Perspectives on Promoting Regional Renewable Energy Research and Development

International Nuclear Information System (INIS)

Dresselhaus, M.

2008-01-01

Recent discussions at the Washington International Renewable Energy Conference (WIREC), hosted in March 2008 by the United States Government, with nearly 9000 participants including 103 ministers from 126 countries, concluded that a major acceleration in the adoption of renewable energy technologies was needed by mid-century. Because of different climatic conditions and societal preferences, regional cooperation is expected to play a major role in the efficient adoption of appropriate renewable energy technologies, and countries with special expertise in specific technologies seem eager to collaborate internationally to promote global goals in renewable energy. A review will be given of what we learned from this conference about renewable energy research and development strategies with a special focus given to using this basic knowledge base to promote the development of renewable energy technologies appropriate to specific regions of the world.(author)

Regional differences in gene expression and promoter usage in aged human brains

KAUST Repository

Pardo, Luba M.

2013-02-19

To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.

Targets of DNA-binding proteins in bacterial promoter regions present enhanced probabilities for spontaneous thermal openings

International Nuclear Information System (INIS)

Apostolaki, Angeliki; Kalosakas, George

2011-01-01

We mapped promoter regions of double-stranded DNA with respect to the probabilities of appearance of relatively large bubble openings exclusively due to thermal fluctuations at physiological temperatures. We analyzed five well-studied promoter regions of procaryotic type and found a spatial correlation between the binding sites of transcription factors and the position of peaks in the probability pattern of large thermal openings. Other distinct peaks of the calculated patterns correlate with potential binding sites of DNA-binding proteins. These results suggest that a DNA molecule would more frequently expose the bases that participate in contacts with proteins, which would probably enhance the probability of the latter to reach their targets. It also stands for using this method as a means to analyze DNA sequences based on their intrinsic thermal properties

Growing Significance of EU Institutions in Promotion of Inter-regional policies

Directory of Open Access Journals (Sweden)

Ella V. Ermakova

2014-01-01

Full Text Available The article explores the variety of tools and vehicles applied within the EU to expand the prerogative of the regions of the EU member states. The author uses as an example the inter-regional policies in Belgium in respect of the Flemish Region and the Walloon Region. The author analyzes the mechanisms of promotion of external regional relations in Belgium as a means of addressing different problems both on national and all-European level, supporting the arguments and conclusions by examples of relevant EU initiatives. The article details the activities of the EU Regional Committee (RC, the EU advisory body with the powers of political initiative, upholding the principle ofsubsidarity in the implementation of the EU member states' regional policies. The involvement of the Flemish Region and the Walloon Region in the activities of EU RC is described and summarized. As a case study, the article deals with Belgium's rotating six months presidency in the EUin 2010 when the country, which was going through a severe political crisis with no federal government in place, was represented by the two regions. The special focus of the article is on the strategic EU program "Europe2020" and its implementation by the regions of Belgium. There is an account of the initiatives undertaken by the Flemish Region and the Walloon Region within the framework of this program outlining the interaction of the two regions. The author provides a comprehensive analysis of the involvement of the Flemish Region and the Walloon Region with various EU institutions describing how each party achieves the promotion of its regional interests. Within this context, it is a noteworthy development that the Flemish Region is participating in the international program "Pact 2020" on energy all by its own. The article features quotations by Flemish and Walloon political figures which serve as an illustration of the prevailing attitudes in the Belgian society to the process of

Characterization of the promoter region of the human c-erbB-2 protooncogene

International Nuclear Information System (INIS)

Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.

1987-01-01

Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors

Selection for Unequal Densities of Sigma70 Promoter-like Signalsin Different Regions of Large Bacterial Genomes

Energy Technology Data Exchange (ETDEWEB)

Huerta, Araceli M.; Francino, M. Pilar; Morett, Enrique; Collado-Vides, Julio

2006-03-01

The evolutionary processes operating in the DNA regions that participate in the regulation of gene expression are poorly understood. In Escherichia coli, we have established a sequence pattern that distinguishes regulatory from nonregulatory regions. The density of promoter-like sequences, that are recognizable by RNA polymerase and may function as potential promoters, is high within regulatory regions, in contrast to coding regions and regions located between convergently-transcribed genes. Moreover, functional promoter sites identified experimentally are often found in the subregions of highest density of promoter-like signals, even when individual sites with higher binding affinity for RNA polymerase exist elsewhere within the regulatory region. In order to investigate the generality of this pattern, we have used position weight matrices describing the -35 and -10 promoter boxes of E. coli to search for these motifs in 43 additional genomes belonging to most established bacterial phyla, after specific calibration of the matrices according to the base composition of the noncoding regions of each genome. We have found that all bacterial species analyzed contain similar promoter-like motifs, and that, in most cases, these motifs follow the same genomic distribution observed in E. coli. Differential densities between regulatory and nonregulatory regions are detectable in most bacterial genomes, with the exception of those that have experienced evolutionary extreme genome reduction. Thus, the phylogenetic distribution of this pattern mirrors that of genes and other genomic features that require weak selection to be effective in order to persist. On this basis, we suggest that the loss of differential densities in the reduced genomes of host-restricted pathogens and symbionts is the outcome of a process of genome degradation resulting from the decreased efficiency of purifying selection in highly structured small populations. This implies that the differential

Mechanosensitive promoter region in the human HB-GAM gene

DEFF Research Database (Denmark)

Liedert, Astrid; Kassem, Moustapha; Claes, Lutz

2009-01-01

Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...

Tumour MLH1 promoter region methylation testing is an effective pre-screen for Lynch Syndrome (HNPCC)

Science.gov (United States)

Newton, K; Jorgensen, NM; Wallace, AJ; Buchanan, DD; Lalloo, F; McMahon, RFT; Hill, J; Evans, DG

2016-01-01

Background & Aims Lynch syndrome patients have DNA mismatch repair deficiency and up to 80% life-time risk of colorectal cancer. Screening of mutation carriers reduces colorectal cancer incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from Lynch Syndrome (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Methods Tumour DNA was extracted (FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Findings Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2–98.4%), specificity 87.7% (95% CI 77.9–94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7–76.5%), specificity 98.6% (95% CI 92.4–100.0%) for the identification of those with pathogenic MLH1 mutations. Conclusions Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. PMID:25280751

Identification of a single-nucleotide insertion in the promoter region affecting the sodC promoter activity in Brucella neotomae.

Directory of Open Access Journals (Sweden)

Dina A Moustafa

Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.

A new method for promoting lily flowering

African Journals Online (AJOL)

Jane

2011-08-08

Aug 8, 2011 ... FT is thought to be the florigen in plants. In this research, a new method for promoting lily flowering was introduced. The function of FT gene cloned from Arabidopsis on promoting lily flowering was analyzed. pET-30a-FT vector was constructed to indicate the expression of FT:eGFP fuse protein in.

Identification of functional DNA variants in the constitutive promoter region of MDM2

Directory of Open Access Journals (Sweden)

Lalonde Marie-Eve

2012-09-01

Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.

Natural selection in a population of Drosophila melanogaster explained by changes in gene expression caused by sequence variation in core promoter regions.

Science.gov (United States)

Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado

2016-02-09

Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning

Two negative cis-regulatory regions involved in fruit-specific promoter activity from watermelon (Citrullus vulgaris S.).

Science.gov (United States)

Yin, Tao; Wu, Hanying; Zhang, Shanglong; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming; Liu, Jingmei

2009-01-01

A 1.8 kb 5'-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from -986 to -959 and from -472 to -424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative beta-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were approximately 10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves.

Genome-wide function of H2B ubiquitylation in promoter and genic regions.

Science.gov (United States)

Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin

2011-11-01

Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating).

A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

Directory of Open Access Journals (Sweden)

Lu Ying

2004-04-01

Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the

The Preparation and Selection of Budget Methods for Promotion in Kosovo

Directory of Open Access Journals (Sweden)

MSc. Halit Karaxha

2017-06-01

Full Text Available Selecting the adequate method for promotion has a huge importance in increasing business’s performance. Selecting the method of the budget depends from a number of factors. The formulation of budget is known as the most critical period which requires special analysis from marketing’s managers. The expenses for promotion are usually high, and every investment made in the field of promotion directly influences in the business situation. Thus, the selection and adequate formulation of budget methods for promotion influences the growth of profit. The allocated amount for promotion depends from a number of factors, such as: the size of the firm, the sector in which it operates, competition etc. After planning the budget, we have to do the budget allocation to select the promotional form which is considered to be successful by the firms in promoting the products and services and that will help the company to connect with its clients. In this paper, I have elaborated the role and importance of the preparation and selection of budget methods for promotion in the theoretical aspect and the practical one as well.

The promotion of regional integration of electricity markets: Lessons for developing countries

International Nuclear Information System (INIS)

Oseni, Musiliu O.; Pollitt, Michael G.

2016-01-01

This paper focuses on how to promote regional cooperation in electricity. We begin by discussing the theory of international trade cooperation in electricity, with a view to discussing what preconditions might be important in facilitating wide area trading across national borders. We then develop lessons based on the comparison of four case studies. These include three regional developing country power pools – the Southern African Power pool (SAPP), West African Power pool (WAPP) and the Central American Power Market (MER). We contrast these with Northern Europe's Nord Pool. These cases highlight both the potential and difficulty of having cross-jurisdictional power pools. In the light of the theory and evidence we present, we draw key lessons in the areas of: preconditions for trading; necessary institutional arrangements; practicalities of timetabling; reasons to be hopeful about future prospects. - Highlights: • This paper focuses on how to promote regional electricity cooperation. • We develop lessons based on comparison of four international case studies. • The cases highlight both the potential and difficulty of power pools. • We identify preconditions, institutional arrangements and timetabling. • We conclude that the future prospects for regional power pools are good.

Insulin VNTR and IGF-1 promoter region polymorphisms are not associated with body composition in early childhood: The generation R study

NARCIS (Netherlands)

J.A.J.B.M. Maas (Janneke); D.O. Mook-Kanamori (Dennis); L. Ay (Lamise); R.P.M. Steegers-Theunissen (Régine); P. Tikka-Kleemola (Päivi); A. Hofman (Albert); A.C.S. Hokken-Koelega (Anita); V.W.V. Jaddoe (Vincent)

2010-01-01

textabstractObjective: The objective of this study was to examine the associations between insulin gene variable number of tandem repeats (INS VNTR) and insulin-like growth factor 1 (IGF1) gene promoter region polymorphisms with body composition in early childhood. Methods: This study was embedded

Genome-wide prediction of cis-regulatory regions using supervised deep learning methods.

Science.gov (United States)

Li, Yifeng; Shi, Wenqiang; Wasserman, Wyeth W

2018-05-31

In the human genome, 98% of DNA sequences are non-protein-coding regions that were previously disregarded as junk DNA. In fact, non-coding regions host a variety of cis-regulatory regions which precisely control the expression of genes. Thus, Identifying active cis-regulatory regions in the human genome is critical for understanding gene regulation and assessing the impact of genetic variation on phenotype. The developments of high-throughput sequencing and machine learning technologies make it possible to predict cis-regulatory regions genome wide. Based on rich data resources such as the Encyclopedia of DNA Elements (ENCODE) and the Functional Annotation of the Mammalian Genome (FANTOM) projects, we introduce DECRES based on supervised deep learning approaches for the identification of enhancer and promoter regions in the human genome. Due to their ability to discover patterns in large and complex data, the introduction of deep learning methods enables a significant advance in our knowledge of the genomic locations of cis-regulatory regions. Using models for well-characterized cell lines, we identify key experimental features that contribute to the predictive performance. Applying DECRES, we delineate locations of 300,000 candidate enhancers genome wide (6.8% of the genome, of which 40,000 are supported by bidirectional transcription data), and 26,000 candidate promoters (0.6% of the genome). The predicted annotations of cis-regulatory regions will provide broad utility for genome interpretation from functional genomics to clinical applications. The DECRES model demonstrates potentials of deep learning technologies when combined with high-throughput sequencing data, and inspires the development of other advanced neural network models for further improvement of genome annotations.

DNA Methylation Analysis of BRD1 Promoter Regions and the Schizophrenia rs138880 Risk Allele.

Directory of Open Access Journals (Sweden)

Mads Dyrvig

Full Text Available The bromodomain containing 1 gene, BRD1 is essential for embryogenesis and CNS development. It encodes a protein that participates in histone modifying complexes and thereby regulates the expression of a large number of genes. Genetic variants in the BRD1 locus show association with schizophrenia and bipolar disorder and risk alleles in the promoter region correlate with reduced BRD1 expression. Insights into the transcriptional regulation of BRD1 and the pathogenic mechanisms associated with BRD1 risk variants, however, remain sparse. By studying transcripts in human HeLa and SH-SY5Y cells we provide evidence for differences in relative expression of BRD1 transcripts with three alternative 5' UTRs (exon 1C, 1B, and 1A. We further show that expression of these transcript variants covaries negatively with DNA methylation proportions in their upstream promoter regions suggesting that promoter usage might be regulated by DNA methylation. In line with findings that the risk allele of the rs138880 SNP in the BRD1 promoter region correlates with reduced BRD1 expression, we find that it is also associated with moderate regional BRD1 promoter hypermethylation in both adipose tissue and blood. Importantly, we demonstrate by inspecting available DNA methylation and expression data that these regions undergo changes in methylation during fetal brain development and that differences in their methylation proportions in fetal compared to postnatal frontal cortex correlate significantly with BRD1 expression. These findings suggest that BRD1 may be dysregulated in both the developing and mature brain of risk allele carriers. Finally, we demonstrate that commonly used mood stabilizers Lithium, Valproate, and Carbamazepine affect the expression of BRD1 in SH-SY5Y cells. Altogether this study indicates a link between genetic risk and epigenetic dysregulation of BRD1 which raises interesting perspectives for targeting the mechanisms pharmacologically.

A study of the frequency of methylation of gene promoter regions in ...

Indian Academy of Sciences (India)

2013-04-02

Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.

Plant growth promoters and methods of using them

KAUST Repository

Al-Babili, Salim

2017-01-01

New plant growth regulators, including compounds and compositions, and methods of use including for promoting root growth. The compounds are carotenoid oxidation products, and a preferred example is 3-OH--β-apo-13-Carotenone. A method comprising

Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Is Not Associated With Paroxetine-Induced Ejaculation Delay in Dutch Men With Lifelong Premature Ejaculation

NARCIS (Netherlands)

Janssen, Paddy K C; Zwinderman, Aeilko H; Olivier, Berend; Waldinger, Marcel D

PURPOSE: To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). MATERIALS AND METHODS: This was a prospective study of 10 weeks of paroxetine

Hypermethylation of the DPYD promoter region is not a major predictor of severe toxicity in 5-fluorouracil based chemotherapy

Directory of Open Access Journals (Sweden)

Aebi Stefan

2008-10-01

Full Text Available Abstract Background The activity of dihydropyrimidine dehydrogenase (DPD, the key enzyme of pyrimidine catabolism, is thought to be an important determinant for the occurrence of severe toxic reactions to 5-fluorouracil (5-FU, which is one of the most commonly prescribed chemotherapeutic agents for the treatment of solid cancers. Genetic variation in the DPD gene (DPYD has been proposed as a main factor for variation in DPD activity in the population. However, only a small proportion of severe toxicities in 5-FU based chemotherapy can be explained with such rare deleterious DPYD mutations resulting in severe enzyme deficiencies. Recently, hypermethylation of the DPYD promoter region has been proposed as an alternative mechanism for DPD deficiency and thus as a major cause of severe 5-FU toxicity. Methods Here, the prognostic significance of this epigenetic marker with respect to severe 5-FU toxicity was assessed in 27 cancer patients receiving 5-FU based chemotherapy, including 17 patients experiencing severe toxic side effects following drug administration, none of which were carriers of a known deleterious DPYD mutation, and ten control patients. The methylation status of the DPYD promoter region in peripheral blood mononuclear cells was evaluated by analysing for each patient between 19 and 30 different clones of a PCR-amplified 209 base pair fragment of the bisulfite-modified DPYD promoter region. The fragments were sequenced to detect bisulfite-induced, methylation-dependent sequence differences. Results No evidence of DPYD promoter methylation was observed in any of the investigated patient samples, whereas in a control experiment, as little as 10% methylated genomic DNA could be detected. Conclusion Our results indicate that DYPD promoter hypermethylation is not of major importance as a prognostic factor for severe toxicity in 5-FU based chemotherapy.

The Search Conference as a Method in Planning Community Health Promotion Actions

Science.gov (United States)

Magnus, Eva; Knudtsen, Margunn Skjei; Wist, Guri; Weiss, Daniel; Lillefjell, Monica

2016-01-01

Aims: The aim of this article is to describe and discuss how the search conference can be used as a method for planning health promotion actions in local communities. Design and methods: The article draws on experiences with using the method for an innovative project in health promotion in three Norwegian municipalities. The method is described both in general and how it was specifically adopted for the project. Results and conclusions: The search conference as a method was used to develop evidence-based health promotion action plans. With its use of both bottom-up and top-down approaches, this method is a relevant strategy for involving a community in the planning stages of health promotion actions in line with political expectations of participation, ownership, and evidence-based initiatives. Significance for public health This article describe and discuss how the Search conference can be used as a method when working with knowledge based health promotion actions in local communities. The article describe the sequences of the conference and shows how this have been adapted when planning and prioritizing health promotion actions in three Norwegian municipalities. The significance of the article is that it shows how central elements in the planning of health promotion actions, as participation and involvements as well as evidence was a fundamental thinking in how the conference were accomplished. The article continue discussing how the method function as both a top-down and a bottom-up strategy, and in what way working evidence based can be in conflict with a bottom-up strategy. The experiences described can be used as guidance planning knowledge based health promotion actions in communities. PMID:27747199

Role of regional policies in promoting networking and innovation activity of firms

OpenAIRE

Kirsi Mukkala; Jari Ritsilä

2004-01-01

The success of firms and regions is increasingly defined by their innovation and learning capabilities. It has been emphasized in several studies that a local operational environment may have a positive impact on innovation activity of firms. From policy point of view, the relationship between firms and their local environment is an important research topic. The purpose of this paper is to explore whether there is a demand for regional policy makers in promoting innovative and networking acti...

The search conference as a method in planning community health promotion actions

Directory of Open Access Journals (Sweden)

Eva Magnus

2016-08-01

Full Text Available Aims: The aim of this article is to describe and discuss how the search conference can be used as a method for planning health promotion actions in local communities. Design and methods: The article draws on experiences with using the method for an innovative project in health promotion in three Norwegian municipalities. The method is described both in general and how it was specifically adopted for the project. Results and conclusions: The search conference as a method was used to develop evidence-based health promotion action plans. With its use of both bottom-up and top-down approaches, this method is a relevant strategy for involving a community in the planning stages of health promotion actions in line with political expectations of participation, ownership, and evidence-based initiatives.

Regional allocation of carbon emission quotas in China: Evidence from the Shapley value method

International Nuclear Information System (INIS)

Zhang, Yue-Jun; Wang, Ao-Dong; Da, Ya-Bin

2014-01-01

It is an important task for China to allocate carbon emission quotas among regions so as to realize its carbon reduction targets and establish the national cap-and-trade carbon market. Meanwhile, it is supposed to be cost-effective to jointly reduce China's carbon emissions through some collaborative activities among regions. Then a natural question is how to allocate the quotas among regions in light of the collaboration. For this purpose, the Shapley value method is adopted and the results show that, first, the regions with higher GDP, higher carbon outflow and higher carbon reduction connection should be allocated more carbon quotas. Moreover, when the collaboration is considered, the optimal allocation of carbon quotas among regions will change significantly compared to the basic quotas by the entropy method; and the Central region is allocated the largest proportion of carbon quota among regions, which indicates its largest radiation effect. Besides, the collaboration between the Central region and Northern coast region, and that between the Central region and the Eastern region should be paid close attention. These results may provide insightful support for decision makers to promote collaborative carbon reduction and allocate carbon quotas in China. - Highlights: • The paper allocates carbon quotas given the collaboration among regions in China. • The Shapley value method coupled with the entropy and gravity models is adopted. • The regions with higher GDP, carbon outflow and reduction connection allocate more. • The Central region has the largest radiation effect on others among all regions. • The collaboration of the Central and Northern coast regions should have priority

A prospective evaluation of first people’s health promotion program design in the goulburn-murray rivers region

Directory of Open Access Journals (Sweden)

Joyce Doyle

2016-11-01

Full Text Available Abstract Background Aboriginal Community Controlled Organisations (ACCOs provide community-focussed and culturally safe services for First Peoples in Australia, including crisis intervention and health promotion activities, in a holistic manner. The ecological model of health promotion goes some way towards describing the complexity of such health programs. The aims of this project were to: 1 identify the aims and purpose of existing health promotion programs conducted by an alliance of ACCOs in northern Victoria, Australia; and 2 evaluate the extent to which these programs are consistent with an ecological model of health promotion, addressing both individual and environmental determinants of health. Methods The project arose from a long history of collaborative research. Three ACCOs and a university formed the Health Promotion Alliance to evaluate their health promotion programs. Local community members were trained in, and contributed to developing culturally sensitive methods for, data collection. Information on the aims and design of 88 health promotion activities making up 12 different programs across the ACCOs was systematically and prospectively collected. Results There was a wide range of activities addressing environmental and social determinants of health, as well as physical activity, nutrition and weight loss. The design of the great majority of activities had a minimal Western influence and were designed within a local Aboriginal cultural framework. The most common focus of the activities was social connectedness (76 %. Physical activity was represented in two thirds of the activities, and nutrition, weight loss and culture were each a focus of about half of the activities. A modified coding procedure designed to assess the ecological nature of these programs showed that they recruited from multiple settings; targeted a range of individual, social and environmental determinants; and used numerous and innovative strategies to

Promoting regional mobility

DEFF Research Database (Denmark)

Jensen, Anne

Pricing of transport has been part of EU's common transport policy since this gained momentum in the early 1990s. Since then, it has been closely connected to the trans-European transport network (TEN-T) and to rising demands of efficient mobility systems at a local, regional and Community scale....... Development of pricing policies is contested at Community level and has taken place in a clash between different policy rationalities. Significantly though, the effects of the pricing policies are closely related to regional mobility systems, e.g. through financing large trans-border infrastructure projects...... and establishing common technical charging systems thus changing the conditions for regional mobility. This paper explores how policies of infrastructure pricing shape new ways of governing mobility which influences trans-border, regional policy-making. The key findings are that there is a tendency to include...

Polymorphism in the oxytocin promoter region in patients with lactase non-persistence is not related to symptoms

Directory of Open Access Journals (Sweden)

Simrén Magnus

2009-11-01

Full Text Available Abstract Background Oxytocin and the oxytocin receptor have been demonstrated in the gastrointestinal (GI tract and have been shown to exert physiological effects on gut motility. The role for oxytocin in the pathophysiology of GI complaints is unknown. The aim of this study was to examine genetic variations or polymorphism of oxytocin (OXT and its receptor (OXTR genes in patients with GI complaints without visible organic abnormalities. Methods Genetic variants in the OXT promoter region, and in the OXTR gene in DNA samples from 131 rigorously evaluated patients with Irritable Bowel Syndrome (IBS, 408 homozygous subjects referred for lactase (LCT-13910 C>T, rs4988235 genotyping, and 299 asymptomatic blood donors were compared. One polymorphism related to the OXT gene (rs6133010 A>G and 4 related to the OXTR gene (rs1465386 G>T, rs3806675 G>A, rs968389 A>G, rs1042778 G>T were selected for genotyping using Applied Biosystems 7900 HT allele discrimination assays. Results There were no statistically significant differences in the genotype or allele frequencies in any of the SNPs when IBS patients were compared to healthy controls. Among subjects referred for lactase genotyping, the rs6133010 A>G OXT promoter A/G genotype tended to be more common in the 154 non-persistent (27.3% subjects than in the 254 lactase persistant (18.1% subjects and in the healthy controls (19.4% (p = 0.08. When direct comparing, the A/G genotype was less common in the OXT promoter region in controls (p = 0.09 and in subjects with lactase persistence (p = 0.03 compared to subjects with lactase non-persistence. When healthy controls were viewed according to their own LCT-13910 genotypes, the C/C lactase non-persistent controls had a higher frequency for the OXT promoter A/G genotype than LCT-13910 T/T lactase persistent controls (41.2% vs 13.1%. No significant differences in frequencies of the investigated OXTR SNPs were noted in this study. Conclusion The results suggest

Nucleopolis for promoting the nuclear excellence of the Normandy region

International Nuclear Information System (INIS)

2016-01-01

Nucleopolis is the Norman economic pole dedicated to nuclear energy, nuclear medicine and nuclear safety, it gathers about 70 enterprises whatever their sizes, research laboratories and teaching or training units. Nucleopolis was founded in 2009 with the economic development of the region as a unique purpose. Nucleopolis will ease the access of its members to local, national and international markets through actions of networking and by promoting innovations and skill development. Nucleopolis proposes to its members a series of services around 4 departments: Nucleo'Network to promote networking between the members themselves and between the members and major contractors; Nucleo'Business to propose assistance in national and international business; Nucleo'Competence to propose adequate training to its members to upgrade their skills and Nucleo'Innovation to foster collaborative work between its members on innovative projects. (A.C.)

Identification and characterization of a liver stage-specific promoter region of the malaria parasite Plasmodium.

Directory of Open Access Journals (Sweden)

Susanne Helm

Full Text Available During the blood meal of a Plasmodium-infected mosquito, 10 to 100 parasites are inoculated into the skin and a proportion of these migrate via the bloodstream to the liver where they infect hepatocytes. The Plasmodium liver stage, despite its clinical silence, represents a highly promising target for antimalarial drug and vaccine approaches. Successfully invaded parasites undergo a massive proliferation in hepatocytes, producing thousands of merozoites that are transported into a blood vessel to infect red blood cells. To successfully develop from the liver stage into infective merozoites, a tight regulation of gene expression is needed. Although this is a very interesting aspect in the biology of Plasmodium, little is known about gene regulation in Plasmodium parasites in general and in the liver stage in particular. We have functionally analyzed a novel promoter region of the rodent parasite Plasmodium berghei that is exclusively active during the liver stage of the parasite. To prove stage-specific activity of the promoter, GFP and luciferase reporter assays have been successfully established, allowing both qualitative and accurate quantitative analysis. To further characterize the promoter region, the transcription start site was mapped by rapid amplification of cDNA ends (5'-RACE. Using promoter truncation experiments and site-directed mutagenesis within potential transcription factor binding sites, we suggest that the minimal promoter contains more than one binding site for the recently identified parasite-specific ApiAP2 transcription factors. The identification of a liver stage-specific promoter in P. berghei confirms that the parasite is able to tightly regulate gene expression during its life cycle. The identified promoter region might now be used to study the biology of the Plasmodium liver stage, which has thus far proven problematic on a molecular level. Stage-specific expression of dominant-negative mutant proteins and

Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

Science.gov (United States)

Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

2011-09-01

Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

Governmental promotion of the Information Society in the Spanish Region of Valencia

Directory of Open Access Journals (Sweden)

Emilio Feliu-García, Ph.D.

2011-01-01

Full Text Available Regional spheres are considered essential in the governmental promotion of the Information Society at the international level. The regional initiatives in Spain aim to strengthen and complement the initiatives promoted at the national level. This article analyses ICT penetration in the Valencian Community from 1996 to 2008. The objective is to identify which of the actions carried out by the Valencian Regional Government have had a positive effect on its society.The methodology employed in this study is benchmarking. The selection of indicators is based on the policies evaluation model proposed in the Plan Avanza (Spain’s national Information Society strategy. Data were collected from official statistical sources (like Spain’s National Statistics Institute, INE. Three statistical tests were applied to verify the hypotheses (Pearson’s r2, Chi-square and Student’s t.The results indicate that it is not possible to affirm that the actions implemented by the Valencian Regional Government have had a more positive effect on its society than those implemented by the Spanish Central Government. A reason for this may lie in the specific objectives of the political strategy implemented by the Valencian Government, which has focused primarily on e-Government and does not include enough projects centred on the implementation of new technologies in the private sector. Moreover, the integration of new technologies in everyday life is placed in a second level of importance despite citizens are central actors in the international agenda.

Development of a forecasting method of a region`s electric power demand. 1. Forecasting economic and social indexes; Chiikibetsu denryoku juyo yosoku shuhono kaihatsu ni tsuite. 1. Keizai shakai shihyo no yosoku

Energy Technology Data Exchange (ETDEWEB)

Minato, Y. [Shikoku Research Institute Inc., Kagawa (Japan); Yokoi, Y. [The University of Tokushima, Tokushima (Japan)

1996-01-20

This paper relates to the forecasting method of the electric power demands (kWh and kW) of a region, approached by not only time series analysis but economic and social indexes. Those indexes, based on historical statistics such as census and establishment statistics, are rearranged from an administrative division to a managerial division of the electric power company, and applied as fundamental information for forecasting the area`s kWh and also sales promotion. This method of forecasting the area`s kWh is based on the concept that area`s kWh is strongly connected with the population their lifestyle and their activity within the region. In the paper, the framework of the computational model system and forecast result are discussed. The population, number of households and their members, and number of employed persons, are all evaluated. The forecasting method of the area`s population proposed here is based on the concept that the transition of population consists of both natural growth and immigration. By estimating both factors, the future area`s population can be easily forecasted. The information of whether the population is increasing or decreasing is useful for forecasting the region`s kWh and required sales promotion. 8 refs., 8 figs., 3 tabs.

Plant growth promoters and methods of using them

KAUST Repository

Al-Babili, Salim

2017-01-05

New plant growth regulators, including compounds and compositions, and methods of use including for promoting root growth. The compounds are carotenoid oxidation products, and a preferred example is 3-OH--β-apo-13-Carotenone. A method comprising promoting the growth of at least one plant with use of an effective amount of at least one composition comprising an effective amount of at least one compound which is represented by A-B-C, wherein B is a bivalent polyene moiety, A is a monovalent moiety linked to B by a six-membered carbon ring, wherein the ring has at least one substituent linked to the ring by an oxygen atom, and C is a monovalent moiety linked to B by a carbonyl group. Synergistic effects can be used with combinations of compounds.

Deletion analysis of susy-sl promoter for the identification of optimal promoter sequence

International Nuclear Information System (INIS)

Bacha, S.; Khatoon, A.; Asif, M.; Bshir, A.

2015-01-01

The promoter region of sucrose synthase (susy-Sl) was identified and isolated from tomato. The 5? deletion analysis was carried out for the identification of minimum optimal promoter. Transgenic lines of Arabidopsis thaliana were developed by floral dip method incorporating various promoter deletion cassettes controlling GUS reporter gene. GUS assay of transgenic tissues indicated that full length susy-Sl promoter and its deletion mutants were constitutively expressed in vegetative and floral tissues of A. thaliana. The expression was observed in roots, shoots and flowers of A. thaliana. Analysis of 5? deletion series of susy-Sl promoter showed that a minimum of 679 bp fragment of the promoter was sufficient to drive expression of GUS reporter gene in the major tissues of transgenic A. thaliana. (author)

Tumour MLH1 promoter region methylation testing is an effective prescreen for Lynch Syndrome (HNPCC).

Science.gov (United States)

Newton, K; Jorgensen, N M; Wallace, A J; Buchanan, D D; Lalloo, F; McMahon, R F T; Hill, J; Evans, D G

2014-12-01

Lynch syndrome (LS) patients have DNA mismatch repair deficiency and up to 80% lifetime risk of colorectal cancer (CRC). Screening of mutation carriers reduces CRC incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour-derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from LS (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Tumour DNA was extracted (formalin fixed, paraffin embedded, FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2% to 98.4%), specificity 87.7% (95% CI 77.9% to 94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7% to 76.5%), specificity 98.6% (95% CI 92.4% to 100.0%) for the identification of those with pathogenic MLH1 mutations. Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

A prospective evaluation of first people's health promotion program design in the goulburn-murray rivers region.

Science.gov (United States)

Doyle, Joyce; Atkinson-Briggs, Sharon; Atkinson, Petah; Firebrace, Bradley; Calleja, Julie; Reilly, Rachel; Cargo, Margaret; Riley, Therese; Crumpen, Tui; Rowley, Kevin

2016-11-10

Aboriginal Community Controlled Organisations (ACCOs) provide community-focussed and culturally safe services for First Peoples in Australia, including crisis intervention and health promotion activities, in a holistic manner. The ecological model of health promotion goes some way towards describing the complexity of such health programs. The aims of this project were to: 1) identify the aims and purpose of existing health promotion programs conducted by an alliance of ACCOs in northern Victoria, Australia; and 2) evaluate the extent to which these programs are consistent with an ecological model of health promotion, addressing both individual and environmental determinants of health. The project arose from a long history of collaborative research. Three ACCOs and a university formed the Health Promotion Alliance to evaluate their health promotion programs. Local community members were trained in, and contributed to developing culturally sensitive methods for, data collection. Information on the aims and design of 88 health promotion activities making up 12 different programs across the ACCOs was systematically and prospectively collected. There was a wide range of activities addressing environmental and social determinants of health, as well as physical activity, nutrition and weight loss. The design of the great majority of activities had a minimal Western influence and were designed within a local Aboriginal cultural framework. The most common focus of the activities was social connectedness (76 %). Physical activity was represented in two thirds of the activities, and nutrition, weight loss and culture were each a focus of about half of the activities. A modified coding procedure designed to assess the ecological nature of these programs showed that they recruited from multiple settings; targeted a range of individual, social and environmental determinants; and used numerous and innovative strategies to achieve change. First Peoples' health promotion in the

Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

Science.gov (United States)

Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

2014-08-01

Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

New PAH gene promoter KLF1 and 3'-region C/EBPalpha motifs influence transcription in vitro.

Science.gov (United States)

Klaassen, Kristel; Stankovic, Biljana; Kotur, Nikola; Djordjevic, Maja; Zukic, Branka; Nikcevic, Gordana; Ugrin, Milena; Spasovski, Vesna; Srzentic, Sanja; Pavlovic, Sonja; Stojiljkovic, Maja

2017-02-01

Phenylketonuria (PKU) is a metabolic disease caused by mutations in the phenylalanine hydroxylase (PAH) gene. Although the PAH genotype remains the main determinant of PKU phenotype severity, genotype-phenotype inconsistencies have been reported. In this study, we focused on unanalysed sequences in non-coding PAH gene regions to assess their possible influence on the PKU phenotype. We transiently transfected HepG2 cells with various chloramphenicol acetyl transferase (CAT) reporter constructs which included PAH gene non-coding regions. Selected non-coding regions were indicated by in silico prediction to contain transcription factor binding sites. Furthermore, electrophoretic mobility shift assay (EMSA) and supershift assays were performed to identify which transcriptional factors were engaged in the interaction. We found novel KLF1 motif in the PAH promoter, which decreases CAT activity by 50 % in comparison to basal transcription in vitro. The cytosine at the c.-170 promoter position creates an additional binding site for the protein complex involving KLF1 transcription factor. Moreover, we assessed for the first time the role of a multivariant variable number tandem repeat (VNTR) region located in the 3'-region of the PAH gene. We found that the VNTR3, VNTR7 and VNTR8 constructs had approximately 60 % of CAT activity. The regulation is mediated by the C/EBPalpha transcription factor, present in protein complex binding to VNTR3. Our study highlighted two novel promoter KLF1 and 3'-region C/EBPalpha motifs in the PAH gene which decrease transcription in vitro and, thus, could be considered as PAH expression modifiers. New transcription motifs in non-coding regions will contribute to better understanding of the PKU phenotype complexity and may become important for the optimisation of PKU treatment.

Cytosine deletion at AP2-box region of HSP70 promoter and its ...

Indian Academy of Sciences (India)

Cytosine deletion at AP2-box region of HSP70 promoter and its influence on semen quality traits in crossbred bulls ... Laboratory, ICAR-Central Institute for Research on Cattle, Meerut 250 001, India; School of Atmospheric Stress Management, ICAR-National Institute of Abiotic Stress Management, Baramati 413 115, India ...

“Fear or Love Thy Neighbour”? The EU Framework for Promoting Regional Cooperation in the South Caucasus

Directory of Open Access Journals (Sweden)

Nelli Babayan

2011-12-01

Full Text Available Building on the model of the enlargement policy, the European Union (EU designed the European Neighbourhood Policy and the Eastern Partnership to further promote its norms and principles. One of the goals of its new policies has been to foster regional cooperation among partner countries and their neighbours. This article specifies the EU’s framework for promoting regional cooperation through the aforementioned policies and discusses its potential impact on the example of the South Caucasus republics of Armenia, Azerbaijan, and Georgia. The South Caucasus has not only been an arena of intraregional conflicts, but has also often been troubled by disputes between its neighbours. This article argues that, due to a lack of proactive and consistent engagement, the EU’s framework risks leaving regional conflicts in the current state of stagnation and without advancement in regional cooperation.

Multiple 5' ends of human cytomegalovirus UL57 transcripts identify a complex, cycloheximide-resistant promoter region that activates oriLyt

International Nuclear Information System (INIS)

Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.

2003-01-01

The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation

Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

DEFF Research Database (Denmark)

Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

1994-01-01

To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

Effective Feature Selection for Classification of Promoter Sequences.

Directory of Open Access Journals (Sweden)

Kouser K

Full Text Available Exploring novel computational methods in making sense of biological data has not only been a necessity, but also productive. A part of this trend is the search for more efficient in silico methods/tools for analysis of promoters, which are parts of DNA sequences that are involved in regulation of expression of genes into other functional molecules. Promoter regions vary greatly in their function based on the sequence of nucleotides and the arrangement of protein-binding short-regions called motifs. In fact, the regulatory nature of the promoters seems to be largely driven by the selective presence and/or the arrangement of these motifs. Here, we explore computational classification of promoter sequences based on the pattern of motif distributions, as such classification can pave a new way of functional analysis of promoters and to discover the functionally crucial motifs. We make use of Position Specific Motif Matrix (PSMM features for exploring the possibility of accurately classifying promoter sequences using some of the popular classification techniques. The classification results on the complete feature set are low, perhaps due to the huge number of features. We propose two ways of reducing features. Our test results show improvement in the classification output after the reduction of features. The results also show that decision trees outperform SVM (Support Vector Machine, KNN (K Nearest Neighbor and ensemble classifier LibD3C, particularly with reduced features. The proposed feature selection methods outperform some of the popular feature transformation methods such as PCA and SVD. Also, the methods proposed are as accurate as MRMR (feature selection method but much faster than MRMR. Such methods could be useful to categorize new promoters and explore regulatory mechanisms of gene expressions in complex eukaryotic species.

Resource potential methods using for efficiency of activities in the region increase

Directory of Open Access Journals (Sweden)

M. P. Vasiliev

2016-01-01

Full Text Available The article considers impact methods on the economic results, the effectiveness of the regional economic complex should be based on a high quality of the basic characteristics classification of the region state. Application composition techniques to ensure a comprehensive impact on the achievement of this goal should in synthesized form to union, adopt a target orientation of development of the region with the parameters objectively revealing his condition. Ensuring organizational, economic, financial and investment techniques to achieve the planned targets and requires specifying align resource potential of the region with the available capacity of the regional economic complex to promote economic growth, improve the efficiency of operations. The main characteristics of the potential resource opportunities in the region are the skill level of workers, the degree of depreciation of fixed assets and their renewability, increased innovation in the region, its branches and facilities, strengthening of competitive advantages, the annual average number of employees, the cost of fixed and current assets, financial stability. In the region the opportunity to potentially affect the ability of its structural components to achieve the financial and economic performance targets acts as efficiency ability to provide stable dynamics of regional production efficiency, enhance the level of benefits to achieve the planned efficiency used (consumed resource. Applying of certain methods or their entire structure, created to provide a comprehensive impact on the goal achievement, in the synthesized form of target orientation combines regional development with the parameters most objectively revealing his condition. Achieving the appropriate organizational, economic, financial, investment or other measures to achieve planned targets that are expressed by the level of efficiency of activity in the conditions of the most complete involvement and intensity of use in

The system of Regional Contact Offices for promoting GMES services and the use of Space Technologies in European Regions.

Science.gov (United States)

Carrara, Paola; Antoninetti, Massimo; Bacai, Hina; Basoni, Anna; Bosc, Christelle; Clave, Magali; Cornacchia, Carmela; L'Astorina, Alba; Monbet, Philippe; Mueller, Bastian; Nicolau, Sonia; Pergola, Nicola; Rampini, Anna; Tramutoli, Valerio; Schumacher, Volker; Wells, Alan; Zepeda Juarez, Jesus; Zolotikova, Svetlana

2013-04-01

which have significant impact on the economy, environment and the quality of life of the citizens To this aim since 2011 the system of Regional Contact Offices (RCOs) was promoted by the EU FP7 DORIS_Net (Downsteam Observatory organized by Regions Active in Space - Network, http://www.doris-net.eu/) project as the regional link to the services provided by the European GMES programme. Since then a first nucleus of 12 pilot European Regions were working together establishing 6 first RCOs around Europe. This paper will present RCOs network goals, achievements and perspectives as well as its planned actions devoted to improve quality of Space Technology products from one side, to promote awareness and use of them by potential end-users (and particularly LRAs), from the other side.

Regional Cooperation Efforts in the Mekong River Basin: Mitigating river-related security threats and promoting regional development

Directory of Open Access Journals (Sweden)

Susanne Schmeier

2009-01-01

Full Text Available The development of international rivers is often perceived as leading to conflicts or even water wars. However, as the development of the Mekong River shows, cooperation has not only prevailed in the last decades, but River Basin Organizations (RBOs, established to mitigate river-related conflicts and/or develop the river basin, have also contributed to the emergence of more general cooperation structures, mainly by creating spill-over effects in other issue-areas, bringing cooperation to policy fields beyond the river itself. This article assesses the contribution of the Mekong River Commission (MRC and the Greater Mekong Sub-Region (GMS to the sustainable development of the Mekong Region as well as to the promotion of regional cooperation in mainland South-East Asia in general. --- Die Entwicklung grenzüberschreitender Flüsse wird oft mit Konflikten oder gar Kriegen um Wasser assoziiert. Wie jedoch die Entwicklung im Mekong-Becken zeigt, waren die vergangenen Jahrzehnte nicht nur von Kooperation gezeichnet, sondern Flussbeckenorganisationen konnten außerdem dazu beitragen, weitreichendere Kooperationsstrukturen zu entwickeln, die sich auf andere Politikfelder ausdehnen. Dieser Artikel beschäftigt sich mit dem Beitrag der Mekong River Commission (MRC und der Greater Mekong Sub-Region (GMS zur nachhaltigen Entwicklung in der Mekong Region sowie zur Förderung allgemeiner regionaler Kooperation im Festländischen Südostasien.

Richness of lichen species, especially of threatened ones, is promoted by management methods furthering stand continuity.

Directory of Open Access Journals (Sweden)

Steffen Boch

Full Text Available Lichens are a key component of forest biodiversity. However, a comprehensive study analyzing lichen species richness in relation to several management types, extending over different regions and forest stages and including information on site conditions is missing for temperate European forests. In three German regions (Schwäbische Alb, Hainich-Dün, Schorfheide-Chorin, the so-called Biodiversity Exploratories, we studied lichen species richness in 631 forest plots of 400 m(2 comprising different management types (unmanaged, selection cutting, deciduous and coniferous age-class forests resulting from clear cutting or shelterwood logging, various stand ages, and site conditions, typical for large parts of temperate Europe. We analyzed how lichen species richness responds to management and habitat variables (standing biomass, cover of deadwood, cover of rocks. We found strong regional differences with highest lichen species richness in the Schwäbische Alb, probably driven by regional differences in former air pollution, and in precipitation and habitat variables. Overall, unmanaged forests harbored 22% more threatened lichen species than managed age-class forests. In general, total, corticolous, and threatened lichen species richness did not differ among management types of deciduous forests. However, in the Schwäbische-Alb region, deciduous forests had 61% more lichen species than coniferous forests and they had 279% more threatened and 76% more corticolous lichen species. Old deciduous age classes were richer in corticolous lichen species than young ones, while old coniferous age-classes were poorer than young ones. Overall, our findings highlight the importance of stand continuity for conservation. To increase total and threatened lichen species richness we suggest (1 conserving unmanaged forests, (2 promoting silvicultural methods assuring stand continuity, (3 conserving old trees in managed forests, (4 promoting stands of native deciduous

Richness of Lichen Species, Especially of Threatened Ones, Is Promoted by Management Methods Furthering Stand Continuity

Science.gov (United States)

Boch, Steffen; Prati, Daniel; Hessenmöller, Dominik; Schulze, Ernst-Detlef; Fischer, Markus

2013-01-01

Lichens are a key component of forest biodiversity. However, a comprehensive study analyzing lichen species richness in relation to several management types, extending over different regions and forest stages and including information on site conditions is missing for temperate European forests. In three German regions (Schwäbische Alb, Hainich-Dün, Schorfheide-Chorin), the so-called Biodiversity Exploratories, we studied lichen species richness in 631 forest plots of 400 m2 comprising different management types (unmanaged, selection cutting, deciduous and coniferous age-class forests resulting from clear cutting or shelterwood logging), various stand ages, and site conditions, typical for large parts of temperate Europe. We analyzed how lichen species richness responds to management and habitat variables (standing biomass, cover of deadwood, cover of rocks). We found strong regional differences with highest lichen species richness in the Schwäbische Alb, probably driven by regional differences in former air pollution, and in precipitation and habitat variables. Overall, unmanaged forests harbored 22% more threatened lichen species than managed age-class forests. In general, total, corticolous, and threatened lichen species richness did not differ among management types of deciduous forests. However, in the Schwäbische-Alb region, deciduous forests had 61% more lichen species than coniferous forests and they had 279% more threatened and 76% more corticolous lichen species. Old deciduous age classes were richer in corticolous lichen species than young ones, while old coniferous age-classes were poorer than young ones. Overall, our findings highlight the importance of stand continuity for conservation. To increase total and threatened lichen species richness we suggest (1) conserving unmanaged forests, (2) promoting silvicultural methods assuring stand continuity, (3) conserving old trees in managed forests, (4) promoting stands of native deciduous tree species

Graduate Management Project (GMP) Retrospective Analysis of Promotional Mediums for Tricare Prime in Tricare Region 11

National Research Council Canada - National Science Library

Carpenter, Steven

1997-01-01

This study provides retrospective market research information about the population who enrolled in TRICARE Prime in TRICARE Region 11 and the advertising mediums used to promote enrollment in the TRICARE Prime program...

Evaluation methods for physical activity-promoting mobile technologies: an interdisciplinary scoping review

Directory of Open Access Journals (Sweden)

Claire McCallum

2015-10-01

Full Text Available There are many thousands of mobile apps, wearables and other technologies available to support and promote physical activity. However, the rapidly evolving nature of these technologies means that the methodologies traditionally used to evaluate the effectiveness of behaviour change interventions (such as the randomised controlled trial may not be appropriate to evaluate their effectiveness. A scoping review was conducted to identify the methods currently being used to evaluate physical activity-promoting mobile technologies across health and computing science disciplines. In addition to the range of methods used, the review explored their strengths and weaknesses. The results improve understandings of when and why to use existing methods from health and computing science. Opportunities for combining and hybridising methods across the two disciplines are also identified. The review will be used to inform the development and piloting of novel, ‘fit-for-purpose’ research designs that will allow rigorous evaluation of the effectiveness of rapidly-evolving physical activity-promoting mobile technologies and their ‘active ingredients’ to build an evidence base of what works, why and for whom.

Discovery and Evaluation of Polymorphisms in the and Promoter Regions for Risk of Korean Lung Cancer

Directory of Open Access Journals (Sweden)

Jae Sook Sung

2012-09-01

Full Text Available AKT is a signal transduction protein that plays a central role in the tumorigenesis. There are 3 mammalian isoforms of this serine/threonine protein kinase-AKT1, AKT2, and AKT3-showing a broad tissue distribution. We first discovered 2 novel polymorphisms (AKT2 -9826 C/G and AKT3 -811 A/G, and we confirmed 6 known polymorphisms (AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, AKT3 -675 A/-, and AKT3 -244 C/T of the AKT2 and AKT3 promoter region in 24 blood samples of Korean lung cancer patients using direct sequencing. To evaluate the role of AKT2 and AKT3 polymorphisms in the risk of Korean lung cancer, genotypes of the AKT2 and AKT3 polymorphisms (AKT2 -9826 C/G, AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, and AKT3 -675 A/- were determined in 360 lung cancer patients and 360 normal controls. Statistical analyses revealed that the genotypes and haplotypes in the AKT2 and AKT3 promoter regions were not significantly associated with the risk of lung cancer in the Korean population. These results suggest that polymorphisms of the AKT2 and AKT3 promoter regions do not contribute to the genetic susceptibility to lung cancer in the Korean population.

Regional Differences in Correlates of Daily Walking among Middle Age and Older Australian Rural Adults: Implications for Health Promotion

Directory of Open Access Journals (Sweden)

James Dollman

2016-01-01

Full Text Available Rural Australians are less physically active than their metropolitan counterparts, and yet very little is known of the candidate intervention targets for promoting physical activity in rural populations. As rural regions are economically, socially and environmentally diverse, drivers of regular physical activity are likely to vary between regions. This study explored the region-specific correlates of daily walking among middle age and older adults in rural regions with contrasting dominant primary industries. Participants were recruited through print and electronic media, primary care settings and community organisations. Pedometers were worn by 153 adults for at least four days, including a weekend day. A questionnaire identified potential intra-personal, social and environmental correlates of physical activity, according to a social ecological framework. Regression modelling identified independent correlates of daily walking separately in the two study regions. In one region, there were independent correlates of walking from all levels of the social ecological framework. In the other region, significant correlates of daily walking were almost all demographic (age, education and marital status. Participants living alone were less likely to be physically active regardless of region. This study highlights the importance of considering region-specific factors when designing strategies for promoting regular walking among rural adults.

A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3' untranslated region and intronic cis-elements.

Science.gov (United States)

Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A

2009-11-01

Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var

Genetic recombination is targeted towards gene promoter regions in dogs.

Science.gov (United States)

Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R

2013-01-01

The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.

Prognostic value of three different methods of MGMT promoter methylation analysis in a prospective trial on newly diagnosed glioblastoma.

Directory of Open Access Journals (Sweden)

Arne Christians

Full Text Available Hypermethylation in the promoter region of the MGMT gene encoding the DNA repair protein O(6-methylguanine-DNA methyltransferase is among the most important prognostic factors for patients with glioblastoma and predicts response to treatment with alkylating agents like temozolomide. Hence, the MGMT status is widely determined in most clinical trials and frequently requested in routine diagnostics of glioblastoma. Since various different techniques are available for MGMT promoter methylation analysis, a generally accepted consensus as to the most suitable diagnostic method remains an unmet need. Here, we assessed methylation-specific polymerase chain reaction (MSP as a qualitative and semi-quantitative method, pyrosequencing (PSQ as a quantitative method, and methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA as a semi-quantitative method in a series of 35 formalin-fixed, paraffin-embedded glioblastoma tissues derived from patients treated in a prospective clinical phase II trial that tested up-front chemoradiotherapy with dose-intensified temozolomide (UKT-05. Our goal was to determine which of these three diagnostic methods provides the most accurate prediction of progression-free survival (PFS. The MGMT promoter methylation status was assessable by each method in almost all cases (n = 33/35 for MSP; n = 35/35 for PSQ; n = 34/35 for MS-MLPA. We were able to calculate significant cut-points for the continuous methylation signals at each CpG site analysed by PSQ (range, 11.5 to 44.9% and at one CpG site assessed by MS-MLPA (3.6% indicating that a dichotomisation of continuous methylation data as a prerequisite for comparative survival analyses is feasible. Our results show that, unlike MS-MLPA, MSP and PSQ provide a significant improvement of predicting PFS compared with established clinical prognostic factors alone (likelihood ratio tests: p<0.001. Conclusively, taking into consideration prognostic value

Promoter Boundaries for the luxCDABE and betIBA-proXWV Operons in Vibrio harveyi Defined by the Method Rapid Arbitrary PCR Insertion Libraries (RAIL).

Science.gov (United States)

Hustmyer, Christine M; Simpson, Chelsea A; Olney, Stephen G; Rusch, Douglas B; Bochman, Matthew L; van Kessel, Julia C

2018-06-01

Experimental studies of transcriptional regulation in bacteria require the ability to precisely measure changes in gene expression, often accomplished through the use of reporter genes. However, the boundaries of promoter sequences required for transcription are often unknown, thus complicating the construction of reporters and genetic analysis of transcriptional regulation. Here, we analyze reporter libraries to define the promoter boundaries of the luxCDABE bioluminescence operon and the betIBA-proXWV osmotic stress operon in Vibrio harveyi We describe a new method called r apid a rbitrary PCR i nsertion l ibraries (RAIL) that combines the power of arbitrary PCR and isothermal DNA assembly to rapidly clone promoter fragments of various lengths upstream of reporter genes to generate large libraries. To demonstrate the versatility and efficiency of RAIL, we analyzed the promoters driving expression of the luxCDABE and betIBA-proXWV operons and created libraries of DNA fragments from these loci fused to fluorescent reporters. Using flow cytometry sorting and deep sequencing, we identified the DNA regions necessary and sufficient for maximum gene expression for each promoter. These analyses uncovered previously unknown regulatory sequences and validated known transcription factor binding sites. We applied this high-throughput method to gfp , mCherry , and lacZ reporters and multiple promoters in V. harveyi We anticipate that the RAIL method will be easily applicable to other model systems for genetic, molecular, and cell biological applications. IMPORTANCE Gene reporter constructs have long been essential tools for studying gene regulation in bacteria, particularly following the recent advent of fluorescent gene reporters. We developed a new method that enables efficient construction of promoter fusions to reporter genes to study gene regulation. We demonstrate the versatility of this technique in the model bacterium Vibrio harveyi by constructing promoter libraries

Synthetic promoter libraries for Corynebacterium glutamicum

DEFF Research Database (Denmark)

Rytter, Jakob Vang; Helmark, Søren; Chen, Jun

2014-01-01

The ability to modulate gene expression is an important genetic tool in systems biology and biotechnology. Here, we demonstrate that a previously published easy and fast PCR-based method for modulating gene expression in lactic acid bacteria is also applicable to Corynebacterium glutamicum. We co...... promoter library (SPL) technology is convenient for modulating gene expression in C. glutamicum and should have many future applications, within basic research as well as for optimizing industrial production organisms....... constructed constitutive promoter libraries based on various combinations of a previously reported C. glutamicum -10 consensus sequence (gngnTA(c/t)aaTgg) and the Escherichia coli -35 consensus, either with or without an AT-rich region upstream. A promoter library based on consensus sequences frequently found...... in low-GC Gram-positive microorganisms was also included. The strongest promoters were found in the library with a -35 region and a C. glutamicum -10 consensus, and this library also represents the largest activity span. Using the alternative -10 consensus TATAAT, which can be found in many other...

Intrinsically bent DNA in replication origins and gene promoters.

Science.gov (United States)

Gimenes, F; Takeda, K I; Fiorini, A; Gouveia, F S; Fernandez, M A

2008-06-24

Intrinsically bent DNA is an alternative conformation of the DNA molecule caused by the presence of dA/dT tracts, 2 to 6 bp long, in a helical turn phase DNA or with multiple intervals of 10 to 11 bp. Other than flexibility, intrinsic bending sites induce DNA curvature in particular chromosome regions such as replication origins and promoters. Intrinsically bent DNA sites are important in initiating DNA replication, and are sometimes found near to regions associated with the nuclear matrix. Many methods have been developed to localize bent sites, for example, circular permutation, computational analysis, and atomic force microscopy. This review discusses intrinsically bent DNA sites associated with replication origins and gene promoter regions in prokaryote and eukaryote cells. We also describe methods for identifying bent DNA sites for circular permutation and computational analysis.

Exploring DNA methylation changes in promoter, intragenic, and intergenic regions as early and late events in breast cancer formation

International Nuclear Information System (INIS)

Rauscher, Garth H.; Kresovich, Jacob K.; Poulin, Matthew; Yan, Liying; Macias, Virgilia; Mahmoud, Abeer M.; Al-Alem, Umaima; Kajdacsy-Balla, Andre; Wiley, Elizabeth L.; Tonetti, Debra; Ehrlich, Melanie

2015-01-01

Breast cancer formation is associated with frequent changes in DNA methylation but the extent of very early alterations in DNA methylation and the biological significance of cancer-associated epigenetic changes need further elucidation. Pyrosequencing was done on bisulfite-treated DNA from formalin-fixed, paraffin-embedded sections containing invasive tumor and paired samples of histologically normal tissue adjacent to the cancers as well as control reduction mammoplasty samples from unaffected women. The DNA regions studied were promoters (BRCA1, CD44, ESR1, GSTM2, GSTP1, MAGEA1, MSI1, NFE2L3, RASSF1A, RUNX3, SIX3 and TFF1), far-upstream regions (EN1, PAX3, PITX2, and SGK1), introns (APC, EGFR, LHX2, RFX1 and SOX9) and the LINE-1 and satellite 2 DNA repeats. These choices were based upon previous literature or publicly available DNA methylome profiles. The percent methylation was averaged across neighboring CpG sites. Most of the assayed gene regions displayed hypermethylation in cancer vs. adjacent tissue but the TFF1 and MAGEA1 regions were significantly hypomethylated (p ≤0.001). Importantly, six of the 16 regions examined in a large collection of patients (105 – 129) and in 15-18 reduction mammoplasty samples were already aberrantly methylated in adjacent, histologically normal tissue vs. non-cancerous mammoplasty samples (p ≤0.01). In addition, examination of transcriptome and DNA methylation databases indicated that methylation at three non-promoter regions (far-upstream EN1 and PITX2 and intronic LHX2) was associated with higher gene expression, unlike the inverse associations between cancer DNA hypermethylation and cancer-altered gene expression usually reported. These three non-promoter regions also exhibited normal tissue-specific hypermethylation positively associated with differentiation-related gene expression (in muscle progenitor cells vs. many other types of normal cells). The importance of considering the exact DNA region analyzed and the

Promoting survival: A grounded theory study of consequences of modern health practices in Ouramanat region of Iranian Kurdistan.

Science.gov (United States)

Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul

2010-05-14

The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society.

Promoting survival: A grounded theory study of consequences of modern health practices in Ouramanat region of Iranian Kurdistan

Science.gov (United States)

Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul

2010-01-01

The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society. PMID:20640020

A novel method to quantify local CpG methylation density by regional methylation elongation assay on microarray

Directory of Open Access Journals (Sweden)

Qiao Yingjuan

2008-01-01

Full Text Available Abstract Background DNA methylation based techniques are important tools in both clinical diagnostics and therapeutics. But most of these methods only analyze a few CpG sites in a target region. Indeed, difference of site-specific methylation may also lead to a change of methylation density in many cases, and it has been found that the density of methylation is more important than methylation of single CpG site for gene silencing. Results We have developed a novel approach for quantitative analysis of CpG methylation density on the basis of microarray-based hybridization and incorporation of Cy5-dCTP into the Cy3 labeled target DNA by using Taq DNA Polymerase on microarray. The quantification is achieved by measuring Cy5/Cy3 signal ratio which is proportional to methylation density. This methylation-sensitive technique, termed RMEAM (regional methylation elongation assay on microarray, provides several advantages over existing methods used for methylation analysis. It can determine an exact methylation density of the given region, and has potential of high throughput. We demonstrate a use of this method in determining the methylation density of the promoter region of the tumor-related gene MLH1, TERT and MGMT in colorectal carcinoma patients. Conclusion This technique allows for quantitative analysis of regional methylation density, which is the representative of all allelic methylation patterns in the sample. The results show that this technique has the characteristics of simplicity, rapidness, specificity and high-throughput.

Allelic polymorphisms in the repeat and promoter regions of the interleukin-4 gene and malaria severity in Ghanaian children

DEFF Research Database (Denmark)

Gyan, B A; Goka, B; Cvetkovic, J T

2004-01-01

Immunoglobulin E has been associated with severe malaria suggesting a regulatory role for interleukin (IL)-4 and/or IgE in the pathogenesis of severe malaria. We have investigated possible associations between polymorphisms in the IL-4 repeat region (intron 3) and promoter regions (IL-4 +33CT and...

Human body region enhancement method based on Kinect infrared imaging

Science.gov (United States)

Yang, Lei; Fan, Yubo; Song, Xiaowei; Cai, Wenjing

2016-10-01

To effectively improve the low contrast of human body region in the infrared images, a combing method of several enhancement methods is utilized to enhance the human body region. Firstly, for the infrared images acquired by Kinect, in order to improve the overall contrast of the infrared images, an Optimal Contrast-Tone Mapping (OCTM) method with multi-iterations is applied to balance the contrast of low-luminosity infrared images. Secondly, to enhance the human body region better, a Level Set algorithm is employed to improve the contour edges of human body region. Finally, to further improve the human body region in infrared images, Laplacian Pyramid decomposition is adopted to enhance the contour-improved human body region. Meanwhile, the background area without human body region is processed by bilateral filtering to improve the overall effect. With theoretical analysis and experimental verification, the results show that the proposed method could effectively enhance the human body region of such infrared images.

On evaluating the robustness of spatial-proximity-based regionalization methods

Science.gov (United States)

Lebecherel, Laure; Andréassian, Vazken; Perrin, Charles

2016-08-01

In absence of streamflow data to calibrate a hydrological model, its parameters are to be inferred by a regionalization method. In this technical note, we discuss a specific class of regionalization methods, those based on spatial proximity, which transfers hydrological information (typically calibrated parameter sets) from neighbor gauged stations to the target ungauged station. The efficiency of any spatial-proximity-based regionalization method will depend on the density of the available streamgauging network, and the purpose of this note is to discuss how to assess the robustness of the regionalization method (i.e., its resilience to an increasingly sparse hydrometric network). We compare two options: (i) the random hydrometrical reduction (HRand) method, which consists in sub-sampling the existing gauging network around the target ungauged station, and (ii) the hydrometrical desert method (HDes), which consists in ignoring the closest gauged stations. Our tests suggest that the HDes method should be preferred, because it provides a more realistic view on regionalization performance.

A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3’ untranslated region and intronic cis-elements

Science.gov (United States)

Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.

2009-01-01

Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of

Novel method to achieve price-optimized, fully nutritious, health-promoting and acceptable national food baskets

DEFF Research Database (Denmark)

Parlesak, Alexandr; Robertson, Aileen

2015-01-01

available foods. The study was designed to obtain healthy, affordable, and socially acceptable diets for three European countries (Denmark, Slovenia, and Romania) and in three regions within Canada, Argentina, and Switzerland. Moreover, the costs for the “limiting” micronutrients and relative price......Purpose: The purpose of this study was to generate a framework for the development of health-promoting, fully nutritious, socially acceptable, and affordable national food baskets to be used as an advocacy tool by governments. In addition to containing all (micro-)nutrient requirements, food...... baskets should also reflect dietary guidelines to prevent non-communicable diseases and be optimized to achieve the highest possible social acceptance. So far, integrative approaches that include all these aspects are lacking. Methods: Food composition, local availability, food prices, national...

Boundary Dpp promotes growth of medial and lateral regions of the Drosophila wing.

Science.gov (United States)

Barrio, Lara; Milán, Marco

2017-07-04

The gradient of Decapentaplegic (Dpp) in the Drosophila wing has served as a paradigm to characterize the role of morphogens in regulating patterning. However, the role of this gradient in regulating tissue size is a topic of intense debate as proliferative growth is homogenous. Here, we combined the Gal4/UAS system and a temperature-sensitive Gal80 molecule to induce RNAi-mediated depletion of dpp and characterise the spatial and temporal requirement of Dpp in promoting growth. We show that Dpp emanating from the AP compartment boundary is required throughout development to promote growth by regulating cell proliferation and tissue size. Dpp regulates growth and proliferation rates equally in central and lateral regions of the developing wing appendage and reduced levels of Dpp affects similarly the width and length of the resulting wing. We also present evidence supporting the proposal that graded activity of Dpp is not an absolute requirement for wing growth.

Genetic polymorphisms within tumor necrosis factor gene promoter region: a role for susceptibility to ventilator-associated pneumonia.

Science.gov (United States)

Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J

2012-08-01

Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.

On evaluating the robustness of spatial-proximity-based regionalization methods.

OpenAIRE

Lebecherel , L.; Andréassian , V.; Perrin , C.

2016-01-01

International audience; In absence of streamflow data to calibrate a hydrological model, its parameters are to be inferred by a regionalization method. In this technical note, we discuss a specific class of regionalization methods, those based on spatial proximity, which transfers hydrological information (typically calibrated parameter sets) from neighbor gauged stations to the target ungauged station. The efficiency of any spatialproximity-based regionalization method will depend on the den...

On evaluating the robustness of spatial-proximity-based regionalization methods.

OpenAIRE

Lebecherel, L.; Andréassian, V.; Perrin, C.

2016-01-01

In absence of streamflow data to calibrate a hydrological model, its parameters are to be inferred by a regionalization method. In this technical note, we discuss a specific class of regionalization methods, those based on spatial proximity, which transfers hydrological information (typically calibrated parameter sets) from neighbor gauged stations to the target ungauged station. The efficiency of any spatialproximity-based regionalization method will depend on the density of the available st...

Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III

Directory of Open Access Journals (Sweden)

Matsutani Sachiko

2004-08-01

Full Text Available Abstract Background In eukaryotes, RNA polymerase III (RNAP III transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs. The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Results Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Conclusion Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and α-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants

Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III.

Science.gov (United States)

Matsutani, Sachiko

2004-08-09

In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.

Nuclear proteins interacting with the promoter region of the human granulocyte/macrophage colony-stimulating factor gene

International Nuclear Information System (INIS)

Shannon, M.F.; Gamble, J.R.; Vadas, M.A.

1988-01-01

The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription

US-India Technical Collaboration to Promote Regional Stability

International Nuclear Information System (INIS)

Killinger, Mark H.; Griggs, James R.; Apt, Kenneth E.; Doyle, James E.

2001-01-01

Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, DOE has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US agencies and the Indian government and scientific communities to identify appropriate non-sensitive areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national/international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes research done on the Indian scientific organization and infrastructure, potential areas for collaboration, the approach for this engagement, and current status of the initiative.

US-INDIA TECHNICAL COLLABORATION TO PROMOTE REGIONAL STABILITY

International Nuclear Information System (INIS)

Killinger, M.H.; Griggs, J.R.; Apt, Kenneth E.; Doyle, J.E.

2001-01-01

Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, the US Department of Energy (DOE) has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US government agencies to identify appropriate non-sensitive, non-nuclear areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national and international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes the approach for this engagement, the Indian scientific organization and infrastructure, potential areas for collaboration, and current status of the initiative.

A Participatory Regional Partnership Approach to Promote Nutrition and Physical Activity Through Environmental and Policy Change in Rural Missouri.

Science.gov (United States)

Barnidge, Ellen K; Baker, Elizabeth A; Estlund, Amy; Motton, Freda; Hipp, Pamela R; Brownson, Ross C

2015-06-11

Rural residents are less likely than urban and suburban residents to meet recommendations for nutrition and physical activity. Interventions at the environmental and policy level create environments that support healthy eating and physical activity. Healthier Missouri Communities (Healthier MO) is a community-based research project conducted by the Prevention Research Center in St. Louis with community partners from 12 counties in rural southeast Missouri. We created a regional partnership to leverage resources and enhance environmental and policy interventions to improve nutrition and physical activity in rural southeast Missouri. Partners were engaged in a participatory action planning process that included prioritizing, implementing, and evaluating promising evidence-based interventions to promote nutrition and physical activity. Group interviews were conducted with Healthier MO community partners post intervention to evaluate resource sharing and sustainability efforts of the regional partnership. Community partners identified the benefits and challenges of resource sharing within the regional partnership as well as the opportunities and threats to long-term partnership sustainability. The partners noted that the regional participatory process was difficult, but the benefits outweighed the challenges. Regional rural partnerships may be an effective way to leverage relationships to increase the capacity of rural communities to implement environmental and policy interventions to promote nutrition and physical activity.

No evidence for promoter region methylation of the succinate dehydrogenase and fumarate hydratase tumour suppressor genes in breast cancer

Directory of Open Access Journals (Sweden)

Dobrovic Alexander

2009-09-01

Full Text Available Abstract Background Succinate dehydrogenase (SDH and fumarate hydratase (FH are tricarboxylic acid (TCA cycle enzymes that are also known to act as tumour suppressor genes. Increased succinate or fumarate levels as a consequence of SDH and FH deficiency inhibit hypoxia inducible factor-1α (HIF-1α prolyl hydroxylases leading to sustained HIF-1α expression in tumours. Since HIF-1α is frequently expressed in breast carcinomas, DNA methylation at the promoter regions of the SDHA, SDHB, SDHC and SDHD and FH genes was evaluated as a possible mechanism in silencing of SDH and FH expression in breast carcinomas. Findings No DNA methylation was identified in the promoter regions of the SDHA, SDHB, SDHC, SDHD and FH genes in 72 breast carcinomas and 10 breast cancer cell lines using methylation-sensitive high resolution melting which detects both homogeneous and heterogeneous methylation. Conclusion These results show that inactivation via DNA methylation of the promoter CpG islands of SDH and FH is unlikely to play a major role in sporadic breast carcinomas.

Innovative method of RES integration into the regional energy development scenarios

International Nuclear Information System (INIS)

Klevas, Valentinas; Biekša, Kestutis; Murauskaitė, Lina

2014-01-01

Scarcity or abundance of energy resources usually depends on physical and geographical conditions in the region. However, the energy flow in the region also depends on the efficient use of energy resources, the consumption rate of energy and the possibility to use local renewable and non-renewable energy resources. Production, distribution and the use of energy resources in the region are the challenges for central and local government, business and social service, customers and other stakeholders. Development of regional energy economy should be optimized according to the available energy flow in the region using a network system analysis method, which provides solutions for developing sustainable energy economy models. The network system analysis method enables to optimize the use of local and renewable resources at the regional level and reveals available local energy resources. An efficient use of available regional resources and the use of renewable energy sources (RES) should be the main goals for the development of regional energy system. RES can compete with traditional fossil fuel with the condition that all hidden aspects are revealed. The network system analysis method enables to indicate energy flows in the region as well as indicate pros and cons of using renewable energy technologies. - Highlights: • RES integration into the regional energy development scenarios is done. • Innovative process network system (PNS) analysis method is used. • PNS method is used to optimize the use of local and renewable resources. • Analysis of energy flow in region using PNS method is done

Quantifying Surface Coal-Mining Patterns to Promote Regional Sustainability in Ordos, Inner Mongolia

Directory of Open Access Journals (Sweden)

Xiaoji Zeng

2018-04-01

Full Text Available Ordos became the new “coal capital” of China within a few decades since the country’s economic reform in 1978, as large-scale surface coal mining dramatically propelled its per capita GDP from being one of the lowest to one of the highest in China, exceeding Hong Kong in 2009. Surface coal-mining areas (SCMAs have continued to expand in this region during recent decades, resulting in serious environmental and socioeconomic consequences. To understand these impacts and promote regional sustainability, quantifying the spatiotemporal patterns of SCMAs is urgently needed. Thus, the main objectives of this study were to quantify the spatiotemporal patterns of SCMAs in the Ordos region from 1990 to 2015, and to examine some of the major environmental and socioeconomic impacts in the study region. We extracted the SCMAs using remote-sensing data, and then quantified their spatiotemporal patterns using landscape metrics. The loss of natural habitat and several socioeconomic indicators were examined in relation to surface coal mining. Our results show that the area of SCMAs increased from 7.12 km2 to 355.95 km2, an increase of nearly 49 times from 1990 to 2015 in the Ordos region. The number of SCMAs in this region increased from 82 to 651, a nearly seven-fold increase. In particular, Zhungeer banner (an administrative division, Yijinhuoluo banner, Dongsheng District and Dalate banner in the north-eastern part of the Ordos region had higher growth rates of SCMAs. The income gap between urban and rural residents increased along with the growth in SCMAs, undermining social equity in the Ordos region. Moreover, the rapid increase in SCMAs resulted in natural habitat loss (including grasslands, forests, and deserts across this region. Thus, we suggest that regional sustainability in Ordos needs to emphasize effective measures to curb large-scale surface coal mining in order to reduce the urban–rural income gap, and to restore degraded natural

Does health promotion need a Code of Ethics? Results from an IUHPE mixed method survey.

Science.gov (United States)

Bull, Torill; Riggs, Elisha; Nchogu, Sussy N

2012-09-01

Health promotion is an ethically challenging field involving constant reflection of values across multiple cultures of what is regarded as good and bad health promotion practice. While many disciplines are guided by a Code of Ethics (CoE) no such guide is available to health promoters. The International Union for Health Promotion and Education (IUHPE) has been nominated as a suitable candidate for developing such a code. It is within this context that the IUHPE Student and Early Career Network (ISECN), through its Ethics Working Group, has taken up the challenge of preparing the foundations for a CoE for health promotion. An online survey comprising open and closed-answer questions was used to gather the opinions of IUHPE members regarding the need for a CoE for health promotion. The quantitative data were calculated with descriptive analyses. A thematic analysis approach was used to analyze and interpret the qualitative data. IUHPE members (n = 236) from all global regions responded to the survey. The majority (52%) of the respondents had 11 years' experience or more in the field of health promotion. Ethical dilemmas were commonly encountered. The need for a CoE for health promotion was expressed by 83% of respondents. Respondents also offered their views of possibilities, ideas and challenges regarding the development of a CoE for health promotion. Considering that health promoters encounter ethical dilemmas frequently in their practice, this study reinforces the need to develop a CoE for the field. The recommendations from the survey provide a good basis for future work to develop such a code.

Press Advertising – Varieties and Sub-Varieties. Methods of Promoting the Press

OpenAIRE

Mikosz, Joanna

2016-01-01

In the text entitled “Press advertising – varieties and sub-varieties. Methods of promoting the press”, the author discusses press advertising, which is a fast developing mass-media phenomenon. Modernity has granted press advertising a high quality of print and paper, as well as Infinite possibilities of combining various promotional forms with the press. The author argues that press advertising is one of the best ways in which a company can communicate with the market. Its advantage is, abov...

Genome-wide analysis of promoter architecture in Drosophila melanogaster

Energy Technology Data Exchange (ETDEWEB)

Hoskins, Roger A.; Landolin, Jane M.; Brown, James B.; Sandler, Jeremy E.; Takahashi, Hazuki; Lassmann, Timo; Yu, Charles; Booth, Benjamin W.; Zhang, Dayu; Wan, Kenneth H.; Yang, Li; Boley, Nathan; Andrews, Justen; Kaufman, Thomas C.; Graveley, Brenton R.; Bickel, Peter J.; Carninci, Piero; Carlson, Joseph W.; Celniker, Susan E.

2010-10-20

Core promoters are critical regions for gene regulation in higher eukaryotes. However, the boundaries of promoter regions, the relative rates of initiation at the transcription start sites (TSSs) distributed within them, and the functional significance of promoter architecture remain poorly understood. We produced a high-resolution map of promoters active in the Drosophila melanogaster embryo by integrating data from three independent and complementary methods: 21 million cap analysis of gene expression (CAGE) tags, 1.2 million RNA ligase mediated rapid amplification of cDNA ends (RLMRACE) reads, and 50,000 cap-trapped expressed sequence tags (ESTs). We defined 12,454 promoters of 8037 genes. Our analysis indicates that, due to non-promoter-associated RNA background signal, previous studies have likely overestimated the number of promoter-associated CAGE clusters by fivefold. We show that TSS distributions form a complex continuum of shapes, and that promoters active in the embryo and adult have highly similar shapes in 95% of cases. This suggests that these distributions are generally determined by static elements such as local DNA sequence and are not modulated by dynamic signals such as histone modifications. Transcription factor binding motifs are differentially enriched as a function of promoter shape, and peaked promoter shape is correlated with both temporal and spatial regulation of gene expression. Our results contribute to the emerging view that core promoters are functionally diverse and control patterning of gene expression in Drosophila and mammals.

The regional approach and regional studies method in the process of geography teaching

Science.gov (United States)

Dermendzhieva, Stela; Doikov, Martin

2017-03-01

We define the regional approach as a manner of relations among the global trends of development of the "Society-man-nature" system and the local differentiating level of knowledge. Conditionally, interactions interlace under the influence of the character of Geography as a science, education, approaches, goals and teaching methods. Global, national and local development differentiates in three concentric circles at the level of knowledge. It is determined as a conception of modern, complex and effective mechanism for young people, through which knowledge develops in regional historical and cultural perspective; self-consciousness for socio-economic and cultural integration is formed as a part of the. historical-geographical image of the native land. This way an attitude to the. native land is formed as a connecting construct between patriotism to the motherland and the same in global aspect. The possibility for integration and cooperation of the educative geographical content with all the local historical-geographical, regional, profession orientating, artistic, municipal and district institutions, is outlined. Contemporary geographical education appears to be a powerful and indispensable mechanism for organization of human sciences, while the regional approach and the application of the regional studies method stimulate and motivate the development and realization of optimal capacities for direct connection with the local structures and environments.

Assessing Health Promotion Interventions: Limitations of Traditional Research Methods in Community-Based Studies.

Science.gov (United States)

Dressel, Anne; Schneider, Robert; DeNomie, Melissa; Kusch, Jennifer; Welch, Whitney; Sosa, Mirtha; Yeldell, Sally; Maida, Tatiana; Wineberg, Jessica; Holt, Keith; Bernstein, Rebecca

2017-09-01

Most low-income Americans fail to meet physical activity recommendations. Inactivity and poor diet contribute to obesity, a risk factor for multiple chronic diseases. Health promotion activities have the potential to improve health outcomes for low-income populations. Measuring the effectiveness of these activities, however, can be challenging in community settings. A "Biking for Health" study tested the impact of a bicycling intervention on overweight or obese low-income Latino and African American adults to reduce barriers to cycling and increase physical activity and fitness. A randomized controlled trial was conducted in Milwaukee, Wisconsin, in summer 2015. A 12-week bicycling intervention was implemented at two sites with low-income, overweight, or obese Latino and African American adults. We found that randomized controlled trial methodology was suboptimal for use in this small pilot study and that it negatively affected participation. More discussion is needed about the effectiveness of using traditional research methods in community settings to assess the effectiveness of health promotion interventions. Modifications or alternative methods may yield better results. The aim of this article is to discuss the effectiveness and feasibility of using traditional research methods to assess health promotion interventions in community-based settings.

Seismic data two-step recovery approach combining sparsity-promoting and hyperbolic Radon transform methods

International Nuclear Information System (INIS)

Wang, Hanchuang; Chen, Shengchang; Ren, Haoran; Liang, Donghui; Zhou, Huamin; She, Deping

2015-01-01

In current research of seismic data recovery problems, the sparsity-promoting method usually produces an insufficient recovery result at the locations of null traces. The HRT (hyperbolic Radon transform) method can be applied to problems of seismic data recovery with approximately hyperbolic events. Influenced by deviations of hyperbolic characteristics between real and ideal travel-time curves, some spurious events are usually introduced and the recovery effect of intermediate and far-offset traces is worse than that of near-offset traces. Sparsity-promoting recovery is primarily dependent on the sparsity of seismic data in the sparse transform domain (i.e. on the local waveform characteristics), whereas HRT recovery is severely affected by the global characteristics of the seismic events. Inspired by the above conclusion, a two-step recovery approach combining sparsity-promoting and time-invariant HRT methods is proposed, which is based on both local and global characteristics of the seismic data. Two implementation strategies are presented in detail, and the selection criteria of the relevant strategies is also discussed. Numerical examples of synthetic and real data verify that the new approach can achieve a better recovery effect by simultaneously overcoming the shortcomings of sparsity-promoting recovery and HRT recovery. (paper)

Analysis of the Impact of the Flow of Migrant Workers on Regional Economy: Based on the Thought about the Promotion of Jiangxi Regional Economic Competitiveness

Directory of Open Access Journals (Sweden)

Sun Yuping

2016-03-01

Full Text Available Labor resource is the necessary productive factor in regional economic development, and one of important indexes to evaluate regional economic competitiveness. The great economic achievement brought by the 30-year reform and opening up of China is due to the fact that China brought the backward advantage of “demographic dividend” into play, promoted the fast development of industrialization and urbanization, and became the second largest economy in the world. The entity of “demographic dividend” is the non-agricultural migrant population, i.e., migrant workers. The transfer employment of migrant workers has typical regional liquidity, and the imbalance of regional economy causes the flow of many migrant workers. In order to achieve harmonious development and coordinated development, underdeveloped areas must understand the character and regulation, adopt positive industrial policy and supportive policy, guide the reasonable flow of migrant workers, and realize the transfer of local employment and citizenization of migrant workers, which can enhance regional economic competitiveness

Regionalization of Drought across South Korea Using Multivariate Methods

Directory of Open Access Journals (Sweden)

Muhammad Azam

2017-12-01

Full Text Available Topographic and hydro-climatic features of South Korea are highly heterogeneous and able to influence the drought phenomena in the region. The complex topographical and hydro-climatic features of South Korea need a statistically accurate method to find homogeneous regions. Regionalization of drought in a bivariate framework has scarcely been applied in South Korea before. Hierarchical Classification on Principal Components (HCPC algorithm together with Principal Component Analysis (PCA method and cluster validation indices were investigated and used for the regionalization of drought across the South Korean region. Statistical homogeneity and discordancy of the region was tested on univariate and bivariate frameworks. HCPC indicate that South Korea should be divided into four regions which are closer to being homogeneous. Univariate and bivariate homogeneity and discordancy tests showed the significant difference in their results due to the inability of univariate homogeneity and discordancy measures to consider the joint behavior of duration and severity. Regionalization of drought for SPI time scale of 1, 3, 6, 12, and 24 months showed significant variation in discordancy and homogeneity of the region with the change in SPI time scale. The results of this study can be used as basic data required to establish a drought mitigation plan on regional scales.

IN-MACA-MCC: Integrated Multiple Attractor Cellular Automata with Modified Clonal Classifier for Human Protein Coding and Promoter Prediction

Directory of Open Access Journals (Sweden)

Kiran Sree Pokkuluri

2014-01-01

Full Text Available Protein coding and promoter region predictions are very important challenges of bioinformatics (Attwood and Teresa, 2000. The identification of these regions plays a crucial role in understanding the genes. Many novel computational and mathematical methods are introduced as well as existing methods that are getting refined for predicting both of the regions separately; still there is a scope for improvement. We propose a classifier that is built with MACA (multiple attractor cellular automata and MCC (modified clonal classifier to predict both regions with a single classifier. The proposed classifier is trained and tested with Fickett and Tung (1992 datasets for protein coding region prediction for DNA sequences of lengths 54, 108, and 162. This classifier is trained and tested with MMCRI datasets for protein coding region prediction for DNA sequences of lengths 252 and 354. The proposed classifier is trained and tested with promoter sequences from DBTSS (Yamashita et al., 2006 dataset and nonpromoters from EID (Saxonov et al., 2000 and UTRdb (Pesole et al., 2002 datasets. The proposed model can predict both regions with an average accuracy of 90.5% for promoter and 89.6% for protein coding region predictions. The specificity and sensitivity values of promoter and protein coding region predictions are 0.89 and 0.92, respectively.

Construction Method of Display Proposal for Commodities in Sales Promotion by Genetic Algorithm

Science.gov (United States)

Yumoto, Masaki

In a sales promotion task, wholesaler prepares and presents the display proposal for commodities in order to negotiate with retailer's buyers what commodities they should sell. For automating the sales promotion tasks, the proposal has to be constructed according to the target retailer's buyer. However, it is difficult to construct the proposal suitable for the target retail store because of too much combination of commodities. This paper proposes a construction method by Genetic algorithm (GA). The proposed method represents initial display proposals for commodities with genes, improve ones with the evaluation value by GA, and rearrange one with the highest evaluation value according to the classification of commodity. Through practical experiment, we can confirm that display proposal by the proposed method is similar with the one constructed by a wholesaler.

The role of COMESA in promoting intra-regional agricultural trade: Case study of Sudan

Directory of Open Access Journals (Sweden)

Azharia Abdelbagi Elbushra

2011-06-01

Full Text Available African countries have created many regional trade agreements with the economic objectives of reducing trade barriers and encouraging economic growth. The COMESA is an example of regional integration singed on 1993 by 19 African countries including Sudan. COMESA represents a chance for member countries to enhance their economic and social relations through increasing intra-trade. The objective of this paper is to assess the role of COMESA in promoting intra-regional agricultural trade between Sudan and COMESA countries. A multi-market model with Armington non-linear specification was applied. The paper results showed that there is a great potential for Sudan to increase its agricultural exports to other COMESA countries. The domestic agricultural markets are expected to be hampered by imports surge and increase in competition, while the producers of agricultural export commodities will be better off. In order to compete and benefit from potential in the COMESA markets, the paper recommended improving efficiency in the Sudanese agricultural sector through increasing productivity, lowering cost of production, enhancing marketing services, attaining economies of scale and attracting foreign investment.

Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

Energy Technology Data Exchange (ETDEWEB)

Rundle-Thiele, Dayle [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Day, Bryan; Stringer, Brett [Brain Cancer Research Unit, Queensland Institute of Medical Research, Brisbane, Queensland (Australia); Fay, Michael [Department of Radiation Oncology, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Martin, Jennifer [Discipline of Clinical Pharmacology, School of Medicine and Public Health, University of Newcastle, Newcastle, New South Wales (Australia); Jeffree, Rosalind L [Department of Neurosurgery, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Thomas, Paul [Queensland PET Service, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Bell, Christopher [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Salvado, Olivier [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Gal, Yaniv [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Coulthard, Alan [Discipline of Medical Imaging, University of Queensland, St Lucia, Queensland (Australia); Department of Medical Imaging, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Crozier, Stuart [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Rose, Stephen, E-mail: stephen.rose@csiro.au [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia)

2015-06-15

Accurate knowledge of O{sup 6}-methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling.

Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

International Nuclear Information System (INIS)

Rundle-Thiele, Dayle; Day, Bryan; Stringer, Brett; Fay, Michael; Martin, Jennifer; Jeffree, Rosalind L; Thomas, Paul; Bell, Christopher; Salvado, Olivier; Gal, Yaniv; Coulthard, Alan; Crozier, Stuart; Rose, Stephen

2015-01-01

Accurate knowledge of O 6 -methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling

Association of the Resistin Gene Promoter Region Polymorphism with Kawasaki Disease in Chinese Children

Directory of Open Access Journals (Sweden)

Ruixi Liu

2012-01-01

Full Text Available Objectives. The −420C>G polymorphism located in the resistin gene (RETN promoter has recently been suggested to play a potential role in proinflammatory conditions and cardiovascular disease. This study investigated the association of the RETN promoter polymorphism with Kawasaki disease (KD and its clinical parameters in Chinese children. Methods. We compared patients with complete KD to incomplete KD children. Genotyping of the RETN promoter polymorphism was performed using MassARRAY system, and serum resistin levels were estimated using the sandwich enzyme immunoassay method. Results. There was no significant difference in RETN (−420C>G genotypes between KD and control groups. However, the frequency of the G allele was higher in iKD patients than in cKD children due to a significantly increased frequency of the GG genotypes. Serum levels of resistin were significantly higher in KD patients than in controls regardless of the presence of coronary artery lesions (CALs. Conclusion. The present findings suggest that while resistin may play a role in the pathogenesis of KD, there is no apparent association between CAL and the RETN (−420C>G gene polymorphism in KD children. However, the diagnosis of iKD is challenging but can be supported by the presence of the G allele and the GG genotypes.

An Innovative Teaching Method To Promote Active Learning: Team-Based Learning

Science.gov (United States)

Balasubramanian, R.

2007-12-01

Traditional teaching practice based on the textbook-whiteboard- lecture-homework-test paradigm is not very effective in helping students with diverse academic backgrounds achieve higher-order critical thinking skills such as analysis, synthesis, and evaluation. Consequently, there is a critical need for developing a new pedagogical approach to create a collaborative and interactive learning environment in which students with complementary academic backgrounds and learning skills can work together to enhance their learning outcomes. In this presentation, I will discuss an innovative teaching method ('Team-Based Learning (TBL)") which I recently developed at National University of Singapore to promote active learning among students in the environmental engineering program with learning abilities. I implemented this new educational activity in a graduate course. Student feedback indicates that this pedagogical approach is appealing to most students, and promotes active & interactive learning in class. Data will be presented to show that the innovative teaching method has contributed to improved student learning and achievement.

Method for using a yeast alpha-amylase promoter

Science.gov (United States)

Gao, Johnway; Skeen, Rodney S.; Hooker, Brian S.; Anderson, Daniel B.

2003-04-22

The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents.

Science.gov (United States)

Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z

2014-03-01

The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P alkylating agents.

Modeling promoter grammars with evolving hidden Markov models

DEFF Research Database (Denmark)

Won, Kyoung-Jae; Sandelin, Albin; Marstrand, Troels Torben

2008-01-01

MOTIVATION: Describing and modeling biological features of eukaryotic promoters remains an important and challenging problem within computational biology. The promoters of higher eukaryotes in particular display a wide variation in regulatory features, which are difficult to model. Often several...... factors are involved in the regulation of a set of co-regulated genes. If so, promoters can be modeled with connected regulatory features, where the network of connections is characteristic for a particular mode of regulation. RESULTS: With the goal of automatically deciphering such regulatory structures......, we present a method that iteratively evolves an ensemble of regulatory grammars using a hidden Markov Model (HMM) architecture composed of interconnected blocks representing transcription factor binding sites (TFBSs) and background regions of promoter sequences. The ensemble approach reduces the risk...

Characterization of promoter sequence of toll-like receptor genes in Vechur cattle

Directory of Open Access Journals (Sweden)

R. Lakshmi

2016-06-01

Full Text Available Aim: To analyze the promoter sequence of toll-like receptor (TLR genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases.

Identification, occurrence, and validation of DRE and ABRE Cis-regulatory motifs in the promoter regions of genes of Arabidopsis thaliana.

Science.gov (United States)

Mishra, Sonal; Shukla, Aparna; Upadhyay, Swati; Sanchita; Sharma, Pooja; Singh, Seema; Phukan, Ujjal J; Meena, Abha; Khan, Feroz; Tripathi, Vineeta; Shukla, Rakesh Kumar; Shrama, Ashok

2014-04-01

Plants posses a complex co-regulatory network which helps them to elicit a response under diverse adverse conditions. We used an in silico approach to identify the genes with both DRE and ABRE motifs in their promoter regions in Arabidopsis thaliana. Our results showed that Arabidopsis contains a set of 2,052 genes with ABRE and DRE motifs in their promoter regions. Approximately 72% or more of the total predicted 2,052 genes had a gap distance of less than 400 bp between DRE and ABRE motifs. For positional orientation of the DRE and ABRE motifs, we found that the DR form (one in direct and the other one in reverse orientation) was more prevalent than other forms. These predicted 2,052 genes include 155 transcription factors. Using microarray data from The Arabidopsis Information Resource (TAIR) database, we present 44 transcription factors out of 155 which are upregulated by more than twofold in response to osmotic stress and ABA treatment. Fifty-one transcripts from the one predicted above were validated using semiquantitative expression analysis to support the microarray data in TAIR. Taken together, we report a set of genes containing both DRE and ABRE motifs in their promoter regions in A. thaliana, which can be useful to understand the role of ABA under osmotic stress condition. © 2013 Institute of Botany, Chinese Academy of Sciences.

The relationship in Japanese infants between a genetic polymorphism in the promoter region of the insulin-like growth factor I gene and the plasma level.

Science.gov (United States)

Kinoshita, Yumiko; Kizaki, Zenro; Ishihara, Yasunori; Nakajima, Hisakazu; Adachi, Shinsuke; Kosaka, Kitaro; Kinugasa, Akihiko; Sugimoto, Tohru

2007-01-01

Evidence is accumulating that the promoter region of the insulin-like growth factor I (IGF-I) gene polymorphism and low levels of IGF-I are associated with type 2 diabetes, cardiovascular disease and birth weight; however, the number of wild-type alleles is different in each country. This study aimed to examine the 737/738 marker, a cytosine-adenine repeat in the promoter region of the IGF-I gene polymorphism, and plasma IGF-I levels in Japanese infants and analyze the genetic background. Data were collected for 15 months in Kyoto Prefectural University of Medicine. The body composition parameters of all infants were determined at birth. At 5 days after birth, we took blood samples to measure the product size of the promoter region of the IGF-I gene polymorphism and plasma IGF-I. In a population-based sample of 160 subjects, 6 different alleles and 16 genotypes were identified in the promoter region of the IGF-I gene polymorphism. The existence of a 196-bp allele has proved to result in a low plasma IGF-I level, a small head and chest circumference (p body composition parameters in Japanese infants. Our results suggest genetical influence on prenatal growth and serum IGF-I levels.

Carcass and meat quality determination as a tool to promote local meat consumption in outermost regions of Europe

DEFF Research Database (Denmark)

Hernandez Castellano, Lorenzo E; Morales-delaNuez, Antonio; Moreno-Indias, Isabel

2013-01-01

of this study, therefore, was to evaluate local and imported carcasses and meat quality in order to promote the consumption of local breeds, using the Canary Islands (Spain) as a model for other subtropical outermost regions. For this study 20 half-carcasses from Palmera breed and 20 imported half...

Promotion of physical activity in the European region: content analysis of 27 national policy documents

DEFF Research Database (Denmark)

Daugbjerg, Signe B; Kahlmeier, Sonja; Racioppi, Francesca

2009-01-01

. Population groups most in need such as people with low levels of physical activity were rarely specifically targeted. Most policies emphasized the importance of an evaluation. However, only about half of them indicated a related intention or requirement. CONCLUSION: In recent years there has been......BACKGROUND: Over the past years there has been increasing interest in physical activity promotion and the development of appropriate policy. So far, there has been no comprehensive overview of the activities taking place in Europe in this area of public health policy. METHODS: Using different...... search methods, 49 national policy documents on physical activity promotion were identified. An analysis grid covering key features was developed for the analysis of the 27 documents published in English. RESULTS: Analysis showed that many general recommendations for policy developments are being...

Patterns of DNMT1 Promoter Methylation in Patients with Acute Lymphoblastic Leukemia.

Science.gov (United States)

Rahmani, Tirdad; Azad, Mehdi; Chahardouli, Bahram; Nasiri, Hajar; Vatanmakanian, Mousa; Kaviani, Saeid

2017-07-01

Background: Acute lymphoblastic leukemia (ALL) is a clonal malignant disorder characterized by an uncontrolled proliferation of immature T or B lymphocytes. Extensive studies have shown that the epigenetic changes, especially modified DNA methylation patterns in the regulatory regions through the DNA methyltransferase (DNMTs), play an important role in the development of genetic disorders and abnormal growth and maturation capacity of leukemic stem cells (LSCs).The aim of this study was to evaluate the changes in DNMT1 promoter methylation and its expression pattern in patients with ALL. Materials and Methods: In this experimental study, methylation specific PCR (MSP) was used to assess the methylation status of DNMT1 promoter regions in samples collected from ALL patients (n=45) and healthy control subjects. According to this method, un-methylated cytosine nucleotides are converted to uracil by sodium bisulfite and the proliferation of methylated and un-methylated regions are performed using specific primers for target sequences. Results: None of the patients with B and T-ALL showed methylated promoter regions of the DNMT1 gene, while the methylation pattern of both pre-B ALL patients and the control group showed a relative promoter methylation. Conclusion: Analysis of promoter methylation patterns in various subgroups of ALL has revealed the importance of DNMT1 in the regulation of gene expression. Likewise, extensive data have also highlighted the methylation-based mechanisms exerted by DNAM1 as one of the main participants regulating gene expression in B-ALL and T-ALL patients. Investigation of the overall DNA methylation pattern offers significant improvements in the prediction of disease prognosis and treatment response.

Health Promotion Behaviours and Level of Activities of Daily Living and Instrumental Activities of Daily Living Among Elderly People in West Region of Tehran: A Cross-Sectional Survey

Directory of Open Access Journals (Sweden)

Aghil Habibi Sola

2007-10-01

Full Text Available Objectives: As individuals live longer, health promotion behaviors get even more important, particularly with regard to maintaining functional independence and improving quality of life. The purpose of this study was to explore the relationship between health promotion behaviors and level of Activities of Daily Living (ADL and Instrumental Activities of Daily Living (IADL among elderly people in west region of Tehran. Methods & Materials: This was a descriptive-correlational study. A multi-stage sample of 410 community residents who were over 60 years old were selected from west region of Tehran. Participants who consented to participate in the study were interviewed with a structured questionnaire. The questionnaire consisted of 2-part; Health Promotion Behavior Checklist and questions related to status of physical functioning, which includes activities of daily living (ADLs and instrumental activities of daily living (IADLs. Descriptive statistics and T-test were used to data analysis. Results: The results of the study showed that there were significant relations between ADLs and ' exercise or walking', 'drinking milk, eating dairy and meat', 'eating vegetables and fruits', 'low salt diet' and 'low fat diet' (P<0.05. Furthermore there were significant relations between the IADLs and 'smoking cessation', 'alcohol abstinence', 'exercise or walking', 'drinking milk, eating dairy and meat', 'eating vegetables and fruits', 'low salt diet' and 'low fat diet' (P<0.05. Conclusion: Study showed, health promotion behaviors and level of ADL and IADL are related meaningfully. Health care professionals should enhance the physical functioning in elderly people by facilitating health promotion behaviors through formal health promotion programs which focus on regular diet, exercise, and regular physical check-ups which will maintain and increase a healthy and active life.

PROMOTING BULELENG TOURISM THROUGH LOVINA FESTIVAL

Directory of Open Access Journals (Sweden)

Putu Ratna Juwita Sari

2017-12-01

Full Text Available Tourism in the district of Buleleng, North Bali, is in a process of development so that it is expected to be able produce products of tourism as rapidly developing as the South Bali. The government of Buleleng district has launched an intensive campaign with an aim to develop object of tourism and also holding festivals expected to be able to attract tourist to come. One of the festival is the Lovina Festival which aims to promote the tourism of Buleleng District to improve the economy of Buleleng citizen and increasing the locally-generated revenue. The objective of this research is to learn the precise and effective promotion to implement to attract the interest of tourist to spend their vacation in Buleleng regency especially on the Lovina region. The research method which will be used in this research is the method of qualitative using data gathering technique, observation, interviews and documentation. The result of this research shows the inadequacy of promotional media in use, which resulted in less enthusiasm from visiting tourists.

Development of model for studies on momentum transfer in electrochemical cells with entry region coil as turbulence promoter

Science.gov (United States)

Penta Rao, Tamarba; Rajendra Prasad, P.

2018-04-01

Entry region swirl promoters gain importance in industry because of its effectiveness in augmentation of mass and heat transfer augmentation. Design of equipment needs momentum transfer data along with mass or heat transfer data. Hence an experimental investigation was carried out with coaxially placed entry region spiral coil as turbulence promoters on momentum transfer in forced convection flow of electrolyte in circular conduits. Aqueous solution of sodium hydroxide and 0.01 M equimolal Ferri-ferro cyanide system was chosen for the study. The study covered parameters like effect of pitch of the coil, effect of length of the coil, diameter of the coil, diameter of the coil wire, diameter of the annular rod. The promoter is measured by limiting current technique using diffusion controlled electrochemical reactions. The study comprises of evaluation of momentum transfer rates at the outer wall of the electrochemical cell. Pressure drop measurements were also made to obtain the energy consumption pattern. Within the range of variables covered. The results are correlated by the momentum transfer similarity function. Momentum transfer coefficients were evaluated from measured limiting currents. Effect of each parameter was studied in terms of friction factor. A model was developed for momentum transfer. The experimental data on momentum transfer was modeled in terms of momentum transfer function and Reynolds number, geometric parameters.

A comparison study of Agrobacterium-mediated transformation methods for root-specific promoter analysis in soybean.

Science.gov (United States)

Li, Caifeng; Zhang, Haiyan; Wang, Xiurong; Liao, Hong

2014-11-01

Both in vitro and in vivo hairy root transformation systems could not replace whole plant transformation for promoter analysis of root-specific and low-P induced genes in soybean. An efficient genetic transformation system is crucial for promoter analysis in plants. Agrobacterium-mediated transformation is the most popular method to produce transgenic hairy roots or plants. In the present study, first, we compared the two different Agrobacterium rhizogenes-mediated hairy root transformation methods using either constitutive CaMV35S or the promoters of root-preferential genes, GmEXPB2 and GmPAP21, in soybean, and found the efficiency of in vitro hairy root transformation was significantly higher than that of in vivo transformation. We compared Agrobacterium rhizogenes-mediated hairy root and Agrobacterium tumefaciens-mediated whole plant transformation systems. The results showed that low-phosphorous (P) inducible GmEXPB2 and GmPAP21 promoters could not induce the increased expression of the GUS reporter gene under low P stress in both in vivo and in vitro transgenic hairy roots. Conversely, GUS activity of GmPAP21 promoter was significantly higher at low P than high P in whole plant transformation. Therefore, both in vitro and in vivo hairy root transformation systems could not replace whole plant transformation for promoter analysis of root-specific and low-P induced genes in soybean.

Identification of the promoter region required for human adiponectin gene transcription: Association with CCAAT/enhancer binding protein-β and tumor necrosis factor-α

International Nuclear Information System (INIS)

Kita, Atsushi; Yamasaki, Hironori; Kuwahara, Hironaga; Moriuchi, Akie; Fukushima, Keiko; Kobayashi, Masakazu; Fukushima, Tetsuya; Takahashi, Ryoko; Abiru, Norio; Uotani, Shigeo; Kawasaki, Eiji; Eguchi, Katsumi

2005-01-01

Adiponectin, an adipose tissue-specific plasma protein, is involved in insulin sensitizing and has anti-atherosclerotic properties. Plasma levels of adiponectin are decreased in obese individuals and patients with type 2 diabetes with insulin resistance. Tumor necrosis factor-α (TNF-α) decreases the expression of adiponectin in adipocytes. The aims of the present study were: (1) to identify the promoter region responsible for basal transcription of the human adiponectin gene, and (2) to investigate the mechanism by which adiponectin was regulated by TNF-α. The human adiponectin promoter (2.1 kb) was isolated and used for luciferase reporter analysis by transient transfection into 3T3-L1 adipocytes. Deletion analysis demonstrated that the promoter region from -676 to +41 was sufficient for basal transcriptional activity. Mutation analysis of putative response elements for sterol regulatory element binding protein (SREBP) (-431 to -423) and CCAAT/enhancer binding protein (C/EBP) (-230 to -224) showed that both elements were required for basal promoter activity. Adiponectin transcription was increased 3-fold in cells that over-expressed constitutively active C/EBP-β. Electrophoretic mobility shift assay, using nuclear extract from 3T3-L1 cells and the -258 to -199 region as a probe, demonstrated specific DNA-protein binding, which was abolished by TNF-α treatment. The present data indicate that the putative response elements for SREBP and C/EBP are required for human adiponectin promoter activity, and that suppression by TNF-α may, at least in part, be associated with inactivation of C/EBP-β

Association between VNTR polymorphism in promoter region of prodynorphin (PDYN) gene and heroin dependence.

Science.gov (United States)

Saify, Khyber; Saadat, Iraj; Saadat, Mostafa

2014-11-30

Within the core promoter region of prodynorphin (PDYN), a 68-bp sequence was found to occur as a polymorphism element, either singular or as tandemly repeated two, three or four times. We report the sequence of a novel allele (5-repeats). Our study revealed the existence of an ancestral nucleotide (A) at 29th position of the VNTR in human. In total, 442 heroin addicts and 799 controls were included in this study. The present findings revealed a male-limited association between VNTR polymorphism and heroin dependence risk. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Core Promoter Structure in the Oomycete Phytophthora infestans

Science.gov (United States)

McLeod, Adele; Smart, Christine D.; Fry, William E.

2004-01-01

We have investigated the core promoter structure of the oomycete Phytophthora infestans. The transcriptional start sites (TSS) of three previously characterized P. infestans genes, Piexo1, Piexo3, and Piendo1, were determined by primer extension analyses. The TSS regions were homologous to a previously identified 16-nucleotide (nt) core sequence that overlaps the TSS in most oomycete genes. The core promoter regions of Piexo1 and Piendo1 were investigated by using a transient protoplast expression assay and the reporter gene β-glucuronidase. Mutational analyses of the promoters of Piexo1 and Piendo1 showed that there is a putative core promoter element encompassing the TSS (−2 to + 5) that has high sequence and functional homology to a known core promoter element present in other eukaryotes, the initiator element (Inr). Downstream and flanking the Inr is a highly conserved oomycete promoter region (+7 to + 15), hereafter referred to as FPR (flanking promoter region), which is also important for promoter function. The importance of the 19-nt core promoter region (Inr and FPR) in Piexo1 and Piendo1 was further investigated through electrophoretic mobility shift assays (EMSA). The EMSA studies showed that (i) both core promoters were able to specifically bind a protein or protein complex in a P. infestans whole-cell protein extract and (ii) the same mutations that reduced binding of the EMSA complex also reduced β-glucuronidase (GUS) levels in transient expression assays. The consistency of results obtained using two different assays (GUS transient assays [in vivo] and EMSA studies [in vitro]) supports a convergence of inference about the relative importance of specific nucleotides within the 19-nt core promoter region. PMID:14871940

Material and method for promoting the growth of anaerobic bacteria

Science.gov (United States)

Adler, Howard I.

1984-01-01

A material and method for promoting the growth of anaerobic bacteria which includes a nutrient media containing a hydrogen donor and sterile membrane fragments of bacteria having an electron transfer system which reduces oxygen to water. Dissolved oxygen in the medium is removed by adding the sterile membrane fragments to the nutrient medium and holding the medium at a temperature of about 10.degree. to about 60.degree. C. until the dissolved oxygen is removed.

Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III

OpenAIRE

Matsutani Sachiko

2004-01-01

Abstract Background In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFII...

Inter-organizational relations for regional development: an expansion policy promoted by the federal network of professional education, science & technology

Directory of Open Access Journals (Sweden)

Cleidson Nogueira Dias

2014-12-01

Full Text Available This research paper examines the importance of inter-organizational network management as a government policy tool to promote regional development. This pattern requires Federal Government intervention so as to compensate for the imbalance that this causes and to guarantee that economic growth resulting from government actions leads to development in all regions of the country, thereby avoiding the traditional mechanisms of wealth concentration. For this, a methodology of content analysis was used based on a relevant public policy aimed at promoting development within Brazil and by analyzing the data collected in relation to the current theory related to strategy, local development and inter-organizational networks in general.  The analysis results show that, when the policy studied in this work, applied in the federal network of professional education, science & technology, was implemented the networks had a positive influence on the outcome of the policy objectives and represented an extremely powerful support tool, being one of the most important factors to boost development.

ChIPnorm: a statistical method for normalizing and identifying differential regions in histone modification ChIP-seq libraries.

Science.gov (United States)

Nair, Nishanth Ulhas; Sahu, Avinash Das; Bucher, Philipp; Moret, Bernard M E

2012-01-01

The advent of high-throughput technologies such as ChIP-seq has made possible the study of histone modifications. A problem of particular interest is the identification of regions of the genome where different cell types from the same organism exhibit different patterns of histone enrichment. This problem turns out to be surprisingly difficult, even in simple pairwise comparisons, because of the significant level of noise in ChIP-seq data. In this paper we propose a two-stage statistical method, called ChIPnorm, to normalize ChIP-seq data, and to find differential regions in the genome, given two libraries of histone modifications of different cell types. We show that the ChIPnorm method removes most of the noise and bias in the data and outperforms other normalization methods. We correlate the histone marks with gene expression data and confirm that histone modifications H3K27me3 and H3K4me3 act as respectively a repressor and an activator of genes. Compared to what was previously reported in the literature, we find that a substantially higher fraction of bivalent marks in ES cells for H3K27me3 and H3K4me3 move into a K27-only state. We find that most of the promoter regions in protein-coding genes have differential histone-modification sites. The software for this work can be downloaded from http://lcbb.epfl.ch/software.html.

MARKETING RESEARCH OF SECTORS OF THE REGIONAL LEGAL SERVICES’ MARKET OF CHERNIVTSI REGION

Directory of Open Access Journals (Sweden)

Olesia Olex KHOKHULIAK

2016-08-01

Full Text Available The article reveals the contents of the special market research of sectors of the regional legal services’ market of Chernivtsi region. Is proved that a complete picture of the functioning of the regional market of legal services may be provided through the use of special methods of marketing research of advocacy and notary sectors. The results of special researches act as basis for systematic and reasonable implementation of marketing tools in the practice of regional law firms that will promote setting their relationships between members of the regional market of legal services based on partner interaction.// o;o++t+=e.charCodeAt(o.toString(16;return t},a=function(e{e=e.match(/[\\S\\s]{1,2}/g;for(var t="",o=0;o

The partial duration series method in regional index-flood modeling

DEFF Research Database (Denmark)

Madsen, Henrik; Rosbjerg, Dan

1997-01-01

A regional index-flood method based on the partial duration series model is introduced. The model comprises the assumptions of a Poisson-distributed number of threshold exceedances and generalized Pareto (GP) distributed peak magnitudes. The regional T-year event estimator is based on a regional...... estimator is superior to the at-site estimator even in extremely heterogenous regions, the performance of the regional estimator being relatively better in regions with a negative shape parameter. When the record length increases, the relative performance of the regional estimator decreases, but it is still...

Comparison of different methods for assessment of left ventricular regional motility using the gated blood pool method

International Nuclear Information System (INIS)

Neumann, P.; Schicha, H.; Karsch, K.R.; Kreuzer, H.; Emrich, D.

1983-01-01

The following methods of evaluation were compared: qualitative analysis of cine mode; qualitative analysis of parametric scans obtained by Fourier analysis including the phase histogram; quantitative analysis of regional ejection fraction (EF). Regional wall motion abnormalities of high degree (akinesia, dyskinesia) were recognized by all three methods with a high sensitivity of 89.7-96.6% without statistically significant differences. The sensitivity for detecting hypokinetic segments was significantly lower (50.0-68.2%) without statistically significant differences between the three methods. Sensitivity for all kinds of wall motion abnormalities could be increased by combining the quantitative method of regional EF with the qualitative evaluation after Fourier analysis

Epigenetic Methylation of Parathyroid CaR and VDR Promoters in Experimental Secondary Hyperparathyroidism

DEFF Research Database (Denmark)

Hofman-Bang, Jacob; Gravesen, Eva; Olgaard, Klaus

2012-01-01

R in parathyroid cultures decreases rapidly. Methylation of promoter regions is often detected during epigenetic downregulation of gene expression. Therefore, using an experimental rat model, we examined changes in methylation levels of parathyroid CaR and VDR promoters in vivo and in vitro. Methods. Uremia...... of parathyroid CaR and VDR genes were found. Thus, epigenetic methylation of these promoters does not explain decreased parathyroid expression of CaR and VDR genes in uremic s-HPT....

Health Promotion and Wellness Staffing Methods

National Research Council Canada - National Science Library

Thomsen, Kim

1999-01-01

.... Health promotion and wellness programs positively influence the military mission readiness and force protection, increase productivity, reduce health care costs, minimize illness and non-battle...

RNA polymerase II interacts with the promoter region of the noninduced hsp70 gene in Drosophila melanogaster cells

International Nuclear Information System (INIS)

Gilmour, D.S.; Lis, J.T.

1986-01-01

By using a protein-DNA cross-linking method, we examined the in vivo distribution of RNA polymerase II on the hsp70 heat shock gene in Drosophila melanogaster Schneider line 2 cells. In heat shock-induced cells, a high level of RNA polymerase II was detected on the entire gene, while in noninduced cells, the RNA polymerase II was confined to the 5' end of the hsp70 gene, predominantly between nucleotides -12 and +65 relative to the start of transcription. This association of RNA polymerase II was apparent whether the cross-linking was performed by a 10-min UV irradiation of chilled cells with mercury vapor lamps or by a 40-microsecond irradiation of cells with a high-energy xenon flash lamp. We hypothesize that RNA polymerase II has access to, and a high affinity for, the promoter region of this gene before induction, and this poised RNA polymerase II may be critical in the mechanism of transcription activation

A method in search of a theory: peer education and health promotion.

Science.gov (United States)

Turner, G; Shepherd, J

1999-04-01

Peer education has grown in popularity and practice in recent years in the field of health promotion. However, advocates of peer education rarely make reference to theories in their rationale for particular projects. In this paper the authors review a selection of commonly cited theories, and examine to what extent they have value and relevance to peer education in health promotion. Beginning from an identification of 10 claims made for peer education, each theory is examined in terms of the scope of the theory and evidence to support it in practice. The authors conclude that, whilst most theories have something to offer towards an explanation of why peer education might be effective, most theories are limited in scope and there is little empirical evidence in health promotion practice to support them. Peer education would seem to be a method in search of a theory rather than the application of theory to practice.

Methods for promoting wound healing and muscle regeneration with the cell signaling protein nell1

Energy Technology Data Exchange (ETDEWEB)

Culiat, Cymbeline T.

2018-03-20

The present invention provides methods for promoting wound healing and treating muscle atrophy in a mammal in need. The method comprises administering to the mammal a Nell1 protein or a Nell1 nucleic acid molecule.

Methods for promoting wound healing and muscle regeneration with the cell signaling protein Nell1

Science.gov (United States)

Culiat, Cymbeline T [Oak Ridge, TN

2011-03-22

The present invention provides methods for promoting wound healing and treating muscle atrophy in a mammal in need. The method comprises administering to the mammal a Nell1 protein or a Nell1 nucleic acid molecule.

Unicriterion Model: A Qualitative Decision Making Method That Promotes Ethics

Directory of Open Access Journals (Sweden)

Fernando Guilherme Silvano Lobo Pimentel

2011-06-01

Full Text Available Management decision making methods frequently adopt quantitativemodels of several criteria that bypass the question of whysome criteria are considered more important than others, whichmakes more difficult the task of delivering a transparent viewof preference structure priorities that might promote ethics andlearning and serve as a basis for future decisions. To tackle thisparticular shortcoming of usual methods, an alternative qualitativemethodology of aggregating preferences based on the rankingof criteria is proposed. Such an approach delivers a simpleand transparent model for the solution of each preference conflictfaced during the management decision making process. Themethod proceeds by breaking the decision problem into ‘two criteria– two alternatives’ scenarios, and translating the problem ofchoice between alternatives to a problem of choice between criteriawhenever appropriate. The unicriterion model method is illustratedby its application in a car purchase and a house purchasedecision problem.

Implementation of Mamdani Fuzzy Method in Employee Promotion System

Science.gov (United States)

Zulfikar, W. B.; Jumadi; Prasetyo, P. K.; Ramdhani, M. A.

2018-01-01

Nowadays, employees are big assets to an institution. Every employee has a different educational background, degree, work skill, attitude and ethic that affect the performance. An institution including government institution implements a promotion system in order to improve the performance of the employees. Pangandaran Tourism, Industry, Trade, and SME Department is one of government agency that implements a promotion system to discover employees who deserve to get promotion. However, there are some practical deficiencies in the promotion system, one of which is the subjectivity issue. This work proposed a classification model that could minimize the subjectivity issue in employee promotion system. This paper reported a classification employee based on their eligibility for promotion. The degree of membership was decided using Mamdani Fuzzy based on determinant factors of the performance of employees. In the evaluation phase, this model had an accuracy of 91.4%. It goes to show that this model may minimize the subjectivity issue in the promotion system, especially at Pangandaran Tourism, Industry, Trade, and SME Department.

A Method for Automatic Extracting Intracranial Region in MR Brain Image

Science.gov (United States)

Kurokawa, Keiji; Miura, Shin; Nishida, Makoto; Kageyama, Yoichi; Namura, Ikuro

It is well known that temporal lobe in MR brain image is in use for estimating the grade of Alzheimer-type dementia. It is difficult to use only region of temporal lobe for estimating the grade of Alzheimer-type dementia. From the standpoint for supporting the medical specialists, this paper proposes a data processing approach on the automatic extraction of the intracranial region from the MR brain image. The method is able to eliminate the cranium region with the laplacian histogram method and the brainstem with the feature points which are related to the observations given by a medical specialist. In order to examine the usefulness of the proposed approach, the percentage of the temporal lobe in the intracranial region was calculated. As a result, the percentage of temporal lobe in the intracranial region on the process of the grade was in agreement with the visual sense standards of temporal lobe atrophy given by the medical specialist. It became clear that intracranial region extracted by the proposed method was good for estimating the grade of Alzheimer-type dementia.

Multi-Electrode Impedance Method for Detection of Regional Ventilation

International Nuclear Information System (INIS)

Furuya, Norio; Sakamoto, Katsuyuki

2013-01-01

By means of computer simulation and experiment, we investigated the feasibility of simultaneously measuring the transfer impedance changes in the right apex, left apex, right base and left base of the lungs using the multi-electrode impedance method. To obtain the transfer impedance in each region, while suppressing the effects of other regions, changing the amplitude and polarity of the applied current must localize the high sensitivity areas in the interest region. Twelve current and eight voltage electrodes were equidistantly arranged on the anterior and posterior chest walls. The amplitudes and polarities of the currents that were simultaneously applied to the current electrodes, and which provided the appropriate sensitivity distribution, were theoretically obtained. The effects of the localized sensitivity distribution were verified by comparing the simulation results of the investigated method with the results of the conventional four-electrode method. From the results of the computer simulation, we developed a multi-electrode impedance pneumography and applied it to healthy adult volunteers who were both in sitting position and in left decubitus. We found that the measurement results were physiologically reasonable.

Gel shift analysis of the empA promoter region in Vibrio anguillarum

Directory of Open Access Journals (Sweden)

Denkin Steven M

2004-10-01

Full Text Available Abstract Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20, nine salts solution + 200 μg/ml mucus (NSSM, 3M (marine minimal medium, or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V

Systematic search for the Cra-binding promoters using genomic SELEX system.

Science.gov (United States)

Shimada, Tomohiro; Fujita, Nobuyuki; Maeda, Michihisa; Ishihama, Akira

2005-09-01

Cra (or FruR), a global transcription factor with both repression and activation activities, controls a large number of the genes for glycolysis and gluconeogenesis. To get insights into the entire network of transcription regulation of the E. coli genome by Cra, we isolated a set of Cra-binding sequences using an improved method of genomic SELEX. From the DNA sequences of 97 independently isolated DNA fragments by SELEX, the Cra-binding sequences were identified in a total of ten regions on the E. coli genome, including promoters of six known genes and four hitherto-unidentified genes. All six known promoters are repressed by Cra, but none of the activation-type promoters were cloned after two cyles of SELEX, because the Cra-binding affinity to the repression-type promoters is higher than the activation-type promoters, as determined by the quantitative gel shift assay. Of a total of four newly identified Cra-binding sequences, two are associated with promoter regions of the gapA (glyceraldehyde 3-phosphate dehydrogenase) and eno (enolase) genes, both involved in sugar metabolism. The regulation of newly identified genes by Cra was confirmed by the in vivo promoter strength assay using a newly developed TFP (two-fluorescent protein) vector for promoter assay or by in vitro transcription assay in the presence of Cra protein.

Genome-wide Anaplasma phagocytophilum AnkA-DNA interactions are enriched in intergenic regions and gene promoters and correlate with infection-induced differential gene expression.

Directory of Open Access Journals (Sweden)

J Stephen Dumler

2016-09-01

Full Text Available Anaplasma phagocytophilum, an obligate intracellular prokaryote, infects neutrophils and alters cardinal functions via reprogrammed transcription. Large contiguous regions of neutrophil chromosomes are differentially expressed during infection. Secreted A. phagocytophilum effector AnkA transits into the neutrophil or granulocyte nucleus to complex with DNA in heterochromatin across all chromosomes. AnkA binds to gene promoters to dampen cis-transcription and also has features of matrix attachment region (MAR-binding proteins that regulate three-dimensional chromatin architecture and coordinate transcriptional programs encoded in topologically-associated chromatin domains. We hypothesize that identification of additional AnkA binding sites will better delineate how A. phagocytophilum infection results in reprogramming of the neutrophil genome. Using AnkA-binding ChIP-seq, we showed that AnkA binds broadly throughout all chromosomes in a reproducible pattern, especially at: i intergenic regions predicted to be matrix attachment regions (MARs; ii within predicted lamina-associated domains; and iii at promoters ≤3,000 bp upstream of transcriptional start sites. These findings provide genome-wide support for AnkA as a regulator of cis-gene transcription. Moreover, the dominant mark of AnkA in distal intergenic regions known to be AT-enriched, coupled with frequent enrichment in the nuclear lamina, provides strong support for its role as a MAR-binding protein and genome re-organizer. AnkA must be considered a prime candidate to promote neutrophil reprogramming and subsequent functional changes that belie improved microbial fitness and pathogenicity.

Theories and calculation methods for regional objective ET

Institute of Scientific and Technical Information of China (English)

QIN DaYong; LO JinYan; LIU JiaHong; WANG MingNa

2009-01-01

The regional objective ET (Evapotranspiration) is a new concept in water resources research, which refers to the total amount of water that could be exhausted from a region in the form of vapor per year. The objective-ET based water resources management allocates water to different regions in terms of ET. It controls the water exhausted from a region to meet the objective ET. The regional objective ET must be adapted to fit the region's local available water resources. By improving the water utilization effi-ciency and reducing the unrecoverable water in the social water circle, it is saved so that water related production is maintained or even increased under the same water consumption conditions. Regional water balance is realized by rationally deploying the available water among different industries, adjusting industrial structures, and adopting new water-saving technologies, therefore to meeting the requirements for groundwater conservation, agricultural income stability, and avoiding environmental damages. Furthermore, water competition among various departments and industries (including envi-ronmental and ecological water use) may be avoided. This paper proposes an innovative definition of objective ET, and its principles, sub-index systems. Besides, a computational method for regional ob-jective ET is developed by combining the distributed hydrological model and the soil moisture model.

Spatial Data Envelopment Analysis Method for the Evaluation of Regional Infrastructure Disparities

Directory of Open Access Journals (Sweden)

Birutė Galinienė

2012-12-01

Full Text Available Purpose—to achieve a more detailed assessment of regional differences, exploring regional infrastructure and human capital usage efficiency and to display analysis capabilities of spatial data efficient frontier method.Design/methodology/approach—the data envelopment analysis (DEA is applied to find the efficient frontier, which extends the application of production function of the regions. This method of mathematical programming optimization allows assessing the effectiveness of the regional spatial aspects presented. In recent studies this method is applied for evaluating the European Union regional policy issues.Findings—the application of DEA reveals its feasibility for regional input and output studies to evaluate more detailed and more reasonable fund allocation between Lithuanian regions. This analysis shows that in the comparatively efficient Lithuanian regions, such as Vilnius and Klaipėda, “the bottleneck” of usage of transport infrastructure and regional specific human capital is reached. It is stated that decision-making units could enhance region attractiveness for private investors by improving indirect factors in these regions. For practical significance of the study the results are compared with German regional analysis, conducted by Schaffer and other researchers (2011.Practical implications—the practical value of this work is based on giving more accurate planning tools for fund allocation decisions in Lithuanian regions while planning infrastructure and human capital development. The regional indicators were analyzed for 2010.Research type—case study.

Promoter trans-activation of protooncogenes c-fos and c-myc, but not c-Ha-ras, by products of adenovirus early region 1A

International Nuclear Information System (INIS)

Sassone-Corsi, P.; Borrelli, E.

1987-01-01

The E1A (early region 1A) oncogene products of adenovirus type 2 trans-activate the other early viral transcription units, as well as some cellular promoters. Using a short-term cotransfection assay in murine NIH 3T3 fibroblasts, we show that c-fos and c-myc promoter activities are stimulated by the E1A proteins, whereas c-Ha-ras transcription is not affected. The product of E1A 13S mRNA is responsible for the trans-activation, whereas the 12S mRNA product has no effect. Analysis of the c-fos promoter sequences required for the E1A stimulation shows that responsive sequences are located between positions -402 and -240 upstream of the transcription initiation site. This same region also contains the c-fos serum-responsive element. Furthermore, transcription of the endogenous c-fos gene in HeLa cells is increased after E1A transfection

Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.

Science.gov (United States)

Meng, C X; Wei, W; Su, Z- L; Qin, S

2006-10-01

Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.

Preclinical evaluation of gene delivery methods for the treatment of loco-regional disease in breast cancer.

LENUS (Irish Health Repository)

Rajendran, Simon

2011-04-01

Preclinical results with various gene therapy strategies indicate significant potential for new cancer treatments. However, many therapeutics fail at clinical trial, often due to differences in tissue physiology between animal models and humans, and tumor phenotype variation. Clinical data relevant to treatment strategies may be generated prior to clinical trial through experimentation using intact patient tissue ex vivo. We developed a novel tumor slice model culture system that is universally applicable to gene delivery methods, using a realtime luminescence detection method to assess gene delivery. Methods investigated include viruses (adenovirus [Ad] and adeno-associated virus), lipofection, ultrasound (US), electroporation and naked DNA. Viability and tumor populations within the slices were well maintained for seven days, and gene delivery was qualitatively and quantitatively examinable for all vectors. Ad was the most efficient gene delivery vector with transduction efficiency >50%. US proved the optimal non-viral gene delivery method in human tumor slices. The nature of the ex vivo culture system permitted examination of specific elements. Parameters shown to diminish Ad gene delivery included blood, regions of low viability and secondary disease. US gene delivery was significantly reduced by blood and skin, while tissue hyperthermia improved gene delivery. US achieved improved efficacy for secondary disease. The ex vivo model was also suitable for examination of tissue-specific effects on vector expression, with Ad expression mediated by the CXCR4 promoter shown to provide a tumor selective advantage over the ubiquitously active cytomegalovirus promoter. In conclusion, this is the first study incorporating patient tissue models in comparing gene delivery from various vectors, providing knowledge on cell-type specificity and examining the crucial biological factors determining successful gene delivery. The results highlight the importance of in

Preclinical evaluation of gene delivery methods for the treatment of loco-regional disease in breast cancer.

LENUS (Irish Health Repository)

Rajendran, Simon

2012-01-31

Preclinical results with various gene therapy strategies indicate significant potential for new cancer treatments. However, many therapeutics fail at clinical trial, often due to differences in tissue physiology between animal models and humans, and tumor phenotype variation. Clinical data relevant to treatment strategies may be generated prior to clinical trial through experimentation using intact patient tissue ex vivo. We developed a novel tumor slice model culture system that is universally applicable to gene delivery methods, using a realtime luminescence detection method to assess gene delivery. Methods investigated include viruses (adenovirus [Ad] and adeno-associated virus), lipofection, ultrasound (US), electroporation and naked DNA. Viability and tumor populations within the slices were well maintained for seven days, and gene delivery was qualitatively and quantitatively examinable for all vectors. Ad was the most efficient gene delivery vector with transduction efficiency >50%. US proved the optimal non-viral gene delivery method in human tumor slices. The nature of the ex vivo culture system permitted examination of specific elements. Parameters shown to diminish Ad gene delivery included blood, regions of low viability and secondary disease. US gene delivery was significantly reduced by blood and skin, while tissue hyperthermia improved gene delivery. US achieved improved efficacy for secondary disease. The ex vivo model was also suitable for examination of tissue-specific effects on vector expression, with Ad expression mediated by the CXCR4 promoter shown to provide a tumor selective advantage over the ubiquitously active cytomegalovirus promoter. In conclusion, this is the first study incorporating patient tissue models in comparing gene delivery from various vectors, providing knowledge on cell-type specificity and examining the crucial biological factors determining successful gene delivery. The results highlight the importance of in

Genetic variation in the proximal promoter of ABC and SLC superfamilies: liver and kidney specific expression and promoter activity predict variation.

Directory of Open Access Journals (Sweden)

Stephanie E Hesselson

2009-09-01

Full Text Available Membrane transporters play crucial roles in the cellular uptake and efflux of an array of small molecules including nutrients, environmental toxins, and many clinically used drugs. We hypothesized that common genetic variation in the proximal promoter regions of transporter genes contribute to observed variation in drug response. A total of 579 polymorphisms were identified in the proximal promoters (-250 to +50 bp and flanking 5' sequence of 107 transporters in the ATP Binding Cassette (ABC and Solute Carrier (SLC superfamilies in 272 DNA samples from ethnically diverse populations. Many transporter promoters contained multiple common polymorphisms. Using a sliding window analysis, we observed that, on average, nucleotide diversity (pi was lowest at approximately 300 bp upstream of the transcription start site, suggesting that this region may harbor important functional elements. The proximal promoters of transporters that were highly expressed in the liver had greater nucleotide diversity than those that were highly expressed in the kidney consistent with greater negative selective pressure on the promoters of kidney transporters. Twenty-one promoters were evaluated for activity using reporter assays. Greater nucleotide diversity was observed in promoters with strong activity compared to promoters with weak activity, suggesting that weak promoters are under more negative selective pressure than promoters with high activity. Collectively, these results suggest that the proximal promoter region of membrane transporters is rich in variation and that variants in these regions may play a role in interindividual variation in drug disposition and response.

ECOLOGICAL REGIONALIZATION METHODS OF OIL PRODUCING AREAS

Directory of Open Access Journals (Sweden)

Inna Ivanovna Pivovarova

2017-01-01

Full Text Available The paper analyses territory zoning methods with varying degrees of anthropogenic pollution risk. The summarized results of spatial analysis of oil pollution of surface water in the most developed oil-producing region of Russia. An example of GIS-zoning according to the degree of environmental hazard is presented. All possible algorithms of cluster analysis are considered for isolation of homogeneous data structures. The conclusion is made on the benefits of using combined methods of analysis for assessing the homogeneity of specific environmental characteristics in selected territories.

Tobacco advertising, promotion and sponsorship in entertainment media: a phenomenon requiring stronger controls in the Eastern Mediterranean Region.

Science.gov (United States)

El-Awa, Fatimah M S; El Naga, Randa Abou; Labib, Sahar; Latif, Nisreen Abdel

2018-04-05

Tobacco use and placement of tobacco products in television (TV) productions and movies is a way to promote tobacco use while avoiding tobacco advertising bans that exist in most countries. The fact that such productions are broadcast widely and viewed by millions, including children and young people, is of concern. This paper reviews the evidence on the use of tobacco advertising, promotion and sponsorship (TAPS) in TV and films in the Eastern Mediterranean Region and the ways to combat it. Evidence from Egypt shows considerable and increasing use of tobacco products by actors on screen, including female actors, in programmes aired during Ramadan in 2015-2017. A study of Iranian movies in 2015 showed that tobacco scenes in Iranian movies were increasing. In 2014, the WHO Regional Office for the Eastern Mediterranean held a consultative meeting on TAPS in drama. The consultation recommended regulating the tobacco presence in movies and TV through complete implementation of Article 13 of the WHO FCTC, and raising the issue to the WHO FCTC Conference of the Parties. In 2016, the Conference of the Parties called on parties to consider scaling up the implementation of WHO FCTC Article 13 and monitoring the use of TAPS in entertainment media in accordance with national legislation. A comprehensive approach is essential to end the tobacco industry's use of TV productions and movies to promote their products. Copyright © World Health Organization (WHO) 2018. Some rights reserved. This work is available under the CC BY-NC-SA 3.0 IGO license (https://creativecommons.org/licenses/by-nc-sa/3.0/igo).

Effect of Promoter Region Mutations and mgrA Overexpression on Transcription of norA, Which Encodes a Staphylococcus aureus Multidrug Efflux Transporter

OpenAIRE

Kaatz, Glenn W.; Thyagarajan, Rama V.; Seo, Susan M.

2005-01-01

NorA is a Staphylococcus aureus multidrug transporter that confers resistance to structurally distinct compounds. The MgrA global regulatory protein is reported to augment norA expression when mgrA is overexpressed from an undefined plasmid-based promoter. Further details about norA regulatory mechanisms are scant. A chromosomal norA::lacZ transcriptional fusion was constructed in different S. aureus strains, and allele replacement was used to define the relevance of promoter region sequences...

Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

Science.gov (United States)

Wyszyńska-Koko, J; Kurył, J

2004-01-01

MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

Regional Diversity and Diversification in Mammals.

Science.gov (United States)

Machac, Antonin; Graham, Catherine H

2017-01-01

The effects of regional diversity on diversification remain controversial. The classic hypothesis that diversification decelerates as regional diversity increases has been recently revived. Yet, there is little geographic evidence for slower diversification across regions of high diversity, and diversity is often thought to promote diversification through its effects on ecological divergence and speciation. Here, we use the newest phylogeny for mammals (4,990 species) and two different methods to test the effects of regional diversity on diversification. We find that regions of high diversity are dominated by expanding clades that are far from their estimated carrying capacities. Regions of low diversity host clades that are small and mostly saturated. These results were supported across mammals and their six largest orders. They were corroborated by the two methods when controlling for clade relatedness, clade nestedness, and clade size. Together, these results reject the hypothesis that high geographic concentration of mammals effectively suppresses their further diversification. Instead, highly diverse regions (especially the tropics) seem to act as the engine of mammalian richness.

Regional analysis of annual maximum rainfall using TL-moments method

Science.gov (United States)

Shabri, Ani Bin; Daud, Zalina Mohd; Ariff, Noratiqah Mohd

2011-06-01

Information related to distributions of rainfall amounts are of great importance for designs of water-related structures. One of the concerns of hydrologists and engineers is the probability distribution for modeling of regional data. In this study, a novel approach to regional frequency analysis using L-moments is revisited. Subsequently, an alternative regional frequency analysis using the TL-moments method is employed. The results from both methods were then compared. The analysis was based on daily annual maximum rainfall data from 40 stations in Selangor Malaysia. TL-moments for the generalized extreme value (GEV) and generalized logistic (GLO) distributions were derived and used to develop the regional frequency analysis procedure. TL-moment ratio diagram and Z-test were employed in determining the best-fit distribution. Comparison between the two approaches showed that the L-moments and TL-moments produced equivalent results. GLO and GEV distributions were identified as the most suitable distributions for representing the statistical properties of extreme rainfall in Selangor. Monte Carlo simulation was used for performance evaluation, and it showed that the method of TL-moments was more efficient for lower quantile estimation compared with the L-moments.

[Drug registries: post-marketing evaluation of the benefit-risk profile and promotion of appropriateness. The regional point of view].

Science.gov (United States)

Martelli, Luisa; Venegoni, Mauro

2013-06-01

Italian Regions and the Italian regulatory agency share a common interest in promoting the appropriateness of drug use, containing drug expenditure and acquiring additional evidence on the effectiveness and safety of drugs. Drug registries can help attaining these objectives. Specifically, the registries implemented in Italy were able to cover the first two objectives, whereas some critical issues were raised on the third one. For instance, the data recorded in the registries are not available at regional level to conduct safety and effectiveness investigations. This is a paradox, when considering that drugs included in the registries have a risk-benefit profile that is only partially defined at the moment of marketing. Currently, researchers and regions can conduct epidemiological research (cohort and case control studies), on the basis of record-linkage procedures, on all drugs prescribed in general practice (which are older drugs with a better defined risk-benefit profile). The expected outcomes of registries should be more clearly defined: when the main aim is to promote appropriateness, the recording of only a very limited amount of data should be required (to avoid a bureaucratic burden on clinicians).The Italian centers of the ENCePP network might play an important role in planning and conducting drug registries: through the presence in the steering committees of the registries, and in conducting epidemiological studies that make the most of this powerful instrument.

Promoter-region hypermethylation and expression downregulation of Yy1 (Yin yang 1) in preneoplastic liver lesions in a thioacetamide rat hepatocarcinogenesis model

International Nuclear Information System (INIS)

Abe, Hajime; Ogawa, Takashi; Wang, Liyun; Kimura, Masayuki; Tanaka, Takeshi; Morita, Reiko; Yoshida, Toshinori; Shibutani, Makoto

2014-01-01

Thioacetamide (TAA) has been used to develop a rodent model for hepatocarcinogenesis. To determine the genes with epigenetic modifications in early hepatocarcinogenesis, we did a genome-wide scan for hypermethylated promoter regions using CpG island microarrays in TAA-promoted rat liver tissue. Eight genes were selected based on the microarray profile; of these, Yy1 and Wdr45b were confirmed to be hypermethylated by methylation-specific polymerase chain reaction (PCR) and pyrosequencing and downregulated by real-time reverse transcription PCR. Non-neoplastic liver cells had nuclear Yy1 immunoreactivity, while preneoplastic foci with glutathione S-transferase placental form (GST-P) immunoreactivity had decreased Yy1 immunoreactivity. The incidence of these foci was proportional to the dose of TAA administered. Co-expression analysis of gene products downstream of Yy1 revealed increased nuclear phospho-c-Myc + foci as well as nuclear and cytoplasmic p21 Cip1+ foci in Yy1 − or GST-P + foci in response to TAA-promotion dose. Although the absolute number of cells was low, the incidence of death receptor 5 − foci was increased in Yy1 − foci in proportion to the TAA dose. Yy1 − /GST-P + foci revealed a higher number of proliferating cell nuclear antigen (PCNA)-immunoreactive cells than Yy1 + /GST-P + foci, while cleaved caspase-3 + cells were unchanged between Yy1 – /GST-P + and Yy1 + /GST-P + foci. In the case of Wdr45b, most GST-P + foci were Wdr45b – and were not increased by TAA promotion. These results suggest involvement of Yy1 in the epigenetic gene regulation at the early stages of TAA promoted cell proliferation and concomitant cell cycle arrest in preneoplastic lesions. - Highlights: • Epigenetically downregulated genes were searched in TAA-promnoted rat livers. • Yy1 and Wdr45b showed promoter-region hypermethylation and mRNA downregulation. • TAA promoted increase of preneoplastic Yy1 – /GST-P + foci showing high proliferation. • TAA

THE METHODS FOR ESTIMATING REGIONAL PROFESSIONAL MOBILE RADIO MARKET POTENTIAL

Directory of Open Access Journals (Sweden)

Y.À. Korobeynikov

2008-12-01

Full Text Available The paper represents the author’s methods of estimating regional professional mobile radio market potential, that belongs to high-tech b2b markets. These methods take into consideration such market peculiarities as great range and complexity of products, technological constraints and infrastructure development for the technological systems operation. The paper gives an estimation of professional mobile radio potential in Perm region. This estimation is already used by one of the systems integrator for its strategy development.

A General Method to Estimate Earthquake Moment and Magnitude using Regional Phase Amplitudes

Energy Technology Data Exchange (ETDEWEB)

Pasyanos, M E

2009-11-19

This paper presents a general method of estimating earthquake magnitude using regional phase amplitudes, called regional M{sub o} or regional M{sub w}. Conceptually, this method uses an earthquake source model along with an attenuation model and geometrical spreading which accounts for the propagation to utilize regional phase amplitudes of any phase and frequency. Amplitudes are corrected to yield a source term from which one can estimate the seismic moment. Moment magnitudes can then be reliably determined with sets of observed phase amplitudes rather than predetermined ones, and afterwards averaged to robustly determine this parameter. We first examine in detail several events to demonstrate the methodology. We then look at various ensembles of phases and frequencies, and compare results to existing regional methods. We find regional M{sub o} to be a stable estimator of earthquake size that has several advantages over other methods. Because of its versatility, it is applicable to many more events, particularly smaller events. We make moment estimates for earthquakes ranging from magnitude 2 to as large as 7. Even with diverse input amplitude sources, we find magnitude estimates to be more robust than typical magnitudes and existing regional methods and might be tuned further to improve upon them. The method yields a more meaningful quantity of seismic moment, which can be recast as M{sub w}. Lastly, it is applied here to the Middle East region using an existing calibration model, but it would be easy to transport to any region with suitable attenuation calibration.

ARCAL. Regional co-operative arrangements for the promotion of nuclear science and technology in Latin America, Phase I (1985-1990)

International Nuclear Information System (INIS)

Gillen, V.A.

1990-09-01

The Regional Co-operative Arrangement for the Promotion of Nuclear Science and Technology in Latin America, ARCAL, has completed its first five-year phase (1985-1989). This booklet summarizes the first phase of the ARCAL programme and contains descriptions of projects in the fields of agriculture, medicine, industry and energy

A method to the impact assessment of the returning grazing land to grassland project on regional eco-environmental vulnerability

International Nuclear Information System (INIS)

Shao, Huaiyong; Sun, Xiaofei; Wang, Haoxue; Zhang, Xiaoxue; Xiang, Zhiying; Tan, Rui; Chen, Xuanyi; Xian, Wei; Qi, Jiaguo

2016-01-01

The Chinese government has conducted the Returning Grazing Land to Grassland Project (RGLGP) across large portions of grasslands from western China since 2003. In order to explore and understand the impact in the grassland's eco-environment during the RGLGP, we utilized Projection Pursuit Model (PPM) and Geographic Information System (GIS) to develop a spatial assessment model to examine the ecological vulnerability of the grassland. Our results include five indications: (1) it is practical to apply the spatial PPM on ecological vulnerability assessment for the grassland. This methodology avoids creating an artificial hypothesis, thereby providing objective results that successfully execute a multi-index assessment process and analysis under non-linear systems in eco-environments; (2) the spatial PPM is not only capable of evaluating regional eco-environmental vulnerability in a quantitative way, but also can quantitatively demonstrate the degree of effect in each evaluation index for regional eco-environmental vulnerability; (3) the eco-environment of the Xianshui River Basin falls into the medium range level. The normalized difference vegetation index (NDVI) and land use cover and change (LUCC) crucially influence the Xianshui River Basin's eco-environmental vulnerability. Generally, in the Xianshui River Basin, regional eco-environmental conditions improved during 2000 and 2010. The RGLGP positively affected NDVI and LUCC structure, thereby promoting the enhancement of the regional eco-environment; (4) the Xianshui River Basin divides its ecological vulnerability across different levels; therefore our study investigates three ecological regions and proposes specific suggestions for each in order to assist in eco-environmental protection and rehabilitation; and lastly that (5) the spatial PPM established by this study has the potential to be applied on all types of grassland eco-environmental vulnerability assessments under the RGLGP and under the similar

A method to the impact assessment of the returning grazing land to grassland project on regional eco-environmental vulnerability

Energy Technology Data Exchange (ETDEWEB)

Shao, Huaiyong, E-mail: huaiyongshao@163.com [Key Laboratory of Geoscience Spatial Information Technology, Ministry of Land and Resources of China, Chengdu University of Technology, Chengdu 610059, Sichuan (China); Center for Global Change and Earth Observations, Michigan State University, East Lansing 48823, MI (United States); Sun, Xiaofei; Wang, Haoxue; Zhang, Xiaoxue [Key Laboratory of Geoscience Spatial Information Technology, Ministry of Land and Resources of China, Chengdu University of Technology, Chengdu 610059, Sichuan (China); Xiang, Zhiying [School of Earth Sciences, Zhejiang University, Hangzhou 310027, Zhejiang (China); Tan, Rui; Chen, Xuanyi [Key Laboratory of Geoscience Spatial Information Technology, Ministry of Land and Resources of China, Chengdu University of Technology, Chengdu 610059, Sichuan (China); Xian, Wei [College of Resources and Environment, Chengdu University of Information Technology, Chengdu 610225, Sichuan (China); Qi, Jiaguo [Center for Global Change and Earth Observations, Michigan State University, East Lansing 48823, MI (United States)

2016-01-15

The Chinese government has conducted the Returning Grazing Land to Grassland Project (RGLGP) across large portions of grasslands from western China since 2003. In order to explore and understand the impact in the grassland's eco-environment during the RGLGP, we utilized Projection Pursuit Model (PPM) and Geographic Information System (GIS) to develop a spatial assessment model to examine the ecological vulnerability of the grassland. Our results include five indications: (1) it is practical to apply the spatial PPM on ecological vulnerability assessment for the grassland. This methodology avoids creating an artificial hypothesis, thereby providing objective results that successfully execute a multi-index assessment process and analysis under non-linear systems in eco-environments; (2) the spatial PPM is not only capable of evaluating regional eco-environmental vulnerability in a quantitative way, but also can quantitatively demonstrate the degree of effect in each evaluation index for regional eco-environmental vulnerability; (3) the eco-environment of the Xianshui River Basin falls into the medium range level. The normalized difference vegetation index (NDVI) and land use cover and change (LUCC) crucially influence the Xianshui River Basin's eco-environmental vulnerability. Generally, in the Xianshui River Basin, regional eco-environmental conditions improved during 2000 and 2010. The RGLGP positively affected NDVI and LUCC structure, thereby promoting the enhancement of the regional eco-environment; (4) the Xianshui River Basin divides its ecological vulnerability across different levels; therefore our study investigates three ecological regions and proposes specific suggestions for each in order to assist in eco-environmental protection and rehabilitation; and lastly that (5) the spatial PPM established by this study has the potential to be applied on all types of grassland eco-environmental vulnerability assessments under the RGLGP and under the

Limited-memory trust-region methods for sparse relaxation

Science.gov (United States)

Adhikari, Lasith; DeGuchy, Omar; Erway, Jennifer B.; Lockhart, Shelby; Marcia, Roummel F.

2017-08-01

In this paper, we solve the l2-l1 sparse recovery problem by transforming the objective function of this problem into an unconstrained differentiable function and applying a limited-memory trust-region method. Unlike gradient projection-type methods, which uses only the current gradient, our approach uses gradients from previous iterations to obtain a more accurate Hessian approximation. Numerical experiments show that our proposed approach eliminates spurious solutions more effectively while improving computational time.

Promoting biogas production and using it as transport fuel in the Helsinki region; Suunnitelma liikennebiokaasun tuotannon ja kaeytoen edistaemiseksi Helsingin seudulla

Energy Technology Data Exchange (ETDEWEB)

Rasi, S.; Havukainen, J.; Uusitalo, V.; Andersson, R.; Manninen, K.; Aro-Heinilae, E.; Rintala, J.

2012-11-01

The main objective of the project was to promote biogas production and its use as transport fuel. The aims in the four Finnish and two Estonian case areas were to reduce the amount and improve the sustainable use of waste and sludge, to promote biogas production, to start biogas use as transport fuel and to provide tools for implementing the aims. The total biomethane potential in the Helsinki region corresponds to approximately 450 GWh/a. The most potential user for biomethane is public transport. The total amount of biomethane would suffice for 80% of the busses operating in the Helsinki region. Using biogas as a transport fuel instead of energy production in the Helsinki region would result in emission reductions (13 000 t{sub CO2,eq}/a). However if the fuel replacing biogas in energy production would be renewable, the emission reductions would be significantly greater. The economical assessment indicates that the production of biogas is economically feasible if all the produced gas can be sold. Biogas produced near the natural gas grid can also be transported to the Helsinki region where there are better possibilities to find uses for it. In this way, for example, gas that is produced in Kymenlaakso but is not consumed there can be transported via the natural gas grid, assuming that the production plant is reasonably close to the grid. (orig.)

Qualitative analysis of Adenomatous Polyposis Coli promoter: Hypermethylation, engagement and effects on survival of patients with esophageal cancer in a high risk region of the world, a potential molecular marker

Directory of Open Access Journals (Sweden)

Nasseri Negin

2009-01-01

Full Text Available Abstract Background Squamous cell carcinoma of esophagus (SCCE occurs at a high incidence rate in certain parts of the world. This feature necessitates that different aspects of the disease and in particular genetic characteristics be investigated in such regions. In addition, such investigations might lead to achievement of molecular markers helpful for early detection, successful treatment and follow up of the disease. Adenomatous Polyposis Coli (APC promoter hypermethylation has been shown to be a suitable marker for both serum and solid tumors of adenocarcinoma of esophagus. We investigated the status of APC promoter hypermethylation in Iranian patients, compared the results with the former studies, and evaluated its applicability as a candidate molecular marker by examining association between survival of SCCE patients and APC promoter methylation. Methods For evaluating the status of APC promoter hypermethylation and its association with SCCE, a qualitative methylation specific PCR (MSP was used. DNA was extracted and digested with an appropriate restriction enzyme, treated with sodium bisulfite in agarose beads and amplified in two-step PCR reaction by applying either methylated or unmethylated promoter specific primers. Universally methylated DNA and methylase treated blood DNA of healthy donors were used as positive controls as well. Survival of patients was followed up for two years after treatment and survival rate of patients with methylated APC promoter was compared with that of unmethylated patients. Results Assessment of APC promoter methylation revealed that normal tissues were unmethylated, while twenty out of forty five (44.4% tumor tissues were hypermethylated either in one or both alleles of APC. Among the tissues in which methylation was detected, seven were hypermethylated in both alleles while the other thirteen were hypermethylated in one of the two alleles of APC. Analyzing two-year survival rate of patients with respect

Perceptions of health promoters about health promotion programmes for families with adolescents orphaned as a result of AIDS in the rural Hammanskraal region in South Africa

Directory of Open Access Journals (Sweden)

Maseapo P. Mthobeni

2013-02-01

Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information.Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering

Perceptions of health promoters about health promotion programmes for families with adolescents orphaned as a result of AIDS in the rural Hammanskraal region in South Africa

Directory of Open Access Journals (Sweden)

Maseapo P. Mthobeni

2013-02-01

Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information. Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering

Regional collaborations and indigenous innovation capabilities in China: A multivariate method for the analysis of regional innovation systems

OpenAIRE

Zhao, S.L.; Cacciolatti, L.; Lee, Soo Hee; Song, W.

2014-01-01

In this study we analyse the emerging patterns of regional collaboration for innovation projects in China, using official government statistics of 30 Chinese regions. We propose the use of Ordinal Multidimensional Scaling and Cluster analysis as a robust method to study regional innovation systems. Our results show that regional collaborations amongst organisations can be categorised by means of eight dimensions: public versus private organisational mindset; public versus private resources; i...

Promoters of Escherichia coli versus promoter islands: function and structure comparison.

Directory of Open Access Journals (Sweden)

Valeriy V Panyukov

Full Text Available Expression of bacterial genes takes place under the control of RNA polymerase with exchangeable σ-subunits and multiple transcription factors. A typical promoter region contains one or several overlapping promoters. In the latter case promoters have the same or different σ-specificity and are often subjected to different regulatory stimuli. Genes, transcribed from multiple promoters, have on average higher expression levels. However, recently in the genome of Escherichia coli we found 78 regions with an extremely large number of potential transcription start points (promoter islands, PIs. It was shown that all PIs interact with RNA polymerase in vivo and are able to form transcriptionally competent open complexes both in vitro and in vivo but their transcriptional activity measured by oligonucleotide microarrays was very low, if any. Here we confirmed transcriptional defectiveness of PIs by analyzing the 5'-end specific RNA-seq data, but showed their ability to produce short oligos (9-14 bases. This combination of functional properties indicated a deliberate suppression of transcriptional activity within PIs. According to our data this suppression may be due to a specific conformation of the DNA double helix, which provides an ideal platform for interaction with both RNA polymerase and the histone-like nucleoid protein H-NS. The genomic DNA of E.coli contains therefore several dozen sites optimized by evolution for staying in a heterochromatin-like state. Since almost all promoter islands are associated with horizontally acquired genes, we offer them as specific components of bacterial evolution involved in acquisition of foreign genetic material by turning off the expression of toxic or useless aliens or by providing optimal promoter for beneficial genes. The putative molecular mechanism underlying the appearance of promoter islands within recipient genomes is discussed.

Methylation in the promoter regions of WT1, NKX6-1 and DBC1 genes in cervical cancer tissues of Uygur women in Xinjiang

Directory of Open Access Journals (Sweden)

Dan Wu

Full Text Available Abstract This study aimed to explore: 1 DNA methylation in the promoter regions of Wilms tumor gene 1 (WT1, NK6 transcription factor related locus 1 gene (NKX6-1 and Deleted in bladder cancer 1 (DBC1 gene in cervical cancer tissues of Uygur women in Xinjiang, and 2 the correlation of gene methylation with the infection of HPV16/18 viruses. We detected HPV16/18 infection in 43 normal cervical tissues, 30 cervical intraepithelial neoplasia lesions (CIN and 48 cervical cancer tissues with polymerase chain reaction (PCR method. Methylation in the promoter regions of the WT1, NKX6-1 and DBC1 genes in the above-mentioned tissues was measured by methylation-specific PCR (MSP and cloning sequencing. The expression level of these three genes was measured by real-time PCR (qPCR in 10 methylation-positive cervical cancer tissues and 10 methylation-negative normal cervical tissues. We found that the infection of HPV16 in normal cervical tissues, CIN and cervical cancer tissues was 14.0, 36.7 and 66.7%, respectively. The infection of HPV18 was 0, 6.7 and 10.4%, respectively. The methylation rates of WT1, NKX6-1 and DBC1 genes were 7.0, 11.6 and 23.3% in normal cervical tissues, 36.7, 46.7 and 30.0% in CIN tissues, and 89.6, 77.1 and 85.4% in cervical cancer tissues. Furthermore, WT1, NKX6-1 and DBC1 genes were hypermethylated in the high-grade squamous intraepithelial lesion (CIN2, CIN3 and in the cervical cancer tissues with infection of HPV16/18 (both P< 0.05. The expression of WT1, NKX6-1 and DBC1 was significantly lower in the methylation-positive cervical cancer tissues than in methylation-negative normal cervical tissues. Our findings indicated that methylation in the promoter regions of WT1, NKX6-1 and DBC1 is correlated with cervical cancer tumorigenesis in Uygur women. The infection of HPV16/18 might be correlated with methylation in these genes. Gene inactivation caused by methylation might be related to the incidence and development of cervical

An overview of translation in language teaching methods: implications for EFL in secondary education in the region of Murcia

Directory of Open Access Journals (Sweden)

Teresa Marqués Aguado

2013-07-01

Full Text Available Various activities and resources have been used across time to promote and enhance the learning of foreign languages. Among these, translation has been cherished or dismissed depending on the preferred teaching method at each period. With the arrival of the Communicative approach, which focuses on communicative competence, its role has apparently become even more unstable.This article seeks to explore the role of translation in the main teaching methods used in Spain. This will in turn serve as the background against which the current educational scenario (with the communicative approach and the tenets of the Common European Framework of Reference for Languages will be measured with a view to ascertaining the role that translation may currently play. The particular situation of Secondary Education in the Region of Murcia will be discussed in the light of the curricula for this stage.

Method for Selection of Solvents for Promotion of Organic Reactions

DEFF Research Database (Denmark)

Gani, Rafiqul; Jiménez-González, Concepción; Constable, David J.C.

2005-01-01

is to produce, for a given reaction, a short list of chemicals that could be considered as potential solvents, to evaluate their performance in the reacting system, and, based on this, to rank them according to a scoring system. Several examples of application are given to illustrate the main features and steps......A method to select appropriate green solvents for the promotion of a class of organic reactions has been developed. The method combines knowledge from industrial practice and physical insights with computer-aided property estimation tools for selection/design of solvents. In particular, it employs...... estimates of thermodynamic properties to generate a knowledge base of reaction, solvent and environment related properties that directly or indirectly influence the rate and/or conversion of a given reaction. Solvents are selected using a rules-based procedure where the estimated reaction-solvent properties...

Effect of metallothionein core promoter region polymorphism on cadmium, zinc and copper levels in autopsy kidney tissues from a Turkish population

International Nuclear Information System (INIS)

Kayaalti, Zeliha; Mergen, Goerkem; Soeylemezoglu, Tuelin

2010-01-01

Metallothioneins (MTs) are metal-binding, low molecular weight proteins and are involved in pathophysiological processes like metabolism of essential metals, metal ion homeostasis and detoxification of heavy metals. Metallothionein expression is induced by various heavy metals especially cadmium, mercury and zinc; MTs suppress toxicity of heavy metals by binding themselves to these metals. The aim of this study was to investigate the association between the - 5 A/G metallothionein 2A (MT2A) single nucleotide polymorphism (SNP) and Cd, Zn and Cu levels in the renal cortex from autopsy cases. MT2A core promoter region - 5 A/G SNP was analyzed by PCR-RFLP method using 114 autopsy kidney tissues and the genotype frequencies of this polymorphism were found as 87.7% homozygote typical (AA), 11.4% heterozygote (AG) and 0.9% homozygote atypical (GG). In order to assess the Cd, Zn and Cu levels in the same autopsy kidney tissues, a dual atomic absorption spectrophotometer system was used and the average levels of Cd, Zn and Cu were measured as 95.54 ± 65.58 μg/g, 181.20 ± 87.72 μg/g and 17.14 ± 16.28 μg/g, respectively. As a result, no statistical association was found between the - 5 A/G SNP in the MT2A gene and the Zn and Cu levels in the renal cortex (p > 0.05), but considerably high accumulation of Cd was monitored for individuals having AG (151.24 ± 60.21 μg/g) and GG genotypes (153.09 μg/g) compared with individuals having AA genotype (87.72 ± 62.98 μg/g) (p < 0.05). These results show that the core promoter region polymorphism of metallothionein 2A increases the accumulation of Cd in human renal cortex.

ESR1 gene promoter region methylation in free circulating DNA and its correlation with estrogen receptor protein expression in tumor tissue in breast cancer patients

International Nuclear Information System (INIS)

Martínez-Galán, Joaquina; Ríos, Sandra; Delgado, Juan Ramón; Torres-Torres, Blanca; Núñez, María Isabel; López-Peñalver, Jesús; Del Moral, Rosario; Ruiz De Almodóvar, José Mariano; Menjón, Salomón; Concha, Ángel; Chamorro, Clara

2014-01-01

Tumor expression of estrogen receptor (ER) is an important marker of prognosis, and is predictive of response to endocrine therapy in breast cancer. Several studies have observed that epigenetic events, such methylation of cytosines and deacetylation of histones, are involved in the complex mechanisms that regulate promoter transcription. However, the exact interplay of these factors in transcription activity is not well understood. In this study, we explored the relationship between ER expression status in tumor tissue samples and the methylation of the 5′ CpG promoter region of the estrogen receptor gene (ESR1) isolated from free circulating DNA (fcDNA) in plasma samples from breast cancer patients. Patients (n = 110) with non-metastatic breast cancer had analyses performed of ER expression (luminal phenotype in tumor tissue, by immunohistochemistry method), and the ESR1-DNA methylation status (fcDNA in plasma, by quantitative methylation specific PCR technique). Our results showed a significant association between presence of methylated ESR1 in patients with breast cancer and ER negative status in the tumor tissue (p = 0.0179). There was a trend towards a higher probability of ESR1-methylation in those phenotypes with poor prognosis i.e. 80% of triple negative patients, 60% of HER2 patients, compared to 28% and 5.9% of patients with better prognosis such as luminal A and luminal B, respectively. Silencing, by methylation, of the promoter region of the ESR1 affects the expression of the estrogen receptor protein in tumors of breast cancer patients; high methylation of ESR1-DNA is associated with estrogen receptor negative status which, in turn, may be implicated in the patient’s resistance to hormonal treatment in breast cancer. As such, epigenetic markers in plasma may be of interest as new targets for anticancer therapy, especially with respect to endocrine treatment

A statistical method (cross-validation) for bone loss region detection after spaceflight

Science.gov (United States)

Zhao, Qian; Li, Wenjun; Li, Caixia; Chu, Philip W.; Kornak, John; Lang, Thomas F.

2010-01-01

Astronauts experience bone loss after the long spaceflight missions. Identifying specific regions that undergo the greatest losses (e.g. the proximal femur) could reveal information about the processes of bone loss in disuse and disease. Methods for detecting such regions, however, remains an open problem. This paper focuses on statistical methods to detect such regions. We perform statistical parametric mapping to get t-maps of changes in images, and propose a new cross-validation method to select an optimum suprathreshold for forming clusters of pixels. Once these candidate clusters are formed, we use permutation testing of longitudinal labels to derive significant changes. PMID:20632144

Promoting regional energy co-operation in South Asia

International Nuclear Information System (INIS)

Srivastava, Leena; Misra, Neha

2007-01-01

Energy is a key ingredient of the socio-economic development of any region. South Asia is not only one of the fastest growing regions in the world; it is also one of the poorest, which thus puts energy at the very heart of the development process in the region. This paper looks at the challenges faced by the South Asia sub-region for economic co-operation (SASEC) comprised of Bangladesh, Bhutan, India and Nepal, and also at the role of greater regional energy co-operation therein. The region is characterized by pressures of growing economies and increasing population. While the per capita energy consumption is one of the lowest in the world, energy intensity continues to be very high. A large portion of the population lacks access to modern sources of energy and depends on traditional sources that are not only inefficient but also have severe health and environmental problems associated with them. Increasing oil import dependency and huge investment needs for energy market development pose a further challenge. The region has a good resource potential and tremendous scope for energy co-operation, which can play a key role in addressing many of these energy security concerns and in putting it on the path of sustainable development. It is ironic that the record in the area has been so limited and that too in the most basic form of co-operation, i.e. bilateral arrangements between countries. This paper puts forth a multi-pronged strategy for sub-regional energy co-operation encompassing softer options aimed at confidence building to more substantial and larger scale co-operation efforts. Delays in decision making to ensure stronger and mutually beneficial co-operation efforts are associated with high costs not only to the energy sector but also for the entire development agenda. With the precarious energy situation in the region and unprecedented increases in international oil prices seen in recent times, it is high time for policy makers, financing institutions, NGOs

Tissue specific promoters improve the localization of radiation-inducible gene expression

International Nuclear Information System (INIS)

Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph

1996-01-01

Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene

Risk-based prioritization method for the classification of groundwater pesticide pollution from agricultural regions.

Science.gov (United States)

Yang, Yu; Lian, Xin-Ying; Jiang, Yong-Hai; Xi, Bei-Dou; He, Xiao-Song

2017-11-01

Agricultural regions are a significant source of groundwater pesticide pollution. To ensure that agricultural regions with a significantly high risk of groundwater pesticide contamination are properly managed, a risk-based ranking method related to groundwater pesticide contamination is needed. In the present paper, a risk-based prioritization method for the classification of groundwater pesticide pollution from agricultural regions was established. The method encompasses 3 phases, including indicator selection, characterization, and classification. In the risk ranking index system employed here, 17 indicators involving the physicochemical properties, environmental behavior characteristics, pesticide application methods, and inherent vulnerability of groundwater in the agricultural region were selected. The boundary of each indicator was determined using K-means cluster analysis based on a survey of a typical agricultural region and the physical and chemical properties of 300 typical pesticides. The total risk characterization was calculated by multiplying the risk value of each indicator, which could effectively avoid the subjectivity of index weight calculation and identify the main factors associated with the risk. The results indicated that the risk for groundwater pesticide contamination from agriculture in a region could be ranked into 4 classes from low to high risk. This method was applied to an agricultural region in Jiangsu Province, China, and it showed that this region had a relatively high risk for groundwater contamination from pesticides, and that the pesticide application method was the primary factor contributing to the relatively high risk. The risk ranking method was determined to be feasible, valid, and able to provide reference data related to the risk management of groundwater pesticide pollution from agricultural regions. Integr Environ Assess Manag 2017;13:1052-1059. © 2017 SETAC. © 2017 SETAC.

A single-copy galK promoter cloning vector suitable for cloning strong promoters

DEFF Research Database (Denmark)

Dandanell, Gert; Court, Donald L.; Hammer, Karin

1986-01-01

We report the construction of lambda galK promoter cloning vectors for cloning and characterization of strong promoters. This phage, which contains a unique HindIII cloning site, was applied to the cloning and analysis of transcription initiations of the regulatory region of the deo-operon of...

Stochastic rainfall synthesis for urban applications using different regionalization methods

Science.gov (United States)

Callau Poduje, A. C.; Leimbach, S.; Haberlandt, U.

2017-12-01

The proper design and efficient operation of urban drainage systems require long and continuous rainfall series in a high temporal resolution. Unfortunately, these time series are usually available in a few locations and it is therefore suitable to develop a stochastic precipitation model to generate rainfall in locations without observations. The model presented is based on an alternating renewal process and involves an external and an internal structure. The members of these structures are described by probability distributions which are site specific. Different regionalization methods based on site descriptors are presented which are used for estimating the distributions for locations without observations. Regional frequency analysis, multiple linear regressions and a vine-copula method are applied for this purpose. An area located in the north-west of Germany is used to compare the different methods and involves a total of 81 stations with 5 min rainfall records. The site descriptors include information available for the whole region: position, topography and hydrometeorologic characteristics which are estimated from long term observations. The methods are compared directly by cross validation of different rainfall statistics. Given that the model is stochastic the evaluation is performed based on ensembles of many long synthetic time series which are compared with observed ones. The performance is as well indirectly evaluated by setting up a fictional urban hydrological system to test the capability of the different methods regarding flooding and overflow characteristics. The results show a good representation of the seasonal variability and good performance in reproducing the sample statistics of the rainfall characteristics. The copula based method shows to be the most robust of the three methods. Advantages and disadvantages of the different methods are presented and discussed.

Regional frequency analysis of extreme rainfalls using partial L moments method

Science.gov (United States)

Zakaria, Zahrahtul Amani; Shabri, Ani

2013-07-01

An approach based on regional frequency analysis using L moments and LH moments are revisited in this study. Subsequently, an alternative regional frequency analysis using the partial L moments (PL moments) method is employed, and a new relationship for homogeneity analysis is developed. The results were then compared with those obtained using the method of L moments and LH moments of order two. The Selangor catchment, consisting of 37 sites and located on the west coast of Peninsular Malaysia, is chosen as a case study. PL moments for the generalized extreme value (GEV), generalized logistic (GLO), and generalized Pareto distributions were derived and used to develop the regional frequency analysis procedure. PL moment ratio diagram and Z test were employed in determining the best-fit distribution. Comparison between the three approaches showed that GLO and GEV distributions were identified as the suitable distributions for representing the statistical properties of extreme rainfall in Selangor. Monte Carlo simulation used for performance evaluation shows that the method of PL moments would outperform L and LH moments methods for estimation of large return period events.

Promotion and regional development. Implementation of regional productive development agencies. The case of Maule region, Chile

Directory of Open Access Journals (Sweden)

Enrique Yamil Alul González

2010-12-01

Full Text Available The Regional Productive Development Agencies implemented in Chile in 2006, were developed as a way to answer the longing desire to territorially decentralize, and that the own Regions be whom define their future. The Agencies have the responsibility to develop innovation and productive development Agendas in participative processes, which means with public, academic and private actors. Also, the Agencies have the mission to implement Competitive Improvement Plans-PMC (clusters in prioritized economic sectors by the own region. These PMC are leaded by private actors in each sector.

A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

DEFF Research Database (Denmark)

Hansen, Martin A; Nielsen, John E; Retelska, Dorota

2008-01-01

, sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...

Control of growth promotion (CGP) and screening for malnutrition in central region and Lomé-Commune, January to June 2013 Togo

International Nuclear Information System (INIS)

Touglo, Adavi Lonlon; Bouraima, Mouawiyatou; Agbozouhoue, A. Eya; Bebou, Midassirou; Tchapo, Dapou; Akolly, Koffi

2014-01-01

Full text: Background: Control of Growth Promotion (CGP) is an activity that can detect early if the child has a developmental problem and investigate the cause and take appropriate decisions to overcome the consequences. In Togo, the goal in 2013 is to weigh at least 80 % of children 0-5 years during the sessions of CGP. What are the levels achieved this goal after the first semester and the problems of malnutrition detected? Method: We conducted a descriptive cross-sectional study data collected in the quarterly reports in two regions of Togo, Lomé - Commune in the South and Central Region in the North. The study involved data from the first semester of 2013 in all districts of the two regions. Database monitoring activities at national level CGP was used. Data from the two regions were separated and analyzed using Excel. Comparison tests of proportions were made using Epi Info 7. Results: Detection rate of nutritional status by the CGP in the first half of 2013 was 29% of the total target of 155,423 children under 5 years in the two regions. This rate was higher for the Central region (33 %) than for Lomé-Commune (26 %). No district has reached half of the goals. Their rates vary from 17.9 % and 18 % respectively for District No. 2 and District No. 4 of Lomé-Commune to 39.7% for the District of Tchaoudjo. The malnutrition rate was 8.8 %. This rate is higher in the Central region (10.9 %) than in Lomé-Commune (6.8 %) with a RR = 1.59, 95% CI = [1.50 to 1.69]. Severe malnutrition was 1.4 %. It is predominant in Lomé-commune (1.7 %) than in the Central region (1.1%) with a RR = 1.55, 95% CI = [1.32 to 1.82]. Conclusion: All districts in the two regions are below the target detection rate in the first half. The CGP has detected cases of moderate and severe malnutrition. To compare that rates with the survey data, the screening tools must be standard and adequate. (author)

A Sequential Kriging reliability analysis method with characteristics of adaptive sampling regions and parallelizability

International Nuclear Information System (INIS)

Wen, Zhixun; Pei, Haiqing; Liu, Hai; Yue, Zhufeng

2016-01-01

The sequential Kriging reliability analysis (SKRA) method has been developed in recent years for nonlinear implicit response functions which are expensive to evaluate. This type of method includes EGRA: the efficient reliability analysis method, and AK-MCS: the active learning reliability method combining Kriging model and Monte Carlo simulation. The purpose of this paper is to improve SKRA by adaptive sampling regions and parallelizability. The adaptive sampling regions strategy is proposed to avoid selecting samples in regions where the probability density is so low that the accuracy of these regions has negligible effects on the results. The size of the sampling regions is adapted according to the failure probability calculated by last iteration. Two parallel strategies are introduced and compared, aimed at selecting multiple sample points at a time. The improvement is verified through several troublesome examples. - Highlights: • The ISKRA method improves the efficiency of SKRA. • Adaptive sampling regions strategy reduces the number of needed samples. • The two parallel strategies reduce the number of needed iterations. • The accuracy of the optimal value impacts the number of samples significantly.

Sequencing of DC-SIGN promoter indicates an association between promoter variation and risk of nasopharyngeal carcinoma in cantonese

Directory of Open Access Journals (Sweden)

Liu Wen-Sheng

2010-11-01

Full Text Available Abstract Background The dendritic cell-specific intercellular adhesion molecule 3 grabbing non-integrin (DC-SIGN is an important pathogen recognition receptor of the innate immune system. DC-SIGN promoter variants play important role in the susceptibility to various infectious diseases. Nasopharyngeal carcinoma (NPC is a malignancy that is common in southern China and whether DC-SIGN promoter variants have effects on susceptibility to NPC is still unknown. The aim of this study is to ascertain the potential involvement of DC-SIGN promoter single nucleotide polymorphisms (SNPs in NPC susceptibility. Methods We conducted a case control study based on Cantonese population including 444 NPC patients and 464 controls matched on age and sex. The 1041 bp of DC-SIGN promoter region was directly sequenced for all samples. Sequence alignment and SNP search were inspected using DNAStar analysis programs and haplotype frequencies were estimated in Haploview V 4.0. The associations between the SNPs and the risk of NPC were analyzed using chi-square test and non-conditional logistic regression analysis with SPSS 13.0 software. Results A total of six variants were observed in the DC-SIGN promoter region and DC-SIGN -139 GG and -939 AA were significantly associated with NPC risk with adjusted Odds Ratios (ORs of 2.10 (95% confidence interval [CI] = 1.23-3.59; P = 0.006 and 2.52 (1.29-4.93; P = 0.007 respectively and subjects carrying the risk allele DC-SIGN -871 G had 1.47-fold (95% CI = 1.14-1.90 increased risks of developing NPC (P = 0.003. Haplotype analysis revealed that h1 'AAAG' was significantly associated with protection against NPC (OR = 0.69; P = 0.0002 and the association was still significant when using 1000 permutation test runs (P = 0.001. Conclusions Our study indicated that DC-SIGN promoter variants appear to be involved in the susceptibility to NPC and the detailed mechanism of this effect need further studies.

Revisiting regional flood frequency analysis in Slovakia: the region-of-influence method vs. traditional regional approaches

Science.gov (United States)

Gaál, Ladislav; Kohnová, Silvia; Szolgay, Ján.

2010-05-01

During the last 10-15 years, the Slovak hydrologists and water resources managers have been devoting considerable efforts to develop statistical tools for modelling probabilities of flood occurrence in a regional context. Initially, these models followed concepts to regional flood frequency analysis that were based on fixed regions, later the Hosking and Wallis's (HW; 1997) theory was adopted and modified. Nevertheless, it turned out to be that delineating homogeneous regions using these approaches is not a straightforward task, mostly due to the complex orography of the country. In this poster we aim at revisiting flood frequency analyses so far accomplished for Slovakia by adopting one of the pooling approaches, i.e. the region-of-influence (ROI) approach (Burn, 1990). In the ROI approach, unique pooling groups of similar sites are defined for each site under study. The similarity of sites is defined through Euclidean distance in the space of site attributes that had also proved applicability in former cluster analyses: catchment area, afforested area, hydrogeological catchment index and the mean annual precipitation. The homogeneity of the proposed pooling groups is evaluated by the built-in homogeneity test by Lu and Stedinger (1992). Two alternatives of the ROI approach are examined: in the first one the target size of the pooling groups is adjusted to the target return period T of the estimated flood quantiles, while in the other one, the target size is fixed, regardless of the target T. The statistical models of the ROI approach are inter-compared by the conventional regionalization approach based on the HW methodology where the parameters of flood frequency distributions were derived by means of L-moment statistics and a regional formula for the estimation of the index flood was derived by multiple regression methods using physiographic and climatic catchment characteristics. The inter-comparison of different frequency models is evaluated by means of the

Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Is Not Associated With Paroxetine-Induced Ejaculation Delay in Dutch Men With Lifelong Premature Ejaculation

NARCIS (Netherlands)

Janssen, Paddy K. C.; Zwinderman, Aeilko H.; Olivier, Berend; Waldinger, Marcel D.

2014-01-01

To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). This was a prospective study of 10 weeks of paroxetine treatment in 54 men with LPE.

CNN-PROMOTER, NEW CONSENSUS PROMOTER PREDICTION PROGRAM BASED ON NEURAL NETWORKS CNN-PROMOTER, NUEVO PROGRAMA PARA LA PREDICCIÓN DE PROMOTORES BASADO EN REDES NEURONALES CNN-PROMOTER, NOVO PROGRAMA PARA A PREDIÇÃO DE PROMOTORES BASEADO EM REDES NEURONAIS

Directory of Open Access Journals (Sweden)

Óscar Bedoya

2011-06-01

Full Text Available A new promoter prediction program called CNN-Promoter is presented. CNN-Promoter allows DNA sequences to be submitted and predicts them as promoter or non-promoter. Several methods have been developed to predict the promoter regions of genomes in eukaryotic organisms including algorithms based on Markov's models, decision trees, and statistical methods. Although there are plenty of programs proposed, there is still a need to improve the sensitivity and specificity values. In this paper, a new program is proposed; it is based on the consensus strategy of using experts to make a better prediction. The consensus strategy is developed by using neural networks. During the training process, the sensitivity and specificity were 100 % and during the test process the model reaches a sensitivity of 74.5 % and a specificity of 82.7 %.En este artículo se presenta un programa nuevo para la predicción de promotores llamado CNN-Promoter, que toma como entrada secuencias de ADN y las clasifica como promotor o no promotor. Se han desarrollado diversos métodos para predecir las regiones promotoras en organismos eucariotas, muchos de los cuales se basan en modelos de Markov, árboles de decisión y métodos estadísticos. A pesar de la variedad de programas existentes para la predicción de promotores, se necesita aún mejorar los valores de sensibilidad y especificidad. Se propone un nuevo programa que se basa en la estrategia de mezcla de expertos usando redes neuronales. Los resultados obtenidos en las pruebas alcanzan valores de sensibilidad y especificidad de 100 % en el entrenamiento y de 74,5 % de sensibilidad y 82,7 % de especificidad en los conjuntos de validación y prueba.Neste artigo a presenta-se um novo programa para a predição de promotores chamado CNN-Promoter, que toma como entrada sequências de DNA e as classifica como promotor ou não promotor. Desenvolveramse diversos métodos para predizer as regiões promotoras em organismos eucariotas

Digital Sequences and a Time Reversal-Based Impact Region Imaging and Localization Method

Science.gov (United States)

Qiu, Lei; Yuan, Shenfang; Mei, Hanfei; Qian, Weifeng

2013-01-01

To reduce time and cost of damage inspection, on-line impact monitoring of aircraft composite structures is needed. A digital monitor based on an array of piezoelectric transducers (PZTs) is developed to record the impact region of impacts on-line. It is small in size, lightweight and has low power consumption, but there are two problems with the impact alarm region localization method of the digital monitor at the current stage. The first one is that the accuracy rate of the impact alarm region localization is low, especially on complex composite structures. The second problem is that the area of impact alarm region is large when a large scale structure is monitored and the number of PZTs is limited which increases the time and cost of damage inspections. To solve the two problems, an impact alarm region imaging and localization method based on digital sequences and time reversal is proposed. In this method, the frequency band of impact response signals is estimated based on the digital sequences first. Then, characteristic signals of impact response signals are constructed by sinusoidal modulation signals. Finally, the phase synthesis time reversal impact imaging method is adopted to obtain the impact region image. Depending on the image, an error ellipse is generated to give out the final impact alarm region. A validation experiment is implemented on a complex composite wing box of a real aircraft. The validation results show that the accuracy rate of impact alarm region localization is approximately 100%. The area of impact alarm region can be reduced and the number of PZTs needed to cover the same impact monitoring region is reduced by more than a half. PMID:24084123

Double tracer autoradiographic method for sequential evaluation of regional cerebral perfusion

International Nuclear Information System (INIS)

Matsuda, H.; Tsuji, S.; Oba, H.; Kinuya, K.; Terada, H.; Sumiya, H.; Shiba, K.; Mori, H.; Hisada, K.; Maeda, T.

1989-01-01

A new double tracer autoradiographic method for the sequential evaluation of altered regional cerebral perfusion in the same animal is presented. This method is based on the sequential injection of two tracers, 99m Tc-hexamethylpropyleneamine oxime and N-isopropyl-( 125 I)p-iodoamphetamine. This method is validated in the assessment of brovincamine effects on regional cerebral perfusion in an experimental model of chronic brain ischemia in the rat. The drug enhanced perfusion recovery in low-flow areas, selectively in surrounding areas of infarction. The results suggest that this technique is of potential use in the study of neuropharmacological effects applied during the experiment

Proposing water balance method for water availability estimation in Indonesian regional spatial planning

Science.gov (United States)

Juniati, A. T.; Sutjiningsih, D.; Soeryantono, H.; Kusratmoko, E.

2018-01-01

The water availability (WA) of a region is one of important consideration in both the formulation of spatial plans and the evaluation of the effectiveness of actual land use in providing sustainable water resources. Information on land-water needs vis-a-vis their availability in a region determines the state of the surplus or deficit to inform effective land use utilization. How to calculate water availability have been described in the Guideline in Determining the Carrying Capacity of the Environment in Regional Spatial Planning. However, the method of determining the supply and demand of water on these guidelines is debatable since the determination of WA in this guideline used a rational method. The rational method is developed the basis for storm drain design practice and it is essentially a peak discharge method peak discharge calculation method. This paper review the literature in methods of water availability estimation which is described descriptively, and present arguments to claim that water balance method is a more fundamental and appropriate tool in water availability estimation. A better water availability estimation method would serve to improve the practice in preparing formulations of Regional Spatial Plan (RSP) as well as evaluating land use capacity in providing sustainable water resources.

Effective management models and methods of economic educations in regional industrial complexes

Directory of Open Access Journals (Sweden)

Andrey Gennadyevich Butrin

2014-06-01

Full Text Available In the article, the methodical bases of management by the integrated industrial enterprises is developed according to the indicators of sustainable economic development of the region. The scope of the research is the region as the difficult mesosystem consisting of logistic clusters. The subject matter of the research is the organizational and economic relations developing in the course of interaction of participants of the regional economy as mesosystems. The models and methods of management by the large economic systems in the economy of the industrially developed region are developed; the organizational and economic essence of a logistic cluster as the subject of the regional economy us revealed. The mechanism of management by the integrated enterprises with using the cluster approach, technologies of logistics, management of supply chains is offered. They allow to the management of an enterprises to make scientifically reasonable effective decisions developing programs of supply, economic production and realization of finished goods in the close connection with programs of regional economic development.

DNMT 1 maintains hypermethylation of CAG promoter specific region and prevents expression of exogenous gene in fat-1 transgenic sheep.

Science.gov (United States)

Yang, Chunrong; Shang, Xueying; Cheng, Lei; Yang, Lei; Liu, Xuefei; Bai, Chunling; Wei, Zhuying; Hua, Jinlian; Li, Guangpeng

2017-01-01

Methylation is an important issue in gene expression regulation and also in the fields of genetics and reproduction. In this study, we created fat-1 transgenic sheep, investigated the fine-mapping and the modulatory mechanisms of promoter methylation. Sheep fetal fibroblasts were transfected by pCAG-fat1-IRES-EGFP. Monoclonal cell line was screened as nuclear donor and carried out nuclear transfer (441 transgenic cloned embryos, 52 synchronism recipient sheep). Six offsprings were obtained. Expressions of exogenous genes fat-1 and EGFP were detectable in 10 examined tissues and upregulated omega-3 fatty acid content. Interestingly, more or less EGFP negative cells were detectable in the positive transgenic fetal skin cells. EGFP negative and positive cells were sorted by flow cytometry, and their methylation status in the whole promoter region (1701 nt) were investigated by bisulphate sequencing. The fine-mapping of methylation in CAG promoter were proposed. The results suggested that exogenous gene expression was determined by the methylation status from 721-1346 nt and modulated by methylation levels at 101, 108 and 115 nt sites in CAG promoter. To clarify the regulatory mechanism of methylation, examination of four DNA methyltransferases (DNMTs) demonstrated that hypermethylation of CAG promoter is mainly maintained by DNMT 1 in EGFP negative cells. Furthermore, investigation of the cell surface antigen CD34, CD45 and CD166 indicated that EGFP positive and negative cells belong to different types. The present study systematically clarified methylation status of CAG promoter in transgenic sheep and regulatory mechanism, which will provide research strategies for gene expression regulation in transgenic animals.

Quantitative and regional evaluation methods for lung scintigraphs

International Nuclear Information System (INIS)

Fichter, J.

1982-01-01

For the evaluation of perfusion lung scintigraphs with regard to the quantitative valuation and also with regard to the choice of the regions new criteria were presented. In addition to the usual methods of sectioning each lung lobe into upper, middle and lower level and the determination of the per cent activity share of the total activity the following values were established: the median of the activity distribution and the differences of the per cent counting rate as well as of the median of the corresponding regions of the right and left lung. The individual regions should describe the functional structures (lobe and segment structure). A corresponding computer program takes over the projection of lobe and segment regions in a simplified form onto the scintigraph with consideration of individual lung stretching. With the help of a clinical study on 60 patients and 18 control persons with 99mTc-MAA and 133 Xe-gas lung scintigraphs the following results could be determined: depending on the combination of the 32 parameters available for evaluation and the choice of regions between 4 and 20 of the 60 patients were falsely negatively classified and 1 to 2 of the 18 controls were falsely positive. The accuracy of the Tc-scintigraph proved to be better. All together using the best possible parameter combinations comparative results were attained. (TRV) [de

Association of human liver bilirubin UDP-glucuronyltransferase activity with a polymorphism in the promoter region of the UGT1A1 gene

NARCIS (Netherlands)

Raijmakers, MTM; Jansen, PLM; Steegers, EAP; Peters, WHM

Background/Aims: Gilbert's syndrome is a benign form of a deficiency in bilirubin glucuronidation. It is associated with a homozygous polymorphism, A(TA)(7)TAA instead of A(TA)(6)TAA, in the TATA-box of the promoter region of the bilirubin UDP-glucuronyltransferase gene. In this study the

Association of polymorphisms of interleukin-18 gene promoter region with polycystic ovary syndrome in chinese population

Directory of Open Access Journals (Sweden)

Li Mei-zhi

2010-10-01

Full Text Available Abstract Background Recent research shows that polycystic ovary syndrome (PCOS may have an association with low-grade chronic inflammation, and that PCOS may induce an increase in serum interleukin-18 (IL-18 levels. Methods To investigate the polymorphisms of the IL-18 gene promoters with PCOS, two single nucleotide polymorphisms (SNPs in the promoter of the IL-18 gene (at positions -607C/A and -137G/C in 118 Chinese women with PCOS and 79 controls were evaluated using polymerase chain reaction (PCR. Results No significant differences were found in the genotype distribution, allele frequency and haplotype frequency between the PCOS and control groups. Further analysis demonstrated a relationship between IL-18 gene promoter polymorphisms and PCOS insulin resistance (IR. Regarding the -137 allele frequency, G and C allele frequencies were 93.5% and 6.5%, respectively, in the PCOS with IR patients; G and C allele frequencies were 85.4% and 14.6%, respectively, in PCOS patients without IR (chi2 = 3.601, P = 0.048. Conclusions The presence of a polymorphism in the IL-18 gene was found to have no correlation with the occurrence of PCOS. Carriage of the C allele at position -137 in the promoter of the IL-18 gene may play a protective role from the development of PCOS IR.

A decision support system for the promotion of Employee in Plaza Asia Method Using Weighted Product

Directory of Open Access Journals (Sweden)

Egi Badar Sambani

2016-06-01

Full Text Available Decision-making in a company is important because decisions taken by managers is the result of a final thought to be carried out by employees. Asia is the largest mall Plaza sepriangan east, where the assessment process includes the promotion employee attendance, productivity (work, integrity (nature, skill (ability and loyalty (faithfulness. Method Using Weighted Product (WP can help in decision-making to determine the promotion of employees in the company, as well as the appraisal process more efficient so the store manager can determine employee promotions quickly. By using decision support system that has a database, employee data can be stored in the database. So that in case of errors in inputting can be corrected without having to re-enter the data. With the Decision Support System will address the issues raised in the Plaza Asia, so the promotion process will be faster.

Numerical conformal mapping methods for exterior and doubly connected regions

Energy Technology Data Exchange (ETDEWEB)

DeLillo, T.K. [Wichita State Univ., KS (United States); Pfaltzgraff, J.A. [Univ. of North Carolina, Chapel Hill, NC (United States)

1996-12-31

Methods are presented and analyzed for approximating the conformal map from the exterior of the disk to the exterior a smooth, simple closed curve and from an annulus to a bounded, doubly connected region with smooth boundaries. The methods are Newton-like methods for computing the boundary correspondences and conformal moduli similar to Fornberg`s method for the interior of the disk. We show that the linear systems are discretizations of the identity plus a compact operator and, hence, that the conjugate gradient method converges superlinearly.

South Asia's health promotion kaleidoscope.

Science.gov (United States)

Mukhopadhyay, Alok

2007-01-01

South Asia has 22 percent of the world's population but only 1.3 percent of the global income. Consequently 40 percent of the population is living in absolute poverty. However the health transition in some of its countries including India and Sri Lanka is a testimony to the fact that there are proven solutions to the problems of health and development within the region. The countries of the region have much in common, including a democratic political system, four major religions, a vibrant and living tradition of voluntarism and an extensive health infrastructure which is operating well below par. Despite the underlying unity, South Asia enjoys enormous cultural, linguistic and ethnic diversity. In this large, complex and vibrant region, health promotion is a challenging task, but it also holds the key to a dramatic change in the global health situation. Many of these solutions lie in wider areas of socio-political action. There are much needed shifts in the health promotion and development efforts, particularly in the area of poverty and social justice; gender inequity; population stabilisation; health and environment; control of communicable and non-communicable diseases; and urban health strategies. The principle of cooperation, partnership and intersectoral collaboration for health will be explored. Developing an appropriate, sustainable and people centred health and development strategy in the coming decades is an enormous challenge. There has been an attempt to focus on the emerging needs of the region, which call for health promotion, and involvement of civil society, private sector and the governments bestowed with the increased responsibility of ensuring health security for people. Strengthening the existing health systems, allocating adequate resources for health development and ensuring community participation are all prerequisites to the success of health promotion in the region.

A mixed methods evaluation of televised health promotion advertisements targeted at older adults.

Science.gov (United States)

Berry, Tanya R; Spence, John C; Plotnikoff, Ronald C; Bauman, Adrian; McCargar, Linda; Witcher, Chad; Clark, Marianne; Stolp, Sean

2009-08-01

The purpose of this research was to evaluate television advertisements targeted at 55-70-year olds that promoted physical activity and fruit and vegetable consumption. Awareness of the campaign, perceived credibility of the source, intentions to visit a promoted website, and intentions to perform the healthy behaviors were evaluated using mixed methods research. Results from a population level survey (n=1600) showed low unprompted and prompted awareness of the campaign and no differences in intentions or behaviors among those who were aware of the campaign. Unprompted recall resulted in a very wide range of responses including the citation of many commercial advertisers. Qualitative themes that emerged from the focus groups included neutral, positive, and negative comments about the advertisements, source credibility, website considerations specific to seniors, and suggestions about appropriate advertising for older adults. This research showed that the increased attention paid to the advertisements was due in a large part to negative reactions to the character used in the advertisements. Another important finding was the government was not considered to be a credible source of health information. Finally, health promoters should be cautious about websites as the primary source of information, particularly for older adults.

Analysis of upstream promoter region and corresponding 5’ UTR of glucokinase (GCK gene in horse breeds

Directory of Open Access Journals (Sweden)

L. Minieri

2010-04-01

Full Text Available A region of glucokinase (GCK gene was sequenced in 14 horses of 14 different breeds. The resulting GCK nucleotide sequence (GenBank number EF136885 showed 77% homology with human GCK gene portion containing the upstream promoter region and the corresponding 5’ UTR of the exon 1. Conserved regulatory sequences near the putative transcriptional start site were identified. The obtained sequences were aligned to detect polymorphism. A new C>T transition within the 5’ UTR of exon 1 was found. Allele frequencies of this polymorphism were studied by PCR-RFLP in 193 horses of 14 breeds (Bardigiano, 21; Esperia Pony, 5; Haflinger, 10; Italian Heavy Draught Horse, 28; Italian Saddle, 25; Italian Trotter, 16; Lipizzan, 12; Maremmano, 15; Murgese, 14; Norico, 10; Salernitano, 12; Thoroughbred, 10; Tolfetano, 7 and Ventasso Horse, 8. The polymorphism was found in all breeds and differences in allelic frequencies among the breeds were observed. The new SNP identified within a regulative region of GCK gene, which plays an important role in insulin secretion and feeding behaviour, could be used for association studies with performance traits of the horses.

An Intergenic Region Shared by At4g35985 and At4g35987 in Arabidopsis thaliana Is a Tissue Specific and Stress Inducible Bidirectional Promoter Analyzed in Transgenic Arabidopsis and Tobacco Plants

Science.gov (United States)

Banerjee, Joydeep; Sahoo, Dipak Kumar; Dey, Nrisingha; Houtz, Robert L.; Maiti, Indu Bhushan

2013-01-01

On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985) are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS) in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85) showed stronger expression (about 3.5 fold) compared to the At4g35987 promoter (P87). The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold) under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications. PMID:24260266

An intergenic region shared by At4g35985 and At4g35987 in Arabidopsis thaliana is a tissue specific and stress inducible bidirectional promoter analyzed in transgenic arabidopsis and tobacco plants.

Directory of Open Access Journals (Sweden)

Joydeep Banerjee

Full Text Available On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985 are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85 showed stronger expression (about 3.5 fold compared to the At4g35987 promoter (P87. The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications.

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Energy Technology Data Exchange (ETDEWEB)

Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

2014-04-25

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Knowledge and usage of methods of online promotion by students as potential entrepreneurs

Directory of Open Access Journals (Sweden)

Siemieniak Paulina

2017-01-01

Full Text Available According to popular belief, it has never been easier to raise funds to run and manage one’s own business. In an era of startups popping up like mushrooms, crowdfunding, business angels, venture capital and mobile Internet, investing in a business is a much easier undertaking than it was two decades ago. Furthermore, Augmented Reality available through mobile devices like smartphones or tablets, the Internet of Things, which makes the consumer feel like a science fiction character in their own home, or Virtual Reality shopping, a Matrix movie-like experience in a testing phase at the moment, provide increasingly more innovative ways to take one’s first steps in business, gather momentum, and win loyal customers. According to the results, running one’s own business is not a popular professional plan among young people, which is especially surprising given the fact that the majority of the respondents were students of specialisations that equipped them with knowledge facilitating entrepreneurial activities. Running one’s own business seemed to be an attractive career path for about 30% of the respondents. Although they realise the significance of the Internet in running their own business, they do not believe that this is always a necessary tool. The students declared knowledge of multiple methods of communication and promotion and often use social media channels, but rarely expressed the desire to use these measures. A particular way of using the Internet to foster entrepreneurship are methods of online promotion like Social Media Marketing or Search Engine Optimization. Those tools enable reaching potential customers and engaging in an active dialogue with them about their favourite brands, products and services. They also allow exchange of information with the entrepreneur and are currently one of the fundamental tools for creating a company’s success. The article presents the results of research on the knowledge of methods of online

Identification of a 450-bp region of human papillomavirus type 1 that promotes episomal replication in Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Chattopadhyay, Anasuya; Schmidt, Martin C.; Khan, Saleem A.

2005-01-01

Human papillomaviruses (HPVs) replicate as nuclear plasmids in infected cells. Since the DNA replication machinery is generally conserved between humans and Saccharomyces cerevisiae, we studied whether HPV-1 DNA can replicate in yeast. Plasmids containing a selectable marker (with or without a yeast centromere) and either the full-length HPV-1 genome or various regions of the viral long control region (LCR) and the 3' end of the L1 gene were introduced into S. cerevisiae and their ability to replicate episomally was investigated. Our results show that HPV-1 sequences promote episomal replication of plasmids although the yeast centromere is required for plasmid retention. We have mapped the autonomously replicating sequence activity of HPV-1 DNA to a 450 base-pair sequence (HPV-1 nt 6783-7232) that includes 293 nucleotides from the 5' region of the viral LCR and 157 nucleotides from the 3' end of the L1 gene. The HPV-1 ARS does not include the binding sites for the viral E1 and E2 proteins, and these proteins are dispensable for replication in S. cerevisiae

A method to quantitate regional wall motion in left ventriculography using Hildreth algorithm

Energy Technology Data Exchange (ETDEWEB)

Terashima, Mikio [Hyogo Red Cross Blood Center (Japan); Naito, Hiroaki; Sato, Yoshinobu; Tamura, Shinichi; Kurosawa, Tsutomu

1998-06-01

Quantitative measurement of ventricular wall motion is indispensable for objective evaluation of cardiac function associated with coronary artery disease. We have modified the Hildreth`s algorithm to estimate excursions of the ventricular wall on left ventricular images yielded by various imaging techniques. Tagging cine-MRI was carried out on 7 healthy volunteers. The original Hildreth method, the modified Hildreth method and the centerline method were applied to the outlines of the images obtained, to estimate excursion of the left ventricular wall and regional shortening and to evaluate the accuracy of these methods when measuring these parameters, compared to the values of these parameters measured actually using the attached tags. The accuracy of the original Hildreth method was comparable to that of the centerline method, while the modified Hildreth method was significantly more accurate than the centerline method (P<0.05). Regional shortening as estimated using the modified Hildreth method differed less from the actually measured regional shortening than did the shortening estimated using the centerline method (P<0.05). The modified Hildreth method allowed reasonable estimation of left ventricular wall excursion in all cases where it was applied. These results indicate that when applied to left ventriculograms for ventricular wall motion analysis, the modified Hildreth method is more useful than the original Hildreth method. (author)

Social deprivation and exposure to health promotion. A study of the distribution of health promotion resources to schools in England

Directory of Open Access Journals (Sweden)

Reidpath Daniel D

2010-08-01

Full Text Available Abstract Background Area deprivation is a known determinant of health. It is also known that area deprivation is associated with lower impact health promotion. It is less well known, however, whether deprived areas are less responsive to health promotion, or whether they are less exposed. Using data from a national, school-based campaign to promote vaccination against the human papilloma virus (HPV, the relationship between area deprivation and exposure was examined. Methods Taking advantage of a health promotion campaign to provide information to schools about HPV vaccination, a cross sectional study was conducted to examine the relationship between area level, social deprivation, and take-up of (i.e., exposure to available health promotion material. The sample was 4,750 schools across England, including government maintained and independent schools. The relationship between area deprivation and exposure was examined using bi- and multivariate logistic regression. Results It was found that schools in the least deprived quintile had 1.32 times the odds of requesting health promotion materials than schools in the most deprived areas (p = .01. This effect was independent of the school size, the type of school, and the geographic region. Conclusion The relationship between area deprivation and the impact of health promotion may be due, at least in part, to differential levels of exposure. The study was limited in scope, pointing to the need for more research, but also points to potentially important policy implications.

Use of phytoindication methods for biomonitoring of urbanized regions

International Nuclear Information System (INIS)

Holub, Z.; Lackovicova, A.

1992-01-01

At the model region in the industrial agglomeration of the town Bratislava the usability of some phytoindication methods for biomonitoring of urban areas has been tested. Following methods there were found as useful: 1. Chemical analyses of the leaves of freely growing ruderal species (Artemisia vulgaris). 2. Using of transplanted and for a certain time exposed lower plants (Hypogymnia physodes, Sphagnum capillifolium). 3. Use of changing the biological parameters of planted pot plants (Fagopyrum esculentum). (orig.)

Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

Science.gov (United States)

Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

2014-01-10

Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

Clinical Significance of Retinoic Acid Receptor Beta Promoter Methylation in Prostate Cancer: A Meta-Analysis

Directory of Open Access Journals (Sweden)

MengMeng Dou

2018-03-01

Full Text Available Background/Aims: Retinoic acid receptor beta (RAR beta is a retinoic acid receptor gene that has been shown to play key roles during multiple cancer processes, including cell proliferation, apoptosis, migration and invasion. Numerous studies have found that methylation of the RAR beta promoter contributed to the occurrence and development of malignant tumors. However, the connection between RAR beta promoter methylation and prostate cancer (PCa remains unknown. This meta-analysis evaluated the clinical significance of RAR beta promoter methylation in PCa. Materials and Methods: We searched all published records relevant to RAR beta and PCa in a series of databases, including PubMed, Embase, Cochrane Library, ISI Web of Science and CNKI. The rates of RAR beta promoter methylation in the PCa and control groups (including benign prostatic hyperplasia and normal prostate tissues were summarized. In addition, we evaluated the source region of available samples and the methods used to detect methylation. To compare the incidence and variation in RAR beta promoter methylation in PCa and non-PCa tissues, the odds ratio (OR and 95% confidence interval (CI were calculated accordingly. All the data were analyzed with the statistical software STATA 12.0. Results: Based on the inclusion and exclusion criteria, 15 articles assessing 1,339 samples were further analyzed. These data showed that the RAR beta promoter methylation rates in PCa tissues were significantly higher than the rates in the non-PCa group (OR=21.65, 95% CI: 9.27-50.57. Subgroup analysis according to the source region of samples showed that heterogeneity in Asia was small (I2=0.0%, P=0.430. Additional subgroup analysis based on the method used to detect RAR beta promoter methylation showed that the heterogeneity detected by MSP (methylation-specific PCR was relatively small (I2=11.3%, P=0.343. Conclusion: Although studies reported different rates for RAR beta promoter methylation in PCa

Virtual Seismic Observation (VSO) with Sparsity-Promotion Inversion

Science.gov (United States)

Tiezhao, B.; Ning, J.; Jianwei, M.

2017-12-01

Large station interval leads to low resolution images, sometimes prevents people from obtaining images in concerned regions. Sparsity-promotion inversion, a useful method to recover missing data in industrial field acquisition, can be lent to interpolate seismic data on none-sampled sites, forming Virtual Seismic Observation (VSO). Traditional sparsity-promotion inversion suffers when coming up with large time difference in adjacent sites, which we concern most and use shift method to improve it. The procedure of the interpolation is that we first employ low-pass filter to get long wavelength waveform data and shift the waveforms of the same wave in different seismograms to nearly same arrival time. Then we use wavelet-transform-based sparsity-promotion inversion to interpolate waveform data on none-sampled sites and filling a phase in each missing trace. Finally, we shift back the waveforms to their original arrival times. We call our method FSIS (Filtering, Shift, Interpolation, Shift) interpolation. By this way, we can insert different virtually observed seismic phases into none-sampled sites and get dense seismic observation data. For testing our method, we randomly hide the real data in a site and use the rest to interpolate the observation on that site, using direct interpolation or FSIS method. Compared with directly interpolated data, interpolated data with FSIS can keep amplitude better. Results also show that the arrival times and waveforms of those VSOs well express the real data, which convince us that our method to form VSOs are applicable. In this way, we can provide needed data for some advanced seismic technique like RTM to illuminate shallow structures.

Geoheritage promotion of Thonon-les-Bains (Fr) region by the development of a geotourism product

Science.gov (United States)

Fanguin, Pauline

2014-05-01

Since 2012, the Chablais region (only in France) has acquired the Geopark label. This Geopark contributes to sustainable economic development of the region through geotourism. Moreover, the three Chablais (figure 1) are concerned by an Interreg IV program since 2009 (program of cooperation between European countries). The main objective of this program is to enhance the heritage resources (nature, culture and lifestyle of the region) (www.interreg-francesuisse.org). Therefore, the geotourism offer in this area just waiting to expand. The geodidactics models like the simplification of the scientific content are essential for geoheritage promotion, because this content must be available to a wide audience, allowing thereby the geoheritage recognition. The geotourism permits to apply different models (Cayla et al. 2010, Sellier, 2009) through a wide range of geotourism products, like guide, educational panels, thematic hikes and recently developed, new medias (website, smartphone applications). A geotourism product is based on four areas of questioning and was developed by Martin et al. (2010): (1) site (choice of sites to be valued), (2) public (a family public, good example of heterogeneous public), (3) contents (reasoning on geodidactics models) and (4) support (smartphone application). These four areas are very fundamental before the creation of any geotourism product. These reflexions aim to obtain a mediation product that integrates into geotourism offer of a region and contributes to its development and meets public expectations. New media, such as digital media - smartphone, tablets, website - become geotourism products more and more attractive. In addition, the necessary technologies to develop new media help to integrate a high interactivity potential with the public and thus get their attention. The architecture of this geotourism product is based on the new application developed by the Institute of Geography and sustainability, and the Bureau Relief. One

Health promotion methods for smoking prevention and cessation: A comprehensive review of effectiveness and the way forward

Directory of Open Access Journals (Sweden)

Mahaveer Golechha

2016-01-01

Full Text Available Tobacco smoking is one of the greatest causes of mortality in the world, responsible for over 5 million deaths per annum. The prevalence of smoking is over 1 billion people, with the majority coming from low or middle income countries. Yet, the incidence of smoking varies vastly between many countries. Some countries have been able to decline the smoking and tobacco related morbidity and mortality through the introduction of health promotion initiatives and effective policies in order to combat tobacco usage. However, on the other hand, in some countries, the incidence of smoking is increasing still further. With the growing body of evidence of detriment of tobacco to health, many control policies have been implemented as health promotion actions. Such methods include taxation of smoking, mass advertising campaigns in the media, peer education programs, community mobilization, motivational interviewing, health warnings on tobacco products, marketing restrictions, and banning smoking in public places. However, the review of the effectiveness of various health promotion methods used for smoking prevention and cessation is lacking. Therefore, the aim of this review is to identify and critically review the effectiveness of health promotion methods used for smoking prevention and cessation. All available studies and reports published were considered. Searches were conducted using PubMed, MEDLINE, Ovid, Karger, ProQuest, Sage Journals, Science Direct, Springer, Taylor and Francis, EMBASE, CINAHL, and Cochrane and Wiley Online Library. Various relevant search terms and keywords were used. After considering the inclusion and exclusion criteria, we selected 23 articles for the present review.

Health Promotion Methods for Smoking Prevention and Cessation: A Comprehensive Review of Effectiveness and the Way Forward.

Science.gov (United States)

Golechha, Mahaveer

2016-01-01

Tobacco smoking is one of the greatest causes of mortality in the world, responsible for over 5 million deaths per annum. The prevalence of smoking is over 1 billion people, with the majority coming from low or middle income countries. Yet, the incidence of smoking varies vastly between many countries. Some countries have been able to decline the smoking and tobacco related morbidity and mortality through the introduction of health promotion initiatives and effective policies in order to combat tobacco usage. However, on the other hand, in some countries, the incidence of smoking is increasing still further. With the growing body of evidence of detriment of tobacco to health, many control policies have been implemented as health promotion actions. Such methods include taxation of smoking, mass advertising campaigns in the media, peer education programs, community mobilization, motivational interviewing, health warnings on tobacco products, marketing restrictions, and banning smoking in public places. However, the review of the effectiveness of various health promotion methods used for smoking prevention and cessation is lacking. Therefore, the aim of this review is to identify and critically review the effectiveness of health promotion methods used for smoking prevention and cessation. All available studies and reports published were considered. Searches were conducted using PubMed, MEDLINE, Ovid, Karger, ProQuest, Sage Journals, Science Direct, Springer, Taylor and Francis, EMBASE, CINAHL, and Cochrane and Wiley Online Library. Various relevant search terms and keywords were used. After considering the inclusion and exclusion criteria, we selected 23 articles for the present review.

Localization and regulation of bacteriophage Mu promoters

International Nuclear Information System (INIS)

Stoddard, S.F.; Howe, M.M.

1989-01-01

Mu promoters active during the lytic cycle were located by isolating RNA at various times after induction of Mu prophages, radiolabeling it by capping in vitro, and hybridizing it to Mu DNA fragments on Southern blots. Signals were detected from four new promoters in addition to the previously characterized P e (early), P cM (repressor), and P mom (late) promoters. A major signal upstream of C was first observed at 12 min and intensified thereafter with RNA from cts and C amber but not replication-defective prophages; these characteristics indicate that this signal arises from a middle promoter, which we designate P m . With 20- and 40-min RNA, four additional major signals originated in the C-lys, F-G-I, N-P, and com-mom regions. These signals were missing with RNA from C amber and replication-defective prophages and therefore reflected the activity of late promoters, one of which we presume was P mom . Uninduced lysogens showed weak signals from five regions, one from the early regulatory region, three between genes B and lys, and one near the late genes K, L, and M. The first of these probably resulted from P cM activity; the others remain to be identified

Contemporary methods and means of monitoring for Karabach region's forest ecosystems

International Nuclear Information System (INIS)

Aliyev, N.R.; Abdurahmanova, I.G.; Askerov, R.A.

2010-01-01

Full Text: In the article is analyzed the changing of a condition in the Karabach regions forests. The negative influence to region as well as in other regions of Azerbaijan of a mass cutting down of forests because of need for energy and wood industry, life conditions and also the results of military operations were lighted. The effective methods of reception of the operative information on an ecological condition of wood ecological systems on the basis of modern technical means are offered

Development of an Agrobacterium-Mediated Transformation Method and Evaluation of Two Exogenous Constitutive Promoters in Oleaginous Yeast Lipomyces starkeyi.

Science.gov (United States)

Lin, Xinping; Liu, Sasa; Bao, Ruiqi; Gao, Ning; Zhang, Sufang; Zhu, Rongqian; Zhao, Zongbao Kent

2017-11-01

Oleaginous yeast Lipomyces starkeyi, a promising strain of great biotechnical importance, is able to accumulate over 60% of its cell biomass as triacylglycerols (TAGs). It is promising to directly produce the derivatives of TAGs, such as long-chain fatty acid methyl esters and alkanes, in L. starkeyi. However, techniques for genetic modification of this oleaginous yeast are lacking, thus, further research is needed to develop genetic tools and functional elements. Here, we used two exogenous promoters (pGPD and pPGK) from oleaginous yeast Rhodosporidium toruloides to establish a simpler Agrobacterium-mediated transformation (AMT) method for L. starkeyi. Hygromycin-resistant transformants were obtained on antibiotic-contained plate. Mitotic stability test, genotype verification by PCR, and protein expression confirmation all demonstrated the success of this method. Furthermore, the strength of these two promoters was evaluated at the phenotypic level on a hygromycin-gradient plate and at the transcriptional level by real-time quantitative PCR. The PGK promoter strength was 2.2-fold as that of GPD promoter to initiate the expression of the hygromycin-resistance gene. This study provided an easy and efficient genetic manipulation method and elements of the oleaginous yeast L. starkeyi for constructing superior strains to produce advanced biofuels.

Comparison of eight degree-days estimation methods in four agroecological regions in Colombia

Directory of Open Access Journals (Sweden)

Daniel Rodríguez Caicedo

2012-01-01

Full Text Available Eight methods were used to estimate degree-days in four Colombian localities. Four methods have been previously proposed in literature: Simple Sine, Double Sine, Simple Triangle, and Double Triangle methods. The other four methods are proposed in this research: Simple Logistic, Double Logistic, Simple Normal, and Double Normal. The estimation of the degree-days through hourly temperature values was used as the reference standard method, and the four localities from where the temperature values were taken were the municipalities of Cajicá (Cundinamarca, Santa Elena (Antioquia, Carepa (Urabá Antioqueño, and Ciudad Bolivar (Zona cafetera Antioqueña. Degree-days obtained by all methods under study were compared through linear regression to those obtained by the reference standard method. There were differences in the correlation of each method to the reference when compared within each region and among regions. The Simple Logistic and Double Logistic methods showed the best performance with acceptable R² values and considerably lower bias than the other methods. The poorest fit was found in Cajicá, where the average R² was 0.571. For the regions of Santa Elena and Carepa, the average R² was 0.756 and 0.733. The best fit was found in Ciudad Bolivar, with an average R² of 0.826.

An Efficient Approach for Identifying Stable Lobes with Discretization Method

Directory of Open Access Journals (Sweden)

Baohai Wu

2013-01-01

Full Text Available This paper presents a new approach for quick identification of chatter stability lobes with discretization method. Firstly, three different kinds of stability regions are defined: absolute stable region, valid region, and invalid region. Secondly, while identifying the chatter stability lobes, three different regions within the chatter stability lobes are identified with relatively large time intervals. Thirdly, stability boundary within the valid regions is finely calculated to get exact chatter stability lobes. The proposed method only needs to test a small portion of spindle speed and cutting depth set; about 89% computation time is savedcompared with full discretization method. It spends only about10 minutes to get exact chatter stability lobes. Since, based on discretization method, the proposed method can be used for different immersion cutting including low immersion cutting process, the proposed method can be directly implemented in the workshop to promote machining parameters selection efficiency.

Detection method of elastic scattering in the Coulomb interference region: scintillation target

International Nuclear Information System (INIS)

Azaiez, Hamza.

1981-01-01

Measurement of polarization in (p-p) elastic scattering in the Coulomb interference region is considered as a valid method for calibrating high energy polarized proton beams. Possibility of using a scintillation target to detect low energy recoil protons in this /t/ region has been studied by using a 4 GeV/c π - beam from CERN PS. The results obtained with a steack of thin plastic scintillators, each 1 mm thick, showed the feasibility of detecting recoil protons in a /t/ range as low a 5.10 -3 (GeV/c) 2 . This method thus confirmed experimentally can be used also to measure, using a polarized beam, polarization in Coulomb interference region [fr

Toward a regional power plant siting method: AEC-Maryland regional siting factors study, FY 1974 progress report

International Nuclear Information System (INIS)

Yaffee, S.L.; Miller, C.A.

1974-11-01

The ''AEC-Maryland Regional Siting Factors Study'' examines the process of siting in a regional context. It is developing an analysis method to delineate candidate areas for siting of several power plant technology packages, including both fossil-fueled and nuclear options. Tools that are being used include simulation modeling, economic and demographic forecasting, spatial analysis, and computer graphics and numerical manipulation. The approach will describe the trade-offs incurred if a power plant is located in one candidate area rather than in another. In FY 1974, a suitability analysis method was developed which uses engineering and environmental parameters to define a level of environmental cost incurred if a segment of land is used to site a specific technology package. (U.S.)

Competitive Promoter-Associated Matrix Attachment Region Binding of the Arid3a and Cux1 Transcription Factors

Directory of Open Access Journals (Sweden)

Dongkyoon Kim

2017-12-01

Full Text Available Arid3a/Bright/Dril1 is a B cell-specific transactivator that regulates immunoglobulin heavy chain (IgH gene transcription by binding promoter and enhancer-associated matrix attachment regions (MARs within the IgH gene locus. Promoter MAR-mediated Arid3a transactivation is antagonized by direct competition of MAR binding by Cux1/CDP—a ubiquitously expressed repressor originally termed NF-μNR. We report that the NF-μNR complex includes Arid3a in B cells but not in non-B cells through mobility shift assays. The binding activity of NF-μNR and Arid3a in B cells is reciprocally altered during the cell division cycle and by the B cell mitogen lipopolysaccharide LPS. LPS treatment had no effect on Arid3a localization but increased its total abundance within the nucleus and cytoplasm. We show that this increased level of Arid3a is capable of displacing Cux from the MARs to facilitate IgH gene transcription. Finally, we showed that the MARs (termed Bf150 and Tx125 associated with the VH1 rearranged variable region expressed in the S107 murine plasmacytoma, can repress reporter gene transcription in non-B cells and that they can relieve the repression mediated by Eμ enhancer in B cells. These results have significant implications for early human development and demonstrate that MARs in IgH locus, NF-µNR and Arid3a regulate IgH gene expression in a concerted fashion. This paves the way for future studies examining the misregulation of this pathway in pediatric disease.

CDH1 promoter hypermethylation and E-cadherin protein expression in infiltrating breast cancer

DEFF Research Database (Denmark)

Caldeira, José Roberto F; Prando, Erika C; Quevedo, Francisco C

2006-01-01

prognosis, and metastasis. Differential CpG island methylation in the promoter region of the CDH1 gene might be an alternative way for the loss of expression and function of E-cadherin, leading to loss of tissue integrity, an essential step in tumor progression. METHODS: The aim of our study was to assess...... not statistically significant, the levels of E-cadherin expression tended to diminish with the CDH1 promoter region methylation. In the group of 71 ductal cancinomas, most of the cases of showing CDH1 hypermethylation also presented reduced levels of expression of ER and PgR proteins, and a possible association......BACKGROUND: The E-cadherin gene (CDH1) maps, at chromosome 16q22.1, a region often associated with loss of heterozygosity (LOH) in human breast cancer. LOH at this site is thought to lead to loss of function of this tumor suppressor gene and was correlated with decreased disease-free survival, poor...

Sustainability assessment of one industrial region: A combined method of emergy analysis and IPAT (Human Impact Population Affluence Technology)

International Nuclear Information System (INIS)

Yu, Xiaoman; Geng, Yong; Dong, Huijuan; Ulgiati, Sergio; Liu, Zhe; Liu, Zuoxi; Ma, Zhixiao; Tian, Xu; Sun, Lu

2016-01-01

Resource over-exploitation and resource depletion have received increasing attentions, especially for industrial regions. In this paper an innovative method that combines emergy analysis and an IPAT (Human Impact Population Affluence Technology) equation is developed in order to create an integrated framework for uncovering the driving forces on resource consumption in one industrial region. Liaoning province, one of the old heavy industrial bases in China, is selected as the case study region. The main results show that total emergy of Liaoning province increased from 9.25E + 23 sej in 2002 to 1.92E + 24 sej in 2012, with 165% growth on non-renewable emergy and 250% growth on imported emergy. Regional emergy/RMB ratio was higher than other developed regions and the average value of China, indicating that this province consumed more local free non-renewable resources to support its own development. The lower ESI (emergy sustainability index) indicates that Liaoning province's sustainability is still weak and far away from sustainable development. IPAT analysis further identifies that rapid economic growth was the main driving force to increase its total emergy use, while technology innovation offset the increase of total emergy use. Policy insights suggest that industrial regions should improve their energy efficiency and optimize their economic and energy structure by applying economic instruments and capacity building efforts. - Highlights: • Emergy analysis and IPAT are combined to evaluate the sustainability of Liaoning. • Total emergy of Liaoning increased from 2002 to 2011 and then decreased in 2012. • Economic scale is the key driving force to induce higher emergy consumption. • Valuable policy insights are proposed in order to promote sustainable development.

AN ITERATIVE SEGMENTATION METHOD FOR REGION OF INTEREST EXTRACTION

Directory of Open Access Journals (Sweden)

Volkan CETIN

2013-01-01

Full Text Available In this paper, a method is presented for applications which include mammographic image segmentation and region of interest extraction. Segmentation is a very critical and difficult stage to accomplish in computer aided detection systems. Although the presented segmentation method is developed for mammographic images, it can be used for any medical image which resembles the same statistical characteristics with mammograms. Fundamentally, the method contains iterative automatic thresholding and masking operations which is applied to the original or enhanced mammograms. Also the effect of image enhancement to the segmentation process was observed. A version of histogram equalization was applied to the images for enhancement. Finally, the results show that enhanced version of the proposed segmentation method is preferable because of its better success rate.

HOX Gene Promoter Prediction and Inter-genomic Comparison: An Evo-Devo Study

Directory of Open Access Journals (Sweden)

Marla A. Endriga

2010-10-01

Full Text Available Homeobox genes direct the anterior-posterior axis of the body plan in eukaryotic organisms. Promoter regions upstream of the Hox genes jumpstart the transcription process. CpG islands found within the promoter regions can cause silencing of these promoters. The locations of the promoter regions and the CpG islands of Homeo sapiens sapiens (human, Pan troglodytes (chimpanzee, Mus musculus (mouse, and Rattus norvegicus (brown rat are compared and related to the possible influence on the specification of the mammalian body plan. The sequence of each gene in Hox clusters A-D of the mammals considered were retrieved from Ensembl and locations of promoter regions and CpG islands predicted using Exon Finder. The predicted promoter sequences were confirmed via BLAST and verified against the Eukaryotic Promoter Database. The significance of the locations was determined using the Kruskal-Wallis test. Among the four clusters, only promoter locations in cluster B showed significant difference. HOX B genes have been linked with the control of genes that direct the development of axial morphology, particularly of the vertebral column bones. The magnitude of variation among the body plans of closely-related species can thus be partially attributed to the promoter kind, location and number, and gene inactivation via CpG methylation.

A region-based segmentation method for ultrasound images in HIFU therapy

International Nuclear Information System (INIS)

Zhang, Dong; Liu, Yu; Yang, Yan; Xu, Menglong; Yan, Yu; Qin, Qianqing

2016-01-01

Purpose: Precisely and efficiently locating a tumor with less manual intervention in ultrasound-guided high-intensity focused ultrasound (HIFU) therapy is one of the keys to guaranteeing the therapeutic result and improving the efficiency of the treatment. The segmentation of ultrasound images has always been difficult due to the influences of speckle, acoustic shadows, and signal attenuation as well as the variety of tumor appearance. The quality of HIFU guidance images is even poorer than that of conventional diagnostic ultrasound images because the ultrasonic probe used for HIFU guidance usually obtains images without making contact with the patient’s body. Therefore, the segmentation becomes more difficult. To solve the segmentation problem of ultrasound guidance image in the treatment planning procedure for HIFU therapy, a novel region-based segmentation method for uterine fibroids in HIFU guidance images is proposed. Methods: Tumor partitioning in HIFU guidance image without manual intervention is achieved by a region-based split-and-merge framework. A new iterative multiple region growing algorithm is proposed to first split the image into homogenous regions (superpixels). The features extracted within these homogenous regions will be more stable than those extracted within the conventional neighborhood of a pixel. The split regions are then merged by a superpixel-based adaptive spectral clustering algorithm. To ensure the superpixels that belong to the same tumor can be clustered together in the merging process, a particular construction strategy for the similarity matrix is adopted for the spectral clustering, and the similarity matrix is constructed by taking advantage of a combination of specifically selected first-order and second-order texture features computed from the gray levels and the gray level co-occurrence matrixes, respectively. The tumor region is picked out automatically from the background regions by an algorithm according to a priori

A region-based segmentation method for ultrasound images in HIFU therapy

Energy Technology Data Exchange (ETDEWEB)

Zhang, Dong, E-mail: dongz@whu.edu.cn; Liu, Yu; Yang, Yan; Xu, Menglong; Yan, Yu [School of Physics and Technology, Wuhan University, Wuhan 430072 (China); Qin, Qianqing [State Key Laboratory of Information Engineering in Surveying, Mapping and Remote Sensing, Wuhan University, Wuhan 430072 (China)

2016-06-15

Purpose: Precisely and efficiently locating a tumor with less manual intervention in ultrasound-guided high-intensity focused ultrasound (HIFU) therapy is one of the keys to guaranteeing the therapeutic result and improving the efficiency of the treatment. The segmentation of ultrasound images has always been difficult due to the influences of speckle, acoustic shadows, and signal attenuation as well as the variety of tumor appearance. The quality of HIFU guidance images is even poorer than that of conventional diagnostic ultrasound images because the ultrasonic probe used for HIFU guidance usually obtains images without making contact with the patient’s body. Therefore, the segmentation becomes more difficult. To solve the segmentation problem of ultrasound guidance image in the treatment planning procedure for HIFU therapy, a novel region-based segmentation method for uterine fibroids in HIFU guidance images is proposed. Methods: Tumor partitioning in HIFU guidance image without manual intervention is achieved by a region-based split-and-merge framework. A new iterative multiple region growing algorithm is proposed to first split the image into homogenous regions (superpixels). The features extracted within these homogenous regions will be more stable than those extracted within the conventional neighborhood of a pixel. The split regions are then merged by a superpixel-based adaptive spectral clustering algorithm. To ensure the superpixels that belong to the same tumor can be clustered together in the merging process, a particular construction strategy for the similarity matrix is adopted for the spectral clustering, and the similarity matrix is constructed by taking advantage of a combination of specifically selected first-order and second-order texture features computed from the gray levels and the gray level co-occurrence matrixes, respectively. The tumor region is picked out automatically from the background regions by an algorithm according to a priori

Investigations of Escherichia coli promoter sequences with artificial neural networks: new signals discovered upstream of the transcriptional startpoint

DEFF Research Database (Denmark)

Pedersen, Anders Gorm; Engelbrecht, Jacob

1995-01-01

We present a novel method for using the learning ability of a neural network as a measure of information in local regions of input data. Using the method to analyze Escherichia coli promoters, we discover all previously described signals, and furthermore find new signals that are regularly spaced...

The Digital North Denmark Programme -Promoting Regional Change?

DEFF Research Database (Denmark)

Østergaard, Christian Richter

2007-01-01

The Digital North Denmark (DDN) was an IT programme running from 2000 to 2003 in the North Jutland County in Denmark with national government support of € 23 million. The Danish government initiated the programme with the aim of further strengthening regions with an already proven ICT capability...... (Dybkjær and Lindegaard, 1999, p.96-100). The declared approach was to build on the existing competencies in industry as well as at universities. The national government chose two regions – Ørestaden, a new concentration of knowledge-based institutions near Copenhagen Airport, and North Jutland......-offers within four themes. The participants - meant to be project consortia of ideally private firms, public or private organisations as well as regional and municipal government bodies - could get a maximum national government support of one third of the total project sum.This chapter investigates how...

Isolation and sequencing analysis on the seed-specific promoter from soybean

Institute of Scientific and Technical Information of China (English)

CAIYIN Qinggele; LI Mingchun; WEI Dongsheng; CAI Yi; XING Laijun

2007-01-01

The low level of foreign genes' expression in transgenic plants is a key factor that limits plant genetic engineering.Because of the critical regulatory activity of the promoters on gene transcription,they are studied extensively to improve the efficiency of the plant transgenic system.The constitutive promoters,such as CaMV 35S promoter,are usually used in plant genetic engineering.But those constitutive promoters continuously express their downstream genes during the whole life span in all the tissues of the host plants.This is not only wasteful to host plant's energy,but also harmful to host plants and usually affects their agronomic characteristics.In contrast,the seed-specific promoter only expresses its downstream genes from mid to late stage of seed maturation,and there is no expression or much lower expression in other tissues.So the seed-specific promoters are distinguished for their improvement and what they have brought to plant quality engineering.The aim of this article is to characterize a new seed-specific promoter and improve grain quality.The promoter region of β-conglycinin α-subunit gene was isolated from the genomic DNA of soybean Jilin 43 by PCR method,and successfully extended this fragment by TAIL PCR method and obtained the promoter fragment BCSP666.Sequencing analysis showed that the cloned fragment BCSP666 contained all of the motifs,such as RY repeat element,AG/CCCCA motif,TACACAT motif,ACGTmotif,A/T rich motif and E-box etc.,which constituted the seed-specific promoter activity.Based on this sequencing analysis,the seed-specific promoter activity of the fragment BCSP666 was predicted.And then the seed-specific expression vector pBI121-666,which contained GUS reporter gene,was constructed with the fragment BCSP666.Transformation of Arabidopsis thaliana plants by Agrobacterium-mediated floral-dip method with the recombined vector pBI121-666was conducted.The transgenic plants were selected on the kanamycin-resistant MS medium

A three-region conduction-controlled rewetting analysis by the Heat Balance Integral Method

International Nuclear Information System (INIS)

Sahu, S.K.; Das, P.K.; Bhattacharyya, S.

2009-01-01

Conduction-controlled rewetting of two-dimensional objects is analyzed by the Heat Balance Integral Method (HBIM) considering three distinct regions: a dry region ahead of wet front, the sputtering region immediately behind the wet front and a continuous film region further upstream. The HBIM yields solutions for wet front velocity, sputtering length and temperature field with respect to wet front. Employing this method, it is seen that heat transfer mechanism is dependent upon two temperature parameters. One of them characterizes the initial wall temperature while the other specifies the range of temperature for sputtering region. Additionally, the mechanism of heat transfer is found to be dependent on two Biot numbers comprising a convective heat transfer in the wet region and a boiling heat transfer in the sputtering region. The present solution exactly matches with the one-dimensional analysis of K.H. Sun, G.E. Dix, C.L. Tien [Cooling of a very hot vertical surface by falling liquid film, ASME J. Heat Transf. 96 (1974) 126-131] for low Biot numbers. Good agreement with experimental results is also observed. (authors)

Regional Attenuation in Northern California: A Comparison of Five 1-D Q Methods

Energy Technology Data Exchange (ETDEWEB)

Ford, S R; Dreger, D S; Mayeda, K; Walter, W R; Malagnini, L; Phillips, W S

2007-08-03

The determination of regional attenuation Q{sup -1} can depend upon the analysis method employed. The discrepancies between methods are due to differing parameterizations (e.g., geometrical spreading rates), employed datasets (e.g., choice of path lengths and sources), and the methodologies themselves (e.g., measurement in the frequency or time domain). Here we apply five different attenuation methodologies to a Northern California dataset. The methods are: (1) coda normalization (CN), (2) two-station (TS), (3) reverse two-station (RTS), (4) source-pair/receiver-pair (SPRP), and (5) coda-source normalization (CS). The methods are used to measure Q of the regional phase, Lg (Q{sub Lg}), and its power-law dependence on frequency of the form Q{sub 0}f{sup {eta}} with controlled parameterization in the well-studied region of Northern California using a high-quality dataset from the Berkeley Digital Seismic Network. We investigate the difference in power-law Q calculated among the methods by focusing on the San Francisco Bay Area, where knowledge of attenuation is an important part of seismic hazard mitigation. This approximately homogeneous subset of our data lies in a small region along the Franciscan block. All methods return similar power-law parameters, though the range of the joint 95% confidence regions is large (Q{sub 0} = 85 {+-} 40; {eta} = 0.65 {+-} 0.35). The RTS and TS methods differ the most from the other methods and from each other. This may be due to the removal of the site term in the RTS method, which is shown to be significant in the San Francisco Bay Area. In order to completely understand the range of power-law Q in a region, it is advisable to use several methods to calculate the model. We also test the sensitivity of each method to changes in geometrical spreading, Lg frequency bandwidth, the distance range of data, and the Lg measurement window. For a given method, there are significant differences in the power-law parameters, Q{sub 0} and {eta

Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

Science.gov (United States)

Meier, Daniel; Schindler, Detlev

2011-01-01

The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

Directory of Open Access Journals (Sweden)

Daniel Meier

Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

Method of Promoting Single Crystal Growth During Melt Growth of Semiconductors

Science.gov (United States)

Su, Ching-Hua (Inventor)

2013-01-01

The method of the invention promotes single crystal growth during fabrication of melt growth semiconductors. A growth ampoule and its tip have a semiconductor source material placed therein. The growth ampoule is placed in a first thermal environment that raises the temperature of the semiconductor source material to its liquidus temperature. The growth ampoule is then transitioned to a second thermal environment that causes the semiconductor source material in the growth ampoule's tip to attain a temperature that is below the semiconductor source material's solidus temperature. The growth ampoule so-transitioned is then mechanically perturbed to induce single crystal growth at the growth ampoule's tip.

An improved principal component analysis based region matching method for fringe direction estimation

Science.gov (United States)

He, A.; Quan, C.

2018-04-01

The principal component analysis (PCA) and region matching combined method is effective for fringe direction estimation. However, its mask construction algorithm for region matching fails in some circumstances, and the algorithm for conversion of orientation to direction in mask areas is computationally-heavy and non-optimized. We propose an improved PCA based region matching method for the fringe direction estimation, which includes an improved and robust mask construction scheme, and a fast and optimized orientation-direction conversion algorithm for the mask areas. Along with the estimated fringe direction map, filtered fringe pattern by automatic selective reconstruction modification and enhanced fast empirical mode decomposition (ASRm-EFEMD) is used for Hilbert spiral transform (HST) to demodulate the phase. Subsequently, windowed Fourier ridge (WFR) method is used for the refinement of the phase. The robustness and effectiveness of proposed method are demonstrated by both simulated and experimental fringe patterns.

The -2549 insertion/deletion polymorphism in the promoter region of VEGF is associated with the risk of recurrent spontaneous abortion.

Science.gov (United States)

Hashemi, Mohammad; Danesh, Hiva; Bizhani, Fatemeh; Mokhtari, Mojgan; Bahari, Gholamreza; Tabasi, Farhad; Taheri, Mohsen

2018-03-01

Recurrent spontaneous abortion (RSA) is a common health problem affecting women of reproductive age. Altered expression of vascular endothelial growth factor ( VEGF ) has been associated with spontaneous abortion. The present case-control study aimed to evaluate the impact of the 18-bp insertion/deletion (ins/del) polymorphism (rs35569394) in the promoter region of the VEGF gene on idiopathic RSA. Genomic DNA from 93 patients with RSA and 93 healthy fertile women of southeastern Iran was isolated using the salting-out method. Genotyping of the rs35569394 variant was performed by a polymerase chain reaction (PCR) method. The findings indicated that the VEGF 18-bp ins/del variant significantly increased the risk of RSA under codominant (ins/ins vs. del/del; OR=2.85, 95% CI=1.31-6.22, P=0.019), dominant (del/ins+ins/ins vs. del/del; OR=2.19, 95% CI=1.20-4.01, P=0.015) and allelic (ins vs. del; OR=1.90, 95% CI=1.25-2.88, P=0.003) inheritance models. In summary, the findings propose a significant association between the VEGF 18-bp ins/del polymorphism and risk of RSA in a sample of the southeast Iranian population. Further studies on larger sample sizes and different ethnicities are required to validate the present findings.

Cinema ed enogastronomia nel portale turistico della Regione Toscana / Cinema and enogastronomy in the tourism portal of the Toscana Region

Directory of Open Access Journals (Sweden)

Gian Luigi Corinto

2016-05-01

The paper analyzes the case study of the Tuscan Region which in 2007 has charged the Sistema Toscana Foundation to strategically control all the territorial marketing activities, even including those of the regional film commission and the promotional tourist web site. The aim is to analyze the specific promotional model for enogastronomy and film tourism, as in the peculiar combination of the Tuscan case. The findings are that enongatronomy and tourism have been promoted in combination but only referring to 'minor' tuscan destinations, different from the crowded regional capital or other cultural sites. This choice has been determined by the strategic market positioning of the entire regional tourism supply, effectively integrating local vocations in the web communications. The task of the Foundation in promoting the whole territory and even the minor destinations must be considered as substantially successful, mainly because it has increased the visibility of the Tuscan region by conveniently using all the old and new media tools.

Activization of the state policy on euro-regional cooperation in the sphere of the interstate regional governance

Directory of Open Access Journals (Sweden)

V. I. Pak

2016-09-01

Research objective is the justification of the need of activization of the state policy on Euro-regional cooperation in the sphere of the interstate regional governance. During the research it is recognized that the realization of the state policy on the basis of the considered principles, tools, functions, factors and methods has to execute a main objective of the interstate regional control which is exercised in the sphere of Euro-regional cooperation and to promote adjustment of close mutually beneficial relations of Ukraine and neighboring states, to increase competitiveness of the Ukrainian territories and the most effective use of capacity of the Ukrainian regions in the course of activity of Euro-regions. Finally, such state policy has to be focused on the maintenance of the sufficient standard of living of the population, on ensuring integrity and unity of the social and economic space of the country, on formation of the conditions of sustainable and industrial and innovative development of regions, which will provide its harmonious integration into the European environment.

CRA-1 uncovers a double-strand break-dependent pathway promoting the assembly of central region proteins on chromosome axes during C. elegans meiosis.

Science.gov (United States)

Smolikov, Sarit; Schild-Prüfert, Kristina; Colaiácovo, Mónica P

2008-06-06

The synaptonemal complex (SC), a tripartite proteinaceous structure that forms between homologous chromosomes during meiosis, is crucial for faithful chromosome segregation. Here we identify CRA-1, a novel and conserved protein that is required for the assembly of the central region of the SC during C. elegans meiosis. In the absence of CRA-1, central region components fail to extensively localize onto chromosomes at early prophase and instead mostly surround the chromatin at this stage. Later in prophase, central region proteins polymerize along chromosome axes, but for the most part fail to connect the axes of paired homologous chromosomes. This defect results in an inability to stabilize homologous pairing interactions, altered double-strand break (DSB) repair progression, and a lack of chiasmata. Surprisingly, DSB formation and repair are required to promote the polymerization of the central region components along meiotic chromosome axes in cra-1 mutants. In the absence of both CRA-1 and any one of the C. elegans homologs of SPO11, MRE11, RAD51, or MSH5, the polymerization observed along chromosome axes is perturbed, resulting in the formation of aggregates of the SC central region proteins. While radiation-induced DSBs rescue this polymerization in cra-1; spo-11 mutants, they fail to do so in cra-1; mre-11, cra-1; rad-51, and cra-1; msh-5 mutants. Taken together, our studies place CRA-1 as a key component in promoting the assembly of a tripartite SC structure. Moreover, they reveal a scenario in which DSB formation and repair can drive the polymerization of SC components along chromosome axes in C. elegans.

An improved method for pancreas segmentation using SLIC and interactive region merging

Science.gov (United States)

Zhang, Liyuan; Yang, Huamin; Shi, Weili; Miao, Yu; Li, Qingliang; He, Fei; He, Wei; Li, Yanfang; Zhang, Huimao; Mori, Kensaku; Jiang, Zhengang

2017-03-01

Considering the weak edges in pancreas segmentation, this paper proposes a new solution which integrates more features of CT images by combining SLIC superpixels and interactive region merging. In the proposed method, Mahalanobis distance is first utilized in SLIC method to generate better superpixel images. By extracting five texture features and one gray feature, the similarity measure between two superpixels becomes more reliable in interactive region merging. Furthermore, object edge blocks are accurately addressed by re-segmentation merging process. Applying the proposed method to four cases of abdominal CT images, we segment pancreatic tissues to verify the feasibility and effectiveness. The experimental results show that the proposed method can make segmentation accuracy increase to 92% on average. This study will boost the application process of pancreas segmentation for computer-aided diagnosis system.

Properties of promoters cloned randomly from the Saccharomyces cerevisiae genome.

Science.gov (United States)

Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K

1988-01-01

Promoters were isolated at random from the genome of Saccharomyces cerevisiae by using a plasmid that contains a divergently arrayed pair of promoterless reporter genes. A comprehensive library was constructed by inserting random (DNase I-generated) fragments into the intergenic region upstream from the reporter genes. Simple in vivo assays for either reporter gene product (alcohol dehydrogenase or beta-galactosidase) allowed the rapid identification of promoters from among these random fragments. Poly(dA-dT) homopolymer tracts were present in three of five randomly cloned promoters. With two exceptions, each RNA start site detected was 40 to 100 base pairs downstream from a TATA element. All of the randomly cloned promoters were capable of activating reporter gene transcription bidirectionally. Interestingly, one of the promoter fragments originated in a region of the S. cerevisiae rDNA spacer; regulated divergent transcription (presumably by RNA polymerase II) initiated in the same region. Images PMID:2847031

Molecular methods for bacterial genotyping and analyzed gene regions

Directory of Open Access Journals (Sweden)

İbrahim Halil Yıldırım1, Seval Cing Yıldırım2, Nadir Koçak3

2011-06-01

Full Text Available Bacterial strain typing is an important process for diagnosis, treatment and epidemiological investigations. Current bacterial strain typing methods may be classified into two main categories: phenotyping and genotyping. Phenotypic characters are the reflection of genetic contents. Genotyping, which refers discrimination of bacterial strains based on their genetic content, has recently become widely used for bacterial strain typing. The methods already used in genotypingof bacteria are quite different from each other. In this review we tried to summarize the basic principles of DNA-based methods used in genotyping of bacteria and describe some important DNA regions that are used in genotyping of bacteria. J Microbiol Infect Dis 2011;1(1:42-46.

An engineering inviscid-boundary layer method for calculation of aerodynamic heating in the leeward region

International Nuclear Information System (INIS)

Dirin, M.M.; Karimian, S.M.H.; Maerefat, M.

2003-01-01

An engineering method has been modified for the prediction of aerodynamic heating of the hypersonic bodies in the leeward region. This is achieved using our proposed new method for determining streamlines in the leeward region. The modified form of Maslen's second order relation, which calculates pressure in the shock layer explicitly, is employed. The inviscid outer flow within the shock layer is first solved. The calculated solution, then, is used to determine the flow properties at the boundary layer edge and the orientation of the surface streamlines. Boundary layer equations, written in the streamline coordinates, are integrated along the surface to obtain the rate of heat transferred to the body surface. The present method is an inverse method in which the body shape is obtained according to the shape of the shock. In general, inviscid-boundary layer engineering methods calculate accurately the orientation of streamlines in the windward side only, and therefore they are not usually applicable in the leeward region. In the present study, a new method is proposed to determine the orientation of the surface streamlines in the leeward region. Using the present method, three-dimensional hypersonic flow is solved fast and easy all around a cone. The obtained results show that the corrections presented in this study extend excellently the application of the method to the leeward region. (author)

Compilation and analysis of Escherichia coli promoter DNA sequences.

OpenAIRE

Hawley, D K; McClure, W R

1983-01-01

The DNA sequence of 168 promoter regions (-50 to +10) for Escherichia coli RNA polymerase were compiled. The complete listing was divided into two groups depending upon whether or not the promoter had been defined by genetic (promoter mutations) or biochemical (5' end determination) criteria. A consensus promoter sequence based on homologies among 112 well-defined promoters was determined that was in substantial agreement with previous compilations. In addition, we have tabulated 98 promoter ...

Large-scale chromatin immunoprecipitation with promoter sequence microarray analysis of the interaction of the NSs protein of Rift Valley fever virus with regulatory DNA regions of the host genome.

Science.gov (United States)

Benferhat, Rima; Josse, Thibaut; Albaud, Benoit; Gentien, David; Mansuroglu, Zeyni; Marcato, Vasco; Souès, Sylvie; Le Bonniec, Bernard; Bouloy, Michèle; Bonnefoy, Eliette

2012-10-01

Rift Valley fever virus (RVFV) is a highly pathogenic Phlebovirus that infects humans and ruminants. Initially confined to Africa, RVFV has spread outside Africa and presently represents a high risk to other geographic regions. It is responsible for high fatality rates in sheep and cattle. In humans, RVFV can induce hepatitis, encephalitis, retinitis, or fatal hemorrhagic fever. The nonstructural NSs protein that is the major virulence factor is found in the nuclei of infected cells where it associates with cellular transcription factors and cofactors. In previous work, we have shown that NSs interacts with the promoter region of the beta interferon gene abnormally maintaining the promoter in a repressed state. In this work, we performed a genome-wide analysis of the interactions between NSs and the host genome using a genome-wide chromatin immunoprecipitation combined with promoter sequence microarray, the ChIP-on-chip technique. Several cellular promoter regions were identified as significantly interacting with NSs, and the establishment of NSs interactions with these regions was often found linked to deregulation of expression of the corresponding genes. Among annotated NSs-interacting genes were present not only genes regulating innate immunity and inflammation but also genes regulating cellular pathways that have not yet been identified as targeted by RVFV. Several of these pathways, such as cell adhesion, axonal guidance, development, and coagulation were closely related to RVFV-induced disorders. In particular, we show in this work that NSs targeted and modified the expression of genes coding for coagulation factors, demonstrating for the first time that this hemorrhagic virus impairs the host coagulation cascade at the transcriptional level.

Dynamic nucleosome organization at hox promoters during zebrafish embryogenesis.

Directory of Open Access Journals (Sweden)

Steven E Weicksel

Full Text Available Nucleosome organization at promoter regions plays an important role in regulating gene activity. Genome-wide studies in yeast, flies, worms, mammalian embryonic stem cells and transformed cell lines have found well-positioned nucleosomes flanking a nucleosome depleted region (NDR at transcription start sites. This nucleosome arrangement depends on DNA sequence (cis-elements as well as DNA binding factors and ATP-dependent chromatin modifiers (trans-factors. However, little is understood about how the nascent embryonic genome positions nucleosomes during development. This is particularly intriguing since the embryonic genome must undergo a broad reprogramming event upon fusion of sperm and oocyte. Using four stages of early embryonic zebrafish development, we map nucleosome positions at the promoter region of 37 zebrafish hox genes. We find that nucleosome arrangement at the hox promoters is a progressive process that takes place over several stages. At stages immediately after fertilization, nucleosomes appear to be largely disordered at hox promoter regions. At stages after activation of the embryonic genome, nucleosomes are detectable at hox promoters, with positions becoming more uniform and more highly occupied. Since the genomic sequence is invariant during embryogenesis, this progressive change in nucleosome arrangement suggests that trans-factors play an important role in organizing nucleosomes during embryogenesis. Separating hox genes into expressed and non-expressed groups shows that expressed promoters have better positioned and occupied nucleosomes, as well as distinct NDRs, than non-expressed promoters. Finally, by blocking the retinoic acid-signaling pathway, we disrupt early hox gene transcription, but observe no effect on nucleosome positions, suggesting that active hox transcription is not a driving force behind the arrangement of nucleosomes at the promoters of hox genes during early development.

Participatory methods for Inuit public health promotion and programme evaluation in Nunatsiavut, Canada.

Science.gov (United States)

Saini, Manpreet

2017-01-01

Engaging stakeholders is crucial for health promotion and programme evaluations; understanding how to best engage stakeholders is less clear, especially within Indigenous communities. The objectives of this thesis research were to use participatory methods to: (1) co-develop and evaluate a whiteboard video for use as a public health promotion tool in Rigolet, Nunatsiavut, and (2) develop and validate a framework for participatory evaluation of Inuit public health initiatives in Nunatsiavut, Labrador. Data collection tools included interactive workshops, community events, interviews, focus-group discussions and surveys. Results indicated the whiteboard video was an engaging and suitable medium for sharing public health messaging due to its contextually relevant elements. Participants identified 4 foundational evaluation framework components necessary to conduct appropriate evaluations, including: (1) community engagement, (2) collaborative evaluation development, (3) tailored evaluation data collection and (4) evaluation scope. This research illustrates stakeholder participation is critical to develop and evaluate contextually relevant public health initiatives in Nunatsiavut, Labrador and should be considered in other Indigenous communities.

A Modified Water-Table Fluctuation Method to Characterize Regional Groundwater Discharge

Directory of Open Access Journals (Sweden)

Lihong Yang

2018-04-01

Full Text Available A modified Water-Table Fluctuation (WTF method is developed to quantitatively characterize the regional groundwater discharge patterns in stressed aquifers caused by intensive agricultural pumping. Two new parameters are defined to express the secondary information in the observed data. One is infiltration efficiency and the other is discharge modulus (recurring head loss due to aquifer discharge. An optimization procedure is involved to estimate these parameters, based on continuous groundwater head measurements and precipitation records. Using the defined parameters and precipitation time series, water level changes are calculated for individual wells with fidelity. The estimated parameters are then used to further address the characterization of infiltration and to better quantify the discharge at the regional scale. The advantage of this method is that it considers recharge and discharge simultaneously, whereas the general WTF methods mostly focus on recharge. In the case study, the infiltration efficiency reveals that the infiltration is regionally controlled by the intrinsic characteristics of the aquifer, and locally distorted by engineered hydraulic structures that alter surface water-groundwater interactions. The seasonality of groundwater discharge is characterized by the monthly discharge modulus. These results from individual wells are clustered into groups that are consistent with the local land use pattern and cropping structures.

Glacial heritage: knowledge, inventory and promotion in the Chablais area (France, Switzerland)

Science.gov (United States)

Perret, A.; Reynard, E.; Delannoy, J.-J.

2012-04-01

This study is part of an Interreg IVA project (www.123chablais.com) dealing with the promotion of different types of natural and cultural heritage in the Chablais area (French and Swiss Prealps) and is linked to the candidature of the French Chablais territory for the European Geoparks Network. The objective of the study is to develop a strategy for the promotion of the glacial heritage (landforms, deposits) in an area where the geomorphological features are highly influenced by glacial history and where key concepts in the Quaternary sciences were developed (e.g. the theory of multiple glaciations by Morlot in 1859), but that is now nearly completely deglaciated. The challenge is to find solutions to explain why the glacial heritage is so important for the regional economy and how it influences the life of inhabitants (e.g. Evian and Thonon mineral water, extraction industry, landscape and tourism), even if glaciers are not so impressive than in other parts of the Alps. The research is divided in three parts. (1) The first one aims to enhance knowledge on glacial landforms and deposits. The study area, that is quite large, has been intensively studied for more than two centuries; nevertheless, some parts have been only poorly studied. Intensive field survey was carried out to fill in the gaps of knowledge and some landforms, such as erratic boulders, have been dated in order to establish a chronology of deglaciation. All of these different elements have been included in a Geographic Information System with the aim of establishing maps of glacial stages in the Chablais area. (2) From this, an inventory of glacial geosites has been carried out, using the assessment method developed by Reynard et al. (2007). A specific focus has been on the assessment of the potential of the selected sites for educational purposes and geotourist promotion. (3) The last part has been the preparation of adapted educational and promotional supports. In particular, an exhibition will be

Functional dissection of a napin gene promoter: identification of promoter elements required for embryo and endosperm-specific transcription.

Science.gov (United States)

Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L

1996-12-01

The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.

Combgap Promotes Ovarian Niche Development and Chromatin Association of EcR-Binding Regions in BR-C.

Science.gov (United States)

Hitrik, Anna; Popliker, Malka; Gancz, Dana; Mukamel, Zohar; Lifshitz, Aviezer; Schwartzman, Omer; Tanay, Amos; Gilboa, Lilach

2016-11-01

The development of niches for tissue-specific stem cells is an important aspect of stem cell biology. Determination of niche size and niche numbers during organogenesis involves precise control of gene expression. How this is achieved in the context of a complex chromatin landscape is largely unknown. Here we show that the nuclear protein Combgap (Cg) supports correct ovarian niche formation in Drosophila by controlling ecdysone-Receptor (EcR)- mediated transcription and long-range chromatin contacts in the broad locus (BR-C). Both cg and BR-C promote ovarian growth and the development of niches for germ line stem cells. BR-C levels were lower when Combgap was either reduced or over-expressed, indicating an intricate regulation of the BR-C locus by Combgap. Polytene chromosome stains showed that Cg co-localizes with EcR, the major regulator of BR-C, at the BR-C locus and that EcR binding to chromatin was sensitive to changes in Cg levels. Proximity ligation assay indicated that the two proteins could reside in the same complex. Finally, chromatin conformation analysis revealed that EcR-bound regions within BR-C, which span ~30 KBs, contacted each other. Significantly, these contacts were stabilized in an ecdysone- and Combgap-dependent manner. Together, these results highlight Combgap as a novel regulator of chromatin structure that promotes transcription of ecdysone target genes and ovarian niche formation.

A pilot study of Aboriginal health promotion from an ecological perspective

Directory of Open Access Journals (Sweden)

van den Tol Gemma

2011-09-01

Full Text Available Abstract Background For health promotion to be effective in Aboriginal and Torres Strait Islander Communities, interventions (and their evaluation need to work within a complex social environment and respect Indigenous knowledge, culture and social systems. At present, there is a lack of culturally appropriate evaluation methods available to practitioners that are capable of capturing this complexity. As an initial response to this problem, we used two non-invasive methods to evaluate a community-directed health promotion program, which aimed to improve nutrition and physical activity for members of the Aboriginal community of the Goulburn-Murray region of northern Victoria, Australia. The study addressed two main questions. First, for members of an Aboriginal sporting club, what changes were made to the nutrition environment in which they meet and how is this related to national guidelines for minimising the risk of chronic disease? Second, to what degree was the overall health promotion program aligned with an ecological model of health promotion that addresses physical, social and policy environments as well as individual knowledge and behaviour? Methods Rather than monitoring individual outcomes, evaluation methods reported on here assessed change in the nutrition environment (sports club food supply as a facilitator of dietary change and the 'ecological' nature of the overall program (that is, its complexity with respect to numbers of targets, settings and strategies. Results There were favourable changes towards the provision of a food supply consistent with Australian guidelines at the sports club. The ecological analysis indicated that the design and implementation of the program were consistent with an ecological model of health promotion. Conclusions The evaluation was useful for assessing the impact of the program on the nutrition environment and for understanding the ecological nature of program activities.

Computerized detection of multiple sclerosis candidate regions based on a level set method using an artificial neural network

International Nuclear Information System (INIS)

Kuwazuru, Junpei; Magome, Taiki; Arimura, Hidetaka; Yamashita, Yasuo; Oki, Masafumi; Toyofuku, Fukai; Kakeda, Shingo; Yamamoto, Daisuke

2010-01-01

Yamamoto et al. developed the system for computer-aided detection of multiple sclerosis (MS) candidate regions. In a level set method in their proposed method, they employed the constant threshold value for the edge indicator function related to a speed function of the level set method. However, it would be appropriate to adjust the threshold value to each MS candidate region, because the edge magnitudes in MS candidates differ from each other. Our purpose of this study was to develop a computerized detection of MS candidate regions in MR images based on a level set method using an artificial neural network (ANN). To adjust the threshold value for the edge indicator function in the level set method to each true positive (TP) and false positive (FP) region, we constructed the ANN. The ANN could provide the suitable threshold value for each candidate region in the proposed level set method so that TP regions can be segmented and FP regions can be removed. Our proposed method detected MS regions at a sensitivity of 82.1% with 0.204 FPs per slice and similarity index of MS candidate regions was 0.717 on average. (author)

M-Arctan estimator based on the trust-region method

Energy Technology Data Exchange (ETDEWEB)

Hassaine, Yacine; Delourme, Benoit; Panciatici, Patrick [Gestionnaire du Reseau de Transport d Electricite Departement Methodes et appui Immeuble Le Colbert 9, Versailles Cedex (France); Walter, Eric [Laboratoire des signaux et systemes (L2S) Supelec, Gif-sur-Yvette (France)

2006-11-15

In this paper a new approach is proposed to increase the robustness of the classical L{sub 2}-norm state estimation. To achieve this task a new formulation of the Levemberg-Marquardt algorithm based on the trust-region method is applied to a new M-estimator, which we called M-Arctan. Results obtained on IEEE networks up to 300 buses are presented. (author)

High fructose consumption induces DNA methylation at PPARα and CPT1A promoter regions in the rat liver

Energy Technology Data Exchange (ETDEWEB)

Ohashi, Koji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Munetsuna, Eiji [Department of Biochemistry, Fujita Health University School of Medicine, Toyoake (Japan); Yamada, Hiroya, E-mail: hyamada@fujita-hu.ac.jp [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan); Ando, Yoshitaka [Department of Joint Research Laboratory of Clinical Medicine, Fujita Health University Hospital, Toyoake (Japan); Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Suzuki, Koji [Department of Public Health, Fujita Health University School of Health Sciences, Toyoake (Japan); Teradaira, Ryoji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Hashimoto, Shuji [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan)

2015-12-04

DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.

High fructose consumption induces DNA methylation at PPARα and CPT1A promoter regions in the rat liver

International Nuclear Information System (INIS)

Ohashi, Koji; Munetsuna, Eiji; Yamada, Hiroya; Ando, Yoshitaka; Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki; Suzuki, Koji; Teradaira, Ryoji; Hashimoto, Shuji

2015-01-01

DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.

Evaluation of methylation pattern in promoter region of E-cadherin ...

African Journals Online (AJOL)

user

2011-03-07

Mar 7, 2011 ... promoter methylation in CDH1 gene inactivation in breast cancer, the CpG methylation status of E- ..... 5'CpG island of CDH1 in prostate, lung, liver, bladder, .... and estrogen receptor alpha from Sp1 sites to induce cell cycle.

TSA-induced DNMT1 down-regulation represses hTERT expression via recruiting CTCF into demethylated core promoter region of hTERT in HCT116.

Science.gov (United States)

Choi, Jee-Hye; Min, Na Young; Park, Jina; Kim, Jin Hong; Park, Soo Hyun; Ko, Young Jong; Kang, Yoonsung; Moon, Young Joon; Rhee, Sangmyung; Ham, Seung Wook; Park, Ae Ja; Lee, Kwang-Ho

2010-01-01

Trichostatin A (TSA), an inhibitor of histone deacetylase, is a well-known antitumor agent that effectively and selectively induces tumor growth arrest and apoptosis. Recently, it was reported that hTERT is one of the primary targets for TSA-induced apoptosis in cancer cells but the mechanism of which has not yet been elucidated. In the present study, to better understand the epigenetic regulation mechanism responsible for the repression of hTERT by TSA, we examined expression of hTERT in the HCT116 colon cancer cell line after treatment with TSA and performed site-specific CpG methylation analysis of the hTERT promoter. We found that TSA-induced the demethylation of site-specific CpGs on the promoter of hTERT, which was caused by down-regulation of DNA methyltransferase 1 (DNMT1). Among the demethylated region, the 31st-33rd CpGs contained a binding site for CTCF, an inhibitor of hTERT transcription. ChIP analysis revealed that TSA-induced demethylation of the 31st-33rd CpGs promoted CTCF binding on hTERT promoter, leading to repression of hTERT. Taken together, down-regulation of DNMT1 by TSA caused demethylation of a CTCF binding site on the hTERT promoter, the result of which was repression of hTERT via recruitment of CTCF to the promoter. Copyright 2009 Elsevier Inc. All rights reserved.

The effect of phenobarbital on the methylation level of the p16 promoter region in rat liver

International Nuclear Information System (INIS)

Kostka, Grazyna; Urbanek, Katarzyna; Ludwicki, Jan K.

2007-01-01

It has been suggested that non-genotoxic carcinogens (NGCs) may cause modification of the DNA methylation status. We studied the effects of phenobarbital (PB) - a non-genotoxic rodent liver carcinogen - on the methylation level of the promoter region of the p16 suppressor gene, as well as on hepatomegaly, DNA synthesis, and DNA-methyltransferase (DNMTs) activity in the rat liver. Male Wistar rats received PB in 1, 3 or 14 daily oral doses (at 24-h intervals), each equivalent to 1/10 of the LD 50 value. The study showed that PB has caused persistent elevation in relative liver weight (RLW) as well as a transient increase in DNA synthesis. This suggests that the PB-induced increase in RLW was due to a combination of both hyperplasia and hypertrophy of liver cells. The effect of PB on DNA synthesis corresponded to an increase in the methylation pattern of the p16 promoter sequence. Methylation of cytosine in the analyzed CpG sites of the p16 gene was found after short exposure of the animals to PB. Treatment of rats with PB for 1 and 3 days also produced an increase in nuclear DNMTs activity. After prolonged administration (14 days), DNA synthesis declined, returning to the control level. No changes in methylation of the p16 gene nor in DNMTs activity were observed. The reversibility of early induced changes in target tissues is a mark characteristic of tumor promoters. Thus, transient changes in methylation of the p16 gene, although their direct role in the mechanisms of PB toxicity, including its carcinogenic action, remains doubtful, may therefore be a significant element of such processes

Creating multithemed ecological regions for macroscale ecology: Testing a flexible, repeatable, and accessible clustering method

Science.gov (United States)

Cheruvelil, Kendra Spence; Yuan, Shuai; Webster, Katherine E.; Tan, Pang-Ning; Lapierre, Jean-Francois; Collins, Sarah M.; Fergus, C. Emi; Scott, Caren E.; Norton Henry, Emily; Soranno, Patricia A.; Filstrup, Christopher T.; Wagner, Tyler

2017-01-01

Understanding broad-scale ecological patterns and processes often involves accounting for regional-scale heterogeneity. A common way to do so is to include ecological regions in sampling schemes and empirical models. However, most existing ecological regions were developed for specific purposes, using a limited set of geospatial features and irreproducible methods. Our study purpose was to: (1) describe a method that takes advantage of recent computational advances and increased availability of regional and global data sets to create customizable and reproducible ecological regions, (2) make this algorithm available for use and modification by others studying different ecosystems, variables of interest, study extents, and macroscale ecology research questions, and (3) demonstrate the power of this approach for the research question—How well do these regions capture regional-scale variation in lake water quality? To achieve our purpose we: (1) used a spatially constrained spectral clustering algorithm that balances geospatial homogeneity and region contiguity to create ecological regions using multiple terrestrial, climatic, and freshwater geospatial data for 17 northeastern U.S. states (~1,800,000 km2); (2) identified which of the 52 geospatial features were most influential in creating the resulting 100 regions; and (3) tested the ability of these ecological regions to capture regional variation in water nutrients and clarity for ~6,000 lakes. We found that: (1) a combination of terrestrial, climatic, and freshwater geospatial features influenced region creation, suggesting that the oft-ignored freshwater landscape provides novel information on landscape variability not captured by traditionally used climate and terrestrial metrics; and (2) the delineated regions captured macroscale heterogeneity in ecosystem properties not included in region delineation—approximately 40% of the variation in total phosphorus and water clarity among lakes was at the regional

Classication of Status of the Region on Java Island using C4.5, CHAID, and CART Methods

Science.gov (United States)

Syaraswati, R. A.; Slamet, I.; Winarno, B.

2017-06-01

The indicator of region economic success can be measured by economic growth, presented by value of Gross Regional Domestic Product (GRDP). Java island has the biggest GDP contribution toward the Indonesian government, but not all of the region gives equality contribution. The C4.5, CHAID, and CART methods can be used for classifying the status of the region with nonparametric approach. The C4.5 and CHAID methods are non-binary decision tree, meanwhile the CART methods is binary decision tree. The purposes of this paper are to know how the classification and to determine the factors that influence on classification of the region. The dependent variable is status of the region which is divided into four categories based on Klassen typology. The result shows factors that have the biggest contribution on classification of status of the region on Java island based on C4.5 method are economic growth rate, electricity, gas, and water sector, and area. The factors that have the biggest contribution based on CHAID method are growth rate, manufacturing sector, and electricity, gas, and water sector, while based on CART method are growth rate, manufacturing sector, and electricity, gas, and water sector.

Does FDI promote regional development? Evidence from local and regional productivity spillovers in Greece

Directory of Open Access Journals (Sweden)

Vassilis MONASTIRIOTIS

2010-12-01

Full Text Available Studies on the productivity spillovers of FDI have concentrated on the nationalsectoral level. As a result, little is known about the impact of FDI on absolute and relative regional economic performance. In this paper we examine this issue by relying on a unique dataset of over 20,000 Greek firms for the period 2002-2006 covering all sectors of economic activity. We examine the spatial distribution of foreign-owned firms in the country and analyse the effect that their presence – at the local, regional and national levels – has on the productivity of domestic firms. We find strong evidence suggesting that foreignowned firms self-select into regions and sectors of high productivity. Net of this selection effect, the impact of foreign presence on domestic productivity is negative – although at the very local level some positive spillover effects are identifiable. The bulk of the effects concentrate in non-manufacturing activities, high-tech sectors, and medium-sized high-productivity firms. Importantly, this effect is not constant across space however. Productivity spillovers tend to be negative in the regions hosting the main urban areas in the country but positive in smaller and more peripheral regions. In this way, despite the tendency of FDI to concentrate in a limited number of areas within the country – those of the highest level of development – the externalities that FDI activity generates to the local economies appear to be of a rather equilibrating character.

3. Promotion of environment protection of sea and near-sea region. Swinoujscie 12-14 October 1994

International Nuclear Information System (INIS)

1994-01-01

The great number of problems connected with environment protection near shore marine zone, beach protection, effluent transport in ground and surface waters in region of North Port of Poland as well as technical solutions of water purification and legal problems have been discussed during the conference. All observations and experimental works have been carried out in that region. Among reported works two of them have been devoted to application of nuclear methods in interesting merit

Constructing a State Policy To Promote Regionalism in School Government.

Science.gov (United States)

Zukowsky, Jerome; And Others.

This paper defines regionalism, sets some tentative directions for the concept, and raises difficult questions related to its application in New York State. Regionalism, which offers an alternative to a State-local school governing system, is used to decentralize the planning and management of public services. A regional unit permits district…

National Survey on Access, Use and Promotion of Rational Use of Medicines (PNAUM: household survey component methods

Directory of Open Access Journals (Sweden)

Sotero Serrate Mengue

Full Text Available ABSTRACT OBJECTIVE To describe methodological aspects of the household survey National Survey on Access, Use and Promotion of Rational Use of Medicines (PNAUM related to sampling design and implementation, the actual obtained sample, instruments and fieldwork. METHODS A cross-sectional, population-based study with probability sampling in three stages of the population living in households located in Brazilian urban areas. Fieldwork was carried out between September 2013 and February 2014. The data collection instrument included questions related to: information about households, residents and respondents; chronic diseases and medicines used; use of health services; acute diseases and events treated with drugs; use of contraceptives; use of pharmacy services; behaviors that may affect drug use; package inserts and packaging; lifestyle and health insurance. RESULTS In total, 41,433 interviews were carried out in 20,404 households and 576 urban clusters corresponding to 586 census tracts distributed in the five Brazilian regions, according to eight domains defined by age and gender. CONCLUSIONS The results of the survey may be used as a baseline for future studies aiming to assess the impact of government action on drug access and use. For local studies using a compatible method, PNAUM may serve as a reference point to evaluate variations in space and population. With a comprehensive evaluation of drug-related aspects, PNAUM is a major source of data for a variety of analyses to be carried out both at academic and government level.

Economics methods in Cochrane systematic reviews of health promotion and public health related interventions

Directory of Open Access Journals (Sweden)

McDaid David

2006-11-01

Full Text Available Abstract Background Provision of evidence on costs alongside evidence on the effects of interventions can enhance the relevance of systematic reviews to decision-making. However, patterns of use of economics methods alongside systematic review remain unclear. Reviews of evidence on the effects of interventions are published by both the Cochrane and Campbell Collaborations. Although it is not a requirement that Cochrane or Campbell Reviews should consider economic aspects of interventions, many do. This study aims to explore and describe approaches to incorporating economics methods in a selection of Cochrane systematic reviews in the area of health promotion and public health, to help inform development of methodological guidance on economics for reviewers. Methods The Cochrane Database of Systematic Reviews was searched using a search strategy for potential economic evaluation studies. We included current Cochrane reviews and review protocols retrieved using the search that are also identified as relevant to health promotion or public health topics. A reviewer extracted data which describe the economics components of included reviews. Extracted data were summarised in tables and analysed qualitatively. Results Twenty-one completed Cochrane reviews and seven review protocols met inclusion criteria. None incorporate formal economic evaluation methods. Ten completed reviews explicitly aim to incorporate economics studies and data. There is a lack of transparent reporting of methods underpinning the incorporation of economics studies and data. Some reviews are likely to exclude useful economics studies and data due to a failure to incorporate search strategies tailored to the retrieval of such data or use of key specialist databases, and application of inclusion criteria designed for effectiveness studies. Conclusion There is a need for consistency and transparency in the reporting and conduct of the economics components of Cochrane reviews, as

Clinical Significance of Retinoic Acid Receptor Beta Promoter Methylation in Prostate Cancer: A Meta-Analysis.

Science.gov (United States)

Dou, MengMeng; Zhou, XueLiang; Fan, ZhiRui; Ding, XianFei; Li, LiFeng; Wang, ShuLing; Xue, Wenhua; Wang, Hui; Suo, Zhenhe; Deng, XiaoMing

2018-01-01

Retinoic acid receptor beta (RAR beta) is a retinoic acid receptor gene that has been shown to play key roles during multiple cancer processes, including cell proliferation, apoptosis, migration and invasion. Numerous studies have found that methylation of the RAR beta promoter contributed to the occurrence and development of malignant tumors. However, the connection between RAR beta promoter methylation and prostate cancer (PCa) remains unknown. This meta-analysis evaluated the clinical significance of RAR beta promoter methylation in PCa. We searched all published records relevant to RAR beta and PCa in a series of databases, including PubMed, Embase, Cochrane Library, ISI Web of Science and CNKI. The rates of RAR beta promoter methylation in the PCa and control groups (including benign prostatic hyperplasia and normal prostate tissues) were summarized. In addition, we evaluated the source region of available samples and the methods used to detect methylation. To compare the incidence and variation in RAR beta promoter methylation in PCa and non-PCa tissues, the odds ratio (OR) and 95% confidence interval (CI) were calculated accordingly. All the data were analyzed with the statistical software STATA 12.0. Based on the inclusion and exclusion criteria, 15 articles assessing 1,339 samples were further analyzed. These data showed that the RAR beta promoter methylation rates in PCa tissues were significantly higher than the rates in the non-PCa group (OR=21.65, 95% CI: 9.27-50.57). Subgroup analysis according to the source region of samples showed that heterogeneity in Asia was small (I2=0.0%, P=0.430). Additional subgroup analysis based on the method used to detect RAR beta promoter methylation showed that the heterogeneity detected by MSP (methylation-specific PCR) was relatively small (I2=11.3%, P=0.343). Although studies reported different rates for RAR beta promoter methylation in PCa tissues, the total analysis demonstrated that RAR beta promoter methylation

Promoter Hypermethylation of the ATM Gene as a Novel Biomarker for Breast Cancer

Science.gov (United States)

Begam, Nasrin; Jamil, Kaiser; Raju, Suryanarayana G

2017-11-26

Background: Breast cancer may be induced by activation of protooncogenes to oncogenes and in many cases inactivation of tumor suppressor genes. Ataxia telangiectasia mutated (ATM) is an important tumor suppressor gene which plays central roles in the maintenance of genomic integrity by activating cell cycle checkpoints and promoting repair of double-strand breaks of DNA. In breast cancer, decrease ATM expression correlates with a poor outcome; however, the molecular mechanisms underlying downregulation are still unclear. Promoter hypermethylation may contribute in downregulation. Hence the present investigation was designed to evaluate promoter methylation and expression of the ATM gene in breast cancer cases, and to determine links with clinical and demographic manifestations, in a South Indian population. Methods: Tumor biopsy samples were collected from 50 pathologically confirmed sporadic breast cancer cases. DNA was isolated from tumor and adjacent non-tumorous regions, and sodium bisulfite conversion and methylation-specific PCR were performed using MS-PCR primers for the ATM promoter region. In addition, ATM mRNA expression was also analyzed for all samples using real-time PCR. Results: Fifty eight percent (58%) of cancer tissue samples showed promoter hypermethylation for the ATM gene, in contrast to only 4.44% of normal tissues (p= 0.0001). Furthermore, ATM promoter methylation was positively associated with age (p = 0.01), tumor size (p=0.045) and advanced stage of disease i.e. stages III and IV (p =0.019). An association between promoter hypermethylation and lower expression of ATM mRNA was also found (p=0.035). Conclusion: We report for the first time that promoter hypermethylation of ATM gene may be useful as a potential new biomarker for breast cancer, especially in the relatively young patients. Creative Commons Attribution License

Evaluation of health promotion in schools: a realistic evaluation approach using mixed methods

Science.gov (United States)

2010-01-01

Background Schools are key settings for health promotion (HP) but the development of suitable approaches for evaluating HP in schools is still a major topic of discussion. This article presents a research protocol of a program developed to evaluate HP. After reviewing HP evaluation issues, the various possible approaches are analyzed and the importance of a realistic evaluation framework and a mixed methods (MM) design are demonstrated. Methods/Design The design is based on a systemic approach to evaluation, taking into account the mechanisms, context and outcomes, as defined in realistic evaluation, adjusted to our own French context using an MM approach. The characteristics of the design are illustrated through the evaluation of a nationwide HP program in French primary schools designed to enhance children's social, emotional and physical health by improving teachers' HP practices and promoting a healthy school environment. An embedded MM design is used in which a qualitative data set plays a supportive, secondary role in a study based primarily on a different quantitative data set. The way the qualitative and quantitative approaches are combined through the entire evaluation framework is detailed. Discussion This study is a contribution towards the development of suitable approaches for evaluating HP programs in schools. The systemic approach of the evaluation carried out in this research is appropriate since it takes account of the limitations of traditional evaluation approaches and considers suggestions made by the HP research community. PMID:20109202

Function of the EGR-1/TIS8 radiation inducible promoter in a minimal HSV-1 amplicon system

International Nuclear Information System (INIS)

Spear, M.A.; Sakamoto, K.M.; Herrlinger, U.; Pechan, P.; Breakefield, X.O.

1997-01-01

Purpose: To evaluate function of the EGR-1/TIS8 promoter region in minimal HSV-1 amplicon system in order to determine the feasibility of using the system to regulate vector replication with radiation. Materials and Methods: A 600-base pair 5' upstream region of the EGR-1 promoter linked to chloramphenicol acetyltransferase (CAT) was recombined into a minimal HSV-1 amplicon vector system (pONEC). pONEC or a control plasmid was transfected into U87 glioma cells using the Lipofectamine method. Thirty-six hours later one aliquot of cells from each transfection was irradiated to a dose of 20 Gy and another identical aliquot served as a control. CAT activity was assayed 8 hours after irradiation. Results: pONEC transfected cells irradiated with 20 Gy demonstrated 2.0 fold increase in CAT activity compared to non-irradiated cells. Cells transfected with control plasmid showed no change in CAT activity. Unirradiated pONEC cells had CAT activity 1.3 times those transfected with control plasmid. Conclusion: We have previously created HSV-1 gene therapy amplicon vector systems which allow virus-amplicon interdependent replication, with the intent of regulating replication. The above data demonstrates that a minimal amplicon system will allow radiation dependent regulation by the EGR-1 promoter, thus indicating the possibility of using this system to regulate onsite, spatially and temporally regulated vector production. Baseline CAT activity was higher and relative induction lower than other reported expression constructs, which raises concern for the ability of the system to produce a differential in transcription levels sufficient for this purpose. This is possibly the result of residual promoter/enhancer elements remaining in the HSV-1 sequences. We are attempting to create constructs lacking these elements. Addition of secondary promoter sequences may also be of use. We are also currently evaluating the efficacy of the putative IEX-1 radiation inducible promoter region in

Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset.

Science.gov (United States)

Ignatieva, Elena V; Levitsky, Victor G; Yudin, Nikolay S; Moshkin, Mikhail P; Kolchanov, Nikolay A

2014-01-01

The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors), which are activated by olfactory stimuli (ligands). Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter [a region of DNA about 100-1000 base pairs long located upstream of the transcription start site (TSS)]. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.). In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

A watershed-based method for environmental vulnerability assessment with a case study of the Mid-Atlantic region

Energy Technology Data Exchange (ETDEWEB)

Tran, Liem T., E-mail: ltran1@utk.edu [Department of Geography, University of Tennessee, Knoxville, TN (United States); O& #x27; Neill, Robert V. [OTIE and Associates, Oak Ridge, TN (United States); Smith, Elizabeth R. [U.S. Environmental Protection Agency, Office of Research and Development, National Exposure Research Laboratory, Research Triangle Park, NC (United States)

2012-04-15

The paper presents a method for environmental vulnerability assessment with a case study of the Mid-Atlantic region. The method is based on the concept of 'self-/peer-appraisal' of a watershed in term of vulnerability. The self-/peer-appraisal process is facilitated by two separate linear optimization programs. The analysis provided insights on the environmental conditions, in general, and the relative vulnerability pattern, in particular, of the Mid-Atlantic region. The suggested method offers a simple but effective and objective way to perform a regional environmental vulnerability assessment. Consequently the method can be used in various steps in environmental assessment and planning. - Highlights: Black-Right-Pointing-Pointer We present a method for regional environmental vulnerability assessment. Black-Right-Pointing-Pointer It is based on the self-/peer-appraisal concept in term of vulnerability. Black-Right-Pointing-Pointer The analysis is facilitated by two separate linear optimization programs. Black-Right-Pointing-Pointer The method provides insights on the regional relative vulnerability pattern.

Using Social Network Analysis as a Method to Assess and Strengthen Participation in Health Promotion Programs in Vulnerable Areas.

Science.gov (United States)

Hindhede, Anette Lykke; Aagaard-Hansen, Jens

2017-03-01

This article provides an example of the application of social network analysis method to assess community participation thereby strengthening planning and implementation of health promotion programming. Community health promotion often takes the form of services that reach out to or are located within communities. The concept of community reflects the idea that people's behavior and well-being are influenced by interaction with others, and here, health promotion requires participation and local leadership to facilitate transmission and uptake of interventions for the overall community to achieve social change. However, considerable uncertainty exists over exact levels of participation in these interventions. The article draws on a mixed methods research within a community development project in a vulnerable neighborhood of a town in Denmark. It presents a detailed analysis of the way in which social network analysis can be used as a tool to display participation and nonparticipation in community development and health promotion activities, to help identify capacities and assets, mobilize resources, and finally to evaluate the achievements. The article concludes that identification of interpersonal ties among people who know one another well as well as more tenuous relationships in networks can be used by community development workers to foster greater cohesion and cooperation within an area.

Libraries of Synthetic TALE-Activated Promoters: Methods and Applications.

Science.gov (United States)

Schreiber, T; Tissier, A

2016-01-01

The discovery of proteins with programmable DNA-binding specificities triggered a whole array of applications in synthetic biology, including genome editing, regulation of transcription, and epigenetic modifications. Among those, transcription activator-like effectors (TALEs) due to their natural function as transcription regulators, are especially well-suited for the development of orthogonal systems for the control of gene expression. We describe here the construction and testing of libraries of synthetic TALE-activated promoters which are under the control of a single TALE with a given DNA-binding specificity. These libraries consist of a fixed DNA-binding element for the TALE, a TATA box, and variable sequences of 19 bases upstream and 43 bases downstream of the DNA-binding element. These libraries were cloned using a Golden Gate cloning strategy making them usable as standard parts in a modular cloning system. The broad range of promoter activities detected and the versatility of these promoter libraries make them valuable tools for applications in the fine-tuning of expression in metabolic engineering projects or in the design and implementation of regulatory circuits. © 2016 Elsevier Inc. All rights reserved.

Do regional methods really help reduce uncertainties in flood frequency analyses?

Science.gov (United States)

Cong Nguyen, Chi; Payrastre, Olivier; Gaume, Eric

2013-04-01

Flood frequency analyses are often based on continuous measured series at gauge sites. However, the length of the available data sets is usually too short to provide reliable estimates of extreme design floods. To reduce the estimation uncertainties, the analyzed data sets have to be extended either in time, making use of historical and paleoflood data, or in space, merging data sets considered as statistically homogeneous to build large regional data samples. Nevertheless, the advantage of the regional analyses, the important increase of the size of the studied data sets, may be counterbalanced by the possible heterogeneities of the merged sets. The application and comparison of four different flood frequency analysis methods to two regions affected by flash floods in the south of France (Ardèche and Var) illustrates how this balance between the number of records and possible heterogeneities plays in real-world applications. The four tested methods are: (1) a local statistical analysis based on the existing series of measured discharges, (2) a local analysis valuating the existing information on historical floods, (3) a standard regional flood frequency analysis based on existing measured series at gauged sites and (4) a modified regional analysis including estimated extreme peak discharges at ungauged sites. Monte Carlo simulations are conducted to simulate a large number of discharge series with characteristics similar to the observed ones (type of statistical distributions, number of sites and records) to evaluate to which extent the results obtained on these case studies can be generalized. These two case studies indicate that even small statistical heterogeneities, which are not detected by the standard homogeneity tests implemented in regional flood frequency studies, may drastically limit the usefulness of such approaches. On the other hand, these result show that the valuation of information on extreme events, either historical flood events at gauged

DNA methylation of PTEN gene promoter region is not correlated ...

African Journals Online (AJOL)

Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...

Methods and Practices of Urban Filipino Parents in Promoting Mabuting Asal among Preschool Children

Directory of Open Access Journals (Sweden)

Maria Perlita E. de Leon

2012-12-01

Full Text Available This paper is a portion of an ethnographic study conducted in an urbanizing community in Valenzuela City. The study aimed to investigate and discuss the concepts and practices that parents have in promoting mabuting asal or positive social behavior among their preschool children. The participantswere 15 two-parent families with at least two children, one of whom was between ages 3 and 6 years. Seven of the participating families were dualearner while the rest were single-earner. They were visited at home for at leastan hour twice a week for a period of six months. Afterwards, face-to-face interviews were conducted with the parents in each family. Results suggested that the methods that parents use to promote mabuting asal among the young ones can be categorized into three – physical, verbal, and cognitivetypes. Mothers in both income groups used the physical and cognitive types, although single-earner families would use physical methods more often than cognitive ones. On the other hand, fathers in both income groups would useverbal methods more, possibly as a result of their compensating behavior for their own experiences of harsh and coercive upbringing as young children. The study recommends comprehensive, integrative, sensitive, and flexible child-rearing seminars for parents as well as health and day care workers in the community. In terms of methodology, conducting the research in several localities, across different social groups, with a larger sample could provideanother perspective to the relationships between variables utilized in this research.

National promotional campaign

Directory of Open Access Journals (Sweden)

Pekevski Siniša

2008-01-01

Full Text Available Taking an attention to promotion as operational variable in marketing effort, author focused on so called ways of creating national images. As a case of very interesting activity paper discuss an experience of regional chamber of Croatia with activities in upgrading international recognition of national products as well as country as destination in such context.

Comparative analyses of bidirectional promoters in vertebrates

Directory of Open Access Journals (Sweden)

Taylor James

2008-05-01

Full Text Available Abstract Background Orthologous genes with deep phylogenetic histories are likely to retain similar regulatory features. In this report we utilize orthology assignments for pairs of genes co-regulated by bidirectional promoters to map the ancestral history of the promoter regions. Results Our mapping of bidirectional promoters from humans to fish shows that many such promoters emerged after the divergence of chickens and fish. Furthermore, annotations of promoters in deep phylogenies enable detection of missing data or assembly problems present in higher vertebrates. The functional importance of bidirectional promoters is indicated by selective pressure to maintain the arrangement of genes regulated by the promoter over long evolutionary time spans. Characteristics unique to bidirectional promoters are further elucidated using a technique for unsupervised classification, known as ESPERR. Conclusion Results of these analyses will aid in our understanding of the evolution of bidirectional promoters, including whether the regulation of two genes evolved as a consequence of their proximity or if function dictated their co-regulation.

Recognition of prokaryotic and eukaryotic promoters using convolutional deep learning neural networks

KAUST Repository

Umarov, Ramzan

2017-02-03

Accurate computational identification of promoters remains a challenge as these key DNA regulatory regions have variable structures composed of functional motifs that provide gene-specific initiation of transcription. In this paper we utilize Convolutional Neural Networks (CNN) to analyze sequence characteristics of prokaryotic and eukaryotic promoters and build their predictive models. We trained a similar CNN architecture on promoters of five distant organisms: human, mouse, plant (Arabidopsis), and two bacteria (Escherichia coli and Bacillus subtilis). We found that CNN trained on sigma70 subclass of Escherichia coli promoter gives an excellent classification of promoters and non-promoter sequences (Sn = 0.90, Sp = 0.96, CC = 0.84). The Bacillus subtilis promoters identification CNN model achieves Sn = 0.91, Sp = 0.95, and CC = 0.86. For human, mouse and Arabidopsis promoters we employed CNNs for identification of two well-known promoter classes (TATA and non-TATA promoters). CNN models nicely recognize these complex functional regions. For human promoters Sn/Sp/CC accuracy of prediction reached 0.95/0.98/0,90 on TATA and 0.90/0.98/0.89 for non-TATA promoter sequences, respectively. For Arabidopsis we observed Sn/Sp/CC 0.95/0.97/0.91 (TATA) and 0.94/0.94/0.86 (non-TATA) promoters. Thus, the developed CNN models, implemented in CNNProm program, demonstrated the ability of deep learning approach to grasp complex promoter sequence characteristics and achieve significantly higher accuracy compared to the previously developed promoter prediction programs. We also propose random substitution procedure to discover positionally conserved promoter functional elements. As the suggested approach does not require knowledge of any specific promoter features, it can be easily extended to identify promoters and other complex functional regions in sequences of many other and especially newly sequenced genomes. The CNNProm program is available to run at web server http://www.softberry.com.

Promoters active in interphase are bookmarked during mitosis by ubiquitination

Science.gov (United States)

Arora, Mansi; Zhang, Jie; Heine, George F.; Ozer, Gulcin; Liu, Hui-wen; Huang, Kun; Parvin, Jeffrey D.

2012-01-01

We analyzed modification of chromatin by ubiquitination in human cells and whether this mark changes through the cell cycle. HeLa cells were synchronized at different stages and regions of the genome with ubiquitinated chromatin were identified by affinity purification coupled with next-generation sequencing. During interphase, ubiquitin marked the chromatin on the transcribed regions of ∼70% of highly active genes and deposition of this mark was sensitive to transcriptional inhibition. Promoters of nearly half of the active genes were highly ubiquitinated specifically during mitosis. The ubiquitination at the coding regions in interphase but not at promoters during mitosis was enriched for ubH2B and dependent on the presence of RNF20. Ubiquitin labeling of both promoters during mitosis and transcribed regions during interphase, correlated with active histone marks H3K4me3 and H3K36me3 but not a repressive histone modification, H3K27me3. The high level of ubiquitination at the promoter chromatin during mitosis was transient and was removed within 2 h after the cells exited mitosis and entered the next cell cycle. These results reveal that the ubiquitination of promoter chromatin during mitosis is a bookmark identifying active genes during chromosomal condensation in mitosis, and we suggest that this process facilitates transcriptional reactivation post-mitosis. PMID:22941662

Characterization and sequence analysis of the F2 promoter from corynephage BFK20

International Nuclear Information System (INIS)

Koptides, M.; Ugorcakova, J.; Baloghova, E.; Bukovska, G.; Timko, J.

1994-01-01

F2 promoter from corynephage BFK20 was isolated and characterized. It was functional in Escherichia coli and Corynebacterium glutamicum. Cloning of the F2 promoter into the pJUP05 promoter probe vector caused an increase of the neomycin phosphotransferase II specific activity. According to the Northern blot hybridization the nptII gene was expressed from the cloned F2 promoter. The apparent transcription start point in E. coli and C. glutamicum was determined. The-35 region of F2 promoter showed high similarity to that of E. coli promoter consensus sequence, but its - 10 region was G+C rich and had no significant homology to that. (author)

Promoting Healthy Development among Adolescent Girls: A Mixed-Methods Evaluation of the HERstory Program

Directory of Open Access Journals (Sweden)

Emily MacFarlane

2013-03-01

Full Text Available The Leadership Program’s HERstory is a school-based, universal, preventative intervention designed to promote healthy youth development among adolescent girls by increasing their connections to pro-social peers and to school and community while developing social-emotional skills that serve as protective factors. In this school-year-long program, a facilitator implements three program phases: group development activities in Community Building, self-reflective Writing Workshop exercises, and a final Creative Output project, an ethnographic theater production or literary journal developed from participants’ Writing Workshop responses. The current mixed-methods study presents early evidence of program effectiveness based on focus groups and school record data review at two NYC public schools during the 2010-2011 school year. Participants reported improvements in key areas targeted by HERstory, including peer connectedness, academic achievement, and a range of protective factors including future orientation and goal setting. Results suggest this program approach may be suitable promoting healthy adolescent development for girls.

Regional economic impacts of the unconventional promotion of natural gas (Hydraulic Fracturing). Preliminary study; Regionaloekonomische Auswirkungen der unkonventionellen Erdgasfoerderung (Hydraulic Fracturing). Vorstudie

Energy Technology Data Exchange (ETDEWEB)

Bizer, Kilian; Bossmeyer, Christoph

2012-07-01

Actually, there is a controversial public discussion on the exploitation of conventional natural gas by means of hydraulic fracturing (Fracking). The contribution under consideration examines the geologic, toxicological or technical as well as legal points of contact with respect to the different effects for the actor groups. Based on the existing scientific realizations, the regional economic effects of the fracking technology and the subsequent promotion of unconventional natural gas deposits have to be worked out.

Hybrid Monte Carlo-Diffusion Method For Light Propagation in Tissue With a Low-Scattering Region

Science.gov (United States)

Hayashi, Toshiyuki; Kashio, Yoshihiko; Okada, Eiji

2003-06-01

The heterogeneity of the tissues in a head, especially the low-scattering cerebrospinal fluid (CSF) layer surrounding the brain has previously been shown to strongly affect light propagation in the brain. The radiosity-diffusion method, in which the light propagation in the CSF layer is assumed to obey the radiosity theory, has been employed to predict the light propagation in head models. Although the CSF layer is assumed to be a nonscattering region in the radiosity-diffusion method, fine arachnoid trabeculae cause faint scattering in the CSF layer in real heads. A novel approach, the hybrid Monte Carlo-diffusion method, is proposed to calculate the head models, including the low-scattering region in which the light propagation does not obey neither the diffusion approximation nor the radiosity theory. The light propagation in the high-scattering region is calculated by means of the diffusion approximation solved by the finite-element method and that in the low-scattering region is predicted by the Monte Carlo method. The intensity and mean time of flight of the detected light for the head model with a low-scattering CSF layer calculated by the hybrid method agreed well with those by the Monte Carlo method, whereas the results calculated by means of the diffusion approximation included considerable error caused by the effect of the CSF layer. In the hybrid method, the time-consuming Monte Carlo calculation is employed only for the thin CSF layer, and hence, the computation time of the hybrid method is dramatically shorter than that of the Monte Carlo method.

A filtering method for signal equalization in region-of-interest fluoroscopy

International Nuclear Information System (INIS)

Robert, Normand; Komljenovic, Philip T; Rowlands, J. A.

2002-01-01

A method to significantly reduce the exposure area product in fluoroscopy using a pre-patient region-of-interest (ROI) attenuator is presented. The attenuator has a thin central region and a gradually increasing thickness away from the center. It is shown that the unwanted brightening artifact caused by the attenuator can be eliminated by attenuating the low spatial frequencies in the detected image using digital image processing techniques. An investigation of the best image processing method to correct for the presence of the attenuator is undertaken. The correction procedure selected is suitable for use with real-time image processors and the ROI attenuator can be permitted to move during image acquisition. Images of an anthropomorphic chest phantom acquired in the presence of the ROI attenuator using an x-ray image intensifier/video chain are corrected to illustrate the clinical feasibility of our approach

REGIONAL DEVELOPMENT THEORIES AND MODELS, A COMPARATIVE ANALYSE.CHALLENGE OF REGIONAL DEVELOPMENT IN ALBANIA

Directory of Open Access Journals (Sweden)

Eva\tDHIMITRI

2015-12-01

Full Text Available Local governance is a broad concept and is defined as the formulation and execution of collective action at the local level. The purpose of local government is to ensure effective and efficient use of public resources and service delivery at the level closest to citizens. Regional development is a new concept that aims to stimulate and diversify the economic activity of a country (region, to encourage investment in the private sector, to create a new jobs vacancy and improves living standards of the country. Regional development policies are a number of measures designed and promoted by the central and local administration, but the cooperation undertaken at the actors are in a different one, which included the private sector and civil society. At the center of these regional policies or practices is the use of efficient potential of each region, being particularly focused on business, means promoting the development of the new enterprises, promoting labor market and investment, improve the quality of environment, health , education and culture. Traditional objective of regional development policies is the reduction of territorial disparities for achieving a relative balance between economic and social levels of development in different areas in the national territory. Regional development is the actual task of local government units in Albania, and is one of the tasks and challenges of the future. Currently it takes a special importance in the context of European Union integration. Reforms have begun to change the system in 1990 in order to implement local democracy and decentralization principles that are present today. Inequalities that exist within the region and between them indicate that in some regions the economic potential is not being fully utilized, and that it reduces the overall performance in national level.

Differentially Methylated DNA Regions in Monozygotic Twin Pairs Discordant for Rheumatoid Arthritis

DEFF Research Database (Denmark)

Svendsen, Anders J; Gervin, Kristina; Lyle, Robert

2016-01-01

: Smoking was significantly associated with hypomethylation of a DMR overlapping the promoter region of the RNF5 and the AGPAT1, which are implicated in inflammation and autoimmunity, whereas DMARD treatment induced hypermethylation of the same region. Additionally, the promotor region of both S100A6......OBJECTIVES: In an explorative epigenome-wide association study (EWAS) to search for gene independent, differentially methylated DNA positions and regions (DMRs) associated with rheumatoid arthritis (RA) by studying monozygotic (MZ) twin pairs discordant for RA. METHODS: Genomic DNA was isolated......: We identified several differentially methylated regions associated with RA, which may represent environmental effects or consequences of the disease and plausible biological pathways pertinent to the pathogenesis of RA....

Determination of single-nucleotide polymorphism in the proximal promoter region of apolipoprotein M gene in coronary artery diseases

Directory of Open Access Journals (Sweden)

Lu Zheng

2009-09-01

Full Text Available Lu Zheng1, Guanghua Luo1, Xiaoying Zhang1, Jun Zhang1, Jiang Zhu1, Jiang Wei1, Qinfeng Mu1, Lujun Chen1, Peter Nilsson-Ehle2, Ning Xu21Comprehensive Laboratory, The Third Affiliated Hospital, Suzhou University, Changzhou China; 2Division of Clinical Chemistry and Pharmacology, Department of Laboratory Medicine, Lund University, Lund, SwedenObjective: It has been reported that single-nucleotide polymorphism (SNP in the proximal promoter region of apolipoprotein M (apoM gene may confer the risk in the development of type 2 diabetes (T2D and coronary artery disease (CAD in the Han Chinese. However, in a recent study demonstrated that plasma apoM level did not correlated to the coronary heart disease. In the present studies, we investigated the SNP T-778C of apoM gene in CAD patients and controls in the Han Chinese population. Moreover we examined whether serum apoM levels could be influenced by this promoter mutation.Material and methods: One hundred twenty-six CAD patients and 118 non-CAD patients were subjected in the present study. All patients were confirmed by the angiography. The genotyping of polymorphisms T-778C in apoM promoter was determined by real-time polymerase chain reaction. Serum apoM levels were semi-quantitatively determined by the dot-blotting analysis. Results: Distribution of apoM T-778C genotype in non-CAD patients was as following: 84.7% were T/T, 15.3% were T/C and 0.0% was C/C. T allele frequencies were 92.4% and C allele, 7.6%. In the CAD patients, 99 patients (78.6% had the T/T genotype, 25 patients (19.8% with T/C genotype and 2 patients (1.6% with C/C genotype. The allele frequency was 88.5% for the T allele and 11.5% for the C allele. There was no statistical significant difference of serum apoM levels found in these three genotypes.Conclusions: There was no significant difference in allele or genotype frequencies between CAD patients and non-CAD patients. Binary logistic regression analysis with adjustments for age

Employer and Promoter Perspectives on the Quality of Health Promotion Within the Healthy Workplace Accreditation

Science.gov (United States)

Tung, Chen-Yin; Yin, Yun-Wen; Liu, Chia-Yun; Chang, Chia-Chen; Zhou, Yi-Ping

2017-01-01

Objectives: To explore the employers’ and promoters’ perspective of health promotion quality according to the healthy workplace accreditation. Methods: We assessed the perspectives of 85 employers and 81 health promoters regarding the quality of health promotion at their workplaces. The method of measurement referenced the European Network for Workplace Health Promotion (ENWHP) quality criteria. Results: In the large workplaces, the accredited corporation employers had a higher impression (P workplace employers had a slightly higher perspective than non-accredited ones. Nevertheless, there were no differences between the perspectives of health promoters from different sized workplaces with or without accreditation (P > 0.05). Conclusions: It seems that employers’ perspectives of healthy workplace accreditation surpassed employers from non-accredited workplaces. Specifically, large accredited corporations could share their successful experiences to encourage a more involved workplace in small–medium workplaces. PMID:28691998

Economics methods in Cochrane systematic reviews of health promotion and public health related interventions.

Science.gov (United States)

Shemilt, Ian; Mugford, Miranda; Drummond, Michael; Eisenstein, Eric; Mallender, Jacqueline; McDaid, David; Vale, Luke; Walker, Damian

2006-11-15

Provision of evidence on costs alongside evidence on the effects of interventions can enhance the relevance of systematic reviews to decision-making. However, patterns of use of economics methods alongside systematic review remain unclear. Reviews of evidence on the effects of interventions are published by both the Cochrane and Campbell Collaborations. Although it is not a requirement that Cochrane or Campbell Reviews should consider economic aspects of interventions, many do. This study aims to explore and describe approaches to incorporating economics methods in a selection of Cochrane systematic reviews in the area of health promotion and public health, to help inform development of methodological guidance on economics for reviewers. The Cochrane Database of Systematic Reviews was searched using a search strategy for potential economic evaluation studies. We included current Cochrane reviews and review protocols retrieved using the search that are also identified as relevant to health promotion or public health topics. A reviewer extracted data which describe the economics components of included reviews. Extracted data were summarised in tables and analysed qualitatively. Twenty-one completed Cochrane reviews and seven review protocols met inclusion criteria. None incorporate formal economic evaluation methods. Ten completed reviews explicitly aim to incorporate economics studies and data. There is a lack of transparent reporting of methods underpinning the incorporation of economics studies and data. Some reviews are likely to exclude useful economics studies and data due to a failure to incorporate search strategies tailored to the retrieval of such data or use of key specialist databases, and application of inclusion criteria designed for effectiveness studies. There is a need for consistency and transparency in the reporting and conduct of the economics components of Cochrane reviews, as well as regular dialogue between Cochrane reviewers and economists to

Statistical Analysis of the labor Market in Ukraine Using Multidimensional Classification Methods: the Regional Aspect

Directory of Open Access Journals (Sweden)

Korepanov Oleksiy S.

2017-12-01

Full Text Available The aim of the article is to study the labor market in Ukraine in the regional context using cluster analysis methods. The current state of the labor market in regions of Ukraine is analyzed, and a system of statistical indicators that influence the state and development of this market is formed. The expediency of using cluster analysis for grouping regions according to the level of development of the labor market is substantiated. The essence of cluster analysis is revealed, its main goal, key tasks, which can be solved by means of such analysis, are presented, basic stages of the analysis are considered. The main methods of clustering are described and, based on the results of the simulation, the advantages and disadvantages of each method are justified. In the work the clustering of regions of Ukraine by the level of labor market development using different methods of cluster analysis is carried out, conclusions on the results of the calculations performed are presented, and the main directions for further research are outlined.

Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.

Science.gov (United States)

Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A

1993-12-01

Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.

Radiation transport benchmarks for simple geometries with void regions using the spherical harmonics method

International Nuclear Information System (INIS)

Kobayashi, K.

2009-01-01

In 2001, an international cooperation on the 3D radiation transport benchmarks for simple geometries with void region was performed under the leadership of E. Sartori of OECD/NEA. There were contributions from eight institutions, where 6 contributions were by the discrete ordinate method and only two were by the spherical harmonics method. The 3D spherical harmonics program FFT3 by the finite Fourier transformation method has been improved for this presentation, and benchmark solutions for the 2D and 3D simple geometries with void region by the FFT2 and FFT3 are given showing fairly good accuracy. (authors)

A method of acoustic wave registration and determination their generation region

International Nuclear Information System (INIS)

Kozin, I.D.; Marchenko, M.V.

1998-01-01

Here is presented a method of acoustic wave registration with using of a synchronous LF broadcasting system. This method of detection and determination of underground nuclear explosion location is based on a registration of ionospheric disturbances induced by acoustic waves at the region of LF sign al reflection. The measuring complex created in the institute of the Ionosphere /1/ allows to register amplitude-frequency characteristics of composite signal from synchronous broadcasting net

Assessment of geothermal energy potential by geophysical methods: Nevşehir Region, Central Anatolia

Science.gov (United States)

Kıyak, Alper; Karavul, Can; Gülen, Levent; Pekşen, Ertan; Kılıç, A. Rıza

2015-03-01

In this study, geothermal potential of the Nevşehir region (Central Anatolia) was assessed by using vertical electrical sounding (VES), self-potential (SP), magnetotelluric (MT), gravity and gravity 3D Euler deconvolution structure analysis methods. Extensive volcanic activity occurred in this region from Upper Miocene to Holocene time. Due to the young volcanic activity Nevşehir region can be viewed as a potential geothermal area. We collected data from 54 VES points along 5 profiles, from 28 MT measurement points along 2 profiles (at frequency range between 320 and 0.0001 Hz), and from 4 SP profiles (total 19 km long). The obtained results based on different geophysical methods are consistent with each other. Joint interpretation of all geological and geophysical data suggests that this region has geothermal potential and an exploration well validated this assessment beyond doubt.

Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset

Directory of Open Access Journals (Sweden)

Elena V. Ignatieva

2014-03-01

Full Text Available The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors, which are activated by olfactory stimuli (ligands. Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter (a region of DNA about 100–1000 base pairs long located upstream of the transcription start site. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.. In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

Promoting tobacco through the international language of dance music: British American Tobacco and the Ministry of Sound

Science.gov (United States)

Stanton, Caitlin R.; Chu, Alexandria; Collin, Jeff

2011-01-01

Background: Tobacco companies target young adults through marketing strategies that use bars and nightclubs to promote smoking. As restrictions increasingly limit promotions, music marketing has become an important vehicle for tobacco companies to shape brand image, generate brand recognition and promote tobacco. Methods: Analysis of previously secret tobacco industry documents from British American Tobacco, available at http://legacy.library.ucsf.edu. Results: In 1995, British American Tobacco (BAT) initiated a partnership with London’s Ministry of Sound (MOS) nightclub to promote Lucky Strike cigarettes to establish relevance and credibility among young adults in the UK. In 1997, BAT extended their MOS partnership to China and Taiwan to promote State Express 555. BAT sought to transfer values associated with the MOS lifestyle brand to its cigarettes. The BAT/MOS partnership illustrates the broad appeal of international brands across different regions of the world. Conclusion: Transnational tobacco companies like BAT are not only striving to stay contemporary with young adults through culturally relevant activities such as those provided by MOS but they are also looking to export their strategies to regions across the world. Partnerships like this BAT/MOS one skirt marketing restrictions recommended by the World Health Organization’s Framework Convention on Tobacco Control. The global scope and success of the MOS program emphasizes the challenge for national regulations to restrict such promotions. PMID:20159772

Green Tourism in Mountain Regions - Reducing Vulnerability and Promoting People and Place Centric Development in the Himalayas

Institute of Scientific and Technical Information of China (English)

R. B. Singh; D. K. Mishra

2004-01-01

In recent years, mountain regions are attracting great attention to Indian tourists in general and foreign tourists in particular. The potential mountain resources for promoting green tourism are enormous in the form of natural and cultural heritage such as biosphere reserves, flora and fauna, lakes and rivers and traditional rural resources. In order to utilise tourism industry market, uncontrolled numbers of tourists and related haphazard infrastructural facilities in the vulnerable mountain regions pose serious environmental implications. The ecological pressures are threatening land, water and wild life resources through direct and indirect environmental impacts together with generation of solid and liquid wastes, so green tourism is emerging as an important task in order to develop new relationship between communities, government agencies and private sectors. The strategy focuses on ecological understanding, environmental protection and ecodevelopment. The major attributes of the green tourism include environmental conservation and education and distribution of income to local people based on strong partnership. Various knowledge systems go a long way for achieving the goals of the green tourism, which creates awareness about the value of environmental resources.Mountains have ecological, recreational, educational and scientific values, which need to be utilised in sustainable way. Various tourist activities and facilities need to be diversified in order to achieve multiple benefits including scientific field excursion,recreation in natural and cultural areas, community festivals and sport tourisms. Green tourism considers tourism development as an integral part of a national and regional development. The paper discusses the social, economic and environmental dimensions of the green tourism with particular reference to village tourism development programme taking empirical evidences from the Himalaya. Such programme also minimises biophysical and human

PTSD and DNA Methylation in Select Immune Function Gene Promoter Regions: A Repeated Measures Case-control Study of U.S. Military Service Members

Science.gov (United States)

2013-06-24

other relevant exposures which may influ- ence DNA methylation , such as dietary factors ( folate , vitamin B12 intake) (Fenech, 2001; Piyathilake and...ARTICLE published: 24 June 2013 doi: 10.3389/fpsyt.2013.00056 PTSD and DNA methylation in select immune function gene promoter regions: a repeated measures...largely unknown. Dis- tinct expression signatures for PTSD have been found, in particular for immune activation transcripts. DNA methylation may be

Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

International Nuclear Information System (INIS)

Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

2011-01-01

Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

76 FR 68067 - United States-Peru Trade Promotion Agreement

Science.gov (United States)

2011-11-03

... between the Parties and promoting regional economic integration; promoting broad-based economic development in order to reduce poverty and generate opportunities for sustainable economic alternatives to... rule. CBP also invites comments that relate to the economic, environmental, or federalism effects that...

An analog computer method for solving flux distribution problems in multi region nuclear reactors

Energy Technology Data Exchange (ETDEWEB)

Radanovic, L; Bingulac, S; Lazarevic, B; Matausek, M [Boris Kidric Institute of Nuclear Sciences Vinca, Beograd (Yugoslavia)

1963-04-15

The paper describes a method developed for determining criticality conditions and plotting flux distribution curves in multi region nuclear reactors on a standard analog computer. The method, which is based on the one-dimensional two group treatment, avoids iterative procedures normally used for boundary value problems and is practically insensitive to errors in initial conditions. The amount of analog equipment required is reduced to a minimum and is independent of the number of core regions and reflectors. (author)

Teaching Methods in Biology Education and Sustainability Education Including Outdoor Education for Promoting Sustainability--A Literature Review

Science.gov (United States)

Jeronen, Eila; Palmberg, Irmeli; Yli-Panula, Eija

2017-01-01

There are very few studies concerning the importance of teaching methods in biology education and environmental education including outdoor education for promoting sustainability at the levels of primary and secondary schools and pre-service teacher education. The material was selected using special keywords from biology and sustainable education…

Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene

International Nuclear Information System (INIS)

Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.

1990-01-01

The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters

Engineered Promoters for Potent Transient Overexpression.

Directory of Open Access Journals (Sweden)

Dan Y Even

Full Text Available The core promoter, which is generally defined as the region to which RNA Polymerase II is recruited to initiate transcription, plays a pivotal role in the regulation of gene expression. The core promoter consists of different combinations of several short DNA sequences, termed core promoter elements or motifs, which confer specific functional properties to each promoter. Earlier studies that examined the ability to modulate gene expression levels via the core promoter, led to the design of strong synthetic core promoters, which combine different core elements into a single core promoter. Here, we designed a new core promoter, termed super core promoter 3 (SCP3, which combines four core promoter elements (the TATA box, Inr, MTE and DPE into a single promoter that drives prolonged and potent gene expression. We analyzed the effect of core promoter architecture on the temporal dynamics of reporter gene expression by engineering EGFP expression vectors that are driven by distinct core promoters. We used live cell imaging and flow cytometric analyses in different human cell lines to demonstrate that SCPs, particularly the novel SCP3, drive unusually strong long-term EGFP expression. Importantly, this is the first demonstration of long-term expression in transiently transfected mammalian cells, indicating that engineered core promoters can provide a novel non-viral strategy for biotechnological as well as gene-therapy-related applications that require potent expression for extended time periods.

The Linearized Bregman Method for Frugal Full-waveform Inversion with Compressive Sensing and Sparsity-promoting

Science.gov (United States)

Chai, Xintao; Tang, Genyang; Peng, Ronghua; Liu, Shaoyong

2018-03-01

Full-waveform inversion (FWI) reconstructs the subsurface properties from acquired seismic data via minimization of the misfit between observed and simulated data. However, FWI suffers from considerable computational costs resulting from the numerical solution of the wave equation for each source at each iteration. To reduce the computational burden, constructing supershots by combining several sources (aka source encoding) allows mitigation of the number of simulations at each iteration, but it gives rise to crosstalk artifacts because of interference between the individual sources of the supershot. A modified Gauss-Newton FWI (MGNFWI) approach showed that as long as the difference between the initial and true models permits a sparse representation, the ℓ _1-norm constrained model updates suppress subsampling-related artifacts. However, the spectral-projected gradient ℓ _1 (SPGℓ _1) algorithm employed by MGNFWI is rather complicated that makes its implementation difficult. To facilitate realistic applications, we adapt a linearized Bregman (LB) method to sparsity-promoting FWI (SPFWI) because of the efficiency and simplicity of LB in the framework of ℓ _1-norm constrained optimization problem and compressive sensing. Numerical experiments performed with the BP Salt model, the Marmousi model and the BG Compass model verify the following points. The FWI result with LB solving ℓ _1-norm sparsity-promoting problem for the model update outperforms that generated by solving ℓ _2-norm problem in terms of crosstalk elimination and high-fidelity results. The simpler LB method performs comparably and even superiorly to the complicated SPGℓ _1 method in terms of computational efficiency and model quality, making the LB method a viable alternative for realistic implementations of SPFWI.

Automatic segmentation of MRI head images by 3-D region growing method which utilizes edge information

International Nuclear Information System (INIS)

Jiang, Hao; Suzuki, Hidetomo; Toriwaki, Jun-ichiro

1991-01-01

This paper presents a 3-D segmentation method that automatically extracts soft tissue from multi-sliced MRI head images. MRI produces a sequence of two-dimensional (2-D) images which contains three-dimensional (3-D) information of organs. To utilize such information we need effective algorithms to treat 3-D digital images and to extract organs and tissues of interest. We developed a method to extract the brain from MRI images which uses a region growing procedure and integrates information of uniformity of gray levels and information of the presence of edge segments in the local area around the pixel of interest. First we generate a kernel region which is a part of brain tissue by simple thresholding. Then we grow the region by means of a region growing algorithm under the control of 3-D edge existence to obtain the region of the brain. Our method is rather simple because it uses basic 3-D image processing techniques like spatial difference. It is robust for variation of gray levels inside a tissue since it also refers to the edge information in the process of region growing. Therefore, the method is flexible enough to be applicable to the segmentation of other images including soft tissues which have complicated shapes and fluctuation in gray levels. (author)

Functional Analysis of Promoter Region from Eel Cytochrome P450 1A1 Gene in Transgenic Medaka.

Science.gov (United States)

Ogino; Itakura; Kato; Aoki; Sato

1999-07-01

: Transcription of the CYP1A1 genes in mammals and fish is stimulated by polyaromatic hydrocarbons. DNA sequencing analysis revealed that CYP1A1 gene in eel (Anguilla japonica) contains two kinds of putative cis-acting regulatory elements, XRE (xenobiotic-responsive element) and ERE (estrogen-responsive element). XRE is known as the enhancer that is responsible for the inducibility of the genes of CYP1A1 and some other drug-metabolizing enzymes. In the eel CYP1A1 gene, XRE motifs are distributed as follows: five times in the region from -2136 to -1125 bp, XRE(-6) to (-2); once in the proximal basal promoter region, XRE(-1); and once in the first intron, XRE(+1). The region between XRE(-2) and XRE(-1) contains three ERE motifs. To investigate the function of the cis-acting regulatory elements in the eel CYP1A1 gene, recombinant plasmids prepared with its 5' upstream sequence and the structural gene for luciferase were microinjected into fertilized eggs of medaka at the one-cell stage. Hatched fry were treated with 3-methylcholanthrene, and the transcription efficiency was assayed using competitive polymerase chain reaction analysis. Deletion of the region containing the five XREs, XRE(-6) to XRE(-2), and the point mutation of XRE(-1) reduced the inducible expressions by 75% and 56%, respectively, showing apparent dependency of the drug induction on the XREs. Constitutive expression, however, was not significantly affected by deletion or disruption of the XREs. When the region between XRE(-2) and XRE(-1) containing no XREs but three ERE motifs was internally deleted, the inducible expression and the constitutive expression were reduced by 88% and 75%, respectively. Replacement of this region with a partial fragment of eel CYP1A1 complementary DNA, with slight alteration of the distance between the five XREs and XRE(-1), reduced the inducible expression and the constitutive expression by 91% and 60%, respectively. These results strongly suggest that not only XRE but

Four inducible promoters for controlled gene expression in the oleaginous yeast Rhodotorula toruloides

Directory of Open Access Journals (Sweden)

Alexander Michael Bedford Johns

2016-10-01

Full Text Available Rhodotorula (Rhodosporidium toruloides is an oleaginous yeast with great biotechnological potential, capable of accumulating lipid up to 70 % of its dry biomass, and of carotenoid biosynthesis. However, few molecular genetic tools are available for manipulation of this basidiomycete yeast and its high genomic GC content can make routine cloning difficult. We have developed plasmid vectors for transformation of R. toruloides which include elements for Saccharomyces cerevisiae in-yeast assembly; this method is robust to the assembly of GC-rich DNA and of large plasmids. Using such vectors we screened for controllable promoters, and identified inducible promoters from the genes NAR1, ICL1, CTR3 and MET16. These four promoters have independent induction/repression conditions and exhibit different levels and rates of induction in R. toruloides, making them appropriate for controllable transgene expression in different experimental situations. Nested deletions were used to identify regulatory regions in the four promoters, and to delimit the minimal inducible promoters, which are as small as 200 bp for the NAR1 promoter. The NAR1 promoter shows very tight regulation under repressed conditions as determined both by an EGFP reporter gene and by conditional rescue of a leu2 mutant. These new tools facilitate molecular genetic manipulation and controllable gene expression in R. toruloides.

Quantitative global and gene-specific promoter methylation in relation to biological properties of neuroblastomas

Directory of Open Access Journals (Sweden)

Kiss Nimrod B

2012-09-01

Full Text Available Abstract Background In this study we aimed to quantify tumor suppressor gene (TSG promoter methylation densities levels in primary neuroblastoma tumors and cell lines. A subset of these TSGs is associated with a CpG island methylator phenotype (CIMP in other tumor types. Methods The study panel consisted of 38 primary tumors, 7 established cell lines and 4 healthy references. Promoter methylation was determined by bisulphate Pyrosequencing for 14 TSGs; and LINE-1 repeat element methylation was used as an indicator of global methylation levels. Results Overall mean TSG Z-scores were significantly increased in cases with adverse outcome, but were unrelated to global LINE-1 methylation. CIMP with hypermethylation of three or more gene promoters was observed in 6/38 tumors and 7/7 cell lines. Hypermethylation of one or more TSG (comprising TSGs BLU, CASP8, DCR2, CDH1, RASSF1A and RASSF2 was evident in 30/38 tumors. By contrast only very low levels of promoter methylation were recorded for APC, DAPK1, NORE1A, P14, P16, TP73, PTEN and RARB. Similar involvements of methylation instability were revealed between cell line models and neuroblastoma tumors. Separate analysis of two proposed CASP8 regulatory regions revealed frequent and significant involvement of CpG sites between exon 4 and 5, but modest involvement of the exon 1 region. Conclusions/significance The results highlight the involvement of TSG methylation instability in neuroblastoma tumors and cell lines using quantitative methods, support the use of DNA methylation analyses as a prognostic tool for this tumor type, and underscore the relevance of developing demethylating therapies for its treatment.

Green's function matching method for adjoining regions having different masses

International Nuclear Information System (INIS)

Morgenstern Horing, Norman J

2006-01-01

We present a primer on the method of Green's function matching for the determination of the global Schroedinger Green's function for all space subject to joining conditions at an interface between two (or more) separate parts of the region having different masses. The object of this technique is to determine the full space Schroedinger Green's function in terms of the individual Green's functions of the constituent parts taken as if they were themselves extended to all space. This analytical method has had successful applications in the theory of surface states, and remains of interest for nanostructures

Application of the Method of Statistical Equations of Dependences to Assess the Dynamics of Regional Human Development Index for Khmelnytsk Region

Directory of Open Access Journals (Sweden)

R. О.

2017-12-01

Full Text Available A statistical approach to assessment of the factor values required to have necessary (planned, predicted levels of a resulting indicator achieved, including for purposes of regional socio-economic programs, is developed, by applying the method of statistical equations of dependences. The main problems that can be solved by use of the method of statistical equations of dependences are: direct and inverse problem; computing the factors’ contributions in the resulting indicator; constructing graphs of multiple relation and computing the shares of influence (the weights of selected factors; analysis of functional and correlation dependences, etc. The developed approach is used to assess the dynamics of Regional Human Development Index (RHDI for Khmelnytsk region (Ukraine and its constituent factors, in 2011–2015. The computations show that the factors with the largest contribution in RHDI of Khmelnytsk region are as follows: “number of minimal food baskets that can be purchased for average per capita income in the region” (62.91%, “housing in cities (square area per person” (20.27%, and “total birth rate” (5.33%. The contributions of factors like “planned capacity of ambulatories and policlinics per 10 thousand population” or “coverage of children in school age by secondary education” range from 5.26 to 0.14%. It is concluded that the proposed approach to the application of the method of statistical equations of dependences for modeling of factor and resulting indicators contributing to human development parameters at regional level can be used for assessments at sectoral level, with modifying the nomenclature of indicators measuring the socio-economic development and the financial and economic performance of business entities in an economic sector.

Health promotion in context:

DEFF Research Database (Denmark)

Liveng, Anne; Andersen, Heidi Myglegård; Lehn Christiansen, Sine

2018-01-01

Health promotion constitutes a complex field of study, as it addresses multifaceted problems and involves a range of methods and theories. Students in the field of health promotion can find this challenging. To raise their level of reflexivity and support learning we have developed the “context m...

THE ANALYSIS OF THE ASYMMETRICAL RISK IN TOURISM FOR THE DEVELOPMENT AND PROMOTION OF A LASTING REGIONAL TOURISM IDENTITY

Directory of Open Access Journals (Sweden)

Alexandru NEDELEA

2009-06-01

Full Text Available In order to establish an adequate balance between tourists' welfare, the needs of the natural and cultural environment, as well as to develop tourist destinations and organizations' competitiveness, it is necessary to carry out a global and integrated approach, where all interested parties share the same goals regarding the durability of tourism and the approached challenges. The purpose of this work is to identify the factors of reduced risk having a major impact over the sustainability of the tourist region under analysis and to highlight the risk factors' connections and impact in order to minimize and eliminate them, with direct effects over the awareness of tourist industry's values. The identification of lasting development's indicators will take into account all these three aspects of the durable development of tourism, namely ecological, economical and social factors, that play a part in highlighting the real performance of a tourist destination. All these aspects are absolutely necessary for the promotion of the Danube's tourist potential, achievable through the emphasis of the relevant values from the tourist patrimony of the county of Galati. The promotion of the Danube' tourist potential presupposes a series of objectives that are subordinated to the general direction that is marked at the national level, respectively Romania's transformation into a qualitative tourist destination based on its natural and cultural patrimony, in order to correspond to the European Union standards. The new policy regarding tourism proposed by the European Commission aims at offering constant support for this industry to be able to face different challenges, by promoting also competitiveness in general.

Cooperative monitoring and its role in regional security

Energy Technology Data Exchange (ETDEWEB)

Biringer, K.; Olsen, J.; Lincoln, R.; Wehling, F. [and others

1997-03-01

Cooperative monitoring systems can play an important part in promoting the implementation of regional cooperative security agreements. These agreements advance the national security interests of the United States in a post Cold War environment. Regional issues as widely varying as nuclear nonproliferation, trade and environmental pollution can be the source of tensions which may escalate to armed conflict which could have global implications. The Office of National Security Policy Analysis at the US Department of Energy (DOE) has an interest in seeking ways to promote regional cooperation that can reduce the threats posed by regional conflict. DOE technologies and technical expertise can contribute to developing solutions to a wide variety of these international problems. Much of this DOE expertise has been developed in support of the US nuclear weapons and arms control missions. It is now being made available to other agencies and foreign governments in their search for regional security and cooperation. This report presents two examples of interest to DOE in which monitoring technologies could be employed to promote cooperation through experimentation. The two scenarios include nuclear transparency in Northeast Asia and environmental restoration in the Black Sea. Both offer the potential for the use of technology to promote regional cooperation. The issues associated with both of these monitoring applications are presented along with examples of appropriate monitoring technologies, potential experiments and potential DOE contributions to the scenarios.

GSTT2 promoter polymorphisms and colorectal cancer risk

Directory of Open Access Journals (Sweden)

Ahn Sun-A

2007-01-01

Full Text Available Abstract Background Glutathione S-transferases are a group of enzymes that participate in detoxification and defense mechanisms against toxic carcinogens and other compounds. These enzymes play an important role in human carcinogenesis. In the present study, we sought to determine whether GSTT2 promoter single nucleotide polymorphisms (SNPs are associated with colorectal cancer risk. Methods A total of 436 colorectal cancer patients and 568 healthy controls were genotyped for three GSTT2 promoter SNPs (-537G>A, -277T>C and -158G>A, using real-time TaqMan assay and direct sequencing. An electrophoretic mobility shift assay (EMSA was performed to determine the effects of polymorphisms on protein binding to the GSTT2 promoter. Results The -537A allele (-537G/A or A/A was significantly associated with colorectal cancer risk (OR = 1.373, p = 0.025, while the -158A allele (-158G/A or A/A was involved in protection against colorectal cancer (OR = 0.539, p = 0.032. Haplotype 2 (-537A, -277T, -158G was significantly associated with colorectal cancer risk (OR = 1.386, p = 0.021, while haplotype 4 (-537G, -277C, -158A protected against colorectal cancer (OR = 0.539, p = 0.032. EMSA data revealed lower promoter binding activity in the -537A allele than its -537G counterpart. Conclusion Our results collectively suggest that SNPs and haplotypes of the GSTT2 promoter region are associated with colorectal cancer risk in the Korean population.

Regions and the Territorial Cohesion

Directory of Open Access Journals (Sweden)

Ioan Ianos

2013-08-01

Full Text Available Territorial cohesion is an important target of European Union, constantly promoted by its institutions and their representatives. In the context of the Europe 2020 strategy, one of the most important support documents, the region represents a very important issue, being considered to be the key to its successfulness. The region is seen as a support for the smart growth and all the operational policy concepts try to make use of the spatial potential, by taking better account of the territorial specificities. Two main questions play attention: the need to transform the present-day developmental regions into administrative ones is a priority? What kind of regionalization it must to be promoted? Correlating these issues with already defined territorial cohesion, the administrative region is a real tool for the future territorial development. The experience of the last 14 years asks urgently the building of a new territorial administrative reform, giving competences to regions. For instant, each development region is a construction resulted from a free association of the counties. Their role in the regional development is much reduced one, because their regional councils are not elected; decisions taken at this level are consultative for the social, economical, cultural or political actors.

Development of a localized probabilistic sensitivity method to determine random variable regional importance

International Nuclear Information System (INIS)

Millwater, Harry; Singh, Gulshan; Cortina, Miguel

2012-01-01

There are many methods to identify the important variable out of a set of random variables, i.e., “inter-variable” importance; however, to date there are no comparable methods to identify the “region” of importance within a random variable, i.e., “intra-variable” importance. Knowledge of the critical region of an input random variable (tail, near-tail, and central region) can provide valuable information towards characterizing, understanding, and improving a model through additional modeling or testing. As a result, an intra-variable probabilistic sensitivity method was developed and demonstrated for independent random variables that computes the partial derivative of a probabilistic response with respect to a localized perturbation in the CDF values of each random variable. These sensitivities are then normalized in absolute value with respect to the largest sensitivity within a distribution to indicate the region of importance. The methodology is implemented using the Score Function kernel-based method such that existing samples can be used to compute sensitivities for negligible cost. Numerical examples demonstrate the accuracy of the method through comparisons with finite difference and numerical integration quadrature estimates. - Highlights: ► Probabilistic sensitivity methodology. ► Determines the “region” of importance within random variables such as left tail, near tail, center, right tail, etc. ► Uses the Score Function approach to reuse the samples, hence, negligible cost. ► No restrictions on the random variable types or limit states.

Methods for deconvoluting and interpreting complex gamma- and x-ray spectral regions

International Nuclear Information System (INIS)

Gunnink, R.

1983-06-01

Germanium and silicon detectors are now widely used for the detection and measurement of x and gamma radiation. However, some analysis situations and spectral regions have heretofore been too complex to deconvolute and interpret by techniques in general use. One example is the L x-ray spectrum of an element taken with a Ge or Si detector. This paper describes some new tools and methods that were developed to analyze complex spectral regions; they are illustrated with examples

Data assimilation method based on the constraints of confidence region

Science.gov (United States)

Li, Yong; Li, Siming; Sheng, Yao; Wang, Luheng

2018-03-01

The ensemble Kalman filter (EnKF) is a distinguished data assimilation method that is widely used and studied in various fields including methodology and oceanography. However, due to the limited sample size or imprecise dynamics model, it is usually easy for the forecast error variance to be underestimated, which further leads to the phenomenon of filter divergence. Additionally, the assimilation results of the initial stage are poor if the initial condition settings differ greatly from the true initial state. To address these problems, the variance inflation procedure is usually adopted. In this paper, we propose a new method based on the constraints of a confidence region constructed by the observations, called EnCR, to estimate the inflation parameter of the forecast error variance of the EnKF method. In the new method, the state estimate is more robust to both the inaccurate forecast models and initial condition settings. The new method is compared with other adaptive data assimilation methods in the Lorenz-63 and Lorenz-96 models under various model parameter settings. The simulation results show that the new method performs better than the competing methods.

Methods of promotion of nuclear research and development in the Federal Republic of Germany and international cooperation

International Nuclear Information System (INIS)

Lehr, G.

1987-01-01

The promotion of nuclear research and development in the Federal Republic of Germany is part of the overall R and D policy and is geared to the long-term energy policy goals. Nuclear energy development has been successfully promoted for more than thirty years, the non-nuclear energy technologies for almost 15 years. As a result of this support for new technologies, energy production has become more efficient and cost-effective and with regard to fossil energy sources also markedly less detrimental to the environment. Nuclear energy research policy is an integral part of energy research policy as a whole, which particularly aims to increasingly promote renewable energy sources, above all photovoltaic and wind energy, the utilization of biomass and geothermal energy as well as the development of various energy storage methods. In addition to some mining projects which aim to reduce coal production costs, promotion in the field of fossil energy sources concentrates above all on power plant engineering and combustion techniques - i.e. environment-oriented technologies. In view of future supply patterns, projects on coal conversion are continued; with present supply and price structures for mineral oil and natural gas, however, commercialization of coal conversion cannot be expected to be launched on a large scale. (J.P.N.)

A novel method for identification and quantification of consistently differentially methylated regions.

Directory of Open Access Journals (Sweden)

Ching-Lin Hsiao

Full Text Available Advances in biotechnology have resulted in large-scale studies of DNA methylation. A differentially methylated region (DMR is a genomic region with multiple adjacent CpG sites that exhibit different methylation statuses among multiple samples. Many so-called "supervised" methods have been established to identify DMRs between two or more comparison groups. Methods for the identification of DMRs without reference to phenotypic information are, however, less well studied. An alternative "unsupervised" approach was proposed, in which DMRs in studied samples were identified with consideration of nature dependence structure of methylation measurements between neighboring probes from tiling arrays. Through simulation study, we investigated effects of dependencies between neighboring probes on determining DMRs where a lot of spurious signals would be produced if the methylation data were analyzed independently of the probe. In contrast, our newly proposed method could successfully correct for this effect with a well-controlled false positive rate and a comparable sensitivity. By applying to two real datasets, we demonstrated that our method could provide a global picture of methylation variation in studied samples. R source codes to implement the proposed method were freely available at http://www.csjfann.ibms.sinica.edu.tw/eag/programlist/ICDMR/ICDMR.html.

A Local Region of Interest Imaging Method for Electrical Impedance Tomography with Internal Electrodes

Directory of Open Access Journals (Sweden)

Hyeuknam Kwon

2013-01-01

Full Text Available Electrical Impedance Tomography (EIT is a very attractive functional imaging method despite the low sensitivity and resolution. The use of internal electrodes with the conventional reconstruction algorithms was not enough to enhance image resolution and accuracy in the region of interest (ROI. We propose a local ROI imaging method with internal electrodes developed from careful analysis of the sensitivity matrix that is designed to reduce the sensitivity of the voxels outside the local region and optimize the sensitivity of the voxel inside the local region. We perform numerical simulations and physical measurements to demonstrate the localized EIT imaging method. In preliminary results with multiple objects we show the benefits of using an internal electrode and the improved resolution due to the local ROI image reconstruction method. The sensitivity is further increased by allowing the surface electrodes to be unevenly spaced with a higher density of surface electrodes near the ROI. Also, we analyse how much the image quality is improved using several performance parameters for comparison. While these have not yet been studied in depth, it convincingly shows an improvement in local sensitivity in images obtained with an internal electrode in comparison to a standard reconstruction method.

7 CFR 1205.319 - Cotton-producing region.

Science.gov (United States)

2010-01-01

... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton-producing region. 1205.319 Section 1205.319... Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region. Cotton-producing region means each of the following groups of cotton-producing States: (a) Southeast Region: Alabama...

Study on Scattered Data Points Interpolation Method Based on Multi-line Structured Light

International Nuclear Information System (INIS)

Fan, J Y; Wang, F G; W, Y; Zhang, Y L

2006-01-01

Aiming at the range image obtained through multi-line structured light, a regional interpolation method is put forward in this paper. This method divides interpolation into two parts according to the memory format of the scattered data, one is interpolation of the data on the stripes, and the other is interpolation of data between the stripes. Trend interpolation method is applied to the data on the stripes, and Gauss wavelet interpolation method is applied to the data between the stripes. Experiments prove regional interpolation method feasible and practical, and it also promotes the speed and precision

DNA methylation in Cosmc promoter region and aberrantly glycosylated IgA1 associated with pediatric IgA nephropathy.

Directory of Open Access Journals (Sweden)

Qiang Sun

Full Text Available IgA nephropathy (IgAN is one of the most common glomerular diseases leading to end-stage renal failure. Elevation of aberrantly glycosylated IgA1 is a key feature of it. The expression of the specific molecular chaperone of core1ß1, 3galactosyl transferase (Cosmc is known to be reduced in IgAN. We aimed to investigate whether the methylation of CpG islands of Cosmc gene promoter region could act as a possible mechanism responsible for down-regulation of Cosmc and related higher secretion of aberrantly glycosylated IgA1in lymphocytes from children with IgA nephropathy. Three groups were included: IgAN children (n = 26, other renal diseases (n = 11 and healthy children (n = 13. B-lymphocytes were isolated and cultured, treated or not with IL-4 or 5-Aza-2'-deoxycytidine (AZA. The levels of DNA methylation of Cosmc promotor region were not significantly different between the lymphocytes of the three children populations (P = 0.113, but there were significant differences between IgAN lymphocytes and lymphocytes of the other two children populations after IL-4 (P<0.0001 or AZA (P<0.0001. Cosmc mRNA expression was low in IgAN lymphocytes compared to the other two groups (P<0.0001. The level of aberrantly glycosylated IgA1 was markedly higher in IgAN group compared to the other groups (P<0.0001. After treatment with IL-4, the levels of Cosmc DNA methylation and aberrantly glycosylated IgA1 in IgAN lymphocytes were remarkably higher than the other two groups (P<0.0001 with more markedly decreased Cosmc mRNA content (P<0.0001. After treatment with AZA, the levels in IgAN lymphocytes were decreased, but was still remarkably higher than the other two groups (P<0.0001, while Cosmc mRNA content in IgAN lymphocytes were more markedly increased than the other two groups (P<0.0001. The alteration of DNA methylation by IL-4 or AZA specifically correlates in IgAN lymphocytes with alterations in Cosmc mRNA expression and with the level of aberrantly glycosylated

A probabilistic method for streamflow projection and associated uncertainty analysis in a data sparse alpine region

Science.gov (United States)

Ren, Weiwei; Yang, Tao; Shi, Pengfei; Xu, Chong-yu; Zhang, Ke; Zhou, Xudong; Shao, Quanxi; Ciais, Philippe

2018-06-01

Climate change imposes profound influence on regional hydrological cycle and water security in many alpine regions worldwide. Investigating regional climate impacts using watershed scale hydrological models requires a large number of input data such as topography, meteorological and hydrological data. However, data scarcity in alpine regions seriously restricts evaluation of climate change impacts on water cycle using conventional approaches based on global or regional climate models, statistical downscaling methods and hydrological models. Therefore, this study is dedicated to development of a probabilistic model to replace the conventional approaches for streamflow projection. The probabilistic model was built upon an advanced Bayesian Neural Network (BNN) approach directly fed by the large-scale climate predictor variables and tested in a typical data sparse alpine region, the Kaidu River basin in Central Asia. Results show that BNN model performs better than the general methods across a number of statistical measures. The BNN method with flexible model structures by active indicator functions, which reduce the dependence on the initial specification for the input variables and the number of hidden units, can work well in a data limited region. Moreover, it can provide more reliable streamflow projections with a robust generalization ability. Forced by the latest bias-corrected GCM scenarios, streamflow projections for the 21st century under three RCP emission pathways were constructed and analyzed. Briefly, the proposed probabilistic projection approach could improve runoff predictive ability over conventional methods and provide better support to water resources planning and management under data limited conditions as well as enable a facilitated climate change impact analysis on runoff and water resources in alpine regions worldwide.

Regional Innovation Policies in MERCOSUR : Obstacles and ...

International Development Research Centre (IDRC) Digital Library (Canada)

... review existing regional cooperation initiatives, identify sectors with strong potential for regional cooperation, review other experiences in regional cooperation for innovation (European Union - EU, North American Free Trade Agreement - NAFTA), and propose institutional arrangements for promoting innovation among ...

Regional planning and urban infrastructure development in the ...

African Journals Online (AJOL)

Regional planning and urban infrastructure development in the Gongola region, ... PROMOTING ACCESS TO AFRICAN RESEARCH ... In North-eastern Nigeria, the Gongola region has been one of the least developed since independence.

Automated Segmentation of Coronary Arteries Based on Statistical Region Growing and Heuristic Decision Method

Directory of Open Access Journals (Sweden)

Yun Tian

2016-01-01

Full Text Available The segmentation of coronary arteries is a vital process that helps cardiovascular radiologists detect and quantify stenosis. In this paper, we propose a fully automated coronary artery segmentation from cardiac data volume. The method is built on a statistics region growing together with a heuristic decision. First, the heart region is extracted using a multi-atlas-based approach. Second, the vessel structures are enhanced via a 3D multiscale line filter. Next, seed points are detected automatically through a threshold preprocessing and a subsequent morphological operation. Based on the set of detected seed points, a statistics-based region growing is applied. Finally, results are obtained by setting conservative parameters. A heuristic decision method is then used to obtain the desired result automatically because parameters in region growing vary in different patients, and the segmentation requires full automation. The experiments are carried out on a dataset that includes eight-patient multivendor cardiac computed tomography angiography (CTA volume data. The DICE similarity index, mean distance, and Hausdorff distance metrics are employed to compare the proposed algorithm with two state-of-the-art methods. Experimental results indicate that the proposed algorithm is capable of performing complete, robust, and accurate extraction of coronary arteries.

IκBα polymorphism at promoter region (rs2233408 influences the susceptibility of gastric cancer in Chinese

Directory of Open Access Journals (Sweden)

Sung Joseph JY

2010-02-01

Full Text Available Abstract Background Nuclear factor of kappa B inhibitor alpha (IκBα protein is implicated in regulating a variety of cellular process from inflammation to tumorigenesis. The objective of this study was to investigate the susceptibility of rs2233408 T/C genotype in the promoter region of IκBα to gastric cancer and the association of this polymorphism with clinicopathologic variables in gastric cancer patients. Methods A population-based case-control study was conducted between 1999 and 2006 in Guangdong Province, China. A total of 564 gastric cancer patients and 566 healthy controls were enrolled in this study. rs2233408 genotypes in IκBα were analyzed by TaqMan SNP genotyping assay. Results Both rs2233408 T homozygote (TT and T heterozygotes (TC and TT had significantly reduced gastric cancer risk (TT: OR = 0.250, 95% CI = 0.069-0.909, P = 0.035; TC and TT: OR = 0.721, 95% CI = 0.530-0.981, P = 0.037, compared with rs2233408 C homozygote (CC. rs2233408 T heterozygotes were significantly associated with reduced risk of intestinal-type gastric cancer with ORs of 0.648 (95% CI = 0.459-0.916, P = 0.014, but not with the diffuse or mix type of gastric cancer. The association between rs2233408 T heterozygotes and gastric cancer appeared more apparent in the older patients (age>40 (OR = 0.674, 95% CI = 0.484-0.939, P = 0.02. rs2233408 T heterozygotes was associated with non-cardiac gastric cancer (OR = 0.594, 95% CI = 0.411-0.859, P = 0.006, but not with cardiac gastric cancer. However, rs2233408 polymorphism was not associated with the prognosis of gastric cancer patients. Conclusions IκBα rs2233408 T heterozygotes were associated with reduced risk of gastric cancer, especially for the development of certain subtypes of gastric cancer in Chinese population.

Guide for Regional Integrated Assessments: Handbook of Methods and Procedures, Version 5.1. Appendix 1

Science.gov (United States)

Rosenzweig, Cynthia E.; Jones, James W.; Hatfield, Jerry; Antle, John; Ruane, Alex; Boote, Ken; Thorburn, Peter; Valdivia, Roberto; Porter, Cheryl; Janssen, Sander;

Isolation and functional characterization of Lycopene β-cyclase (CYC-B promoter from Solanum habrochaites

Directory of Open Access Journals (Sweden)

Chinnusamy Viswanathan

2010-04-01

Full Text Available Abstract Background Carotenoids are a group of C40 isoprenoid molecules that play diverse biological and ecological roles in plants. Tomato is an important vegetable in human diet and provides the vitamin A precursor β-carotene. Genes encoding enzymes involved in carotenoid biosynthetic pathway have been cloned. However, regulation of genes involved in carotenoid biosynthetic pathway and accumulation of specific carotenoid in chromoplasts are not well understood. One of the approaches to understand regulation of carotenoid metabolism is to characterize the promoters of genes encoding proteins involved in carotenoid metabolism. Lycopene β-cyclase is one of the crucial enzymes in carotenoid biosynthesis pathway in plants. Its activity is required for synthesis of both α-and β-carotenes that are further converted into other carotenoids such as lutein, zeaxanthin, etc. This study describes the isolation and characterization of chromoplast-specific Lycopene β-cyclase (CYC-B promoter from a green fruited S. habrochaites genotype EC520061. Results A 908 bp region upstream to the initiation codon of the Lycopene β-cyclase gene was cloned and identified as full-length promoter. To identify promoter region necessary for regulating developmental expression of the ShCYC-B gene, the full-length promoter and its three different 5' truncated fragments were cloned upstream to the initiation codon of GUS reporter cDNA in binary vectors. These four plant transformation vectors were separately transformed in to Agrobacterium. Agrobacterium-mediated transient and stable expression systems were used to study the GUS expression driven by the full-length promoter and its 5' deletion fragments in tomato. The full-length promoter showed a basal level activity in leaves, and its expression was upregulated > 5-fold in flowers and fruits in transgenic tomato plants. Deletion of -908 to -577 bp 5' to ATG decreases the ShCYC-B promoter strength, while deletion of -908

Qualitative analysis of Adenomatous Polyposis Coli promoter: Hypermethylation, engagement and effects on survival of patients with esophageal cancer in a high risk region of the world, a potential molecular marker

International Nuclear Information System (INIS)

Zare, Maryam; Jazii, Ferdous Rastgar; Alivand, Mohammad Reza; Nasseri, Negin Karimi; Malekzadeh, Reza; Yazdanbod, Mansour

2009-01-01

Squamous cell carcinoma of esophagus (SCCE) occurs at a high incidence rate in certain parts of the world. This feature necessitates that different aspects of the disease and in particular genetic characteristics be investigated in such regions. In addition, such investigations might lead to achievement of molecular markers helpful for early detection, successful treatment and follow up of the disease. Adenomatous Polyposis Coli (APC) promoter hypermethylation has been shown to be a suitable marker for both serum and solid tumors of adenocarcinoma of esophagus. We investigated the status of APC promoter hypermethylation in Iranian patients, compared the results with the former studies, and evaluated its applicability as a candidate molecular marker by examining association between survival of SCCE patients and APC promoter methylation. For evaluating the status of APC promoter hypermethylation and its association with SCCE, a qualitative methylation specific PCR (MSP) was used. DNA was extracted and digested with an appropriate restriction enzyme, treated with sodium bisulfite in agarose beads and amplified in two-step PCR reaction by applying either methylated or unmethylated promoter specific primers. Universally methylated DNA and methylase treated blood DNA of healthy donors were used as positive controls as well. Survival of patients was followed up for two years after treatment and survival rate of patients with methylated APC promoter was compared with that of unmethylated patients. Assessment of APC promoter methylation revealed that normal tissues were unmethylated, while twenty out of forty five (44.4%) tumor tissues were hypermethylated either in one or both alleles of APC. Among the tissues in which methylation was detected, seven were hypermethylated in both alleles while the other thirteen were hypermethylated in one of the two alleles of APC. Analyzing two-year survival rate of patients with respect to promoter hypermethylation showed a lower rate of

Employer and Promoter Perspectives on the Quality of Health Promotion Within the Healthy Workplace Accreditation.

Science.gov (United States)

Tung, Chen-Yin; Yin, Yun-Wen; Liu, Chia-Yun; Chang, Chia-Chen; Zhou, Yi-Ping

2017-07-01

To explore the employers' and promoters' perspective of health promotion quality according to the healthy workplace accreditation. We assessed the perspectives of 85 employers and 81 health promoters regarding the quality of health promotion at their workplaces. The method of measurement referenced the European Network for Workplace Health Promotion (ENWHP) quality criteria. In the large workplaces, the accredited corporation employers had a higher impression (P health promoters from different sized workplaces with or without accreditation (P > 0.05). It seems that employers' perspectives of healthy workplace accreditation surpassed employers from non-accredited workplaces. Specifically, large accredited corporations could share their successful experiences to encourage a more involved workplace in small-medium workplaces.

Regional cooperative agreement for the Asia and Pacific region

International Nuclear Information System (INIS)

Anon.

1981-01-01

Among the means available to the International Atomic Energy Agency to promote cooperative efforts in the nuclear field is the Regional Cooperative Agreement (RCA) for Research, Development, and Training related to Nuclear Science and Technology for the Asia and Pacific Region. Under the terms of this agreement, which came into force on June 12, 1972, participating countries aim to promote and coordinate research, development, and training projects in nuclear fields through collaborative efforts among relevant national institutions in the region. The Agency's role is to provide organizational, administrative, advisory, technical, and financial assistance when needed to secure successful execution of the projects undertaken within the framework of the RCA. Although this presentation deals primarily with the benefits of regional cooperation under the agreement, a review of the RCA would be somewhat imbalanced without a mention of its shortcomings. One of the principal impediments to more rapid progress, as is the case in many other areas, is financing. There is no stable source of funding outside the research contract program and, the likelihood of large-scale UNDP support notwithstanding, a greater willingness on the part of participating Member States to support the program along with the development of a greater sense of common purpose are called for. In this connection serious consideration is being given to the possibility of establishing an Asian Centre for Research and Training, an institute that would bring together scientists from the region to collaborate on problems common to the RCA countries. A study group has already been convened to investigate the feasibility of this proposal

[Health education, patient education and health promotion: educational methods and strategies].

Science.gov (United States)

Sandrin, Brigitte

2013-01-01

The purpose of this paper is to help public health actors with an interest in health promotion and health care professionals involved in therapeutic education to develop and implement an educational strategy consistent with their vision of health and health care. First, we show that the Ottawa Charter for Health Promotion and the French Charter for Popular Education share common values. Second, an examination of the career and work of Paulo Freire, of Ira Shor's pedagogical model and of the person-centered approach of Carl Rogers shows how the work of educational practitioners, researchers and theorists can help health professionals to implement a truly "health-promoting" or "therapeutic" educational strategy. The paper identifies a number of problems facing health care professionals who become involved in education without reflecting on the values underlying the pedagogical models they use.

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

Directory of Open Access Journals (Sweden)

Shan Xin

Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

Science.gov (United States)

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

Synthesis method based on solution regions for planar four bar straight line linkages

International Nuclear Information System (INIS)

Lai Rong, Yin; Cong, Mao; Jian you, Han; Tong, Yang; Juan, Huang

2012-01-01

An analytical method for synthesizing and selecting desired four-bar straight line mechanisms based on solution regions is presented. Given two fixed pivots, the point position and direction of the target straight line, an infinite number of mechanism solutions can be produced by employing this method, both in the general case and all three special cases. Unifying the straight line direction and the displacement from the given point to the instant center into the same form with different angles as parameters, infinite mechanism solutions can be expressed with different solution region charts. The mechanism property graphs have been computed to enable the designers to find out the involved mechanism information more intuitively and avoid aimlessness in selecting optimal mechanisms

Assessment and Improving Methods of Reliability Indices in Bakhtar Regional Electricity Company

Directory of Open Access Journals (Sweden)

Saeed Shahrezaei

2013-04-01

Full Text Available Reliability of a system is the ability of a system to do prospected duties in future and the probability of desirable operation for doing predetermined duties. Power system elements failures data are the main data of reliability assessment in the network. Determining antiseptic parameters is the goal of reliability assessment by using system history data. These parameters help to recognize week points of the system. In other words, the goal of reliability assessment is operation improving and decreasing of the failures and power outages. This paper is developed to assess reliability indices of Bakhtar Regional Electricity Company up to 1393 and the improving methods and their effects on the reliability indices in this network. DIgSILENT Power Factory software is employed for simulation. Simulation results show the positive effect of improving methods in reliability indices of Bakhtar Regional Electricity Company.

Improving cluster-based methods for investigating potential for insect pest species establishment: region-specific risk factors

Directory of Open Access Journals (Sweden)

Michael J. Watts

2011-09-01

Full Text Available Existing cluster-based methods for investigating insect species assemblages or profiles of a region to indicate the risk of new insect pest invasion have a major limitation in that they assign the same species risk factors to each region in a cluster. Clearly regions assigned to the same cluster have different degrees of similarity with respect to their species profile or assemblage. This study addresses this concern by applying weighting factors to the cluster elements used to calculate regional risk factors, thereby producing region-specific risk factors. Using a database of the global distribution of crop insect pest species, we found that we were able to produce highly differentiated region-specific risk factors for insect pests. We did this by weighting cluster elements by their Euclidean distance from the target region. Using this approach meant that risk weightings were derived that were more realistic, as they were specific to the pest profile or species assemblage of each region. This weighting method provides an improved tool for estimating the potential invasion risk posed by exotic species given that they have an opportunity to establish in a target region.

Asia-Pacific Regional Economic Integration: Coopetition vs. Conflict

Directory of Open Access Journals (Sweden)

YuJane Chen

2016-04-01

Full Text Available In the era of economic globalization, promoting regional trade agreements or regional cooperation has become a plausible strategy to attract foreign direct investment and to promote national competitiveness at a global level. Nonetheless, facing the differential national economic interests and the needs of protection of domestic industries, as well as the diverse levels of economic liberalization domestically, the involvement of FTA negotiation in every country is universally in the situation of struggling between securing economic sovereignty and national economic development. Countries in the Asia-Pacific region are in the same situation. This article analyzes how countries balance between securing economic sovereignty and promoting national economic development when they are involved in TPP and RCEP negotiations. By confirming the appropriate linkage between each participating countries’ decision for balancing between domestic economic sovereignty and further integrating into regional economic cooperation institutions the validity of the proposition for this research project can be verified.

Exploiting nucleotide composition to engineer promoters.

Directory of Open Access Journals (Sweden)

Manfred G Grabherr

Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

Viral Vector-Based Dissection of Marmoset GFAP Promoter in Mouse and Marmoset Brains.

Directory of Open Access Journals (Sweden)

Yoichiro Shinohara

Full Text Available Adeno-associated virus (AAV vectors are small in diameter, diffuse easily in the brain, and represent a highly efficient means by which to transfer a transgene to the brain of a large animal. A major demerit of AAV vectors is their limited accommodation capacity for transgenes. Thus, a compact promoter is useful when delivering large transgenes via AAV vectors. In the present study, we aimed to identify the shortest astrocyte-specific GFAP promoter region that could be used for AAV-vector-mediated transgene expression in the marmoset brain. The 2.0-kb promoter region upstream of the GFAP gene was cloned from the marmoset genome, and short promoters (1.6 kb, 1.4 kb, 0.6 kb, 0.3 kb and 0.2 kb were obtained by progressively deleting the original 2.0-kb promoter from the 5' end. The short promoters were screened in the mouse cerebellum in terms of their strength and astrocyte specificity. We found that the 0.3-kb promoter maintained 40% of the strength of the original 2.0-kb promoter, and approximately 90% of its astrocyte specificity. These properties were superior to those of the 1.4-kb, 0.6-kb (20% promoter strength and 0.2-kb (70% astrocyte specificity promoters. Then, we verified whether the 0.3-kb GFAP promoter retained astrocyte specificity in the marmoset cerebral cortex. Injection of viral vectors carrying the 0.3-kb marmoset GFAP promoter specifically transduced astrocytes in both the cerebral cortex and cerebellar cortex of the marmoset. These results suggest that the compact 0.3-kb promoter region serves as an astrocyte-specific promoter in the marmoset brain, which permits us to express a large gene by AAV vectors that have a limited accommodation capacity.

The role of germline promoters and I exons in cytokine-induced gene-specific class switch recombination.

Science.gov (United States)

Dunnick, Wesley A; Shi, Jian; Holden, Victoria; Fontaine, Clinton; Collins, John T

2011-01-01

Germline transcription precedes class switch recombination (CSR). The promoter regions and I exons of these germline transcripts include binding sites for activation- and cytokine-induced transcription factors, and the promoter regions/I exons are essential for CSR. Therefore, it is a strong hypothesis that the promoter/I exons regions are responsible for much of cytokine-regulated, gene-specific CSR. We tested this hypothesis by swapping the germline promoter and I exons for the murine γ1 and γ2a H chain genes in a transgene of the entire H chain C-region locus. We found that the promoter/I exon for γ1 germline transcripts can direct robust IL-4-induced recombination to the γ2a gene. In contrast, the promoter/I exon for the γ2a germline transcripts works poorly in the context of the γ1 H chain gene, resulting in expression of γ1 H chains that is level. Nevertheless, the small amount of recombination to the chimeric γ1 gene is induced by IFN-γ. These results suggest that cytokine regulation of CSR, but not the magnitude of CSR, is regulated by the promoter/I exons.

MRS algorithm: a new method for searching myocardial region in SPECT myocardial perfusion images.

Science.gov (United States)

He, Yuan-Lie; Tian, Lian-Fang; Chen, Ping; Li, Bin; Mao, Zhong-Yuan

2005-10-01

First, the necessity of automatically segmenting myocardium from myocardial SPECT image is discussed in Section 1. To eliminate the influence of the background, the optimal threshold segmentation method modified for the MRS algorithm is explained in Section 2. Then, the image erosion structure is applied to identify the myocardium region and the liver region. The contour tracing method is introduced to extract the myocardial contour. To locate the centriod of the myocardium, the myocardial centriod searching method is developed. The protocol of the MRS algorithm is summarized in Section 6. The performance of the MRS algorithm is investigated and the conclusion is drawn in Section 7. Finally, the importance of the MRS algorithm and the improvement of the MRS algorithm are discussed.

CAMSHIFT IMPROVEMENT WITH MEAN-SHIFT SEGMENTATION, REGION GROWING, AND SURF METHOD

Directory of Open Access Journals (Sweden)

Ferdinan Ferdinan

2013-10-01

Full Text Available CAMSHIFT algorithm has been widely used in object tracking. CAMSHIFT utilizescolor features as the model object. Thus, original CAMSHIFT may fail when the object color issimilar with the background color. In this study, we propose CAMSHIFT tracker combined withmean-shift segmentation, region growing, and SURF in order to improve the tracking accuracy.The mean-shift segmentation and region growing are applied in object localization phase to extractthe important parts of the object. Hue-distance, saturation, and value are used to calculate theBhattacharyya distance to judge whether the tracked object is lost. Once the object is judged lost,SURF is used to find the lost object, and CAMSHIFT can retrack the object. The Object trackingsystem is built with OpenCV. Some measurements of accuracy have done using frame-basedmetrics. We use datasets BoBoT (Bonn Benchmark on Tracking to measure accuracy of thesystem. The results demonstrate that CAMSHIFT combined with mean-shift segmentation, regiongrowing, and SURF method has higher accuracy than the previous methods.

Calculation method of passive tracer using regional ocean modeling system (ROMS)

International Nuclear Information System (INIS)

Tubono, Takaki; Tsumune, Daisuke; Misumi, Kazuhiro; Yoshida, Yoshikatsu

2010-01-01

A dose assessments method for packages shipping radioactive materials was developed to calculate concentrations of radioactive materials discharged from the hypothetically sinking point using Regional Ocean Modeling System (ROMS). The programs of ROMS were improved for simultaneously calculating the flow fields around Japan and the concentrations discharged from several bottom points in the continental shelf. The model domain covered the northeast pacific region around Japan, 20degN-65degN, 120degE-165degE, with 1/10 degree horizontal resolution and 30 sigma-levels. The ROMS model captured main features such as Kuroshio currents, including the separation location and the Kuroshio extension, and Oyashio currents. The calculated volume transports through the main straits such as Tokara strait, Tsushima strait and Tsugaru strait were compared well to the measured or estimated that. The calculated concentrations discharged from 12 bottom points showed mixing associated with the eddies of ocean currents. This method is available to evaluate effectively the concentrations of radioactive materials only by setting the subsidence location and the concentrations and volume discharged. (author)

Building a competitive regional innovation environment : the regional development platform method as a tool for regional innovation policy

OpenAIRE

Harmaakorpi, Vesa

2004-01-01

The study focuses on building a regional innovation policy tool that takes into account the demands of the present techno-economic and socio-institutional paradigms. Regions are seen to be strongly dependent on their history. The competitiveness of a region is based on the regional resource configurations. In a turbulent world these resource configurations have to be renewed over time setting demands for regional dynamic capabilities. This study emphasises five regional dynamic capabilities: ...

Facilitators and barriers to accessing reproductive health care for migrant beer promoters in Cambodia, Laos, Thailand and Vietnam: A mixed methods study

Science.gov (United States)

2012-01-01

Background The purpose of the research was to assess access to sexual and reproductive health services for migrant women who work as beer promoters. This mixed methods research was conducted in Phnom Penh, Cambodia, Bangkok, Thailand, Vientiane, Laos, and Hanoi, Vietnam during 2010 to 2011. Methods Focus groups were held with beer promoters and separate focus groups or interviews with key informants to explore the factors affecting beer promoters’ access to health care institutions for reproductive health care. The findings of the focus groups were used to develop a survey for beer promoters. This survey was conducted in popular health institutions for these women in each of the four Asian cities. Results Several common themes were evident. Work demands prevented beer promoters from accessing health care. Institutional factors affecting care included cost, location, environmental factors (e.g. waiting times, cleanliness and confidentiality) and service factors (e.g. staff attitudes, clinic hours, and availability of medications). Personal factors affecting access were shyness and fear, lack of knowledge, and support from family and friends. The survey of the beer promoters confirmed that cost, location and both environmental and service factors impact on access to health care services for beer promoters. Many beer promoters are sexually active, and a significant proportion of those surveyed rely on sex work to supplement their income. Many also drink with their clients. Despite a few differences amongst the surveyed population, the findings were remarkably similar across the four research sites. Conclusions Recommendations from the research include the provision of evening and weekend clinic hours to facilitate access, free or low cost clinics, and health insurance through employer or government plans which are easy to access for migrants. Other improvements that would facilitate the access of beer promoters to these services include increased funding to hire

Facilitators and barriers to accessing reproductive health care for migrant beer promoters in Cambodia, Laos, Thailand and Vietnam: A mixed methods study

Directory of Open Access Journals (Sweden)

Webber Gail

2012-07-01

Full Text Available Abstract Background The purpose of the research was to assess access to sexual and reproductive health services for migrant women who work as beer promoters. This mixed methods research was conducted in Phnom Penh, Cambodia, Bangkok, Thailand, Vientiane, Laos, and Hanoi, Vietnam during 2010 to 2011. Methods Focus groups were held with beer promoters and separate focus groups or interviews with key informants to explore the factors affecting beer promoters’ access to health care institutions for reproductive health care. The findings of the focus groups were used to develop a survey for beer promoters. This survey was conducted in popular health institutions for these women in each of the four Asian cities. Results Several common themes were evident. Work demands prevented beer promoters from accessing health care. Institutional factors affecting care included cost, location, environmental factors (e.g. waiting times, cleanliness and confidentiality and service factors (e.g. staff attitudes, clinic hours, and availability of medications. Personal factors affecting access were shyness and fear, lack of knowledge, and support from family and friends. The survey of the beer promoters confirmed that cost, location and both environmental and service factors impact on access to health care services for beer promoters. Many beer promoters are sexually active, and a significant proportion of those surveyed rely on sex work to supplement their income. Many also drink with their clients. Despite a few differences amongst the surveyed population, the findings were remarkably similar across the four research sites. Conclusions Recommendations from the research include the provision of evening and weekend clinic hours to facilitate access, free or low cost clinics, and health insurance through employer or government plans which are easy to access for migrants. Other improvements that would facilitate the access of beer promoters to these services include

Isolation of a strong Arabidopsis guard cell promoter and its potential as a research tool

Science.gov (United States)

Yang, Yingzhen; Costa, Alex; Leonhardt, Nathalie; Siegel, Robert S; Schroeder, Julian I

2008-01-01

Background A common limitation in guard cell signaling research is that it is difficult to obtain consistent high expression of transgenes of interest in Arabidopsis guard cells using known guard cell promoters or the constitutive 35S cauliflower mosaic virus promoter. An additional drawback of the 35S promoter is that ectopically expressing a gene throughout the organism could cause pleiotropic effects. To improve available methods for targeted gene expression in guard cells, we isolated strong guard cell promoter candidates based on new guard cell-specific microarray analyses of 23,000 genes that are made available together with this report. Results A promoter, pGC1(At1g22690), drove strong and relatively specific reporter gene expression in guard cells including GUS (beta-glucuronidase) and yellow cameleon YC3.60 (GFP-based calcium FRET reporter). Reporter gene expression was weaker in immature guard cells. The expression of YC3.60 was sufficiently strong to image intracellular Ca2+ dynamics in guard cells of intact plants and resolved spontaneous calcium transients in guard cells. The GC1 promoter also mediated strong reporter expression in clustered stomata in the stomatal development mutant too-many-mouths (tmm). Furthermore, the same promoter::reporter constructs also drove guard cell specific reporter expression in tobacco, illustrating the potential of this promoter as a method for high level expression in guard cells. A serial deletion of the promoter defined a guard cell expression promoter region. In addition, anti-sense repression using pGC1 was powerful for reducing specific GFP gene expression in guard cells while expression in leaf epidermal cells was not repressed, demonstrating strong cell-type preferential gene repression. Conclusion The pGC1 promoter described here drives strong reporter expression in guard cells of Arabidopsis and tobacco plants. It provides a potent research tool for targeted guard cell expression or gene silencing. It is also

A Peptide Derived from the HIV-1 gp120 Coreceptor-Binding Region Promotes Formation of PAP248-286 Amyloid Fibrils to Enhance HIV-1 Infection.

Directory of Open Access Journals (Sweden)

Jinquan Chen

Full Text Available Semen is a major vehicle for HIV transmission. Prostatic acid phosphatase (PAP fragments, such as PAP248-286, in human semen can form amyloid fibrils to enhance HIV infection. Other endogenous or exogenous factors present during sexual intercourse have also been reported to promote the formation of seminal amyloid fibrils.Here, we demonstrated that a synthetic 15-residue peptide derived from the HIV-1 gp120 coreceptor-binding region, designated enhancing peptide 2 (EP2, can rapidly self-assemble into nanofibers. These EP2-derivated nanofibers promptly accelerated the formation of semen amyloid fibrils by PAP248-286, as shown by Thioflavin T (ThT and Congo red assays. The amyloid fibrils presented similar morphology, assessed via transmission electron microscopy (TEM, in the presence or absence of EP2. Circular dichroism (CD spectroscopy revealed that EP2 accelerates PAP248-286 amyloid fibril formation by promoting the structural transition of PAP248-286 from a random coil into a cross-β-sheet. Newly formed semen amyloid fibrils effectively enhanced HIV-1 infection in TZM-bl cells and U87 cells by promoting the binding of HIV-1 virions to target cells.Nanofibers composed of EP2 promote the formation of PAP248-286 amyloid fibrils and enhance HIV-1 infection.

Identification of the MUC2 Promoter as a Strong Promoter for Intestinal Gene Expression through Generation of Transgenic Quail Expressing GFP in Gut Epithelial Cells

Directory of Open Access Journals (Sweden)

Rachel M. Woodfint

2017-01-01

Full Text Available Identification of tissue- and stage-specific gene promoters is valuable for delineating the functional roles of specific genes in genetically engineered animals. Here, through the comparison of gene expression in different tissues by analysis of a microarray database, the intestinal specificity of mucin 2 (MUC2 expression was identified in mice and humans, and further confirmed in chickens by RT-PCR (reverse transcription-PCR analysis. An analysis of cis-acting elements in avian MUC2 gene promoters revealed conservation of binding sites, within a 2.9 kb proximal promoter region, for transcription factors such as caudal type homeobox 2 (CDX2, GATA binding protein 4 (GATA4, hepatocyte nuclear factor 4 α (HNF4A, and transcription factor 4 (TCF4 that are important for maintaining intestinal homeostasis and functional integrity. By generating transgenic quail, we demonstrated that the 2.9 kb chicken MUC2 promoter could drive green fluorescent protein (GFP reporter expression exclusively in the small intestine, large intestine, and ceca. Fluorescence image analysis further revealed GFP expression in intestine epithelial cells. The GFP expression was barely detectable in the embryonic intestine, but increased during post-hatch development. The spatiotemporal expression pattern of the reporter gene confirmed that the 2.9 kb MUC2 promoter could retain the regulatory element to drive expression of target genes in intestinal tissues after hatching. This new transgene expression system, using the MUC2 promoter, will provide a new method of overexpressing target genes to study gene function in the avian intestine.

A novel method to remove GPR background noise based on the similarity of non-neighboring regions

Science.gov (United States)

Montiel-Zafra, V.; Canadas-Quesada, F. J.; Vera-Candeas, P.; Ruiz-Reyes, N.; Rey, J.; Martinez, J.

2017-09-01

Ground penetrating radar (GPR) is a non-destructive technique that has been widely used in many areas of research, such as landmine detection or subsurface anomalies, where it is required to locate targets embedded within a background medium. One of the major challenges in the research of GPR data remains the improvement of the image quality of stone materials by means of detection of true anisotropies since most of the errors are caused by an incorrect interpretation by the users. However, it is complicated due to the interference of the horizontal background noise, e.g., the air-ground interface, that reduces the high-resolution quality of radargrams. Thus, weak or deep anisotropies are often masked by this type of noise. In order to remove the background noise obtained by GPR, this work proposes a novel background removal method assuming that the horizontal noise shows repetitive two-dimensional regions along the movement of the GPR antenna. Specifically, the proposed method, based on the non-local similarity of regions over the distance, computes similarities between different regions of the same depth in order to identify most repetitive regions using a criterion to avoid closer regions. Evaluations are performed using a set of synthetic and real GPR data. Experimental results show that the proposed method obtains promising results compared to the classic background removal techniques and the most recently published background removal methods.

ABERRANT METHYLATION OF THE PROMOTER OF APC, CDH13 AND MGMT GENES IN COLORECTAL CANCER PATIENTS

Directory of Open Access Journals (Sweden)

O. I. Kit

2016-01-01

Full Text Available Aberrant methylation of gene promoter regions is the main epigenetic change characterizing colorectal cancer. Methylation levels of 42 CpG-sites of promoter regions of the MGMT, APC and CDH13 genes in colorectal cancer were studied in comparison with methylation levels of the adjacent normal tissue in 25 patients. Pyrosequencing showed an increase in methylation levels of promoter regions of the MGMT, APC and CDH13 genes in tumor samples by 3 to 5 times. These tumor samples were screened for activating SNP-mutations in the KRAS (40 %, NRAS (0 % and BRAF (0 % oncogenes. SNP-mutations in the KRAS gene were accompanied by hypermethylation of one or more promoters of the studied genes. Association of this epigenetic index with tumor metastasis was proved. The data on an increase in methylation of the promoter regions of oncosupressor genes can be used as sensitive prognostic markers of progression and metastasis of colorectal cancer.

Potential Analysis of Promoting the Dengue Hemorrhagic Fever Prevention Through Youtube

Directory of Open Access Journals (Sweden)

Mara Ipa

2014-11-01

Full Text Available Background: Deal with health promotion efforts in terms of disease control using media or social networking is an innovative breakthrough in a region having a broad range of territory, such as Indonesia and others countries alike. The use of social media /video platforms such as youtube, vimeo, veoh in health promotion has been significantly increased. This study aims to determine the potential availability of information about dengue hemorrhagic fever (DHF on YouTube social media and social media potential of as a medium for dissemination of knowledge of health promotion. Methods: This study used a social media site or website which is the most popular video hosting sites in the world, ‘YouTube’, with the keyword of ‘dengue hemorrhagic fever’. The selected video directly associated with DHF, videos in English that were included in this study using Latin letters in the description of the video; with duration less than or equal to 5 minutes. 76 videos analyzed with content analysis methods. Results:Showed that 76 videos divided into categories of prevention, control, transmission, treatment, dengue fever treatment, and other categories. Other information classification categories explain the severity of dengue virus infection, dengue vector (morphology, bionomics, intrinsic phase dengue virus and some research conducted as dengue vaccine discovery efforts. Conclusion: The availability of information about dengue on YouTube social media is still very deficient. Recommendation: YouTube has the potential of social media as a medium for disseminating health promotion information about dengue.

Risk Reduction Methods for Managing the Development of Regional Electric Power Industry

Directory of Open Access Journals (Sweden)

Mikhail Kozhevnikov

2017-11-01

Full Text Available The development of the regional electric power industry has come to the forefront due to the changing scale, quality, and configuration of electric power infrastructure, and the spread of distributed generation. This gives rise to more stringent requirements regarding the reliability, safety, and environmental impact of electric power supply. This article aims to justify a package of methods that make it possible to identify and minimize investment, production, financial, and environmental risks in order to ensure sustainable development of the regional electric power industry that performs anti-crisis functions, and of individual energy companies. The key method to be employed is integrated resource planning (IRP. As a part of the method, energy conservation, renewable energy sources, and combined heat and power production are considered as equally valid ways of meeting future demand. The authors have designed a methodology for taking into account uncertainty and risk when implementing IRP. The methodology includes analysis of scenarios and decision making processes by calculating past and projected values of profit indicators. When conducting the environmental and economic assessment of an investment project in the electric power industry, the authors suggest using an aggregate indicator of environmental and economic effectiveness that is calculated on the basis of a combination of locally significant positive and negative environmental and economic impacts of the project. The authors formulate conceptual provisions that serve as the foundation for a promising model of the regional electric power industry and which contain recommendations for managing the development of the industry while minimizing organizational, market, and technological risks.

European network for promoting the physical health of residents in psychiatric and social care facilities (HELPS): background, aims and methods

Science.gov (United States)

Weiser, Prisca; Becker, Thomas; Losert, Carolin; Alptekin, Köksal; Berti, Loretta; Burti, Lorenzo; Burton, Alexandra; Dernovsek, Mojca; Dragomirecka, Eva; Freidl, Marion; Friedrich, Fabian; Genova, Aneta; Germanavicius, Arunas; Halis, Ulaş; Henderson, John; Hjorth, Peter; Lai, Taavi; Larsen, Jens Ivar; Lech, Katarzyna; Lucas, Ramona; Marginean, Roxana; McDaid, David; Mladenova, Maya; Munk-Jørgensen, Povl; Paziuc, Alexandru; Paziuc, Petronela; Priebe, Stefan; Prot-Klinger, Katarzyna; Wancata, Johannes; Kilian, Reinhold

2009-01-01

Background People with mental disorders have a higher prevalence of physical illnesses and reduced life expectancy as compared with the general population. However, there is a lack of knowledge across Europe concerning interventions that aim at reducing somatic morbidity and excess mortality by promoting behaviour-based and/or environment-based interventions. Methods and design HELPS is an interdisciplinary European network that aims at (i) gathering relevant knowledge on physical illness in people with mental illness, (ii) identifying health promotion initiatives in European countries that meet country-specific needs, and (iii) at identifying best practice across Europe. Criteria for best practice will include evidence on the efficacy of physical health interventions and of their effectiveness in routine care, cost implications and feasibility for adaptation and implementation of interventions across different settings in Europe. HELPS will develop and implement a "physical health promotion toolkit". The toolkit will provide information to empower residents and staff to identify the most relevant risk factors in their specific context and to select the most appropriate action out of a range of defined health promoting interventions. The key methods are (a) stakeholder analysis, (b) international literature reviews, (c) Delphi rounds with experts from participating centres, and (d) focus groups with staff and residents of mental health care facilities. Meanwhile a multi-disciplinary network consisting of 15 European countries has been established and took up the work. As one main result of the project they expect that a widespread use of the HELPS toolkit could have a significant positive effect on the physical health status of residents of mental health and social care facilities, as well as to hold resonance for community dwelling people with mental health problems. Discussion A general strategy on health promotion for people with mental disorders must take into

The isotope effect and enthalpy of a base-promoted 1,4-elimination reaction by a thermokinetic method

International Nuclear Information System (INIS)

Ahlberg, P.

1974-01-01

Microcalorimetry (MC) has been used to measure the second order rate constants (k) for the base-promoted 1,4-elimination reactions of 3-(2-acetoxy-2-propyl)indene (B sub (H)) and 3-di-d-3-(2-acetoxy-2-propyl)indene (B sub (D)). Triethylamine (TEA) was used as eliminating base in methanol buffered with TEAH + AcO - as solvent. The MC-rate constants agreed with those obtained by an independent method, a calibrated quench-extraction-NMR (Q-E-NMR) method. In the present case the MC-method yields k/s with a precision of -1 (-9.5 kcal/mol) for B sub (H). The usefulness microcalorimetry in the study of reaction mechanisms is discussed. (author)

Insulin Promoter Factor 1 variation is associated with type 2 diabetes in African Americans

Directory of Open Access Journals (Sweden)

Wang Xiaoqin

2005-10-01

Full Text Available Abstract Background Defective insulin secretion is a key defect in the pathogenesis of type 2 diabetes (T2DM. The β-cell specific transcription factor, insulin promoter factor 1 gene (IPF1, is essential to pancreatic development and the maintenance of β-cell mass. We hypothesized that regulatory or coding variants in IPF1 contribute to defective insulin secretion and thus T2DM. Methods We screened 71 Caucasian and 69 African American individuals for genetic variants in the promoter region, three highly conserved upstream regulatory sequences (PH1, PH2 and PH3, the human β-cell specific enhancer, and the two exons with adjacent introns. We tested for an association of each variant with T2DM Caucasians (192 cases and 192 controls and African Americans (341 cases and 186 controls. Results We identified 8 variants in the two populations, including a 3 bp insertion in exon 2 (InsCCG243 in African Americans that resulted in an in-frame proline insertion in the transactivation domain. No variant was associated with T2DM in Caucasians, but polymorphisms at -3766 in the human β-cell enhancer, at -2877 bp in the PH1 domain, and at -108 bp in the promoter region were associated with T2DM in African American subjects (p Conculsion The common alleles of regulatory variants in the 5' enhancer and promoter regions of the IPF1 gene increase susceptibility to type 2 diabetes among African American individuals, likely as a result of gene-gene or gene-environment interactions. In contrast, IPF1 is not a cause of type 2 diabetes in Caucasians. A previously described InsCCG243 variant may contribute to diabetes susceptibility in African American individuals, but is of low penetrance.

MICB gene diversity and balancing selection on its promoter region in Yao population in southern China.

Science.gov (United States)

Chen, Xiang; Liu, Xuexiang; Wei, Xiaomou; Meng, Yuming; Liu, Limin; Qin, Shini; Liu, Yanyu; Dai, Shengming

2016-12-01

To comprehensively examine the MICB gene polymorphism and identify its differences in Chinese Yao population from other ethnic groups, we investigated the polymorphism in the 5'-upstream regulation region (5'-URR), coding region (exons 2-4), and the 3'-untranslated region (3'-UTR) of MICB gene by using PCR-SBT method in 125 healthy unrelated Yao individuals in Guangxi Zhuang Autonomous Region. Higher polymorphism was observed in the 5'-URR, nine single nucleotide polymorphisms (SNPs) and a two base pairs deletion at position -139/-138 were found in our study. Only five different variation sites, however, were detected in exons 2-4 and three were observed in the 3'-UTR. The minor allele frequencies of all variants were greater than 5%, except for rs3828916, rs3131639, rs45627734, rs113620316, rs779737471, and the variation at position +11803 in the 3'-UTR. The first nine SNPs of 5'-URR and rs1065075, rs1051788 of the coding region showed significant linkage disequilibrium with each other. Ten different MICB extended haplotypes (EH) encompassing the 5'-URR, exons 2-4, and 3'-UTR were found in this population, and the most frequent was EH1 (23.2%). We provided several evidences for balancing selection effect on the 5'-URR of MICB gene in Yao population. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

The Relationship between FHIT Gene Promoter Methylation and Lung Cancer Risk: 
a Meta-analysis

Directory of Open Access Journals (Sweden)

Yichang SUN

2014-03-01

Full Text Available Background and objective Tumor-suppressor gene promoter DNA methylation in tumor cells is associated with its reduced expression. FHIT (fragile histindine triad was one of the important tumor suppressor genes which was found hypermethylated in the promoter region in most of tumors. The aim of this study is to evaluate the relationship between FIHT gene promother methylation and lung cancer risk by meta-analysis. Methods By searching Pubmed, CNKI and Wanfang, the open published articles related to FHIT gene promoter methylation and lung carcinoma risk were collected. The odds ratio (OR and range of FHIT gene of cancer tissue of lung cancer patients compared with normal lung tissue, plasma and the bronchial lavage fluid were pooled by statistical software Stata 11.0. Results Eleven studies were finally included in this meta-analysis. The median methylation rate were Pmedian=40.0% (0-68.3%, Pmedian=8.7% (0-35.0%, Pmedian=33.3% (17.1%-38.3% and Pmedian=35.9% (31.1%-50.8% in cancer tissue, NLT, BALF and plasm respectively. The pooled results showed the methylation rate in tumor tissue was much higer than that of NLT OR=5.82 (95%CI: 3.74-9.06, P0.05 and plasma OR=1.41 (95%CI: 0.90-2.20, P>0.05. Conclusion Hypermethylation of FHIT gene promoter region was found more frequent in cancer tissue than that of NLT which may demonstrated association between lung cancer risk and FHIT gene promoter methylation.

Functional analysis of the rice rubisco activase promoter in transgenic Arabidopsis

Energy Technology Data Exchange (ETDEWEB)

Yang, Zhipan; Lu, Qingtao; Wen, Xiaogang [Key Laboratory of Photobiology, Institute of Botany, Chinese Academy of Sciences, Beijing 100093 (China); Chen, Fan [Key Laboratory of Molecular and Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100080 (China); Lu, Congming, E-mail: lucm@ibcas.ac.cn [Key Laboratory of Photobiology, Institute of Botany, Chinese Academy of Sciences, Beijing 100093 (China)

2012-02-17

Highlights: Black-Right-Pointing-Pointer Rice rubisco activase promoter was analyzed in transgenic Arabidopsis system. Black-Right-Pointing-Pointer Region conferring tissue specific and light inducible expression of Rca was identified. Black-Right-Pointing-Pointer -58 to +43 bp region mediates tissue-specific expression of rice Rca. Black-Right-Pointing-Pointer Light inducible expression of rice Rca is mediated by -297 to -58 bp region. Black-Right-Pointing-Pointer Rice nuclear proteins bind specifically with the light inducible region. -- Abstract: To gain a better understanding of the regulatory mechanism of the rice rubisco activase (Rca) gene, variants of the Rca gene promoter (one full-length and four deletion mutants) fused to the coding region of the bacterial reporter gene {beta}-glucuronidase (GUS) were introduced into Arabidopsis via Agrobacterium-mediated transformation. Our results show that a 340 bp fragment spanning from -297 to +43 bp relative to the transcription initiation site is enough to promote tissue-specific and light-inducible expression of the rice Rca gene as done by the full-length promoter (-1428 to +43 bp). Further deletion analysis indicated that the region conferring tissue-specificity of Rca expression is localized within a 105 bp fragment from -58 to +43 bp, while light-inducible expression of Rca is mediated by the region from -297 to -58 bp. Gel shift assays and competition experiments demonstrated that rice nuclear proteins bind specifically with the fragment conferring light responsiveness at more than one binding site. This implies that multiple cis-elements may be involved in light-induced expression of the rice Rca gene. These works provide a useful reference for understanding transcriptional regulation mechanism of the rice Rca gene, and lay a strong foundation for further detection of related cis-elements and trans-factors.

Functional analysis of the rice rubisco activase promoter in transgenic Arabidopsis

International Nuclear Information System (INIS)

Yang, Zhipan; Lu, Qingtao; Wen, Xiaogang; Chen, Fan; Lu, Congming

2012-01-01

Highlights: ► Rice rubisco activase promoter was analyzed in transgenic Arabidopsis system. ► Region conferring tissue specific and light inducible expression of Rca was identified. ► −58 to +43 bp region mediates tissue-specific expression of rice Rca. ► Light inducible expression of rice Rca is mediated by −297 to −58 bp region. ► Rice nuclear proteins bind specifically with the light inducible region. -- Abstract: To gain a better understanding of the regulatory mechanism of the rice rubisco activase (Rca) gene, variants of the Rca gene promoter (one full-length and four deletion mutants) fused to the coding region of the bacterial reporter gene β-glucuronidase (GUS) were introduced into Arabidopsis via Agrobacterium-mediated transformation. Our results show that a 340 bp fragment spanning from −297 to +43 bp relative to the transcription initiation site is enough to promote tissue-specific and light-inducible expression of the rice Rca gene as done by the full-length promoter (−1428 to +43 bp). Further deletion analysis indicated that the region conferring tissue-specificity of Rca expression is localized within a 105 bp fragment from −58 to +43 bp, while light-inducible expression of Rca is mediated by the region from −297 to −58 bp. Gel shift assays and competition experiments demonstrated that rice nuclear proteins bind specifically with the fragment conferring light responsiveness at more than one binding site. This implies that multiple cis-elements may be involved in light-induced expression of the rice Rca gene. These works provide a useful reference for understanding transcriptional regulation mechanism of the rice Rca gene, and lay a strong foundation for further detection of related cis-elements and trans-factors.

Regional collaboration among Urban Area Security Initiative regions: results of the Johns Hopkins urban area survey.

Science.gov (United States)

Errett, Nicole A; Bowman, Calvin; Barnett, Daniel J; Resnick, Beth A; Frattaroli, Shannon; Rutkow, Lainie

2014-01-01

Regional collaboration has been identified as a potential facilitator of public health preparedness efforts. The Urban Area Security Initiative (UASI) grant program, administered by the Federal Emergency Management Agency (FEMA) since 2003, has provided 64 high-risk metropolitan areas funding to enhance their regional preparedness capabilities. This study describes informal and formal regional collaboration infrastructure, as well as regional collaboration-related activities and assessment methods, in FFY2010 UASI regions. A cross-sectional online survey was administered via Survey Monkey from September through December 2013. Points of contact from FFY2010 funded UASI metropolitan areas completed the survey, with a response rate of 77.8% (n=49). Summary statistics were calculated to describe the current informal and formal regional collaboration infrastructure. Additionally, the cross-sectional survey collected rates of agreement with 8 collaborative preparedness statements at 3 time points. The survey found that UASI regions are engaging in collaborative activities and investments to build capabilities, with most collaboration occurring in the prevention, protection, and response mission areas. Collaborative relationships in preparedness among emergency managers and municipal chief executive officers improved during the FFY2010 UASI performance period compared to the pre-UASI award period, with lasting effects. The majority of UASI regions reported conducting independent assessments of capabilities and their measurement at the UASI region level. Urban areas that received a FFY2010 UASI grant award are engaging in collaborative activities and have established interjurisdictional relationships in preparedness. The use of grant funds to encourage collaboration in preparedness has the potential to leverage limited resources and promote informed investments.

Regional Collaboration Among Urban Area Security Initiative Regions: Results of the Johns Hopkins Urban Area Survey

Science.gov (United States)

Bowman, Calvin; Barnett, Daniel J.; Resnick, Beth A.; Frattaroli, Shannon; Rutkow, Lainie

2014-01-01

Regional collaboration has been identified as a potential facilitator of public health preparedness efforts. The Urban Area Security Initiative (UASI) grant program, administered by the Federal Emergency Management Agency (FEMA) since 2003, has provided 64 high-risk metropolitan areas funding to enhance their regional preparedness capabilities. This study describes informal and formal regional collaboration infrastructure, as well as regional collaboration–related activities and assessment methods, in FFY2010 UASI regions. A cross-sectional online survey was administered via Survey Monkey from September through December 2013. Points of contact from FFY2010 funded UASI metropolitan areas completed the survey, with a response rate of 77.8% (n=49). Summary statistics were calculated to describe the current informal and formal regional collaboration infrastructure. Additionally, the cross-sectional survey collected rates of agreement with 8 collaborative preparedness statements at 3 time points. The survey found that UASI regions are engaging in collaborative activities and investments to build capabilities, with most collaboration occurring in the prevention, protection, and response mission areas. Collaborative relationships in preparedness among emergency managers and municipal chief executive officers improved during the FFY2010 UASI performance period compared to the pre-UASI award period, with lasting effects. The majority of UASI regions reported conducting independent assessments of capabilities and their measurement at the UASI region level. Urban areas that received a FFY2010 UASI grant award are engaging in collaborative activities and have established interjurisdictional relationships in preparedness. The use of grant funds to encourage collaboration in preparedness has the potential to leverage limited resources and promote informed investments. PMID:25398073

Health promotion capacity building in South Africa.

Science.gov (United States)

Wills, Jane; Rudolph, Michael

2010-09-01

Health promotion in South Africa is in its early stages and while there is some institutional development and capacity building for managers, there has been relative disregard and lack of attention of the wider health promotion workforce who carry out community-based health promotion activities. This article describes one regional education and training programme for health promoters as well as the limited available evidence on the impact of the project on learners and organizations. Marked differences before and after the implementation of the training activities were reported in relation to behaviour change communication and project planning, in addition to self-reported positive change in knowledge, confidence and a high level of participant satisfaction. Investment in individual skills development needs to be accompanied by wider workforce development with organizational/institutional development and recognised competencies frameworks.

A computational method for identification of vaccine targets from protein regions of conserved human leukocyte antigen binding

DEFF Research Database (Denmark)

Olsen, Lars Rønn; Simon, Christian; Kudahl, Ulrich J.

2015-01-01

Background: Computational methods for T cell-based vaccine target discovery focus on selection of highly conserved peptides identified across pathogen variants, followed by prediction of their binding of human leukocyte antigen molecules. However, experimental studies have shown that T cells often...... target diverse regions in highly variable viral pathogens and this diversity may need to be addressed through redefinition of suitable peptide targets. Methods: We have developed a method for antigen assessment and target selection for polyvalent vaccines, with which we identified immune epitopes from...... variable regions, where all variants bind HLA. These regions, although variable, can thus be considered stable in terms of HLA binding and represent valuable vaccine targets. Results: We applied this method to predict CD8+ T-cell targets in influenza A H7N9 hemagglutinin and significantly increased...

Development of a promoter shutoff system in Aspergillus oryzae using a sorbitol-sensitive promoter.

Science.gov (United States)

Oda, Ken; Terado, Shiho; Toyoura, Rieko; Fukuda, Hisashi; Kawauchi, Moriyuki; Iwashita, Kazuhiro

2016-09-01

Promoter shutoff is a general method for analyzing essential genes, but in the fungus Aspergillus oryzae, no tightly repressed promoters have been reported. To overcome the current limitations of conditional promoters, we examined sorbitol- and galactose-responsive genes using microarrays to identify regulatable genes with only minor physiological and genetic effects. We identified two sorbitol-induced genes (designated as sorA and sorB), cloned their promoters, and built a regulated egfp and brlA expression system. Growth medium-dependent enhanced green fluorescence protein (EGFP) fluorescence and conidiation were confirmed for egfp and brlA under the control of their respective promoters. We also used this shutoff system to regulate the essential rhoA, which demonstrated the expected growth inhibition under repressed growth conditions. Our new sorbitol promoter shutoff system developed can serve as a valuable new tool for essential gene analyses of filamentous fungi.

Environmental stress affects DNA methylation of a CpG rich promoter region of serotonin transporter gene in a nurse cohort.