of large metallic calculations significantly, while eliminating subspace diagonalization for insulating systems altogether. We describe the implementation of the method within the framework of the discontinuous Galerkin (DG) electronic structure method and show that this results in a computational scheme that can effectively tackle bulk and nano systems containing tens of thousands of electrons, with chemical accuracy, within a few minutes or less of wall clock time per SCF iteration on large-scale computing platforms. We anticipate that our method will be instrumental in pushing the envelope of large-scale ab initio molecular dynamics. As a demonstration of this, we simulate a bulk silicon system containing 8,000 atoms at finite temperature, and obtain an average SCF step wall time of 51 s on 34,560 processors; thus allowing us to carry out 1.0 ps of ab initio molecular dynamics in approximately 28 h (of wall time).

  5. The complementary use of radioanalytical methods and trace analysis methods for the characterisation of environmental IAEA reference materials

    International Nuclear Information System (INIS)

    De Regge, P.; Burns, K.; Campbell, M.; Makarewicz, M.; Markowicz, A.; Mattiuzzi, M.; Tajani, A.; Toervenyi, A.; Zeiller, E.

    2001-01-01

    The IAEA laboratories have access to both nuclear analytical methods and conventional instrumental methods for trace analysis for the characterisation of its environmental and biological reference materials. A technical concept integrating the homogeneity data, the recommended test portion mass and the uncertainty on the trace element concentrations is explored using a combination of INAA, XRF, ICP-MS, ICP-AES, and AAS. The above approach is illustrated by selected examples of reference materials currently under evaluation for their trace element content. They include some or all of the following elements Al, As, Br, Ca, Cd, Co, Cr, Cs, Cu, Fe, Hg, K, Mg, Mn, Mo, Na, Ni, Pb, Rb, Se, Sr, Th, U, Zn in environmental biomonitor organisms (lichen, algae) and air dust filters. (author)

  6. PIXE and PGAA - Complementary methods for studies on ancient glass artefacts (from Byzantine, late medieval to modern Murano glass)

    Science.gov (United States)

    Constantinescu, Bogdan; Cristea-Stan, Daniela; Szőkefalvi-Nagy, Zoltán; Kovács, Imre; Harsányi, Ildikó; Kasztovszky, Zsolt

    2018-02-01

    Combined external milli-beam Particle Induced X-ray Emission (PIXE) and Prompt Gamma Activation Analysis (PGAA) analysis was applied to characterize the composition of paste and colorants from some fragments of Byzantine bracelets (10th-12th Centuries AD), late medieval (17th-18th Centuries AD) and modern Murano glass pieces. As fluxes, PGAA revealed the samples are soda-lime glass, except four samples - two medieval vessel white shards and two dark Byzantine fragments of bracelets - which have potash flux. Aluminium was detected in various proportions in all samples indicating different sources for the added sand. The presence of Magnesium is relevant only in one bracelet fragment suggesting the use of plant (wood?) ash and confirming that the Byzantine bracelet is manufactured from the mixture of both types of glass (natron and plant ash based). PGAA also indicated the presence of low quantities of Cadmium, high level of Arsenic and Lead (possibly lead arsenate) in one medieval sample and of ZnO in Murano glass, and of CoO traces (maximum 0.1%) in all blue-colored Byzantine, late medieval to modern Murano glass artefacts. PIXE confirmed the use of small quantities of CoO for blue color, indicated Manganese combined with Iron for dark glass, Copper for green, Lead, Tin and an Arsenic compound (orpiment?) for yellow and in the case of modern Murano glass Selenium and Cadmium to obtain a reddish color. Despite PIXE - PIGE combination is probably the best one for glass analysis, our external milli-PIXE - PGAA methods proved to be adequate complementary tools to determine many chemical elements from glass composition - Si, Na, K, Ca, Al, Mg, various metallic oxides.

  7. Current Understandings of the Research-Practice Gap From the Viewpoint of Complementary Medicine Academics: A Mixed-Method Investigation.

    Science.gov (United States)

    Leach, Matthew J; Tucker, Basil

    Research plays an important role in advancing health and healthcare. However, much research evidence is not reflected in contemporary complementary and alternative medicine (CAM) practice. Understanding and addressing the reasons for this research-practice gap may have positive implications for quality of care. To shed light on the gap between research and CAM practice. Descriptive cross-sectional, mixed-method study. A total of 126 senior CAM academics across Australasia, Europe, UK, and North America. Participants completed a 30-item online survey and a semi-structured interview; both of which explored the research-practice gap in CAM. A total of 43 (34%) academics completed the survey, with 29 (67%) respondents undergoing an interview. There was general agreement among respondents that CAM research should be informed by practice, and practice informed by research; however, most agreed that this did not reflect the current situation. Translational issues were perceived to be the primary reason for the research-practice gap in CAM. Suggested strategies for closing the gap focussed mostly around improving CAM student/practitioner education and training, and researcher-practitioner engagement and collaboration. Study findings point toward the presence of a research-practice gap in CAM, with several factors likely to be instrumental in sustaining this gap. Attention now needs to focus on understanding the views of CAM clinicians on this issue. Insights gained from this research will help inform the development of a multi-modal strategy that will effectively target the barriers to change in order to bring CAM research and practice closer together. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Robotic therapy provides a stimulus for upper limb motor recovery after stroke that is complementary to and distinct from conventional therapy.

    Science.gov (United States)

    Brokaw, Elizabeth B; Nichols, Diane; Holley, Rahsaan J; Lum, Peter S

    2014-05-01

    Individuals with chronic stroke often have long-lasting upper extremity impairments that impede function during activities of daily living. Rehabilitation robotics have shown promise in improving arm function, but current systems do not allow realistic training of activities of daily living. We have incorporated the ARMin III and HandSOME device into a novel robotic therapy modality that provides functional training of reach and grasp tasks. To compare the effects of equal doses of robotic and conventional therapy in individuals with chronic stroke. Subjects were randomized to 12 hours of robotic or conventional therapy and then crossed over to the other therapy type after a 1-month washout period. Twelve moderate to severely impaired individuals with chronic stroke were enrolled, and 10 completed the study. Across the 3-month study period, subjects showed significant improvements in the Fugl-Meyer (P = .013) and Box and Blocks tests (P = .028). The robotic intervention produced significantly greater improvements in the Action Research Arm Test than conventional therapy (P = .033). Gains in the Box and Blocks test from conventional therapy were larger than from robotic therapy in subjects who received conventional therapy after robotic therapy (P = .044). Data suggest that robotic therapy can elicit improvements in arm function that are distinct from conventional therapy and supplements conventional methods to improve outcomes. Results from this pilot study should be confirmed in a larger study.

  9. 32 CFR 199.14 - Provider reimbursement methods.

    Science.gov (United States)

    2010-07-01

    ... physicians. (6) All services provided by nurse anesthetists. (7) All services related to discharges involving... more accurate data became available. (v) No update for inflation. The children's hospital differential... considered lower volume hospitals. (B) Hospitals that subsequently become higher volume hospitals. In any...

  10. Methodical Approaches to Communicative Providing of Retailer Branding

    Directory of Open Access Journals (Sweden)

    Andrey Kataev

    2017-07-01

    Full Text Available The thesis is devoted to the rationalization of methodical approaches for provision of branding of retail trade enterprises. The article considers the features of brand perception by retail consumers and clarifies the specifics of customer reviews of stores for the procedures accompanying brand management. It is proved that besides traditional communication mix, the most important tool of communicative influence on buyers is the store itself as a place for comfortable shopping. The shop should have a stimulating effect on all five human senses, including sight, smell, hearing, touch, and taste, which shall help maximize consumer integration into the buying process.

  11. Complementary feeding

    DEFF Research Database (Denmark)

    Fewtrell, Mary; Bronsky, Jiri; Campoy, Cristina

    2017-01-01

    or sugarsweetened beverages should be avoided. Vegan diets should only be used under appropriate medical or dietetic supervision and parents should understand the serious consequences of failing to follow advice regarding supplementation of the diet. Method: Parents should be encouraged to respond to their infant...

  12. Complementary biomarker-based methods for characterising Arctic sea ice conditions: A case study comparison between multivariate analysis and the PIP25 index

    Science.gov (United States)

    Köseoğlu, Denizcan; Belt, Simon T.; Smik, Lukas; Yao, Haoyi; Panieri, Giuliana; Knies, Jochen

    2018-02-01

    The discovery of IP25 as a qualitative biomarker proxy for Arctic sea ice and subsequent introduction of the so-called PIP25 index for semi-quantitative descriptions of sea ice conditions has significantly advanced our understanding of long-term paleo Arctic sea ice conditions over the past decade. We investigated the potential for classification tree (CT) models to provide a further approach to paleo Arctic sea ice reconstruction through analysis of a suite of highly branched isoprenoid (HBI) biomarkers in ca. 200 surface sediments from the Barents Sea. Four CT models constructed using different HBI assemblages revealed IP25 and an HBI triene as the most appropriate classifiers of sea ice conditions, achieving a >90% cross-validated classification rate. Additionally, lower model performance for locations in the Marginal Ice Zone (MIZ) highlighted difficulties in characterisation of this climatically-sensitive region. CT model classification and semi-quantitative PIP25-derived estimates of spring sea ice concentration (SpSIC) for four downcore records from the region were consistent, although agreement between proxy and satellite/observational records was weaker for a core from the west Svalbard margin, likely due to the highly variable sea ice conditions. The automatic selection of appropriate biomarkers for description of sea ice conditions, quantitative model assessment, and insensitivity to the c-factor used in the calculation of the PIP25 index are key attributes of the CT approach, and we provide an initial comparative assessment between these potentially complementary methods. The CT model should be capable of generating longer-term temporal shifts in sea ice conditions for the climatically sensitive Barents Sea.

  13. Entrainment and high-density three-dimensional mapping in right atrial macroreentry provide critical complementary information: Entrainment may unmask "visual reentry" as passive.

    Science.gov (United States)

    Pathik, Bhupesh; Lee, Geoffrey; Nalliah, Chrishan; Joseph, Stephen; Morton, Joseph B; Sparks, Paul B; Sanders, Prashanthan; Kistler, Peter M; Kalman, Jonathan M

    2017-10-01

    With the recent advent of high-density (HD) 3-dimensional (3D) mapping, the utility of entrainment is uncertain. However, the limitations of visual representation and interpretation of these high-resolution 3D maps are unclear. The purpose of this study was to determine the strengths and limitations of both HD 3D mapping and entrainment mapping during mapping of right atrial macroreentry. Fifteen patients were studied. The number and type of circuits accounting for ≥90% of the tachycardia cycle length using HD 3D mapping were verified using systematic entrainment mapping. Entrainment sites with an unexpectedly long postpacing interval despite proximity to the active circuit were evaluated. Based on HD 3D mapping, 27 circuits were observed: 12 peritricuspid, 2 upper loop reentry, 10 lower loop reentry, and 3 lateral wall circuits. With entrainment, 17 of the 27 circuits were active: all 12 peritricuspid and 2 upper loop reentry. However, lower loop reentry was confirmed in only 3 of 10, and none of the 3 lateral wall circuits were present. Mean percentage of tachycardia cycle length covered by active circuits was 98% ± 1% vs 97% ± 2% for passive circuits (P = .09). None of the 345 entrainment runs terminated tachycardia or changed tachycardia mechanism. In 8 of 15 patients, 13 examples of unexpectedly long postpacing interval were observed at entrainment sites located distal to localized zones of slow conduction seen on HD 3D mapping. Using HD 3D mapping, "visual reentry" may be due to passive circuitous propagation rather than a critical reentrant circuit. HD 3D mapping provides new insights into regional conduction and helps explain unusual entrainment phenomena. Copyright © 2017 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

  14. Position detectors, methods of detecting position, and methods of providing positional detectors

    Science.gov (United States)

    Weinberg, David M.; Harding, L. Dean; Larsen, Eric D.

    2002-01-01

    Position detectors, welding system position detectors, methods of detecting various positions, and methods of providing position detectors are described. In one embodiment, a welding system positional detector includes a base that is configured to engage and be moved along a curved surface of a welding work piece. At least one position detection apparatus is provided and is connected with the base and configured to measure angular position of the detector relative to a reference vector. In another embodiment, a welding system positional detector includes a weld head and at least one inclinometer mounted on the weld head. The one inclinometer is configured to develop positional data relative to a reference vector and the position of the weld head on a non-planar weldable work piece.

  15. Complementary method of analyzing the quality of the implant I-125 seeds for prostate brachytherapy using ultrasound imaging post-implant

    International Nuclear Information System (INIS)

    Jimenez Dominguez, M.; Carrasco Herrera, M.; Baeza Trujillo, M.; Herrador Cordoba, M.

    2011-01-01

    In this paper we propose a complementary method based on Longitudinal mode ultrasound images acquired the same day of surgery, at the end of the implant. This option will allow us to evaluate the dosimetry end of treatment with the patient in the same position he was planning and to the rectum and bladder just as full. This will permit the identification of bodies and the seeds of interest more easily and will have a reference with which to compare one month later, when the CT images can also detect whether there has been some migration.

  16. Dysmenorrhea Characteristics of Female Students of Health School and Affecting Factors and Their Knowledge and Use of Complementary and Alternative Medicine Methods.

    Science.gov (United States)

    Midilli, Tulay Sagkal; Yasar, Eda; Baysal, Ebru

    2015-01-01

    The purpose of this study was to examine the menstruation and dysmenorrhea characteristics and the factors affecting dysmenorrhea of health school students, and the knowledge and use of the methods of complementary and alternative medicine (CAM) on the part of those students with dysmenorrhea. This is a descriptive study. A descriptive analysis was made by calculating the number, percentage, mean, Pearson χ, and logistic regression analysis. A total of 488 female students participated in the research and 87.7% (n = 428) of all students experienced dysmenorrhea. It was detected that a family history of dysmenorrhea and regular menstrual cycles of the students were dysmenorrhea-affecting factors (P dysmenorrhea used CAM methods. Heat application of CAM methods for dysmenorrhea management was the most commonly used and also known by the students. The students who experienced severe pain used analgesics (P < .05) and CAM methods (P < .05).

  17. Dating of rock art and the effect of human activity on vegetation: The complementary use of archaeological and scientific methods

    Science.gov (United States)

    Hjelle, Kari Loe; Lødøen, Trond Klungseth

    2017-07-01

    One of the main aims of Scandinavian rock art research in recent years has been to identify the culture or society responsible for the imagery. This is of mutual importance, as studies of material culture can shed light on the rock art, while the iconography can be used to understand the contemporary material remains. A major challenge however, has been to determine the exact age of the images, as there are no direct dating materials. In order to overcome this challenge archaeological excavations and palynological analyses have been carried out at Vingen in Western Norway, one of Scandinavia's largest rock art areas. The archaeological and palynological data achieved, as well as loss-on-ignition are independent means for the dating of human activity. Since these methods provided similar results, an indirect connection to the rock art production activity may be inferred. Dates from archaeological contexts indicate a peak of activity between 6900 and 6300 cal. BP, with a potential start 7350 cal. BP and a culmination 6100 cal. BP. Palynological data from three different types of basins have documented forest disturbance in the same time period. Local vegetation reconstructions using the Landscape Reconstruction Algorithm has proved useful to identify anthropogenic-induced land cover changes in the Mesolithic period and a marked reforestation at the transition to the Neolithic period. The applied methods have helped to considerably improve our understanding of past activity and the environment, and demonstrates the potential of archaeological excavations and palynological studies for dating of rock art.

  18. Complementary and Integrative Medicine

    Science.gov (United States)

    ... medical treatments that are not part of mainstream medicine. When you are using these types of care, it may be called complementary, integrative, or alternative medicine. Complementary medicine is used together with mainstream medical ...

  19. Complementary and Alternative Medicine

    Science.gov (United States)

    ... for Educators Search English Español Complementary and Alternative Medicine KidsHealth / For Teens / Complementary and Alternative Medicine What's ... a replacement. How Is CAM Different From Conventional Medicine? Conventional medicine is based on scientific knowledge of ...

  20. A complementary MOS process

    International Nuclear Information System (INIS)

    Jhabvala, M.D.

    1977-03-01

    The complete sequence used to manufacture complementary metal oxide semiconductor (CMOS) integrated circuits is described. The fixed-gate array concept is presented as a means of obtaining CMOS integrated circuits in a fast and reliable fashion. Examples of CMOS circuits fabricated by both the conventional method and the fixed-gate array method are included. The electrical parameter specifications and characteristics are given along with typical values used to produce CMOS circuits. Temperature-bias stressing data illustrating the thermal stability of devices manufactured by this process are presented. Results of a preliminary study on the radiation sensitivity of circuits manufactured by this process are discussed. Some process modifications are given which have improved the radiation hardness of our CMOS devices. A formula description of the chemicals and gases along with the gas flow rates is also included

  1. Systemic Errors in Quantitative Polymerase Chain Reaction Titration of Self-Complementary Adeno-Associated Viral Vectors and Improved Alternative Methods

    Science.gov (United States)

    Fagone, Paolo; Wright, J. Fraser; Nathwani, Amit C.; Nienhuis, Arthur W.; Davidoff, Andrew M.

    2012-01-01

    Abstract Self-complementary AAV (scAAV) vector genomes contain a covalently closed hairpin derived from a mutated inverted terminal repeat that connects the two monomer single-stranded genomes into a head-to-head or tail-to-tail dimer. We found that during quantitative PCR (qPCR) this structure inhibits the amplification of proximal amplicons and causes the systemic underreporting of copy number by as much as 10-fold. We show that cleavage of scAAV vector genomes with restriction endonuclease to liberate amplicons from the covalently closed terminal hairpin restores quantitative amplification, and we implement this procedure in a simple, modified qPCR titration method for scAAV vectors. In addition, we developed and present an AAV genome titration procedure based on gel electrophoresis that requires minimal sample processing and has low interassay variability, and as such is well suited for the rigorous quality control demands of clinical vector production facilities. PMID:22428975

  2. Shortened screening method for phosphorus fractionation in sediments A complementary approach to the standards, measurements and testing harmonised protocol

    International Nuclear Information System (INIS)

    Pardo, Patricia; Rauret, Gemma; Lopez-Sanchez, Jose Fermin

    2004-01-01

    The SMT protocol, a sediment phosphorus fractionation method harmonised and validated in the frame of the standards, measurements and testing (SMT) programme (European Commission), establishes five fractions of phosphorus according to their extractability. The determination of phosphate extracted is carried out spectrophotometrically. This protocol has been applied to 11 sediments of different origin and characteristics and the phosphorus extracted in each fraction was determined not only by UV-Vis spectrophotometry, but also by inductively coupled plasma-atomic emission spectrometry. The use of these two determination techniques allowed the differentiation between phosphorus that was present in the extracts as soluble reactive phosphorus and as total phosphorus. From the comparison of data obtained with both determination techniques a shortened screening method, for a quick evaluation of the magnitude and importance of the fractions given by the SMT protocol, is proposed and validated using two certified reference materials

  3. Hooded seal Cystophora cristata foraging areas in the Northeast Atlantic Ocean-Investigated using three complementary methods.

    Directory of Open Access Journals (Sweden)

    Jade Vacquie-Garcia

    Full Text Available Identifying environmental characteristics that define the ecological niche of a species is essential to understanding how changes in physical conditions might affect its distribution and other aspects of its ecology. The present study used satellite relay data loggers (SRDLs to study habitat use by Northeast Atlantic hooded seals (N = 20; 9 adult females, 3 adult males, and 8 juveniles. Three different methods were used in combination to achieve maximum insight regarding key foraging areas for hooded seals in this region, which have decline by 85% in recent decades: 1 first passage time (FPT; 2 vertical transit rate and; 3 change in dive drift rate. Generalized additive mixed models (GAMM were applied to each method to determine whether specific habitat characteristics were associated with foraging. Separate models were run for the post-molting and the post-breeding seasons; sex and age classes were included in the GAMMs. All three methods highlighted a few common geographic areas as being important foraging zones; however, there were also some different areas identified by the different methods, which highlights the importance of using multiple indexes when analyzing tracking and diving data to study foraging behavior. Foraging occurred most commonly in relatively shallow areas with high Sea Surface Temperatures (SST, corresponding to continental shelf areas with Atlantic Water masses. All age and sex classes overlapped spatially to some extent, but the different age and sex groups showed differences in the bathymetry of their foraging areas as well as in their vertical use of the water column. When foraging, pups dove in the upper part of the water column in relatively deep areas. Adult females foraged relatively shallowly in deep water areas too, though in shallower areas than pups. Adult males foraged close to the bottom in shallower areas.

  4. Parental concerns about complementary feeding

    DEFF Research Database (Denmark)

    Nielsen, Annemette; Michaelsen, Kim F.; Holm, Lotte

    2013-01-01

    Background/objectives:To investigate and analyze differences in parental concerns during earlier and later phases of complementary feeding.Subject/methods:Eight focus group interviews were conducted with 45 mothers of children aged 7 or 13 months. Deductive and inductive coding procedures were ap......:10.1038/ejcn.2013.165....

  5. Complementary medicine in chronic pain treatment.

    Science.gov (United States)

    Simpson, Charles A

    2015-05-01

    This article discusses several issues related to therapies that are considered "complementary" or "alternative" to conventional medicine. A definition of "complementary and alternative medicine" (CAM) is considered in the context of the evolving health care field of complementary medicine. A rationale for pain physicians and clinicians to understand these treatments of chronic pain is presented. The challenges of an evidence-based approach to incorporating CAM therapies are explored. Finally, a brief survey of the evidence that supports several widely available and commonly used complementary therapies for chronic pain is provided. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Complementary and alternative medicine used by persons with functional gastrointestinal disorders to alleviate symptom distress.

    Science.gov (United States)

    Stake-Nilsson, Kerstin; Hultcrantz, Rolf; Unge, Peter; Wengström, Yvonne

    2012-03-01

    The aim of this study was to describe the complementary and alternative medicine methods most commonly used to alleviate symptom distress in persons with functional gastrointestinal disorders. People with functional gastrointestinal disorders face many challenges in their everyday lives, and each individual has his/her own way of dealing with this illness. The experience of illness often leads persons with functional gastrointestinal disorders to complementary and alternative medicine as a viable healthcare choice. Quantitative and describing design. A study-specific complementary and alternative medicine questionnaire was used, including questions about complementary and alternative medicine methods used and the perceived effects of each method. Efficacy assessments for each method were preventive effect, partial symptom relief, total symptom relief or no effect. A total of 137 persons with functional gastrointestinal disorders answered the questionnaire, 62% (n = 85) women and 38% (n = 52) men. A total of 28 different complementary and alternative medicine methods were identified and grouped into four categories: nutritional, drug/biological, psychological activity and physical activity. All persons had tried at least one method, and most methods provided partial symptom relief. Persons with functional gastrointestinal disorders commonly use complementary and alternative medicine methods to alleviate symptoms. Nurses have a unique opportunity to expand their roles in this group of patients. Increased knowledge of complementary and alternative medicine practices would enable a more comprehensive patient assessment and a better plan for meaningful interventions that meet the needs of individual patients. © 2011 Blackwell Publishing Ltd.

  7. CT-based texture analysis potentially provides prognostic information complementary to interim fdg-pet for patients with hodgkin's and aggressive non-hodgkin's lymphomas

    Energy Technology Data Exchange (ETDEWEB)

    Ganeshan, B.; Miles, K.A.; Shortman, R.; Afaq, A.; Ardeshna, K.M.; Groves, A.M.; Kayani, I. [University College London, Institute of Nuclear Medicine, London (United Kingdom); Babikir, S. [International Atomic Energy Agency (IAEA), Human Health Division, Nuclear Medicine and Diagnostic Imaging Section, Vienna (Austria)

    2017-03-15

    The purpose of this study was to investigate the ability of computed tomography texture analysis (CTTA) to provide additional prognostic information in patients with Hodgkin's lymphoma (HL) and high-grade non-Hodgkin's lymphoma (NHL). This retrospective, pilot-study approved by the IRB comprised 45 lymphoma patients undergoing routine 18F-FDG-PET-CT. Progression-free survival (PFS) was determined from clinical follow-up (mean-duration: 40 months; range: 10-62 months). Non-contrast-enhanced low-dose CT images were submitted to CTTA comprising image filtration to highlight features of different sizes followed by histogram-analysis using kurtosis. Prognostic value of CTTA was compared to PET FDG-uptake value, tumour-stage, tumour-bulk, lymphoma-type, treatment-regime, and interim FDG-PET (iPET) status using Kaplan-Meier analysis. Cox regression analysis determined the independence of significantly prognostic imaging and clinical features. A total of 27 patients had aggressive NHL and 18 had HL. Mean PFS was 48.5 months. There was no significant difference in pre-treatment CTTA between the lymphoma sub-types. Kaplan-Meier analysis found pre-treatment CTTA (medium feature scale, p=0.010) and iPET status (p<0.001) to be significant predictors of PFS. Cox analysis revealed that an interaction between pre-treatment CTTA and iPET status was the only independent predictor of PFS (HR: 25.5, 95% CI: 5.4-120, p<0.001). Specifically, pre-treatment CTTA risk stratified patients with negative iPET. CTTA can potentially provide prognostic information complementary to iPET for patients with HL and aggressive NHL. (orig.)

  8. Agarose cell block technique as a complementary method in the diagnosis of fungal osteomyelitis in a dog

    Directory of Open Access Journals (Sweden)

    N.S. Rocha

    2012-04-01

    Full Text Available A 7-year-old Labrador Retriever female dog presenting left forelimb lameness for one day was admitted to the Veterinary Hospital (UNESP-Botucatu for clinical evaluation. Several tests, including blood and image analysis, microbiological culture and cytology of lytic areas of affected bone were made in order to establish a diagnosis. Serum biochemical profile revealed increased levels of liver enzymes, plasma globulin, creatine kinase (CK and calcium. Hemogram revealed anemia and leukocytosis; left humerus image analysis revealed an osteolytic lesion and cytology revealed a suppurative periostitis. Differential diagnosis was a nonspecific infectious inflammatory process or osteosarcoma. Since it was not possible to achieve a definitive diagnosis and there was a highly suspicious for an infectious agent, an agarose cell block of the bone marrow fine-needle aspiration was made. The cytological examination of cell block presented similar findings as described previously. However, additional stains including periodic acid-Schiff (PAS were positive for fungal hyphae, which rendered a diagnosis of fungal osteomyelitis due to Aspergillus spp. This case report illustrates an uncommon cause of osteomyelitis for breed that was diagnosed by an underused method in veterinary medicine.

  9. A novel method of providing a library of n-mers or biopolymers

    DEFF Research Database (Denmark)

    2012-01-01

    The present invention relates to a method of providing a library of n-mer sequences, wherein the library is composed of an n-mer sequence. Also the invention concerns a method of providing a library of biopolymer sequences having one or more n-mers in common. Further provided are specific primers...

  10. Properties of n-eicosane-filled microcapsules with different morphology. Phase Change Materials studied by positron spectroscopy and complementary methods

    Energy Technology Data Exchange (ETDEWEB)

    Zgardzińska, B., E-mail: bozena.zgardzinska@poczta.umcs.lublin.pl [Department of Nuclear Methods, Institute of Physics, Maria Curie-Sklodowska University, Pl. M. Curie-Sklodowskiej 1, 20-031 Lublin (Poland); Filipek, M. [Department of Nuclear Methods, Institute of Physics, Maria Curie-Sklodowska University, Pl. M. Curie-Sklodowskiej 1, 20-031 Lublin (Poland); Fortuniak, W. [Center of Molecular and Macromolecular Studies, Polish Academy of Sciences, Sienkiewicza 112, 90-363 Łódź (Poland); Mroczek, P. [Department of Geoecology and Palaeogeography, Faculty of Earth Sciences and Spatial Management, Maria Curie-Sklodowska University, Al. Kraśnicka 2cd, 20-718 Lublin (Poland)

    2016-07-01

    The Positron Annihilation Lifetime Spectroscopy (PALS) was used to investigate properties of selected Phase Change Materials (PCMs) as a function of temperature from 123 K to 333 K. Three different PCM microcapsules investigated in this work were built of n-eicosane filling and a siloxane polymer as a shell material. It has been found that the properties of ortho-positronium (o-Ps) annihilating in n-eicosane filler depend on the microcapsule morphology. In the samples where the whole interior is composed of n-eicosane and the polymer forms the outer shell only, the n-eicosane behaves like a neat macroscopic sample. In the microcapsules containing the network of polymer threads inside the globule, n-eicosane shows no rise of o-Ps intensity with time which is typical for all pure alkanes. For this morphology, the melting point of n-eicosane is preceded by the 4 K wide temperature range, where the structure resembling the rotator phase is observed (rotator phase appears in neat even-numbered alkanes with carbon chain over 20 atoms). Supplementary data were obtained by the DSC method. SEM images confirmed the morphological differentiation of microcapsules. Low temperature (close to liquid nitrogen) destroys the structure of microcapsules, particularly their outer shell. - Highlights: • Polymer-alkane microcapsules were synthesized with different morphology. • Morphological diversity of microcapsules is reflected in the parameters of the PALS. • PALS show the effect of spatial limitations on the formation of lamellar structure. • PALS is a new way to determine the percentage of microcapsules components.

  11. Studies of the subsurface zone created in aluminium and its alloys by means of positron annihilation and complementary methods

    International Nuclear Information System (INIS)

    Dryzek, E.

    2008-01-01

    There are presented the results of the studies of the subsurface zone created in aluminium and its alloys during sliding or other surface modification treatments. The application of the positron annihilation techniques due to their high sensitivity to crystal lattice defects enabled to determine defects profiles in the subsurface zone. The positron annihilation studies were correlated with other conventional measurements applied in tribology, i.e. microhardness measurements, scanning electron microscopy, X-ray diffraction and in a special case stress distribution calculated theoretically. It was shown that the positron annihilation spectroscopy is a useful tool for profiling of the subsurface zone created during sliding even for light metals their alloys and composites. The total range of the subsurface zone detected by the positron annihilation extends from 50 μm to 450 μm depending on the material studied and surface modification treatment. Additionally, the type of the main defects can be determined. The studies of the pure aluminium samples after dry sliding enabled to find the defect concentration of vacancy type in the depth less then 1 μm and to correlate its value with the size of crystallites. It supports the conclusion on recovery processes taking place in this layer. There was made the attempt to apply the Doppler broadening coincidence spectroscopy to the studies of aluminium alloy and composite. In view of the interdisciplinary character the present thesis enclose also the review of the basic issues of tribology, measurement methods applied to the subsurface zone studies and positron annihilation experimental techniques. (author)

  12. Understanding cancer survivors' information needs and information-seeking behaviors for complementary and alternative medicine from short- to long-term survival: a mixed-methods study.

    Science.gov (United States)

    Scarton, Lou Ann; Del Fiol, Guilherme; Oakley-Girvan, Ingrid; Gibson, Bryan; Logan, Robert; Workman, T Elizabeth

    2018-01-01

    The research examined complementary and alternative medicine (CAM) information-seeking behaviors and preferences from short- to long-term cancer survival, including goals, motivations, and information sources. A mixed-methods approach was used with cancer survivors from the "Assessment of Patients' Experience with Cancer Care" 2004 cohort. Data collection included a mail survey and phone interviews using the critical incident technique (CIT). Seventy survivors from the 2004 study responded to the survey, and eight participated in the CIT interviews. Quantitative results showed that CAM usage did not change significantly between 2004 and 2015. The following themes emerged from the CIT: families' and friends' provision of the initial introduction to a CAM, use of CAM to manage the emotional and psychological impact of cancer, utilization of trained CAM practitioners, and online resources as a prominent source for CAM information. The majority of participants expressed an interest in an online information-sharing portal for CAM. Patients continue to use CAM well into long-term cancer survivorship. Finding trustworthy sources for information on CAM presents many challenges such as reliability of source, conflicting information on efficacy, and unknown interactions with conventional medications. Study participants expressed interest in an online portal to meet these needs through patient testimonials and linkage of claims to the scientific literature. Such a portal could also aid medical librarians and clinicians in locating and evaluating CAM information on behalf of patients.

  13. Young children feeding and Zinc levels of complementary foods in ...

    African Journals Online (AJOL)

    Young children feeding and Zinc levels of complementary foods in Western ... localities helped to identify the recipes used for preparation of complementary foods. ... foods given to them, the cooking methods and the frequency of consumption.

  14. Complementary and Alternative Medicine

    Science.gov (United States)

    ... therapies are often lacking; therefore, the safety and effectiveness of many CAM therapies are uncertain. The National Center for Complementary and Alternative Medicine (NCCAM) is sponsoring research designed to fill this ...

  15. Two complementary liquid chromatography-tandem mass spectrometry (LC-MS/MS) methods to study the excretion and metabolic interaction of edaravone and taurine in rats.

    Science.gov (United States)

    Tang, Dao-quan; Zheng, Xiao-xiao; Li, Yin-jie; Bian, Ting-ting; Yu, Yan-yan; Du, Qian; Yang, Dong-zhi; Jiang, Shui-shi

    2014-11-01

    In this study, two independent and complementary liquid chromatography-tandem mass spectrometry (LC-MS/MS) methods were respectively developed and validated for the determination of edaravone or taurine in rat urine, feces and bile after intravenous administration, using 3-methyl-l-p-tolyl-5-pyrazolone and sulfanilic acid as the internal standards (IS). Edaravone was separated on an Agilent Eclipse Plus C18 column (100×2.1 mm, 3.5 μm) using methanol and water (containing 5 mM ammonium formate and 0.02% formic acid) as mobile phase, while taurine was performed on a Waters Atlantis HILIC Silica column (150×2.1 mm, 3 μm) using acetonitrile and water (containing 5mM ammonium formate and 0.2% formic acid) as mobile phase. The mass analysis was performed in a Triple Quadrupole mass spectrometer via multiple reaction monitoring (MRM) with negative ionization mode. The optimized mass transition ion pairs (m/z) for quantification were 173.1→92.2 and 187.2→106.0 for edaravone and its IS, 124.1→80.0 and 172.0→80.0 for taurine and its IS, respectively. The validated methods have been successfully applied to the excretion and metabolism interaction study of edaravone and taurine in rats after independent intravenous administration and co-administration with a single dose. The results demonstrated that there were no significant alternations on the metabolism and cumulative excretion rate of edaravone and taurine, implying that the proposed combination therapy was pharmacologically viable. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. African Journal of Traditional, Complementary and Alternative ...

    African Journals Online (AJOL)

    African Journal of Traditional, Complementary and Alternative Medicines. ... and Ficus thonningii blume (moraceae), two plants used in traditional medicine in the ... The effective method for investigation meridian tropism theory in rats · EMAIL ...

  17. African Journal of Traditional, Complementary and Alternative ...

    African Journals Online (AJOL)

    African Journal of Traditional, Complementary and Alternative Medicines. ... based on a descriptive survey from the western black sea region of Turkey · EMAIL ... on volatile oil constituents of Codonopsis radix (dangshen) by GC-MS method ...

  18. Corporates Governance: A complementary model for multi ...

    African Journals Online (AJOL)

    pc

    2018-03-05

    Mar 5, 2018 ... Architecture" with a complementary framework is important to make sure for ... Research Article. Special Issue ... complimentary is that it helps in providing a lot of Metrics which are very useful .... Data quality. • Data priority ...

  19. System and Method for Providing Vertical Profile Measurements of Atmospheric Gases

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — A system and method for using an air collection device to collect a continuous air sample as the device descends through the atmosphere are provided. The air...

  20. Interconnection blocks: a method for providing reusable, rapid, multiple, aligned and planar microfluidic interconnections

    DEFF Research Database (Denmark)

    Sabourin, David; Snakenborg, Detlef; Dufva, Hans Martin

    2009-01-01

    In this paper a method is presented for creating 'interconnection blocks' that are re-usable and provide multiple, aligned and planar microfluidic interconnections. Interconnection blocks made from polydimethylsiloxane allow rapid testing of microfluidic chips and unobstructed microfluidic observ...

  1. Vulnerability analysis of complementary transportation systems with applications to railway and airline systems in China

    International Nuclear Information System (INIS)

    Ouyang, Min; Pan, ZheZhe; Hong, Liu; He, Yue

    2015-01-01

    Most of existing studies on vulnerability analysis of multiple infrastructure systems mainly focus on negative effects of interdependencies, which mean that failures in one system can propagate to other systems and aggravate the initial damage. In reality, there also exist positive effects of interdependencies, which are shown in complementary systems and mean that if one system fails another system can provide alternative services to satisfy customers' demands. Different types of transportation systems in a city or country are typical complementary systems. Taking railway and airline systems in China as an example, this paper proposes a network-based approach to model the vulnerability of complementary transportation systems, and based on this model, this paper further introduces a dynamic complementary strength metric, which can help decision makers design or select better complementary topologies from the vulnerability perspective. Also, based on a simple genetic algorithm, this paper analyzes whether critical components for single systems are still important when taking two systems as a whole for analysis. Results show that a protection strategy of hardening a few critical components is also good strategy for the combined system. In addition, the findings and several assumptions are further discussed to close the gap between theory and practice. - Highlights: • We propose a method to model and analyze complementary system vulnerability. • We study vulnerability of complementary railway and airline systems in China. • We propose an approach to quantify dynamic complementary strength. • A few critical components for single systems are important for combined system

  2. Dementia: treating patients and caregivers with complementary and alternative medicine--results of a clinical expert conference using the World Café method.

    Science.gov (United States)

    Teut, Michael; Bloedt, Susanne; Baur, Roland; Betsch, Frederik; Elies, Michael; Fruehwald, Maria; Fuesgen, Ingo; Kerckhoff, Annette; Krüger, Eckard; Schimpf, Dorothee; Schnabel, Katharina; Walach, Harald; Warme, Britta; Warning, Albercht; Wilkens, Johannes; Witt, Claudia M

    2013-01-01

    In Germany the number of inhabitants with dementia is expected to increase from 1.2 million at present to 2.3 million in 2050. Our aim was to investigate which treatments complementary and alternative medicine (CAM) experts consider to be of therapeutic use in developing treatment strategies and hypotheses for further clinical studies. In a participatory group workshop the 'World Café' method was used. As questions we asked: 1) 'Based on your clinical experience, which CAM therapies are effective in the treatment of patients with dementia? 2) Based on your clinical experience, which CAM therapies are effective in the treatment of lay and professional caregivers of patients with dementia?, and 3) How should a CAM treatment program look like?' Further Delphi rounds were used to reach consensus and summarize the results. The 2-day workshop took place in January 2012 in Berlin. A total of 17 experts participated. The most important subject in the treatment was the need to understand patients' biographies in order to individualize the therapy. Therapy itself consists of the therapeutic relationship, nonmedical therapies such as sports, massage, music and arts therapy as well as medical treatment such as herbal or homeopathic medicines. With regard to caregivers the most important aim is to prevent or reduce psychological distress, e.g., by mind-body programs. Instead of single treatments, more general elements such as understanding the patients' biographies, therapeutic relationships, individualizing, networking, and self-care emerged as main results. An integrative treatment program should connect outpatient and inpatient care as well as all experts. CAM training courses should be offered to doctors, nurses, and caregivers. Future clinical studies should focus on complex intervention programs integrating these key elements. © 2013 S. Karger GmbH, Freiburg.

  3. Systems and methods for providing power to a load based upon a control strategy

    Science.gov (United States)

    Perisic, Milun; Kajouke, Lateef A; Ransom, Ray M

    2013-12-24

    Systems and methods are provided for an electrical system. The electrical system includes a load, an interface configured to receive a voltage from a voltage source, and a controller configured to receive the voltage from the voltage source through the interface and to provide a voltage and current to the load. Wherein, when the controller is in a constant voltage mode, the controller provides a constant voltage to the load, when the controller is in a constant current mode, the controller provides a constant current to the load, and when the controller is in a constant power mode, the controller provides a constant power to the load.

  4. Method and Apparatus Providing Deception and/or Altered Operation in an Information System Operating System

    Science.gov (United States)

    Cohen, Fred; Rogers, Deanna T.; Neagoe, Vicentiu

    2008-10-14

    A method and/or system and/or apparatus providing deception and/or execution alteration in an information system. In specific embodiments, deceptions and/or protections are provided by intercepting and/or modifying operation of one or more system calls of an operating system.

  5. Provider Payment Trends and Methods in the Massachusetts Health Care System

    OpenAIRE

    Allison Barrett; Timothy Lake

    2010-01-01

    This report investigates provider payment methods in Massachusetts. Payments include fee-for-service, the predominant model; global payments, which pay providers a single fee for all or most required services during a contract period; and pay-for-performance models, which layer quality incentives onto payments.

  6. 47 CFR 51.329 - Notice of network changes: Methods for providing notice.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 3 2010-10-01 2010-10-01 false Notice of network changes: Methods for providing notice. 51.329 Section 51.329 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED...) Filing a public notice with the Commission; or (2) Providing public notice through industry fora...

  7. Discovering complementary colors from the perspective of steam education

    Science.gov (United States)

    Karabey, Burak; Yigit Koyunkaya, Melike; Enginoglu, Turan; Yurumezoglu, Kemal

    2018-05-01

    This study explored the theory and applications of complementary colors using a technology-based activity designed from the perspective of STEAM education. Complementary colors and their areas of use were examined from the perspective of physics, mathematics and art, respectively. The study, which benefits from technology, makes the theory of complementary colors accessible to all through practical applications and provides a multidisciplinary, integrated and innovative technique of teaching the subject of colors, which could be used to teach complementary colors.

  8. System and Method for Providing a Climate Data Analytic Services Application Programming Interface Distribution Package

    Science.gov (United States)

    Schnase, John L. (Inventor); Duffy, Daniel Q. (Inventor); Tamkin, Glenn S. (Inventor)

    2016-01-01

    A system, method and computer-readable storage devices for providing a climate data analytic services application programming interface distribution package. The example system can provide various components. The system provides a climate data analytic services application programming interface library that enables software applications running on a client device to invoke the capabilities of a climate data analytic service. The system provides a command-line interface that provides a means of interacting with a climate data analytic service by issuing commands directly to the system's server interface. The system provides sample programs that call on the capabilities of the application programming interface library and can be used as templates for the construction of new client applications. The system can also provide test utilities, build utilities, service integration utilities, and documentation.

  9. Interconnection blocks: a method for providing reusable, rapid, multiple, aligned and planar microfluidic interconnections

    International Nuclear Information System (INIS)

    Sabourin, D; Snakenborg, D; Dufva, M

    2009-01-01

    In this paper a method is presented for creating 'interconnection blocks' that are re-usable and provide multiple, aligned and planar microfluidic interconnections. Interconnection blocks made from polydimethylsiloxane allow rapid testing of microfluidic chips and unobstructed microfluidic observation. The interconnection block method is scalable, flexible and supports high interconnection density. The average pressure limit of the interconnection block was near 5.5 bar and all individual results were well above the 2 bar threshold considered applicable to most microfluidic applications

  10. Configurable memory system and method for providing atomic counting operations in a memory device

    Science.gov (United States)

    Bellofatto, Ralph E.; Gara, Alan G.; Giampapa, Mark E.; Ohmacht, Martin

    2010-09-14

    A memory system and method for providing atomic memory-based counter operations to operating systems and applications that make most efficient use of counter-backing memory and virtual and physical address space, while simplifying operating system memory management, and enabling the counter-backing memory to be used for purposes other than counter-backing storage when desired. The encoding and address decoding enabled by the invention provides all this functionality through a combination of software and hardware.

  11. Method of immobilizing weapons plutonium to provide a durable, disposable waste product

    Science.gov (United States)

    Ewing, Rodney C.; Lutze, Werner; Weber, William J.

    1996-01-01

    A method of atomic scale fixation and immobilization of plutonium to provide a durable waste product. Plutonium is provided in the form of either PuO.sub.2 or Pu(NO.sub.3).sub.4 and is mixed with and SiO.sub.2. The resulting mixture is cold pressed and then heated under pressure to form (Zr,Pu)SiO.sub.4 as the waste product.

  12. Cloud Service Provider Methods for Managing Insider Threats: Analysis Phase 1

    Science.gov (United States)

    2013-11-01

    of Standards and Technology (NIST) Special Publication 800-145 (NIST SP 800-145) defines three types of cloud services : Software as a Service ( SaaS ...among these three models. NIST SP 800-145 describes the three service models as follows: SaaS —The capability provided to the consumer is to use the...Cloud Service Provider Methods for Managing Insider Threats: Analysis Phase I Greg Porter November 2013 TECHNICAL NOTE CMU/SEI-2013-TN-020

  13. Complementary Coffee Cups

    Science.gov (United States)

    Banchoff, Thomas

    2006-01-01

    What may have been the birth of a new calculus problem took place when the author noticed that two coffee cups, one convex and one concave, fit nicely together, and he wondered which held more coffee. The fact that their volumes were about equal led to the topic of this article: complementary surfaces of revolution with equal volumes.

  14. Complementary and Integrative Therapies

    Science.gov (United States)

    ... include: • Acupressure and acupuncture • Aromatherapy • Art therapy and music therapy • Chiropractic medicine and massage • Guided imagery • Meditation and ... should I avoid? • Is this complementary therapy (name therapy) safe? Is there research showing it is safe? • Are there side effects ...

  15. Learning outcomes of in-person and virtual field-based geoscience instruction at Grand Canyon National Park: complementary mixed-methods analyses

    Science.gov (United States)

    Semken, S. C.; Ruberto, T.; Mead, C.; Bruce, G.; Buxner, S.; Anbar, A. D.

    2017-12-01

    Students with limited access to field-based geoscience learning can benefit from immersive, student-centered virtual-reality and augmented-reality field experiences. While no digital modalities currently envisioned can truly supplant field-based learning, they afford students access to geologically illustrative but inaccessible places on Earth and beyond. As leading producers of immersive virtual field trips (iVFTs), we investigate complementary advantages and disadvantages of iVFTs and in-person field trips (ipFTs). Settings for our mixed-methods study were an intro historical-geology class (n = 84) populated mostly by non-majors and an advanced Southwest geology class (n = 39) serving mostly majors. Both represent the diversity of our urban Southwestern research university. For the same credit, students chose either an ipFT to the Trail of Time (ToT) Exhibition at Grand Canyon National Park (control group) or an online Grand Canyon iVFT (experimental group), in the same time interval. Learning outcomes for each group were identically drawn from elements of the ToT and assessed using pre/post concept sketching and inquiry exercises. Student attitudes and cognitive-load factors for both groups were assessed pre/post using the PANAS instrument (Watson et al., 1998) and with affective surveys. Analysis of pre/post concept sketches indicated improved knowledge in both groups and classes, but more so in the iVFT group. PANAS scores from the intro class showed the ipFT students having significantly stronger (p = .004) positive affect immediately prior to the experience than the iVFT students, possibly reflecting their excitement about the trip to come. Post-experience, the two groups were no longer significantly different, possibly due to the fatigue associated with a full-day ipFT. Two lines of evidence suggest that the modalities were comparable in expected effectiveness. First, the information relevant for the concept sketch was specifically covered in both

  16. Willingness to Pay for Complementary Health Care Insurance in Iran.

    Science.gov (United States)

    Nosratnejad, Shirin; Rashidian, Arash; Akbari Sari, Ali; Moradi, Najme

    2017-09-01

    Complementary health insurance is increasingly used to remedy the limitations and shortcomings of the basic health insurance benefit packages. Hence, it is essential to gather reliable information about the amount of Willingness to Pay (WTP) for health insurance. We assessed the WTP for health insurance in Iran in order to suggest an affordable complementary health insurance. The study sample consisted of 300 household heads all over provinces of Iran in 2013. The method applied was double bounded dichotomous choice and open-ended question approach of contingent valuation. The average WTP for complementary health insurance per person per month by double bounded dichotomous choice and open-ended question method respectively was 199000 and 115300 Rials (8 and 4.6 USD, respectively). Household's heads with higher levels of income and those who worked had more WTP for the health insurance. Besides, the WTP increased in direct proportion to the number of insured members of each household and in inverse proportion to the family size. The WTP value can be used as a premium in a society. As an important finding, the study indicated that the households were willing to pay higher premiums than currently collected for the complementary health insurance coverage in Iran. This offers the policy makers the opportunity to increase the premium and provide good benefits package for insured people of country then better risk pooling.

  17. Online Wavelet Complementary velocity Estimator.

    Science.gov (United States)

    Righettini, Paolo; Strada, Roberto; KhademOlama, Ehsan; Valilou, Shirin

    2018-02-01

    In this paper, we have proposed a new online Wavelet Complementary velocity Estimator (WCE) over position and acceleration data gathered from an electro hydraulic servo shaking table. This is a batch estimator type that is based on the wavelet filter banks which extract the high and low resolution of data. The proposed complementary estimator combines these two resolutions of velocities which acquired from numerical differentiation and integration of the position and acceleration sensors by considering a fixed moving horizon window as input to wavelet filter. Because of using wavelet filters, it can be implemented in a parallel procedure. By this method the numerical velocity is estimated without having high noise of differentiators, integration drifting bias and with less delay which is suitable for active vibration control in high precision Mechatronics systems by Direct Velocity Feedback (DVF) methods. This method allows us to make velocity sensors with less mechanically moving parts which makes it suitable for fast miniature structures. We have compared this method with Kalman and Butterworth filters over stability, delay and benchmarked them by their long time velocity integration for getting back the initial position data. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

  18. Fibromyalgia and Complementary Health Approaches

    Science.gov (United States)

    ... Musculoskeletal and Skin Diseases Web site . What the Science Says About Complementary Health Approaches for Fibromyalgia Mind ... Complementary and alternative medical therapies in fibromyalgia . Current Pharmaceutical Design . 2006;12(1):47–57. Sherman KJ, ...

  19. Monitoring and evaluating the adherence to a complementary food supplement (Ying Yang Bao) among young children in rural Qinghai, China: a mixed methods evaluation study.

    Science.gov (United States)

    Wu, Qiong; Zhang, Yanfeng; Chang, Suying; Wang, Wei; Helena van Velthoven, Michelle; Han, Huijun; Xing, Min; Chen, Li; Du, Xiaozhen; Scherpbier, Robert W

    2017-06-01

    Large investments are currently made in community-based complementary food supplement (Ying Yang Bao, YYB) programs to improve nutrition of young children in rural areas in China. However, there is a lack of knowledge about the experience and challenges of implementing YYB programs in China. We aimed to: 1) monitor distribution of YYB; 2) assess children's adherence to and acceptability of YYB; and 3) evaluate community-based strategies to improve the program. This mixed methods evaluation study combined data from surveys and focus groups that took place during a controlled interventional evaluation trial. The trial aimed to evaluate the effectiveness of community-based YYB distribution on improving children's health status in rural areas in China. We conducted five cross-sectional surveys with caregivers of children aged 6-23 months (baseline survey (N = 1804) in August 2012 and four follow-up cross-sectional surveys: 1) N = 494 in January 2013; 2) N = 2187 in August 2013; 3) N = 504 in January 2014; and 4) N = 2186 in August 2014) in one rural county in Qinghai Province. We used a two-stage cluster sampling technique to select mothers with eligible children for each survey. Information was collected from caregivers on household characteristics, YYB consumption and acceptability in the surveys. High adherence in each survey was defined as children who consumed at least four YYB sachets during the previous week. A logistic regression model was developed to obtain odds ratios (OR) with 95% confidence intervals of factors associated with high adherence. Also, we conducted 10 focus groups with73 caregivers and health workers involved in the YYB distribution. Content analysis was used to explore qualitative findings, which were used to gain deeper insight into the quantitative results. Around 90% of caregivers had ever received YYB and more than 80% of children ever took YYB. Caregivers mainly knew about YYB through their village doctors. High

  20. THIRD PARTY LOGISTIC SERVICE PROVIDER SELECTION USING FUZZY AHP AND TOPSIS METHOD

    Directory of Open Access Journals (Sweden)

    Golam Kabir

    2012-03-01

    Full Text Available The use of third party logistic(3PL services providers is increasing globally to accomplish the strategic objectives. In the increasingly competitive environment, logistics strategic management requires systematic and structured approach to have cutting edge over the rival. Logistics service provider selection is a complex multi-criteria decision making process; in which, decision makers have to deals with the optimization of conflicting objectives such as quality, cost, and delivery time. In this paper, fuzzy analytic hierarchy process (FAHP approach based on technique for order preference by similarity to ideal solution (TOPSIS method has been proposed for evaluating and selecting an appropriate logistics service provider, where the ratings of each alternative and importance weight of each criterion are expressed in triangular fuzzy numbers.

  1. A method of providing a barrier in a fracture-containing system

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention relates to a method of providing a barrier in a fracture-containing system, comprising: i) Providing a treatment fluid comprising: a) a base fluid; b) an elastomeric material, wherein said elastomeric material comprises at least one polymer capable of crosslinking into an el......The present invention relates to a method of providing a barrier in a fracture-containing system, comprising: i) Providing a treatment fluid comprising: a) a base fluid; b) an elastomeric material, wherein said elastomeric material comprises at least one polymer capable of crosslinking...... into an elastomer, and c) at least one crosslinking agent; ii) Placing the treatment fluid in a fracture-containing system; iii) Allowing the elastomeric material to crosslink with itself to form a barrier in said fracture-containing system; wherein the elastomeric material and/or the crosslinking agent...... are of neutral buoyancy with regard to the base fluid. The invention is contemplated to having utility not only in the oil-drilling industry but also in the plugging of fractures in sewer drains, pipelines etc....

  2. Detraditionalisation, gender and alternative and complementary medicines.

    Science.gov (United States)

    Sointu, Eeva

    2011-03-01

    This article is premised on the importance of locating the appeal and meaning of alternative and complementary medicines in the context of gendered identities. I argue that the discourse of wellbeing--captured in many alternative and complementary health practices--is congruent with culturally prevalent ideals of self-fulfilling, authentic, unique and self-responsible subjectivity. The discourse of wellbeing places the self at the centre, thus providing a contrast with traditional ideas of other-directed and caring femininity. As such, involvement in alternative and complementary medicines is entwined with a negotiation of shifting femininities in detraditionalising societies. Simultaneously, many alternative and complementary health practices readily tap into and reproduce traditional representations of caring femininity. It is through an emphasis on emotional honesty and intimacy that the discourse of wellbeing also captures a challenge to traditional ideas of masculinity. Expectations and experiences relating to gender add a further level of complexity to the meaningfulness and therapeutic value of alternative and complementary medicines and underlie the gender difference in the utilisation of holistic health practices. I draw on data from a qualitative study with 44, primarily white, middle-class users and practitioners of varied alternative and complementary medicines in the UK. © 2010 The Author. Sociology of Health & Illness © 2010 Foundation for the Sociology of Health & Illness/Blackwell Publishing Ltd.

  3. Complementary and alternative treatment of musculoskeletal pain.

    Science.gov (United States)

    Grazio, Simeon; Balen, Diana

    2011-12-01

    The use of complementary and alternative medicine (CAM) is high and increasing worldwide. Patients usually use CAM in addition to conventional medicine, mainly to treat pain. In a large number of cases, people use CAM for chronic musculoskeletal pain as in osteoarthritis, back pain, neck pain, or fibromyalgia. Herewith, a review is presented of CAM efficacy in treating musculoskeletal pain for which, however, no scientific research has so far provided evidence solid enough. In some rare cases where adequate pain control cannot be achieved, CAM might be considered in rational and individual approach based on the first general rule in medicine "not to harm" and on the utility theory of each intervention, i.e. according to the presumed mechanism of painful stimulus and with close monitoring of the patient's response. Further high quality studies are warranted to elucidate the efficacy and side effects of CAM methods. Therefore, conventional medicine remains the main mode of treatment for patients with musculoskeletal painful conditions.

  4. ELV Recycling Service Provider Selection Using the Hybrid MCDM Method: A Case Application in China

    Directory of Open Access Journals (Sweden)

    Fuli Zhou

    2016-05-01

    Full Text Available With the rapid depletion of natural resources and undesired environmental changes globally, more interest has been shown in the research of green supply chain practices, including end-of-life vehicle (ELV recycling. The ELV recycling is mandatory for auto-manufacturers by legislation for the purpose of minimizing potential environmental damages. The purpose of the present research is to determine the best choice of ELV recycling service provider by employing an integrating hybrid multi-criteria decision making (MCDM method. In this research, economic, environmental and social factors are taken into consideration. The linguistic variables and trapezoidal fuzzy numbers (TFNs are applied into this evaluation to deal with the vague and qualitative information. With the combined weight calculation of criteria based on fuzzy aggregation and Shannon Entropy techniques, the normative multi-criteria optimization technique (FVIKOR method is applied to explore the best solution. An application was performed based on the proposed hybrid MCDM method, and sensitivity analysis was conducted on different decision making scenarios. The present study provides a decision-making approach on ELV recycling business selection under sustainability and green philosophy with high robustness and easy implementation.

  5. Narrative journalism as complementary inquiry

    Directory of Open Access Journals (Sweden)

    Jørgen Jeppesen

    2011-10-01

    Full Text Available Narrative journalism is a method to craft stories worth reading about real people. In this article, we explore the ability of that communicative power to produce insights complementary to those obtainable through traditional qualitative and quantitative research methods. With examples from a study of journalistic narrative as patient involvement in professional rehabilitation, interview data transcribed as stories are analyzed for qualities of heterogeneity, sensibility, transparency, and reflexivity. Building on sociological theories of thinking with stories, writing as inquiry, and public journalism as ethnography, we suggest that narrative journalism as a common practice might unfold dimensions of subjective otherness of the self. Aspiring to unite writing in both transparently confrontational and empathetically dialogic ways, the narrative journalistic method holds a potential to expose dynamics of power within the interview.

  6. Complementary Social Science?

    DEFF Research Database (Denmark)

    Blok, Anders; Pedersen, Morten Axel

    2014-01-01

    of measurement device deployed. At the same time, however, we also expect new interferences and polyphonies to arise at the intersection of Big and Small Data, provided that these are, so to speak, mixed with care. These questions, we stress, are important not only for the future of social science methods......The rise of Big Data in the social realm poses significant questions at the intersection of science, technology, and society, including in terms of how new large-scale social databases are currently changing the methods, epistemologies, and politics of social science. In this commentary, we address...

  7. System and method of providing quick thermal comfort with reduced energy by using directed spot conditioning

    Science.gov (United States)

    Wang, Mingyu; Kadle, Prasad S.; Ghosh, Debashis; Zima, Mark J.; Wolfe, IV, Edward; Craig, Timothy D

    2016-10-04

    A heating, ventilation, and air conditioning (HVAC) system and a method of controlling a HVAC system that is configured to provide a perceived comfortable ambient environment to an occupant seated in a vehicle cabin. The system includes a nozzle configured to direct an air stream from the HVAC system to the location of a thermally sensitive portion of the body of the occupant. The system also includes a controller configured to determine an air stream temperature and an air stream flow rate necessary to establish the desired heat supply rate for the sensitive portion and provide a comfortable thermal environment by thermally isolating the occupant from the ambient vehicle cabin temperature. The system may include a sensor to determine the location of the sensitive portion. The nozzle may include a thermoelectric device to heat or cool the air stream.

  8. Method of App Selection for Healthcare Providers Based on Consumer Needs.

    Science.gov (United States)

    Lee, Jisan; Kim, Jeongeun

    2018-01-01

    Mobile device applications can be used to manage health. However, healthcare providers hesitate to use them because selection methods that consider the needs of health consumers and identify the most appropriate application are rare. This study aimed to create an effective method of identifying applications that address user needs. Women experiencing dysmenorrhea and premenstrual syndrome were the targeted users. First, we searched for related applications from two major sources of mobile applications. Brainstorming, mind mapping, and persona and scenario techniques were used to create a checklist of relevant criteria, which was used to rate the applications. Of the 2784 applications found, 369 were analyzed quantitatively. Of those, five of the top candidates were evaluated by three groups: application experts, clinical experts, and potential users. All three groups ranked one application the highest; however, the remaining rankings differed. The results of this study suggest that the method created is useful because it considers not only the needs of various users but also the knowledge of application and clinical experts. This study proposes a method for finding and using the best among existing applications and highlights the need for nurses who can understand and combine opinions of users and application and clinical experts.

  9. Discussion of a method for providing general risk information by linking with the nuclear information

    International Nuclear Information System (INIS)

    Shobu, Nobuhiro; Yokomizo, Shirou; Umezawa, Sayaka

    2004-06-01

    'Risk information navigator (http://www.ricotti.jp/risknavi/)', an internet tool for arousing public interest and fostering people's risk literacy, has been developed as the contents for the official website of Techno Community Square 'RICOTTI' (http://www.ricotti.jp) at TOKAI village. In this report we classified the risk information into the fields, Health/Daily Life', 'Society/Crime/Disaster' and Technology/Environment/Energy', for the internet tool contents. According to these categories we discussed a method for providing various risk information on general fields by linking with the information on nuclear field. The web contents are attached to this report with the CD-R media. (author)

  10. A method to provide rapid in situ determination of tip radius in dynamic atomic force microscopy

    International Nuclear Information System (INIS)

    Santos, Sergio; Guang Li; Souier, Tewfik; Gadelrab, Karim; Chiesa, Matteo; Thomson, Neil H.

    2012-01-01

    We provide a method to characterize the tip radius of an atomic force microscopy in situ by monitoring the dynamics of the cantilever in ambient conditions. The key concept is that the value of free amplitude for which transitions from the attractive to repulsive force regimes are observed, strongly depends on the curvature of the tip. In practice, the smaller the value of free amplitude required to observe a transition, the sharper the tip. This general behavior is remarkably independent of the properties of the sample and cantilever characteristics and shows the strong dependence of the transitions on the tip radius. The main advantage of this method is rapid in situ characterization. Rapid in situ characterization enables one to continuously monitor the tip size during experiments. Further, we show how to reproducibly shape the tip from a given initial size to any chosen larger size. This approach combined with the in situ tip size monitoring enables quantitative comparison of materials measurements between samples. These methods are set to allow quantitative data acquisition and make direct data comparison readily available in the community.

  11. Complementary Therapy for Addiction: “Drumming Out Drugs”

    Science.gov (United States)

    Winkelman, Michael

    2003-01-01

    Objectives. This article examines drumming activities as complementary addiction treatments and discusses their reported effects. Methods. I observed drumming circles for substance abuse (as a participant), interviewed counselors and Internet mailing list participants, initiated a pilot program, and reviewed literature on the effects of drumming. Results. Research reviews indicate that drumming enhances recovery through inducing relaxation and enhancing theta-wave production and brain-wave synchronization. Drumming produces pleasurable experiences, enhanced awareness of preconscious dynamics, release of emotional trauma, and reintegration of self. Drumming alleviates self-centeredness, isolation, and alienation, creating a sense of connectedness with self and others. Drumming provides a secular approach to accessing a higher power and applying spiritual perspectives. Conclusions. Drumming circles have applications as complementary addiction therapy, particularly for repeated relapse and when other counseling modalities have failed. PMID:12660212

  12. Method for providing slip energy control in permanent magnet electrical machines

    Science.gov (United States)

    Hsu, John S.

    2006-11-14

    An electric machine (40) has a stator (43), a permanent magnet rotor (38) with permanent magnets (39) and a magnetic coupling uncluttered rotor (46) for inducing a slip energy current in secondary coils (47). A dc flux can be produced in the uncluttered rotor when the secondary coils are fed with dc currents. The magnetic coupling uncluttered rotor (46) has magnetic brushes (A, B, C, D) which couple flux in through the rotor (46) to the secondary coils (47c, 47d) without inducing a current in the rotor (46) and without coupling a stator rotational energy component to the secondary coils (47c, 47d). The machine can be operated as a motor or a generator in multi-phase or single-phase embodiments and is applicable to the hybrid electric vehicle. A method of providing a slip energy controller is also disclosed.

  13. Providing the physical basis of SCS curve number method and its proportionality relationship from Richards' equation

    Science.gov (United States)

    Hooshyar, M.; Wang, D.

    2016-12-01

    The empirical proportionality relationship, which indicates that the ratio of cumulative surface runoff and infiltration to their corresponding potentials are equal, is the basis of the extensively used Soil Conservation Service Curve Number (SCS-CN) method. The objective of this paper is to provide the physical basis of the SCS-CN method and its proportionality hypothesis from the infiltration excess runoff generation perspective. To achieve this purpose, an analytical solution of Richards' equation is derived for ponded infiltration in shallow water table environment under the following boundary conditions: 1) the soil is saturated at the land surface; and 2) there is a no-flux boundary which moves downward. The solution is established based on the assumptions of negligible gravitational effect, constant soil water diffusivity, and hydrostatic soil moisture profile between the no-flux boundary and water table. Based on the derived analytical solution, the proportionality hypothesis is a reasonable approximation for rainfall partitioning at the early stage of ponded infiltration in areas with a shallow water table for coarse textured soils.

  14. Content and Methods used to Train Tobacco Cessation Treatment Providers: An International Survey.

    Science.gov (United States)

    Kruse, Gina R; Rigotti, Nancy A; Raw, Martin; McNeill, Ann; Murray, Rachael; Piné-Abata, Hembadoon; Bitton, Asaf; McEwen, Andy

    2017-12-01

    There are limited existing data describing the training methods used to educate tobacco cessation treatment providers around the world. To measure the prevalence of tobacco cessation treatment content, skills training and teaching methods reported by tobacco treatment training programs across the world. Web-based survey in May-September 2013 among tobacco cessation training experts across six geographic regions and four World Bank income levels. Response rate was 73% (84 of 115 countries contacted). Of 104 individual programs from 84 countries, most reported teaching brief advice (78%) and one-to-one counseling (74%); telephone counseling was uncommon (33%). Overall, teaching of knowledge topics was more commonly reported than skills training. Programs in lower income countries less often reported teaching about medications, behavioral treatments and biomarkers and less often reported skills-based training about interviewing clients, medication management, biomarker measurement, assessing client outcomes, and assisting clients with co-morbidities. Programs reported a median 15 hours of training. Face-to-face training was common (85%); online programs were rare (19%). Almost half (47%) included no learner assessment. Only 35% offered continuing education. Nearly all programs reported teaching evidence-based treatment modalities in a face-to-face format. Few programs delivered training online or offered continuing education. Skills-based training was less common among low- and middle-income countries (LMICs). There is a large unmet need for tobacco treatment training protocols which emphasize practical skills, and which are more rapidly scalable than face-to-face training in LMICs.

  15. The initiation of complementary feeding among Qom indigenous people

    OpenAIRE

    Irene Olmedo, Sofía; Valeggia, Claudia

    2014-01-01

    As of six months of life, breastfeeding no longer covers an infant’s energy or micronutrient needs, so appropriate complementary feeding should be provided. The objective of this study was to assess the time and adequacy for introducing complementary feeding in a Qom/Toba population and analyze the sociocultural concepts of families regarding complementary feeding. Quantitative and qualitative data were collected by participant observation and semistructured surveys administered to mothers of...

  16. Nurses' beliefs, experiences and practice regarding complementary and alternative medicine in Taiwan.

    Science.gov (United States)

    Smith, Graeme D; Wu, Shu-Chen

    2012-09-01

    To gain an insight into this issue, this study used a qualitative approach and aims to explore and describe nurses' beliefs, experiences and practice regarding complementary and alternative medicine in Taiwan. The integration of complementary and alternative medicine with conventional medicine has become more common worldwide in recent years. An increase in patient use and an expansion of nurses using complementary and alternative medicine has spawned further investigation. Most published studies have concentrated on the usage of complementary and alternative medicine in western societies and have focused principally on physicians' attitudes and practice patterns in this regard. Despite the large amount of time and the unique relationship that nurses share with their patients, little research has investigated the nurse's attitudes and practice regarding complementary and alternative medicine. Moreover, there has been no previous research into understanding this issue from the Taiwanese nursing perspective. A qualitative research design. By using an exploratory, descriptive, qualitative approach, data were collected from 11 registered nurses. The methods of the data collection were in-depth, semi-structured interviews, field notes and memos and the data were analysed using the constant comparative method. Three major categories emerged from the data; namely, a 'lack of clear definition', 'limited experience' and 'high interest' towards complementary and alternative medicine. These results suggest that the definition of complementary and alternative medicine is often unclear for nurses in Taiwan. Due to the organisational policies and personal knowledge base, very few nurses integrate complementary and alternative medicine into their daily practice. However, the nurses in Taiwan show a great desire to participate in complementary and alternative medicine continuing education programmes. This study is not only significant in filling the gap in the existing literature

  17. Pet birds II. Complementary diagnostic procedures

    International Nuclear Information System (INIS)

    Beregi, A.; Molnar, V.; Felkai, F.; Biro, F.

    1997-01-01

    Microscopical examinations are useful in detecting bacteria from droppings and body fluids. Antimicrobial susceptibility tests are also used to perform antimicrobial therapy. Parasitological examinations can also be done on pet birds. Hematological examinations are not very common because of the difficulties in determining the normal serum values that might vary by species and sexes. The vena cutanea ulnaris is the best vein for drawing blood from a pet bird but nail clipping for this purpose is also widely used. The most common and basic complementary examination method is radiology. Birds can be radiographed without anesthesia. Ventrodorsal and latero-lateral pictures are required. The right positioning and setting the adequate values is the most important. Contrast radiographs can also be made on birds. Endoscopy is widely used for sex determination but also can be used for the examination of abdominal organs. Ultrasound examination of pet birds is not a common method because of the difficulties provided by the air sacs. ECG is not a widely used method either because of the high heart beat frequency of birds. Other methods such as necropsy, cytological, histological and toxicological examinations can also be performed on pet birds

  18. Comparison of the complementary feeding practices between ...

    African Journals Online (AJOL)

    The aim of this study was to compare the complementary feeding practices between mothers with twins and mothers with singletons. Methods: mother-infant pairs (50 mother-twin pairs and 50 mother-singleton pairs) with children aged 6 to 23 months were recruited from two public health clinics and communities in Tema ...

  19. Complementary Theories to Supply Chain Management

    DEFF Research Database (Denmark)

    Halldorsson, Arni; Hsuan, Juliana; Kotzab, Herbert

    Borrowing from complementary theories has become an important part of theorizing SCM. We build upon principal-agent theory (PAT), transaction cost analysis (TCA), network theory (NT), and resource-based view (RBV) to provide insights on how to structure a supply chain and manage it. Through...

  20. Prevalence and Correlates of Complementary and Alternative ...

    African Journals Online (AJOL)

    Background: The rate of complementary and alternative medicine (CAM) use among cancer patients is on the increase worldwide. This is due to the innate urge among humans to try new and alternative ways of medicine, especially where conventional medicine failed to provide satisfactory solution such as in sickle cell ...

  1. Biodiverse food solutions to enhance complementary feeding

    DEFF Research Database (Denmark)

    Robertson, Aileen; Parlesak, Alexandr; Greiner, Ted

    2016-01-01

    In her recent editorial, Dr. de Pee (2015) states there are two main ways to provide additional nutrients during complementary feeding: fortification and supplementation. She illustrates some problems associated with these ‘solutions’, including lack of compliance. Rather than conclude that lipid...

  2. Development of guidance and methodical documents for providing the decommissioning of radiation-hazardous objects

    International Nuclear Information System (INIS)

    Ermakov, A.

    2015-01-01

    Federal Center for Nuclear and Radiation Safety (JSC FCNRS) developed and approbated guidance and methodical documents for providing the facility to radiologically safe status in the course of Building B decommissioning activity at JSC VNIINM (A.A. Bochvar High-Technology Scientific Research Institute for Inorganic Materials). The scope of application of the documents developed is as follows: - preliminary segregation of radwaste into streams during its collection and preparation for removal from facilities/sites under decommissioning; - express assessment of specific activity (activity) of radwaste generated in the course of dismantling and decontamination activities; - radiological survey of premises and building structures following completion of dismantling and decontamination activities; - SRW processing (compaction, reduction in size), packaging, characterisation and containerisation in order to reduce risks of spread of radioactive contamination. Documents that have been developed can be used both at nuclear facilities/ sites similar to the JSC VNIINM Building B in terms of work stages and types of waste to be generated, and other facilities/ sites taking into consideration their peculiarities. (author)

  3. Testing the efficacy of Yoga as a Complementary Therapy for Smoking Cessation: Design and Methods of the BreathEasy trial

    Science.gov (United States)

    Bock, Beth C; Rosen, Rochelle K.; Fava, Joseph L.; Gaskins, Ronnesia B.; Jennings, Ernestine; Thind, Herpreet; Carmody, James; Dunsiger, Shira I; Gidron, Naama; Becker, Bruce M.; Marcus, Bess H.

    2014-01-01

    Smokers trying to quit encounter many challenges including nicotine withdrawal symptoms, cigarette craving, increased stress and negative mood and concern regarding weight gain. These phenomena make it difficult to successfully quit smoking. Studies in non-smoking populations show that yoga reduces stress and negative mood and improves weight control. By increasing mindfulness we anticipate that yoga may also improve smokers’ ability to cope with the negative symptoms associated with quitting. Yoga may also improve cognitive deliberation which is needed to make effective choices and avoid smoking in tempting situations. The BreathEasy study is a rigorous, randomized controlled clinical trial examining the efficacy of Iyengar yoga as a complementary therapy to cognitive-behavioral therapy for smoking cessation. All participants are given an 8-week program of smoking cessation classes, and are randomized to either twice weekly yoga (Yoga) or twice-weekly health and wellness classes which serve as a control for contact and participant burden (CTL). Assessments are conducted at baseline, 8 weeks, 3, 6, and 12 months follow up. The primary outcome is prolonged abstinence using an intention-to-treat approach. Multiple internal and external audits using blind data collection are employed to ensure treatment fidelity and reliability of study results. To understand why yoga may be more effective than CTL, we will examine mechanisms of action (i.e., mediators) underlying intervention efficacy. We will examine maintenance of yoga practice and smoking status at each follow up. Focus groups and interviews will be used to enrich our understanding of the relationship of yoga practice and smoking abstinence. PMID:24937018

  4. Complementary feeding: a Global Network cluster randomized controlled trial

    Directory of Open Access Journals (Sweden)

    Pasha Omrana

    2011-01-01

    Full Text Available Abstract Background Inadequate and inappropriate complementary feeding are major factors contributing to excess morbidity and mortality in young children in low resource settings. Animal source foods in particular are cited as essential to achieve micronutrient requirements. The efficacy of the recommendation for regular meat consumption, however, has not been systematically evaluated. Methods/Design A cluster randomized efficacy trial was designed to test the hypothesis that 12 months of daily intake of beef added as a complementary food would result in greater linear growth velocity than a micronutrient fortified equi-caloric rice-soy cereal supplement. The study is being conducted in 4 sites of the Global Network for Women's and Children's Health Research located in Guatemala, Pakistan, Democratic Republic of the Congo (DRC and Zambia in communities with toddler stunting rates of at least 20%. Five clusters per country were randomized to each of the food arms, with 30 infants in each cluster. The daily meat or cereal supplement was delivered to the home by community coordinators, starting when the infants were 6 months of age and continuing through 18 months. All participating mothers received nutrition education messages to enhance complementary feeding practices delivered by study coordinators and through posters at the local health center. Outcome measures, obtained at 6, 9, 12, and 18 months by a separate assessment team, included anthropometry; dietary variety and diversity scores; biomarkers of iron, zinc and Vitamin B12 status (18 months; neurocognitive development (12 and 18 months; and incidence of infectious morbidity throughout the trial. The trial was supervised by a trial steering committee, and an independent data monitoring committee provided oversight for the safety and conduct of the trial. Discussion Findings from this trial will test the efficacy of daily intake of meat commencing at age 6 months and, if beneficial, will

  5. The Effect of Health Information Technology on Health Care Provider Communication: A Mixed-Method Protocol.

    Science.gov (United States)

    Manojlovich, Milisa; Adler-Milstein, Julia; Harrod, Molly; Sales, Anne; Hofer, Timothy P; Saint, Sanjay; Krein, Sarah L

    2015-06-11

    Communication failures between physicians and nurses are one of the most common causes of adverse events for hospitalized patients, as well as a major root cause of all sentinel events. Communication technology (ie, the electronic medical record, computerized provider order entry, email, and pagers), which is a component of health information technology (HIT), may help reduce some communication failures but increase others because of an inadequate understanding of how communication technology is used. Increasing use of health information and communication technologies is likely to affect communication between nurses and physicians. The purpose of this study is to describe, in detail, how health information and communication technologies facilitate or hinder communication between nurses and physicians with the ultimate goal of identifying how we can optimize the use of these technologies to support effective communication. Effective communication is the process of developing shared understanding between communicators by establishing, testing, and maintaining relationships. Our theoretical model, based in communication and sociology theories, describes how health information and communication technologies affect communication through communication practices (ie, use of rich media; the location and availability of computers) and work relationships (ie, hierarchies and team stability). Therefore we seek to (1) identify the range of health information and communication technologies used in a national sample of medical-surgical acute care units, (2) describe communication practices and work relationships that may be influenced by health information and communication technologies in these same settings, and (3) explore how differences in health information and communication technologies, communication practices, and work relationships between physicians and nurses influence communication. This 4-year study uses a sequential mixed-methods design, beginning with a

  6. A method for analyzing the business case for provider participation in the National Cancer Institute's Community Clinical Oncology Program and similar federally funded, provider-based research networks.

    Science.gov (United States)

    Reiter, Kristin L; Song, Paula H; Minasian, Lori; Good, Marjorie; Weiner, Bryan J; McAlearney, Ann Scheck

    2012-09-01

    The Community Clinical Oncology Program (CCOP) plays an essential role in the efforts of the National Cancer Institute (NCI) to increase enrollment in clinical trials. Currently, there is little practical guidance in the literature to assist provider organizations in analyzing the return on investment (ROI), or business case, for establishing and operating a provider-based research network (PBRN) such as the CCOP. In this article, the authors present a conceptual model of the business case for PBRN participation, a spreadsheet-based tool and advice for evaluating the business case for provider participation in a CCOP organization. A comparative, case-study approach was used to identify key components of the business case for hospitals attempting to support a CCOP research infrastructure. Semistructured interviews were conducted with providers and administrators. Key themes were identified and used to develop the financial analysis tool. Key components of the business case included CCOP start-up costs, direct revenue from the NCI CCOP grant, direct expenses required to maintain the CCOP research infrastructure, and incidental benefits, most notably downstream revenues from CCOP patients. The authors recognized the value of incidental benefits as an important contributor to the business case for CCOP participation; however, currently, this component is not calculated. The current results indicated that providing a method for documenting the business case for CCOP or other PBRN involvement will contribute to the long-term sustainability and expansion of these programs by improving providers' understanding of the financial implications of participation. Copyright © 2011 American Cancer Society.

  7. A mixed methods study of patient-provider communication about opioid analgesics.

    Science.gov (United States)

    Hughes, Helen Kinsman; Korthuis, Philip Todd; Saha, Somnath; Eggly, Susan; Sharp, Victoria; Cohn, Jonathan; Moore, Richard; Beach, Mary Catherine

    2015-04-01

    To describe patient-provider communication about opioid pain medicine and explore how these discussions affect provider attitudes toward patients. We audio-recorded 45 HIV providers and 423 patients in routine outpatient encounters at four sites across the country. Providers completed post-visit questionnaires assessing their attitudes toward patients. We identified discussions about opioid pain management and analyzed them qualitatively. We used logistic regression to assess the association between opioid discussion and providers' attitudes toward patients. 48 encounters (11% of the total sample) contained substantive discussion of opioid-related pain management. Most conversations were initiated by patients (n=28, 58%) and ended by the providers (n=36, 75%). Twelve encounters (25%) contained dialog suggesting a difference of opinion or conflict. Providers more often agreed than disagreed to give the prescription (50% vs. 23%), sometimes reluctantly; in 27% (n=13) of encounters, no decision was made. Fewer than half of providers (n=20, 42%) acknowledged the patient's experience of pain. Providers had a lower odds of positive regard for the patient (adjusted OR=0.51, 95% CI: 0.27-0.95) when opioids were discussed. Pain management discussions are common in routine outpatient HIV encounters and providers may regard patients less favorably if opioids are discussed during visits. The sometimes-adversarial nature of these discussions may negatively affect provider attitudes toward patients. Empathy and pain acknowledgment are tools that clinicians can use to facilitate productive discussions of pain management. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  8. Complementary Therapies – a spiritual resource in recovery-processes?

    DEFF Research Database (Denmark)

    Lunde, Anita; Dürr, Dorte Wiwe; Johannessen, Helle

    rehabilitative treatments intends to support recovery processes of people with serious mental illness. Aim: To investigate how employees and residents perceive complementary therapies as an integral rehabilitative treatment, and to explore the recovery related implications of spirituality employed in the use...... and health as well as for the ethics of providing complementary treatment practice in social psychiatry....

  9. Special Section: Complementary and Alternative Medicine (CAM): Time to Talk

    Science.gov (United States)

    ... to discuss with your health care providers any complementary and alternative medicines you take or are thinking about starting. Photo: ... adults 50 and older use some form of complementary and alternative medicine (CAM). But less than one-third who use ...

  10. Devices and methods of operation thereof for providing stable flow for centrifugal compressors

    Science.gov (United States)

    Skoch, Gary J. (Inventor); Stevens, Mark A. (Inventor); Jett, Thomas A. (Inventor)

    2008-01-01

    Centrifugal compressor flow stabilizing devices and methods of operation thereof are disclosed that act upon the flow field discharging from the impeller of a centrifugal compressor and modify the flow field ahead of the diffuser vanes such that flow conditions contributing to rotating stall and surge are reduced or even eliminated. In some embodiments, shaped rods and methods of operation thereof are disclosed, whereas in other embodiments reverse-tangent air injection devices and methods are disclosed.

  11. Unsafe abortion in urban and rural Tanzania: method, provider and consequences

    DEFF Research Database (Denmark)

    Rasch, Vibeke; Kipingili, Rose

    2009-01-01

    OBJECTIVE: To describe unsafe abortion methods and associated health consequences in Tanzania, where induced abortion is restricted by law but common and known to account for a disproportionate share of hospital admissions. METHOD: Cross-sectional study of women admitted with alleged miscarriage...

  12. Compositions and methods for providing plants with tolerance to abiotic stress conditions

    KAUST Repository

    Hirt, Heribert; De Zelicourt, Axel; Saad, Maged

    2017-01-01

    It has been discovered that the desert endophytic bacterium SA187 SA187 can provide resistance or tolerance to abiotic stress conditions to seeds or plants. Compositions containing SA187 can be used to enhance plant development and yield under

  13. Systematic reviews of complementary therapies - an annotated bibliography. Part 3: homeopathy

    NARCIS (Netherlands)

    Linde, K.; Hondras, M.; Vickers, A.; ter Riet, G.; Melchart, D.

    2001-01-01

    BACKGROUND: Complementary therapies are widespread but controversial. We aim to provide a comprehensive collection and a summary of systematic reviews of clinical trials in three major complementary therapies (acupuncture, herbal medicine, homeopathy). This article is dealing with homeopathy.

  14. Systematic reviews of complementary therapies - an annotated bibliography. Part 2: herbal medicine

    NARCIS (Netherlands)

    Linde, K.; ter Riet, G.; Hondras, M.; Vickers, A.; Saller, R.; Melchart, D.

    2001-01-01

    BACKGROUND: Complementary therapies are widespread but controversial. We aim to provide a comprehensive collection and a summary of systematic reviews of clinical trials in three major complementary therapies (acupuncture, herbal medicine, homeopathy). This article is dealing with herbal medicine.

  15. Report on the meeting of the working groups on neutron scattering applied to studying condensed matter, and neutron scattering and complementary methods applied in chemistry and biology

    International Nuclear Information System (INIS)

    1985-06-01

    The present volume consists of 55 lectures. The subjects are: 1) Elastic neutron diffraction, 2) Lattice dynamics, 3) Diffusion, 4) Polymers, 5) Biology, 6) Methods and tools, 7) Magnetism. For distinct papers see hints under relevant topics. (BHO)

  16. NMR system and method having a permanent magnet providing a rotating magnetic field

    Science.gov (United States)

    Schlueter, Ross D [Berkeley, CA; Budinger, Thomas F [Berkeley, CA

    2009-05-19

    Disclosed herein are systems and methods for generating a rotating magnetic field. The rotating magnetic field can be used to obtain rotating-field NMR spectra, such as magic angle spinning spectra, without having to physically rotate the sample. This result allows magic angle spinning NMR to be conducted on biological samples such as live animals, including humans.

  17. The duty to provide information in the case of neuroradiological examination methods

    International Nuclear Information System (INIS)

    Deutsch, E.

    1987-01-01

    The author gives a survey on the judicial decisions concerning the obligation to give information in the case of neuroradiological examination methods. The scope and content of the medical explanation depends inter alia on the urgency and the necessity of the medical diagnosis and on the understanding of the patient. (WG) [de

  18. Vehicle Tracking System, Vehicle Infrastructure Provided with Vehicle Tracking System and Method for Tracking

    NARCIS (Netherlands)

    Papp, Z.; Doodeman, G.J.N.; Nelisse, M.W.; Sijs, J.; Theeuwes, J.A.C.; Driessen, B.J.F.

    2010-01-01

    A vehicle tracking system is described comprising - a plurality of sensor nodes (10) that each provide a message (D) indicative for an occupancy status of a detection area of an vehicle infrastructure monitored by said sensor node, said sensor nodes (10) being arranged in the vehicle infrastructure

  19. Compositions and methods for providing plants with tolerance to abiotic stress conditions

    KAUST Repository

    Hirt, Heribert

    2017-07-27

    It has been discovered that the desert endophytic bacterium SA187 SA187 can provide resistance or tolerance to abiotic stress conditions to seeds or plants. Compositions containing SA187 can be used to enhance plant development and yield under environmental stress conditions.

  20. Children and Complementary Health Approaches

    Science.gov (United States)

    ... review and meta-analysis. Annals of Allergy, Asthma & Immunology . 2014;112(6):503–510. Ethical Conduct of ... Print this page Health Topics A–Z Related Topics Complementary, Alternative, or Integrative Health: What’s In a ...

  1. Ibuanyidanda (Complementary Reflection), Communalism and ...

    African Journals Online (AJOL)

    Fr. Prof. Asouzu

    Glossary of Igbo Terms and Phrases ihe ahụ na anya ... other words, it is in mutual dependence that the feeling of intimacy found among kindred ..... Complementary Reflection, Communalism and Theory Formulation in African Philosophy 25.

  2. Cancer and Complementary Health Approaches

    Science.gov (United States)

    ... According to the 2007 National Health Interview Survey (NHIS), which included a comprehensive survey on the use ... their use of complementary health approaches. In the NHIS, survey respondents who had been diagnosed with cancer ...

  3. BASED COMPLEMENTARY FOODS USING GERMINAT

    African Journals Online (AJOL)

    user

    2010-08-08

    Aug 8, 2010 ... Malnutrition affects physical growth, morbidity, mortality, cognitive development, reproduction, and ... malnutrition. Development of complementary foods is guided by nutritional value, acceptability, availability and affordability of raw materials, and simplicity of food processing ... (Memmert, Germany) at 55. 0.

  4. A Novel Resource Management Method of Providing Operating System as a Service for Mobile Transparent Computing

    Directory of Open Access Journals (Sweden)

    Yonghua Xiong

    2014-01-01

    Full Text Available This paper presents a framework for mobile transparent computing. It extends the PC transparent computing to mobile terminals. Since resources contain different kinds of operating systems and user data that are stored in a remote server, how to manage the network resources is essential. In this paper, we apply the technologies of quick emulator (QEMU virtualization and mobile agent for mobile transparent computing (MTC to devise a method of managing shared resources and services management (SRSM. It has three layers: a user layer, a manage layer, and a resource layer. A mobile virtual terminal in the user layer and virtual resource management in the manage layer cooperate to maintain the SRSM function accurately according to the user’s requirements. An example of SRSM is used to validate this method. Experiment results show that the strategy is effective and stable.

  5. A novel resource management method of providing operating system as a service for mobile transparent computing.

    Science.gov (United States)

    Xiong, Yonghua; Huang, Suzhen; Wu, Min; Zhang, Yaoxue; She, Jinhua

    2014-01-01

    This paper presents a framework for mobile transparent computing. It extends the PC transparent computing to mobile terminals. Since resources contain different kinds of operating systems and user data that are stored in a remote server, how to manage the network resources is essential. In this paper, we apply the technologies of quick emulator (QEMU) virtualization and mobile agent for mobile transparent computing (MTC) to devise a method of managing shared resources and services management (SRSM). It has three layers: a user layer, a manage layer, and a resource layer. A mobile virtual terminal in the user layer and virtual resource management in the manage layer cooperate to maintain the SRSM function accurately according to the user's requirements. An example of SRSM is used to validate this method. Experiment results show that the strategy is effective and stable.

  6. METHODS OF PROVIDING NOISE IMMUNITY IN AUTOMOBILE ANTI-THEFT SYSTEM CONTROL

    Directory of Open Access Journals (Sweden)

    Frolov, V.

    2013-06-01

    Full Text Available In modern ani-theft systems they use frequency and phase modulation. Since the width of the signal is limited, it is possible to intercept the signal and then switch off the alarm at the right time.To ensure the noise immunity and secrecy manufacturers use more sophisticated codes using the methods of cryptography. Significant increase in noise immunity in modern ani-theft systems is possible using broadband signals.

  7. System and Method for Providing Web-Based Remote Application Service

    OpenAIRE

    Shuen-Tai Wang; Yu-Ching Lin; Hsi-Ya Chang

    2017-01-01

    With the development of virtualization technologies, a new type of service named cloud computing service is produced. Cloud users usually encounter the problem of how to use the virtualized platform easily over the web without requiring the plug-in or installation of special software. The object of this paper is to develop a system and a method enabling process interfacing within an automation scenario for accessing remote application by using the web browser. To meet this challenge, we have ...

  8. Cloud Service Provider Methods for Managing Insider Threats: Analysis Phase 2, Expanded Analysis and Recommendations

    Science.gov (United States)

    2014-01-01

    and software as a service ( SaaS )) for staff’s abnormal behavior that may indicate an insider incident. As mentioned above, combining SIEM data...Mellon Software Engineering Institute, contacted commercial and government cloud service providers (CSPs) to better understand the administrative and...availability services . We have observed a number of scenarios in which a customer leaves a CSP’s IaaS, PaaS, or SaaS , but its data remains online for some

  9. Evaluation of Two Statistical Methods Provides Insights into the Complex Patterns of Alternative Polyadenylation Site Switching

    Science.gov (United States)

    Li, Jie; Li, Rui; You, Leiming; Xu, Anlong; Fu, Yonggui; Huang, Shengfeng

    2015-01-01

    Switching between different alternative polyadenylation (APA) sites plays an important role in the fine tuning of gene expression. New technologies for the execution of 3’-end enriched RNA-seq allow genome-wide detection of the genes that exhibit significant APA site switching between different samples. Here, we show that the independence test gives better results than the linear trend test in detecting APA site-switching events. Further examination suggests that the discrepancy between these two statistical methods arises from complex APA site-switching events that cannot be represented by a simple change of average 3’-UTR length. In theory, the linear trend test is only effective in detecting these simple changes. We classify the switching events into four switching patterns: two simple patterns (3’-UTR shortening and lengthening) and two complex patterns. By comparing the results of the two statistical methods, we show that complex patterns account for 1/4 of all observed switching events that happen between normal and cancerous human breast cell lines. Because simple and complex switching patterns may convey different biological meanings, they merit separate study. We therefore propose to combine both the independence test and the linear trend test in practice. First, the independence test should be used to detect APA site switching; second, the linear trend test should be invoked to identify simple switching events; and third, those complex switching events that pass independence testing but fail linear trend testing can be identified. PMID:25875641

  10. Alternative and complementary medicine in cancer patient

    International Nuclear Information System (INIS)

    Reckova, M.

    2009-01-01

    The use of alternative and complementary medicine (CAM) in cancer patients is widespread and it is not surprising as the results gained by conventional treatments are not sufficient. However, the results from the studies with CAM are not always sufficient according to their testing in appropriate clinical studies. Another problem that is present in the use of CAM is the possibility of drug-drug interactions between conventional therapies and CAM. Thus, it is of utmost importance that the oncologist possess a good knowledge of available CAM and provide a sufficient time for discussion with the patient and his/her family about possible alternative treatments and any downside risks. The cornerstone for pertinent discussion is sufficient knowledge on the part of the oncologist about those alternative treatments that are usually presented in the media with incomplete information about their relevant clinical tests and side effects. The following article presents a review of the current alternative treatment methods with a focus on the alternative drugs that have already been clinically tested, and secondarily on the alternative drugs that have been used even without sufficient testing in clinical trials. (author)

  11. Complementary technologies for verification of excess plutonium

    International Nuclear Information System (INIS)

    Langner, D.G.; Nicholas, N.J.; Ensslin, N.; Fearey, B.L.; Mitchell, D.J.; Marlow, K.W.; Luke, S.J.; Gosnell, T.B.

    1998-01-01

    Three complementary measurement technologies have been identified as candidates for use in the verification of excess plutonium of weapons origin. These technologies: high-resolution gamma-ray spectroscopy, neutron multiplicity counting, and low-resolution gamma-ray spectroscopy, are mature, robust technologies. The high-resolution gamma-ray system, Pu-600, uses the 630--670 keV region of the emitted gamma-ray spectrum to determine the ratio of 240 Pu to 239 Pu. It is useful in verifying the presence of plutonium and the presence of weapons-grade plutonium. Neutron multiplicity counting is well suited for verifying that the plutonium is of a safeguardable quantity and is weapons-quality material, as opposed to residue or waste. In addition, multiplicity counting can independently verify the presence of plutonium by virtue of a measured neutron self-multiplication and can detect the presence of non-plutonium neutron sources. The low-resolution gamma-ray spectroscopic technique is a template method that can provide continuity of knowledge that an item that enters the a verification regime remains under the regime. In the initial verification of an item, multiple regions of the measured low-resolution spectrum form a unique, gamma-radiation-based template for the item that can be used for comparison in subsequent verifications. In this paper the authors discuss these technologies as they relate to the different attributes that could be used in a verification regime

  12. Physicians' opinions about partner notification methods: case reporting, patient referral, and provider referral.

    Science.gov (United States)

    Hogben, M; St Lawrence, J S; Montaño, D E; Kasprzyk, D; Leichliter, J S; Phillips, W R

    2004-02-01

    The United States has relied upon partner notification strategies to help break the chain of infection and re-infection for sexually transmitted diseases (STD). Physicians are a vital link in the system of STD control, but little is known of physician opinions about partner notification strategies. We collected opinions about partner notification from a national probability sample of physicians in specialties diagnosing STDs. Physicians responded to 17 questions about three relevant forms of STD partner notification: patient based referral, provider based referral, and case reporting. Exploratory factor analyses showed that responses for each form of partner notification could be grouped into four categories: perceived practice norms, infection control, patient relationships, and time/money. Multivariate analyses of the factors showed that physicians endorsed patient based referral most favourably and provider based referral least favourably. Physicians' opinions about partner notification strategies appear to reflect objective reality in some areas, but not in others. Strategies that improve the fit between physicians' opinions and effective notification are needed: some are discussed here.

  13. A quantitative discussion on the assessment of power supply technologies: DEA (data envelopment analysis) and SAW (simple additive weighting) as complementary methods for the “Grammar”

    International Nuclear Information System (INIS)

    Shakouri, Hamed G.; Nabaee, Mahdis; Aliakbarisani, Sajad

    2014-01-01

    The growing concern about the negative effects of fossil fuels on the environment, and the limited resources of them have forced more intensive use of other energy sources. In absence of sufficient economically feasible renewable energies, nuclear power may play essential role in this field. Recently, the advantages and disadvantages of nuclear power and fossil fuels regarding their efficiencies have been attracted researchers' interest. This paper discusses on the findings from “A Grammar for assessing the performance of power supply systems: comparing nuclear energy to fossil energy” (Diaz-Maurin F, Giampietro M. 2013). Although the “Grammar” is a very valuable approach, it can be accomplished by using helpful quantitative methods. In this discussion, we apply quantitative decision-making approaches to compare the same fossil fuel (coal) power plants with nuclear power plants. Economic variables are also taken into consideration. The DEA (data envelopment analysis) and SAW (simple additive weighting) are the methods applied. Results confirm the results of the reference paper in most cases and show that the fossil fuel power plants with CCS (carbon capture and storage) are slightly more efficient than nuclear power plants. However, selection of input and output variables is disputable. Assuming job creation as a desired output can change the ranking results. - Highlights: • A numeric decision making approach is proposed to facilitate assessment of technologies introduced as a “Grammar”. • Two different methods are chosen (SAW and DEA) since the results obtained for ranking may differ with different methods. • We propose to use the original fractional objective function of DEA with equal weightings applied for the attributes. • Proper combinations of both input and output attributes including economic variables are discussed. • The attributes for assessment of the technologies differ from different viewpoints. Labor force and costs are simple

  14. Neural interface methods and apparatus to provide artificial sensory capabilities to a subject

    Energy Technology Data Exchange (ETDEWEB)

    Buerger, Stephen P.; Olsson, III, Roy H.; Wojciechowski, Kenneth E.; Novick, David K.; Kholwadwala, Deepesh K.

    2017-01-24

    Embodiments of neural interfaces according to the present invention comprise sensor modules for sensing environmental attributes beyond the natural sensory capability of a subject, and communicating the attributes wirelessly to an external (ex-vivo) portable module attached to the subject. The ex-vivo module encodes and communicates the attributes via a transcutaneous inductively coupled link to an internal (in-vivo) module implanted within the subject. The in-vivo module converts the attribute information into electrical neural stimuli that are delivered to a peripheral nerve bundle within the subject, via an implanted electrode. Methods and apparatus according to the invention incorporate implantable batteries to power the in-vivo module allowing for transcutaneous bidirectional communication of low voltage (e.g. on the order of 5 volts) encoded signals as stimuli commands and neural responses, in a robust, low-error rate, communication channel with minimal effects to the subjects' skin.

  15. Method for providing uranium articles with a corrosion resistant anodized coating

    International Nuclear Information System (INIS)

    Waldrop, F.B.; Washington, C.A.

    1982-01-01

    Uranium articles are provided with anodized oxide coatings in an aqueous solution of an electrolyte selected from the group consisting of potassium phosphate, potassium hydroxide, ammonium hydroxide, and a mixture of potassium tetraborate and boric acid. The uranium articles are anodized at a temperature greater than about 75 degrees C. With a current flow of less than about 0.036 A/cm2 of surface area while the Ph of the solution is maintained in a range of about 2 to 11.5. The Ph values of the aqueous solution and the low current density utilized during the electrolysis prevent excessive dissolution of the uranium and porosity in the film or watering. The relatively high temperature of the electrolyte bath inhibits hydration and the attendant deleterious pitting so as to enhance corrosion resistance of the anodized coating

  16. A Statistical Method for Aggregated Wind Power Plants to Provide Secondary Frequency Control

    DEFF Research Database (Denmark)

    Hu, Junjie; Ziras, Charalampos; Bindner, Henrik W.

    2017-01-01

    curtailment for aggregated wind power plants providing secondary frequency control (SFC) to the power system. By using historical SFC signals and wind speed data, we calculate metrics for the reserve provision error as a function of the scheduled wind power. We show that wind curtailment can be significantly......The increasing penetration of wind power brings significant challenges to power system operators due to the wind’s inherent uncertainty and variability. Traditionally, power plants and more recently demand response have been used to balance the power system. However, the use of wind power...... as a balancing-power source has also been investigated, especially for wind power dominated power systems such as Denmark. The main drawback is that wind power must be curtailed by setting a lower operating point, in order to offer upward regulation. We propose a statistical approach to reduce wind power...

  17. Pediatric primary care providers' perspectives regarding hospital discharge communication: a mixed methods analysis.

    Science.gov (United States)

    Leyenaar, JoAnna K; Bergert, Lora; Mallory, Leah A; Engel, Richard; Rassbach, Caroline; Shen, Mark; Woehrlen, Tess; Cooperberg, David; Coghlin, Daniel

    2015-01-01

    Effective communication between inpatient and outpatient providers may mitigate risks of adverse events associated with hospital discharge. However, there is an absence of pediatric literature defining effective discharge communication strategies at both freestanding children's hospitals and general hospitals. The objectives of this study were to assess associations between pediatric primary care providers' (PCPs) reported receipt of discharge communication and referral hospital type, and to describe PCPs' perspectives regarding effective discharge communication and areas for improvement. We administered a questionnaire to PCPs referring to 16 pediatric hospital medicine programs nationally. Multivariable models were developed to assess associations between referral hospital type and receipt and completeness of discharge communication. Open-ended questions asked respondents to describe effective strategies and areas requiring improvement regarding discharge communication. Conventional qualitative content analysis was performed to identify emergent themes. Responses were received from 201 PCPs, for a response rate of 63%. Although there were no differences between referral hospital type and PCP-reported receipt of discharge communication (relative risk 1.61, 95% confidence interval 0.97-2.67), PCPs referring to general hospitals more frequently reported completeness of discharge communication relative to those referring to freestanding children's hospitals (relative risk 1.78, 95% confidence interval 1.26-2.51). Analysis of free text responses yielded 4 major themes: 1) structured discharge communication, 2) direct personal communication, 3) reliability and timeliness of communication, and 4) communication for effective postdischarge care. This study highlights potential differences in the experiences of PCPs referring to general hospitals and freestanding children's hospitals, and presents valuable contextual data for future quality improvement initiatives

  18. The use of complementary and alternative therapies in childhood ...

    African Journals Online (AJOL)

    African Journal of Traditional, Complementary and Alternative Medicines ... based on a descriptive survey from the western black sea region of Turkey ... Materials and Methods: The study, of cross-sectional design, was conducted with the ...

  19. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  20. A Complementary Isothermal Amplification Method to the U.S. EPA Quantitative Polymerase Chain Reaction Approach for the Detection of Enterococci in Environmental Waters.

    Science.gov (United States)

    Kolm, Claudia; Martzy, Roland; Brunner, Kurt; Mach, Robert L; Krska, Rudolf; Heinze, Georg; Sommer, Regina; Reischer, Georg H; Farnleitner, Andreas H

    2017-06-20

    We report a novel molecular assay, based on helicase-dependent amplification (HDA), for the detection of enterococci as markers for fecal pollution in water. This isothermal assay targets the same Enterococcus 23S rRNA gene region as the existing quantitative polymerase chain reaction (qPCR) assays of U.S. Environmental Protection Agency Methods 1611 and 1609 but can be entirely performed on a simple heating block. The developed Enterococcus HDA assay successfully discriminated 15 enterococcal from 15 non-enterococcal reference strains and reliably detected 48 environmental isolates of enterococci. The limit of detection was 25 target copies per reaction, only 3 times higher than that of qPCR. The applicability of the assay was tested on 30 environmental water sample DNA extracts, simulating a gradient of fecal pollution. Despite the isothermal nature of the reaction, the HDA results were consistent with those of the qPCR reference. Given this performance, we conclude that the developed Enterococcus HDA assay has great potential as a qualitative molecular screening method for resource-limited settings when combined with compatible up- and downstream processes. This amplification strategy can pave the way for developing a new generation of rapid, low-cost, and field-deployable molecular diagnostic tools for water quality monitoring.

  1. Complementary methods to plan pedestrian evacuation of the French Riviera's beaches in case of tsunami threat: graph- and multi-agent-based modelling

    Directory of Open Access Journals (Sweden)

    A. Sahal

    2013-07-01

    Full Text Available Small amplitude tsunamis have impacted the French Mediterranean shore (French Riviera in the past centuries. Some caused casualties; others only generated economic losses. While the North Atlantic and Mediterranean tsunami warning system is being tested and is almost operational, no awareness and preparedness measure is being implemented at a local scale. Evacuation is to be considered along the French Riviera, but no plan exists within communities. We show that various approaches can provide local stakeholders with evacuation capacities assessments to develop adapted evacuation plans through the case study of the Cannes–Antibes region. The complementarity between large- and small-scale approaches is demonstrated with the use of macro-simulators (graph-based and micro-simulators (multi-agent-based to select shelter points and choose evacuation routes for pedestrians located on the beach. The first one allows automatically selecting shelter points and measuring and mapping their accessibility. The second one shows potential congestion issues during pedestrian evacuations, and provides leads for the improvement of urban environment. Temporal accessibility to shelters is compared to potential local and distal tsunami travel times, showing a 40 min deficit for an adequate crisis management in the first scenario, and a 30 min surplus for the second one.

  2. Complementary methods to plan pedestrian evacuation of the French Riviera's beaches in case of tsunami threat: graph- and multi-agent-based modelling

    Science.gov (United States)

    Sahal, A.; Leone, F.; Péroche, M.

    2013-07-01

    Small amplitude tsunamis have impacted the French Mediterranean shore (French Riviera) in the past centuries. Some caused casualties; others only generated economic losses. While the North Atlantic and Mediterranean tsunami warning system is being tested and is almost operational, no awareness and preparedness measure is being implemented at a local scale. Evacuation is to be considered along the French Riviera, but no plan exists within communities. We show that various approaches can provide local stakeholders with evacuation capacities assessments to develop adapted evacuation plans through the case study of the Cannes-Antibes region. The complementarity between large- and small-scale approaches is demonstrated with the use of macro-simulators (graph-based) and micro-simulators (multi-agent-based) to select shelter points and choose evacuation routes for pedestrians located on the beach. The first one allows automatically selecting shelter points and measuring and mapping their accessibility. The second one shows potential congestion issues during pedestrian evacuations, and provides leads for the improvement of urban environment. Temporal accessibility to shelters is compared to potential local and distal tsunami travel times, showing a 40 min deficit for an adequate crisis management in the first scenario, and a 30 min surplus for the second one.

  3. Analysis of methods of providing anonymity in facial photographs; a randomised controlled study.

    LENUS (Irish Health Repository)

    Clover, A J P

    2010-09-01

    Clinical images are invaluable in medical teaching and research publications. In the past efforts to conceal patient identity, if any, were limited to a black bar concealing the eyes. However, there is no consensus on this among major journals and publishing houses. This research analyses the effectiveness of blacking out the eyes in facial photographs and evaluates alternative techniques. 126 questionnaires were completed. The average numbers of correct responses out of 30 was 24.64 (82.13%) in the control group, 20.59 (68.63%) in the eyes, 20.42 (68.07%) in the eyes and nose group, and 17.53 (58.43%) in the T-shaped group (eyes, nose and mouth). The traditional method of covering the eyes does significantly decrease recognition, however it is only as effective as covering the nose and mouth. The more of the face that is covered the less likely it is that the person is recognised. However, there are people who remain identifiable no matter how much of the face is covered. This work highlights the importance of obtaining consent prior to publication as well as attempting to hide identity.

  4. Gamma Knife radiosurgery of olfactory groove meningiomas provides a method to preserve subjective olfactory function.

    Science.gov (United States)

    Gande, Abhiram; Kano, Hideyuki; Bowden, Gregory; Mousavi, Seyed H; Niranjan, Ajay; Flickinger, John C; Lunsford, L Dade

    2014-02-01

    Anosmia is a common outcome after resection of olfactory groove meningioma(s) (OGM) and for some patients represents a significant disability. To evaluate long term tumor control rates and preservation of subjective olfaction after Gamma Knife (GK) stereotactic radiosurgery (SRS) of OGM. We performed a retrospective chart review and telephone assessments of 41 patients who underwent GK SRS between 1987 and 2008. Clinical outcomes were stratified by full, partial or no subjective olfaction, whereas tumor control was assessed by changes in volume greater or lesser than 25%. The median clinical and imaging follow-up were 76 and 65 months, respectively. Prior to SRS, 19 (46%) patients had surgical resections and two (5%) had received fractionated radiation therapy. Twenty four patients (59%) reported a normal sense of smell, 12 (29%) reported a reduced sense of smell and five (12%) had complete anosmia. The median tumor volume was 8.5 cm(3) (range 0.6-56.1), the mean radiation dose at the tumor margin was 13 Gy (range 10-20) and the median estimated dose to the olfactory nerve was 5.1 Gy (range 1.1-18.1). At follow-up, 27 patients (66%) reported intact olfaction (three (7%) described return to a normal sense of smell), nine (22%) described partial anosmia, and five (12%) had complete anosmia. No patient reported deterioration in olfaction after SRS. Thirteen patients (32%) showed significant tumor regression, 26 (63%) had no further growth and two (5%) had progressed. The progression free tumor control rates were 97% at 1 year and 95% at 2, 10 and 20 years. Symptomatic adverse radiation effects occurred in three (7%) patients. Stereotactic radiosurgery provided both long term tumor control and preservation of olfaction.

  5. Private providers' knowledge, attitudes and misconceptions related to long-acting and permanent contraceptive methods: a case study in Bangladesh.

    Science.gov (United States)

    Ugaz, Jorge; Banke, Kathryn; Rahaim, Stephen; Chowdhury, Wahiduzzaman; Williams, Julie

    2016-11-01

    In Bangladesh, use of long-acting and permanent methods of contraception (LAPMs) remains stagnant. Providers' limited knowledge and biases may be a factor. We assessed private providers' knowledge, misconceptions and general attitudes towards LAPM in two urban areas. The ultimate goal is to shape programs and interventions to overcome these obstacles and improve full method choice in Bangladesh. Trained data collectors interviewed a convenience sample of 235 female doctors (obstetricians-gynecologists and general practitioners) and 150 female nurses from 194 commercial (for-profit) health care facilities in Chittagong City Corporation and Dhaka district. Data were collected on the nature of the practice, training received, knowledge about modern contraceptives and attitudes towards LAPM [including intrauterine device (IUDs), implants, female and male sterilization]. All providers, and especially doctors, lacked adequate knowledge regarding side effects for all LAPMs, particularly female and male sterilization. Providers had misconceptions about the effectiveness and convenience of LAPMs compared to short-acting contraceptive methods. Implants and IUDs were generally perceived more negatively than other methods. The majority of providers believed that husbands favor short-acting methods rather than LAPMs and that women should not use a method that their husbands do not approve of. Our findings document knowledge and attitudinal barriers among private for-profit providers in urban areas affecting their provision of accurate information about LAPM choices. Practitioners should be offered the necessary tools to provide women full access to all modern methods, especially LAPMs, in order to contribute to decreasing unmet need and improving full method choice in Bangladesh. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. A novel pseudo-complementary PNA G-C base pair

    DEFF Research Database (Denmark)

    Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn

    2011-01-01

    Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...

  7. Using data mining techniques to explore physicians' therapeutic decisions when clinical guidelines do not provide recommendations: methods and example for type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Toussi Massoud

    2009-06-01

    Full Text Available Abstract Background Clinical guidelines carry medical evidence to the point of practice. As evidence is not always available, many guidelines do not provide recommendations for all clinical situations encountered in practice. We propose an approach for identifying knowledge gaps in guidelines and for exploring physicians' therapeutic decisions with data mining techniques to fill these knowledge gaps. We demonstrate our method by an example in the domain of type 2 diabetes. Methods We analyzed the French national guidelines for the management of type 2 diabetes to identify clinical conditions that are not covered or those for which the guidelines do not provide recommendations. We extracted patient records corresponding to each clinical condition from a database of type 2 diabetic patients treated at Avicenne University Hospital of Bobigny, France. We explored physicians' prescriptions for each of these profiles using C5.0 decision-tree learning algorithm. We developed decision-trees for different levels of detail of the therapeutic decision, namely the type of treatment, the pharmaco-therapeutic class, the international non proprietary name, and the dose of each medication. We compared the rules generated with those added to the guidelines in a newer version, to examine their similarity. Results We extracted 27 rules from the analysis of a database of 463 patient records. Eleven rules were about the choice of the type of treatment and thirteen rules about the choice of the pharmaco-therapeutic class of each drug. For the choice of the international non proprietary name and the dose, we could extract only a few rules because the number of patient records was too low for these factors. The extracted rules showed similarities with those added to the newer version of the guidelines. Conclusion Our method showed its usefulness for completing guidelines recommendations with rules learnt automatically from physicians' prescriptions. It could be used

  8. Complementary therapies for acne vulgaris

    Science.gov (United States)

    Cao, Huijuan; Yang, Guoyan; Wang, Yuyi; Liu, Jian Ping; Smith, Caroline A; Luo, Hui; Liu, Yueming

    2015-01-01

    Background Acne is a chronic skin disease characterised by inflamed spots and blackheads on the face, neck, back, and chest. Cysts and scarring can also occur, especially in more severe disease. People with acne often turn to complementary and alternative medicine (CAM), such as herbal medicine, acupuncture, and dietary modifications, because of their concerns about the adverse effects of conventional medicines. However, evidence for CAM therapies has not been systematically assessed. Objectives To assess the effects and safety of any complementary therapies in people with acne vulgaris. Search methods We searched the following databases from inception up to 22 January 2014: the Cochrane Skin Group Specialised Register, the Cochrane Central Register of Controlled Trials (CENTRAL; 2014, Issue 1), MEDLINE (from 1946), Embase (from 1974), PsycINFO (from 1806), AMED (from 1985), CINAHL (from 1981), Scopus (from 1966), and a number of other databases listed in the Methods section of the review. The Cochrane CAM Field Specialised Register was searched up to May 2014. We also searched five trials registers and checked the reference lists of articles for further references to relevant trials. Selection criteria We included parallel-group randomised controlled trials (or the first phase data of randomised cross-over trials) of any kind of CAM, compared with no treatment, placebo, or other active therapies, in people with a diagnosis of acne vulgaris. Data collection and analysis Three authors collected data from each included trial and evaluated the methodological quality independently. They resolved disagreements by discussion and, as needed, arbitration by another author. Main results We included 35 studies, with a total of 3227 participants. We evaluated the majority as having unclear risk of selection, attrition, reporting, detection, and other biases. Because of the clinical heterogeneity between trials and the incomplete data reporting, we could only include four

  9. Complementary Colours for a Physicist

    Science.gov (United States)

    Babic, Vitomir; Cepic, Mojca

    2009-01-01

    This paper reports on a simple experiment which enables splitting incident light into two different modes, each having a colour exactly complementary to the other. A brief historical development of colour theories and differences in a physicist's point of view with respect to an artist's one is discussed. An experimental system for producing…

  10. Emerging issues in complementary feeding

    DEFF Research Database (Denmark)

    Michaelsen, Kim F.; Grummer-Strawn, Laurence; Bégin, France

    2017-01-01

    the complementary feeding period is summarized. The increased availability of sugar-containing beverages and unhealthy snack foods and its negative effect on young child's diet is described. Negative effects of nonresponsive feeding and force feeding are also discussed, although few scientific studies have...

  11. Complementary therapies in social psychiatry

    DEFF Research Database (Denmark)

    Lunde, Anita; Dürr, Dorte Wiwe

    three residential homes (n= 51 / 91 respondents - response rate 56 %) shows that the most common used complementary therapy is music therapy 43%, and only 10% of residents do not use these therapies at all. Overall, 43% of residents strongly agree, that these therapies strengthens their recovery process...

  12. Industrial Evolution Through Complementary Convergence

    DEFF Research Database (Denmark)

    Frøslev Christensen, Jens

    2011-01-01

    The article addresses the dynamics through which product markets become derailed from early product life cycle (PLC)-tracks and engaged in complementary convergence with other product markets or industries. We compare and contrast the theories that can explain, respectively, the PLC...

  13. Complementary Medicine Journal of Faculty of Nursing and Midwifery

    OpenAIRE

    Seraji; Vakilian

    2011-01-01

    Introduction: Half of the pregnant women suffer from the excruciating degrees of labor pain. Nowadays, however, the use of painkillers for decreasing labor pain due to their adverse effects on the mother and child is less common and attention has been shifted towards non-medical methods and complementary medicine such as message therapy, acupuncture, hydrotherapy, and herbal medicine. One of the branches of complementary medicine is hydrotherapy with herbal essences. Breathing techniques, on ...

  14. Complementary therapies for acne vulgaris.

    Science.gov (United States)

    Cao, Huijuan; Yang, Guoyan; Wang, Yuyi; Liu, Jian Ping; Smith, Caroline A; Luo, Hui; Liu, Yueming

    2015-01-19

    Acne is a chronic skin disease characterised by inflamed spots and blackheads on the face, neck, back, and chest. Cysts and scarring can also occur, especially in more severe disease. People with acne often turn to complementary and alternative medicine (CAM), such as herbal medicine, acupuncture, and dietary modifications, because of their concerns about the adverse effects of conventional medicines. However, evidence for CAM therapies has not been systematically assessed. To assess the effects and safety of any complementary therapies in people with acne vulgaris. We searched the following databases from inception up to 22 January 2014: the Cochrane Skin Group Specialised Register, the Cochrane Central Register of Controlled Trials (CENTRAL; 2014,Issue 1), MEDLINE (from 1946), Embase (from 1974), PsycINFO (from 1806), AMED (from 1985), CINAHL (from 1981), Scopus (from 1966), and a number of other databases listed in the Methods section of the review. The Cochrane CAM Field Specialised Register was searched up to May 2014. We also searched five trials registers and checked the reference lists of articles for further references to relevant trials. We included parallel-group randomised controlled trials (or the first phase data of randomised cross-over trials) of any kind of CAM, compared with no treatment, placebo, or other active therapies, in people with a diagnosis of acne vulgaris. Three authors collected data from each included trial and evaluated the methodological quality independently. They resolved disagreements by discussion and, as needed, arbitration by another author. We included 35 studies, with a total of 3227 participants. We evaluated the majority as having unclear risk of selection, attrition, reporting, detection, and other biases. Because of the clinical heterogeneity between trials and the incomplete data reporting, we could only include four trials in two meta-analyses, with two trials in each meta-analysis. The categories of CAM included

  15. Using data mining techniques to explore physicians' therapeutic decisions when clinical guidelines do not provide recommendations: methods and example for type 2 diabetes.

    Science.gov (United States)

    Toussi, Massoud; Lamy, Jean-Baptiste; Le Toumelin, Philippe; Venot, Alain

    2009-06-10

    Clinical guidelines carry medical evidence to the point of practice. As evidence is not always available, many guidelines do not provide recommendations for all clinical situations encountered in practice. We propose an approach for identifying knowledge gaps in guidelines and for exploring physicians' therapeutic decisions with data mining techniques to fill these knowledge gaps. We demonstrate our method by an example in the domain of type 2 diabetes. We analyzed the French national guidelines for the management of type 2 diabetes to identify clinical conditions that are not covered or those for which the guidelines do not provide recommendations. We extracted patient records corresponding to each clinical condition from a database of type 2 diabetic patients treated at Avicenne University Hospital of Bobigny, France. We explored physicians' prescriptions for each of these profiles using C5.0 decision-tree learning algorithm. We developed decision-trees for different levels of detail of the therapeutic decision, namely the type of treatment, the pharmaco-therapeutic class, the international non proprietary name, and the dose of each medication. We compared the rules generated with those added to the guidelines in a newer version, to examine their similarity. We extracted 27 rules from the analysis of a database of 463 patient records. Eleven rules were about the choice of the type of treatment and thirteen rules about the choice of the pharmaco-therapeutic class of each drug. For the choice of the international non proprietary name and the dose, we could extract only a few rules because the number of patient records was too low for these factors. The extracted rules showed similarities with those added to the newer version of the guidelines. Our method showed its usefulness for completing guidelines recommendations with rules learnt automatically from physicians' prescriptions. It could be used during the development of guidelines as a complementary source from

  16. THE SIMULATION DIAGNOSTIC METHODS AND REGENERATION WAYS OF REINFORCED - CONCRETE CONSTRUCTIONS OF BRIDGES IN PROVIDING THEIR OPERATING RELIABILITY AND LONGEVITY

    Directory of Open Access Journals (Sweden)

    B. V. Savchinskiy

    2010-03-01

    Full Text Available On the basis of analysis of existing diagnostic methods and regeneration ways of reinforced-concrete constructions of bridges the recommendations on introduction of new modern technologies of renewal of reinforced-concrete constructions of bridges in providing their operating reliability and longevity are offered.

  17. THE SIMULATION DIAGNOSTIC METHODS AND REGENERATION WAYS OF REINFORCED - CONCRETE CONSTRUCTIONS OF BRIDGES IN PROVIDING THEIR OPERATING RELIABILITY AND LONGEVITY

    OpenAIRE

    B. V. Savchinskiy

    2010-01-01

    On the basis of analysis of existing diagnostic methods and regeneration ways of reinforced-concrete constructions of bridges the recommendations on introduction of new modern technologies of renewal of reinforced-concrete constructions of bridges in providing their operating reliability and longevity are offered.

  18. A Mixed-Methods Investigation of Early Childhood Professional Development for Providers and Recipients in the United States

    Science.gov (United States)

    Linder, Sandra M.; Rembert, Kellye; Simpson, Amber; Ramey, M. Deanna

    2016-01-01

    This multi-phase mixed-methods study explores provider and recipient perceptions of the current state of early childhood professional development in a southeastern area of the United States. Professional development for the early childhood workforce has been shown to positively influence the quality of early childhood classrooms. This study…

  19. Perceptions of vaginal microbicides as an HIV prevention method among health care providers in KwaZulu-Natal, South Africa

    Directory of Open Access Journals (Sweden)

    Mantell Joanne E

    2007-03-01

    Full Text Available Abstract Background The promise of microbicides as an HIV prevention method will not be realized if not supported by health care providers. They are the primary source of sexual health information for potential users, in both the public and private health sectors. Therefore, the aim of this study was to determine perceptions of vaginal microbicides as a potential HIV prevention method among health care providers in Durban and Hlabisa, South Africa, using a combination of quantitative and qualitative methods. Results During 2004, semi structured interviews with 149 health care providers were conducted. Fifty seven percent of hospital managers, 40% of pharmacists and 35% of nurses possessed some basic knowledge of microbicides, such as the product being used intra-vaginally before sex to prevent HIV infection. The majority of them were positive about microbicides and were willing to counsel users regarding potential use. Providers from both public and private sectors felt that an effective microbicide should be available to all people, regardless of HIV status. Providers felt that the product should be accessed over-the-counter in pharmacies and in retail stores. They also felt a need for potential microbicides to be available free of charge, and packaged with clear instructions. The media was seen by health care providers as being an effective strategy for promoting microbicides. Conclusion Overall, health care providers were very positive about the possible introduction of an effective microbicide for HIV prevention. The findings generated by this study illustrated the need for training health care providers prior to making the product accessible, as well as the importance of addressing the potential barriers to use of the product by women. These are important concerns in the health care community, and this study also served to educate them for the day when research becomes reality.

  20. Calculation of the energy provided by a PV generator. Comparative study: Conventional methods vs. artificial neural networks

    International Nuclear Information System (INIS)

    Almonacid, F.; Rus, C.; Perez-Higueras, P.; Hontoria, L.

    2011-01-01

    The use of photovoltaics for electricity generation purposes has recorded one of the largest increases in the field of renewable energies. The energy production of a grid-connected PV system depends on various factors. In a wide sense, it is considered that the annual energy provided by a generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. However, a range of factors is influencing the expected outcome by reducing the generation of energy. The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network developed by the R and D Group for Solar and Automatic Energy at the University of Jaen. The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study, mainly due to the fact that this method takes also into account some second order effects, such as low irradiance, angular and spectral effects. -- Research highlights: → It is considered that the annual energy provided by a PV generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. → A range of factors are influencing the expected outcome by reducing the generation of energy (mismatch losses, dirt and dust, Ohmic losses,.). → The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network. → The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study. While classical methods have only taken into account temperature losses, the method based in

  1. The initiation of complementary feeding among Qom indigenous people.

    Science.gov (United States)

    Olmedo, Sofia Irene; Valeggia, Claudia

    2014-06-01

    As of six months of life, breastfeeding no longer covers an infant's energy or micronutrient needs, so appropriate complementary feeding should be provided. The objective of this study was to assess the time and adequacy for introducing complementary feeding in a Qom/Toba population and analyze the sociocultural concepts of families regarding complementary feeding. Quantitative and qualitative data were collected by participant observation and semistructured surveys administered to mothers of 0-2 year old infants. Qom breastfeed their infants long term and on demand. Most infants have an adequate nutritional status and start complementary feeding at around 6 months old as per the local health center and international standards. However, mostly due to socioeconomic factors, foods chosen to complement breastfeeding have a relatively scarce nutritional value.

  2. Complementary and alternative medicine use in children with cystic fibrosis.

    Science.gov (United States)

    Giangioppo, Sandra; Kalaci, Odion; Radhakrishnan, Arun; Fleischer, Erin; Itterman, Jennifer; Lyttle, Brian; Price, April; Radhakrishnan, Dhenuka

    2016-11-01

    To estimate the overall prevalence of complementary and alternative medicine use among children with cystic fibrosis, determine specific modalities used, predictors of use and subjective helpfulness or harm from individual modalities. Of 53 children attending the cystic fibrosis clinic in London, Ontario (100% recruitment), 79% had used complementary and alternative medicine. The most commonly used modalities were air purifiers, humidifiers, probiotics, and omega-3 fatty acids. Family complementary and alternative medicine use was the only independent predictor of overall use. The majority of patients perceived benefit from specific modalities for cystic fibrosis symptoms. Given the high frequency and number of modalities used and lack of patient and disease characteristics predicting use, we recommend that health care providers should routinely ask about complementary and alternative medicine among all pediatric cystic fibrosis patients and assist patients in understanding the potential benefits and risks to make informed decisions about its use. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Attitudes of members of the German Society for Palliative Medicine toward complementary and alternative medicine for cancer patients.

    Science.gov (United States)

    Conrad, A C; Muenstedt, K; Micke, O; Prott, F J; Muecke, R; Huebner, J

    2014-07-01

    A high proportion of cancer patients use complementary and alternative medicine (CAM). In oncology, risks of CAM are side effects and interactions. Our aim was to conduct a survey on professionals in palliative care regarding attitudes toward CAM. An internet-based survey with a standardized questionnaire was sent to all members of the German Society for Palliative Care. The questionnaire collected data on attitude toward CAM and experiences. Six hundred and ninety questionnaires (19 %) were returned (49 % physicians, 35 % nurses, 3 % psychologists). Acceptance of CAM is high (92 % for complementary and 54 % for alternative medicine). Most participants had already been asked on CAM by patients (95 %) and relatives (89 %). Forty-four percent already had used complementary methods and 5 % alternative methods. Only 21 % think themselves adequately informed. Seventy-four percent would use complementary methods in a patient with advanced tumor, and 62 % would use alternative therapy in patients if there was no other therapy. Even from those who are skeptical 45 % would treat a patient with alternative methods. In order to inform patients on CAM and to further patients' autonomy, evidence on benefits and harms of CAM must be provided. As awareness of risks from CAM is low and critical appraisal especially of alternative medicine missing, but interest on information on CAM is high, experts should provide evidence-based recommendations for CAM in palliative care to members of different professions. This could be done by a curriculum focusing on the most often used CAM methods.

  4. A combined usage of stochastic and quantitative risk assessment methods in the worksites: Application on an electric power provider

    International Nuclear Information System (INIS)

    Marhavilas, P.K.; Koulouriotis, D.E.

    2012-01-01

    An individual method cannot build either a realistic forecasting model or a risk assessment process in the worksites, and future perspectives should focus on the combined forecasting/estimation approach. The main purpose of this paper is to gain insight into a risk prediction and estimation methodological framework, using the combination of three different methods, including the proportional quantitative-risk-assessment technique (PRAT), the time-series stochastic process (TSP), and the method of estimating the societal-risk (SRE) by F–N curves. In order to prove the usefulness of the combined usage of stochastic and quantitative risk assessment methods, an application on an electric power provider industry is presented to, using empirical data.

  5. Complementary and alternative medicine in pulmonology.

    Science.gov (United States)

    Mark, John D; Chung, Youngran

    2015-06-01

    To provide a comprehensive review of complementary and alternative medicine (CAM) therapies for the treatment of pulmonary disorders in children. The use of complementary medicine (CAM) is commonly used by both children and adults with breathing problems, and especially in chronic pulmonary disorders such as asthma and cystic fibrosis. Many clinics and hospitals now offer CAM, even though most of the conventionally trained health practitioners have little knowledge or education regarding CAM therapies. Research in CAM that demonstrates overall benefit is lacking, especially in children. Often parents do not report CAM use to their child's healthcare provider and this could compromise their overall quality of care. Although many research studies evaluating CAM therapies have methodological flaws, data exist to support CAM therapies in treating children with pulmonary disorders. This review examines the latest evidence of CAM use and effectiveness in children with pulmonary disorders. Physicians should be aware of the many CAM therapy options and the research surrounding them in order to provide their patients with the most current and accurate information available.

  6. Evaluation of protection factors provided by full-face masks using man-test method at workplace

    International Nuclear Information System (INIS)

    Izumi, Yukio; Kinouchi, Nobuyuki; Ikezawa, Yoshio.

    1994-01-01

    From a practical angle of view to estimate the protection factors (PFs) provided by full-face masks, a number of protection factors were measured with a man-test apparatus just before the wearers started to do radiation work in radiation controlled area. PFs of the total number of 2,279 cases were measured under five simulated working conditions. The measured PFs were widely distributed from 2.3 to 6,700. About 95% of workers obtained PFs more than 50, and about 64% showed much higher PFs more than 1,000 due to good fitting. In the case of some persons, the measured PFs irregularly varied and changed to a large degree. This method is a reliable technique that has been confirmed to protect unexpected internal exposure. From the results obtained, the method should be necessary to provide a better mask and higher PF for each worker. (author)

  7. Integrative Medicine and Complementary and Alternative Therapies

    Science.gov (United States)

    ... complementary therapies with your healthcare team: Are there complementary therapies that you would recommend? What research is available about this therapy’s safety and effectiveness? What are the benefits and risks of this ...

  8. Office of Cancer Complementary and Alternative Medicine

    Science.gov (United States)

    ... C Research. Information. Outreach. The Office of Cancer Complementary and Alternative Medicine (OCCAM) was established in October 1998 to coordinate ... National Cancer Institute (NCI) in the arena of complementary and alternative medicine (CAM). More about us. CAM at the NCI ...

  9. African Journal of Traditional, Complementary and Alternative ...

    African Journals Online (AJOL)

    African Journal of Traditional, Complementary and Alternative Medicines: Advanced Search. Journal Home > African Journal of Traditional, Complementary and Alternative Medicines: Advanced Search. Log in or Register to get access to full text downloads.

  10. A METHOD AND AN APPARATUS FOR PROVIDING TIMING SIGNALS TO A NUMBER OF CIRCUITS, AN INTEGRATED CIRCUIT AND A NODE

    DEFF Research Database (Denmark)

    2006-01-01

    A method of providing or transporting a timing signal between a number of circuits, electrical or optical, where each circuit is fed by a node. The nodes forward timing signals between each other, and at least one node is adapted to not transmit a timing signal before having received a timing...... signal from at least two nodes. In this manner, the direction of the timing skew between nodes and circuits is known and data transport between the circuits made easier....

  11. Definite existence of subphases with eight- and ten-layer unit cells as studied by complementary methods, electric-field-induced birefringence and microbeam resonant x-ray scattering.

    Science.gov (United States)

    Feng, Zhengyu; Chandani Perera, A D L; Fukuda, Atsuo; Vij, Jagdish K; Ishikawa, Ken; Iida, Atsuo; Takanishi, Yoichi

    2017-07-01

    A mixture of two selenium-containing compounds, 80 wt. % AS657 and 20 wt. % AS620, are studied with two complementary methods, electric-field-induced birefringence (EFIB) and microbeam resonant x-ray scattering (μRXS). The mixture shows the typical phase sequence of Sm-C_{A}^{*}-1/3-1/2-Sm-C^{*}-Sm-C_{α}^{*}-Sm-A, where 1/3 and 1/2 are two prototypal ferrielectric and antiferroelectric subphases with three- and four-layer unit cells, respectively. Here we designate the subphase as its q_{T} number defined by the ratio of [F]/([F]+[A]), where [F] and [A] are the numbers of synclinic ferroelectric and anticlinic antiferroelectric orderings in the unit cell, respectively. The electric field vs temperature phase diagram with EFIB contours indicates the emergence of three additional subphases, an antiferroelectric one between Sm-C_{A}^{*} and 1/3 and antiferroelectric and apparently ferrielectric ones between 1/3 and 1/2. The simplest probable q_{T}'s for these additional subphases are 1/4, 2/5, and 3/7, respectively, in the order of increasing temperature. The μRXS profiles indicate that antiferroelectric 1/4 and 2/5 approximately have the eight-layer (FAAAFAAA) and ten-layer (FAFAAFAFAA) Ising unit cells, respectively. The remaining subphase may be ferrielectric 3/7 with a seven-layer unit cell, although the evidence is partial. These experimental results are compared with the phenomenological Landau model [P. V. Dolganov and E. I. Kats, Liq. Cryst. Rev. 1, 127 (2014)2168-039610.1080/21680396.2013.869667] and the quasimolecular model [A. V. Emelyanenko and M. A. Osipov, Phys. Rev. E 68, 051703 (2003)1063-651X10.1103/PhysRevE.68.051703].

  12. Complementary and alternative medicine use in children with thalassaemia.

    Science.gov (United States)

    Efe, Emine; Işler, Ayşegül; Sarvan, Süreyya; Başer, Hayriye; Yeşilipek, Akif

    2013-03-01

    The aims of this study were to: (1) determine the types of complementary and alternative medicine use among children with thalassaemia as reported by parents and (2) describe sociodemographic and medical factors associated with the use of such treatments in families residing in southern Turkey. Thalassaemia is one of the most common human genetic diseases. Despite the therapeutic efforts, patients will encounter a variety of physical and psychological problems. Therefore, the use of complementary and alternative medicines among children thalassaemia is becoming increasingly popular. This is a descriptive study of complementary and alternative medicine. This study was conducted in the Hematology Outpatient Clinic at Akdeniz University Hospital and in the Thalassemia Centre at Ministry of Health Antalya Education and Research Hospital, Antalya, Turkey, between January 2010-December 2010. Parents of 97 paediatric patients, among 125 parents who applied to the haematology outpatient clinic and thalassaemia centre between these dates, agreed to take part in the study with whom contact could be made were included. Data were collected by using a questionnaire. The proportion of parents who reported using one or more of the complementary and alternative medicine methods was 82·5%. Of these parents, 61·8% were using prayer/spiritual practice, 47·4% were using nutritional supplements and 35·1% were using animal materials. It was determined that a significant portion of the parents using complementary and alternative medicine use it to treat their children's health problems, they were informed about complementary and alternative medicine by their paediatricians and family elders, and they have discussed the use of complementary and alternative medicine with healthcare professionals. To sustain medical treatment and prognosis of thalassaemia, it is important for nurses to consult with their patients and parents regarding the use and potential risks of some complementary

  13. Use of complementary and alternative medicine by patients with arthritis.

    Science.gov (United States)

    Unsal, Ayla; Gözüm, Sebahat

    2010-04-01

    The aims of this study were to determine the prevalence of complementary and alternative medicine use in patients with arthritis, the types of complementary and alternative medicine used, pertinent socio-demographic factors associated with complementary and alternative medicine use and its perceived efficacy. Arthritis is a major health issue, and the use of complementary and alternative medicine among patients with arthritis is common. This is a descriptive cross-sectional study. Data were obtained from 250 patients with arthritis at the physiotherapy and immunology clinics Atatürk University Hospital in eastern Turkey between May-July 2005 using a questionnaire developed specifically for this study. The instrument included questions on socio-demographic information, disease specifics and complementary and alternative medicine usage. Seventy-six per cent of participants reported use of at least one form of complementary and alternative medicine in the previous year. Complementary and alternative medicine users and non-users were not significantly different in most socio-demographic characteristics including age, gender, marital status and education level with the exception of economic status. We categorised treatment into six complementary and alternative medicine categories: 62.6% of patients used thermal therapies; 41.5% used oral herbal therapies; 40.5% used hot therapies; 32.6% used externally applied (skin) therapies; 28.4% used massage and 12.6% used cold therapies. All forms of complementary and alternative medicine except thermal and oral herbal therapies were perceived as very effective by more than half of study participants. Complementary and alternative medicine therapy is widely used by patients with arthritis and has perceived beneficial effects. It is important for nurses and other health care professionals to be knowledgeable about the use of complementary and alternative medicine therapies when providing care to patients with arthritis because of

  14. A Similarity-Ranking Method on Semantic Computing for Providing Information-Services in Station-Concierge System

    Directory of Open Access Journals (Sweden)

    Motoki Yokoyama

    2017-07-01

    Full Text Available The prevalence of smartphones and wireless broadband networks have been progressing as a new Railway infomration environment. According to the spread of such devices and information technology, various types of information can be obtained from databases connected to the Internet. One scenario of obtaining such a wide variety of information resources is in the phase of user’s transportation. This paper proposes an information provision system, named the Station Concierge System that matches the situation and intention of passengers. The purpose of this system is to estimate the needs of passengers like station staff or hotel concierge and to provide information resources that satisfy user’s expectations dynamically. The most important module of the system is constructed based on a new information ranking method for passenger intention prediction and service recommendation. This method has three main features, which are (1 projecting a user to semantic vector space by using her current context, (2 predicting the intention of a user based on selecting a semantic vector subspace, and (3 ranking the services by a descending order of relevant scores to the user’ intention. By comparing the predicted results of our method with those of two straightforward computation methods, the experimental studies show the effectiveness and efficiency of the proposed method. Using this system, users can obtain transit information and service map that dynamically matches their context.

  15. Complementary and alternative interventions in atopic dermatitis.

    Science.gov (United States)

    Lee, Joohee; Bielory, Leonard

    2010-08-01

    The burden of atopic diseases, including atopic dermatitis (AD), is significant and far-reaching. In addition to cost of care and therapies, it affects the quality of life for those affected as well as their caretakers. Complementary and alternative therapies are commonly used because of concerns about potential adverse effects of conventional therapies and frustration with the lack of response to prescribed medications, be it due to the severity of the AD or the lack of appropriate regular use. Despite the promising results reported with various herbal medicines and biologic products, the clinical efficacy of such alternative therapies remains to be determined. Physicians need to be educated about alternative therapies and discuss benefits and potential adverse effects or limitations with patients. A systematic approach and awareness of reputable and easily accessible resources are helpful in dealing with complementary and alternative medicine (CAM). The use of CAM interventions is common among individuals with AD. Epidemiologic data have been a motivating drive for better elucidation of the efficacy of CAM interventions for allergic disease. Herbal medicines and biologics for AD treatment and, more recently, prevention comprise a major area of clinical investigation. Potential mechanisms of therapeutic effect elucidated by animal models and human clinical studies implicate modulation of TH2-type allergic inflammation and induction of immune tolerance. Population-based research regarding the use of CAM for allergic diseases underscores the increasing challenge for care providers with respect to identifying CAM use and ensuring safe use of allopathic and complementary medicines in disease management. Copyright 2010. Published by Elsevier Inc.

  16. Thyroid Disease and Complementary and Alternative Medicine (CAM)

    Science.gov (United States)

    ... Alternative Medicine in Thyroid Disease Complementary and Alternative Medicine in Thyroid Disease (CAM) WHAT IS COMPLEMENTARY AND ALTERNATIVE MEDICINE (CAM)? Complementary and Alternative Medicine (CAM) is defined ...

  17. Behavioural responses to hypoxia provide a non-invasive method for distinguishing between stress coping styles in fish

    DEFF Research Database (Denmark)

    Laursen, Danielle Caroline; Olsén, Hanna L.; Ruiz-Gomez, Maria de Lourdes

    2011-01-01

    . These individual differences may result in suboptimal production and compromised welfare in aquaculture. An approach to overcome these problems could be to sort fish and optimise rearing conditions according to coping style. It has been previously demonstrated that the proactive and reactive coping styles in fish......, these fish provided an opportunity for verifying a method for sorting fish with respect to coping style by exposure to hypoxia. Groups consisting of 24 individually tagged fish, 12 HR and 12 LR were exposed to hypoxia in a two choice system. The system consisted of a “home” tank provided with cover connected...... to a second brightly “illuminated” tank via a closable doorway. During the experiment, the doorway between the two tanks was opened and hypoxic conditions were gradually induced in the “home” tank by bubbling with nitrogen. The latency time to move away from hypoxic conditions to normoxic conditions...

  18. The paradox of compassionate work: a mixed-methods study of satisfying and fatiguing experiences of animal health care providers.

    Science.gov (United States)

    Polachek, Alicia J; Wallace, Jean E

    2018-03-01

    Compassionate work appears paradoxical as it may provide great rewards, but may also come at great costs to care providers. This paper explores the paradox of compassionate work by examining what interactions contribute to compassion satisfaction and what interactions contribute to compassion fatigue. This mixed-methods, cross-sectional study uses qualitative interview data from animal health care providers (N = 20) to identify work interactions that they find satisfying or stressful. Quantitative survey data (N = 572) are used to test hypotheses generated from the interviews regarding predictors of compassion satisfaction and compassion fatigue. Interview transcripts were analyzed using a directed content analysis approach. Survey data were analyzed using ordinary least squares regression. The results highlight the complex nature of compassionate work. As hypothesized, making a difference to animals and building relationships with animal patients and human clients relate to greater compassion satisfaction. Human client barriers to animal care and witnessing client grief relate to greater compassion fatigue, as predicted. None of the predictors relate to less compassion fatigue, but forming relationships with animal patients relates to both greater compassion satisfaction and compassion fatigue. This paper enhances our understanding of provider-client-patient interactions and highlights the paradox of compassionate work.

  19. runjags: An R Package Providing Interface Utilities, Model Templates, Parallel Computing Methods and Additional Distributions for MCMC Models in JAGS

    Directory of Open Access Journals (Sweden)

    Matthew J. Denwood

    2016-07-01

    Full Text Available The runjags package provides a set of interface functions to facilitate running Markov chain Monte Carlo models in JAGS from within R. Automated calculation of appropriate convergence and sample length diagnostics, user-friendly access to commonly used graphical outputs and summary statistics, and parallelized methods of running JAGS are provided. Template model specifications can be generated using a standard lme4-style formula interface to assist users less familiar with the BUGS syntax. Automated simulation study functions are implemented to facilitate model performance assessment, as well as drop-k type cross-validation studies, using high performance computing clusters such as those provided by parallel. A module extension for JAGS is also included within runjags, providing the Pareto family of distributions and a series of minimally-informative priors including the DuMouchel and half-Cauchy priors. This paper outlines the primary functions of this package, and gives an illustration of a simulation study to assess the sensitivity of two equivalent model formulations to different prior distributions.

  20. DETECTION OF REPORTS FALSIFICATION PROVIDED TO A BANK BY A BORROWER USING THE METHOD OF DYNAMIC PARAMETERS ANALYSIS

    Directory of Open Access Journals (Sweden)

    M. S. Lyuft

    2015-01-01

    Full Text Available Summary. The main stop-factors in a landing were formed in the article according to the procedure of the European Bank for Reconstruction and Development by the means of questioning the leading Russian banks that finance small-scale business. It is given the description of this method, also it is identified the main weaknesses of the EBRD methodology. There is a description of the main methods of the borrowing company’s analytical balance and thereupon it is made the conclusion about the necessity of the analysis of the balance’s principal factors across time. The analysis of indicators and factors in the dynamics enables us to see trends in the development of the company, and to identify deviations in the coefficients. Either materiality or difference from normal values of these coefficients may indicate the factors of the borrowers’ misconduct, and in particular it gives evidence concerning falsification of reports provided to a bank. There are stages of information processing for falsification’s detection, excluding the interest from decision-makers about the possibility of lending in the results of a transaction. The formula that determinates the value of net profit falsification has been made on basis of dynamic parameters of the analytical balance and the connection with the administrative profit-and-loss report. Further, the article provides the second method of a determination of the net profit falsification already based on data of the parameters in dynamics namely business profitability rate. The process of calculation Payment To Income - payment to income - an indicator, in order to obtain good data on who falsify net income. Are key strengths of this method of identifying and conclusions paragraph article.

  1. Attitudes toward and education about complementary and alternative medicine among adult patients with depression in Taiwan.

    Science.gov (United States)

    Hsu, Mei-Chi; Moyle, Wendy; Creedy, Debra; Venturato, Lorraine; Ouyang, Wen-Chen; Sun, Gwo-Ching

    2010-04-01

    To investigate patients' attitudes toward complementary and alternative medicine, the education nurses provided about complementary and alternative medicine for treating depression and to test whether such education mediates the effect of complementary and alternative medicine use and attitudes toward complementary and alternative medicine. Although we know that attitudes influence behaviour, very few studies simultaneously explore the relationship between attitudes, education and complementary and alternative medicine use. Survey. This study was conducted as part of a larger survey, using face-to-face survey interviews with 206 adult patients aged 50 years or over and hospitalised in conventional hospitals in Taiwan for treatment of depression. The attitudes toward complementary and alternative medicine and patient education about complementary and alternative medicine instruments were specially developed for the study. Participants expressed slightly favourable attitudes toward complementary and alternative medicine. Many participants (50%) expressed that they were willing to try any potential treatment for depression. They believed that complementary and alternative medicine helped them to feel better and to live a happier life. However, 66.5% of participants reported that they had inadequate knowledge of complementary and alternative medicine. Participants with a higher monthly income, longer depression duration and religious beliefs hold more positive attitudes toward complementary and alternative medicine. Most participants were not satisfied with the education they received about complementary and alternative medicine. Patient education about complementary and alternative medicine was found to be a mediator for the use of complementary and alternative medicine. Patient education from nurses may predict patients' attitudes toward complementary and alternative medicine. Continuing nursing education is needed to enable nurses to respond knowledgeably to

  2. Traditional, complementary, and alternative medicine approaches to mental health care and psychological wellbeing in India and China.

    Science.gov (United States)

    Thirthalli, Jagadisha; Zhou, Liang; Kumar, Kishore; Gao, Jie; Vaid, Henna; Liu, Huiming; Hankey, Alex; Wang, Guojun; Gangadhar, Bangalore N; Nie, Jing-Bao; Nichter, Mark

    2016-07-01

    India and China face the same challenge of having too few trained psychiatric personnel to manage effectively the substantial burden of mental illness within their population. At the same time, both countries have many practitioners of traditional, complementary, and alternative medicine who are a potential resource for delivery of mental health care. In our paper, part of The Lancet and Lancet Psychiatry's Series about the China-India Mental Health Alliance, we describe and compare types of traditional, complementary, and alternative medicine in India and China. Further, we provide a systematic overview of evidence assessing the effectiveness of these alternative approaches for mental illness and discuss challenges in research. We suggest how practitioners of traditional, complementary, and alternative medicine and mental health professionals might forge collaborative relationships to provide more accessible, affordable, and acceptable mental health care in India and China. A substantial proportion of individuals with mental illness use traditional, complementary, and alternative medicine, either exclusively or with biomedicine, for reasons ranging from faith and cultural congruence to accessibility, cost, and belief that these approaches are safe. Systematic reviews of the effectiveness of traditional, complementary, and alternative medicine find several approaches to be promising for treatment of mental illness, but most clinical trials included in these systematic reviews have methodological limitations. Contemporary methods to establish efficacy and safety-typically through randomised controlled trials-need to be complemented by other means. The community of practice built on collaborative relationships between practitioners of traditional, complementary, and alternative medicine and providers of mental health care holds promise in bridging the treatment gap in mental health care in India and China. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Digital photography provides a fast, reliable, and noninvasive method to estimate anthocyanin pigment concentration in reproductive and vegetative plant tissues.

    Science.gov (United States)

    Del Valle, José C; Gallardo-López, Antonio; Buide, Mª Luisa; Whittall, Justen B; Narbona, Eduardo

    2018-03-01

    Anthocyanin pigments have become a model trait for evolutionary ecology as they often provide adaptive benefits for plants. Anthocyanins have been traditionally quantified biochemically or more recently using spectral reflectance. However, both methods require destructive sampling and can be labor intensive and challenging with small samples. Recent advances in digital photography and image processing make it the method of choice for measuring color in the wild. Here, we use digital images as a quick, noninvasive method to estimate relative anthocyanin concentrations in species exhibiting color variation. Using a consumer-level digital camera and a free image processing toolbox, we extracted RGB values from digital images to generate color indices. We tested petals, stems, pedicels, and calyces of six species, which contain different types of anthocyanin pigments and exhibit different pigmentation patterns. Color indices were assessed by their correlation to biochemically determined anthocyanin concentrations. For comparison, we also calculated color indices from spectral reflectance and tested the correlation with anthocyanin concentration. Indices perform differently depending on the nature of the color variation. For both digital images and spectral reflectance, the most accurate estimates of anthocyanin concentration emerge from anthocyanin content-chroma ratio, anthocyanin content-chroma basic, and strength of green indices. Color indices derived from both digital images and spectral reflectance strongly correlate with biochemically determined anthocyanin concentration; however, the estimates from digital images performed better than spectral reflectance in terms of r 2 and normalized root-mean-square error. This was particularly noticeable in a species with striped petals, but in the case of striped calyces, both methods showed a comparable relationship with anthocyanin concentration. Using digital images brings new opportunities to accurately quantify the

  4. Development of quality indicators for low-risk labor care provided by midwives using a RAND-modified Delphi method.

    Science.gov (United States)

    Ueda, Kayo; Ohtera, Shosuke; Kaso, Misato; Nakayama, Takeo

    2017-09-22

    In childbirth, most deliveries are low-risk, defined as spontaneous labor at full term without special high-risk facts or complications, especially in high-resource countries where maternal and perinatal mortality rates are very low. Indeed, the majority of mothers and infants have no serious conditions during labor. However, the quality of care provided is not assured, and performance may vary by birthing facility and provider. The overuse of technology in childbirth in some parts of the world is almost certainly based on assumptions like, "something can go wrong at any minute." There is a need to assess the quality of care provided for mothers and infants in low-risk labor. We aimed to develop specific quality indicators for low-risk labor care provided primarily by midwives in Japan. We used a RAND-modified Delphi method, which integrates evidence review with expert consensus development. The procedure comprises five steps: (1) literature review, including clinical practice guidelines, to extract and develop quality indicator candidates; (2) formation of a multidisciplinary panel; (3) independent panel ratings (Round 1); (4) panel meeting and independent panel ratings (Round 2); and (5) independent panel ratings (Round 3). The three independent panel ratings (Rounds 1-3) were held between July and December 2012. The assembled multidisciplinary panel comprised eight clinicians (two pediatricians, three obstetricians, and three midwives) and three mothers who were nonclinicians. Evidentiary review extracted 166 key recommendations from 32 clinical practice guidelines, and 31 existing quality indicators were added. After excluding duplicate recommendations and quality indicators, the panel discussed 25 candidate indicators. Of these, 18 were adopted, one was modified, six were not adopted, and four were added during the meeting, respectively. We established 23 quality indicators for low-risk labor care provided by midwives in labor units in Japan.

  5. A mixed-methods examination of communication between oncologists and primary care providers among primary care physicians in underserved communities.

    Science.gov (United States)

    Shen, Megan Johnson; Binz-Scharf, Maria; D'Agostino, Tom; Blakeney, Natasha; Weiss, Elisa; Michaels, Margo; Patel, Shilpa; McKee, M Diane; Bylund, Carma L

    2015-03-15

    Research has demonstrated that communication and care coordination improve cancer patient outcomes. To improve communication and care coordination, it is important to understand primary care providers' (PCPs') perceptions of communication with oncologists as well as PCPs' communication needs. A mixed-methods approach was used in the present study. In the qualitative phase of the study, 18 PCPs practicing in underserved, minority communities were interviewed about their experiences communicating with oncologists. In the quantitative phase of the study, 128 PCPs completed an online survey about their preferences, experiences, and satisfaction with communication with oncologists. Results indicated a PCP-oncologist gap in communication occurred between diagnosis and treatment. PCPs wanted more communication with oncologists, updates on their patients' prognosis throughout treatment, and to be contacted via telephone or email and saw their role as crucial in providing supportive care for their patients. Although PCPs recognize that they play a critical, proactive role in supporting patients throughout the continuum of their cancer care experience, existing norms regarding postreferral engagement and oncologist-PCP communication often hinder activation of this role among PCPs. Expected standards regarding the method, frequency, and quality of postreferral communication should be jointly articulated and made accountable between PCPs and oncologists to help improve cancer patients' quality of care, particularly in minority communities. © 2014 American Cancer Society.

  6. Design of organic complementary circuits and systems on foil

    CERN Document Server

    Abdinia, Sahel; Cantatore, Eugenio

    2015-01-01

    This book describes new approaches to fabricate complementary organic electronics, and focuses on the design of circuits and practical systems created using these manufacturing approaches. The authors describe two state-of-the-art, complementary organic technologies, characteristics and modeling of their transistors and their capability to implement circuits and systems on foil. Readers will benefit from the valuable overview of the challenges and opportunities that these extremely innovative technologies provide. ·         Demonstrates first circuits implemented using specific complementary organic technologies, including first printed analog to digital converter, first dynamic logic on foil and largest complementary organic circuit ·         Includes step-by-step design from single transistor level to complete systems on foil ·         Provides a platform for comparing state-of-the-art complementary organic technologies and for comparing these with other similar technologies, spec...

  7. Complementary therapy use by women's health clinic clients.

    Science.gov (United States)

    Pettigrew, Amy C; King, Margaret O'Brien; McGee, Karen; Rudolph, Connie

    2004-01-01

    While it is known that more women than men use complementary and alternative therapies, it is important to look at women who are pregnant or possibly receiving hormonal therapy, as side effects and consequences of these therapies may have a significant effect on their health status. To assess women's knowledge, perceived effectiveness and use of 20 complementary and alternative therapies. Descriptive four-page questionnaire to obtain data on the use, reason for use, knowledge, perceived effectiveness, and sources of information of twenty complementary and alternative therapies. Women's Health Center at a large Midwestern hospital. A convenience sample of 250 women waiting to be seen by either a nurse midwife or obstetrician/gynecologist at an outpatient clinic. Sixty-nine percent of the participants used one or more complementary therapy. The most frequently used therapies included prayer, vitamins, massage, diet, and aromatherapy. The best predictor of use of each therapy was the participant's knowledge of the therapy. Participants generally rated the efficacy of the therapies higher than their knowledge level. Frequently cited sources of information were popular media and family. The least common information sources were nurse-midwives, drug stores, Internet, and other professional healthcare providers. Women in this setting use complementary therapies at a rate greater than the general population. The participants obtained a great deal of their information about the therapies from popular press, media, friends, and family members rather than from licensed healthcare providers.

  8. Family building using embryo adoption: relationships and contact arrangements between provider and recipient families-a mixed-methods study.

    Science.gov (United States)

    Frith, Lucy; Blyth, Eric; Lui, Steve

    2017-05-01

    What contact arrangements are established between providers and recipients of embryos using Snowflakes® Embryo Adoption Program? Contact arrangements varied considerably and were generally positively described, although some challenges were acknowledged. Reproductive technologies create new and diverse family forms, and the ways in which families created by embryo adoption are negotiated in practice have not been extensively investigated. This exploratory, mixed-methods study had two phases: (i) an online survey (open May-September 2013) and (ii) qualitative semi-structured interviews by email (conducted between 2014 and 2015), exploring participants' experiences of contact with their embryo provider or recipient. Phase I included 17 providers (14 women and 3 men) and 28 recipients (27 women and 1 man). Phase II included 8 providers (5 women and 3 men) and 12 recipients (10 women and 2 men). All participants, except one, were located in the US. This study illustrates how embryo adoption in the US, as a form of conditional donation, can operate and how the participants define and negotiate these emerging relationships. All families were open with their children about how they were conceived and early contact between recipients and providers (frequently before birth) was valued. On the whole, participants were happy with the amount and type of contact they had, and where the current contact did not involve the children, it was seen as a way of keeping the channels open for future contact when the children were older. Participants often portrayed the opportunities for contact as being in the best interests of the child. The study participants are a particular group who had chosen to either receive or give their embryos via a conditional embryo adoption agency in the US and had established contact. Therefore, this is not a representative sample of those who provide or receive embryos for family building. This embryo adoption model clearly fulfils a need; some people

  9. [Alternative and complementary medicine from the primary care physician's viewpoint].

    Science.gov (United States)

    Soós, Sándor Árpád; Eőry, Ajándék; Eőry, Ajándok; Harsányi, László; Kalabay, László

    2015-07-12

    The patients initiate the use of complementary and alternative medicine and this often remains hidden from their primary care physician. To explore general practitioners' knowledge and attitude towards complementary and alternative medicine, and study the need and appropriate forms of education, as well as ask their opinion on integration of alternative medicine into mainstream medicine. A voluntary anonymous questionnaire was used on two conferences for general practitioners organized by the Family Medicine Department of Semmelweis University. Complementary and alternative medicine was defined by the definition of the Hungarian Academy of Sciences and certified modalities were all listed. 194 general practitioners answered the questionnaire (39.8% response rate). 14% of the responders had licence in at least one of the complementary and alternative therapies, 45% used complementary and alternative therapy in their family in case of illness. It was the opinion of the majority (91.8%) that it was necessary to be familiar with every method used by their patients, however, 82.5% claimed not to have enough knowledge in complementary medicine. Graduate and postgraduate education in the field was thought to be necessary by 86% of the responders; increased odds for commitment in personal education was found among female general practitioners, less than 20 years professional experience and personal experience of alternative medicine. These data suggest that general practitioners would like to know more about complementary and alternative medicine modalities used by their patients. They consider education of medical professionals necessary and a special group is willing to undergo further education in the field.

  10. Complementary Feeding: Review of Recommendations, Feeding Practices and Adequacy of Homemade Complementary Food Preparations in Developing Countries – lessons from Ethiopia

    Directory of Open Access Journals (Sweden)

    Motuma A Abeshu

    2016-10-01

    Full Text Available Breastfeeding provides the ideal food during the first 6 months of life. Complementary feeding is the process starting when breast milk alone is no longer sufficient, the target age being between 6 to 23 months. The gap between nutritional requirement and amount obtained from breast milk increases with age. For energy, 200kcal, 300kcal and 550kcal per day is expected to be covered by complementary foods at 6-8, 9-11 and 12-23 months, respectively. In addition, the complementary foods must provide relatively large proportions of micronutrients such as: iron, zinc, phosphorus, magnesium, calcium and vitamin B6. In several parts of the developing world, complementary feeding continues as a challenge to good nutrition in children. In Ethiopia, only 4.2% of breastfed children of 6–23 months of age have a minimum acceptable diet. The gaps are mostly attributed to either poor dietary quality or poor feeding practices, if not both. Commercial fortified foods are often beyond the reach of the poor. Thus, homemade complementary foods remain commonly used. However, unfortified complementary foods that are predominantly plant-based provide insufficient amounts of key nutrients (particularly iron, zinc and calcium during the age of 6 – 23 months even, when based on an improved recipe. This review thus assessed complementary feeding practice and recommendation and reviewed the level of adequacy of homemade complementary foods.

  11. An analytical solution of Richards' equation providing the physical basis of SCS curve number method and its proportionality relationship

    Science.gov (United States)

    Hooshyar, Milad; Wang, Dingbao

    2016-08-01

    The empirical proportionality relationship, which indicates that the ratio of cumulative surface runoff and infiltration to their corresponding potentials are equal, is the basis of the extensively used Soil Conservation Service Curve Number (SCS-CN) method. The objective of this paper is to provide the physical basis of the SCS-CN method and its proportionality hypothesis from the infiltration excess runoff generation perspective. To achieve this purpose, an analytical solution of Richards' equation is derived for ponded infiltration in shallow water table environment under the following boundary conditions: (1) the soil is saturated at the land surface; and (2) there is a no-flux boundary which moves downward. The solution is established based on the assumptions of negligible gravitational effect, constant soil water diffusivity, and hydrostatic soil moisture profile between the no-flux boundary and water table. Based on the derived analytical solution, the proportionality hypothesis is a reasonable approximation for rainfall partitioning at the early stage of ponded infiltration in areas with a shallow water table for coarse textured soils.

  12. Evaluating the impact of healthcare provider training to improve tuberculosis management: a systematic review of methods and outcome indicators used.

    Science.gov (United States)

    Wu, Shishi; Roychowdhury, Imara; Khan, Mishal

    2017-03-01

    Developing human resources capacity is vital for tuberculosis (TB) control in low- and middle-income countries. Although investments in TB healthcare provider (HCP) training programmes have increased, it is unclear whether these are robustly evaluated. The objective of this systematic review was to synthesize the methods and outcome indicators used to assess TB HCP training programmes. A systematic scoping review of publications reporting on evaluations of training programmes for TB HCPs - including doctors, nurses, paramedics, and lay health workers - was conducted through a search in three electronic databases, Google Scholar, and five websites of non-profit organizations. Data on the study location, population trained, outcomes assessed, and evaluation approach were extracted. After screening 499 unique publications, 21 were eligible for inclusion in the analysis. The majority of evaluations were conducted in Africa. The most common evaluation methods were a review of patient records (n=8, 38%) and post-training interview with trainees (n=7, 33%). In terms of outcomes, more than half of the studies (n=12, 57%) evaluated knowledge acquisition of trainees, with only six (29%) assessing on-the-job behaviour change. Even though more funds have been invested in TB HCP training, publications from robust evaluations assessing the impact on quality of care and behaviour change are limited. Copyright © 2016. Published by Elsevier Ltd.

  13. Team dynamics, clinical work satisfaction, and patient care coordination between primary care providers: A mixed methods study.

    Science.gov (United States)

    Song, Hummy; Ryan, Molly; Tendulkar, Shalini; Fisher, Josephine; Martin, Julia; Peters, Antoinette S; Frolkis, Joseph P; Rosenthal, Meredith B; Chien, Alyna T; Singer, Sara J

    Team-based care is essential for delivering high-quality, comprehensive, and coordinated care. Despite considerable research about the effects of team-based care on patient outcomes, few studies have examined how team dynamics relate to provider outcomes. The aim of this study was to examine relationships among team dynamics, primary care provider (PCP) clinical work satisfaction, and patient care coordination between PCPs in 18 Harvard-affiliated primary care practices participating in Harvard's Academic Innovations Collaborative. First, we administered a cross-sectional survey to all 548 PCPs (267 attending clinicians, 281 resident physicians) working at participating practices; 65% responded. We assessed the relationship of team dynamics with PCPs' clinical work satisfaction and perception of patient care coordination between PCPs, respectively, and the potential mediating effect of patient care coordination on the relationship between team dynamics and work satisfaction. In addition, we embedded a qualitative evaluation within the quantitative evaluation to achieve a convergent mixed methods design to help us better understand our findings and illuminate relationships among key variables. Better team dynamics were positively associated with clinical work satisfaction and quality of patient care coordination between PCPs. Coordination partially mediated the relationship between team dynamics and satisfaction for attending clinicians, suggesting that higher satisfaction depends, in part, on better teamwork, yielding more coordinated patient care. We found no mediating effects for resident physicians. Qualitative results suggest that sources of satisfaction from positive team dynamics for PCPs may be most relevant to attending clinicians. Improving primary care team dynamics could improve clinical work satisfaction among PCPs and patient care coordination between PCPs. In addition to improving outcomes that directly concern health care providers, efforts to

  14. VIEWS OF LECTURERS ON COMPLEMENTARY METHODS OF MEASUREMENT AND EVALUATION THAT CAN BE USED IN BASIC ENGLISH TEACHING AT UNIVERSITY LEVEL ÖĞRETİM ELEMANLARININ ÜNİVERSİTE DÜZEYİNDEKİ TEMEL İNGİLİZCE ÖĞRETİMİNDE KULLANILABİLECEK TAMAMLAYICI ÖLÇME VE DEĞERLENDİRME YÖNTEMLERİNE İLİŞKİN GÖRÜŞLERİ

    Directory of Open Access Journals (Sweden)

    Ayşenur DÖNDER

    2012-01-01

    Full Text Available The purpose of this study is to determine the ideas and opinions of lecturers on complementary measurement and evaluation methods which are used or can be used in teaching of Basic English at universities and provide possible suggestions. The method of the study was designed as a qualitative case study research model. Participants were determined through easy reachable sampling. The study population included 75 lecturers carrying out researches in the field of English and working in Fırat University, İnönü University and Cumhuriyet University. The samples were 53 lecturer reached from this population. The data were applied through the Likert-type questionnaire which was developed by the researchers and received expert opinions. Opinions of the lecturers on the process of complementary measurement and evaluation; the knowledge levels of the lecturers about complementary measurement and evaluation methods and the use of them were analyzed together with the frequencies and interpreted without taking the gender variable into account.The results of the study revealed that even though the lecturers who participated in the study are familiar with the complementary measurement and assessment methods, and additionally they believe in the importance and benefits of the complementary methods, paperpencil method known as the classical method in measurement and evaluation is the most commonly used method. Crowded classes and limited time that can be argued as two main reasons the lecturers encounter during the process of complementary measurement and evaluation. Reluctance of students, lack of in-service training, students’ unfamiliarity with the techniques of complementary measurement and evaluation take place as other reasons the lecturers face in applying complementary measurement and evaluation. Bu araştırmanın amacı, öğretim elemanlarının üniversitelerde verilen temel İngilizce öğretiminde kullanılan ve kullanılabilecek tamamlay

  15. Determination of complementary therapies for prevention of striae gravidarum

    Directory of Open Access Journals (Sweden)

    Gamze Teskereci

    2018-03-01

    Full Text Available Background and Design: Striae gravidarum (SG has been reported to be associated with various factors, but the role of complementary therapies in the prevention of SG is still not well understood. The aim of this study was to determine complementary therapies for prevention of SG. Materials and Methods: This descriptive research was conducted on 120 pregnant women in a maternity clinic at a university hospital. Of 120 women, 49 were going through the last trimester and 71 were going through their first postpartum 24 hours. Data were collected using a 25-item-questionnaire through face-to-face interviews between June and July in 2016. Obtained data were evaluated by using descriptive statistics, chi-square test and the Kruskal-Wallis test. Results: 90.8% of women had SG. For the prevention of SG, 46.7% of women used massage, a manipulative body-based complementary therapy, 55.2% used oils, 28.6% used creams and 8.0% used a mixture of creams and oils for massaging. 42.9% of women started to use complementary therapies in their first trimester. Half of the women stated that they had received information about complementary therapies. A significantly lower rate of women using massage had SG compared to those not using massage (p=0.023. Conclusion: It was concluded that nearly half of the women used massage for the prevention of SG. In addition, massage application was found to reduce the occurrence of SG.

  16. Systematic reviews of complementary therapies – an annotated bibliography. Part 3: Homeopathy

    Science.gov (United States)

    Linde, Klaus; Hondras, Maria; Vickers, Andrew; Riet, Gerben ter; Melchart, Dieter

    2001-01-01

    Background Complementary therapies are widespread but controversial. We aim to provide a comprehensive collection and a summary of systematic reviews of clinical trials in three major complementary therapies (acupuncture, herbal medicine, homeopathy). This article is dealing with homeopathy. Potentially relevant reviews were searched through the register of the Cochrane Complementary Medicine Field, the Cochrane Library, Medline, and bibliographies of articles and books. To be included articles had to review prospective clinical trials of homeopathy; had to describe review methods explicitly; had to be published; and had to focus on treatment effects. Information on conditions, interventions, methods, results and conclusions was extracted using a pretested form and summarized descriptively. Results Eighteen out of 22 potentially relevant reviews preselected in the screening process met the inclusion criteria. Six reviews addressed the question whether homeopathy is effective across conditions and interventions. The majority of available trials seem to report positive results but the evidence is not convincing. For isopathic nosodes for allergic conditions, oscillococcinum for influenza-like syndromes and galphimia for pollinosis the evidence is promising while in other areas reviewed the results are equivocal. Interpretation Reviews on homeopathy often address general questions. While the evidence is promising for some topics the findings of the available reviews are unlikely to end the controversy on this therapy. PMID:11527508

  17. The scientific basis of alternative and complementary intervention in ...

    African Journals Online (AJOL)

    It is noted that some complementary treatment methods are not pharmacological in nature but employs natural forces, which are energy of some sorts. From the mass-energy equivalence known to orthodox science it is easy to conclude that every matter is crystallized energy and therefore all that exists in nature is energy in ...

  18. Infant Feeding Practices and the Effect of Early Complementary ...

    African Journals Online (AJOL)

    Objective: The objective of this study was to determine infant feeding practices and the effect of early complementary feeding on the nutritional status of children in Makada Community, Sabon Gari Local Government Area (LGA), Kaduna State, Nigeria. Materials and Methods: A cross-sectional survey was carried out.

  19. An insight into the use of complementary and alternative medicines ...

    African Journals Online (AJOL)

    Background: Complementary and alternative medicines (CAM) are increasingly popular globally with frequent use amongst patients with atopic eczema (AE). Despite increased AE prevalence in South Africa (SA), no local data on CAM-use for this disease exists. Methods: A cross-sectional study utilizing a comprehensive ...

  20. The Financing of Complementary Currencies: Problems and Perspectives

    NARCIS (Netherlands)

    R.F.H. Schroeder (Rolf)

    2015-01-01

    textabstractCosts and cost coverage of complementary currencies has been neglected by researchers so far. This article provides an analysis of the different types of costs incurred and asks for appropriate means of financing such projects. External public and private sources are discussed in a

  1. Evidence-based practice beliefs and behaviors of nurses providing cancer pain management: a mixed-methods approach.

    Science.gov (United States)

    Eaton, Linda H; Meins, Alexa R; Mitchell, Pamela H; Voss, Joachim; Doorenbos, Ardith Z

    2015-03-01

    To describe evidence-based practice (EBP) beliefs and behaviors of nurses who provide cancer pain management. Descriptive, cross-sectional with a mixed-methods approach. Two inpatient oncology units in the Pacific Northwest. 40 RNs.
 Data collected by interviews and web-based surveys. EBP beliefs, EBP implementation, evidence-based pain management. Nurses agreed with the positive aspects of EBP and their implementation ability, although implementation level was low. They were satisfied with their pain management practices. Oncology nursing certification was associated with innovativeness, and innovativeness was associated with EBP beliefs. Themes identified were (a) limited definition of EBP, (b) varied evidence-based pain management decision making, (c) limited identification of evidence-based pain management practices, and (d) integration of nonpharmacologic interventions into patient care. Nurses' low level of EBP implementation in the context of pain management was explained by their trust that standards of care and medical orders were evidence-based. Nurses' EBP beliefs and behaviors should be considered when developing strategies for sustaining evidence-based pain management practices. Implementation of the EBP process by nurses may not be realistic in the inpatient setting; therefore, hospital pain management policies need to be evidence-based and reinforced with nurses.

  2. Special Section: Complementary and Alternative Medicine (CAM):Quiz on Complementary and Alternative Medicine

    Science.gov (United States)

    ... Special Section CAM Quiz on Complementary and Alternative Medicine Past Issues / Winter 2009 Table of Contents For ... low back pain. True False Complementary and alternative medicine (CAM) includes: Meditation Chiropractic Use of natural products, ...

  3. Attitudes towards holistic complementary and alternative medicine: a sample of healthy people in Turkey.

    Science.gov (United States)

    Erci, Behice

    2007-04-01

    This study aimed to investigate the attitude towards holistic complementary and alternative medicine of healthy people, and to evaluate the relationship between attitude towards holistic complementary and alternative medicine and the characteristics of the participants. Complementary and alternative medicines are becoming more accepted. This study used descriptive and correlational designs. The study included healthy individuals who attended or visited a primary care centre for healthcare services. The sample of the study consisted of 448 persons who responded to the questionnaire. The Attitude towards Holistic Complementary and Alternative Medicine scale consisted of 11 items on a six-point, and two subscales. The mean score of holistic complementary and alternative medicine was studied in relation to attributes and holistic complementary and alternative medicine. The mean score on the scale was 58.1 SD 4.1 point, and in terms of the mean score of the scale, the sample group showed a negative attitude towards holistic complementary and alternative medicine and one subscale. Demographic characteristics of the sample group affected attitudes towards holistic complementary and alternative medicine and both subscales. In light of these results, it is clear that healthy Turkish population have a tendency towards conventional medicine. Health professionals caring for healthy people should provide comprehensive care that addresses the physical, psychosocial and spiritual needs of the individual; they could provide the consultation regarding to different patterns of complementary therapies.

  4. Qualitative content analysis of complementary topical therapies ...

    African Journals Online (AJOL)

    In order to alleviate diabetic foot problems, patients sometimes seek complementary therapies outside the professional context. This paper describes the use of complementary remedies as a topical treatment for diabetic foot ulcers among Jordanians. Qualitative content analysis was used to analyse written responses of 68 ...

  5. Complementary feeding: a commentary by the ESPGHAN Committee on Nutrition.

    Science.gov (United States)

    Agostoni, Carlo; Decsi, Tamas; Fewtrell, Mary; Goulet, Olivier; Kolacek, Sanja; Koletzko, Berthold; Michaelsen, Kim Fleischer; Moreno, Luis; Puntis, John; Rigo, Jacques; Shamir, Raanan; Szajewska, Hania; Turck, Dominique; van Goudoever, Johannes

    2008-01-01

    This position paper on complementary feeding summarizes evidence for health effects of complementary foods. It focuses on healthy infants in Europe. After reviewing current knowledge and practices, we have formulated these conclusions: Exclusive or full breast-feeding for about 6 months is a desirable goal. Complementary feeding (ie, solid foods and liquids other than breast milk or infant formula and follow-on formula) should not be introduced before 17 weeks and not later than 26 weeks. There is no convincing scientific evidence that avoidance or delayed introduction of potentially allergenic foods, such as fish and eggs, reduces allergies, either in infants considered at increased risk for the development of allergy or in those not considered to be at increased risk. During the complementary feeding period, >90% of the iron requirements of a breast-fed infant must be met by complementary foods, which should provide sufficient bioavailable iron. Cow's milk is a poor source of iron and should not be used as the main drink before 12 months, although small volumes may be added to complementary foods. It is prudent to avoid both early (or=7 months) introduction of gluten, and to introduce gluten gradually while the infant is still breast-fed, inasmuch as this may reduce the risk of celiac disease, type 1 diabetes mellitus, and wheat allergy. Infants and young children receiving a vegetarian diet should receive a sufficient amount ( approximately 500 mL) of breast milk or formula and dairy products. Infants and young children should not be fed a vegan diet.

  6. Complementary and Alternative Medicines: Usage and Its Determinant Factors Among Outpatients in Southeast of Iran.

    Science.gov (United States)

    Ghaedi, Fateme; Dehghan, Mahlagha; Salari, Masoumeh; Sheikhrabori, Akbar

    2015-12-13

    Prevalence of complementary and alternative medicines is increasing specially in patients with chronic diseases. Therefore, based on the high prevalence of chronic disorders, the present study aimed to determine complementary and alternative medicine usage frequency and its determinant factors. This was a cross-sectional study. Five hundred clients participated in the study by using convenience sampling. A 2-part questionnaire (including demographic form and researcher-created questionnaire) was used for studying the prevalence of using complementary and alternative medicine methods, and users' satisfaction. Findings showed that 75.4% of people used at least one complementary and alternative medicine method. Most of users consumed medicinal plants (69.4%). The most common reason of using a complementary and alternative medicine method was common cold (32.9%). The highest satisfaction belonged to massage (2.94 ± 0.74). The usage of complementary and alternative medicine was 3.22 times higher in people with academic educations when compared with illiterate people. Concerning the high usage of complementary and alternative medicine, it is necessary to train specialists in this field in order to offer such treatments in a safe manner. Also, outcomes of application of complementary and alternative medicine methods should be studied. © The Author(s) 2015.

  7. Um método para a implantação e promoção de acesso às Práticas Integrativas e Complementares na Atenção Primária à Saúde A method for the implementation and promotion of access to comprehensive and complementary primary healthcare practices

    Directory of Open Access Journals (Sweden)

    Melissa Costa Santos

    2012-11-01

    Full Text Available A oferta de Práticas Integrativas e Complementares no Sistema Único de Saúde é estimulada para ampliar a integralidade da atenção e o acesso às mesmas, mas é um desafio incorporá-las aos serviços. Nosso objetivo é apresentar um método de implantação das PIC na Atenção Primária à Saúde, derivado da análise de experiências municipais, resultado parcial de estudo de mestrado cuja metodologia foi a pesquisa-ação. O método envolve 4 fases:1 - definição do núcleo responsável pela implantação e sua solidificação; 2 - análise situacional, com mapeamento de profissionais competentes já existentes; 3 - regulamentação, organização do acesso e legitimação; 4 - ciclo de implantação: pactuação de planos locais, tutoria e atividades de educação permanente em saúde. As fases são descritas, fundamentadas e sucintamente discutidas. O método estimula o desenvolvimento de ações racionais e sustentáveis, fomenta a gestão participativa, a construção da integralidade e a ampliação responsável do cuidado realizado na Atenção Primária à Saúde através da oferta progressiva e sustentável de Práticas Integrativas e Complementares.The rendering of integrated and complementary practices in the Brazilian Unified Health System is fostered to increase the comprehensiveness of care and access to same, though it is a challenge to incorporate them into the services. Our objective is to provide a simple method of implementation of such practices in Primary Healthcare, derived from analysis of experiences in municipalities, using partial results of a master's thesis that employed research-action methodology. The method involves four stages: 1 - defininition of a nucleus responsible for implementation and consolidation thereof; 2 - situational analysis, with definition of the existing competent professionals; 3 - regulation, organization of access and legitimation; and 4 - implementation cycle: local plans, mentoring

  8. Evaluation of programs to improve complementary feeding in infants and young children.

    Science.gov (United States)

    Frongillo, Edward A

    2017-10-01

    Evaluation of complementary feeding programs is needed to enhance knowledge on what works, to document responsible use of resources, and for advocacy. Evaluation is done during program conceptualization and design, implementation, and determination of effectiveness. This paper explains the role of evaluation in the advancement of complementary feeding programs, presenting concepts and methods and illustrating them through examples. Planning and investments for evaluations should occur from the beginning of the project life cycle. Essential to evaluation is articulation of a program theory on how change would occur and what program actions are required for change. Analysis of program impact pathways makes explicit the dynamic connections in the program theory and accounts for contextual factors that could influence program effectiveness. Evaluating implementation functioning is done through addressing questions about needs, coverage, provision, and utilization using information obtained from process evaluation, operations research, and monitoring. Evaluating effectiveness is done through assessing impact, efficiency, coverage, process, and causality. Plausibility designs ask whether the program seemed to have an effect above and beyond external influences, often using a nonrandomized control group and baseline and end line measures. Probability designs ask whether there was an effect using a randomized control group. Evaluations may not be able to use randomization, particularly for programs implemented at a large scale. Plausibility designs, innovative designs, or innovative combinations of designs sometimes are best able to provide useful information. Further work is needed to develop practical designs for evaluation of large-scale country programs on complementary feeding. © 2017 John Wiley & Sons Ltd.

  9. How Complementary and Alternative Medicine Practitioners Use PubMed

    Science.gov (United States)

    Quint-Rapoport, Mia

    2007-01-01

    Background PubMed is the largest bibliographic index in the life sciences. It is freely available online and is used by professionals and the public to learn more about medical research. While primarily intended to serve researchers, PubMed provides an array of tools and services that can help a wider readership in the location, comprehension, evaluation, and utilization of medical research. Objective This study sought to establish the potential contributions made by a range of PubMed tools and services to the use of the database by complementary and alternative medicine practitioners. Methods In this study, 10 chiropractors, 7 registered massage therapists, and a homeopath (N = 18), 11 with prior research training and 7 without, were taken through a 2-hour introductory session with PubMed. The 10 PubMed tools and services considered in this study can be divided into three functions: (1) information retrieval (Boolean Search, Limits, Related Articles, Author Links, MeSH), (2) information access (Publisher Link, LinkOut, Bookshelf ), and (3) information management (History, Send To, Email Alert). Participants were introduced to between six and 10 of these tools and services. The participants were asked to provide feedback on the value of each tool or service in terms of their information needs, which was ranked as positive, positive with emphasis, negative, or indifferent. Results The participants in this study expressed an interest in the three types of PubMed tools and services (information retrieval, access, and management), with less well-regarded tools including MeSH Database and Bookshelf. In terms of their comprehension of the research, the tools and services led the participants to reflect on their understanding as well as their critical reading and use of the research. There was universal support among the participants for greater access to complete articles, beyond the approximately 15% that are currently open access. The abstracts provided by PubMed were

  10. Use of complementary and alternative medicine by patients with cancer in northern Turkey: analysis of cost and satisfaction.

    Science.gov (United States)

    Aydin Avci, Ilknur; Koç, Zeliha; Sağlam, Zeynep

    2012-03-01

    The aims of this study were to determine (1) the prevalence of complementary and alternative medicine use among patients with cancer, (2) the method of use of the particular therapy, (3) the reasons for using complementary and alternative medicine therapies, (4) the benefits experienced by the use of complementary and alternative medicine, (5) the source of information about complementary and alternative medicine therapies and, (6) the satisfaction and cost of complementary and alternative medicine. Complementary and alternative medicine consists of diverse medical and healthcare systems, practices and products that are not considered at present to be a part of conventional medicine. The majority of patients who use complementary and alternative medicine use more than one method. Complementary and alternative medicine use is more common in cases of advanced disease or poor prognosis. This is a descriptive study of complementary and alternative medicine. This study was conducted in the Chemotherapy Unit at Ondokuz Mayıs University, Faculty of Medicine, Samsun, Turkey, between 18 March 2008-30 June 2008. Two hundred fifty-three patients with cancer, among 281 patients who applied to the chemotherapy clinic between these dates, agreed to take part in the study with whom contact could be made were included. A questionnaire including descriptive characteristics in collecting data, characteristics about diseases and their treatments, complementary and alternative medicine information and implementation situations and a control list about complementary and alternative medicine implementations were given. The collected data were evaluated by computer using descriptive statistics, the chi-square test and Student's t-test. In this study, 94·1% of the patients were content with medical treatment, 58·9% of them used complementary and alternative medicine treatments, 41·1% did not use any complementary and alternative medicine treatments. The satisfaction level of the

  11. Size-specific dose estimate (SSDE) provides a simple method to calculate organ dose for pediatric CT examinations

    Energy Technology Data Exchange (ETDEWEB)

    Moore, Bria M.; Brady, Samuel L., E-mail: samuel.brady@stjude.org; Kaufman, Robert A. [Department of Radiological Sciences, St Jude Children' s Research Hospital, Memphis, Tennessee 38105 (United States); Mirro, Amy E. [Department of Biomedical Engineering, Washington University, St Louis, Missouri 63130 (United States)

    2014-07-15

    Purpose: To investigate the correlation of size-specific dose estimate (SSDE) with absorbed organ dose, and to develop a simple methodology for estimating patient organ dose in a pediatric population (5–55 kg). Methods: Four physical anthropomorphic phantoms representing a range of pediatric body habitus were scanned with metal oxide semiconductor field effect transistor (MOSFET) dosimeters placed at 23 organ locations to determine absolute organ dose. Phantom absolute organ dose was divided by phantom SSDE to determine correlation between organ dose and SSDE. Organ dose correlation factors (CF{sub SSDE}{sup organ}) were then multiplied by patient-specific SSDE to estimate patient organ dose. The CF{sub SSDE}{sup organ} were used to retrospectively estimate individual organ doses from 352 chest and 241 abdominopelvic pediatric CT examinations, where mean patient weight was 22 kg ± 15 (range 5–55 kg), and mean patient age was 6 yrs ± 5 (range 4 months to 23 yrs). Patient organ dose estimates were compared to published pediatric Monte Carlo study results. Results: Phantom effective diameters were matched with patient population effective diameters to within 4 cm; thus, showing appropriate scalability of the phantoms across the entire pediatric population in this study. IndividualCF{sub SSDE}{sup organ} were determined for a total of 23 organs in the chest and abdominopelvic region across nine weight subcategories. For organs fully covered by the scan volume, correlation in the chest (average 1.1; range 0.7–1.4) and abdominopelvic region (average 0.9; range 0.7–1.3) was near unity. For organ/tissue that extended beyond the scan volume (i.e., skin, bone marrow, and bone surface), correlation was determined to be poor (average 0.3; range: 0.1–0.4) for both the chest and abdominopelvic regions, respectively. A means to estimate patient organ dose was demonstrated. Calculated patient organ dose, using patient SSDE and CF{sub SSDE}{sup organ}, was compared to

  12. The Patient-Provider Relationship Is Associated with Hepatitis C Treatment Eligibility: A Prospective Mixed-Methods Cohort Study.

    Directory of Open Access Journals (Sweden)

    Shari S Rogal

    Full Text Available Hepatitis C virus (HCV treatment has the potential to cure the leading cause of cirrhosis and hepatocellular carcinoma. However, only those deemed eligible for treatment have the possibility of this cure. Therefore, understanding the determinants of HCV treatment eligibility is critical. Given that effective communication with and trust in healthcare providers significantly influences treatment eligibility decisions in other diseases, we aimed to understand patient-provider interactions in the HCV treatment eligibility process. This prospective cohort study was conducted in the VA Pittsburgh Healthcare System. Patients were recruited after referral for gastroenterology consultation for HCV treatment with interferon and ribavirin. Consented patients completed semi-structured interviews and validated measures of depression, substance and alcohol use, and HCV knowledge. Two coders analyzed the semi-structured interviews. Factors associated with patient eligibility for interferon-based therapy were assessed using multivariate logistic regression. Of 339 subjects included in this analysis, only 56 (16.5% were deemed eligible for HCV therapy by gastroenterology (GI providers. In the multivariate logistic regression, patients who were older (OR = 0.96, 95%CI = 0.92-0.99, p = .049, reported concerns about the GI provider (OR = 0.40, 95%CI = 0.10-0.87, p = 0.02 and had depression symptoms (OR = 0.32, 95%CI = 0.17-0.63, p = 0.001 were less likely to be eligible. Patients described barriers that included feeling stigmatized and poor provider interpersonal or communication skills. In conclusion, we found that patients' perceptions of the relationship with their GI providers were associated with treatment eligibility. Establishing trust and effective communication channels between patients and providers may lower barriers to potential HCV cure.

  13. complementary techniques of percutaneous closure of ductus

    African Journals Online (AJOL)

    2013-07-07

    Jul 7, 2013 ... the complementary use of either type of devices to close small and ... complete occlusion of the ductus. 2F ... release of the device showing complete occlusion. 3E ..... Raskinds prosthesis Circulation 1989; 80:1706-1710 . 5.

  14. Irritable Bowel Syndrome and Complementary Health Practices

    Science.gov (United States)

    ... IBS) in adults: conventional and complementary/alternative approaches. Alternative Medicine Review. 2011;16(2):134–151. Herbal Supplements Shi J, Tong Y, Shen JG, et al. Effectiveness and safety of herbal medicines in the treatment ...

  15. Corporates governance: a complementary model for multi ...

    African Journals Online (AJOL)

    Corporates governance: a complementary model for multi frameworks and tools. ... Organization became highly needed to transform and convert the available legacy of fragmented solutions and ... Also Data considered as a vital part of the .

  16. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  17. African Journal of Traditional, Complementary and Alternative ...

    African Journals Online (AJOL)

    African Journal of Traditional, Complementary and Alternative Medicines. ... extracts of three Togolese medicinal plants against ESBL Klebsiella pneumoniae strains ... Ethnobotanical survey of medicinal plants used in the management of ...

  18. Alternative and Complementary Therapies for Hepatitis C

    Science.gov (United States)

    ... and Complementary Therapies Viral Hepatitis Menu Menu Viral Hepatitis Viral Hepatitis Home For Veterans and the Public Veterans ... treatments which have been proven to reduce the hepatitis C viral load. Just because something is "natural" (an herb, ...

  19. African Journal of Traditional, Complementary and Alternative ...

    African Journals Online (AJOL)

    These observations could be explained by some qualitative and /or quantitative differences observed between the constituents of the two essential oils studied. Keywords: Cymbopogon nardus, Essential oil, Chemistry, Analgesic, Comparison, Benin, Congo. African Journal of Traditional and Complementary Medicine Vol.

  20. African Journal of Traditional, Complementary and Alternative ...

    African Journals Online (AJOL)

    AJTCAM), a new broad-based journal, is founded on two key tenets: To publish exciting research in all areas of applied medicinal plants, Traditional medicines, Complementary Alternative Medicines, food and agricultural technologies, and ...

  1. Complementary method of analyzing the quality of the implant I-125 seeds for prostate brachytherapy using ultrasound imaging post-implant; Metodo complementario de analisis de la calidad del implante de semillas de I-125 para braquiterapia de prostata mediante la adquisicion de imagenes ecograficas post-implante

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez Dominguez, M.; Carrasco Herrera, M.; Baeza Trujillo, M.; Herrador Cordoba, M.

    2011-07-01

    In this paper we propose a complementary method based on Longitudinal mode ultrasound images acquired the same day of surgery, at the end of the implant. This option will allow us to evaluate the dosimetry end of treatment with the patient in the same position he was planning and to the rectum and bladder just as full. This will permit the identification of bodies and the seeds of interest more easily and will have a reference with which to compare one month later, when the CT images can also detect whether there has been some migration.

  2. A Post-Final Assignment for the Methods Course: Providing an Incentive to Professional Growth for Future Teachers.

    Science.gov (United States)

    Bentley, Michael L.

    This paper describes J. Rosengren's post-final assignment and M. Harmin's truth signs activity that were incorporated into a secondary science methods course for preservice teachers. The strength of the post-final assignment is that it is a strategy for extending student learning past the end of a course and even beyond the initial teaching…

  3. New Technologies Provide Quantum Changes in the Scale, Speed, and Success of SELEX Methods and Aptamer Characterization

    Directory of Open Access Journals (Sweden)

    Abdullah Ozer

    2014-01-01

    Full Text Available Single-stranded oligonucleotide aptamers have attracted great attention in the past decade because of their diagnostic and therapeutic potential. These versatile, high affinity and specificity reagents are selected by an iterative in vitro process called SELEX, Systematic Evolution of Ligands by Exponential Enrichment. Numerous SELEX methods have been developed for aptamer selections; some that are simple and straightforward, and some that are specialized and complicated. The method of SELEX is crucial for selection of an aptamer with desired properties; however, success also depends on the starting aptamer library, the target molecule, aptamer enrichment monitoring assays, and finally, the analysis and characterization of selected aptamers. Here, we summarize key recent developments in aptamer selection methods, as well as other aspects of aptamer selection that have significant impact on the outcome. We discuss potential pitfalls and limitations in the selection process with an eye to aid researchers in the choice of a proper SELEX strategy, and we highlight areas where further developments and improvements are desired. We believe carefully designed multiplexed selection methods, when complemented with high-throughput downstream analysis and characterization assays, will yield numerous high-affinity aptamers to protein and small molecule targets, and thereby generate a vast array of reagents for probing basic biological mechanisms and implementing new diagnostic and therapeutic applications in the near future.

  4. 47 CFR 52.31 - Deployment of long-term database methods for number portability by CMRS providers.

    Science.gov (United States)

    2010-10-01

    ... require software but not hardware changes to provide portability (“Hardware Capable Switches”), within 60... queries, so that they can deliver calls from their networks to any party that has retained its number after switching from one telecommunications carrier to another. (c) [Reserved] (d) In the event a...

  5. An optical device capable of providing a structural color, and a corresponding method of manufacturing such a device

    DEFF Research Database (Denmark)

    2014-01-01

    ) with respect to the average surface positions. The position, size, and randomness of the protrusions are arranged so as to provide, at least up to a maximum angle of incidence (A_in) with respect to a normal to the surface, an angle-independent substantially homogeneous structural color perception for a normal...

  6. The impact of NHS based primary care complementary therapy services on health outcomes and NHS costs: a review of service audits and evaluations

    Directory of Open Access Journals (Sweden)

    Wye Lesley

    2009-03-01

    Full Text Available Abstract Background The aim of this study was to review evaluations and audits of primary care complementary therapy services to determine the impact of these services on improving health outcomes and reducing NHS costs. Our intention is to help service users, service providers, clinicians and NHS commissioners make informed decisions about the potential of NHS based complementary therapy services. Methods We searched for published and unpublished studies of NHS based primary care complementary therapy services located in England and Wales from November 2003 to April 2008. We identified the type of information included in each document and extracted comparable data on health outcomes and NHS costs (e.g. prescriptions and GP consultations. Results Twenty-one documents for 14 services met our inclusion criteria. Overall, the quality of the studies was poor, so few conclusions can be made. One controlled and eleven uncontrolled studies using SF36 or MYMOP indicated that primary care complementary therapy services had moderate to strong impact on health status scores. Data on the impact of primary care complementary therapy services on NHS costs were scarcer and inconclusive. One controlled study of a medical osteopathy service found that service users did not decrease their use of NHS resources. Conclusion To improve the quality of evaluations, we urge those evaluating complementary therapy services to use standardised health outcome tools, calculate confidence intervals and collect NHS cost data from GP medical records. Further discussion is needed on ways to standardise the collection and reporting of NHS cost data in primary care complementary therapy services evaluations.

  7. Treatment of complementary events in constructing the linked Level 1 and Level 2 fault trees

    International Nuclear Information System (INIS)

    Jo, Young G.; Ahn, Kwang-Il

    2009-01-01

    Complementary events in the event trees for a PRA model should be treated properly in order to evaluate plant risk correctly. In this paper, the characteristics of the following three different cutset generation methods were investigated first in order to find the best practical way for treating complementary events: (1) exact method which treats complementary events logically, (2) no-delete term method which does not treat complementary events at all, and (3) delete term method which treats complementary events by deleting nonsense cutsets which are generated as a result of ignoring complementary events. Then, practical methods for treating complementary events in constructing linked fault trees for Level 1 and Level 2 PRA were suggested and demonstrated. The suggested methods deal with the following selected four typical cases: (1) Case 1-an event tree event (E) is represented by a fault tree gate whose inputs consist of only fault tree gates, (2) Case 2-E is represented by a single basic event, (3) Case 3-E is represented by an OR fault tree gate which has a single basic event and a fault tree gate as inputs, and (4) Case 4-E is represented by an AND fault tree gate which has a single basic event and a fault tree gate as inputs. In the suggested methods, first the high level logic structures of event tree events are examined and restructured, if needed. Then, the delete term method, the exact method, and the combination of the two methods are applied to through Case 1 to Case 4, respectively. As a result, it is recommended to treat complementary events, using the suggested methods, before Level 1 and Level 2 PRA fault trees are coupled

  8. Researching complementary and alternative medicine

    National Research Council Canada - National Science Library

    Adams, Jon

    2007-01-01

    ... the investigation of CAM. Contributors draw upon their own CAM research work and experience to explain and review a range of methods and research issues pertinent to the contemporary of CAM and its future development, such as: field * * * * * the issues facing practitioners who wish to conduct research; how and why qualitative methods should...

  9. An overview of filtration methods that can provide protection from the macrofouling zebra mussel at hydroelectric facilities

    Energy Technology Data Exchange (ETDEWEB)

    Smythe, A.G.; Short, T.M. [Acres International Corp., Amherst, NY (United States)

    1995-12-31

    The non-indigenous freshwater zebra and quagga mussels (Dreissena, spp.) threaten to foul freshwater conduits throughout much of the United States and southern Canada. Initially, many electric facilities within the lower Great Lakes drainage were fouled. More recently, other systems both in and out of the Great Lakes, have been exposed to infested water facilitated by canals and boat traffic and impacted by the mussels. Mussels have clogged conduits and fouled equipment and monitoring sensors in relatively distant regions including the Hudson River, the Mississippi River south to New Orleans, and the Arkansas River into Oklahoma. Chemicals can effectively control the mussels, however, filtration methods promise to be a relatively cost effective, environmentally safe alternative control approach. Information on traditional filtration methods will be presented in this paper along with recent research results for in-line filters.

  10. Evaluation of Effective Factors on e-Loyalty in Organizations Providing Electronic Services using Fuzzy AHP Method

    Directory of Open Access Journals (Sweden)

    fatemeh mohammadi

    2012-12-01

    Full Text Available In today's business world, proper identification of customer’s requirements and a quick response to these requirements is a key to commercial success. Increasing customer loyalty affects the profitability and organizations can ensure their long-term interests by means of planning. In today's competitive world, the services provided by the competing company have to be more similar to each other and can be hard to surprise customers within completely new service in the long term, because the newest services are quickly imitated by competitors and marketed. Hence investment in customer loyalty is an effective and profitable investment for companies. One criticism that has entered into the e-service is customer loyalty. In order to study the causes of e-loyalty for organization providing e-services, this research identified the factors affecting customer loyalty in e-services and with questionnaire prepared and by using fuzzy hierarchical decision-making process acquires the weight of each factor and ultimately rank them. The results show that the quality of service provided to e-services customers is the most important factor in creating e-loyalty.

  11. Midwives' support for Complementary and Alternative Medicine: a literature review.

    Science.gov (United States)

    Hall, Helen G; McKenna, Lisa G; Griffiths, Debra L

    2012-03-01

    There is evidence that the use of Complementary and Alternative Medicine by childbearing women is becoming increasingly popular in industrialised countries. The aim of this is paper is to review the research literature investigating the midwives' support for the use of these therapies. A search for relevant research published from 2000 to 2009 was undertaken using a range of databases and by examining relevant bibliographies. A total of thirteen studies were selected for inclusion in this review. The findings indicate that the use of Complementary and Alternative Medicine is widespread in midwifery practice. Common indications for use include; labour induction and augmentation, nausea and vomiting, relaxation, back pain, anaemia, mal-presentation, perineal discomfort, postnatal depression and lactation problems. The most popular therapies recommended by midwives are massage therapy, herbal medicines, relaxation techniques, nutritional supplements, aromatherapy, homeopathy and acupuncture. Midwives support the use Complementary and Alternative Medicine because they believe it is philosophically congruent; it provides safe alternatives to medical interventions; it supports the woman's autonomy, and; incorporating Complementary and Alternative Medicine can enhance their own professional autonomy. There is considerable support by midwives for the use of Complementary and Alternative Medicine by expectant women. Despite this enthusiasm, currently there are few educational opportunities and only limited research evidence regarding CAM use in midwifery practice. These shortfalls need to be addressed by the profession. Midwives are encouraged to have an open dialogue with childbearing women, to document use and to base any advice on the best available evidence. Copyright © 2010 Australian College of Midwives. Published by Elsevier Ltd. All rights reserved.

  12. Complementary and Alternative Approaches to Pain Relief during Labor

    Directory of Open Access Journals (Sweden)

    Michel Tournaire

    2007-01-01

    Full Text Available This review evaluated the effect of complementary and alternative medicine on pain during labor with conventional scientific methods using electronic data bases through 2006 were used. Only randomized controlled trials with outcome measures for labor pain were kept for the conclusions. Many studies did not meet the scientific inclusion criteria. According to the randomized control trials, we conclude that for the decrease of labor pain and/or reduction of the need for conventional analgesic methods: (i There is an efficacy found for acupressure and sterile water blocks. (ii Most results favored some efficacy for acupuncture and hydrotherapy. (iii Studies for other complementary or alternative therapies for labor pain control have not shown their effectiveness.

  13. Fusing complementary images for pavement cracking measurements

    International Nuclear Information System (INIS)

    Yao, Ming; Zhao, Zuyun; Xu, Bugao; Yao, Xun

    2015-01-01

    Cracking is a major pavement distress that jeopardizes road serviceability and traffic safety. Automated pavement distress survey (APDS) systems have been developed using digital imaging technology to replace human surveys for more timely and accurate inspections. Most APDS systems require special lighting devices to illuminate pavements and prevent shadows of roadside objects that distort cracks in the image. Most artificial lighting devices are laser based, and are either hazardous to unprotected people or require dedicated power supplies on the vehicle. This study was aimed to develop a new imaging system that can scan pavement surface at highway speed and determine the level of severity of pavement cracking without using any artificial lighting. The new system consists of dual line-scan cameras that are installed side by side to scan the same pavement area as the vehicle moves. Cameras are controlled with different exposure settings so that both sunlit and shadowed areas can be visible in two separate images. The paired images contain complementary details useful for reconstructing an image in which the shadows are eliminated. This paper intends to present (1) the design of the dual line-scan camera system, (2) a new calibration method for line-scan cameras to rectify and register paired images, (3) a customized image-fusion algorithm that merges the multi-exposure images into one shadow-free image for crack detection, and (4) the results of the field tests on a selected road over a long period. (paper)

  14. Complementary, alternative, integrative, or unconventional medicine?

    Science.gov (United States)

    Penson, R T; Castro, C M; Seiden, M V; Chabner, B A; Lynch, T J

    2001-01-01

    Shortly before his death in 1995, Kenneth B. Schwartz, a cancer patient at Massachusetts General Hospital (MGH), founded the Kenneth B. Schwartz Center. The Schwartz Center is a non-profit organization dedicated to supporting and advancing compassionate health care delivery, which provides hope to the patient, support to caregivers, and sustenance to the healing process. The center sponsors the Schwartz Center Rounds, a monthly multidisciplinary forum where caregivers reflect on important psychosocial issues faced by patients, their families, and their caregivers, and gain insight and support from fellow staff members. Interest in complementary and alternative medicine (CAM) has grown exponentially in the past decade, fueled by Internet marketing, dissatisfaction with mainstream medicine, and a desire for patients to be actively involved in their health care. There is a large discordance between physician estimates and reported prevalence of CAM use. Many patients do not disclose their practices mainly because they believe CAM falls outside the rubric of conventional medicine or because physicians do not ask. Concern about drug interactions and adverse effects are compounded by a lack of Food and Drug Administration regulation. Physicians need to be informed about CAM and be attuned to the psychosocial needs of patients.

  15. Complementary and alternative medicine usage and its determinant factors among Iranian infertile couples.

    Science.gov (United States)

    Dehghan, Mahlagha; Mokhtarabadi, Sima; Heidari, Fatemeh Ghaedi

    2018-04-04

    Background The aim of this study was to determine the status of utilizing some complementary and alternative medicine techniques in infertile couples. Methods This was a cross-sectional study conducted on 250 infertile couples referred to a hospital in Kerman using convenience sampling. A researcher-made questionnaire was used to study the prevalence and user satisfaction of complementary and alternative medicines. Results Results indicated that 49.6% of the infertile couples used at least one of the complementary and alternative medicines during the past year. Most individuals used spiritual techniques (71.8% used praying and 70.2% used Nazr) and medicinal plants (54.8%). Safety is the most important factor affecting the satisfaction of infertile couples with complementary treatments (couples think that such treatments are safe (54.8%)). Discussion Concerning high prevalence of complementary and alternative treatments in infertile couples, incorporating such treatments into the healthcare education and promoting the awareness of infertile individuals seem crucial.

  16. Mixed Methods Survey of Zoonotic Disease Awareness and Practice among Animal and Human Healthcare Providers in Moshi, Tanzania.

    Directory of Open Access Journals (Sweden)

    Helen L Zhang

    2016-03-01

    Full Text Available Zoonoses are common causes of human and livestock illness in Tanzania. Previous studies have shown that brucellosis, leptospirosis, and Q fever account for a large proportion of human febrile illness in northern Tanzania, yet they are infrequently diagnosed. We conducted this study to assess awareness and knowledge regarding selected zoonoses among healthcare providers in Moshi, Tanzania; to determine what diagnostic and treatment protocols are utilized; and obtain insights into contextual factors contributing to the apparent under-diagnosis of zoonoses.We conducted a questionnaire about zoonoses knowledge, case reporting, and testing with 52 human health practitioners and 10 livestock health providers. Immediately following questionnaire administration, we conducted semi-structured interviews with 60 of these respondents, using the findings of a previous fever etiology study to prompt conversation. Sixty respondents (97% had heard of brucellosis, 26 (42% leptospirosis, and 20 (32% Q fever. Animal sector respondents reported seeing cases of animal brucellosis (4, rabies (4, and anthrax (3 in the previous 12 months. Human sector respondents reported cases of human brucellosis (15, 29%, rabies (9, 18% and anthrax (6, 12%. None reported leptospirosis or Q fever cases. Nineteen respondents were aware of a local diagnostic test for human brucellosis. Reports of tests for human leptospirosis or Q fever, or for any of the study pathogens in animals, were rare. Many respondents expressed awareness of malaria over-diagnosis and zoonoses under-diagnosis, and many identified low knowledge and testing capacity as reasons for zoonoses under-diagnosis.This study revealed differences in knowledge of different zoonoses and low case report frequencies of brucellosis, leptospirosis, and Q fever. There was a lack of known diagnostic services for leptospirosis and Q fever. These findings emphasize a need for improved diagnostic capacity alongside healthcare

  17. ANALYSIS OF METHODS PROVIDING ACCURACY FOR TOOLS AND TECHNIQUES VIBRATION MEASUREMENT IN THE PROCESS OF MAINTAINING AIRWORTHINESS OF AIRCRAFT

    Directory of Open Access Journals (Sweden)

    Anatoliy Alexandrovich Bogoyavlenskiy

    2017-01-01

    Full Text Available On the basis of system approach the structure of the aviation activity areas on air transport related to monitoring and measurements of vibration parameters is presented.The technology analysis of laboratory tests of the onboard equipment control of vibration parameters is carried out. The issues related to ensuring the unity of measurements of vibration parameters are researched and summarized.While dealing with the works on metrological certification described in the article, the risks arising from aviation activity on air transport are taken into account. The certification methods of measuring channels of vibration parametersused on stands for testing GTE at the repairing of aircraft engines are developed. The methods are implemented when con- ducting initial and periodic certifications of test benches for twelve types of aircraft GTE in repair organizations. The reliability of the results of the conducted research due to the fact that they were carried out with the use of certified measure- ment equipment, included in the State register of measuring instruments. The research is conducted for a sufficiently high statistical confidence level with the boundaries 0.95. The studies have shown that running on air transport measurements of vibration parameters are metrologically se- cured, the unity of measurements and their traceability from the national primary reference to special measuring instru- ments, test equipment, and onboard controls of the aircraft is maintained.

  18. Mosasauroid phylogeny under multiple phylogenetic methods provides new insights on the evolution of aquatic adaptations in the group.

    Directory of Open Access Journals (Sweden)

    Tiago R Simões

    Full Text Available Mosasauroids were a successful lineage of squamate reptiles (lizards and snakes that radiated during the Late Cretaceous (95-66 million years ago. They can be considered one of the few lineages in the evolutionary history of tetrapods to have acquired a fully aquatic lifestyle, similarly to whales, ichthyosaurs and plesiosaurs. Despite a long history of research on this group, their phylogenetic relationships have only been tested so far using traditional (unweighted maximum parsimony. However, hypotheses of mosasauroid relationships and the recently proposed multiple origins of aquatically adapted pelvic and pedal features in this group can be more thoroughly tested by methods that take into account variation in branch lengths and evolutionary rates. In this study, we present the first mosasauroid phylogenetic analysis performed under different analytical methods, including maximum likelihood, Bayesian inference, and implied weighting maximum parsimony. The results indicate a lack of congruence in the topological position of halisaurines and Dallasaurus. Additionally, the genus Prognathodon is paraphyletic under all hypotheses. Interestingly, a number of traditional mosasauroid clades become weakly supported, or unresolved, under Bayesian analyses. The reduced resolutions in some consensus trees create ambiguities concerning the evolution of fully aquatic pelvic/pedal conditions under many analyses. However, when enough resolution was obtained, reversals of the pelvic/pedal conditions were favoured by parsimony and likelihood ancestral state reconstructions instead of independent origins of aquatic features in mosasauroids. It is concluded that most of the observed discrepancies among the results can be associated with different analytical procedures, but also due to limited postcranial data on halisaurines, yaguarasaurines and Dallasaurus.

  19. Mosasauroid phylogeny under multiple phylogenetic methods provides new insights on the evolution of aquatic adaptations in the group

    Science.gov (United States)

    Vernygora, Oksana; Paparella, Ilaria; Jimenez-Huidobro, Paulina; Caldwell, Michael W.

    2017-01-01

    Mosasauroids were a successful lineage of squamate reptiles (lizards and snakes) that radiated during the Late Cretaceous (95–66 million years ago). They can be considered one of the few lineages in the evolutionary history of tetrapods to have acquired a fully aquatic lifestyle, similarly to whales, ichthyosaurs and plesiosaurs. Despite a long history of research on this group, their phylogenetic relationships have only been tested so far using traditional (unweighted) maximum parsimony. However, hypotheses of mosasauroid relationships and the recently proposed multiple origins of aquatically adapted pelvic and pedal features in this group can be more thoroughly tested by methods that take into account variation in branch lengths and evolutionary rates. In this study, we present the first mosasauroid phylogenetic analysis performed under different analytical methods, including maximum likelihood, Bayesian inference, and implied weighting maximum parsimony. The results indicate a lack of congruence in the topological position of halisaurines and Dallasaurus. Additionally, the genus Prognathodon is paraphyletic under all hypotheses. Interestingly, a number of traditional mosasauroid clades become weakly supported, or unresolved, under Bayesian analyses. The reduced resolutions in some consensus trees create ambiguities concerning the evolution of fully aquatic pelvic/pedal conditions under many analyses. However, when enough resolution was obtained, reversals of the pelvic/pedal conditions were favoured by parsimony and likelihood ancestral state reconstructions instead of independent origins of aquatic features in mosasauroids. It is concluded that most of the observed discrepancies among the results can be associated with different analytical procedures, but also due to limited postcranial data on halisaurines, yaguarasaurines and Dallasaurus. PMID:28467456

  20. Leveraging long read sequencing from a single individual to provide a comprehensive resource for benchmarking variant calling methods.

    Science.gov (United States)

    Mu, John C; Tootoonchi Afshar, Pegah; Mohiyuddin, Marghoob; Chen, Xi; Li, Jian; Bani Asadi, Narges; Gerstein, Mark B; Wong, Wing H; Lam, Hugo Y K

    2015-09-28

    A high-confidence, comprehensive human variant set is critical in assessing accuracy of sequencing algorithms, which are crucial in precision medicine based on high-throughput sequencing. Although recent works have attempted to provide such a resource, they still do not encompass all major types of variants including structural variants (SVs). Thus, we leveraged the massive high-quality Sanger sequences from the HuRef genome to construct by far the most comprehensive gold set of a single individual, which was cross validated with deep Illumina sequencing, population datasets, and well-established algorithms. It was a necessary effort to completely reanalyze the HuRef genome as its previously published variants were mostly reported five years ago, suffering from compatibility, organization, and accuracy issues that prevent their direct use in benchmarking. Our extensive analysis and validation resulted in a gold set with high specificity and sensitivity. In contrast to the current gold sets of the NA12878 or HS1011 genomes, our gold set is the first that includes small variants, deletion SVs and insertion SVs up to a hundred thousand base-pairs. We demonstrate the utility of our HuRef gold set to benchmark several published SV detection tools.

  1. [Complementary and alternative medicine in oncology].

    Science.gov (United States)

    Hübner, J

    2013-06-01

    Complementary and alternative medicine are frequently used by cancer patients. The main benefit of complementary medicine is that it gives patients the chance to become active. Complementary therapy can reduce the side effects of conventional therapy. However, we have to give due consideration to side effects and interactions: the latter being able to reduce the effectiveness of cancer therapy and so to jeopardise the success of therapy. Therefore, complementary therapy should be managed by the oncologist. It is based on a common concept of cancerogenesis with conventional therapy. Complement therapy can be assessed in studies. Alternative medicine in contrast rejects common rules of evidence-based medicine. It starts from its own concepts of cancerogenesis, which is often in line with the thinking of lay persons. Alternative medicine is offered as either "alternative" to recommended cancer treatment or is used at the same time but without due regard for the interactions. Alternative medicine is a high risk to patients. In the following two parts of the article, the most important complementary and alternative therapies cancer patients use nowadays are presented and assessed according to published evidence.

  2. Asteroid models from photometry and complementary data sources

    Energy Technology Data Exchange (ETDEWEB)

    Kaasalainen, Mikko [Department of Mathematics, Tampere University of Technology (Finland)

    2016-05-10

    I discuss inversion methods for asteroid shape and spin reconstruction with photometry (lightcurves) and complementary data sources such as adaptive optics or other images, occultation timings, interferometry, and range-Doppler radar data. These are essentially different sampling modes (generalized projections) of plane-of-sky images. An important concept in this approach is the optimal weighting of the various data modes. The maximum compatibility estimate, a multi-modal generalization of the maximum likelihood estimate, can be used for this purpose. I discuss the fundamental properties of lightcurve inversion by examining the two-dimensional case that, though not usable in our three-dimensional world, is simple to analyze, and it shares essentially the same uniqueness and stability properties as the 3-D case. After this, I review the main aspects of 3-D shape representations, lightcurve inversion, and the inclusion of complementary data.

  3. Asteroid models from photometry and complementary data sources

    International Nuclear Information System (INIS)

    Kaasalainen, Mikko

    2016-01-01

    I discuss inversion methods for asteroid shape and spin reconstruction with photometry (lightcurves) and complementary data sources such as adaptive optics or other images, occultation timings, interferometry, and range-Doppler radar data. These are essentially different sampling modes (generalized projections) of plane-of-sky images. An important concept in this approach is the optimal weighting of the various data modes. The maximum compatibility estimate, a multi-modal generalization of the maximum likelihood estimate, can be used for this purpose. I discuss the fundamental properties of lightcurve inversion by examining the two-dimensional case that, though not usable in our three-dimensional world, is simple to analyze, and it shares essentially the same uniqueness and stability properties as the 3-D case. After this, I review the main aspects of 3-D shape representations, lightcurve inversion, and the inclusion of complementary data.

  4. A molybdenum disulfide/carbon nanotube heterogeneous complementary inverter.

    Science.gov (United States)

    Huang, Jun; Somu, Sivasubramanian; Busnaina, Ahmed

    2012-08-24

    We report a simple, bottom-up/top-down approach for integrating drastically different nanoscale building blocks to form a heterogeneous complementary inverter circuit based on layered molybdenum disulfide and carbon nanotube (CNT) bundles. The fabricated CNT/MoS(2) inverter is composed of n-type molybdenum disulfide (MOS(2)) and p-type CNT transistors, with a high voltage gain of 1.3. The CNT channels are fabricated using directed assembly while the layered molybdenum disulfide channels are fabricated by mechanical exfoliation. This bottom-up fabrication approach for integrating various nanoscale elements with unique characteristics provides an alternative cost-effective methodology to complementary metal-oxide-semiconductors, laying the foundation for the realization of high performance logic circuits.

  5. Complementary Cohort Strategy for Multimodal Face Pair Matching

    DEFF Research Database (Denmark)

    Sun, Yunlian; Nasrollahi, Kamal; Sun, Zhenan

    2016-01-01

    Face pair matching is the task of determining whether two face images represent the same person. Due to the limited expressive information embedded in the two face images as well as various sources of facial variations, it becomes a quite difficult problem. Towards the issue of few available images...... provided to represent each face, we propose to exploit an extra cohort set (identities in the cohort set are different from those being compared) by a series of cohort list comparisons. Useful cohort coefficients are then extracted from both sorted cohort identities and sorted cohort images...... for complementary information. To augment its robustness to complicated facial variations, we further employ multiple face modalities owing to their complementary value to each other for the face pair matching task. The final decision is made by fusing the extracted cohort coefficients with the direct matching...

  6. 24 CFR 1000.54 - What procedures apply to complaints arising out of any of the methods of providing for Indian...

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false What procedures apply to complaints arising out of any of the methods of providing for Indian preference? 1000.54 Section 1000.54 Housing and... ACTIVITIES General § 1000.54 What procedures apply to complaints arising out of any of the methods of...

  7. Ethical responsibilities of pharmacists when selling complementary medicines: a systematic review.

    Science.gov (United States)

    Salman Popattia, Amber; Winch, Sarah; La Caze, Adam

    2018-04-01

    The widespread sale of complementary medicines in community pharmacy raises important questions regarding the responsibilities of pharmacists when selling complementary medicines. This study reviews the academic literature that explores a pharmacist's responsibilities when selling complementary medicines. International Pharmaceutical Abstracts, Embase, PubMed, Cinahl, PsycINFO and Philosopher's index databases were searched for articles written in English and published between 1995 and 2017. Empirical studies discussing pharmacists' practices or perceptions, consumers' expectations and normative studies discussing ethical perspectives or proposing ethical frameworks related to pharmacists' responsibilities in selling complementary medicines were included in the review. Fifty-eight studies met the inclusion criteria. The majority of the studies discussing the responsibilities of pharmacists selling complementary medicines had an empirical focus. Pharmacists and consumers identified counselling and ensuring safe use of complementary medicines as the primary responsibilities of pharmacists. No formal ethical framework is explicitly employed to describe the responsibilities of pharmacists selling complementary medicines. To the degree any ethical framework is employed, a number of papers implicitly rely on principlism. The studies discussing the ethical perspectives of selling complementary medicines mainly describe the ethical conflict between a pharmacist's business and health professional role. No attempt is made to provide guidance on appropriate ways to resolve the conflict. There is a lack of explicit normative advice in the existing literature regarding the responsibilities of pharmacists selling complementary medicines. This review identifies the need to develop a detailed practice-specific ethical framework to guide pharmacists regarding their responsibilities when selling complementary medicines. © 2018 Royal Pharmaceutical Society.

  8. Complementary structure for designer localized surface plasmons

    Science.gov (United States)

    Gao, Zhen; Gao, Fei; Zhang, Youming; Zhang, Baile

    2015-11-01

    Magnetic localized surface plasmons (LSPs) supported on metallic structures corrugated by very long and curved grooves have been recently proposed and demonstrated on an extremely thin metallic spiral structure (MSS) in the microwave regime. However, the mode profile for the magnetic LSPs was demonstrated by measuring only the electric field, not the magnetic field. Here, based on Babinet's principle, we propose a Babinet-inverted, or complementary MSS whose electric/magnetic mode profiles match the magnetic/electric mode profiles of MSS. This complementarity of mode profiles allows mapping the magnetic field distribution of magnetic LSP mode profile on MSS by measuring the electric field distribution of the corresponding mode on complementary MSS. Experiment at microwave frequencies also demonstrate the use of complementary MSS in sensing refractive-index change in the environment.

  9. THE INTELLECTUAL CAPITAL STATEMENT AND THE BALANCED SCORECARD AS COMPLEMENTARY MODELS IN MEASURING FIRM INTANGIBLES

    Directory of Open Access Journals (Sweden)

    Veltri Stefania

    2011-12-01

    Full Text Available The purpose of this paper is to examine the role of two different new management tool, the Balanced Scorecard (BSC and the Intellectual Capital Report (ICR in managing and reporting intangibles. Unlike the majority of IC scholars the author, and consistently with Bukh et al. (2005, the author starts from the idea that BSC and ICR are not alternative, but complementary tools in measuring intangibles, addressing different needs for firms that measure, manage and report intangibles. The research hypothesis of the paper will be demonstrated through the analysis of a case study of an Italian group which use both intangibles reporting systems. A case study methodology has been chosen, given that it is widely used by researchers and provide the basis for the application of ideas and extension of methods (Yin, 1994. Intercos group has been chosen to test the research hypothesis, since it makes use of both models in measuring and reporting intangibles. The study of the case Intercos group found evidence that the two types of extended reporting are different and yet complementary and that both tools are necessary for firm in measuring IC, since they address different aims. This includes therefore a marked difference in use of indicators, given that IC indicators in the ICR have to support the overall aims derived by company's strategy, while BSC indicators provides a breakdown of strategic goals with respect to profitability, growth etc. The contribution of the paper to the IC literature is to extend the findings of the Bukh et al.s (2003 study, investigating the hypothesis (and finding evidence that BSC and ICR are complementary in reporting intangibles in an Italian group. Implications of the paper are for company's manager, who increase the awareness that they have at their disposal two management tools, with address different aims, to manage intangibles.

  10. Complementary Therapies and Medicines and Reproductive Medicine.

    Science.gov (United States)

    Smith, Caroline A; Armour, Mike; Ee, Carolyn

    2016-03-01

    Complementary therapies and medicines are a broad and diverse range of treatments, and are frequently used by women and their partners during the preconception period to assist with infertility, and to address pregnancy-related conditions. Despite frequent use, the evidence examining the efficacy, effectiveness, and safety for many modalities is lacking, with variable study quality. In this article, we provide an overview of research evidence with the aim of examining the evidence to inform clinical practice. During the preconception period, there is mixed evidence for acupuncture to improve ovulation, or increase pregnancy rates. Acupuncture may improve sperm quality, but there is insufficient evidence to determine whether this results in improved pregnancy and live birth rates. Acupuncture can be described as a low-risk intervention. Chinese and Western herbal medicines may increase pregnancy rates; however, study quality is low. The evaluation of efficacy, effectiveness, and safety during the first trimester of pregnancy has most commonly reported on herbs, supplements, and practices such as acupuncture. There is high-quality evidence reporting the benefits of herbal medicines and acupuncture to treat nausea in pregnancy. The benefit from ginger to manage symptoms of nausea in early pregnancy is incorporated in national clinical guidelines, and vitamin B6 is recommended as a first-line treatment for nausea and vomiting in pregnancy. The safety of ginger and vitamin B6 is considered to be well established, and is based on epidemiological studies. Acupuncture has been shown to reduce back pain and improve function for women in early pregnancy. There is little evidence to support the use of cranberries in pregnancy for prevention of urinary tract infections, and chiropractic treatment for back pain. Overall the numbers of studies are small and of low quality, although the modalities appear to be low risk of harm. Thieme Medical Publishers 333 Seventh Avenue, New

  11. Complementary Therapies for Pain Among Individuals Receiving Hemodialysis: A Systematic Review.

    Science.gov (United States)

    Zins, Savannah; Gross, Cynthia R; Huff, Edwin D; Hooke, Mary Catherine

    2018-01-01

    Pain is a major problem for individuals undergoing hemodialysis and can lead to decreased quality of life when ineffectively managed. Pain is often reported as burdensome; thus, nurses must learn effective, nonpharmacological adjuncts to help care for symptomatic patients. The purpose of this review was to identify non-pharmacologic complementary therapies and evaluate their effectiveness in minimizing pain among individuals undergoing hemodialysis. Multiple complementary interventions were identified, and several reduced pain, but evidence is qualified by limitations in study methods. Complementary therapies have the potential to reduce pain among individuals undergoing hemodialysis; however, more research is needed. Copyright© by the American Nephrology Nurses Association.

  12. Development of the adult and child complementary medicine questionnaires fielded on the National Health Interview Survey

    Science.gov (United States)

    2013-01-01

    The 2002, 2007, and 2012 complementary medicine questionnaires fielded on the National Health Interview Survey provide the most comprehensive data on complementary medicine available for the United States. They filled the void for large-scale, nationally representative, publicly available datasets on the out-of-pocket costs, prevalence, and reasons for use of complementary medicine in the U.S. Despite their wide use, this is the first article describing the multi-faceted and largely qualitative processes undertaken to develop the surveys. We hope this in-depth description enables policy makers and researchers to better judge the content validity and utility of the questionnaires and their resultant publications. PMID:24267412

  13. Fabricating an organic complementary inverter by integrating two transistors on a single substrate

    International Nuclear Information System (INIS)

    Wang Jun; Wei Bin; Zhang Jianhua

    2008-01-01

    Organic complementary inverters were fabricated by integrating two transistors of different electric type on a single substrate. One is a p-type organic heterojunction transistor with a depletion–accumulation mode that acts as a load element. The other is an n-type transistor with an accumulation mode that acts as a drive element. Typical inverter characteristics with a voltage gain of 12 were obtained. Compared with conventional devices, our organic complementary inverter used only one-step patterning of an organic semiconductor, and simultaneously suppressed the leakage current between supply voltage and ground. Therefore, current studies provide a simpler path to fabrication of organic complementary circuits

  14. Avaliação crítica dos benefícios e limitações da ressonância magnética como método complementar no diagnóstico das malformações fetais A critical review of benefits and limitations of magnetic resonance imaging as a complementary method in the diagnosis of fetal malformations

    Directory of Open Access Journals (Sweden)

    Renato Luis da Silveira Ximenes

    2008-10-01

    diagnosed with fetal abnormality by ultrasonography were referred to undergo complementary fetal magnetic resonance imaging, particularly for evaluating abnormalities in the fetal central nervous system, thorax, abdomen, renal system, skeletal system, and tumors. The whole evaluation process included a review of the fetal ultrasonography and magnetic resonance images, postnatal follow-up, laboratory tests, imaging studies and necropsy. RESULTS: The present study has demonstrated that complementary magnetic resonance imaging did provide further information in 60% of cases, with the following benefits: improved information on the fetus as a whole, with a large field of view, higher anatomic resolution provided by fast sequences, superior soft tissue contrast resolution, besides the fact that the visualization of the fetus is not significantly affected by maternal obesity or oligohydramnios. Limitations of the method include contraindication in the first gestational trimester and in cases of maternal claustrophobia, sensitivity to fetal motion, low sensitivity for detecting cardiovascular and skeletal malformations. CONCLUSION: Fetal magnetic resonance imaging plays a significant role as a complementary method for the diagnosis of fetal anomalies.

  15. Medicare Provider Data - Hospice Providers

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Hospice Utilization and Payment Public Use File provides information on services provided to Medicare beneficiaries by hospice providers. The Hospice PUF...

  16. Perceptions of methicillin-resistant Staphylococcus aureus and hand hygiene provider training and patient education: results of a mixed method study of health care providers in Department of Veterans Affairs spinal cord injury and disorder units.

    Science.gov (United States)

    Hill, Jennifer N; Hogan, Timothy P; Cameron, Kenzie A; Guihan, Marylou; Goldstein, Barry; Evans, Martin E; Evans, Charlesnika T

    2014-08-01

    The goal of this study was to assess current practices for training of spinal cord injury and disorder (SCI/D) health care workers and education of veterans with SCI/D in Department of Veterans Affairs (VA) spinal cord injury (SCI) centers on methicillin-resistant Staphylococcus aureus (MRSA) prevention. Mixed methods. A Web-based survey was distributed to 673 VA SCI/D providers across 24 SCI centers; 21 acute care and 1 long-term care facility participated. There were 295 that responded, 228 had complete data and were included in this analysis. Semistructured interviews were conducted with 30 SCI/D providers across 9 SCI centers. Nurses, physicians, and therapists represent most respondents (92.1%, n = 210); over half (56.6%, n = 129) were nurses. Of providers, 75.9% (n = 173) reported receiving excellent or good training on how to educate patients about MRSA. However, nurses were more likely to report having excellent or good training for how to educate patients about MRSA (P = .005). Despite this, only 63.6% (n = 82) of nurses perceived the education they provide patients on how MRSA is transmitted as excellent or good. Despite health care workers reporting receiving excellent or good training on MRSA-related topics, this did not translate to excellent or good education for patients, suggesting that health care workers need additional training for educating patients. Population-specific MRSA prevention educational materials may also assist providers in educating patients about MRSA prevention for individuals with SCI/D. Published by Mosby, Inc.

  17. Characterisation of Inorganic Pigments Used by Selected Painters by Using Ion Microprobe and Other Complementary Techniques

    International Nuclear Information System (INIS)

    Fazinic, S.; Pastuovic, Z.; Jaksic, M.; Kusijanovic, K.; Mudronja, D.; Braun, M.; Desnica, V.

    2011-01-01

    The aim of the presentation is to show results of the collaboration between the Croatian Conservation Institute (CCI) and the Laboratory for Ion Beam Interactions of the Rudjer Boskovic Institute (RBI) established within the present CRP. CCI is the central Croatian institution for conservation and restoration of cultural heritage objects. Prior to restoration/conservation CCI performs scientific analysis of an object, primarily to enable selection of the best strategy for its restoration/conservation. In many occasions such analysis is also helpful to resolve issues such as clarification of authenticity and/or authorship of an object. CCI has its analytical laboratory which is fully dedicated to the analysis of cultural heritage and art objects. CCI analytical laboratory is equipped with various microscopy techniques, photography methods, portable X-ray Fluorescence Spectrometer (XRF) and X-ray radiography instrumentation. Access to complementary microanalytical techniques like Raman Spectroscopy or Ion Beam Analytical (IBA) techniques is provided through already long and successful collaboration with RBI. The RBI Laboratory for Ion Beam Interactions provides complementary analysis of layered microsamples by using IBA techniques, such as Particle Induced X-ray Emission (PIXE) and Rutherford Back-scattering (RBS), and for the miniature samples by using ion microprobe. (author)

  18. Complementary filter implementation in the dynamic language Lua

    Science.gov (United States)

    Sadowski, Damian; Sawicki, Aleksander; Lukšys, Donatas; Slanina, Zdenek

    2017-08-01

    The article presents the complementary filter implementation, that is used for the estimation of the pitch angle, in Lua script language. Inertial sensors as accelerometer and gyroscope were used in the study. Methods of angles estimation using acceleration and angular velocity sensors were presented in the theoretical part of the article. The operating principle of complementary filter has been presented. The prototype of Butterworth's analogue filter and its digital equivalent have been designed. Practical implementation of the issue was performed with the use of PC and DISCOVERY evaluation board equipped with STM32F01 processor, L3GD20 gyroscope and LS303DLHC accelerometer. Measurement data was transmitted by UART serial interface, then processed with the use of Lua software and luaRS232 programming library. Practical implementation was divided into two stages. In the first part, measurement data has been recorded and then processed with help of a complementary filter. In the second step, coroutines mechanism was used to filter data in real time.

  19. Black Hole Complementary Principle and Noncommutative Membrane

    International Nuclear Information System (INIS)

    Wei Ren

    2006-01-01

    In the spirit of black hole complementary principle, we have found the noncommutative membrane of Scharzchild black holes. In this paper we extend our results to Kerr black hole and see the same story. Also we make a conjecture that spacetimes are noncommutative on the stretched membrane of the more general Kerr-Newman black hole.

  20. African Journal of Traditional, Complementary and Alternative ...

    African Journals Online (AJOL)

    Differences in attitudes towards/beliefs on complementary and alternative medicine witnessed between physiotherapists, nurses/paramedics and physicians · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. D Živčić, A Racz, D Naletilić, 57-65.

  1. Mental disorders frequency alternative and complementary ...

    African Journals Online (AJOL)

    Objectives: Diabetes mellitus (DM) and hypertension (HT) are chronic disorders with which mental disorders may coexist and for which patients may resort to alternative medicine use. Alternative and complementary medicine is a treatment option that patients tend to use. This study is to determine the prevalence of mental ...

  2. Complementary medicines: When regulation results in revolution

    African Journals Online (AJOL)

    dates, depending on their classification, e.g. antiviral complementary medicines had to be ... must be written in English and at least one other official language and must indicate the ... able task. Furthermore, the cost of merely applying, especially for ... the nature of the industry will change once the new laws are fully.

  3. African Journal of Traditional, Complementary and Alternative ...

    African Journals Online (AJOL)

    Anti-diabetic effects of Zhuoduqing formula, a Chinese herbal decoction, ... Bioactive components of Gynura divaricata and its potential use in health, ... Whole-body vibration exercise improves functional parameters in patients ... Survey of dental students' attitude regarding oriental medicine/complementary and alternative ...

  4. Hypertension management: Perspectives of complementary and al ...

    African Journals Online (AJOL)

    Information available on the various forms of Complementary and Alternative Medicine (CAM) used in the management of hypertension is inadequate and conflicting. The primary objective of this study was to assess the use of CAM in the management of hypertension by CAM practition-ers. A qualitative study utilizing ...

  5. (COPD) on complementary and alternative medicine (CAM)

    African Journals Online (AJOL)

    The purpose of this study was to examine the frequency of complementary and alternative medicine usage in Chronic Obstructive Pulmonary Disease (COPD) patients living in the eastern part of Turkey. In this study a descriptive design was used. The study was conducted with 216 patients who were present at the clinic.

  6. African Journal of Traditional, Complementary and Alternative ...

    African Journals Online (AJOL)

    African Journal of Traditional, Complementary and Alternative Medicines. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 14, No 6 (2017) >. Log in or Register to get access to full text downloads.

  7. Errata | Adewunmi | African Journal of Traditional, Complementary ...

    African Journals Online (AJOL)

    African Journal of Traditional, Complementary and Alternative Medicines. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 14, No 6 (2017) >. Log in or Register to get access to full text downloads.

  8. Complementary and alternative medicine use among diabetic ...

    African Journals Online (AJOL)

    Abstract. Complementary and alternative medicine (CAM) use is common among patients with chronic diseases in developing countries. The rising use of CAM in the management of diabetes is an emerging public health concern given the potential adverse effects, drug interactions and benefits associated with its use.

  9. African Journal of Traditional, Complementary and Alternative ...

    African Journals Online (AJOL)

    African Journal of Traditional, Complementary and Alternative Medicines. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 14, No 4S (2017) >. Log in or Register to get access to full text downloads.

  10. Determining Complementary Properties with Quantum Clones

    Science.gov (United States)

    Thekkadath, G. S.; Saaltink, R. Y.; Giner, L.; Lundeen, J. S.

    2017-08-01

    In a classical world, simultaneous measurements of complementary properties (e.g., position and momentum) give a system's state. In quantum mechanics, measurement-induced disturbance is largest for complementary properties and, hence, limits the precision with which such properties can be determined simultaneously. It is tempting to try to sidestep this disturbance by copying the system and measuring each complementary property on a separate copy. However, perfect copying is physically impossible in quantum mechanics. Here, we investigate using the closest quantum analog to this copying strategy, optimal cloning. The coherent portion of the generated clones' state corresponds to "twins" of the input system. Like perfect copies, both twins faithfully reproduce the properties of the input system. Unlike perfect copies, the twins are entangled. As such, a measurement on both twins is equivalent to a simultaneous measurement on the input system. For complementary observables, this joint measurement gives the system's state, just as in the classical case. We demonstrate this experimentally using polarized single photons.

  11. ERF/ERFC, Calculation of Error Function, Complementary Error Function, Probability Integrals

    International Nuclear Information System (INIS)

    Vogel, J.E.

    1983-01-01

    1 - Description of problem or function: ERF and ERFC are used to compute values of the error function and complementary error function for any real number. They may be used to compute other related functions such as the normal probability integrals. 4. Method of solution: The error function and complementary error function are approximated by rational functions. Three such rational approximations are used depending on whether - x .GE.4.0. In the first region the error function is computed directly and the complementary error function is computed via the identity erfc(x)=1.0-erf(x). In the other two regions the complementary error function is computed directly and the error function is computed from the identity erf(x)=1.0-erfc(x). The error function and complementary error function are real-valued functions of any real argument. The range of the error function is (-1,1). The range of the complementary error function is (0,2). 5. Restrictions on the complexity of the problem: The user is cautioned against using ERF to compute the complementary error function by using the identity erfc(x)=1.0-erf(x). This subtraction may cause partial or total loss of significance for certain values of x

  12. Parental attitudes toward pediatric use of complementary/alternative medicine in Turkey.

    Science.gov (United States)

    Ustuner Top, Fadime; Konuk Sener, Dilek; Cangur, Sengul

    2017-07-01

    This study was conducted to determine the pediatric usage of complementary/alternative medicine (CAM) by parents in Turkey, the incidence of using these methods, and the factors affecting their use. The sectional and relational design of the study included a sample of 497 parents who took children for treatment at the Maternity and Children's Hospital in Giresun, Turkey. Data for the study were collected via the Personal Information Form and the Evaluation Form for Complementary/Alternative Treatment Use. The data collection tools were filled out by the researchers during the face-to-face interviews. Data obtained from the study were analyzed by Pearson chi-square, Fisher-Freeman-Halton and Fisher's exact (posthoc Bonferroni) tests and Z-test. It was determined that 97.7% of the parents had used at least one CAM method. Moreover, the parents had used CAM methods mostly for respiratory complaints. The CAM methods were most commonly used for the symptoms of fever, diarrhea, and cough. It was observed that the most commonly used alternative methods in the past were vitamin/mineral remedies, cold treatments, and hodja (Islamic teacher) consultations, while the most common alternative methods currently used are massage, music, and cold treatment. In addition, the differences found between CAM users in terms of sociodemographic characteristics were not statistically significant. It is crucial for nurses to learn the characteristics of the health/disease treatments used by those with whom they work in order to increase the efficiency of the service they provide. Thus, it was recommended that nurses should be knowledgeable and aware of the benefits/side effects, treatment methods, and contraindications of CAM. © 2017 Wiley Periodicals, Inc.

  13. Mixed Methods for Implementation Research: Application to Evidence-Based Practice Implementation and Staff Turnover in Community Based Organizations Providing Child Welfare Services

    Science.gov (United States)

    Aarons, Gregory A.; Fettes, Danielle L.; Sommerfeld, David H.; Palinkas, Lawrence

    2013-01-01

    Many public sector services systems and provider organizations are in some phase of learning about or implementing evidence-based interventions. Child welfare service systems represent a context where implementation spans system, management, and organizational concerns. Research utilizing mixed methods that combine qualitative and quantitative design, data collection, and analytic approaches are particularly well-suited to understanding both the process and outcomes of dissemination and implementation efforts in child welfare systems. This paper describes the process of using mixed methods in implementation research and provides an applied example of an examination of factors impacting staff retention during an evidence-based intervention implementation in a statewide child welfare system. We integrate qualitative data with previously published quantitative analyses of job autonomy and staff turnover during this statewide implementation project in order to illustrate the utility of mixed method approaches in providing a more comprehensive understanding of opportunities and challenges in implementation research. PMID:22146861

  14. Mixed methods for implementation research: application to evidence-based practice implementation and staff turnover in community-based organizations providing child welfare services.

    Science.gov (United States)

    Aarons, Gregory A; Fettes, Danielle L; Sommerfeld, David H; Palinkas, Lawrence A

    2012-02-01

    Many public sector service systems and provider organizations are in some phase of learning about or implementing evidence-based interventions. Child welfare service systems represent a context where implementation spans system, management, and organizational concerns. Research utilizing mixed methods that combine qualitative and quantitative design, data collection, and analytic approaches are particularly well suited to understanding both the process and outcomes of dissemination and implementation efforts in child welfare systems. This article describes the process of using mixed methods in implementation research and provides an applied example of an examination of factors impacting staff retention during an evidence-based intervention implementation in a statewide child welfare system. The authors integrate qualitative data with previously published quantitative analyses of job autonomy and staff turnover during this statewide implementation project in order to illustrate the utility of mixed method approaches in providing a more comprehensive understanding of opportunities and challenges in implementation research.

  15. Latent class analysis suggests four distinct classes of complementary medicine users among women with breast cancer

    OpenAIRE

    Strizich, Garrett; Gammon, Marilie D.; Jacobson, Judith S.; Wall, Melanie; Abrahamson, Page; Bradshaw, Patrick T.; Terry, Mary Beth; Teitelbaum, Susan; Neugut, Alfred I.; Greenlee, Heather

    2015-01-01

    Background Breast cancer patients commonly report using >1 form of complementary and alternative medicine (CAM). However, few studies have attempted to analyze predictors and outcomes of multiple CAM modalities. We sought to group breast cancer patients by clusters of type and intensity of complementary and alternative medicine (CAM) use following diagnosis. Methods Detailed CAM use following breast cancer diagnosis was assessed in 2002?2003 among 764 female residents of Long Island, New York...

  16. Analyze of Predictive Model of Innovation Management in Processing and Complementary Industries of Livestock Products

    OpenAIRE

    Ahmad Reza Ommani

    2015-01-01

    The purpose of this study was designing predictive model for innovation management in processing and complementary industries of livestock products. The method of research was correlative descriptive. The population of this research was managers in processing and complementary industries of livestock products of Khouzestan Province (N=486). By stratified random sampling, a random sample (n=125) was selected for participation in the study. A questionnaire was developed to ...

  17. Evaluation of employees in public day care centers knowledge about breastfeeding and complementary feeding

    OpenAIRE

    Souza, Joelânia Pires de O.; Prudente, Amanda Moura; Silva, Dyene Aparecida; Pereira, Leandro Alves; Rinaldi, Ana Elisa M.

    2013-01-01

    OBJECTIVE: To evaluate the knowledge of public day care centers employees about breastfeeding and complementary feeding. METHODS: A cross-sectional study was conducted in 15 public day care centers randomly selected in the city of Uberlandia, Southeast Brazil. A questionnaire applied to school principals, teachers, educators and general services assistants (GSA) included demographic and socioeconomic variables and questions about knowledge on breastfeeding, complementary feeding besides ...

  18. Highly Flexible and High-Performance Complementary Inverters of Large-Area Transition Metal Dichalcogenide Monolayers

    KAUST Repository

    Pu, Jiang

    2016-03-23

    Complementary inverters constructed from large-area monolayers of WSe2 and MoS2 achieve excellent logic swings and yield an extremely high gain, large total noise margin, low power consumption, and good switching speed. Moreover, the WSe2 complementary-like inverters built on plastic substrates exhibit high mechanical stability. The results provide a path toward large-area flexible electronics. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Accuracy of the visual estimation method as a predictor of food intake in Alzheimer's patients provided with different types of food.

    Science.gov (United States)

    Amano, Nobuko; Nakamura, Tomiyo

    2018-02-01

    The visual estimation method is commonly used in hospitals and other care facilities to evaluate food intake through estimation of plate waste. In Japan, no previous studies have investigated the validity and reliability of this method under the routine conditions of a hospital setting. The present study aimed to evaluate the validity and reliability of the visual estimation method, in long-term inpatients with different levels of eating disability caused by Alzheimer's disease. The patients were provided different therapeutic diets presented in various food types. This study was performed between February and April 2013, and 82 patients with Alzheimer's disease were included. Plate waste was evaluated for the 3 main daily meals, for a total of 21 days, 7 consecutive days during each of the 3 months, originating a total of 4851 meals, from which 3984 were included. Plate waste was measured by the nurses through the visual estimation method, and by the hospital's registered dietitians through the actual measurement method. The actual measurement method was first validated to serve as a reference, and the level of agreement between both methods was then determined. The month, time of day, type of food provided, and patients' physical characteristics were considered for analysis. For the 3984 meals included in the analysis, the level of agreement between the measurement methods was 78.4%. Disagreement of measurements consisted of 3.8% of underestimation and 17.8% of overestimation. Cronbach's α (0.60, P visual estimation method was within the acceptable range. The visual estimation method was found to be a valid and reliable method for estimating food intake in patients with different levels of eating impairment. The successful implementation and use of the method depends upon adequate training and motivation of the nurses and care staff involved. Copyright © 2017 European Society for Clinical Nutrition and Metabolism. Published by Elsevier Ltd. All rights reserved.

  20. Limited dietary overlap amongst resident Arctic herbivores in winter: complementary insights from complementary methods.

    Science.gov (United States)

    Schmidt, Niels M; Mosbacher, Jesper B; Vesterinen, Eero J; Roslin, Tomas; Michelsen, Anders

    2018-04-26

    Snow may prevent Arctic herbivores from accessing their forage in winter, forcing them to aggregate in the few patches with limited snow. In High Arctic Greenland, Arctic hare and rock ptarmigan often forage in muskox feeding craters. We therefore hypothesized that due to limited availability of forage, the dietary niches of these resident herbivores overlap considerably, and that the overlap increases as winter progresses. To test this, we analyzed fecal samples collected in early and late winter. We used molecular analysis to identify the plant taxa consumed, and stable isotope ratios of carbon and nitrogen to quantify the dietary niche breadth and dietary overlap. The plant taxa found indicated only limited dietary differentiation between the herbivores. As expected, dietary niches exhibited a strong contraction from early to late winter, especially for rock ptarmigan. This may indicate increasing reliance on particular plant resources as winter progresses. In early winter, the diet of rock ptarmigan overlapped slightly with that of muskox and Arctic hare. Contrary to our expectations, no inter-specific dietary niche overlap was observed in late winter. This overall pattern was specifically revealed by combined analysis of molecular data and stable isotope contents. Hence, despite foraging in the same areas and generally feeding on the same plant taxa, the quantitative dietary overlap between the three herbivores was limited. This may be attributable to species-specific consumption rates of plant taxa. Yet, Arctic hare and rock ptarmigan may benefit from muskox opening up the snow pack, thereby allowing them to access the plants.

  1. Core and Complementary Chiropractic: Lowering Barriers to Patient Utilization of Services.

    Science.gov (United States)

    Triano, John J; McGregor, Marion

    2016-12-01

    The use of chiropractic services has stalled while interest in accessing manipulation services is rising. The purpose of this paper is to consider this dilemma in the context of the dynamics of professional socialization, surveys of public attitudes, and a potential strategic action. This is a reflection work grounded in the literature on professional socialization and the attitudes held regarding chiropractic in modern society, to include its members, and in original data on training programs. Data were interpreted on the background of the authors' cross-cultural experiences spanning patient care, research, education, and interprofessional collaboration. Recommendation on a strategic action to counter barriers in patient referrals was synthesized. Professional socialization is the process by which society enables professional privilege. Illustration of typical and divergent professional socialization models emerged that explain cognitive dissonance toward the profession. Questions of trust are commensurate with the experiences during patient encounters rather than with a common identity for the profession. Diversity among encounters perpetuates the uncertainty that affects referral sources. Commonality as an anchor for consistent professional identity and socialization through the content of core chiropractic, defined by training and practice, offers a means to offset uncertainty. Complementary chiropractic, analogous to complementary medicine, provides an outlet under professional socialization for the interests to explore additional methods of care. The practice workplace is an effective lever for altering barriers to the use of services. Clarifying rhetoric through conceptualization of core and complementary practices simplifies the socialization dynamic. Further, it takes advantage of accepted cultural semantics in meaningful analogy while continuing to empower practical diversity in care delivery in response to evolving scientific evidence.

  2. Complementary Feeding Practice of Mothers and Associated Factors in Hiwot Fana Specialized Hospital, Eastern Ethiopia

    International Nuclear Information System (INIS)

    Semahegn, Agumasie; Girma, Gezahegn Tesfaye

    2014-01-01

    Full text: Background:- In developing world infant and child mortality remain quite high. Malnutrition remains one of the main public health problems in Ethiopia that contributing to 53% of infant and child mortality. Over one third of under-five mortality is caused by under nutrition related to inadequate complementary feeding. Child feeding behaviors are an evidence that having important for a children intellectual, health and survival. Therefore, the objective of the study was to assess of complementary feeding practice of mothers to their young child. Method:- Cross sectional study design was conducted to assess complementary feeding practice of mothers to their young children in Hiwot Fana specialized hospital in January 2013. Two hundred mothers to child pairs were participate in the study to assess their timely initiation practice of complementary feeding and associated factors. Data were collected by using semi-structured questionnaire for face to face interview method. Descriptive statistics, binary and multiple logistic regressions were used for data analysis. Results: The prevalence of timely initiate of complementary feeding was 60.5%. Nineteen percent of mothers were initiating complementary feeding early (before 6 months). The reason for too early initiation of complementary feeding was lack of knowledge and perceived inadequate breast milk production by mothers were 17(47.2%), 11(30.6%) respectively. Mothers have male child three times more likely timely initiate complementary feeding than female child [AOR = 2.9, 95% CI, 1.2, 7.3]. This might be due to traditional gender norm that discriminate female feeding “female eat little talk little” this might start at early age life. Conclusion: More than half of them initiated complementary feeding timely which was low. The main reason reported by the mothers for early initiation of complementary feeding was lack of knowledge. Mothers who have male child were three times more likely timely initiate

  3. The Prevalence of Complementary and Alternative Medicine Use Among Dermatology Outpatients in Shiraz, Iran.

    Science.gov (United States)

    Dastgheib, Ladan; Farahangiz, Saman; Adelpour, Zeinab; Salehi, Alireza

    2017-10-01

    The objective of this study was to assess complementary and alternative medicine use and its related factors among Iranian dermatology outpatients. In this cross-sectional study, a self-structured questionnaire was administered to 600 dermatology outpatients. Mann-Whitney U test, chi-square test, and binary logistic regression test were used. A total of 188 (31.3%) patients had used one of complementary and alternative medicine methods. The most frequent method used was herbal medicine (89.9%). The mean years of duration of the skin condition were significantly higher in complementary and alternative medicine users compared with nonusers ( P = .037). Patients with acne and alopecia significantly used more complementary and alternative medicine (odds ratio: 2.48 and 3.19, respectively). There was a significant relationship between education and using complementary and alternative medicine ( P alternative medicine use is prevalent among our patients and we should think of ways of educating general population about complementary and alternative medicine methods and their potential risks and benefits and encourage our health care workers to communicate these materials with their patients.

  4. Impact of an online medical internet site on knowledge and practice of health care providers: a mixed methods study of the Spinal Cord Injury Rehabilitation Evidence project.

    Science.gov (United States)

    Eng, Janice J; Noonan, Vanessa K; Townson, Andrea F; Higgins, Caroline E; Rogers, Jess; Wolfe, Dalton L

    2014-12-23

    It is not known whether ongoing access to a broad-based Internet knowledge resource can influence the practice of health care providers. We undertook a study to evaluate the impact of a Web-based knowledge resource on increasing access to evidence and facilitating best practice of health care providers. The objective of this study was to evaluate (1) the impact of the Spinal Cord Injury Rehabilitation Evidence (SCIRE) project on access to information for health care providers and researchers and (2) how SCIRE influenced health care providers' management of clients. A 4-part mixed methods evaluation was undertaken: (1) monitoring website traffic and utilization using Google Analytics, (2) online survey of users who accessed the SCIRE website, (3) online survey of targeted end-users, that is, rehabilitation health care providers known to work with spinal cord injury (SCI) clients, as well as researchers, and (4) focus groups with health care providers who had previously accessed SCIRE. The online format allowed the content for a relatively specialized field to have far reach (eg, 26 countries and over 6500 users per month). The website survey and targeted end-user survey confirmed that health care providers, as well as researchers perceived that the website increased their access to SCI evidence. Access to SCIRE not only improved knowledge of SCI evidence but helped inform changes to the health providers' clinical practice and improved their confidence in treating SCI clients. The SCIRE information directly influenced the health providers' clinical decision making, in terms of choice of intervention, equipment needs, or assessment tool. A Web-based knowledge resource may be a relatively inexpensive method to increase access to evidence-based information, increase knowledge of the evidence, inform changes to the health providers' practice, and influence their clinical decision making.

  5. Promotion and advocacy for improved complementary feeding: can we apply the lessons learned from breastfeeding?

    Science.gov (United States)

    Piwoz, Ellen G; Huffman, Sandra L; Quinn, Victoria J

    2003-03-01

    Although many successes have been achieved in promoting breastfeeding, this has not been the case for complementary feeding. Some successes in promoting complementary feeding at the community level have been documented, but few of these efforts have expanded to a larger scale and become sustained. To discover the reasons for this difference, the key factors for the successful promotion of breastfeeding on a large scale were examined and compared with the efforts made in complementary feeding. These factors include definition and rationale, policy support, funding, advocacy, private-sector involvement, availability and use of monitoring data, integration of research into action, and the existence of a well-articulated series of steps for successful implementation. The lessons learned from the promotion of breastfeeding should be applied to complementary feeding, and the new Global Strategy for Infant and Young Child Feeding provides an excellent first step in this process.

  6. Organizational and provider level factors in implementation of trauma-informed care after a city-wide training: an explanatory mixed methods assessment.

    Science.gov (United States)

    Damian, April Joy; Gallo, Joseph; Leaf, Philip; Mendelson, Tamar

    2017-11-21

    While there is increasing support for training youth-serving providers in trauma-informed care (TIC) as a means of addressing high prevalence of U.S. childhood trauma, we know little about the effects of TIC training on organizational culture and providers' professional quality of life. This mixed-methods study evaluated changes in organizational- and provider-level factors following participation in a citywide TIC training. Government workers and nonprofit professionals (N = 90) who participated in a nine-month citywide TIC training completed a survey before and after the training to assess organizational culture and professional quality of life. Survey data were analyzed using multiple regression analyses. A subset of participants (n = 16) was interviewed using a semi-structured format, and themes related to organizational and provider factors were identified using qualitative methods. Analysis of survey data indicated significant improvements in participants' organizational culture and professional satisfaction at training completion. Participants' perceptions of their own burnout and secondary traumatic stress also increased. Four themes emerged from analysis of the interview data, including "Implementation of more flexible, less-punitive policies towards clients," "Adoption of trauma-informed workplace design," "Heightened awareness of own traumatic stress and need for self-care," and "Greater sense of camaraderie and empathy for colleagues." Use of a mixed-methods approach provided a nuanced understanding of the impact of TIC training and suggested potential benefits of the training on organizational and provider-level factors associated with implementation of trauma-informed policies and practices. Future trainings should explicitly address organizational factors such as safety climate and morale, managerial support, teamwork climate and collaboration, and individual factors including providers' compassion satisfaction, burnout, and secondary

  7. Validation of a new method for testing provider clinical quality in rural settings in low- and middle-income countries: the observed simulated patient.

    Directory of Open Access Journals (Sweden)

    Tin Aung

    Full Text Available BACKGROUND: Assessing the quality of care provided by individual health practitioners is critical to identifying possible risks to the health of the public. However, existing assessment methods can be inaccurate, expensive, or infeasible in many developing country settings, particularly in rural areas and especially for children. Following an assessment of the strengths and weaknesses of the existing methods for provider assessment, we developed a synthesis method combining components of direct observation, clinical vignettes, and medical mannequins which we have termed "Observed Simulated Patient" or OSP. An OSP assessment involves a trained actor playing the role of a 'mother', a life-size doll representing a 5-year old boy, and a trained observer. The provider being assessed was informed in advance of the role-playing, and told to conduct the diagnosis and treatment as he normally would while verbally describing the examinations. METHODOLOGY/PRINCIPAL FINDINGS: We tested the validity of OSP by conducting parallel scoring of medical providers in Myanmar, assessing the quality of their diagnosis and treatment of pediatric malaria, first by direct observation of true patients and second by OSP. Data were collected from 20 private independent medical practitioners in Mon and Kayin States, Myanmar between December 26, 2010 and January 12, 2011. All areas of assessment showed agreement between OSP and direct observation above 90% except for history taking related to past experience with malaria medicines. In this area, providers did not ask questions of the OSP to the same degree that they questioned real patients (agreement 82.8%. CONCLUSIONS/SIGNIFICANCE: The OSP methodology may provide a valuable option for quality assessment of providers in places, or for health conditions, where other assessment tools are unworkable.

  8. Use of complementary and alternative medicine within Norwegian hospitals

    OpenAIRE

    Jacobsen, Renate; Fønnebø, Vinjar; Foss, Nina; Kristoffersen, Agnete Egilsdatter

    2015-01-01

    Background: Over the recent decades complementary and alternative medicine (CAM) use within and outside of the public health care system in Norway has increased. The aim of this study is to describe to what extent CAM is offered in Norwegian hospitals in 2013 and investigate possible changes since 2008. Methods: In January 2013 a one-page questionnaire was sent to the medical director of all included hospitals (n = 80). He/she was asked to report whether or not one or more specifi...

  9. Complementary construction of ideal nonimaging concentrators and its applications.

    Science.gov (United States)

    Gordon, J M

    1996-10-01

    A construction principle for ideal nonimaging concentrators based on the complementary edge rays outside the nominal field of view is presented, with illustrations for the trumpet, compound parabolic concentrator, and compound hyperbolic concentrator. A simple string construction for the trumpet concentrator is shown to follow from this observation-the trumpet having been the one ideal concentrator for which no string-construction method had previously been noted. An application of these observations for solar concentrator design when nonisothermal receivers are advantageous is also presented.

  10. On the complementary presentation of results of risk studies

    International Nuclear Information System (INIS)

    Ehrhardt, J.; Bayer, A.

    1983-01-01

    The presentation of the loss of years of life provides the opportunity to illustrate in complementary way the mortality risks evaluated as part of risk studies. As phase A of the DRS (German risk study nuclear power plants) bears upon the results of the American ''Reactor Safety Study'' (WASH 1400) it does not contain that factor of failure which has only been determined in subsequent studies. Phase B intends to present the results of risk assessments increasingly in form of abridged lifetime. (orig.) [de

  11. Learning from nature: binary cooperative complementary nanomaterials.

    Science.gov (United States)

    Su, Bin; Guo, Wei; Jiang, Lei

    2015-03-01

    In this Review, nature-inspired binary cooperative complementary nanomaterials (BCCNMs), consisting of two components with entirely opposite physiochemical properties at the nanoscale, are presented as a novel concept for the building of promising materials. Once the distance between the two nanoscopic components is comparable to the characteristic length of some physical interactions, the cooperation between these complementary building blocks becomes dominant and endows the macroscopic materials with novel and superior properties. The first implementation of the BCCNMs is the design of bio-inspired smart materials with superwettability and their reversible switching between different wetting states in response to various kinds of external stimuli. Coincidentally, recent studies on other types of functional nanomaterials contribute more examples to support the idea of BCCNMs, which suggests a potential yet comprehensive range of future applications in both materials science and engineering. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. ZEROES OF GENERALIZED FRESNEL COMPLEMENTARY INTEGRAL FUNCTIONS

    Directory of Open Access Journals (Sweden)

    Jaime Lobo Segura

    2016-08-01

    Full Text Available Theoretical upper and lower bounds are established for zeroes of a parametric family of functions which are defined by integrals of the same type as the Fresnel complementary integral. Asymptotic properties for these bounds are obtained as well as monotony properties of the localization intervals. Given the value of the parameter an analytical-numerical procedure is deduced to enclose all zeros of a given function with an a priori error.

  13. Reveal quantum correlation in complementary bases

    OpenAIRE

    Shengjun Wu; Zhihao Ma; Zhihua Chen; Sixia Yu

    2014-01-01

    An essential feature of genuine quantum correlation is the simultaneous existence of correlation in complementary bases. We reveal this feature of quantum correlation by defining measures based on invariance under a basis change. For a bipartite quantum state, the classical correlation is the maximal correlation present in a certain optimum basis, while the quantum correlation is characterized as a series of residual correlations in the mutually unbiased bases. Compared with other approaches ...

  14. The copper intrauterine device for emergency contraception: an opportunity to provide the optimal emergency contraception method and transition to highly effective contraception.

    Science.gov (United States)

    Dermish, Amna I; Turok, David K

    2013-07-01

    Worldwide, 40% of all pregnancies are unintended. Widespread, over-the-counter availability of oral emergency contraception (EC) has not reduced unintended pregnancy rates. The EC visit presents an opportunity to initiate a highly effective method of contraception in a population at high risk of unintended pregnancy who are actively seeking to avoid pregnancy. The copper intrauterine device (IUD), the most effective method of EC, continues to provide contraception as effective as sterilization for up to 12 years, and it should be offered as the first-line method of EC wherever possible. Increased demand for and supply of the copper IUD for EC may have an important role in reducing rates of unintended pregnancy. The EC visit should include access to the copper IUD as optimal care but should ideally include access to all highly effective methods of contraception.

  15. Biofeedback as complementary treatment in patients with epilepsy – an underestimated therapeutic option? Review, results, discussion

    Directory of Open Access Journals (Sweden)

    Uhlmann Carmen

    2016-12-01

    Full Text Available Background. Biofeedback methods represent side effect free complementary options in the treatment of epilepsy. In this paper we review the current status of these methods in terms of clinical study results and their evaluation by systematic review papers. Possible mechanisms of action in biofeedback methods are discussed.

  16. Organizational and provider level factors in implementation of trauma-informed care after a city-wide training: an explanatory mixed methods assessment

    Directory of Open Access Journals (Sweden)

    April Joy Damian

    2017-11-01

    Full Text Available Abstract Background While there is increasing support for training youth-serving providers in trauma-informed care (TIC as a means of addressing high prevalence of U.S. childhood trauma, we know little about the effects of TIC training on organizational culture and providers’ professional quality of life. This mixed-methods study evaluated changes in organizational- and provider-level factors following participation in a citywide TIC training. Methods Government workers and nonprofit professionals (N = 90 who participated in a nine-month citywide TIC training completed a survey before and after the training to assess organizational culture and professional quality of life. Survey data were analyzed using multiple regression analyses. A subset of participants (n = 16 was interviewed using a semi-structured format, and themes related to organizational and provider factors were identified using qualitative methods. Results Analysis of survey data indicated significant improvements in participants’ organizational culture and professional satisfaction at training completion. Participants’ perceptions of their own burnout and secondary traumatic stress also increased. Four themes emerged from analysis of the interview data, including “Implementation of more flexible, less-punitive policies towards clients,” “Adoption of trauma-informed workplace design,” “Heightened awareness of own traumatic stress and need for self-care,” and “Greater sense of camaraderie and empathy for colleagues.” Conclusion Use of a mixed-methods approach provided a nuanced understanding of the impact of TIC training and suggested potential benefits of the training on organizational and provider-level factors associated with implementation of trauma-informed policies and practices. Future trainings should explicitly address organizational factors such as safety climate and morale, managerial support, teamwork climate and collaboration, and

  17. Investigation into the use of complementary and alternative medicine and affecting factors in Turkish asthmatic patients.

    Science.gov (United States)

    Tokem, Yasemin; Aytemur, Zeynep Ayfer; Yildirim, Yasemin; Fadiloglu, Cicek

    2012-03-01

    The purpose of this study was to examine the frequency of complementary and alternative medicine usage in asthmatic patients living in the west of Turkey, the most frequently used complementary and alternative medicine methods and socio-demographic factors affecting this and factors related to the disease. While the rate of complementary and alternative medicine usage in asthmatic patients and the reasons for using it vary, practices specific to different countries and regions are of interest. Differing cultural and social factors even in geographically similar regions can affect the type of complementary and alternative medicine used. Two hundred asthmatic patients registered in the asthma outpatient clinic of a large hospital in Turkey and who had undergone pulmonary function tests within the previous six months were included in this study, which was planned according to a descriptive design. The patients filled out a questionnaire on their demographic characteristics and complementary and alternative medicine usage. The proportion of patients who reported using one or more of the complementary and alternative medicine methods was 63·0%. Of these patients, 61·9% were using plants and herbal treatments, 53·2% were doing exercises and 36·5% said that they prayed. The objectives of their use of complementary and alternative medicine were to reduce asthma-related complaints (58%) and to feel better (37·8%). The proportion of people experiencing adverse effects was 3·3% (n = 4). Factors motivating asthmatic patients to use complementary and alternative medicine were the existence of comorbid diseases and a long period since diagnosis (p complementary and alternative medicine and the severity of the disease, pulmonary function test parameters, the number of asthma attacks or hospitalisations because of asthma within the last year (p > 0·05). Understanding by nurses of the causes and patterns of the use of complementary and alternative medicine in asthmatic

  18. Healing and Preventing Pain: Complementary and Integrative Approaches

    Science.gov (United States)

    ... page please turn JavaScript on. Feature: Pain Management Healing and Preventing Pain, Complementary and Integrative Approaches Past ... Pain Management" Articles Putting A Pause In Pain / Healing and Preventing Pain Complementary and Integrative Approaches / Pain ...

  19. Mind-Body Medicine Practices in Complementary and Alternative Medicine

    Science.gov (United States)

    ... Visitor Information RePORT NIH Fact Sheets Home > Mind-Body Medicine Practices in Complementary and Alternative Medicine Small Text Medium Text Large Text Mind-Body Medicine Practices in Complementary and Alternative Medicine YESTERDAY ...

  20. High Cholesterol and Complementary Health Practices: What the Science Says

    Science.gov (United States)

    ... professionals High Cholesterol and Complementary Health Practices: What the Science Says Share: February 2013 Dietary Supplements Red Yeast ... to exploring complementary health products and practices in the context of rigorous ... health researchers, and disseminating authoritative information ...

  1. Complementary and Alternative Medicines: The Herbal Male ...

    African Journals Online (AJOL)

    For a very long time, family planning methods have paid little attention to the needs of men, but instead focused primarily on women. A bulk of contraceptives on the market today is women oriented. Probably, many providers assume that women have the greatest stake and interest as far as family planning is concerned.

  2. Active Complementary Control for Affine Nonlinear Control Systems With Actuator Faults.

    Science.gov (United States)

    Fan, Quan-Yong; Yang, Guang-Hong

    2017-11-01

    This paper is concerned with the problem of active complementary control design for affine nonlinear control systems with actuator faults. The outage and loss of effectiveness fault cases are considered. In order to achieve the performance enhancement of the faulty control system, the complementary control scheme is designed in two steps. Firstly, a novel fault estimation scheme is developed. Then, by using the fault estimations to reconstruct the faulty system dynamics and introducing a cost function as the optimization objective, a nearly optimal complementary control is obtained online based on the adaptive dynamic programming (ADP) method. Unlike most of the previous ADP methods with the addition of a probing signal, new adaptive weight update laws are derived to guarantee the convergence of neural network weights and the stability of the closed-loop system, which strongly supports the online implementation of the ADP method. Finally, two simulation examples are given to illustrate the performance and effectiveness of the proposed method.

  3. Use of the 3DVH Software as a complementary method of IMRT pretreatment evaluation; Utilizacao do Software 3DVH como metodo complementar de avaliacao de pre-tratamento de IMRT

    Energy Technology Data Exchange (ETDEWEB)

    Lyra, Jesse G.P.; Bruning, Fabio F.; Funchal, Melissa; Toledo, Hugo V.; Bornatto, Pricila; Fernandes, Tatiane C.O., E-mail: jesse_lyra@hotmail.com [Hospital Erasto Gaertner / Liga Paranaense de Combate ao Cancer (LPCC), Departamento de Radioterapia, Curitiba, PR (Brazil)

    2013-04-15

    The aim of this study is to compare the method of treatment planning evaluation for IMRT using the gamma index to the method of the 3DVH Software. The 3DVH Software was used with the MapCheck2 detector 2D array under a 6MV x-ray beam of linear accelerator equipped with 120 leafs MLC. Nine treatment plans of prostate patients chose randomly and fully anonimatize were performed in the Eclipse planning system, using the AAA calculation algorithm in IMRT sliding window technique. These plans were approved and treated according to the gamma analysis criteria of the institution. The comparisons were made in absolute dose and normalized at maximum dose for each field and then with the 3DVH Software the Dmax, Dmean, D15%, D25%, D35% and D50% parameters for the bladder and rectum, Dmean for the bulb, Dmax for the femur and D95% for the PTV were evaluated. In the planar analysis by field, the plans studied had a minimum of 97.5% approval. The PTV-related differences have relative variation from 1.3 to 2.2%, that is, greater coverage than expected for this structure. For the organs at risk, the relative differences observed were between -5.3 to 25.8%, which could result in a non-approved plan if these variations are close to the clinical tolerances of the OAR. The results show that even a plan compatible with greater than or equal to 95% of the points, the gamma analysis does not give enough information if this plan can or cannot be approved for treatment and that there is a need for more detailed verification of the plan which considers not only the planar evaluation, but also the evaluation of the DVH measured, and the 3DVH Software proved be adequate for this analysis. (author)

  4. Complementary feeding practices and nutritional status of children 6 ...

    African Journals Online (AJOL)

    Objectives: Inappropriate complementary feeding practices among children aged 6-23 months is major cause of under nutrition. There is scarce information on the relationship between complementary feeding practices and nutritional status. This study aimed to determine the factors contributing to the complementary ...

  5. Complementary and Alternative Medicine (CAM): Expanding Horizons of Health Care

    Science.gov (United States)

    ... please turn Javascript on. The National Center for Complementary and Alternative Medicine (NCCAM) is this year celebrating 10 years of ... Photo: NCCAM This year, the National Center for Complementary and Alternative Medicine (NCCAM) celebrates its 10th anniversary. We explore complementary ...

  6. Women's motivation, perception and experience of complementary and alternative medicine in pregnancy: A meta-synthesis.

    Science.gov (United States)

    Bowman, Rebekah L; Davis, Deborah L; Ferguson, Sally; Taylor, Jan

    2018-04-01

    complementary and Alternative Medicine use during pregnancy is popular in many countries, including Australia. There is currently little evidence to support this practice, which raises the question of women's motivation for use of these therapies and the experiences they encounter. this study aims to explore the perceptions, motivations and experiences of pregnant women with regard to their use of Complementary and Alternative Medicine during pregnancy. a systemic review and meta-synthesis of the available research was conducted. Five databases were explored - CINAHL Plus, Medline, PubMed, AMED and Web of Science using the search terms complementary and alternative medicine; pregnancy; and pregnant. Articles included in this meta-synthesis were screened using the Preferred Reporting Items for Systematic Reviews and Meta-Analyses tool. ten initial themes were drawn from the six studies. These ten themes were summarised by three cluster themes. The results suggest that women are using Complementary and Alternative Medicine in their pregnancy as a means of supporting their sense of self-determination, to pursue a natural and safe childbirth, and because they experience a close affiliation with the philosophical underpinnings of Complementary and Alternative Medicine as an alternative to the biomedical model. these findings are important to practitioners, policy makers, governing bodies and researchers, providing insight into the motivations for Complementary and Alternative Medicine use by women in pregnancy. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  7. Use of complementary and alternative medicine among midlife Arab women living in Qatar.

    Science.gov (United States)

    Gerber, L M; Mamtani, R; Chiu, Y-L; Bener, A; Murphy, M; Cheema, S; Verjee, M

    2014-10-12

    The prevalence of use of complementary and alternative medicine (CAM) is widespread and is growing worldwide. This cross-sectional study in Qatar examined the use of CAM and its correlates among Arab women in their midlife years. Women aged 40-60 years (n = 814) were recruited at primary care centres in Qatar and completed a specially designed, pre-tested questionnaire. Overall, 38.2% of midlife women in Qatar had used CAM in the previous 12 months. Nutritional remedies and herbal remedies were the most commonly used CAM therapies, followed by physical methods. Qatari nationality and higher level of education were independently associated with CAM use. Menopause transition status was not independently associated with use of CAM. The prevalence of CAM use by women in Qatar was high, consistent with other reports worldwide. It is essential to educate and inform patients and health-care providers about the benefits and limitations associated with CAM.

  8. Complementary medicines in medicine: Conceptualising terminology among Australian medical students using a constructivist grounded theory approach.

    Science.gov (United States)

    Templeman, Kate; Robinson, Anske; McKenna, Lisa

    2015-02-01

    Terminology around the use of complementary medicines (CM) within medical discourse is ambiguous. Clear collective discourse within the medical context is required. This study reports the findings of a Constructivist Grounded Theory Method study used to explore medical students' conceptualisation of terminology and associated value components around CMs as evidenced within their discourse community. The results show that terminology surrounding CMs within medicine is politically charged and fraught with value judgements. Terms used to describe CMs were considered, many of which were deemed problematic. Categorisation of specific medicines was also deemed inappropriate in certain contexts. Conceptualisation of CM terminology, categorisation and value implications, discriminated between levels of evidence for CMs and provided insights into the social change of medicine towards emergence of an evidence-based integrative approach. The results show that terminology surrounding CM is a social construct consistent with fluid conceptualisation and operationalisation in different social contexts. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Geology - Background complementary studies. Forsmark modelling stage 2.2

    Energy Technology Data Exchange (ETDEWEB)

    Stephens, Michael B. [Geological Survey of Sweden, Uppsala (Sweden); Skagius, Kristina [Kemakta Konsult AB, Stockholm (Sweden)] (eds.)

    2007-09-15

    During Forsmark model stage 2.2, seven complementary geophysical and geological studies were initiated by the geological modelling team, in direct connection with and as a background support to the deterministic modelling of deformation zones. One of these studies involved a field control on the character of two low magnetic lineaments with NNE and NE trends inside the target volume. The interpretation of these lineaments formed one of the late deliveries to SKB that took place after the data freeze for model stage 2.2 and during the initial stage of the modelling work. Six studies involved a revised processing and analysis of reflection seismic, refraction seismic and selected oriented borehole radar data, all of which had been presented earlier in connection with the site investigation programme. A prime aim of all these studies was to provide a better understanding of the geological significance of indirect geophysical data to the geological modelling team. Such essential interpretative work was lacking in the material acquired in connection with the site investigation programme. The results of these background complementary studies are published together in this report. The titles and authors of the seven background complementary studies are presented below. Summaries of the results of each study, with a focus on the implications for the geological modelling of deformation zones, are presented in the master geological report, SKB-R--07-45. The sections in the master report, where reference is made to each background complementary study and where the summaries are placed, are also provided. The individual reports are listed in the order that they are referred to in the master geological report and as they appear in this report. 1. Scan line fracture mapping and magnetic susceptibility measurements across two low magnetic lineaments with NNE and NE trend, Forsmark. Jesper Petersson, Ulf B. Andersson and Johan Berglund. 2. Integrated interpretation of surface and

  10. Geology - Background complementary studies. Forsmark modelling stage 2.2

    International Nuclear Information System (INIS)

    Stephens, Michael B.; Skagius, Kristina

    2007-09-01

    During Forsmark model stage 2.2, seven complementary geophysical and geological studies were initiated by the geological modelling team, in direct connection with and as a background support to the deterministic modelling of deformation zones. One of these studies involved a field control on the character of two low magnetic lineaments with NNE and NE trends inside the target volume. The interpretation of these lineaments formed one of the late deliveries to SKB that took place after the data freeze for model stage 2.2 and during the initial stage of the modelling work. Six studies involved a revised processing and analysis of reflection seismic, refraction seismic and selected oriented borehole radar data, all of which had been presented earlier in connection with the site investigation programme. A prime aim of all these studies was to provide a better understanding of the geological significance of indirect geophysical data to the geological modelling team. Such essential interpretative work was lacking in the material acquired in connection with the site investigation programme. The results of these background complementary studies are published together in this report. The titles and authors of the seven background complementary studies are presented below. Summaries of the results of each study, with a focus on the implications for the geological modelling of deformation zones, are presented in the master geological report, SKB-R--07-45. The sections in the master report, where reference is made to each background complementary study and where the summaries are placed, are also provided. The individual reports are listed in the order that they are referred to in the master geological report and as they appear in this report. 1. Scan line fracture mapping and magnetic susceptibility measurements across two low magnetic lineaments with NNE and NE trend, Forsmark. Jesper Petersson, Ulf B. Andersson and Johan Berglund. 2. Integrated interpretation of surface and

  11. Acceptability of multipurpose human papillomavirus vaccines among providers and mothers of adolescent girls: A mixed-methods study in five countries

    Directory of Open Access Journals (Sweden)

    Nadja A. Vielot

    2017-06-01

    Full Text Available Introduction: Multipurpose vaccines (MPVs could be formulated to prevent multiple sexually transmitted infections simultaneously. Little is known about acceptability of MPVs among vaccine health care providers (HCPs or mothers of adolescent girls. Methods: 151 adolescent vaccine providers and 118 mothers of adolescent girls aged 9–14 were recruited from five geographically-diverse countries: Argentina, Malaysia, South Africa, South Korea, and Spain. We assessed providers’ preferences for single-purpose human papillomavirus (HPV vaccine versus MPVs (including HPV+herpes simplex virus (HSV−2, HPV+HIV, or HPV+HSV-2+HIV via quantitative surveys. Maternal MPV attitudes were assessed in four focus group discussions (FGDs in each country. Results: Most providers preferred MPVs over single-purpose HPV vaccination, with preference ranging from 61% in Malaysia to 96% in South Africa. HPV+HSV-2+HIV was the most preferred MPV formulation (56–82%. Overall, 53% of the mothers preferred MPVs over single-purpose HPV vaccines, with strongest support in South Africa (90% and lowest support in South Korea (29%. Convenience and trust in the health care system were commonly-cited reasons for MPV acceptability. Safety and efficacy concerns were common barriers to accepting MPVs, though specific concerns differed by country. Across FGDs, additional safety and efficacy information on MPVs were requested, particularly from trusted sources like HCPs. Conclusions: Though maternal acceptability of MPVs varied by country, MPV acceptability would be enhanced by having HCPs provide parents with additional MPV vaccine safety and efficacy information. While most providers preferred MPVs, future health behavior research should identify acceptability barriers, and targeted provider interventions should equip providers to improve vaccination discussions with parents. Keywords: Vaccines, Acceptability, Multipurpose, Human papillomavirus, Sexually transmitted

  12. The Dutch Complementary and Alternative Medicine (CAM) protocol: to ensure the safe and effective use of complementary and alternative medicine within Dutch mental health care

    NARCIS (Netherlands)

    Hoenders, H.J.R.; Appelo, M.T.; van den Brink, E.H.; Hartogs, B.M.A.; de Jong, J.T.V.M.

    2011-01-01

    Background: Complementary and alternative medicine (CAM) is subject to heated debates and prejudices. Studies show that CAM is widely used by psychiatric patients, usually without the guidance of a therapist and without the use of a solid working method, leading to potential health risks. Aim: The

  13. Artificial spatiotemporal touch inputs reveal complementary decoding in neocortical neurons.

    Science.gov (United States)

    Oddo, Calogero M; Mazzoni, Alberto; Spanne, Anton; Enander, Jonas M D; Mogensen, Hannes; Bengtsson, Fredrik; Camboni, Domenico; Micera, Silvestro; Jörntell, Henrik

    2017-04-04

    Investigations of the mechanisms of touch perception and decoding has been hampered by difficulties in achieving invariant patterns of skin sensor activation. To obtain reproducible spatiotemporal patterns of activation of sensory afferents, we used an artificial fingertip equipped with an array of neuromorphic sensors. The artificial fingertip was used to transduce real-world haptic stimuli into spatiotemporal patterns of spikes. These spike patterns were delivered to the skin afferents of the second digit of rats via an array of stimulation electrodes. Combined with low-noise intra- and extracellular recordings from neocortical neurons in vivo, this approach provided a previously inaccessible high resolution analysis of the representation of tactile information in the neocortical neuronal circuitry. The results indicate high information content in individual neurons and reveal multiple novel neuronal tactile coding features such as heterogeneous and complementary spatiotemporal input selectivity also between neighboring neurons. Such neuronal heterogeneity and complementariness can potentially support a very high decoding capacity in a limited population of neurons. Our results also indicate a potential neuroprosthetic approach to communicate with the brain at a very high resolution and provide a potential novel solution for evaluating the degree or state of neurological disease in animal models.

  14. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, December 2015

    International Nuclear Information System (INIS)

    Cabellos, Oscar; De Saint Jean, Cyrille; Hursin, Mathieu; Pelloni, Sandro; Ivanov, Evgeny; Kodeli, Ivan; Leconte, Pierre; Palmiotti, Giuseppe; Salvatores, Massimo; Sobes, Vladimir; Yokoyama, Kenji

    2015-12-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the fifth formal Subgroup 39 meeting held at the Institute Curie, Paris, France, on 4 December 2015. It comprises a Summary Record of the meeting, and all the available presentations (slides) given by the participants: A - Sensitivity methods: - 1: Short update on deliverables (K. Yokoyama); - 2: Does one shot Bayesian is equivalent to successive update? Bayesian inference: some matrix linear algebra (C. De Saint Jean); - 3: Progress in Methodology (G. Palmiotti); - SG39-3: Use of PIA approach. Possible application to neutron propagation experiments (S. Pelloni); - 4: Update on sensitivity coefficient methods (E. Ivanov); - 5: Stress test for U-235 fission (H. Wu); - 6: Methods and approaches development at ORNL for providing feedback from integral benchmark experiments for improvement of nuclear data files (V. Sobes); B - Integral experiments: - 7a: Update on SEG analysis (G. Palmiotti); - 7b:Status of MANTRA (G. Palmiotti); - 7c: Possible new experiments at NRAD (G. Palmiotti); - 8: B-eff experiments (I. Kodeli); - 9: On going CEA activities related to dedicated integral experiments for nuclear date validation in the Fast energy range (P. Leconte); - 10: PROTEUS Experiments: an update (M. Hursin); - 11: Short updates on neutron propagation experiments, STEK, CIELO status (O. Cabellos)

  15. Presentations provided

    Energy Technology Data Exchange (ETDEWEB)

    Hashemian, H; Beverly, D [Analysis and Measurement Services Corp., Knoxville, TN (United States)

    1999-12-31

    The following topics covered in detail at the workshop included: temperature instrumentation; pressure instrumentation; in-situ calibration and response time testing of RTDs and pressure transmitters; on-line performance monitoring and preventive maintenance of critical equipment; automated measurement of critical parameters; nuclear power plant infrastructure, management and Quality Assurance issues and recent developments for WWER and RBMK reactors. Conclusions drawn were: aging can adversely affect the performance of nuclear plant pressure transmitters; current testing interval of once in every fuel cycle is adequate for aging management; in-situ response time measurements and on-line calibration testing methods have been developed and validated for nuclear plant pressure transmitters; NUREG/CR-5851 should be taken into account for details of aging research on pressure transmitters

  16. Presentations provided

    International Nuclear Information System (INIS)

    Hashemian, H.; Beverly, D.

    1998-01-01

    The following topics covered in detail at the workshop included: temperature instrumentation; pressure instrumentation; in-situ calibration and response time testing of RTDs and pressure transmitters; on-line performance monitoring and preventive maintenance of critical equipment; automated measurement of critical parameters; nuclear power plant infrastructure, management and Quality Assurance issues and recent developments for WWER and RBMK reactors. Conclusions drawn were: aging can adversely affect the performance of nuclear plant pressure transmitters; current testing interval of once in every fuel cycle is adequate for aging management; in-situ response time measurements and on-line calibration testing methods have been developed and validated for nuclear plant pressure transmitters; NUREG/CR-5851 should be taken into account for details of aging research on pressure transmitters

  17. Complementary alternative medicine and nuclear medicine

    International Nuclear Information System (INIS)

    Werneke, Ursula; McCready, V.Ralph

    2004-01-01

    Complementary alternative medicines (CAMs), including food supplements, are taken widely by patients, especially those with cancer. Others take CAMs hoping to improve fitness or prevent disease. Physicians (and patients) may not be aware of the potential side-effects and interactions of CAMs with conventional treatment. Likewise, their known physiological effects could interfere with radiopharmaceutical kinetics, producing abnormal treatment responses and diagnostic results. Nuclear medicine physicians are encouraged to question patients on their intake of CAMs when taking their history prior to radionuclide therapy or diagnosis. The potential effect of CAMs should be considered when unexpected therapeutic or diagnostic results are found. (orig.)

  18. Complementary Theories to Supply Chain Management Revisited

    DEFF Research Database (Denmark)

    Halldorsson, Arni; Hsuan, Juliana; Kotzab, Herbert

    2015-01-01

    Purpose – The aim of this paper is to identify ways by which the theorizing of supply chain management (SCM) takes place, with particular attention to complementary theories. SCM suffers as well as benefits from a “conceptual slack”. Design/methodology/approach – The nature of SCM is discussed...... as organizational units that act or consummate an action that delivers a particular performance. Originality/value – This paper portrays SCM sensitivity to managerial challenges by moving from borrowing to a more bilateral view on theorizing of SCM, reflecting the nature of SCM....

  19. The Perils of Complementary Alternative Medicine

    Directory of Open Access Journals (Sweden)

    Michael J. Bayme

    2014-07-01

    Full Text Available More than 11,000 articles lauding alternative medicine appear in the PubMed database, but there are only a few articles describing the complications of such care. Two patients suffering from complications of alternative medicine were treated in our hospital: one patient developed necrotizing fasciitis after acupuncture, and the second developed an epidural hematoma after chiropractic manipulation. These complications serve as a clarion call to the Israeli Health Ministry, as well as to health ministries around the world, to include complementary medicine under its inspection and legislative authority.

  20. Explicit MDS Codes with Complementary Duals

    DEFF Research Database (Denmark)

    Beelen, Duals Peter; Jin, Lingfei

    2018-01-01

    In 1964, Massey introduced a class of codes with complementary duals which are called Linear Complimentary Dual (LCD for short) codes. He showed that LCD codes have applications in communication system, side-channel attack (SCA) and so on. LCD codes have been extensively studied in literature....... On the other hand, MDS codes form an optimal family of classical codes which have wide applications in both theory and practice. The main purpose of this paper is to give an explicit construction of several classes of LCD MDS codes, using tools from algebraic function fields. We exemplify this construction...

  1. Complementary and Alternative Therapies in ALS

    Science.gov (United States)

    Bedlack, Richard S.; Joyce, Nanette; Carter, Gregory T.; Pagononi, Sabrina; Karam, Chafic

    2015-01-01

    Synopsis Given the severity of their illness and lack of effective disease modifying agents, it is not surprising that most patients with ALS consider trying complementary and alternative therapies. Some of the most commonly considered alternative therapies include special diets, nutritional supplements, cannabis, acupuncture, chelation and energy healing. This chapter reviews these in detail. We also describe 3 models by which physicians may frame discussions about alternative therapies: paternalism, autonomy and shared decision making. Finally, we review a program called ALSUntangled which using shared shared decision making to review alternative therapies for ALS. PMID:26515629

  2. Impact of maternal education about complementary feeding and provision of complementary foods on child growth in developing countries

    Directory of Open Access Journals (Sweden)

    Bhutta Zulfiqar A

    2011-04-01

    Full Text Available Abstract Background Childhood undernutrition is prevalent in low and middle income countries. It is an important indirect cause of child mortality in these countries. According to an estimate, stunting (height for age Z score Methods We conducted a systematic review of published randomized and quasi-randomized trials on PubMed, Cochrane Library and WHO regional databases. The included studies were abstracted and graded according to study design, limitations, intervention details and outcome effects. The primary outcomes were change in weight and height during the study period among children 6-24 months of age. We hypothesized that provision of complementary food and education of mother about complementary food would significantly improve the nutritional status of the children in the intervention group compared to control. Meta-analyses were generated for change in weight and height by two methods. In the first instance, we pooled the results to get weighted mean difference (WMD which helps to pool studies with different units of measurement and that of different duration. A second meta-analysis was conducted to get a pooled estimate in terms of actual increase in weight (kg and length (cm in relation to the intervention, for input into the LiST model. Results After screening 3795 titles, we selected 17 studies for inclusion in the review. The included studies evaluated the impact of provision of complementary foods (±nutritional counseling and of nutritional counseling alone. Both these interventions were found to result in a significant increase in weight [WMD 0.34 SD, 95% CI 0.11 – 0.56 and 0.30 SD, 95 % CI 0.05-0.54 respectively and linear growth [WMD 0.26 SD, 95 % CI 0.08-0.43 and 0.21 SD, 95 % CI 0.01-0.41 respectively]. Pooled results for actual increase in weight in kilograms and length in centimeters showed that provision of appropriate complementary foods (±nutritional counseling resulted in an extra gain of 0.25kg (±0.18 in weight

  3. Quantitative fluorescence kinetic analysis of NADH and FAD in human plasma using three- and four-way calibration methods capable of providing the second-order advantage

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Chao [School of Chemistry and Chemical Engineering, Guizhou University, Guiyang 550025 (China); Wu, Hai-Long, E-mail: hlwu@hnu.edu.cn [State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Hunan University, Changsha 410082 (China); Zhou, Chang; Xiang, Shou-Xia; Zhang, Xiao-Hua; Yu, Yong-Jie; Yu, Ru-Qin [State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Hunan University, Changsha 410082 (China)

    2016-03-03

    The metabolic coenzymes reduced nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FAD) are the primary electron donor and acceptor respectively, participate in almost all biological metabolic pathways. This study develops a novel method for the quantitative kinetic analysis of the degradation reaction of NADH and the formation reaction of FAD in human plasma containing an uncalibrated interferent, by using three-way calibration based on multi-way fluorescence technique. In the three-way analysis, by using the calibration set in a static manner, we directly predicted the concentrations of both analytes in the mixture at any time after the start of their reactions, even in the presence of an uncalibrated spectral interferent and a varying background interferent. The satisfactory quantitative results indicate that the proposed method allows one to directly monitor the concentration of each analyte in the mixture as the function of time in real-time and nondestructively, instead of determining the concentration after the analytical separation. Thereafter, we fitted the first-order rate law to their concentration data throughout their reactions. Additionally, a four-way calibration procedure is developed as an alternative for highly collinear systems. The results of the four-way analysis confirmed the results of the three-way analysis and revealed that both the degradation reaction of NADH and the formation reaction of FAD in human plasma fit the first-order rate law. The proposed methods could be expected to provide promising tools for simultaneous kinetic analysis of multiple reactions in complex systems in real-time and nondestructively. - Highlights: • A novel three-way calibration method for the quantitative kinetic analysis of NADH and FAD in human plasma is proposed. • The method can directly monitor the concentration of each analyte in the reaction in real-time and nondestructively. • The method has the second-order advantage. • A

  4. Quantitative fluorescence kinetic analysis of NADH and FAD in human plasma using three- and four-way calibration methods capable of providing the second-order advantage

    International Nuclear Information System (INIS)

    Kang, Chao; Wu, Hai-Long; Zhou, Chang; Xiang, Shou-Xia; Zhang, Xiao-Hua; Yu, Yong-Jie; Yu, Ru-Qin

    2016-01-01

    The metabolic coenzymes reduced nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FAD) are the primary electron donor and acceptor respectively, participate in almost all biological metabolic pathways. This study develops a novel method for the quantitative kinetic analysis of the degradation reaction of NADH and the formation reaction of FAD in human plasma containing an uncalibrated interferent, by using three-way calibration based on multi-way fluorescence technique. In the three-way analysis, by using the calibration set in a static manner, we directly predicted the concentrations of both analytes in the mixture at any time after the start of their reactions, even in the presence of an uncalibrated spectral interferent and a varying background interferent. The satisfactory quantitative results indicate that the proposed method allows one to directly monitor the concentration of each analyte in the mixture as the function of time in real-time and nondestructively, instead of determining the concentration after the analytical separation. Thereafter, we fitted the first-order rate law to their concentration data throughout their reactions. Additionally, a four-way calibration procedure is developed as an alternative for highly collinear systems. The results of the four-way analysis confirmed the results of the three-way analysis and revealed that both the degradation reaction of NADH and the formation reaction of FAD in human plasma fit the first-order rate law. The proposed methods could be expected to provide promising tools for simultaneous kinetic analysis of multiple reactions in complex systems in real-time and nondestructively. - Highlights: • A novel three-way calibration method for the quantitative kinetic analysis of NADH and FAD in human plasma is proposed. • The method can directly monitor the concentration of each analyte in the reaction in real-time and nondestructively. • The method has the second-order advantage. • A

  5. Wiring assembly and method of forming a channel in a wiring assembly for receiving conductor and providing separate regions of conductor contact with the channel

    Energy Technology Data Exchange (ETDEWEB)

    Stelzer, Gerald; Meinke, Rainer; Senti, Mark

    2018-03-06

    A conductor assembly and method for constructing an assembly of the type which, when conducting current, generates a magnetic field or which, in the presence of a changing magnetic field, induces a voltage. In one embodiment the method provides a first insulative layer tubular in shape and including a surface along which a conductor segment may be positioned. A channel formed in the surface of the insulative layer defines a first conductor path and includes a surface of first contour in cross section along a first plane transverse to the conductor path. A segment of conductor having a surface of second contour in cross section is positioned at least partly in the channel and extends along the conductor path. Along the first plane, contact between the conductor surface of second contour and the channel surface of first contour includes at least two separate regions of contact.

  6. Human rights versus societal norms: a mixed methods study among healthcare providers on social stigma related to adolescent abortion and contraceptive use in Kisumu, Kenya.

    Science.gov (United States)

    Håkansson, Miranda; Oguttu, Monica; Gemzell-Danielsson, Kristina; Makenzius, Marlene

    2018-01-01

    Adolescent pregnancy represents a serious public health issue in sub-Saharan Africa, and stigmatising attitudes are contributing factors. This study investigates stigmatising attitudes related to adolescent pregnancy, abortion and contraceptive use among healthcare providers working with postabortion care (PAC) in a low-resource setting in Kenya. A mixed methods approach in a convergent design was utilised to capture attitudes related to abortion and contraceptive use among 86 (f=62; m=19) PAC providers in Kisumu, Kenya. Two Likert-scale questionnaires were used: the 18-item Stigmatising Attitudes, Beliefs and Actions Scale (SABAS) and the 7-item Contraceptive Use Stigma Scale (CUSS). 74 PAC providers responded to the SABAS, 44 to the CUSS and 12 participated in two focus group discussions. Descriptive statistics, psychometric tests of instruments and qualitative content analysis were conducted and reported in accordance with Consolidated Criteria for Reporting Qualitative Research. Cronbach's α coefficients for the total instrument was 0.88 (SABAS) and 0.84 (CUSS). The majority, 92% (68/74) agreed that a woman who has had an abortion should be treated equally to everyone else, 27% (20/74) considered abortion a sin and 30% (22/74) believed she will make abortion a habit. Contraceptive use among adolescent women was associated with promiscuity (39%; 17/44), hence contraceptives should only be available to married women (36%; 16/44), and 20% (9/44) believed that contraceptive use causes infertility. The providers encouraged women's autonomy and their rights to sexual and reproductive health; however, unclear regulations reinforce religious and cultural beliefs, which hampers implementation of evidence-based contraceptive counselling. Stigmatising attitudes towards young women in need of abortion and contraception is common among PAC providers. Their work is characterised by a conflict between human rights and societal norms, thus highlighting the need for

  7. Development of a reject classification method, applied to the diagnotic of a nuclear reactor core: processing of thermal signals providing from out-of-reactor simulation

    International Nuclear Information System (INIS)

    Smolarz, A.

    1982-07-01

    Development of an evolution detection algorithm which aim is to extend the application field of the form recognition analysis to the diagnosis and follow-up of a complex system: study of the data from the out-of-reactor test loop with forced convection in sodium, study and description of a reject classification algorithm developed in the general point of view of evolution detection. This method is tested with theoretical data and with experimental data provided by the second test loop ISIS [fr

  8. Complementary and Alternative Medicine and Osteoarthritis.

    Science.gov (United States)

    Wang, Chenchen

    2013-01-01

    Patients with osteoarthritis experience high levels of pain, psychological distress and have limited therapeutic options. Emerging evidence from clinical trials suggests that both acupuncture and Tai Chi mind-body therapies are safe and effective treatments for osteoarthritis. Acupuncture has effects over and above those of 'sham acupuncture' and the most robust evidence to date demonstrates that acupuncture does have short-term benefits and is a reasonable referral option for patients with symptomatic osteoarthritis. Tai Chi is a mind-body exercise that enhances cardiovascular fitness, muscular strength, balance, and physical function. It also appears to be associated with reduced stress and anxiety and depression, as well as improved quality of life. Thus, Tai Chi may be safely recommended to patients with osteoarthritis as a complementary and alternative medical approach to affect patient well-being. Integrative approaches combine the best of conventional medicine and complementary and alternative medicine to ultimately improve patient care. These modalities may lead to the development of better disease modifying strategies that could improve symptoms and decrease the progression of osteoarthritis. This overview synthesizes the current body of knowledge about Chinese mind-body medicine to better inform clinical decision-making for our rheumatic patients.

  9. Toward a Scalable and Sustainable Intervention for Complementary Food Safety.

    Science.gov (United States)

    Rahman, Musarrat J; Nizame, Fosiul A; Nuruzzaman, Mohammad; Akand, Farhana; Islam, Mohammad Aminul; Parvez, Sarker Masud; Stewart, Christine P; Unicomb, Leanne; Luby, Stephen P; Winch, Peter J

    2016-06-01

    Contaminated complementary foods are associated with diarrhea and malnutrition among children aged 6 to 24 months. However, existing complementary food safety intervention models are likely not scalable and sustainable. To understand current behaviors, motivations for these behaviors, and the potential barriers to behavior change and to identify one or two simple actions that can address one or few food contamination pathways and have potential to be sustainably delivered to a larger population. Data were collected from 2 rural sites in Bangladesh through semistructured observations (12), video observations (12), in-depth interviews (18), and focus group discussions (3). Although mothers report preparing dedicated foods for children, observations show that these are not separate from family foods. Children are regularly fed store-bought foods that are perceived to be bad for children. Mothers explained that long storage durations, summer temperatures, flies, animals, uncovered food, and unclean utensils are threats to food safety. Covering foods, storing foods on elevated surfaces, and reheating foods before consumption are methods believed to keep food safe. Locally made cabinet-like hardware is perceived to be acceptable solution to address reported food safety threats. Conventional approaches that include teaching food safety and highlighting benefits such as reduced contamination may be a disincentive for rural mothers who need solutions for their physical environment. We propose extending existing beneficial behaviors by addressing local preferences of taste and convenience. © The Author(s) 2016.

  10. Complementary and alternative medicine in chronic neurological pain

    Directory of Open Access Journals (Sweden)

    Shri Kant Mishra

    2015-01-01

    Full Text Available Background: There is a growing trend towards opting for complementary and alternative medicine (CAM in the therapeutic management of various medical disorders. We try to evaluate the current recommendations for CAM therapies in key neurological disorders. Materials and Methods: Sources like PubMed, Embase, UCLA libraries, USC libraries, and National Center for Complementary and Alternative Medicine (NCCAM books were searched to gather data for this review. Results: We discuss the current recommendations for CAM therapies in headaches, neck pains, lower back pains, neuropathic pains, and cancer-related pains. The CAM therapies discussed include natural therapies, mind and body therapies, and several other modalities. Conclusion: We conclude that in spite of vast literature available on the CAM therapies for neurological disorders; there is little evidence for the most beneficial CAM remedies that target common neurological disorders. Although new CAM modalities are brought to light in addition to those that have existed for centuries, further scientific data from evidence-based studies is needed to accurately compare the CAM therapies amongst each other and allopathic treatments.

  11. Chinese cyber espionage: a complementary method to aid PLA modernization

    OpenAIRE

    Ellis, Jamie M.

    2015-01-01

    Approved for public release; distribution is unlimited In 2013, Mandiant published a report linking one People’s Liberation Army (PLA) unit to the virtual exploitation of 11 modern U.S. military platforms. In the last two decades, Chinese cyber espionage has cultivated a significant reputation in cyberspace for its high-volume, illicit exploitation of defense technology. At the same time, the PLA has also rapidly modernized its naval, fighter jet, and air defense technologies. This thesis ...

  12. Complementary methods for the identification of substrates of proteolysis.

    Science.gov (United States)

    Pham, Victoria C; Anania, Veronica G; Phung, Qui T; Lill, Jennie R

    2014-01-01

    Proteolysis describes the cleavage of proteins into smaller components, which in vivo occurs typically to either activate or impair the functionality of cellular proteins. Proteolysis can occur during cellular homeostasis or can be induced due to external stress stimuli such as heat, biological or chemical insult, and is mediated by the activity of cellular enzymes, namely, proteases. Proteolytic cleavage of proteins can influence protein activation by exposing an active site or disrupting inhibitor binding. Conversely, proteolytic cleavage of many proteins has also been shown to lead to protein degradation resulting in inactivation of the substrate. Thousands of proteolytic events are known to take place in regulated cellular processes such as apoptosis and pyroptosis, however, their individual contribution to these processes remains poorly understood. Additionally, many cellular homeostatic processes are regulated by proteolytic events, however, in some cases, few proteolytic substrates have been identified. To gain further insight into the mechanism of action of these cellular processes, and to characterize biomarkers of cell death and other pathological indications, it is imperative to utilize a complete arsenal of tools for studying proteolysis events in vivo and in vitro. In this chapter, we focus on alternative methodologies to N-terminomics for profiling substrates of proteolysis and describe an additional suite of tools including orthogonal biophysical separation techniques such as COFRADIC or GASSP, and affinity capture tools that can enrich for newly formed C-termini (C-terminomics) generated as a result of caspase-mediated proteolysis. © 2014 Elsevier Inc. All rights reserved.

  13. Applications versus properties of Mg–Al layered double hydroxides provided by their syntheses methods: Alkoxide and alkoxide-free sol–gel syntheses and hydrothermal precipitation

    KAUST Repository

    Chubar, Natalia

    2013-12-01

    A tremendous number of studies have examined layered double hydroxides (LDH) for their technological applications in the ion exchange removal of toxic ions, recovery of valuable substances, catalysis, CO2 capture, as a layered host for storage/delivery of biologically active molecules, additives to plastics and building materials, and other functions. Numerous publications always conclude that the materials (prepared, as a rule, using the oldest synthesis method) are very promising for each investigated application; however, the main chemical industries producing these materials advertise them mainly (or only) as plastic additives. The authors performed extensive research using many of the appropriate methods to compare the structure, surface and adsorptive properties of three Mg-Al LHDs produced by advanced synthesis methods. One industrial sample (by Sasol, Germany) prepared by the alkoxide sol-gel method and two novel Mg-Al LDHs synthesised in-house by alkoxide-free sol-gel and hydrothermal precipitation approaches were investigated. Reasons for the very different adsorptive selectivity of the three LDHs towards arsenate, selenate, phosphate, arsenite and selenite have been provided, highlighting the role of speciation of the interlayer carbonate, aluminium, magnesium, interlayer hydration and moisture content in the adsorptive selectivity towards each toxic anion. This work is the first report presenting the regularities of the LDHs structure, surface and anion exchange properties as a function of their syntheses method. It establishes the links to potential technological applications of each investigated LDH and explains the necessary properties required to make the technological application cost-effective and efficient. The paper might accelerate industrial applications of these advanced materials. © 2013 Elsevier B.V.

  14. What are the beliefs of pediatricians and dietitians regarding complementary food introduction to prevent allergy?

    Directory of Open Access Journals (Sweden)

    Leo Sara

    2012-03-01

    Full Text Available Abstract Background The timing of complementary food introduction is controversial. Providing information on the timing of dietary introduction is crucial to the primary prevention of food allergy. The American Academy of Pediatrics offers dietary recommendations that were updated in 2008. Objective Identify the recommendations that general pediatricians and registered dietitians provide to parents and delineate any differences in counselling. Methods A 9-item survey was distributed to pediatricians and dietitians online and by mail. Information on practitioner type, gender, length of practice and specific recommendations regarding complementary food introduction and exposure was collected. Results 181 surveys were returned with a 54% response rate from pediatricians. It was not possible to calculate a meaningful dietitian response rate due to overlapping email databases. 52.5% of all respondents were pediatricians and 45.9% were dietitians. The majority of pediatricians and dietitians advise mothers that peanut abstinence during pregnancy and lactation is unnecessary. Dietitians were more likely to counsel mothers to breastfeed their infants to prevent development of atopic dermatitis than pediatricians. Hydrolyzed formulas for infants at risk of developing allergy were the top choice of formula amongst both practitioners. For food allergy prevention, pediatricians were more likely to recommend delayed introduction of peanut and egg, while most dietitians recommended no delay in allergenic food introduction. Conclusions In the prophylaxis of food allergy, pediatricians are less aware than dietitians of the current recommendation that there is no benefit in delaying allergenic food introduction beyond 4 to 6 months. More dietitians than pediatricians believe that breastfeeding decreases the risk of atopic dermatitis. Practitioners may benefit from increased awareness of current guidelines.

  15. Examining inequalities in uptake of maternal health care and choice of provider in underserved urban areas of Mumbai, India: a mixed methods study.

    Science.gov (United States)

    Alcock, Glyn; Das, Sushmita; Shah More, Neena; Hate, Ketaki; More, Sharda; Pantvaidya, Shanti; Osrin, David; Houweling, Tanja A J

    2015-09-28

    Discussions of maternity care in developing countries tend to emphasise service uptake and overlook choice of provider. Understanding how families choose among health providers is essential to addressing inequitable access to care. Our objectives were to quantify the determinants and choice of maternity care provider in Mumbai's informal urban settlements, and to explore the reasons underlying their choices. The study was conducted in informal urban communities in eastern Mumbai. We developed regression models using data from a census of married women aged 15-49 to test for associations between maternal characteristics and uptake of care and choice of provider. We then conducted seven focus group discussions and 16 in-depth interviews with purposively selected participants, and used grounded theory methods to examine the reasons for their choices. Three thousand eight hundred forty-eight women who had given birth in the preceding 2 years were interviewed in the census. The odds of institutional prenatal and delivery care increased with education, economic status, and duration of residence in Mumbai, and decreased with parity. Tertiary public hospitals were the commonest site of care, but there was a preference for private hospitals with increasing socio-economic status. Women were more likely to use tertiary public hospitals for delivery if they had fewer children and were Hindu. The odds of delivery in the private sector increased with maternal education, wealth, age, recent arrival in Mumbai, and Muslim faith. Four processes were identified in choosing a health care provider: exploring the options, defining a sphere of access, negotiating autonomy, and protective reasoning. Women seeking a positive health experience and outcome adopted strategies to select the best or most suitable, accessible provider. In Mumbai's informal settlements, institutional maternity care is the norm, except among recent migrants. Poor perceptions of primary public health facilities

  16. District health manager and mid-level provider perceptions of practice environments in acute obstetric settings in Tanzania: a mixed-method study.

    Science.gov (United States)

    Ng'ang'a, Njoki; Byrne, Mary Woods; Kruk, Margaret E; Shemdoe, Aloisia; de Pinho, Helen

    2016-08-08

    In sub-Saharan Africa, the capacity of human resources for health (HRH) managers to create positive practice environments that enable motivated, productive, and high-performing HRH is weak. We implemented a unique approach to examining HRH management practices by comparing perspectives offered by mid-level providers (MLPs) of emergency obstetric care (EmOC) in Tanzania to those presented by local health authorities, known as council health management teams (CHMTs). This study was guided by the basic strategic human resources management (SHRM) component model. A convergent mixed-method design was utilized to assess qualitative and quantitative data from the Health Systems Strengthening for Equity: The Power and Potential of Mid-Level Providers project. Survey data was obtained from 837 mid-level providers, 83 of whom participated in a critical incident interview whose aim was to elicit negative events in the practice environment that induced intention to leave their job. HRH management practices were assessed quantitatively in 48 districts with 37 members of CHMTs participating in semi-structured interviews. The eight human resources management practices enumerated in the basic SHRM component model were implemented unevenly. On the one hand, members of CHMTs and mid-level providers agreed that there were severe shortages of health workers, deficient salaries, and an overwhelming workload. On the other hand, members of CHMTs and mid-level providers differed in their perspectives on rewards and allocation of opportunities for in-service training. Although written standards of performance and supervision requirements were available in most districts, they did not reflect actual duties. Members of CHMTs reported high levels of autonomy in key HRH management practices, but mid-level providers disputed the degree to which the real situation on the ground was factored into job-related decision-making by CHMTs. The incongruence in perspectives offered by members of CHMTs

  17. A Reassessment of Complementary Access Tools for Chemical Indicators

    International Nuclear Information System (INIS)

    Siskind, Barry

    2016-01-01

    The Complementary Access Working Group (CAWG) was set up as a multi-laboratory team with members from Brookhaven National Laboratory (BNL), Idaho National Laboratory (INL), Los Alamos National Laboratory (LANL), and Sandia National Laboratories (SNL) under the direction and funding provided by National Nuclear Security Administration (NNSA) through NA-241, Next Generation Safeguards Initiative (NGSI). During FY 13 the CAWG evaluated proliferation indicators based largely on a review of the 1996 version of the IAEA's Physical Model (Phase 1). During FYs 13 and 14, the CAWG then selected technologies and specific portable and hand-held devices that could be used by the IAEA to identify the chemical compositions of materials found during complementary access (Phase 2). [Note that in this report ''chemical'' is used in a broad sense to include elements, metals, and alloys as well as chemical compounds.] In November 2014, the CAWG issued its Phase 3 report describing laboratory and field testing of three devices, each device representing a specific technology that the CAWG had selected as a result of the Phase 1 and Phase 2 activities. LANL and BNL continued measurements and analysis during FY15, leading to a reinterpretation of some of the Phase 3 results. This report serves a twofold purpose. The first section of the report compares and contrasts the Phase 3 testing with presently available preliminary results of the Karlsruhe workshop. The results of Phase 3 (and the reinterpretation of some of these results) as well as the preliminary results of the Karlsruhe workshop provide the rationale for the second section of this report. In Section 2 of this report, we revisit the combinations of signatures and technologies considered in Phases 2 and 3 of the CAWG effort. We do this to determine whether the three technologies and the matching instruments selected for the Phase 3 testing are more limited than initially thought. Based on this initial re

  18. A Reassessment of Complementary Access Tools for Chemical Indicators

    Energy Technology Data Exchange (ETDEWEB)

    Siskind, Barry [Brookhaven National Lab. (BNL), Upton, NY (United States). Nonproliferation and National Security Dept.; Stern, Warren [Brookhaven National Lab. (BNL), Upton, NY (United States). Nonproliferation and National Security Dept.; Henzl, Vladimir [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-04-01

    The Complementary Access Working Group (CAWG) was set up as a multi-laboratory team with members from Brookhaven National Laboratory (BNL), Idaho National Laboratory (INL), Los Alamos National Laboratory (LANL), and Sandia National Laboratories (SNL) under the direction and funding provided by National Nuclear Security Administration (NNSA) through NA-241, Next Generation Safeguards Initiative (NGSI). During FY 13 the CAWG evaluated proliferation indicators based largely on a review of the 1996 version of the IAEA’s Physical Model (Phase 1). During FYs 13 and 14, the CAWG then selected technologies and specific portable and hand-held devices that could be used by the IAEA to identify the chemical compositions of materials found during complementary access (Phase 2). [Note that in this report “chemical” is used in a broad sense to include elements, metals, and alloys as well as chemical compounds.] In November 2014, the CAWG issued its Phase 3 report describing laboratory and field testing of three devices, each device representing a specific technology that the CAWG had selected as a result of the Phase 1 and Phase 2 activities. LANL and BNL continued measurements and analysis during FY15, leading to a reinterpretation of some of the Phase 3 results. This report serves a twofold purpose. The first section of the report compares and contrasts the Phase 3 testing with presently available preliminary results of the Karlsruhe workshop. The results of Phase 3 (and the reinterpretation of some of these results) as well as the preliminary results of the Karlsruhe workshop provide the rationale for the second section of this report. In Section 2 of this report, we revisit the combinations of signatures and technologies considered in Phases 2 and 3 of the CAWG effort. We do this to determine whether the three technologies and the matching instruments selected for the Phase 3 testing are more limited than initially thought. Based on this initial re-evaluation of the

  19. Expectations and responsibilities regarding the sale of complementary medicines in pharmacies: perspectives of consumers and pharmacy support staff.

    Science.gov (United States)

    Iyer, Priya; McFarland, Reanna; La Caze, Adam

    2017-08-01

    Most sales of complementary medicines within pharmacies are conducted by pharmacy support staff. The absence of rigorous evidence for the effectiveness of many complementary medicines raises a number of ethical questions regarding the sale of complementary medicines in pharmacies. Explore (1) what consumers expect from pharmacists/pharmacies with regard to the sale of complementary medicines, and (2) how pharmacy support staff perceive their responsibilities when selling complementary medicines. One-on-one semi-structured interviews were conducted with a convenience sample of pharmacy support staff and consumers in pharmacies in Brisbane. Consumers were asked to describe their expectations when purchasing complementary medicines. Pharmacy support staff were asked to describe their responsibilities when selling complementary medicines. Interviews were conducted and analysed using the techniques developed within Grounded Theory. Thirty-three consumers were recruited from three pharmacies. Consumers described complementary medicine use as a personal health choice. Consumer expectations on the pharmacist included: select the right product for the right person, expert product knowledge and maintaining a wide range of good quality stock. Twenty pharmacy support staff were recruited from four pharmacies. Pharmacy support staff employed processes to ensure consumers receive the right product for the right person. Pharmacy support staff expressed a commitment to aiding consumers, but few evaluated the reliability of effectiveness claims regarding complementary medicines. Pharmacists need to respect the personal health choices of consumers while also putting procedures in place to ensure safe and appropriate use of complementary medicines. This includes providing appropriate support to pharmacy support staff. © 2016 Royal Pharmaceutical Society.

  20. Health care providers' perceived barriers to and need for the implementation of a national integrated health care standard on childhood obesity in the Netherlands - a mixed methods approach.

    Science.gov (United States)

    Schalkwijk, Annemarie A H; Nijpels, Giel; Bot, Sandra D M; Elders, Petra J M

    2016-03-08

    In 2010, a national integrated health care standard for (childhood) obesity was published and disseminated in the Netherlands. The aim of this study is to gain insight into the needs of health care providers and the barriers they face in terms of implementing this integrated health care standard. A mixed-methods approach was applied using focus groups, semi-structured, face-to-face interviews and an e-mail-based internet survey. The study's participants included: general practitioners (GPs) (focus groups); health care providers in different professions (face-to-face interviews) and health care providers, including GPs; youth health care workers; pediatricians; dieticians; psychologists and physiotherapists (survey). First, the transcripts from the focus groups were analyzed thematically. The themes identified in this process were then used to analyze the interviews. The results of the analysis of the qualitative data were used to construct the statements used in the e-mail-based internet survey. Responses to items were measured on a 5-point Likert scale and were categorized into three outcomes: 'agree' or 'important' (response categories 1 and 2), 'disagree' or 'not important'. Twenty-seven of the GPs that were invited (51 %) participated in four focus groups. Seven of the nine health care professionals that were invited (78 %) participated in the interviews and 222 questionnaires (17 %) were returned and included in the analysis. The following key barriers were identified with regard to the implementation of the integrated health care standard: reluctance to raise the subject; perceived lack of motivation and knowledge on the part of the parents; previous negative experiences with lifestyle programs; financial constraints and the lack of a structured multidisciplinary approach. The main needs identified were: increased knowledge and awareness on the part of both health care providers and parents/children; a social map of effective intervention; structural

  1. Abrasive water jet: a complementary tool

    International Nuclear Information System (INIS)

    Duarte, J.P.; Pecas, P.; Nunes, E.; Gouveia, H.

    1998-01-01

    The abrasive water jet is a powerful cutting tool, whose main advantages lie in the absence of thermal effects and the capability of cutting highly thick materials. Compared with Laser, the abrasive water jet allows the cutting of a larger range of thicknesses and a wider variety of materials such as: ornamental stones, metals, polymers, composites, wood, glass ceramics. The application of this technology has suffered and extensive growth, with successful applications in varied industrial sectors like the automotive, aerospace, textile, metalworking, ornamental stones, etc. The present communication aims at introducing the abrasive water jet as a complementary tool to laser cutting, presenting its advantages by showing some documented examples of pieces cut for different industries. (Author) 5 refs

  2. Western and Eastern Values are Complementary

    Directory of Open Access Journals (Sweden)

    Ashok Natarajan

    2018-05-01

    Full Text Available All values are spiritual in their essence, even those that appear to be physical. For all values seek perfection of the whole. The widest and highest perfection is based on the totality and oneness of reality. Such a perfection is comprehensive and inclusive. It is founded on truths that complete other truths rather than compete with them. Despite their vast cultural differences, Eastern and Western values reflect complementary aspects of a unified whole. But the process of developing values in any society depends on its underlying cultural perspective. The nature of mind is such that it divides and analyzes reality, and concentrates on one thing at a time, whereas spirituality is founded on the perception of the whole. This vast difference in underlying cultural orientation helps explain the immense gulf in understanding that has long distinguished and separated the cultures of Asia and Europe.

  3. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, December 2016

    International Nuclear Information System (INIS)

    Cabellos, Oscar; ); PELLONI, Sandro; Ivanov, Evgeny; Sobes, Vladimir; Fukushima, M.; Yokoyama, Kenji; Palmiotti, Giuseppe; Kodeli, Ivo

    2016-12-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the eighth Subgroup 39 meeting, held at the OECD NEA, Boulogne-Billancourt, France, on 1-2 December 2016. It comprises all the available presentations (slides) given by the participants: A - Presentations: Welcome and actions review (Oscar CABELLOS); B - Methods: - Detailed comparison of Progressive Incremental Adjustment (PIA) sequence results involving adjustments of spectral indices and coolant density effects on the basis of the SG33 benchmark (Sandro PELLONI); - ND assessment alternatives: Validation matrix vs XS adjustment (Evgeny IVANOV); - Implementation of Resonance Parameter Sensitivity Coefficients Calculation in CE TSUNAMI-3D (Vladimir SOBES); C - Experiment analysis, sensitivity calculations and benchmarks: - Benchmark tests of ENDF/B-VIII.0 beta 1 using sodium void reactivity worth of FCA-XXVII-1 assembly (M. FUKUSHIMA, Kenji YOKOYAMA); D - Adjustments: - Cross-section adjustment based on JENDL-4.0 using new experiments on the basis of the SG33 benchmark (Kenji YOKOYAMA); - Comparison of adjustment trends with the Cielo evaluation (Sandro PELLONI); - Expanded adjustment in support of CIELO initiative (Giuseppe PALMIOTTI); - First preliminary results of the adjustment exercise using ASPIS Fe88 and SNEAK-7A/7B k_e_f_f and b_e_f_f benchmarks (Ivo KODELI); E - Future actions, deliverables: - Discussion on future of SG39 and possible new subgroup (Giuseppe PALMIOTTI); - WPEC sub-group proposal: Investigation of Covariance Data in

  4. The "Performance of Rotavirus and Oral Polio Vaccines in Developing Countries" (PROVIDE) study: description of methods of an interventional study designed to explore complex biologic problems.

    Science.gov (United States)

    Kirkpatrick, Beth D; Colgate, E Ross; Mychaleckyj, Josyf C; Haque, Rashidul; Dickson, Dorothy M; Carmolli, Marya P; Nayak, Uma; Taniuchi, Mami; Naylor, Caitlin; Qadri, Firdausi; Ma, Jennie Z; Alam, Masud; Walsh, Mary Claire; Diehl, Sean A; Petri, William A

    2015-04-01

    Oral vaccines appear less effective in children in the developing world. Proposed biologic reasons include concurrent enteric infections, malnutrition, breast milk interference, and environmental enteropathy (EE). Rigorous study design and careful data management are essential to begin to understand this complex problem while assuring research subject safety. Herein, we describe the methodology and lessons learned in the PROVIDE study (Dhaka, Bangladesh). A randomized clinical trial platform evaluated the efficacy of delayed-dose oral rotavirus vaccine as well as the benefit of an injectable polio vaccine replacing one dose of oral polio vaccine. This rigorous infrastructure supported the additional examination of hypotheses of vaccine underperformance. Primary and secondary efficacy and immunogenicity measures for rotavirus and polio vaccines were measured, as well as the impact of EE and additional exploratory variables. Methods for the enrollment and 2-year follow-up of a 700 child birth cohort are described, including core laboratory, safety, regulatory, and data management practices. Intense efforts to standardize clinical, laboratory, and data management procedures in a developing world setting provide clinical trials rigor to all outcomes. Although this study infrastructure requires extensive time and effort, it allows optimized safety and confidence in the validity of data gathered in complex, developing country settings. © The American Society of Tropical Medicine and Hygiene.

  5. Introduction of new food textures during complementary feeding: Observations in France.

    Science.gov (United States)

    Marduel Boulanger, A; Vernet, M

    2018-01-01

    Complementary feeding plays a crucial role in the development of infants and toddlers and studies suggest benefits specific to the introduction of food textures. Evaluate the recommendations given to parents, their practices, and their attitudes towards the introduction of food textures during complementary feeding in France. This was a cross-sectional pilot study conducted in 2013. One hundred and eighty-one parents with at least one child aged 6-36 months living in France completed an ad hoc questionnaire. Eighty-eight percent of the parents surveyed received oral information on complementary feeding, but only 46% received such information on the introduction of food textures. Pediatricians were the most frequently listed source of oral information on complementary feeding. More than half the parents also looked for additional information in books and on the internet. While oral recommendations matched parents' practices, they seemed to occur at a later age compared to infants' physiological ability to handle new textures. The quality of information on food texture advice available in paper and electronic formats evaluated using a 4-point scale was found to be limited. Introducing new food texture was spontaneously reported as the most common difficulty in complementary feeding (16%). Fear of choking when first introducing food pieces was reported by 54% of the parents. The parents' lack of information on the introduction of food textures, as well as their fear that their child may choke, should encourage providing new recommendations in France. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  6. The use of complementary and alternative medicine by pregnant women: a literature review.

    Science.gov (United States)

    Hall, Helen G; Griffiths, Debra L; McKenna, Lisa G

    2011-12-01

    The use of complementary and alternative medicine (CAM) has become increasingly prevalent in industrialised countries, with women being the most prolific users. Some women continue to consume these therapies when they become pregnant. To review the literature exploring prevalence and motivation for use of complementary and alternative medicine by pregnant women. A search for relevant literature published from 2001 was undertaken using a range of databases and by examining relevant bibliographies. Although the estimates vary widely from 1% to 87%, the general trend indicates that a significant number of pregnant women use complementary and alternative medicine. Common modalities used include massage, vitamin and mineral supplements, herbal medicine, relaxation therapies and aromatherapy. Reasons for use are varied and include the belief that these therapies offer safe alternatives to pharmaceuticals, they allow greater choice and control over the childbearing experiences, and they are congruent with their holistic health beliefs. The influence of traditional cultural practices on the use of these therapies is unclear. Most expectant women rely on advice from family and friends, and many do not disclose their use to their pregnancy care providers. Many women use complementary and alternative medicine when they are pregnant. Further research is needed to gain a greater understanding of the true prevalence and expectant women's motivation for the use of complementary and alternative medicine. Health-care professionals are encouraged to ask women about their use of these treatments and seek out relevant information. Copyright © 2010 Elsevier Ltd. All rights reserved.

  7. Evaluation of a complementary cyber education program for a pathophysiology class.

    Science.gov (United States)

    Yoo, Ji-Soo; Ryue, Sook-Hee; Lee, Jung Eun; Ahn, Jeong-Ah

    2009-12-01

    The goal of this study was to develop and evaluate a complementary cyber education program for a required pathophysiology class for nursing students. The cyber education program comprised electronic bulletin boards, correspondence material storage, an announcement section, a report submission section, reference sites, and statistics on learning rates. Twelve online lectures complemented five lectures in the classroom. To evaluate the course's educational effectiveness, we performed an online objective questionnaire and an open questionnaire survey anonymously, and compared the complementary cyber education program with traditional classroom education. The complementary cyber education program effected significant improvements in scores for importance with regard to major, clarity of goals and education plans for courses, professor readiness, preciseness and description of lectures, amount and efficiency of assignments, and fairness in appraisal standards compared with the traditional classroom education group. This study indicates that a complementary cyber education program provides nursing students with the flexibility of time and space, the newest information through updated lectures, efficient motivational aids through intimacy between the lecturer and students, and concrete and meaningful tasks. The complementary cyber education course also increased student effort toward studying and student satisfaction with the class.

  8. Human resources for health strategies adopted by providers in resource-limited settings to sustain long-term delivery of ART: a mixed-methods study from Uganda.

    Science.gov (United States)

    Zakumumpa, Henry; Taiwo, Modupe Oladunni; Muganzi, Alex; Ssengooba, Freddie

    2016-10-19

    Human resources for health (HRH) constraints are a major barrier to the sustainability of antiretroviral therapy (ART) scale-up programs in Sub-Saharan Africa. Many prior approaches to HRH constraints have taken a top-down trend of generalized global strategies and policy guidelines. The objective of the study was to examine the human resources for health strategies adopted by front-line providers in Uganda to sustain ART delivery beyond the initial ART scale-up phase between 2004 and 2009. A two-phase mixed-methods approach was adopted. In the first phase, a survey of a nationally representative sample of health facilities (n = 195) across Uganda was conducted. The second phase involved in-depth interviews (n = 36) with ART clinic managers and staff of 6 of the 195 health facilities purposively selected from the first study phase. Quantitative data was analysed based on descriptive statistics, and qualitative data was analysed by coding and thematic analysis. The identified strategies were categorized into five themes: (1) providing monetary and non-monetary incentives to health workers on busy ART clinic days; (2) workload reduction through spacing ART clinic appointments; (3) adopting training workshops in ART management as a motivation strategy for health workers; (4) adopting non-physician-centred staffing models; and (5) devising ART program leadership styles that enhanced health worker commitment. Facility-level strategies for responding to HRH constraints are feasible and can contribute to efforts to increase country ownership of HIV programs in resource-limited settings. Consideration of the human resources for health strategies identified in the study by ART program planners and managers could enhance the long-term sustainment of ART programs by providers in resource-limited settings.

  9. Usability evaluation of pharmacogenomics clinical decision support aids and clinical knowledge resources in a computerized provider order entry system: a mixed methods approach.

    Science.gov (United States)

    Devine, Emily Beth; Lee, Chia-Ju; Overby, Casey L; Abernethy, Neil; McCune, Jeannine; Smith, Joe W; Tarczy-Hornoch, Peter

    2014-07-01

    Pharmacogenomics (PGx) is positioned to have a widespread impact on the practice of medicine, yet physician acceptance is low. The presentation of context-specific PGx information, in the form of clinical decision support (CDS) alerts embedded in a computerized provider order entry (CPOE) system, can aid uptake. Usability evaluations can inform optimal design, which, in turn, can spur adoption. The study objectives were to: (1) evaluate an early prototype, commercial CPOE system with PGx-CDS alerts in a simulated environment, (2) identify potential improvements to the system user interface, and (3) understand the contexts under which PGx knowledge embedded in an electronic health record is useful to prescribers. Using a mixed methods approach, we presented seven cardiologists and three oncologists with five hypothetical clinical case scenarios. Each scenario featured a drug for which a gene encoding drug metabolizing enzyme required consideration of dosage adjustment. We used Morae(®) to capture comments and on-screen movements as participants prescribed each drug. In addition to PGx-CDS alerts, 'Infobutton(®)' and 'Evidence' icons provided participants with clinical knowledge resources to aid decision-making. Nine themes emerged. Five suggested minor improvements to the CPOE user interface; two suggested presenting PGx information through PGx-CDS alerts using an 'Infobutton' or 'Evidence' icon. The remaining themes were strong recommendations to provide succinct, relevant guidelines and dosing recommendations of phenotypic information from credible and trustworthy sources; any more information was overwhelming. Participants' median rating of PGx-CDS system usability was 2 on a Likert scale ranging from 1 (strongly agree) to 7 (strongly disagree). Usability evaluation results suggest that participants considered PGx information important for improving prescribing decisions; and that they would incorporate PGx-CDS when information is presented in relevant and

  10. Professionals and tax companies: analysis of Article 9 , § 3 doDecreto Law No. 406/68 against Complementary Law No. 116/03

    Directory of Open Access Journals (Sweden)

    Michelle Portugal

    2012-04-01

    Full Text Available Analyzes the repeal of Article 9, paragraph 3 of Decree-Law No. 406/68, the qualinstituiu fixed taxation for companies that provide professional services, after the advent of Complementary Law No. 116 of 31 July 2003. presenteestudo we used the inductive method, performed by means of analysis of search bibliográficae regards the matter law. Points out the impossibility of manutençãodo the lump-sum taxation for professional service providers queestejam constituted as a company under the fence in right darepristinação Brazilian Positivo, as the Decree-Law No. 834/69 eposteriormente Complementary Law o 56/87, replaced in writing dosupracitado device, the number of services reached by fixed datributação benefit in order to make it compatible with their lists of serviçoinicialmente proposed by Decree-law 406/68. However, these diplomas legaisforam expressly repealed by Article 10 of Complementary Law No. 116 / 03.Aponta that the fact be made in the form of society is not aptoa criteria trigger disparities in the taxation of professional service providers, under penalty breach of the principle of equality. The research aims to contribute to aaplicação of Complementary Law No. 116/03, particularly as regards àtributação of professional societies, proposing some reflections on daspeculiaridades surrounding the issue, urging the debate on fixed datributação revocation, in order to seek to improve the interpretation that is damatéria now analyzed.

  11. Characterizing genomic alterations in cancer by complementary functional associations.

    Science.gov (United States)

    Kim, Jong Wook; Botvinnik, Olga B; Abudayyeh, Omar; Birger, Chet; Rosenbluh, Joseph; Shrestha, Yashaswi; Abazeed, Mohamed E; Hammerman, Peter S; DiCara, Daniel; Konieczkowski, David J; Johannessen, Cory M; Liberzon, Arthur; Alizad-Rahvar, Amir Reza; Alexe, Gabriela; Aguirre, Andrew; Ghandi, Mahmoud; Greulich, Heidi; Vazquez, Francisca; Weir, Barbara A; Van Allen, Eliezer M; Tsherniak, Aviad; Shao, Diane D; Zack, Travis I; Noble, Michael; Getz, Gad; Beroukhim, Rameen; Garraway, Levi A; Ardakani, Masoud; Romualdi, Chiara; Sales, Gabriele; Barbie, David A; Boehm, Jesse S; Hahn, William C; Mesirov, Jill P; Tamayo, Pablo

    2016-05-01

    Systematic efforts to sequence the cancer genome have identified large numbers of mutations and copy number alterations in human cancers. However, elucidating the functional consequences of these variants, and their interactions to drive or maintain oncogenic states, remains a challenge in cancer research. We developed REVEALER, a computational method that identifies combinations of mutually exclusive genomic alterations correlated with functional phenotypes, such as the activation or gene dependency of oncogenic pathways or sensitivity to a drug treatment. We used REVEALER to uncover complementary genomic alterations associated with the transcriptional activation of β-catenin and NRF2, MEK-inhibitor sensitivity, and KRAS dependency. REVEALER successfully identified both known and new associations, demonstrating the power of combining functional profiles with extensive characterization of genomic alterations in cancer genomes.

  12. Complementary and Alternative Therapies for Autism Spectrum Disorder

    Directory of Open Access Journals (Sweden)

    Natascia Brondino

    2015-01-01

    Full Text Available Background. Complementary and alternative medicine (CAM represents a popular therapeutic option for patients with autism spectrum disorder (ASD. Unfortunately, there is a paucity of data regarding the efficacy of CAM in ASD. The aim of the present systematic review is to investigate trials of CAM in ASD. Material and Methods. We searched the following databases: MEDLINE, EMBASE, Cochrane Database of Systematic Reviews, CINAHL, Psychology and Behavioral Sciences Collection, Agricola, and Food Science Source. Results. Our literature search identified 2687 clinical publications. After the title/abstract screening, 139 publications were obtained for detailed evaluation. After detailed evaluation 67 studies were included, from hand search of references we retrieved 13 additional studies for a total of 80. Conclusion. There is no conclusive evidence supporting the efficacy of CAM therapies in ASD. Promising results are reported for music therapy, sensory integration therapy, acupuncture, and massage.

  13. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, November 2014

    International Nuclear Information System (INIS)

    Aufiero, Manuele; Ivanov, Evgeny; Hoefer, Axel; Yokoyama, Kenji; Da Cruz, Dirceu Ferreira; KODELI, Ivan-Alexander; Hursin, Mathieu; Pelloni, Sandro; Palmiotti, Giuseppe; Salvatores, Massimo; Barnes, Andrew; Cabellos De Francisco, Oscar; ); Ivanova, Tatiana; )

    2014-11-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the third formal Subgroup meeting held at the NEA, Issy-les-Moulineaux, France, on 27-28 November 2014. It comprises a Summary Record of the meeting and all the available presentations (slides) given by the participants: A - Sensitivity methods: 1 - Perturbation/sensitivity calculations with Serpent (M. Aufiero); 2 - Comparison of deterministic and Monte Carlo sensitivity analysis of SNEAK-7A and FLATTOP-Pu Benchmarks (I. Kodeli); B - Integral experiments: 1 - PROTEUS experiments: selected experiments sensitivity profiles and availability, (M. Hursin, M. Salvatores - PROTEUS Experiments, HCLWR configurations); 2 - SINBAD Benchmark Database and FNS/JAEA Liquid Oxygen TOF Experiment Analysis (I. Kodeli); 3 - STEK experiment Opportunity for Validation of Fission Products Nuclear Data (D. Da Cruz); 4 - SEG (tailored adjoint flux shapes) (M. Savatores - comments) 5 - IPPE transmission experiments (Fe, 238 U) (T. Ivanova); 6 - RPI semi-integral (Fe, 238 U) (G. Palmiotti - comments); 7 - New experiments, e.g. in connection with the new NSC Expert Group on 'Improvement of Integral Experiments Data for Minor Actinide Management' (G. Palmiotti - Some comments from the Expert Group) 8 - Additional PSI adjustment studies accounting for nonlinearity (S. Pelloni); 9 - Adjustment methodology issues (G. Palmiotti); C - Am-241 and fission product issues: 1 - Am-241 validation for criticality-safety calculations (A. Barnes - Visio

  14. Male infertility: lifestyle factors and holistic, complementary, and alternative therapies

    Directory of Open Access Journals (Sweden)

    David F Yao

    2016-01-01

    Full Text Available While we may be comfortable with an allopathic approach to male infertility, we are also responsible for knowledge about lifestyle modifications and holistic, complementary, and alternative therapies that are used by many of our patients. This paper provides an evidence-based review separating fact from fiction for several of these therapies. There is sufficient literature to support weight reduction by diet and exercise, smoking cessation, and alcohol moderation. Supplements that have demonstrated positive effects on male fertility on small randomized controlled trial (RCT include aescin, coenzyme Q 10 , glutathione, Korean red ginseng, L-carnitine, nigella sativa, omega-3, selenium, a combination of zinc and folate, and the Menevit antioxidant. There is no support for the use of Vitamin C, Vitamin E, or saffron. The data for Chinese herbal medications, acupuncture, mind-body practice, scrotal cooling, and faith-based healing are sparse or inconclusive.

  15. Two complementary approaches to right-handed currents

    International Nuclear Information System (INIS)

    Gemmler, Katrin M.

    2012-01-01

    Flavour observables impose strong constraints on models of new physics. We study whether right-handed currents can provide a realistic extension to the Standard Model. We analyse two complementary models. These setups lead to new flavour violating interactions in the right-handed sector. We first consider a bottom-up approach assuming a left-right symmetric flavour group broken only by the Yukawa couplings. In this model the vertical stroke V ub vertical stroke problem can be solved. Secondly we study the Left-Right Model. We perform a comprehensive numerical analysis, including all known experimental constraints from ΔF=2 observables and the decay B →X s γ simultaneously. We observe that there exist regions in parameter space in accordance with the all data. In this model all flavour anomalies can be resolved except the vertical stroke V ub vertical stroke problem.

  16. Two complementary approaches to right-handed currents

    Energy Technology Data Exchange (ETDEWEB)

    Gemmler, Katrin M.

    2012-04-17

    Flavour observables impose strong constraints on models of new physics. We study whether right-handed currents can provide a realistic extension to the Standard Model. We analyse two complementary models. These setups lead to new flavour violating interactions in the right-handed sector. We first consider a bottom-up approach assuming a left-right symmetric flavour group broken only by the Yukawa couplings. In this model the vertical stroke V{sub ub} vertical stroke problem can be solved. Secondly we study the Left-Right Model. We perform a comprehensive numerical analysis, including all known experimental constraints from {Delta}F=2 observables and the decay B {yields}X{sub s}{gamma} simultaneously. We observe that there exist regions in parameter space in accordance with the all data. In this model all flavour anomalies can be resolved except the vertical stroke V{sub ub} vertical stroke problem.

  17. Hair: a complementary source of bioanalytical information in forensic toxicology.

    Science.gov (United States)

    Barroso, Mário; Gallardo, Eugenia; Vieira, Duarte Nuno; López-Rivadulla, Manuel; Queiroz, João António

    2011-01-01

    Hair has been used for years in the assessment and documentation of human exposure to drugs, as it presents characteristics that make it extremely valuable for this purpose, namely the fact that sample collection is performed in a noninvasive manner, under close supervision, the possibility of collecting a specimen reflecting a similar timeline in the case of claims or suspicion of a leak in the chain of custody, and the increased window of detection for the drugs. For these reasons, testing for drugs in hair provides unique and useful information in several fields of toxicology, from which the most prominent is the possibility of studying individual drug use histories by means of segmental analysis. This paper will review the unique role of hair as a complementary sample in documenting human exposure to drugs in the fields of clinical and forensic toxicology and workplace drug testing.

  18. A DIFFERENTIATED APPROACH TO THE INTRODUCTION OF COMPLEMENTARY BABY FOOD

    Directory of Open Access Journals (Sweden)

    E. I. Kondrat'eva

    2013-01-01

    Full Text Available The questions of organization of rational feeding of children in the first year of life with the use of industrial production of weaning foods are discussed. The article provides guidance on the timing and sequence of the introduction of complementary baby food in healthy children and children with alimentary disorders. The sequence of individual products and administration of individual meals depends on the health status, nutritional status of the child and the state of his digestive system. In the diet of the child should be used food and meals of industrial production, made of raw materials of high quality which meet the stringent hygienic requirements for safety parameters and have guaranteed by chemical composition. The article presents data on practical advice on the introduction of feeding in the Centre of breast feeding support and management of Tomsk.

  19. Identification of traditional foods with public health potential for complementary feeding in Western Kenya

    DEFF Research Database (Denmark)

    Kinyuru, John N,; Konyole, Silvenus O.; Kenji, Glaston M.

    2012-01-01

    The diversity of traditional foods in Kisumu West District of Western Kenya was assessed with an aim to identify the foods with a potential for complementary feeding. Leaves were the most consumed plant part amongst vegetables, while a few fruits were consumed together with their seeds. Amaranthus...... with nutritional and health benefits as perceived by the locals. Traditional food processing methods such as boiling, fermentation and sun drying were identified. Thus exploitation of the species possessing nutrient, health and processing benefits needs to be explored in complementary feeding....

  20. [Complementary medicine for low back pain : what is the scientific evidence ?

    Science.gov (United States)

    Aveni, Éléonore; Berna, Chantal; Rodondi, Pierre-Yves

    2017-06-21

    Complementary medicines are frequently used by chronic pain patients. It is a challenge for the primary care physician to provide objective information based on the scientific literature. Meta-analyses have shown favourable effects of acupuncture, therapeutic massage and osteopathy for patients with acute low back pain. Concerning chronic low back pain, meta-analyses have shown positive results with acupuncture, osteopathy, yoga and tai-chi. Other therapies have shown positive effects, but further trials are necessary to fully validate them. This article reviews the literature supporting the most studied complementary medicines.

  1. Strategies to teach alternative and complementary therapies in nursing: an integrative review

    Directory of Open Access Journals (Sweden)

    Natália Chantal Magalhães da Silva

    2013-12-01

    Full Text Available The lack of discussions that clarify the teaching of alternative and complementary therapies in undergraduate nursing programs shows the need for developing research on this topic. The objective of this study was to identify, in scientific literature, the strategies for teaching alternative and complementary therapies in nursing undergraduate programs. The guiding methodology used was integrative review. The search was performed on SCIENCE DIRECT, LILACS and MEDLINE databases. According to the articles included in this study, the proposals for including these therapies in the program are by: lectures, theoretical courses and discussion groups. However, studies should be conducted to confirm the efficacy of these strategies so these therapeutic methods can be included in the Pedagogical Political Project of the nursing undergraduate program, thus allowing for the consolidation of those practices. Descriptors: Education, Nursing; Education, Higher; Complementary Therapies.

  2. Complementary Self-Biased Logics Based on Single-Electron Transistor (SET)/CMOS Hybrid Process

    Science.gov (United States)

    Song, Ki-Whan; Lee, Yong Kyu; Sim, Jae Sung; Kim, Kyung Rok; Lee, Jong Duk; Park, Byung-Gook; You, Young Sub; Park, Joo-On; Jin, You Seung; Kim, Young-Wug

    2005-04-01

    We propose a complementary self-biasing method which enables the single-electron transistor (SET)/complementary metal-oxide semiconductor (CMOS) hybrid multi-valued logics (MVLs) to operate well at high temperatures, where the peak-to-valley current ratio (PVCR) of the Coulomb oscillation markedly decreases. The new architecture is implemented with a few transistors by utilizing the phase control capability of the sidewall depletion gates in dual-gate single-electron transistors (DGSETs). The suggested scheme is evaluated by a SPICE simulation with an analytical DGSET model. Furthermore, we have developed a new process technology for the SET/CMOS hybrid systems. We have confirmed that both of the fabricated devices, namely, SET and CMOS transistors, exhibit the ideal characteristics for the complementary self-biasing scheme: the SET shows clear Coulomb oscillations with a 100 mV period and the CMOS transistors show a high voltage gain.

  3. A metamaterial terahertz modulator based on complementary planar double-split-ring resonator

    Science.gov (United States)

    Wang, Chang-hui; Kuang, Deng-feng; Chang, Sheng-jiang; Lin, Lie

    2013-07-01

    A metamaterial based on complementary planar double-split-ring resonator (DSRR) structure is presented and demonstrated, which can optically tune the transmission of the terahertz (THz) wave. Unlike the traditional DSRR metamaterials, the DSRR discussed in this paper consists of two split rings connected by two bridges. Numerical simulations with the finite-difference time-domain (FDTD) method reveal that the transmission spectra of the original and the complementary metamaterials are both in good agreement with Babinet's principle. Then by increasing the carrier density of the intrinsic GaAs substrate, the magnetic response of the complementary special DSRR metamaterial can be weakened or even turned off. This metamaterial structure is promised to be a narrow-band THz modulator with response time of several nanoseconds.

  4. The role of complementary and alternative medicine in the treatment of eating disorders: A systematic review.

    Science.gov (United States)

    Fogarty, Sarah; Smith, Caroline A; Hay, Phillipa

    2016-04-01

    This systematic review critically appraises the role of complementary and alternative medicine in the treatment of those with an eating disorder. Sixteen studies were included in the review. The results of this review show that the role of complementary and alternative medicine in the treatment of those with an eating disorder is unclear and further studies should be conducted. A potential role was found for massage and bright light therapy for depression in those with Bulimia Nervosa and a potential role for acupuncture and relaxation therapy, in the treatment of State Anxiety, for those with an eating disorder. The role of these complementary therapies in treating eating disorders should only be provided as an adjunctive treatment only. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Complementary and Alternative Medicine: Attitudes and Use among Health Educators in the United States

    Science.gov (United States)

    Johnson, Ping; Priestley, Jennifer; Porter, Kandice Johnson; Petrillo, Jane

    2010-01-01

    Background: Interest in and use of complementary and alternative medicine (CAM) in the United States is increasing. However, CAM remains an area of nascency for researchers and western practitioners. Purpose: The purpose of this study was to examine U.S. health educators' attitudes toward CAM and their use of common CAM therapies. Methods: A…

  6. Breast milk and complementary food intake in Brazilian infants according to socio-economic position

    NARCIS (Netherlands)

    Romulus-Nieuwelink, Johanna J. C.; Doak, Colleen; Albernaz, Elaine; Victora, Cesar G.; Haisma, Hinke

    Objective. (a) To compare breast milk and complementary food intake between breast-fed infants from high and low socio-economic status (SES) aged 8 months of age; (b) To compare these intakes with PAHO/WHO recommendations. Methods. Cross-sectional, community-based study in Pelotas, Brazil. Breast

  7. Breast milk and complementary food intake in Brazilian infants according to socio-economic position

    NARCIS (Netherlands)

    Romulus-Nieuwelink, J.C.; Doak, C.M.; Albernaz, E.; Victora, C.G.; Haisma, H.

    2011-01-01

    Objective. (a) To compare breast milk and complementary food intake between breast-fed infants from high and low socio-economic status (SES) aged 8 months of age; (b) To compare these intakes with PAHO/WHO recommendations. Methods. Cross-sectional, community-based study in Pelotas, Brazil. Breast

  8. Observational evidence of the complementary relationship in regional evaporation lends strong support for Bouchet's hypothesis

    Science.gov (United States)

    Jorge A. Ramirez; Michael T. Hobbins; Thomas C. Brown

    2005-01-01

    Using independent observations of actual and potential evapotranspiration at a wide range of spatial scales, we provide direct observational evidence of the complementary relationship in regional evapotranspiration hypothesized by Bouchet in 1963. Bouchet proposed that, for large homogeneous surfaces with minimal advection of heat and moisture, potential and actual...

  9. Complementary and Alternative Medicine in Rural Communities: Current Research and Future Directions

    Science.gov (United States)

    Wardle, Jon; Lui, Chi-Wai; Adams, Jon

    2012-01-01

    Contexts: The consumption of complementary and alternative medicine (CAM) in rural areas is a significant contemporary health care issue. An understanding of CAM use in rural health can provide a new perspective on health beliefs and practice as well as on some of the core service delivery issues facing rural health care generally. Purpose: This…

  10. Perceptions of health care providers and patients on quality of care in maternal and neonatal health in fourteen Bangladesh government healthcare facilities: a mixed-method study.

    Science.gov (United States)

    Islam, Farzana; Rahman, Aminur; Halim, Abdul; Eriksson, Charli; Rahman, Fazlur; Dalal, Koustuv

    2015-06-19

    Bangladesh has achieved remarkable progress in healthcare with a steady decline in maternal and under-5 child mortality rates in efforts to achieve Millennium Development Goals 4 and 5. However, the mortality rates are still very high compared with high-income countries. The quality of healthcare needs improve to reduce mortality rates further. It is essential to investigate the current quality of healthcare before implementing any interventions. The study was conducted to explore the perception of healthcare providers about the quality of maternal and neonatal health (MNH) care. The study also investigated patient satisfaction with the MNH care received from district and sub-district hospitals. Both qualitative and quantitative methods were used in the study. Two district and 12 sub-district hospitals in Thakurgaon and Jamalpur in Bangladesh were the study settings. Fourteen group discussions and 56 in-depth interviews were conducted among the healthcare providers. Client exit interviews were conducted with 112 patients and their attendants from maternity, labor, and neonatal wards before being discharged from the hospitals. Eight physicians and four anthropologists collected data between November and December 2011 using pretested guidelines. The hospital staff identified several key factors that affected the quality of patient care: shortage of staff and logistics; lack of laboratory support; under use of patient-management protocols; a lack of training; and insufficient supervision. Doctors were unable to provide optimal care because of the high volume of patients. The exit interviews revealed that 85 % of respondents were satisfied with the hospital services received. Seven out of 14 respondents were satisfied with the cleanliness of the hospital facilities. More than half of the respondents were satisfied with the drugs they received. In half of the facilities, patients did not get an opportunity to ask the healthcare providers questions about their health

  11. MODERN COMPLEMENTARY FOODS IN THE PREVENTION OF ALLERGIC DISEASES: PROSPECTIVE STUDY RESULTS

    Directory of Open Access Journals (Sweden)

    Т. E. Borovik

    2014-01-01

    Full Text Available Background: Rate allergenic properties of the complementary food line based on grains, fruits/vegetables and meat in the diet of infants (0–1 years old. Methods: The study included children aged 4–6 months with natural, mixed or artificial feeding, who had not received any complementary food before. The children were almost healthy or had a burdened allergic history. Complementary foods (porridge, vegetable puree, meat puree and fruit puree were administered basing on an individual plan depending on age, nutritional status and nature of feces. Tolerability of products and dynamics of mass-height and laboratory parameters were evaluated. At the beginning and at the end of the study, capillary blood was taken to determine the content of hemoglobin in red blood cells (MCH, the equivalent of hemoglobin in reticulocytes (RetHe, iron, ferritin, prealbumin, and specific E class immunoglobulin (IgE to the proteins in cow's and goat milk, apples, pears, prunes, zucchini, broccoli, cauliflower, rice, maize, buckwheat, turkey meat, and rabbit meat (quantitative allergy diagnostics using an express method. In addition, a scatological study was performed. Results: 60 healthy children received complementary foods based on grains, fruits/vegetables and meat on a step-by-step basis. The level of specific IgE to food allergens in all children under the study was within normal range (0–135 IU/ml both initially and after the administration of all the complementary foods studied. Conclusion: The investigated complementary foods have a low sensitizing potential, including in children with a burdened allergic history. This allows us to describe them as hypoallergenic products.

  12. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, May 2014

    International Nuclear Information System (INIS)

    Aliberti, G.; Archier, P.; Dunn, M.; Dupont, E.; Hill, I.; ); Garcia, A.; Hursin, M.; Pelloni, S.; Ivanova, T.; Kodeli, I.; Palmiotti, G.; Salvatores, M.; Touran, N.; Wenming, Wang; Yokoyama, K.

    2014-05-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the second Subgroup meeting, held at the NEA, Issy-les-Moulineaux, France, on 13 May 2014. It comprises a Summary Record of the meeting and all the available presentations (slides) given by the participants: A - Welcome: Review of actions (M. Salvatores); B - Inter-comparison of sensitivity coefficients: 1 - Sensitivity Computation with Monte Carlo Methods (T. Ivanova); 2 - Sensitivity analysis of FLATTOP-Pu (I. Kodeli); 3 - Sensitivity coefficients by means of SERPENT-2 (S. Pelloni); 4 - Demonstration - Database for ICSBEP (DICE) and Database and Analysis Tool for IRPhE (IDAT) (I. Hill); C - Specific new experiments: 1 - PROTEUS FDWR-II (HCLWR) program summary (M. Hursin); 2 - STEK and SEG Experiments, M. Salvatores 3 - Experiments related to "2"3"5U, "2"3"8U, "5"6Fe and "2"3Na, G. Palmiotti); 4 - Validation of Iron Cross Sections against ASPIS Experiments (JEF/DOC-420) (I. Kodeli); 5 - Benchmark analysis of Iron Cross-sections (EFFDOC-1221) (I. Kodeli 6 - Integral Beta-effective Measurements (K. Yokoyama on behalf of M. Ishikawa); D - Adjustment results: 1 - Impacts of Covariance Data and Interpretation of Adjustment Trends of ADJ2010, (K. Yokoyama); 2 - Revised Recommendations from ADJ2010 Adjustment (K. Yokoyama); 3 - Comparisons and Discussions on Adjustment trends from JEFF (CEA) (P. Archier); 4 - Feedback on CIELO Isotopes from ENDF/B-VII.0 Adjustment (G. Palmiotti); 5 - Demonstration - Plot comparisons of participants' results (E

  13. Capacity building of nurses providing neonatal care in Rio de Janeiro, Brazil: methods for the POINTS of care project to enhance nursing education and reduce adverse neonatal outcomes

    Directory of Open Access Journals (Sweden)

    Darlow Brian A

    2012-03-01

    Full Text Available Abstract Background Increased survival of preterm infants in developing countries has often been accompanied by increased morbidity. A previous study found rates of severe retinopathy of prematurity varied widely between different neonatal units in Rio de Janeiro. Nurses have a key role in the care of high-risk infants but often do not have access to ongoing education programmes. We set out to design a quality improvement project that would provide nurses with the training and tools to decrease neonatal mortality and morbidity. The purpose of this report is to describe the methods and make the teaching package (POINTS of care--six modules addressing Pain control; optimal Oxygenation; Infection control; Nutrition interventions; Temperature control; Supportive care available to others. Methods/Design Six neonatal units, caring for 40% of preterm infants in Rio de Janeiro were invited to participate. In Phase 1 of the study multidisciplinary workshops were held in each neonatal unit to identify the neonatal morbidities of interest and to plan for data collection. In Phase 2 the teaching package was developed and tested. Phase 3 consisted of 12 months data collection utilizing a simple tick-sheet for recording. In Phase 4 (the Intervention all nurses were asked to complete all six modules of the POINTS of care package, which was supplemented by practical demonstrations. Phase 5 consisted of a further 12 months data collection. In Phase 1 it was agreed to include inborn infants with birthweight ≤ 1500 g or gestational age of ≤ 34 weeks. The primary outcome was death before discharge and secondary outcomes included retinopathy of prematurity and bronchopulmonary dysplasia. Assuming 400-450 infants in both pre- and post-intervention periods the study had 80% power at p = Discussion The results of the POINTS of Care intervention will be presented in a separate publication. Trial registration Current Controlled Trials: ISRCTN83110114

  14. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, November 2013

    International Nuclear Information System (INIS)

    De Saint Jean, C.; Dupont, E.; ); Dyrda, J.; Hursin, M.; Pelloni, S.; Ishikawa, M.; Ivanov, E.; Ivanova, T.; Kim, D.H.; Ee, Y.O.; Kodeli, I.; Leal, L.; Leichtle, D.; Palmiotti, G.; Salvatores, M.; Pronyaev, V.; Simakov, S.; )

    2013-11-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the first formal Subgroup 39 meeting held at the NEA, Issy-les-Moulineaux, France, on 28-29 November 2013. It comprises a Summary Record of the meeting and all the available presentations (slides) given by the participants: A - Recent data adjustments performances and trends: 1 - Recommendations from ADJ2010 adjustment (M. Ishikawa); 2 - Feedback on CIELO isotopes from ENDF/B-VII.0 adjustment (G. Palmiotti); 3 - Sensitivity and uncertainty results on FLATTOP-Pu (I. Kodeli); 4 - SG33 benchmark: Comparative adjustment results (S. Pelloni) 5 - Integral benchmarks for data assimilation: selection of a consistent set and establishment of integral correlations (E. Ivanov); 6 - PROTEUS experimental data (M. Hursin); 7 - Additional information on High Conversion Light Water Reactor (HCLWR aka FDWR-II) experiments (14 January 2014); 8 - Data assimilation of benchmark experiments for homogenous thermal/epithermal uranium systems (J. Dyrda); B - Methodology issues: 1 - Adjustment methodology issues (G. Palmiotti); 2 - Marginalisation, methodology issues and nuclear data parameter adjustment (C. De Saint Jean); 3 - Nuclear data parameter adjustment (G. Palmiotti). A list of issues and actions conclude the document

  15. The Development of a Community-Based, Pharmacist-Provided Falls Prevention MTM Intervention for Older Adults: Relationship Building, Methods, and Rationale

    Directory of Open Access Journals (Sweden)

    David A. Mott

    2014-01-01

    Full Text Available The objectives of this article are to discuss the process of community engagement experienced to plan and implement a pilot study of a pharmacist-provided MTM intervention focused on reducing the use of medications associated with falling, and to present the research methods that emerged from the community engagement process to evaluate the feasibility, acceptance, and preliminary impact of the intervention. Key lessons learned from the community engagement process also are presented and discussed. The relationship building and planning process took twelve months. The RE-AIM framework broadly guided the planning process since an overarching goal for the community partners was developing a program that could be implemented and sustained in the future. The planning phase focused on identifying research questions that were of most interest to the community partners, the population to study, the capacity of partners to perform activities, and process evaluation. Much of the planning phase was accomplished with face-to-face meetings. After all study processes, study materials, and data collection tools were developed, a focus group of older adults who represented the likely targets of the MTM intervention provided feedback related to the concept and process of the intervention. Nine key lessons were identified from the community engagement process. One key to successful community engagement is partners taking the time to educate each other about experiences, processes, and successes and failures. Additionally, partners must actively listen to each other to better understand barriers and facilitators that likely will impact the planning and implementation processes. Successful community engagement will be important to develop both formative and summative evaluation processes that will help to produce valid evidence about the effectiveness of pharmacists in modifying drug therapy and preventing falls as well as to promote the adoption and

  16. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, May 2015

    International Nuclear Information System (INIS)

    Wang, Wenming; Yokoyama, Kenji; Kim, Do Heon; Kodeli, Ivan-Alexander; Hursin, Mathieu; Pelloni, Sandro; Palmiotti, Giuseppe; Salvatores, Massimo; Touran, Nicholas; Cabellos De Francisco, Oscar; )

    2015-05-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the fourth Subgroup meeting, held at the NEA, Issy-les-Moulineaux, France, on 19-20 May 2015. It comprises a Summary Record of the meeting, two papers on deliverables and all the available presentations (slides) given by the participants: 1 - Status of Deliverables: '1. Methodology' (K. Yokoyama); 2 - Status of Deliverables: '2. Comments on covariance data' (K. Yokoyama); 3 - PROTEUS HCLWR Experiments (M. Hursin); 4 - Preliminary UQ Efforts for TWR Design (N. Touran); 5 - Potential use of beta-eff and other benchmark for adjustment (I. Kodeli); 6 - k_e_f_f uncertainties for a simple case of Am"2"4"1 using different codes and evaluated files (I. Kodeli); 7 - k_e_f_f uncertainties for a simple case of Am"2"4"1 using TSUNAMI (O. Cabellos); 8 - REWIND: Ranking Experiments by Weighting to Improve Nuclear Data (G. Palmiotti); 9 - Recent analysis on NUDUNA/MOCABA applications to reactor physics parameters (E. Castro); 10 - INL exploratory study for SEG (A. Hummel); 11 - The Development of Nuclear Data Adjustment Code at CNDC (H. Wu); 12 - SG39 Perspectives (M. Salvatores). A list of issues and actions conclude the document

  17. IDENTIFYING COMPLEMENTARY AND ALTERNATIVE MEDICINE USAGE INFORMATION FROM INTERNET RESOURCES: A SYSTEMATIC REVIEW

    Science.gov (United States)

    Sharma, V.; Holmes, J.H.; Sarkar, I.N.

    2016-01-01

    SUMMARY Objective Identify and highlight research issues and methods used in studying Complementary and Alternative Medicine (CAM) information needs, access, and exchange over the Internet. Methods A literature search was conducted using Preferred Reporting Items for Systematic Reviews and Meta-Analysis guidelines from PubMed to identify articles that have studied Internet use in the CAM context. Additional searches were conducted at Nature.com and Google Scholar. Results The Internet provides a major medium for attaining CAM information and can also serve as an avenue for conducting CAM related surveys. Based on the literature analyzed in this review, there seems to be significant interest in developing methodologies for identifying CAM treatments, including the analysis of search query data and social media platform discussions. Several studies have also underscored the challenges in developing approaches for identifying the reliability of CAM-related information on the Internet, which may not be supported with reliable sources. The overall findings of this review suggest that there are opportunities for developing approaches for making available accurate information and developing ways to restrict the spread and sale of potentially harmful CAM products and information. Conclusions Advances in Internet research are yet to be used in context of understanding CAM prevalence and perspectives. Such approaches may provide valuable insights into the current trends and needs in context of CAM use and spread. PMID:27352304

  18. Complementary and Alternative Medicine: A Clinical Study in 1,016 Hematology/Oncology Patients.

    Science.gov (United States)

    Hierl, Marina; Pfirstinger, Jochen; Andreesen, Reinhard; Holler, Ernst; Mayer, Stephanie; Wolff, Daniel; Vogelhuber, Martin

    2017-01-01

    Surveys state a widespread use of complementary and alternative medicine (CAM) in patients with malignant diseases. CAM methods might potentially interfere with the metabolization of tumor-specific therapy. However, there is little communication about CAM use in hematology/oncology patients between patients, CAM providers, and oncologists. A self-administered questionnaire was handed out to all patients attending to the hematology/oncology outpatient clinic of Regensburg University Hospital. Subsequently, a chart review of all CAM users was performed. Questionnaires of 1,016 patients were analyzed. Of these patients, 30% used CAM, preferably vitamins and micronutrients. Main information sources for CAM methods were physicians/nonmedical practitioners and friends/relatives. CAM therapies were provided mainly by licensed physicians (29%), followed by nonmedical practitioners (14%) and the patients themselves (13%). Although 62% of the CAM users agreed that the oncologist may know about their CAM therapy, a chart entry about CAM use was found only in 41%. CAM is frequently used by hematology/oncology patients. Systematic communication about CAM is essential to avoid possible drug interactions. © 2017 S. Karger AG, Basel.

  19. Economic valuation of the ecosystem services provided by a protected area in the Brazilian Cerrado: application of the contingent valuation method.

    Science.gov (United States)

    Resende, F M; Fernandes, G W; Andrade, D C; Néder, H D

    2017-11-01

    Considering that the economic valuation of ecosystem services is a useful approach to support the conservation of natural areas, we aimed to estimate the monetary value of the benefits provided by a protected area in southeast Brazil, the Serra do Cipó National Park. We calculated the visitor's willingness to pay to conserve the ecosystems of the protected area using the contingent valuation method. Located in a region under intense anthropogenic pressure, the Serra do Cipó National Park is mostly composed of rupestrian grassland ecosystems, in addition to other Cerrado physiognomies. We conducted a survey consisting of 514 interviews with visitors of the region and found that the mean willingness to pay was R$ 7.16 year-1, which corresponds to a total of approximately R$ 716,000.00 year-1. We detected that per capita income, the household size, the level of interest in environmental issues and the place of origin influenced the likelihood that individuals are willing to contribute to the conservation of the park, as well as the value of the stated willingness to pay. This study conveys the importance of conserving rupestrian grassland and other Cerrado physiognomies to decision makers and society.

  20. Assessment of salient beliefs affecting mothers' intention to adherence to dietary diversity in their children's complementary feeding

    Directory of Open Access Journals (Sweden)

    Akram Karimi-Shahanjarini

    2017-01-01

    Full Text Available Background: Providing a variety of foods has been emphasized as one of the most important features of optimal complementary feeding. This study investigated key beliefs that guide mothers' intention to adherence to dietary diversity in their 1–2-year-old children's complementary feeding. Methods: This was a cross-sectional study involving 290 mothers (mean age = 27, standard deviation = 5.32 with child 1–2-year-old attending maternal and child health section of health centers in Rasht, Iran. To represent the socioeconomic status of the participants, 6 centers out of 15 were selected from three different socioeconomic areas (low-, middle-, and high-income areas. Mothers completed a questionnaire assessing intention and belief-based items of theory of planned behavior. Correlations and multiple regression analyses were performed. Results: The mean age of mothers was 27 ± 5.33 (27–43 years. Regression analyses revealed that among behavioral beliefs, the perception that adherence to dietary diversity would lead to improve children's growth was the significant predictor of intention (β = 0.13,P= 0.04. Regarding normative beliefs, perceived social pressure from health-care professionals to adherence to dietary diversity significantly predicted intention (β = 0.15,P= 0.01. Among control beliefs, the perception that daily pressures made difficult adherence to dietary diversity was the key determinant (β = 0.19,P= 0.01. Conclusions: Findings of this study represent the important beliefs that can be addressed in development planning aimed at modifying mothers' child complementary feeding practices.

  1. Assessment of Salient Beliefs Affecting Mothers’ Intention to Adherence to Dietary Diversity in their Children's Complementary Feeding

    Science.gov (United States)

    Karimi-Shahanjarini, Akram; Rahmani, Fatemeh; Roshanei, Ghodratollah; Mahdi Hazavehei, Seyyed M.

    2017-01-01

    Background: Providing a variety of foods has been emphasized as one of the most important features of optimal complementary feeding. This study investigated key beliefs that guide mothers’ intention to adherence to dietary diversity in their 1–2-year-old children's complementary feeding. Methods: This was a cross-sectional study involving 290 mothers (mean age = 27, standard deviation = 5.32) with child 1–2-year-old attending maternal and child health section of health centers in Rasht, Iran. To represent the socioeconomic status of the participants, 6 centers out of 15 were selected from three different socioeconomic areas (low-, middle-, and high-income areas). Mothers completed a questionnaire assessing intention and belief-based items of theory of planned behavior. Correlations and multiple regression analyses were performed. Results: The mean age of mothers was 27 ± 5.33 (27–43 years). Regression analyses revealed that among behavioral beliefs, the perception that adherence to dietary diversity would lead to improve children's growth was the significant predictor of intention (β = 0.13, P = 0.04). Regarding normative beliefs, perceived social pressure from health-care professionals to adherence to dietary diversity significantly predicted intention (β = 0.15, P = 0.01). Among control beliefs, the perception that daily pressures made difficult adherence to dietary diversity was the key determinant (β = 0.19, P = 0.01). Conclusions: Findings of this study represent the important beliefs that can be addressed in development planning aimed at modifying mothers’ child complementary feeding practices. PMID:28479970

  2. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, May 2016

    International Nuclear Information System (INIS)

    Herman, Michal Wladyslaw; Cabellos De Francisco, Oscar; Beck, Bret; Ignatyuk, Anatoly V.; Palmiotti, Giuseppe; Grudzevich, Oleg T.; Salvatores, Massimo; Chadwick, Mark; Pelloni, Sandro; Diez De La Obra, Carlos Javier; Wu, Haicheng; Sobes, Vladimir; Rearden, Bradley T.; Yokoyama, Kenji; Hursin, Mathieu; Penttila, Heikki; Kodeli, Ivan-Alexander; Plevnik, Lucijan; Plompen, Arjan; Gabrielli, Fabrizio; Leal, Luiz Carlos; Aufiero, Manuele; Fiorito, Luca; Hummel, Andrew; Siefman, Daniel; Leconte, Pierre

    2016-05-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. WPEC subgroup 40-CIELO (Collaborative International Evaluated Library Organization) provides a new working paradigm to facilitate evaluated nuclear reaction data advances. It brings together experts from across the international nuclear reaction data community to identify and document discrepancies among existing evaluated data libraries, measured data, and model calculation interpretations, and aims to make progress in reconciling these discrepancies to create more accurate ENDF-formatted files. SG40-CIELO focusses on 6 important isotopes: "1H, "1"6O, "5"6Fe, "2"3"5","2"3"8U, "2"3"9Pu. This document is the proceedings of the seventh formal Subgroup 39 meeting and of the Joint SG39+SG40 Session held at the NEA, OECD Conference Center, Paris, France on 10-11 May 2016. It comprises a Summary Record of the meeting, and all the available presentations (slides) given by the participants: A - Welcome and actions review (Oscar CABELLOS); B - Methods: - XGPT: uncertainty propagation and data assimilation from continuous energy covariance matrix and resonance parameters covariances (Manuele AUFIERO); - Optimal experiment utilization (REWINDing PIA), (G. Palmiotti); C - Experiment analysis, sensitivity calculations and benchmarks: - Tripoli-4 analysis of SEG experiments (Andrew HUMMEL); - Tripoli-4 analysis of BERENICE experiments (P. DUFAY, Cyrille DE SAINT JEAN); - Preparation of sensitivities of k-eff, beta-eff and shielding benchmarks for adjustment exercise (Ivo KODELI); - SA and

  3. Complementary therapy use by patients and parents of children with asthma and the implications for NHS care: a qualitative study

    Directory of Open Access Journals (Sweden)

    Sharp Debbie

    2006-06-01

    Full Text Available Abstract Background Patients are increasingly using complementary therapies, often for chronic conditions. Asthma is the most common chronic condition in the UK. Previous research indicates that some asthma patients experience gaps in their NHS care. However, little attention has been given to how and why patients and parents of children with asthma use complementary therapies and the implications for NHS care. Methods Qualitative study, comprising 50 semi-structured interviews with a purposeful sample of 22 adults and 28 children with asthma (plus a parent, recruited from a range of NHS and non-NHS settings in Bristol, England. Data analysis was thematic, drawing on the principles of constant comparison. Results A range of complementary therapies were being used for asthma, most commonly Buteyko breathing and homeopathy. Most use took place outside of the NHS, comprising either self-treatment or consultation with private complementary therapists. Complementary therapies were usually used alongside not instead of conventional asthma treatment. A spectrum of complementary therapy users emerged, including "committed", "pragmatic" and "last resort" users. Motivating factors for complementary therapy use included concerns about conventional NHS care ("push factors" and attractive aspects of complementary therapies ("pull factors". While participants were often uncertain whether therapies had directly helped their asthma, breathing techniques such as the Buteyko Method were most notably reported to enhance symptom control and enable reduction in medication. Across the range of therapies, the process of seeking and using complementary therapies seemed to help patients in two broad ways: it empowered them to take greater personal control over their condition rather than feel dependant on medication, and enabled exploration of a broader range of possible causes of their asthma than commonly discussed within NHS settings. Conclusion Complementary therapy

  4. Cerebral asymmetries: complementary and independent processes.

    Directory of Open Access Journals (Sweden)

    Gjurgjica Badzakova-Trajkov

    Full Text Available Most people are right-handed and left-cerebrally dominant for speech, leading historically to the general notion of left-hemispheric dominance, and more recently to genetic models proposing a single lateralizing gene. This hypothetical gene can account for higher incidence of right-handers in those with left cerebral dominance for speech. It remains unclear how this dominance relates to the right-cerebral dominance for some nonverbal functions such as spatial or emotional processing. Here we use functional magnetic resonance imaging with a sample of 155 subjects to measure asymmetrical activation induced by speech production in the frontal lobes, by face processing in the temporal lobes, and by spatial processing in the parietal lobes. Left-frontal, right-temporal, and right-parietal dominance were all intercorrelated, suggesting that right-cerebral biases may be at least in part complementary to the left-hemispheric dominance for language. However, handedness and parietal asymmetry for spatial processing were uncorrelated, implying independent lateralizing processes, one producing a leftward bias most closely associated with handedness, and the other a rightward bias most closely associated with spatial attention.

  5. Behavior analysis and neuroscience: Complementary disciplines.

    Science.gov (United States)

    Donahoe, John W

    2017-05-01

    Behavior analysis and neuroscience are disciplines in their own right but are united in that both are subfields of a common overarching field-biology. What most fundamentally unites these disciplines is a shared commitment to selectionism, the Darwinian mode of explanation. In selectionism, the order and complexity observed in nature are seen as the cumulative products of selection processes acting over time on a population of variants-favoring some and disfavoring others-with the affected variants contributing to the population on which future selections operate. In the case of behavior analysis, the central selection process is selection by reinforcement; in neuroscience it is natural selection. The two selection processes are inter-related in that selection by reinforcement is itself the product of natural selection. The present paper illustrates the complementary nature of behavior analysis and neuroscience through considering their joint contributions to three central problem areas: reinforcement-including conditioned reinforcement, stimulus control-including equivalence classes, and memory-including reminding and remembering. © 2017 Society for the Experimental Analysis of Behavior.

  6. Physician and patient attitudes towards complementary and alternative medicine in obstetrics and gynecology

    Directory of Open Access Journals (Sweden)

    Sen Ananda

    2008-06-01

    Full Text Available Abstract Background In the U.S., complementary and alternative medicine (CAM use is most prevalent among reproductive age, educated women. We sought to determine general attitudes and approaches to CAM among obstetric and gynecology patients and physicians. Methods Obstetrician-gynecologist members of the American Medical Association in the state of Michigan and obstetric-gynecology patients at the University of Michigan were surveyed. Physician and patient attitudes and practices regarding CAM were characterized. Results Surveys were obtained from 401 physicians and 483 patients. Physicians appeared to have a more positive attitude towards CAM as compared to patients, and most reported routinely endorsing, providing or referring patients for at least one CAM modality. The most commonly used CAM interventions by patients were divergent from those rated highest among physicians, and most patients did not consult with a health care provider prior to starting CAM. Conclusion Although obstetrics/gynecology physicians and patients have a positive attitude towards CAM, physician and patients' view of the most effective CAM therapies were incongruent. Obstetrician/gynecologists should routinely ask their patients about their use of CAM with the goal of providing responsible, evidence-based advice to optimize patient care.

  7. Pathways to Healing: Person-centered Responses to Complementary Services

    Science.gov (United States)

    Bertrand, Sharon W.; Fermon, Barbara; Coleman, Julie Foley

    2014-01-01

    Objectives: This research study assessed perceived changes in quality-of-life measures related to participation in complementary services consisting of a variety of nontraditional therapies and/or programs at Pathways: A Health Crisis Resource Center in Minneapolis, Minnesota. Design: Survey data were used to assess perceived changes participants ascribed to their experience with complementary services at Pathways. Quantitative data analysis was conducted using participant demographics together with participant ratings of items from the “Self-Assessment of Change” (SAC) measure developed at the University of Arizona, Tucson. Qualitative data analysis was conducted on written responses to an additional survey question: “To what extent has your participation at Pathways influenced your healing process?” Setting/Location: Pathways offers a variety of services, including one-to-one sessions using nontraditional healing therapies, support groups, educational classes, and practice groups such as yoga and meditation for those facing serious health challenges. These services are offered free of charge through community financial support using volunteer practitioners. Participants: People (126) diagnosed with serious health challenges who used Pathways services from 2007 through 2009. Interventions: Participation in self-selected Pathways services. Measures: Responses to items on the SAC measure plus written responses to the question, “To what extent has your participation at Pathways influenced your healing process?” Results: Quantitative findings: Participants reported experiencing significant changes across all components of the SAC measure. Qualitative findings: Responses to the open-ended survey question identified perspectives on the culture of Pathways and a shift in participants' perceptions of well-being based on their experience of Pathways services. Conclusions: Participation in services provided by the Pathways organization improved perceptions of

  8. Advising patients on the use of complementary and alternative medicine.

    Science.gov (United States)

    Jonas, W B

    2001-09-01

    Complementary and alternative medicine (CAM) is an area of great public interest and activity, both nationally and worldwide. Many alternative medical practices have existed for hundreds, even thousands of years. Patients and professionals are turning to CAM for a variety of reasons. Most have tried conventional medicine for a particular (usually chronic) medical condition and have found the results inadequate. Some are concerned over the side effects of conventional therapies. Some are seeking out a more "holistic" orientation in health care where they can address body, mind, and spirit. A continuing challenge will be how to address CAM services that are based on time, practitioner-patient interactions, and self-care, using modern standards of evidence, education, licensing, and reimbursement. For most CAM therapies, there is insufficient research to say definitively that it works and CAM research is especially limited in the area of cancer. Given that situation, the questions (but not answers) facing the medical practitioner are clear-cut. Should the practitioner await the definitive results of formal Phase III randomized clinical trials, or should the practitioner rely on limited data, seeking out evidence that makes physiological sense and small trials that seem to offer some benefit to the patient? When and at what point do you discourage, permit, or recommend an available alternative therapy? The answers are not simple. There may be differences of opinion and values among the patient, the practitioner, and the organizations that pay for a therapy. CAM areas should be approached with every patient who enters the office recognizing that there are precautions to consider when patients are using, or plan to use, such therapies. This paper presents a broad survey of what complementary and alternative medicine is from the perspectives of both the public as user and the conventional medical practitioner, as well as provides examples of issues pertinent to

  9. Use of Complementary and Alternative Medicine for Work Related ...

    African Journals Online (AJOL)

    Conclusion: Complementary and alternative medicine therapies may improve quality of life, reduce work disruptions and enhance job satisfaction for dentists who suffer from work-related musculoskeletal disorders. It is important that dentists incorporate complementary and alternative medicine strategies into practice to ...

  10. Discovering Complementary Colors from the Perspective of STEAM Education

    Science.gov (United States)

    Karabey, Burak; Koyunkaya, Melike Yigit; Enginoglu, Turan; Yurumezoglu, Kemal

    2018-01-01

    This study explored the theory and applications of complementary colors using a technology-based activity designed from the perspective of STEAM education. Complementary colors and their areas of use were examined from the perspective of physics, mathematics and art, respectively. The study, which benefits from technology, makes the theory of…

  11. Complementary feeding: a commentary by the ESPGHAN Committee on Nutrition

    NARCIS (Netherlands)

    Agostoni, Carlo; Decsi, Tamas; Fewtrell, Mary; Goulet, Olivier; Kolacek, Sanja; Koletzko, Berthold; Michaelsen, Kim Fleischer; Moreno, Luis; Puntis, John; Rigo, Jacques; Shamir, Raanan; Szajewska, Hania; Turck, Dominique; van Goudoever, Johannes

    2008-01-01

    This position paper on complementary feeding summarizes evidence for health effects of complementary foods. It focuses on healthy infants in Europe. After reviewing current knowledge and practices, we have formulated these conclusions: Exclusive or full breast-feeding for about 6 months is a

  12. Adoption of Enriched Local Complementary Food in Osun State ...

    African Journals Online (AJOL)

    Locally processed complementary foods, appropriately enriched can complement breast milk and traditional foods during the nutritionally vulnerable periods of a child life. The study therefore examines the adoption of enriched local complementary foods in Osun State Nigeria. Structured interview schedule was used to ...

  13. Systematic review: Complementary and alternative medicine in the irritable bowel syndrome.

    LENUS (Irish Health Repository)

    Hussain, Z

    2012-02-03

    BACKGROUND: Complementary and alternative medical therapies and practices are widely employed in the treatment of the irritable bowel syndrome. AIM: To review the usage of complementary and alternative medicine in the irritable bowel syndrome, and to assess critically the basis and evidence for its use. METHODS: A systematic review of complementary and alternative medical therapies and practices in the irritable bowel syndrome was performed based on literature obtained through a Medline search. RESULTS: A wide variety of complementary and alternative medical practices and therapies are commonly employed by irritable bowel syndrome patients both in conjunction with and in lieu of conventional therapies. As many of these therapies have not been subjected to controlled clinical trials, some, at least, of their efficacy may reflect the high-placebo response rate that is characteristic of irritable bowel syndrome. Of those that have been subjected to clinical trials most have involved small poor quality studies. There is, however, evidence to support efficacy for hypnotherapy, some forms of herbal therapy and certain probiotics in irritable bowel syndrome. CONCLUSIONS: Doctors caring for irritable bowel syndrome patients need to recognize the near ubiquity of complementary and alternative medical use among this population and the basis for its use. All complementary and alternative medicine is not the same and some, such as hypnotherapy, forms of herbal therapy, specific diets and probiotics, may well have efficacy in irritable bowel syndrome. Above all, we need more science and more controlled studies; the absence of truly randomized placebo-controlled trials for many of these therapies has limited meaningful progress in this area.

  14. Reconfigurable Complementary Logic Circuits with Ambipolar Organic Transistors.

    Science.gov (United States)

    Yoo, Hocheon; Ghittorelli, Matteo; Smits, Edsger C P; Gelinck, Gerwin H; Lee, Han-Koo; Torricelli, Fabrizio; Kim, Jae-Joon

    2016-10-20

    Ambipolar organic electronics offer great potential for simple and low-cost fabrication of complementary logic circuits on large-area and mechanically flexible substrates. Ambipolar transistors are ideal candidates for the simple and low-cost development of complementary logic circuits since they can operate as n-type and p-type transistors. Nevertheless, the experimental demonstration of ambipolar organic complementary circuits is limited to inverters. The control of the transistor polarity is crucial for proper circuit operation. Novel gating techniques enable to control the transistor polarity but result in dramatically reduced performances. Here we show high-performance non-planar ambipolar organic transistors with electrical control of the polarity and orders of magnitude higher performances with respect to state-of-art split-gate ambipolar transistors. Electrically reconfigurable complementary logic gates based on ambipolar organic transistors are experimentally demonstrated, thus opening up new opportunities for ambipolar organic complementary electronics.

  15. Use of complementary and alternative medicines during the third trimester.

    Science.gov (United States)

    Pallivalapila, Abdul Rouf; Stewart, Derek; Shetty, Ashalatha; Pande, Binita; Singh, Rajvir; McLay, James S

    2015-01-01

    To estimate the prevalence, indications, and associated factors for complementary and alternative medicine use during the last trimester of pregnancy. A questionnaire survey was conducted of women with a live birth (N=700) admitted to the postnatal unit at the Royal Aberdeen Maternity Hospital, northeast Scotland. Outcome measures included: complementary and alternative medicine used; vitamins and minerals used; reasons for complementary and alternative medicine use; independent associated factors for use; views; and experiences. Descriptive and inferential statistical analysis was performed. The response rate was 79.6% of eligible women. Two thirds of respondents (61.4%) reported using complementary and alternative medicine, excluding vitamins and minerals, during the third trimester. Respondents reported using a total of 30 different complementary and alternative medicine modalities, of which oral herbal products were the most common (38% of respondents, 40 different products). The independent associated factors for complementary and alternative medicine use identified were: complementary and alternative medicine use before pregnancy (odds ratio [OR] 4.36, 95% confidence interval [CI] 2.39-7.95, Palternative medicine use by family or friends (OR 2.36, 95% CI 1.61-3.47, Palternative medicines were safer than prescribed medicines (P=.006), less likely to be associated with side effects (P≤.001), and could interfere with conventional medicines (P≤.001). Despite the majority of respondents, and notably users, being uncertain about their safety and effectiveness, complementary and alternative medicine modalities and complementary and alternative medicine products are widely used during the third trimester of pregnancy in this study population. Although prior use was the most significant independent associated factor, the role of family and friends, rather than health professionals, in the decision to use complementary and alternative medicine may be of concern

  16. Improving communication when seeking informed consent: a randomised controlled study of a computer-based method for providing information to prospective clinical trial participants.

    Science.gov (United States)

    Karunaratne, Asuntha S; Korenman, Stanley G; Thomas, Samantha L; Myles, Paul S; Komesaroff, Paul A

    2010-04-05

    To assess the efficacy, with respect to participant understanding of information, of a computer-based approach to communication about complex, technical issues that commonly arise when seeking informed consent for clinical research trials. An open, randomised controlled study of 60 patients with diabetes mellitus, aged 27-70 years, recruited between August 2006 and October 2007 from the Department of Diabetes and Endocrinology at the Alfred Hospital and Baker IDI Heart and Diabetes Institute, Melbourne. Participants were asked to read information about a mock study via a computer-based presentation (n = 30) or a conventional paper-based information statement (n = 30). The computer-based presentation contained visual aids, including diagrams, video, hyperlinks and quiz pages. Understanding of information as assessed by quantitative and qualitative means. Assessment scores used to measure level of understanding were significantly higher in the group that completed the computer-based task than the group that completed the paper-based task (82% v 73%; P = 0.005). More participants in the group that completed the computer-based task expressed interest in taking part in the mock study (23 v 17 participants; P = 0.01). Most participants from both groups preferred the idea of a computer-based presentation to the paper-based statement (21 in the computer-based task group, 18 in the paper-based task group). A computer-based method of providing information may help overcome existing deficiencies in communication about clinical research, and may reduce costs and improve efficiency in recruiting participants for clinical trials.

  17. MO-E-17A-04: Size-Specific Dose Estimate (SSDE) Provides a Simple Method to Calculate Organ Dose for Pediatric CT Examinations

    International Nuclear Information System (INIS)

    Moore, B; Brady, S; Kaufman, R; Mirro, A

    2014-01-01

    Purpose: Investigate the correlation of SSDE with organ dose in a pediatric population. Methods: Four anthropomorphic phantoms, representing a range of pediatric body habitus, were scanned with MOSFET dosimeters placed at 23 organ locations to determine absolute organ dosimetry. Phantom organ dosimetry was divided by phantom SSDE to determine correlation between organ dose and SSDE. Correlation factors were then multiplied by patient SSDE to estimate patient organ dose. Patient demographics consisted of 352 chest and 241 abdominopelvic CT examinations, 22 ± 15 kg (range 5−55 kg) mean weight, and 6 ± 5 years (range 4 mon to 23 years) mean age. Patient organ dose estimates were compared to published pediatric Monte Carlo study results. Results: Phantom effective diameters were matched with patient population effective diameters to within 4 cm. 23 organ correlation factors were determined in the chest and abdominopelvic region across nine pediatric weight subcategories. For organs fully covered by the scan volume, correlation in the chest (average 1.1; range 0.7−1.4) and abdominopelvic (average 0.9; range 0.7−1.3) was near unity. For organs that extended beyond the scan volume (i.e., skin, bone marrow, and bone surface), correlation was determined to be poor (average 0.3; range: 0.1−0.4) for both the chest and abdominopelvic regions, respectively. Pediatric organ dosimetry was compared to published values and was found to agree in the chest to better than an average of 5% (27.6/26.2) and in the abdominopelvic region to better than 2% (73.4/75.0). Conclusion: Average correlation of SSDE and organ dosimetry was found to be better than ± 10% for fully covered organs within the scan volume. This study provides a list of organ dose correlation factors for the chest and abdominopelvic regions, and describes a simple methodology to estimate individual pediatric patient organ dose based on patient SSDE

  18. MO-E-17A-04: Size-Specific Dose Estimate (SSDE) Provides a Simple Method to Calculate Organ Dose for Pediatric CT Examinations

    Energy Technology Data Exchange (ETDEWEB)

    Moore, B; Brady, S; Kaufman, R [St Jude Children' s Research Hospital, Memphis, TN (United States); Mirro, A [Washington University, St. Louis, MO (United States)

    2014-06-15

    Purpose: Investigate the correlation of SSDE with organ dose in a pediatric population. Methods: Four anthropomorphic phantoms, representing a range of pediatric body habitus, were scanned with MOSFET dosimeters placed at 23 organ locations to determine absolute organ dosimetry. Phantom organ dosimetry was divided by phantom SSDE to determine correlation between organ dose and SSDE. Correlation factors were then multiplied by patient SSDE to estimate patient organ dose. Patient demographics consisted of 352 chest and 241 abdominopelvic CT examinations, 22 ± 15 kg (range 5−55 kg) mean weight, and 6 ± 5 years (range 4 mon to 23 years) mean age. Patient organ dose estimates were compared to published pediatric Monte Carlo study results. Results: Phantom effective diameters were matched with patient population effective diameters to within 4 cm. 23 organ correlation factors were determined in the chest and abdominopelvic region across nine pediatric weight subcategories. For organs fully covered by the scan volume, correlation in the chest (average 1.1; range 0.7−1.4) and abdominopelvic (average 0.9; range 0.7−1.3) was near unity. For organs that extended beyond the scan volume (i.e., skin, bone marrow, and bone surface), correlation was determined to be poor (average 0.3; range: 0.1−0.4) for both the chest and abdominopelvic regions, respectively. Pediatric organ dosimetry was compared to published values and was found to agree in the chest to better than an average of 5% (27.6/26.2) and in the abdominopelvic region to better than 2% (73.4/75.0). Conclusion: Average correlation of SSDE and organ dosimetry was found to be better than ± 10% for fully covered organs within the scan volume. This study provides a list of organ dose correlation factors for the chest and abdominopelvic regions, and describes a simple methodology to estimate individual pediatric patient organ dose based on patient SSDE.

  19. [The situation of complementary medicine in Germany].

    Science.gov (United States)

    Albrecht, Henning

    2013-01-01

    With the amendment of the German Medicinal Products Act in 1976 and the inclusion of naturopathy and homeopathy into the German Medical Licensure Act from 1988, the German government set up a comparatively favorable framework for Complementary and Alternative Medicine (CAM). But no comprehensive integration into the academic operating systems followed, because the universities as well as the legislative body seemed to have no further interest in CAM. Therefore, research projects in the field and suitable professorships had and still have to be financed by third-party funds. Notwithstanding the success of several CAM-projects, no sustainable development could be established: When the third-party funding runs off and the protagonists retire the institutional structures are supposed to vanish as well. Although the public demand for CAM is high in Germany, the administration detached homeopathy as a compulsory subject from the German Medical Licensure Act in 2002 and restricted severely the refunding of naturopathic medicines by the statutory health insurance in 2004. Moreover, the trend for CAM bashing takes root in the media. Unfortunately the CAM scene does not close ranks and is incapable to implement fundamental data collection processes into daily clinical routine: A wide range of data could justify further efforts to the government as well as to the scientific community. To say something positive, it must be mentioned that the scientific standard of CAM research is high for the most part and that third-party funded projects deliver remarkable results ever and on. Copyright © 2013 S. Karger AG, Basel.

  20. Abrasive water jet: a complementary tool

    Directory of Open Access Journals (Sweden)

    Duarte, J. P.

    1998-04-01

    Full Text Available The abrasive water jet is a powerful cutting tool, whose main advantages lie in the absence of thermal effects and the capability of cutting highly thick materials. Compared with Laser, the abrasive water jet allows the cutting of a larger range of thicknesses and a wider variety of materials such as: ornamental stones, metals, polymers, composites, wood, glass and ceramics. The application of this technology has suffered an extensive growth, with successful applications in varied industrial sectors like the automotive, aerospace, textile, metalworking, ornamental stones, etc. The present communication aims at introducing the abrasive water jet as a complementary tool to laser cutting, presenting its advantages by showing some documented examples of pieces cut for different industries.

    O jacto de água abrasivo é uma poderosa ferramenta de corte, tendo como principais vantagens a ausência de processo térmico e permitir o corte de elevadas espessuras. Comparativamente com o laser o jacto de água abrasivo permite cortar uma maior gama de espessuras, e uma maior diversidade de materiais: rochas ornamentais, metais, polimeros, compósitos, madeiras, vidro e cerâmicos. A aplicação desta tecnologia tem sofrido um crescimento acentuado, existindo aplicações de sucesso nos mais variados sectores industriáis como a indústria automóvel, aeroespacial, têxtil, metalomecânica e rochas ornamentáis. Esta comunição pretende apresentar o corte por jacto de agua abrasivo como uma ferramenta de corte complementar ao corte por laser, apresentando as suas vantagens documentadas através de alguns exemplos de peças executadas para as diferentes indústrias.

  1. The role of global traditional and complementary systems of medicine in the treatment of mental health disorders.

    Science.gov (United States)

    Gureje, Oye; Nortje, Gareth; Makanjuola, Victor; Oladeji, Bibilola D; Seedat, Soraya; Jenkins, Rachel

    2015-02-01

    Traditional and complementary systems of medicine include a broad range of practices, which are commonly embedded in cultural milieus and reflect community beliefs, experiences, religion, and spirituality. Two major components of this system are discernible: complementary alternative medicine and traditional medicine, with different clientele and correlates of patronage. Evidence from around the world suggests that a traditional or complementary system of medicine is commonly used by a large number of people with mental illness. Practitioners of traditional medicine in low-income and middle-income countries fill a major gap in mental health service delivery. Although some overlap exists in the diagnostic approaches of traditional and complementary systems of medicine and conventional biomedicine, some major differences exist, largely in the understanding of the nature and cause of mental disorders. Treatments used by providers of traditional and complementary systems of medicine, especially traditional and faith healers in low-income and middle-income countries, might sometimes fail to meet widespread understandings of human rights and humane care. Nevertheless, collaborative engagement between traditional and complementary systems of medicine and conventional biomedicine might be possible in the care of people with mental illness. The best model to bring about that collaboration will need to be established by the needs of the extant mental health system in a country. Research is needed to provide an empirical basis for the feasibility of such collaboration, to clearly delineate its boundaries, and to test its effectiveness in bringing about improved patient outcomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Complementary feeding and the early origins of obesity risk: a study protocol

    OpenAIRE

    Muniandy, Naleena Devi; Allotey, Pascale A; Soyiri, Ireneous N; Reidpath, Daniel D

    2016-01-01

    Introduction The rise in the prevalence of childhood obesity worldwide calls for an intervention earlier in the life cycle. Studies show that nutrition during early infancy may contribute to later obesity. Hence, this study is designed to determine if the variation in complementary feeding practices poses a risk for the development of obesity later in life. A mixed methods approach will be used in conducting this study. Methods and analysis The target participants are infants born from Januar...

  3. Motivation or demotivation of health workers providing maternal health services in rural areas in Vietnam: findings from a mixed-methods study.

    Science.gov (United States)

    Thu, Nguyen Thi Hoai; Wilson, Andrew; McDonald, Fiona

    2015-12-02

    Motivation is an important driver for health professionals to maintain their professional competencies, continue in the workforce and make a positive contribution to their workplace. While there is some research about the motivation of health workers in low- to middle-income countries, maternal morbidity and mortality remains high and this can be lowered by improving the quality of maternal health services and the training and maintenance of the skills of maternal health workers. This study examines the impact of motivation on maintenance of professional competence among maternal health workers in Vietnam using mixed methods. The study consisted of a survey using a self-administered questionnaire of 240 health workers in five districts across two Vietnamese provinces and in-depth interviews with 43 health workers and health managers at the commune, district and provincial level to explore external factors that influenced motivation. The questionnaire includes a 23-item motivation instrument based on the Kenyan health context, modified for Vietnamese language and culture. The 240 responses represented an estimated 95% of the target sample. Multivariate analysis showed that three factors contributed to the motivation of health workers: access to training (β = -0.14, P = 0.03), ability to perform key tasks (β = 0.22, P = 0.001) and shift schedule (β = -0.13, P = 0.05). Motivation was higher in health workers self-identifying as competent or who were enabled to provide more maternal care services. Motivation was lower in those who worked more frequent night shifts and those who had received training in the last 12 months. The interviews identified that the latter was because they felt the training was irrelevant to them, and in some cases, they do not have the opportunity to practice their learnt skills. The qualitative data also showed other factors relating to service context and organisational management practices contributed to

  4. Characterisation of the suspended particulate matter in a stratified estuarine environment employing complementary techniques

    Science.gov (United States)

    Thomas, Luis P.; Marino, Beatriz M.; Szupiany, Ricardo N.; Gallo, Marcos N.

    2017-09-01

    The ability to predict the sediment and nutrient circulation within estuarine waters is of significant economic and ecological importance. In these complex systems, flocculation is a dynamically active process that is directly affected by the prevalent environmental conditions. Consequently, the floc properties continuously change, which greatly complicates the characterisation of the suspended particle matter (SPM). In the present study, three different techniques are combined in a stratified estuary under quiet weather conditions and with a low river discharge to search for a solution to this problem. The challenge is to obtain the concentration, size and flux of suspended elements through selected cross-sections using the method based on the simultaneous backscatter records of 1200 and 600 kHz ADCPs, isokinetic sampling data and LISST-25X measurements. The two-ADCP method is highly effective for determining the SPM size distributions in a non-intrusive way. The isokinetic sampling and the LISST-25X diffractometer offer point measurements at specific depths, which are especially useful for calibrating the ADCP backscatter intensity as a function of the SPM concentration and size, and providing complementary information on the sites where acoustic records are not available. Limitations and potentials of the techniques applied are discussed.

  5. Identifying Complementary and Alternative Medicine Usage Information from Internet Resources. A Systematic Review.

    Science.gov (United States)

    Sharma, Vivekanand; Holmes, John H; Sarkar, Indra N

    2016-08-05

    Identify and highlight research issues and methods used in studying Complementary and Alternative Medicine (CAM) information needs, access, and exchange over the Internet. A literature search was conducted using Preferred Reporting Items for Systematic Reviews and Meta-Analysis guidelines from PubMed to identify articles that have studied Internet use in the CAM context. Additional searches were conducted at Nature.com and Google Scholar. The Internet provides a major medium for attaining CAM information and can also serve as an avenue for conducting CAM related surveys. Based on the literature analyzed in this review, there seems to be significant interest in developing methodologies for identifying CAM treatments, including the analysis of search query data and social media platform discussions. Several studies have also underscored the challenges in developing approaches for identifying the reliability of CAM-related information on the Internet, which may not be supported with reliable sources. The overall findings of this review suggest that there are opportunities for developing approaches for making available accurate information and developing ways to restrict the spread and sale of potentially harmful CAM products and information. Advances in Internet research are yet to be used in context of understanding CAM prevalence and perspectives. Such approaches may provide valuable insights into the current trends and needs in context of CAM use and spread.

  6. Negotiating complementary and alternative medicine use in primary care visits with older patients

    Science.gov (United States)

    Koenig, Christopher J.; Ho, Evelyn Y.; Yadegar, Vivien; Tarn, Derjung M.

    2013-01-01

    Objective To empirically investigate the ways in which patients and providers discuss Complementary and Alternative Medicine (CAM) treatment in primary care visits. Methods Audio recordings from visits between 256 adult patients aged 50 years and older and 28 primary care physicians were transcribed and analyzed using discourse analysis, an empirical sociolinguistic methodology focusing on how language is used to negotiate meaning. Results Discussion about CAM occurred 128 times in 82 of 256 visits (32.0%). The most frequently discussed CAM modalities were non-vitamin, non-mineral supplements and massage. Three physician–patient interactions were analyzed turn-by-turn to demonstrate negotiations about CAM use. Patients raised CAM discussions to seek physician expertise about treatments, and physicians adopted a range of responses along a continuum that included encouragement, neutrality, and discouragement. Despite differential knowledge about CAM treatments, physicians helped patients assess the risks and benefits of CAM treatments and made recommendations based on patient preferences for treatment. Conclusion Regardless of a physician's stance or knowledge about CAM, she or he can help patients negotiate CAM treatment decisions. Practice implications Providers do not have to possess extensive knowledge about specific CAM treatments to have meaningful discussions with patients and to give patients a framework for evaluating CAM treatment use. PMID:22483672

  7. Dissemination and implementation of an educational tool for veterans on complementary and alternative medicine: a case study.

    Science.gov (United States)

    Held, Rachel Forster; Santos, Susan; Marki, Michelle; Helmer, Drew

    2016-09-02

    We developed and disseminated an educational DVD to introduce U.S. Veterans to independently-practiced complementary and alternative medicine (CAM) techniques and encourage CAM experimentation. The project's goal was to determine optimal dissemination methods to facilitate implementation within the Veteran's Health Administration. In the first phase, the DVD was disseminated using four methods: passive, provider-mediated, active, and peer-mediated. In the second, implementation phase, "champion" providers who supported CAM integrated dissemination into clinical practice. Qualitative data came from Veteran focus groups and semi-structured provider interviews. Data from both phases was triangulated to identify common themes. Effective dissemination requires engaging patients. Providers who most successfully integrated the DVD into practice already had CAM knowledge, and worked in settings where CAM was accepted clinical practice, or with leadership or infrastructure that supported a culture of CAM use. Institutional buy-in allowed for provider networking and effective implementation of the tool. Providers were given autonomy to determine the most appropriate dissemination strategies, which increased enthusiasm and use. Many of the lessons learned from this project can be applied to dissemination of any new educational tool within a healthcare setting. Results reiterate the importance of utilizing best practices for introducing educational tools within the healthcare context and the need for thoughtful, multi-faceted dissemination strategies.

  8. Risks, Benefits, and Importance of Collecting Sexual Orientation and Gender Identity Data in Healthcare Settings: A Multi-Method Analysis of Patient and Provider Perspectives.

    Science.gov (United States)

    Maragh-Bass, Allysha C; Torain, Maya; Adler, Rachel; Schneider, Eric; Ranjit, Anju; Kodadek, Lisa M; Shields, Ryan; German, Danielle; Snyder, Claire; Peterson, Susan; Schuur, Jeremiah; Lau, Brandyn; Haider, Adil H

    2017-04-01

    Research suggests that LGBT populations experience barriers to healthcare. Organizations such as the Institute of Medicine recommend routine documentation of sexual orientation (SO) and gender identity (GI) in healthcare, to reduce LGBT disparities. We explore patient views regarding the importance of SO/GI collection, and patient and provider views on risks and benefits of routine SO/GI collection in various settings. We surveyed LGBT/non-LGBT patients and providers on their views on SO/GI collection. Weighted data were analyzed with descriptive statistics; content analysis was conducted with open-ended responses. One-half of the 1516 patients and 60% of 429 providers were female; 64% of patients and 71% of providers were White. Eighty percent of providers felt that collecting SO data would offend patients, whereas only 11% of patients reported that they would be offended. Patients rated it as more important for primary care providers to know the SO of all patients compared with emergency department (ED) providers knowing the SO of all patients (41.3% vs. 31.6%; P discrimination risk most frequently (49.7%; N = 781), whereas provider comments cited patient discomfort/offense most frequently (54.5%; N = 433). Patients see the importance of SO/GI more in primary care than ED settings. However, many LGBT patients seek ED care due to factors including uninsurance; therefore, the ED may represent an initial point of contact for SO/GI collection. Therefore, patient-centered approaches to collecting SO/GI are needed. Patients and providers differed in perceived risks and benefits to routine SO/GI collection. Provider training in LGBT health may address patients' bias/discrimination concerns, and ultimately reduce LGBT health disparities.

  9. Moral injury: A new challenge for complementary and alternative medicine.

    Science.gov (United States)

    Kopacz, Marek S; Connery, April L; Bishop, Todd M; Bryan, Craig J; Drescher, Kent D; Currier, Joseph M; Pigeon, Wilfred R

    2016-02-01

    Moral injury represents an emerging clinical construct recognized as a source of morbidity in current and former military personnel. Finding effective ways to support those affected by moral injury remains a challenge for both biomedical and complementary and alternative medicine. This paper introduces the concept of moral injury and suggests two complementary and alternative medicine, pastoral care and mindfulness, which may prove useful in supporting military personnel thought to be dealing with moral injury. Research strategies for developing an evidence-base for applying these, and other, complementary and alternative medicine modalities to moral injury are discussed. Published by Elsevier Ltd.

  10. Realization of a complementary medium using dielectric photonic crystals.

    Science.gov (United States)

    Xu, Tao; Fang, Anan; Jia, Ziyuan; Ji, Liyu; Hang, Zhi Hong

    2017-12-01

    By exploiting the scaling invariance of photonic band diagrams, a complementary photonic crystal slab structure is realized by stacking two uniformly scaled double-zero-index dielectric photonic crystal slabs together. The space cancellation effect in complementary photonic crystals is demonstrated in both numerical simulations and microwave experiments. The refractive index dispersion of double-zero-index dielectric photonic crystal is experimentally measured. Using pure dielectrics, our photonic crystal structure will be an ideal platform to explore various intriguing properties related to a complementary medium.

  11. Complementary bowtie aperture for localizing and enhancing optical magnetic field

    Science.gov (United States)

    Zhou, Nan; Kinzel, Edward C.; Xu, Xianfan

    2011-08-01

    Nanoscale bowtie antenna and bowtie aperture antenna have been shown to generate strongly enhanced and localized electric fields below the diffraction limit in the optical frequency range. According to Babinet's principle, their complements will be efficient for concentrating and enhancing magnetic fields. In this Letter, we discuss the enhancement of magnetic field intensity of nanoscale complementary bowtie aperture as well as complementary bowtie aperture antenna, or diabolo nanoantenna. We show that the complementary bowtie antenna resonates at a smaller wavelength and thus is more suitable for applications near visible wavelengths. The near-field magnetic intensity can be further enhanced by the addition of groove structures that scatter surface plasmon.

  12. Treatment of complementary events in event trees in constructing linked fault trees for level 1 and level 2 PRA

    International Nuclear Information System (INIS)

    Jo, Y. G.

    2008-01-01

    Complementary events in the event trees for a PRA model should be treated properly in order to evaluate plant risk correctly. In this study, the characteristics of the following three different cut-set generation methods were investigated first in order to find the best practical way for treating complementary events: 1) exact method which treats complementary events logically, 2) no-delete term method which does not treat complementary events at all, and 3) delete term method which treats complementary events by deleting nonsense cut-sets which are generated as a result of ignoring complementary events. Then, practical methods for treating complementary events in constructing linked fault trees for level 1 and level 2 PRA in EPRI R and R workstation software environment, where CAFTA is the fault tree editor and FORTE is the cut-set engine, were suggested and demonstrated. The suggested methods deal with the following selected four typical cases: Case 1: an event tree event (E) is represented by a fault tree gate whose inputs consist of only fault tree gates, Case 2: E is represented by a single basic event, Case 3: E is represented by an OR fault tree gate which has a single basic event and a fault tree gate as inputs, and Case 4: E is represented by an AND fault tree gate which has a single basic event and a fault tree gate as inputs. In the suggested methods, first the high level logic structures of event tree events are examined and restructured, if needed. Then, the delete term method, the exact method, and the combination of the two methods are applied to Case 1, Case 2, and Cases 3 and 4, respectively. Also, it is recommended to treat complementary events, using the suggested methods, before level 1 and level 2 PRA fault trees are coupled. It should be noted that the selected four typical cases may not cover all different cases encountered in level 1 and level 2 PRA modeling. However, a process similar to the one suggested in this study may be used to find

  13. Proposal of indicators to evaluate complementary feeding based on World Health Organization indicators.

    Science.gov (United States)

    Saldan, Paula Chuproski; Venancio, Sonia Isoyama; Saldiva, Silvia Regina Dias Medici; de Mello, Débora Falleiros

    2016-09-01

    This study compares complementary feeding World Health Organization (WHO) indicators with those built in accordance with Brazilian recommendations (Ten Steps to Healthy Feeding). A cross-sectional study was carried out during the National Immunization Campaign against Poliomyelitis in Guarapuava-Paraná, Brazil, in 2012. Feeding data from 1,355 children aged 6-23 months were obtained through the 24 h diet recall. Based on five indicators, the proportion of adequacy was evaluated: introduction of solid, semi-solid, or soft foods; minimum dietary diversity; meal frequency; acceptable diet; and consumption of iron-rich foods. Complementary feeding showed adequacy higher than 85% in most WHO indicators, while review by the Ten Steps assessment method showed a less favorable circumstance and a high intake of unhealthy foods. WHO indicators may not reflect the complementary feeding conditions of children in countries with low malnutrition rates and an increased prevalence of overweight/obesity. The use of indicators according to the Ten Steps can be useful to identify problems and redirect actions aimed at promoting complementary feeding. © 2016 John Wiley & Sons Australia, Ltd.

  14. MERGING conventional and complementary medicine in a clinic department - a theoretical model and practical recommendations.

    Science.gov (United States)

    Pérard, Marion; Mittring, Nadine; Schweiger, David; Kummer, Christopher; Witt, Claudia M

    2015-06-09

    Today, the increasing demand for complementary medicine encourages health care providers to adapt and create integrative medicine departments or services within clinics. However, because of their differing philosophies, historical development, and settings, merging the partners (conventional and complementary medicine) is often difficult. It is necessary to understand the similarities and differences in both cultures to support a successful and sustainable integration. The aim of this project was to develop a theoretical model and practical steps that are based on theories from mergers in business to facilitate the implementation of an integrative medicine department. Based on a literature search and expert discussions, the cultures were described and model domains were developed. These were applied to two case studies to develop the final model. Furthermore, a checklist with practical steps was devised. Conventional medicine and complementary medicine have developed different corporate cultures. The final model, which should help to foster integration by bridging between these cultures, is based on four overall aspects: culture, strategy, organizational tools and outcomes. Each culture is represented by three dimensions in the model: corporate philosophy (core and identity of the medicine and the clinic), patient (all characteristics of the professional team's contact with the patient), and professional team (the characteristics of the interactions within the professional team). Overall, corporate culture differs between conventional and complementary medicine; when planning the implementation of an integrative medicine department, the developed model and the checklist can support better integration.

  15. Statistical modelling and RCS detrending methods provide similar estimates of long-term trend in radial growth of common beech in north-eastern France

    OpenAIRE

    Bontemps , Jean-Daniel; Esper , Jan

    2011-01-01

    International audience; Dendrochronological methods have greatly contributed to the documentation of past long-term trends in forest growth. These methods primarily focus on the high-frequency signals of tree ring chronologies. They require the removal of the ageing trend in tree growth, known as 'standardisation' or 'detrending', as a prerequisite to the estimation of such trends. Because the approach is sequential, it may however absorb part of the low-frequency historical signal. In this s...

  16. US Spending On Complementary And Alternative Medicine During 2002–08 Plateaued, Suggesting Role In Reformed Health System

    Science.gov (United States)

    Davis, Matthew A.; Martin, Brook I.; Coulter, Ian D.; Weeks, William B.

    2013-01-01

    Complementary and alternative medicine services in the United States are an approximately $9 billion market each year, equal to 3 percent of national ambulatory health care expenditures. Unlike conventional allopathic health care, complementary and alternative medicine is primarily paid for out of pocket, although some services are covered by most health insurance. Examining trends in demand for complementary and alternative medicine services in the United States reported in the Medical Expenditure Panel Survey during 2002–08, we found that use of and spending on these services, previously on the rise, have largely plateaued. The higher proportion of out-of-pocket responsibility for payment for services may explain the lack of growth. Our findings suggest that any attempt to reduce national health care spending by eliminating coverage for complementary and alternative medicine would have little impact at best. Should some forms of complementary and alternative medicine—for example, chiropractic care for back pain—be proven more efficient than allopathic and specialty medicine, the inclusion of complementary and alternative medicine providers in new delivery systems such as accountable care organizations could help slow growth in national health care spending. PMID:23297270

  17. US spending on complementary and alternative medicine during 2002-08 plateaued, suggesting role in reformed health system.

    Science.gov (United States)

    Davis, Matthew A; Martin, Brook I; Coulter, Ian D; Weeks, William B

    2013-01-01

    Complementary and alternative medicine services in the United States are an approximately $9 billion market each year, equal to 3 percent of national ambulatory health care expenditures. Unlike conventional allopathic health care, complementary and alternative medicine is primarily paid for out of pocket, although some services are covered by most health insurance. Examining trends in demand for complementary and alternative medicine services in the United States reported in the Medical Expenditure Panel Survey during 2002-08, we found that use of and spending on these services, previously on the rise, have largely plateaued. The higher proportion of out-of-pocket responsibility for payment for services may explain the lack of growth. Our findings suggest that any attempt to reduce national health care spending by eliminating coverage for complementary and alternative medicine would have little impact at best. Should some forms of complementary and alternative medicine-for example, chiropractic care for back pain-be proven more efficient than allopathic and specialty medicine, the inclusion of complementary and alternative medicine providers in new delivery systems such as accountable care organizations could help slow growth in national health care spending.

  18. A review of nurses' knowledge, attitudes, and ability to communicate the risks and benefits of complementary and alternative medicine.

    Science.gov (United States)

    Chang, Hsiao-Yun; Chang, Huai-Lu

    2015-06-01

    This study reviewed existing literature to investigate how frequently nurses include complementary and alternative forms of medicine in their clinical practice. In so doing, we investigated nurses' knowledge of and attitudes towards complementary and alternative medicine as well as their ability to communicate the risks and benefits of these therapies with patients. Little information is available concerning nurses' knowledge and attitudes towards complementary and alternative medicine or how they incorporate these therapies into their practice. In addition, little is known about the ability of nurses to communicate the risks and benefits of complementary and alternative medicine to their patients. This study used a scoping review method to map and synthesise existing literature. Both electronic and manual searches were used to identify relevant studies published between January 2007 and January 2014. The review was conducted in five stages: (1) identification of research question(s), (2) locate studies, (3) selection of studies, (4) charting of data, and (5) collating, summarising, and reporting of results. Fifteen papers met the inclusion criteria for this review, among which 53·7% referenced how frequently nurses include complementary and alternative medicine in their practice. We found that 66·4% of nurses had positive attitudes towards complementary and alternative medicine; however, 77·4% did not possess a comprehensive understanding of the associated risks and benefits. In addition, nearly half of the respondents (47·3-67·7%) reported feeling uncomfortable discussing complementary and alternative medicine therapies with their patients. The lack of knowledge about complementary and alternative medicine among nurses is a cause for concern, particularly in light of its widespread application. Findings from this study suggest that health care professionals need to promote evidence informed decision-making in complementary and alternative medicine practice

  19. Sleep Disorders and Complementary Health Approaches : What the Science Says

    Science.gov (United States)

    ... Sleep Disorders and Complementary Health Approaches: What the Science Says Share: April 2014 Clinical Guidelines, Scientific Literature, ... five randomized controlled trials evaluating the efficacy of music-assisted relaxation for sleep quality in adults found ...

  20. A complementary model for medical subspecialty training in South ...

    African Journals Online (AJOL)

    research was to develop a business model to complement the current academic ... larger-scale potential public-private partnerships (PPPs). The model ... complementary system, which will benefit both the private and the public sectors.

  1. Have complementary therapies demonstrated effectiveness in rheumatoid arthritis?

    Science.gov (United States)

    Fernández-Llanio Comella, Nagore; Fernández Matilla, Meritxell; Castellano Cuesta, Juan Antonio

    2016-01-01

    In recent decades the treatment of rheumatoid arthritis (RA) has improved thanks to the use of highly effective drugs. However, patients usually require long term therapy, which is not free of side effects. Therefore RA patients often demand complementary medicine, they seek additional sources of relief and/or less side effects. In fact 30-60% of rheumatic patients use some form of complementary medicine. Therefore, from conventional medicine, if we want to optimally treat our patients facilitating communication with them we must know the most commonly used complementary medicines. The aim of this review is to assess, based on published scientific research, what complementary therapies commonly used by patients with RA are effective and safe. Copyright © 2015 Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología. All rights reserved.

  2. 76 FR 6487 - National Center for Complementary and Alternative Medicine; Announcement of Workshop on...

    Science.gov (United States)

    2011-02-04

    ... Complementary and Alternative Medicine; Announcement of Workshop on Clarifying Directions and Approaches to...: The National Center for Complementary and Alternative Medicine (NCCAM) invites the research [email protected] . Background: The National Center for Complementary and Alternative Medicine (NCCAM) was...

  3. 75 FR 52357 - Request for Comment: National Center for Complementary and Alternative Medicine Draft Strategic Plan

    Science.gov (United States)

    2010-08-25

    ...: National Center for Complementary and Alternative Medicine Draft Strategic Plan ACTION: Notice. SUMMARY: The National Center for Complementary and Alternative Medicine (NCCAM) is developing its third... for Complementary and Alternative Medicine (NCCAM) was established in 1998 with the mission of...

  4. 77 FR 31862 - National Center for Complementary & Alternative Medicine; Notice of Closed Meetings

    Science.gov (United States)

    2012-05-30

    ... Complementary & Alternative Medicine; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... Scientific Review, National Center for Complementary and Alternative Medicine, NIH, 6707 Democracy Blvd... for Complementary and Alternative Medicine Special Emphasis Panel; HCS Collaboratory Pragmatic Trials...

  5. Complementary Set Matrices Satisfying a Column Correlation Constraint

    OpenAIRE

    Wu, Di; Spasojevic, Predrag

    2006-01-01

    Motivated by the problem of reducing the peak to average power ratio (PAPR) of transmitted signals, we consider a design of complementary set matrices whose column sequences satisfy a correlation constraint. The design algorithm recursively builds a collection of $2^{t+1}$ mutually orthogonal (MO) complementary set matrices starting from a companion pair of sequences. We relate correlation properties of column sequences to that of the companion pair and illustrate how to select an appropriate...

  6. Supramolecular Assembly of Complementary Cyanine Salt J-Aggregates

    KAUST Repository

    Li, Zhong’ an; Mukhopadhyay, Sukrit; Jang, Sei-Hum; Bredas, Jean-Luc; Jen, Alex K.-Y.

    2015-01-01

    An understanding of structure–property relationships in cyanine dyes is critical for their design and application. Anionic and cationic cyanines can be organized into complementary cyanine salts, offering potential building blocks to modulate their intra/intermolecular interactions in the solid state. Here, we demonstrate how the structures of these complementary salts can be tuned to achieve highly ordered J-type supramolecular aggregate structures of heptamethine dyes in crystalline solids.

  7. The Liquidity Coverage Ratio: the need for further complementary ratios?

    OpenAIRE

    Ojo, Marianne

    2013-01-01

    This paper considers components of the Liquidity Coverage Ratio – as well as certain prevailing gaps which may necessitate the introduction of a complementary liquidity ratio. The definitions and objectives accorded to the Liquidity Coverage Ratio (LCR) and Net Stable Funding Ratio (NSFR) highlight the focus which is accorded to time horizons for funding bank operations. A ratio which would focus on the rate of liquidity transformations and which could also serve as a complementary metric gi...

  8. Supramolecular Assembly of Complementary Cyanine Salt J-Aggregates

    KAUST Repository

    Li, Zhong’an

    2015-09-09

    An understanding of structure–property relationships in cyanine dyes is critical for their design and application. Anionic and cationic cyanines can be organized into complementary cyanine salts, offering potential building blocks to modulate their intra/intermolecular interactions in the solid state. Here, we demonstrate how the structures of these complementary salts can be tuned to achieve highly ordered J-type supramolecular aggregate structures of heptamethine dyes in crystalline solids.

  9. Use of complementary and alternative medicine before and after organ removal due to urologic cancer

    Directory of Open Access Journals (Sweden)

    Mani J

    2015-10-01

    Full Text Available Jens Mani,1 Eva Juengel,1 Ilhan Arslan,1 Georg Bartsch,1 Natalie Filmann,2 Hanns Ackermann,2 Karen Nelson,3 Axel Haferkamp,1 Tobias Engl,1,* Roman A Blaheta1,* 1Department of Urology, 2Institute of Biostatistics and Mathematical Modeling, 3Department of Vascular and Endovascular Surgery, Johann Wolfgang Goethe-University, Frankfurt am Main, Germany *These authors contributed equally to this work Objective: Many patients use complementary and alternative medicine (CAM as primary treatment or symptom relief for a variety of illnesses. This study was designed to investigate the influence of surgical removal of a tumor-bearing urogenital organ on CAM use.Methods: From 2007 to 2011, 350 patients underwent major urological surgery for kidney, prostate, or bladder cancer at the Goethe-University Hospital, Frankfurt, Germany. Data from 172 patients (49%, who returned a questionnaire, were retrospectively evaluated using the hospital information system along with the questionnaire to objectify CAM use 2 years before and after surgery.Results: From the 172 patients returning questionnaires, 56 (33% used CAM before and/or after surgery and 116 (67% never used CAM. Of the 56 CAM users, 30 (54% used CAM presurgery and 53 (95% used CAM postsurgery, indicating a significant change of mind about CAM use. Patients of German nationality used CAM significantly more than patients of other nationalities. Higher educational status (high-school diploma or higher was a significant factor in favor of CAM use. The most common type of CAM used before/after surgery was an alternative medical system (63/49%, a manipulative and body-based method (50/19%, and a biological-based therapy (37/32%. Information about CAM, either provided by medical professionals or by other sources, was the main reason determining whether patients used CAM or not.Conclusion: The number of patients using CAM almost doubled after surgical removal of a cancer-bearing organ. Better awareness and

  10. Methods, Devices and Computer Program Products Providing for Establishing a Model for Emulating a Physical Quantity Which Depends on at Least One Input Parameter, and Use Thereof

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention proposes methods, devices and computer program products. To this extent, there is defined a set X including N distinct parameter values x_i for at least one input parameter x, N being an integer greater than or equal to 1, first measured the physical quantity Pm1 for each...

  11. Refinements of the attending equations for several spectral methods that provide improved quantification of B-carotene and/or lycopene in selected foods

    Science.gov (United States)

    Developing and maintaining maximal levels of carotenoids in fruits and vegetables that contain them is a concern of the produce industry. Toward this end, reliable methods for quantifying lycopene and B-carotene, two of the major health-enhancing carotenoids, are necessary. The goal of this resear...

  12. Method for applying a thin film barrier stack to a device with microstructures, and device provided with such a thin film barrier stack

    NARCIS (Netherlands)

    2005-01-01

    A method for applying a thin film barrier stack to a device with microstructures, such as, for instance, an OLED, wherein the thin film barrier stack forms a barrier to at least moisture and oxygen, wherein the stack is built up from a combination of org. and inorg. layers, characterized in that a

  13. Poly-1,2-azepine, method of producing a film of such a polymer on a substrate and a substrate provided with such a polymer

    NARCIS (Netherlands)

    1990-01-01

    Gas-phase photopolymerisation of phenylazides results in a new type of polymer, a poly-1,2-azepine. This polymer can be provided on a substrate according to a predetermined pattern by exposing it via a mask. After oxidation an electrically conductive polymer is obtained.

  14. Complementary Hand Responses Occur in Both Peri- and Extrapersonal Space.

    Directory of Open Access Journals (Sweden)

    Tim W Faber

    Full Text Available Human beings have a strong tendency to imitate. Evidence from motor priming paradigms suggests that people automatically tend to imitate observed actions such as hand gestures by performing mirror-congruent movements (e.g., lifting one's right finger upon observing a left finger movement; from a mirror perspective. Many observed actions however, do not require mirror-congruent responses but afford complementary (fitting responses instead (e.g., handing over a cup; shaking hands. Crucially, whereas mirror-congruent responses don't require physical interaction with another person, complementary actions often do. Given that most experiments studying motor priming have used stimuli devoid of contextual information, this space or interaction-dependency of complementary responses has not yet been assessed. To address this issue, we let participants perform a task in which they had to mirror or complement a hand gesture (fist or open hand performed by an actor depicted either within or outside of reach. In three studies, we observed faster reaction times and less response errors for complementary relative to mirrored hand movements in response to open hand gestures (i.e., 'hand-shaking' irrespective of the perceived interpersonal distance of the actor. This complementary effect could not be accounted for by a low-level spatial cueing effect. These results demonstrate that humans have a strong and automatic tendency to respond by performing complementary actions. In addition, our findings underline the limitations of manipulations of space in modulating effects of motor priming and the perception of affordances.

  15. Complementary Hand Responses Occur in Both Peri- and Extrapersonal Space.

    Science.gov (United States)

    Faber, Tim W; van Elk, Michiel; Jonas, Kai J

    2016-01-01

    Human beings have a strong tendency to imitate. Evidence from motor priming paradigms suggests that people automatically tend to imitate observed actions such as hand gestures by performing mirror-congruent movements (e.g., lifting one's right finger upon observing a left finger movement; from a mirror perspective). Many observed actions however, do not require mirror-congruent responses but afford complementary (fitting) responses instead (e.g., handing over a cup; shaking hands). Crucially, whereas mirror-congruent responses don't require physical interaction with another person, complementary actions often do. Given that most experiments studying motor priming have used stimuli devoid of contextual information, this space or interaction-dependency of complementary responses has not yet been assessed. To address this issue, we let participants perform a task in which they had to mirror or complement a hand gesture (fist or open hand) performed by an actor depicted either within or outside of reach. In three studies, we observed faster reaction times and less response errors for complementary relative to mirrored hand movements in response to open hand gestures (i.e., 'hand-shaking') irrespective of the perceived interpersonal distance of the actor. This complementary effect could not be accounted for by a low-level spatial cueing effect. These results demonstrate that humans have a strong and automatic tendency to respond by performing complementary actions. In addition, our findings underline the limitations of manipulations of space in modulating effects of motor priming and the perception of affordances.

  16. ACUPUNCTURE EFFECTIVENESS AS A COMPLEMENTARY THERAPY IN FUNCTIONAL DYSPEPSIA PATIENTS

    Directory of Open Access Journals (Sweden)

    Flavia Altaf da Rocha LIMA

    2013-09-01

    Full Text Available Context Functional dyspepsia represents a frequent gastrointestinal disorder in clinical practice. According to the Roma III criteria, functional dyspepsia can be classified into two types as the predominant sympton: epigastric pain and postprandial discomfort. Even though the pathophysiology is still uncertain, the functional dyspepsia seems to be related to multiple mechanisms, among them visceral hypersensitivity, changes in the gastroduodenal motility and gastric accommodation and psychological factors. Objective Evaluate the effectiveness of acupuncture as a complementary to conventional treatment in functional dyspepsia patients. Methods Randomized clinical trial in which were enrolled patients with functional dyspepsia patients in according with Rome III criteria. One group was submitted to drug therapy and specific acupuncture (GI and the other to drug therapy and non-specific acupuncture (GII. The gastrointestinal symptoms, presence of psychiatric disorders and quality of life were evaluated, at the end and three months after treatment. Results After 4 weeks of treatment there was improvement of gastrointestinal symptoms in Group I (55 ± 12 vs 29 ± 8.8; P = 0.001 and Group II (50.5 ± 10.2 vs 46 ± 10.5; P = 0.001. Quality of life was significantly better in Group I than group II (93.4 ± 7.3 vs 102.4 ± 5.1; P = 0.001. Anxiety (93.3% vs 0%; P = 0.001 and depression (46.7% vs 0%; P = 0.004 were significantly lower in Group I than group II. When comparing the two groups after 4 weeks of treatment, gastrointestinal symptoms (29 ± 8.8 vs 46 ± 10.5; P<0.001 and quality of life (102.4 ± 5.1 vs 96 ± 6.1; P = 0.021 were significantly better in Group I than group II. Three months after the treatment, gastrointestinal symptoms remained better only in Group I, when compared to the pre-treatment values (38 ± 11.3 vs 55 ± 12; P = 0.001. Conclusion In patients with functional dyspepsia the complementary acupuncture treatment is superior to

  17. Desorption atmospheric pressure photoionization high-resolution mass spectrometry: a complementary approach for the chemical analysis of atmospheric aerosols.

    Science.gov (United States)

    Parshintsev, Jevgeni; Vaikkinen, Anu; Lipponen, Katriina; Vrkoslav, Vladimir; Cvačka, Josef; Kostiainen, Risto; Kotiaho, Tapio; Hartonen, Kari; Riekkola, Marja-Liisa; Kauppila, Tiina J

    2015-07-15

    On-line chemical characterization methods of atmospheric aerosols are essential to increase our understanding of physicochemical processes in the atmosphere, and to study biosphere-atmosphere interactions. Several techniques, including aerosol mass spectrometry, are nowadays available, but they all suffer from some disadvantages. In this research, desorption atmospheric pressure photoionization high-resolution (Orbitrap) mass spectrometry (DAPPI-HRMS) is introduced as a complementary technique for the fast analysis of aerosol chemical composition without the need for sample preparation. Atmospheric aerosols from city air were collected on a filter, desorbed in a DAPPI source with a hot stream of toluene and nitrogen, and ionized using a vacuum ultraviolet lamp at atmospheric pressure. To study the applicability of the technique for ambient aerosol analysis, several samples were collected onto filters and analyzed, with the focus being on selected organic acids. To compare the DAPPI-HRMS data with results obtained by an established method, each filter sample was divided into two equal parts, and the second half of the filter was extracted and analyzed by liquid chromatography/mass spectrometry (LC/MS). The DAPPI results agreed with the measured aerosol particle number. In addition to the targeted acids, the LC/MS and DAPPI-HRMS methods were found to detect different compounds, thus providing complementary information about the aerosol samples. DAPPI-HRMS showed several important oxidation products of terpenes, and numerous compounds were tentatively identified. Thanks to the soft ionization, high mass resolution, fast analysis, simplicity and on-line applicability, the proposed methodology has high potential in the field of atmospheric research. Copyright © 2015 John Wiley & Sons, Ltd.

  18. Trend of complementary therapies in paediatric age group

    International Nuclear Information System (INIS)

    Ashraf, S.; Satwani, H.; Naz, F.; Abbas, K.; Hassan, A.

    2010-01-01

    Objective: To assess the knowledge of mothers regarding commonly used Complimentary alternative medicines, their usage and various therapeutic choices for common ailments. Methods: A cross-sectional Survey on a pre designed proforma was done from July 2007- August 2007 in the out patient department of a tertiary care hospital. Consent was taken from the participants and 375 complete proformas were included in the study out of 500 interviewed. Results: Of the 375 mothers who were interviewed, 237 (63.2%) believed in alternative medicine whereas 138 (36.8%) did not believe in it. Complimentary alternative medicines (CAM) was used most often in children with respiratory tract and gastro intestinal symptoms, the most frequently used therapy was Honey 58.9% and Joshanda 31.2%, followed by Heeng 11.3% and brandy being used in 2.8% for respiratory complaints. Gastrointestinal symptoms were treated with Saunf water 28.4%, mint 20.6% and ajwain 17.7%. Higher education level was associated with more complementary medicine use. Majority of mothers used it for gastrointestinal problems and respiratory problems 24% and 22.2% respectively. Conclusions: Mothers are aware of various available CAM and are using them for different ailments like honey for respiratory illnesses, Saunf and Ajwain for gastrointestinal problems as they have been found to have linctus and antispasmodic effects respectively. It has also been observed that the CAM was used in combination with other therapeutic modalities and not alone. (author)

  19. Complementary and alternative medicine for allergic rhinitis in Japan.

    Science.gov (United States)

    Yonekura, Syuji; Okamoto, Yoshitaka; Sakurai, Daiju; Sakurai, Toshioki; Iinuma, Tomohisa; Yamamoto, Heizaburou; Hanazawa, Toyoyuki; Horiguchi, Shigetoshi; Kurono, Yuichi; Honda, Kohei; Majima, Yuichi; Masuyama, Keisuke; Takeda, Noriaki; Fujieda, Shigeharu; Okano, Mitsuhiro; Ogino, Satoshi; Okubo, Kimihiro

    2017-07-01

    Complementary and alternative medicine (CAM) is extensively used in patients with allergic diseases worldwide. The purpose of this study was to investigate the actual situation of CAM practice in the treatment of allergic rhinitis. We distributed questionnaires to otolaryngologists at 114 facilities in Japan. The subjects who participated in this study included children effective. The main reasons for CAM use were safety, convenience and low price. However, the group who spent more than $1000 on CAM felt more dissatisfaction and anxiety related to treatment at the hospital. The situation of CAM practice was not consistent and was instead influenced by the backgrounds of the subjects. Many patients who receive CAM report feeling that the effects of treatment provided by hospitals are insufficient and have concerns about the side effects of such treatments. Information regarding standard treatments, as described in the guidelines, should become widely known and diffused, and strong communication with patients should be considered. Copyright © 2016 Japanese Society of Allergology. Production and hosting by Elsevier B.V. All rights reserved.

  20. Complementary Cognitive Capabilities, Economic Decision-Making, and Aging

    Science.gov (United States)

    Li, Ye; Baldassi, Martine; Johnson, Eric J.; Weber, Elke U.

    2014-01-01

    Fluid intelligence decreases with age, yet evidence about age declines in decision-making quality is mixed: Depending on the study, older adults make worse, equally good, or even better decisions than younger adults. We propose a potential explanation for this puzzle, namely that age differences in decision performance result from the interplay between two sets of cognitive capabilities that impact decision making, one in which older adults fare worse (i.e., fluid intelligence) and one in which they fare better (i.e., crystallized intelligence). Specifically, we hypothesized that older adults’ higher levels of crystallized intelligence can provide an alternate pathway to good decisions when the fluid intelligence pathway declines. The performance of older adults relative to younger adults therefore depends on the relative importance of each type of intelligence for the decision at hand. We tested this complementary capabilities hypothesis in a broad sample of younger and older adults, collecting a battery of standard cognitive measures and measures of economically important decision-making “traits”—including temporal discounting, loss aversion, financial literacy, and debt literacy. We found that older participants performed as well as or better than younger participants on these four decision-making measures. Structural equation modeling verified our hypothesis: Older participants’ greater crystallized intelligence offset their lower levels of fluid intelligence for temporal discounting, financial literacy, and debt literacy, but not for loss aversion. These results have important implications for public policy and for the design of effective decision environments for older adults. PMID:24040999