WorldWideScience

Sample records for methods promoter regions

  1. A composite method based on formal grammar and DNA structural features in detecting human polymerase II promoter region.

    Directory of Open Access Journals (Sweden)

    Sutapa Datta

    Full Text Available An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques.

  2. A Composite Method Based on Formal Grammar and DNA Structural Features in Detecting Human Polymerase II Promoter Region

    Science.gov (United States)

    Datta, Sutapa; Mukhopadhyay, Subhasis

    2013-01-01

    An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG) can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques. PMID:23437045

  3. Promoting regional mobility

    DEFF Research Database (Denmark)

    Jensen, Anne

    Pricing of transport has been part of EU's common transport policy since this gained momentum in the early 1990s. Since then, it has been closely connected to the trans-European transport network (TEN-T) and to rising demands of efficient mobility systems at a local, regional and Community scale....... Development of pricing policies is contested at Community level and has taken place in a clash between different policy rationalities. Significantly though, the effects of the pricing policies are closely related to regional mobility systems, e.g. through financing large trans-border infrastructure projects...... and establishing common technical charging systems thus changing the conditions for regional mobility. This paper explores how policies of infrastructure pricing shape new ways of governing mobility which influences trans-border, regional policy-making. The key findings are that there is a tendency to include...

  4. A new method for promoting lily flowering

    African Journals Online (AJOL)

    Jane

    2011-08-08

    Aug 8, 2011 ... FT is thought to be the florigen in plants. In this research, a new method for promoting lily flowering was introduced. The function of FT gene cloned from Arabidopsis on promoting lily flowering was analyzed. pET-30a-FT vector was constructed to indicate the expression of FT:eGFP fuse protein in.

  5. Unveiling DNA structural properties of promoter regions of ...

    Indian Academy of Sciences (India)

    Aditya Kumar

    Unveiling DNA structural properties of promoter regions of prokaryotic transcriptome and their role in gene expression. Aditya Kumar. Assistant Professor. Molecular Biology & Biotechnology. Tezpur University. Tezpur – 784028, Assam ...

  6. Identification and annotation of promoter regions in microbial ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    2007-06-15

    Jun 15, 2007 ... It remains important, not only to detect rarely expressed genes but also for ... well as in identifying genes associated with rRNA, tRNA and ... DNA stability; free energy calculation; promoter; upstream and downstream region.

  7. [Health-Promoting Schools Regional Initiative of the Americas].

    Science.gov (United States)

    Ippolito-Shepherd, Josefa; Cerqueira, Maria Teresa; Ortega, Diana Patricia

    2005-01-01

    In Latin America, comprehensive health promotion programmes and activities are being implemented in the school setting, which take into account the conceptual framework of the Health-Promoting Schools Regional Initiative of the Pan American Health Organization, Regional office of the World Health Organization (PAHO/WHO). These programmes help to strengthen the working relationships between the health and education sectors. The Health-Promoting Schools Regional Initiative, officially launched by PAHO/WHO in 1995, aims to form future generations to have the knowledge, abilities, and skills necessary for promoting and caring for their health and that of their family and community, as well as to create and maintain healthy environments and communities. The Initiative focuses on three main components: comprehensive health education, the creation and maintenance of healthy physical and psychosocial environments, and the access to health and nutrition services, mental health, and active life. In 2001, PAHO conducted a survey in 19 Latin American countries to assess the status and trends of Health-Promoting Schools in the Region, for the appropriate regional, subregional, and national planning of pertinent health promotion and health education programmes and activities. The results of this survey provided information about policies and national plans, multisectoral coordination mechanisms for the support of health promotion in the school settings, the formation and participation in national and international networks of Health-Promoting Schools and about the level of dissemination of the strategy. For the successful development of Health-Promoting Schools is essential to involve the society as a whole, in order to mobilise human resources and materials necessary for implementing health promotion in the school settings. Thus, the constitution and consolidation of networks has been a facilitating mechanism for the exchange of ideas, resources and experiences to strengthen

  8. Identification and annotation of promoter regions in microbial

    Indian Academy of Sciences (India)

    2007-06-15

    Jun 15, 2007 ... Analysis of various predicted structural properties of promoter regions in prokaryotic as well as eukaryotic genomes had earlier indicated that they have several common features, such as lower stability, higher curvature and less bendability, when compared with their neighboring regions. Based on the ...

  9. Social Media Marketing as a tool for promoting the regional investment portals

    Directory of Open Access Journals (Sweden)

    Alisa Yu. Fadeyeva

    2016-01-01

    Full Text Available Objective to investigate the potential of Social Media Marketing as a tool for promoting regional investment portals in the information environment to identify the most effective ways of its implementation and to determine the level of mastering of this tool by the Russian regions. Methods general scientific methods observation comparison analysis induction deduction analogy classification. Results the analysis showed that today Social Media Marketing is an essential tool for interaction with the investment community and one of the most effective ways to promote the regional portal which allows to increase the knowledge of and loyalty to the brand to increase the targeted website traffic to increase the awareness of investors about the specific features of the portal and the regional development agenciesrsquo functioning to promptly receive information about the investment environment and to establish contacts with investors. At the same time the study of SMMactivity in the Russian regions revealed a very low level of quality of communication with investors through social networks. Scientific novelty for the first time the article investigates the significance and makes the comparative analysis of the Social Media Marketing channels with regard to investment promotion agencies as well as the results of the regional structures functioning for effective communication through social networks. Practical significance the main results of the research can be used by the regional investment agencies in order to promote their websites increase the quality of communication with investors and promote the investment attractiveness of the region as a whole. nbsp

  10. Perspectives on Promoting Regional Renewable Energy Research and Development

    International Nuclear Information System (INIS)

    Dresselhaus, M.

    2008-01-01

    Recent discussions at the Washington International Renewable Energy Conference (WIREC), hosted in March 2008 by the United States Government, with nearly 9000 participants including 103 ministers from 126 countries, concluded that a major acceleration in the adoption of renewable energy technologies was needed by mid-century. Because of different climatic conditions and societal preferences, regional cooperation is expected to play a major role in the efficient adoption of appropriate renewable energy technologies, and countries with special expertise in specific technologies seem eager to collaborate internationally to promote global goals in renewable energy. A review will be given of what we learned from this conference about renewable energy research and development strategies with a special focus given to using this basic knowledge base to promote the development of renewable energy technologies appropriate to specific regions of the world.(author)

  11. Mechanosensitive promoter region in the human HB-GAM gene

    DEFF Research Database (Denmark)

    Liedert, Astrid; Kassem, Moustapha; Claes, Lutz

    2009-01-01

    Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...

  12. Health Promotion and Wellness Staffing Methods

    National Research Council Canada - National Science Library

    Thomsen, Kim

    1999-01-01

    .... Health promotion and wellness programs positively influence the military mission readiness and force protection, increase productivity, reduce health care costs, minimize illness and non-battle...

  13. Nucleopolis for promoting the nuclear excellence of the Normandy region

    International Nuclear Information System (INIS)

    2016-01-01

    Nucleopolis is the Norman economic pole dedicated to nuclear energy, nuclear medicine and nuclear safety, it gathers about 70 enterprises whatever their sizes, research laboratories and teaching or training units. Nucleopolis was founded in 2009 with the economic development of the region as a unique purpose. Nucleopolis will ease the access of its members to local, national and international markets through actions of networking and by promoting innovations and skill development. Nucleopolis proposes to its members a series of services around 4 departments: Nucleo'Network to promote networking between the members themselves and between the members and major contractors; Nucleo'Business to propose assistance in national and international business; Nucleo'Competence to propose adequate training to its members to upgrade their skills and Nucleo'Innovation to foster collaborative work between its members on innovative projects. (A.C.)

  14. Promotion and regional development. Implementation of regional productive development agencies. The case of Maule region, Chile

    Directory of Open Access Journals (Sweden)

    Enrique Yamil Alul González

    2010-12-01

    Full Text Available The Regional Productive Development Agencies implemented in Chile in 2006, were developed as a way to answer the longing desire to territorially decentralize, and that the own Regions be whom define their future. The Agencies have the responsibility to develop innovation and productive development Agendas in participative processes, which means with public, academic and private actors. Also, the Agencies have the mission to implement Competitive Improvement Plans-PMC (clusters in prioritized economic sectors by the own region. These PMC are leaded by private actors in each sector.

  15. Genetic recombination is targeted towards gene promoter regions in dogs.

    Science.gov (United States)

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R

    2013-01-01

    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.

  16. Clinical significance of promoter region hypermethylation of microRNA-148a in gastrointestinal cancers

    Directory of Open Access Journals (Sweden)

    Sun JX

    2014-05-01

    Full Text Available Jingxu Sun,1,* Yongxi Song,1,* Zhenning Wang,1 Guoli Wang,2 Peng Gao,1 Xiaowan Chen,1 Zhaohua Gao,1 Huimian Xu1 1Department of Surgical Oncology and General Surgery, First Hospital of China Medical University, Shenyang, People’s Republic of China; 2Department of Biochemistry and Molecular Biology, China Medical University, Shenyang, People’s Republic of China *These authors contributed equally to this work Background: MicroRNAs are associated with tumor genesis and progression in various carcinomas. MicroRNA-148a (miR-148a was reported to have low expression in gastrointestinal cancers, and might be regulated by promoter region DNA methylation. Methods: Bisulfite-modified sequencing was used to determine the promoter region DNA methylation status of human gastrointestinal cancer cell lines. Expression levels of miR-148a in cell lines treated with 5-aza-2′-deoxycytidine were determined by quantitative real-time polymerase chain reaction. Total DNA was extracted from the tissues of 64 patients with gastric cancer and 51 patients with colorectal cancer. Methylation status was determined by methylation-specific polymerase chain reaction. All statistical analyses were performed with SPSS 17.0 software. Results: The promoter regions of genes in human gastrointestinal cancer cell lines were all hypermethylated, except for HT-29, and the expression of miR-148a tended to be higher than in controls after treatment with 5-aza-2′-deoxycytidine. The methylation-specific polymerase chain reaction results showed that 56.25% of gastric cancer tissues and 19.61% of colorectal cancer tissues were hypermethylated. A strong correlation was found between the expression of miR-148a and the methylation status of promoter regions (P<0.001, chi-square test and Pearson’s correlation. Furthermore, promoter region CpG site hypermethylation of miR-148a was correlated with increased tumor size (P=0.01 in gastric cancer after analyzing the correlation between

  17. Plant growth promoters and methods of using them

    KAUST Repository

    Al-Babili, Salim

    2017-01-01

    New plant growth regulators, including compounds and compositions, and methods of use including for promoting root growth. The compounds are carotenoid oxidation products, and a preferred example is 3-OH--β-apo-13-Carotenone. A method comprising

  18. Brand Products of Regional Cuisine in the Promotion of Tourism in Roztocze

    Directory of Open Access Journals (Sweden)

    Bekier-Jaworska Ewa

    2015-03-01

    Full Text Available Introduction. There has been a trend over the last few years of using specialties of regional cuisine as an independent tourist attraction. The creation of local brands is an important element in the promotion of a given region and it also influences the development of culinary tourism. The aim of the studies conducted was to identify regional dishes - a choice of dishes that could be described as 'brand dishes' and the use of those dishes as tourist attractions in Roztocze. Material and methods. Studies were conducted on a group of students studying tourism and recreation at State Higher School of Vocational Education (PWSZ in Zamość using a questionnaire. Results. The questionnaire provided an assessment of the levels of knowledge of regional cuisine among Polish and Ukrainian students, identified the most characteristic dishes and selected brand products, and helped to arrive at a suitable method of promotion. Conclusions. Nationality, family customs and selection of local restaurants highly influence knowledge of regional cuisine. Interviewees decided that the most outstanding products from Roztocze were Zwierzyniec beer, and Biłgoraj pie. Regional products should be used as a tourist attraction in Roztocze.

  19. US-India Technical Collaboration to Promote Regional Stability

    International Nuclear Information System (INIS)

    Killinger, Mark H.; Griggs, James R.; Apt, Kenneth E.; Doyle, James E.

    2001-01-01

    Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, DOE has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US agencies and the Indian government and scientific communities to identify appropriate non-sensitive areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national/international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes research done on the Indian scientific organization and infrastructure, potential areas for collaboration, the approach for this engagement, and current status of the initiative.

  20. US-INDIA TECHNICAL COLLABORATION TO PROMOTE REGIONAL STABILITY

    International Nuclear Information System (INIS)

    Killinger, M.H.; Griggs, J.R.; Apt, Kenneth E.; Doyle, J.E.

    2001-01-01

    Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, the US Department of Energy (DOE) has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US government agencies to identify appropriate non-sensitive, non-nuclear areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national and international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes the approach for this engagement, the Indian scientific organization and infrastructure, potential areas for collaboration, and current status of the initiative.

  1. Business networking for SMEs as a means to promote regional competitiveness: A Theoretical Framework

    OpenAIRE

    Vitor Braga

    2004-01-01

    The competitiveness of regions, as a means of promoting the competitiveness of a country as a whole, has been one of the main topics on the agenda of policy makers over the last decades. Several attempts at promoting competitiveness have been made with different degrees of success. In most cases, public investment in the regions was perceived as the solution to promote regional competitiveness and top-down policies were implemented. However, competitiveness also has an important dimension tha...

  2. Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration

    Science.gov (United States)

    Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

    2015-01-01

    Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832

  3. Constructing a State Policy To Promote Regionalism in School Government.

    Science.gov (United States)

    Zukowsky, Jerome; And Others.

    This paper defines regionalism, sets some tentative directions for the concept, and raises difficult questions related to its application in New York State. Regionalism, which offers an alternative to a State-local school governing system, is used to decentralize the planning and management of public services. A regional unit permits district…

  4. ECOLOGICAL REGIONALIZATION METHODS OF OIL PRODUCING AREAS

    Directory of Open Access Journals (Sweden)

    Inna Ivanovna Pivovarova

    2017-01-01

    Full Text Available The paper analyses territory zoning methods with varying degrees of anthropogenic pollution risk. The summarized results of spatial analysis of oil pollution of surface water in the most developed oil-producing region of Russia. An example of GIS-zoning according to the degree of environmental hazard is presented. All possible algorithms of cluster analysis are considered for isolation of homogeneous data structures. The conclusion is made on the benefits of using combined methods of analysis for assessing the homogeneity of specific environmental characteristics in selected territories.

  5. DNA methylation of PTEN gene promoter region is not correlated ...

    African Journals Online (AJOL)

    Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...

  6. Assessing the effects of data selection and representation on the development of reliable E. coli sigma 70 promoter region predictors.

    Directory of Open Access Journals (Sweden)

    Mostafa M Abbas

    Full Text Available As the number of sequenced bacterial genomes increases, the need for rapid and reliable tools for the annotation of functional elements (e.g., transcriptional regulatory elements becomes more desirable. Promoters are the key regulatory elements, which recruit the transcriptional machinery through binding to a variety of regulatory proteins (known as sigma factors. The identification of the promoter regions is very challenging because these regions do not adhere to specific sequence patterns or motifs and are difficult to determine experimentally. Machine learning represents a promising and cost-effective approach for computational identification of prokaryotic promoter regions. However, the quality of the predictors depends on several factors including: i training data; ii data representation; iii classification algorithms; iv evaluation procedures. In this work, we create several variants of E. coli promoter data sets and utilize them to experimentally examine the effect of these factors on the predictive performance of E. coli σ70 promoter models. Our results suggest that under some combinations of the first three criteria, a prediction model might perform very well on cross-validation experiments while its performance on independent test data is drastically very poor. This emphasizes the importance of evaluating promoter region predictors using independent test data, which corrects for the over-optimistic performance that might be estimated using the cross-validation procedure. Our analysis of the tested models shows that good prediction models often perform well despite how the non-promoter data was obtained. On the other hand, poor prediction models seems to be more sensitive to the choice of non-promoter sequences. Interestingly, the best performing sequence-based classifiers outperform the best performing structure-based classifiers on both cross-validation and independent test performance evaluation experiments. Finally, we propose a

  7. A rapid detection method for PAI-1 promoter insertion/deletion polymorphism (4G/5G

    Directory of Open Access Journals (Sweden)

    Annichino-Bizzacchi Joyce M.

    1998-01-01

    Full Text Available Plasminogen activator inhibitor-1 (PAI-1 is an important inhibitor of fibrinolysis, and increased levels of PAI-1 are associated with atheroma and myocardial infarction. A common 4G/5G insertion/deletion polymorphism located in the promoter region of PAI-1 gene has been described associated with PAI-1 activity in plasma levels. Genotyping of this polymorphism is commonly conducted with an allele-specific oligonucleotide melting technique. In the present study, we describe a quick, easy method for genotyping 4G/5G polymorphism in the promoter region of the PAI-1 gene.

  8. Promoting regional energy co-operation in South Asia

    International Nuclear Information System (INIS)

    Srivastava, Leena; Misra, Neha

    2007-01-01

    Energy is a key ingredient of the socio-economic development of any region. South Asia is not only one of the fastest growing regions in the world; it is also one of the poorest, which thus puts energy at the very heart of the development process in the region. This paper looks at the challenges faced by the South Asia sub-region for economic co-operation (SASEC) comprised of Bangladesh, Bhutan, India and Nepal, and also at the role of greater regional energy co-operation therein. The region is characterized by pressures of growing economies and increasing population. While the per capita energy consumption is one of the lowest in the world, energy intensity continues to be very high. A large portion of the population lacks access to modern sources of energy and depends on traditional sources that are not only inefficient but also have severe health and environmental problems associated with them. Increasing oil import dependency and huge investment needs for energy market development pose a further challenge. The region has a good resource potential and tremendous scope for energy co-operation, which can play a key role in addressing many of these energy security concerns and in putting it on the path of sustainable development. It is ironic that the record in the area has been so limited and that too in the most basic form of co-operation, i.e. bilateral arrangements between countries. This paper puts forth a multi-pronged strategy for sub-regional energy co-operation encompassing softer options aimed at confidence building to more substantial and larger scale co-operation efforts. Delays in decision making to ensure stronger and mutually beneficial co-operation efforts are associated with high costs not only to the energy sector but also for the entire development agenda. With the precarious energy situation in the region and unprecedented increases in international oil prices seen in recent times, it is high time for policy makers, financing institutions, NGOs

  9. The Digital North Denmark Programme -Promoting Regional Change?

    DEFF Research Database (Denmark)

    Østergaard, Christian Richter

    2007-01-01

    The Digital North Denmark (DDN) was an IT programme running from 2000 to 2003 in the North Jutland County in Denmark with national government support of € 23 million. The Danish government initiated the programme with the aim of further strengthening regions with an already proven ICT capability...... (Dybkjær and Lindegaard, 1999, p.96-100). The declared approach was to build on the existing competencies in industry as well as at universities. The national government chose two regions – Ørestaden, a new concentration of knowledge-based institutions near Copenhagen Airport, and North Jutland......-offers within four themes. The participants - meant to be project consortia of ideally private firms, public or private organisations as well as regional and municipal government bodies - could get a maximum national government support of one third of the total project sum.This chapter investigates how...

  10. Study on the binding sites of radiosensitivity associated transcription factor in the promoter region of Ier5 gene

    International Nuclear Information System (INIS)

    Cui Wei; Yin Lingling; Dong Lingyue

    2012-01-01

    Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)

  11. A new polymorphism in goat β-lactoglobulin promoter region

    Directory of Open Access Journals (Sweden)

    Mirella Graziano

    2003-01-01

    Full Text Available An individual variability in β-lactoglobulin content has been previously observed in Girgentana goat milk by HPLC analysis. To identify eventual mutations affecting the transcription level of the gene, the prooter region was characterized in goats showing an anomalous phenotype, consisting in a reduced content of β-lactoglobulin respect to α-lactoalbumine. A single nucleotide substitution not previously reported has been detected. A PCR-RFLP procedure was developed for fast detection of the mutation in different goat breeds: Girgentana, Garganica, Sarda, Alpine, Montefalcone and Saanen. The Montefalcone goat showed the highest frequency of the mutation, confirming one more the peculiarity of this breed.

  12. Graduate Management Project (GMP) Retrospective Analysis of Promotional Mediums for Tricare Prime in Tricare Region 11

    National Research Council Canada - National Science Library

    Carpenter, Steven

    1997-01-01

    This study provides retrospective market research information about the population who enrolled in TRICARE Prime in TRICARE Region 11 and the advertising mediums used to promote enrollment in the TRICARE Prime program...

  13. Plant growth promoters and methods of using them

    KAUST Repository

    Al-Babili, Salim

    2017-01-05

    New plant growth regulators, including compounds and compositions, and methods of use including for promoting root growth. The compounds are carotenoid oxidation products, and a preferred example is 3-OH--β-apo-13-Carotenone. A method comprising promoting the growth of at least one plant with use of an effective amount of at least one composition comprising an effective amount of at least one compound which is represented by A-B-C, wherein B is a bivalent polyene moiety, A is a monovalent moiety linked to B by a six-membered carbon ring, wherein the ring has at least one substituent linked to the ring by an oxygen atom, and C is a monovalent moiety linked to B by a carbonyl group. Synergistic effects can be used with combinations of compounds.

  14. Active sales promotion in urban regions; Aktive Verkaufsfoerderung in Verdichtungsgebieten

    Energy Technology Data Exchange (ETDEWEB)

    Becker, H.D. [Oeffentlichkeitsarbeit, Maingas AG, Frankfurt am Main (Germany)

    1995-03-01

    The first step in any worthwhile marketing strategy for urban regions is to make a survey of all real estates without a gas supply. The data stock thus obtained serves as a short, medium, and long-term basis for all further activity. It cal be used to set up yearly personnel and activity plans. The activities are rounded off by incentives in the form of conversion aids or financing offers and additional measures presented within a Full Service Package Defining clear aims makes it easier to evaluate the success of the activities. (orig.) [Deutsch] Der erste Schritt zu einer erfolgreichen Marktbearbeitung in Verdichtungsgebieten ist die Erhebung aller Liegenschaften ohne Gasversorgung. Der gewonnene Datenbestand dient kurz-, mittel- und langfristig als Grundlage aller Aktivitaeten. Eine Personal- und Aktivitaetenplanung kann jaehrlich daraus abgeleitet werden. Kaufanreize in Form von Umstellhilfen, Finanzierungsangeboten und zusaetzlichen Dienstleistungen im Rahmen eines Full-Service-Angebotes runden die Aktivitaeten ab. Die klare Vorgabe von Zielen erleichert die Erfolgskontrolle. (orig.)

  15. Material and method for promoting the growth of anaerobic bacteria

    Science.gov (United States)

    Adler, Howard I.

    1984-01-01

    A material and method for promoting the growth of anaerobic bacteria which includes a nutrient media containing a hydrogen donor and sterile membrane fragments of bacteria having an electron transfer system which reduces oxygen to water. Dissolved oxygen in the medium is removed by adding the sterile membrane fragments to the nutrient medium and holding the medium at a temperature of about 10.degree. to about 60.degree. C. until the dissolved oxygen is removed.

  16. Genome-wide analysis of regions similar to promoters of histone genes

    KAUST Repository

    Chowdhary, Rajesh

    2010-05-28

    Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that

  17. How to promote the regional cooperation in Asia

    Energy Technology Data Exchange (ETDEWEB)

    Nakano, Masayuki [International Affairs and Safeguards Division, Atomic Energy Bureau, Science and Technology Agency, Tokyo (Japan)

    2000-12-01

    The Tenth International Conference for Nuclear Cooperation in Asia was held in Tokyo on March 10, 1999. Representatives participated from Australia, China, Indonesia, Japan, Korea, Malaysia, the Philippines, Thailand, and Vietnam as well as IAEA as an observer. The countries reflected on the positive achievements of the past ten years and affirmed the major goals for the future, the major theme of the meeting being the evolution of the framework. Some typical cooperative activities have result in: (a) new varieties of plants with greater productivity under a range of environmental conditions (b) development and adoptions of improved analytical procedures to track air pollution in major cities where the identification of the major sources will facilitate remediation measures (c) coordinated trials for radiation therapy of cervical cancer and the development of rigorous protocols (d) training of staff in research reactor operation and in the use of research reactors for the study of new materials. The participating countries have committed to reviewing the six existing sub-categories, namely (1) utilization of research reactors, (2,3) application of radiation and radioisotope in the agriculture and the medical fields, (4) public acceptance of nuclear energy, (5) radioactive waste management, and (6) nuclear safety culture. To share knowledge on human resources development within the region and to consider measures for the further development of human resources in relevant fields, a seminar for human resources development, sponsored by Japan, will be held in Japan. The conference will be renamed as (Forum for Nuclear Cooperation in Asia) beginning with the next conference. The Forum for Nuclear Cooperation in Asia will be held in Japan and in a participating country other than Japan in alternating years. To enhance the regional nuclear cooperation activities under this framework, each participating country will register a Coordinator and Project Leaders to facilitate

  18. How to promote the regional cooperation in Asia

    International Nuclear Information System (INIS)

    Nakano, Masayuki

    2000-01-01

    The Tenth International Conference for Nuclear Cooperation in Asia was held in Tokyo on March 10, 1999. Representatives participated from Australia, China, Indonesia, Japan, Korea, Malaysia, the Philippines, Thailand, and Vietnam as well as IAEA as an observer. The countries reflected on the positive achievements of the past ten years and affirmed the major goals for the future, the major theme of the meeting being the evolution of the framework. Some typical cooperative activities have result in: (a) new varieties of plants with greater productivity under a range of environmental conditions (b) development and adoptions of improved analytical procedures to track air pollution in major cities where the identification of the major sources will facilitate remediation measures (c) coordinated trials for radiation therapy of cervical cancer and the development of rigorous protocols (d) training of staff in research reactor operation and in the use of research reactors for the study of new materials. The participating countries have committed to reviewing the six existing sub-categories, namely (1) utilization of research reactors, (2,3) application of radiation and radioisotope in the agriculture and the medical fields, (4) public acceptance of nuclear energy, (5) radioactive waste management, and (6) nuclear safety culture. To share knowledge on human resources development within the region and to consider measures for the further development of human resources in relevant fields, a seminar for human resources development, sponsored by Japan, will be held in Japan. The conference will be renamed as (Forum for Nuclear Cooperation in Asia) beginning with the next conference. The Forum for Nuclear Cooperation in Asia will be held in Japan and in a participating country other than Japan in alternating years. To enhance the regional nuclear cooperation activities under this framework, each participating country will register a Coordinator and Project Leaders to facilitate

  19. Regional differences in gender promotion and scholarly productivity in otolaryngology.

    Science.gov (United States)

    Eloy, Jean Anderson; Mady, Leila J; Svider, Peter F; Mauro, Kevin M; Kalyoussef, Evelyne; Setzen, Michael; Baredes, Soly; Chandrasekhar, Sujana S

    2014-03-01

    To identify whether regional differences exist in gender disparities in scholarly productivity and faculty rank among academic otolaryngologists. Academic otolaryngologists' bibliometric data analyses. Online faculty listings from 98 otolaryngology departments were organized by gender, academic rank, fellowship training status, and institutional location. The Scopus database was used to assess bibliometrics of these otolaryngologists, including the h-index, number of publications, and publication experience. Analysis included 1127 otolaryngologists, 916 men (81.3%) and 211 women (18.7%). Female faculty comprised 15.4% in the Midwest, 18.8% in the Northeast, 21.3% in the South, and 19.0% in the West (P = .44). Overall, men obtained significantly higher senior academic ranks (associate professor or professor) compared to women (59.8% vs. 40.2%, P .05). Gender disparities in academic rank and scholarly productivity exist most notably in the Northeast, where women in otolaryngology are most underrepresented relative to men at senior academic ranks and in scholarly productivity.

  20. Seismic data restoration with a fast L1 norm trust region method

    International Nuclear Information System (INIS)

    Cao, Jingjie; Wang, Yanfei

    2014-01-01

    Seismic data restoration is a major strategy to provide reliable wavefield when field data dissatisfy the Shannon sampling theorem. Recovery by sparsity-promoting inversion often get sparse solutions of seismic data in a transformed domains, however, most methods for sparsity-promoting inversion are line-searching methods which are efficient but are inclined to obtain local solutions. Using trust region method which can provide globally convergent solutions is a good choice to overcome this shortcoming. A trust region method for sparse inversion has been proposed, however, the efficiency should be improved to suitable for large-scale computation. In this paper, a new L 1 norm trust region model is proposed for seismic data restoration and a robust gradient projection method for solving the sub-problem is utilized. Numerical results of synthetic and field data demonstrate that the proposed trust region method can get excellent computation speed and is a viable alternative for large-scale computation. (paper)

  1. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)

    2006-03-31

    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

  2. Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.

    Directory of Open Access Journals (Sweden)

    Carlos Guerrero-Bosagna

    2010-09-01

    Full Text Available Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a was found to be due to a copy number variation (CNV and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.

  3. Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.

    Science.gov (United States)

    Guerrero-Bosagna, Carlos; Settles, Matthew; Lucker, Ben; Skinner, Michael K

    2010-09-30

    Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip) procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif) that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a) was found to be due to a copy number variation (CNV) and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.

  4. Identification of functional DNA variants in the constitutive promoter region of MDM2

    Directory of Open Access Journals (Sweden)

    Lalonde Marie-Eve

    2012-09-01

    Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.

  5. Unicriterion Model: A Qualitative Decision Making Method That Promotes Ethics

    Directory of Open Access Journals (Sweden)

    Fernando Guilherme Silvano Lobo Pimentel

    2011-06-01

    Full Text Available Management decision making methods frequently adopt quantitativemodels of several criteria that bypass the question of whysome criteria are considered more important than others, whichmakes more difficult the task of delivering a transparent viewof preference structure priorities that might promote ethics andlearning and serve as a basis for future decisions. To tackle thisparticular shortcoming of usual methods, an alternative qualitativemethodology of aggregating preferences based on the rankingof criteria is proposed. Such an approach delivers a simpleand transparent model for the solution of each preference conflictfaced during the management decision making process. Themethod proceeds by breaking the decision problem into ‘two criteria– two alternatives’ scenarios, and translating the problem ofchoice between alternatives to a problem of choice between criteriawhenever appropriate. The unicriterion model method is illustratedby its application in a car purchase and a house purchasedecision problem.

  6. Method for Selection of Solvents for Promotion of Organic Reactions

    DEFF Research Database (Denmark)

    Gani, Rafiqul; Jiménez-González, Concepción; Constable, David J.C.

    2005-01-01

    is to produce, for a given reaction, a short list of chemicals that could be considered as potential solvents, to evaluate their performance in the reacting system, and, based on this, to rank them according to a scoring system. Several examples of application are given to illustrate the main features and steps......A method to select appropriate green solvents for the promotion of a class of organic reactions has been developed. The method combines knowledge from industrial practice and physical insights with computer-aided property estimation tools for selection/design of solvents. In particular, it employs...... estimates of thermodynamic properties to generate a knowledge base of reaction, solvent and environment related properties that directly or indirectly influence the rate and/or conversion of a given reaction. Solvents are selected using a rules-based procedure where the estimated reaction-solvent properties...

  7. Growing Significance of EU Institutions in Promotion of Inter-regional policies

    Directory of Open Access Journals (Sweden)

    Ella V. Ermakova

    2014-01-01

    Full Text Available The article explores the variety of tools and vehicles applied within the EU to expand the prerogative of the regions of the EU member states. The author uses as an example the inter-regional policies in Belgium in respect of the Flemish Region and the Walloon Region. The author analyzes the mechanisms of promotion of external regional relations in Belgium as a means of addressing different problems both on national and all-European level, supporting the arguments and conclusions by examples of relevant EU initiatives. The article details the activities of the EU Regional Committee (RC, the EU advisory body with the powers of political initiative, upholding the principle ofsubsidarity in the implementation of the EU member states' regional policies. The involvement of the Flemish Region and the Walloon Region in the activities of EU RC is described and summarized. As a case study, the article deals with Belgium's rotating six months presidency in the EUin 2010 when the country, which was going through a severe political crisis with no federal government in place, was represented by the two regions. The special focus of the article is on the strategic EU program "Europe2020" and its implementation by the regions of Belgium. There is an account of the initiatives undertaken by the Flemish Region and the Walloon Region within the framework of this program outlining the interaction of the two regions. The author provides a comprehensive analysis of the involvement of the Flemish Region and the Walloon Region with various EU institutions describing how each party achieves the promotion of its regional interests. Within this context, it is a noteworthy development that the Flemish Region is participating in the international program "Pact 2020" on energy all by its own. The article features quotations by Flemish and Walloon political figures which serve as an illustration of the prevailing attitudes in the Belgian society to the process of

  8. Does FDI promote regional development? Evidence from local and regional productivity spillovers in Greece

    Directory of Open Access Journals (Sweden)

    Vassilis MONASTIRIOTIS

    2010-12-01

    Full Text Available Studies on the productivity spillovers of FDI have concentrated on the nationalsectoral level. As a result, little is known about the impact of FDI on absolute and relative regional economic performance. In this paper we examine this issue by relying on a unique dataset of over 20,000 Greek firms for the period 2002-2006 covering all sectors of economic activity. We examine the spatial distribution of foreign-owned firms in the country and analyse the effect that their presence – at the local, regional and national levels – has on the productivity of domestic firms. We find strong evidence suggesting that foreignowned firms self-select into regions and sectors of high productivity. Net of this selection effect, the impact of foreign presence on domestic productivity is negative – although at the very local level some positive spillover effects are identifiable. The bulk of the effects concentrate in non-manufacturing activities, high-tech sectors, and medium-sized high-productivity firms. Importantly, this effect is not constant across space however. Productivity spillovers tend to be negative in the regions hosting the main urban areas in the country but positive in smaller and more peripheral regions. In this way, despite the tendency of FDI to concentrate in a limited number of areas within the country – those of the highest level of development – the externalities that FDI activity generates to the local economies appear to be of a rather equilibrating character.

  9. A prospective evaluation of first people’s health promotion program design in the goulburn-murray rivers region

    Directory of Open Access Journals (Sweden)

    Joyce Doyle

    2016-11-01

    Full Text Available Abstract Background Aboriginal Community Controlled Organisations (ACCOs provide community-focussed and culturally safe services for First Peoples in Australia, including crisis intervention and health promotion activities, in a holistic manner. The ecological model of health promotion goes some way towards describing the complexity of such health programs. The aims of this project were to: 1 identify the aims and purpose of existing health promotion programs conducted by an alliance of ACCOs in northern Victoria, Australia; and 2 evaluate the extent to which these programs are consistent with an ecological model of health promotion, addressing both individual and environmental determinants of health. Methods The project arose from a long history of collaborative research. Three ACCOs and a university formed the Health Promotion Alliance to evaluate their health promotion programs. Local community members were trained in, and contributed to developing culturally sensitive methods for, data collection. Information on the aims and design of 88 health promotion activities making up 12 different programs across the ACCOs was systematically and prospectively collected. Results There was a wide range of activities addressing environmental and social determinants of health, as well as physical activity, nutrition and weight loss. The design of the great majority of activities had a minimal Western influence and were designed within a local Aboriginal cultural framework. The most common focus of the activities was social connectedness (76 %. Physical activity was represented in two thirds of the activities, and nutrition, weight loss and culture were each a focus of about half of the activities. A modified coding procedure designed to assess the ecological nature of these programs showed that they recruited from multiple settings; targeted a range of individual, social and environmental determinants; and used numerous and innovative strategies to

  10. Role of regional policies in promoting networking and innovation activity of firms

    OpenAIRE

    Kirsi Mukkala; Jari Ritsilä

    2004-01-01

    The success of firms and regions is increasingly defined by their innovation and learning capabilities. It has been emphasized in several studies that a local operational environment may have a positive impact on innovation activity of firms. From policy point of view, the relationship between firms and their local environment is an important research topic. The purpose of this paper is to explore whether there is a demand for regional policy makers in promoting innovative and networking acti...

  11. Characterization of the promoter region of the human c-erbB-2 protooncogene

    International Nuclear Information System (INIS)

    Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.

    1987-01-01

    Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors

  12. Method for using a yeast alpha-amylase promoter

    Science.gov (United States)

    Gao, Johnway; Skeen, Rodney S.; Hooker, Brian S.; Anderson, Daniel B.

    2003-04-22

    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  13. Development of a general method for detection and quantification of the P35S promoter based on assessment of existing methods

    Science.gov (United States)

    Wu, Yuhua; Wang, Yulei; Li, Jun; Li, Wei; Zhang, Li; Li, Yunjing; Li, Xiaofei; Li, Jun; Zhu, Li; Wu, Gang

    2014-01-01

    The Cauliflower mosaic virus (CaMV) 35S promoter (P35S) is a commonly used target for detection of genetically modified organisms (GMOs). There are currently 24 reported detection methods, targeting different regions of the P35S promoter. Initial assessment revealed that due to the absence of primer binding sites in the P35S sequence, 19 of the 24 reported methods failed to detect P35S in MON88913 cotton, and the other two methods could only be applied to certain GMOs. The rest three reported methods were not suitable for measurement of P35S in some testing events, because SNPs in binding sites of the primer/probe would result in abnormal amplification plots and poor linear regression parameters. In this study, we discovered a conserved region in the P35S sequence through sequencing of P35S promoters from multiple transgenic events, and developed new qualitative and quantitative detection systems targeting this conserved region. The qualitative PCR could detect the P35S promoter in 23 unique GMO events with high specificity and sensitivity. The quantitative method was suitable for measurement of P35S promoter, exhibiting good agreement between the amount of template and Ct values for each testing event. This study provides a general P35S screening method, with greater coverage than existing methods. PMID:25483893

  14. Targets of DNA-binding proteins in bacterial promoter regions present enhanced probabilities for spontaneous thermal openings

    International Nuclear Information System (INIS)

    Apostolaki, Angeliki; Kalosakas, George

    2011-01-01

    We mapped promoter regions of double-stranded DNA with respect to the probabilities of appearance of relatively large bubble openings exclusively due to thermal fluctuations at physiological temperatures. We analyzed five well-studied promoter regions of procaryotic type and found a spatial correlation between the binding sites of transcription factors and the position of peaks in the probability pattern of large thermal openings. Other distinct peaks of the calculated patterns correlate with potential binding sites of DNA-binding proteins. These results suggest that a DNA molecule would more frequently expose the bases that participate in contacts with proteins, which would probably enhance the probability of the latter to reach their targets. It also stands for using this method as a means to analyze DNA sequences based on their intrinsic thermal properties

  15. A study of the frequency of methylation of gene promoter regions in ...

    Indian Academy of Sciences (India)

    2013-04-02

    Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.

  16. Cytosine deletion at AP2-box region of HSP70 promoter and its ...

    Indian Academy of Sciences (India)

    Cytosine deletion at AP2-box region of HSP70 promoter and its influence on semen quality traits in crossbred bulls ... Laboratory, ICAR-Central Institute for Research on Cattle, Meerut 250 001, India; School of Atmospheric Stress Management, ICAR-National Institute of Abiotic Stress Management, Baramati 413 115, India ...

  17. Identification and characterization of a liver stage-specific promoter region of the malaria parasite Plasmodium.

    Directory of Open Access Journals (Sweden)

    Susanne Helm

    Full Text Available During the blood meal of a Plasmodium-infected mosquito, 10 to 100 parasites are inoculated into the skin and a proportion of these migrate via the bloodstream to the liver where they infect hepatocytes. The Plasmodium liver stage, despite its clinical silence, represents a highly promising target for antimalarial drug and vaccine approaches. Successfully invaded parasites undergo a massive proliferation in hepatocytes, producing thousands of merozoites that are transported into a blood vessel to infect red blood cells. To successfully develop from the liver stage into infective merozoites, a tight regulation of gene expression is needed. Although this is a very interesting aspect in the biology of Plasmodium, little is known about gene regulation in Plasmodium parasites in general and in the liver stage in particular. We have functionally analyzed a novel promoter region of the rodent parasite Plasmodium berghei that is exclusively active during the liver stage of the parasite. To prove stage-specific activity of the promoter, GFP and luciferase reporter assays have been successfully established, allowing both qualitative and accurate quantitative analysis. To further characterize the promoter region, the transcription start site was mapped by rapid amplification of cDNA ends (5'-RACE. Using promoter truncation experiments and site-directed mutagenesis within potential transcription factor binding sites, we suggest that the minimal promoter contains more than one binding site for the recently identified parasite-specific ApiAP2 transcription factors. The identification of a liver stage-specific promoter in P. berghei confirms that the parasite is able to tightly regulate gene expression during its life cycle. The identified promoter region might now be used to study the biology of the Plasmodium liver stage, which has thus far proven problematic on a molecular level. Stage-specific expression of dominant-negative mutant proteins and

  18. Human body region enhancement method based on Kinect infrared imaging

    Science.gov (United States)

    Yang, Lei; Fan, Yubo; Song, Xiaowei; Cai, Wenjing

    2016-10-01

    To effectively improve the low contrast of human body region in the infrared images, a combing method of several enhancement methods is utilized to enhance the human body region. Firstly, for the infrared images acquired by Kinect, in order to improve the overall contrast of the infrared images, an Optimal Contrast-Tone Mapping (OCTM) method with multi-iterations is applied to balance the contrast of low-luminosity infrared images. Secondly, to enhance the human body region better, a Level Set algorithm is employed to improve the contour edges of human body region. Finally, to further improve the human body region in infrared images, Laplacian Pyramid decomposition is adopted to enhance the contour-improved human body region. Meanwhile, the background area without human body region is processed by bilateral filtering to improve the overall effect. With theoretical analysis and experimental verification, the results show that the proposed method could effectively enhance the human body region of such infrared images.

  19. The system of Regional Contact Offices for promoting GMES services and the use of Space Technologies in European Regions.

    Science.gov (United States)

    Carrara, Paola; Antoninetti, Massimo; Bacai, Hina; Basoni, Anna; Bosc, Christelle; Clave, Magali; Cornacchia, Carmela; L'Astorina, Alba; Monbet, Philippe; Mueller, Bastian; Nicolau, Sonia; Pergola, Nicola; Rampini, Anna; Tramutoli, Valerio; Schumacher, Volker; Wells, Alan; Zepeda Juarez, Jesus; Zolotikova, Svetlana

    2013-04-01

    which have significant impact on the economy, environment and the quality of life of the citizens To this aim since 2011 the system of Regional Contact Offices (RCOs) was promoted by the EU FP7 DORIS_Net (Downsteam Observatory organized by Regions Active in Space - Network, http://www.doris-net.eu/) project as the regional link to the services provided by the European GMES programme. Since then a first nucleus of 12 pilot European Regions were working together establishing 6 first RCOs around Europe. This paper will present RCOs network goals, achievements and perspectives as well as its planned actions devoted to improve quality of Space Technology products from one side, to promote awareness and use of them by potential end-users (and particularly LRAs), from the other side.

  20. A prospective evaluation of first people's health promotion program design in the goulburn-murray rivers region.

    Science.gov (United States)

    Doyle, Joyce; Atkinson-Briggs, Sharon; Atkinson, Petah; Firebrace, Bradley; Calleja, Julie; Reilly, Rachel; Cargo, Margaret; Riley, Therese; Crumpen, Tui; Rowley, Kevin

    2016-11-10

    Aboriginal Community Controlled Organisations (ACCOs) provide community-focussed and culturally safe services for First Peoples in Australia, including crisis intervention and health promotion activities, in a holistic manner. The ecological model of health promotion goes some way towards describing the complexity of such health programs. The aims of this project were to: 1) identify the aims and purpose of existing health promotion programs conducted by an alliance of ACCOs in northern Victoria, Australia; and 2) evaluate the extent to which these programs are consistent with an ecological model of health promotion, addressing both individual and environmental determinants of health. The project arose from a long history of collaborative research. Three ACCOs and a university formed the Health Promotion Alliance to evaluate their health promotion programs. Local community members were trained in, and contributed to developing culturally sensitive methods for, data collection. Information on the aims and design of 88 health promotion activities making up 12 different programs across the ACCOs was systematically and prospectively collected. There was a wide range of activities addressing environmental and social determinants of health, as well as physical activity, nutrition and weight loss. The design of the great majority of activities had a minimal Western influence and were designed within a local Aboriginal cultural framework. The most common focus of the activities was social connectedness (76 %). Physical activity was represented in two thirds of the activities, and nutrition, weight loss and culture were each a focus of about half of the activities. A modified coding procedure designed to assess the ecological nature of these programs showed that they recruited from multiple settings; targeted a range of individual, social and environmental determinants; and used numerous and innovative strategies to achieve change. First Peoples' health promotion in the

  1. DNA Methylation Analysis of BRD1 Promoter Regions and the Schizophrenia rs138880 Risk Allele.

    Directory of Open Access Journals (Sweden)

    Mads Dyrvig

    Full Text Available The bromodomain containing 1 gene, BRD1 is essential for embryogenesis and CNS development. It encodes a protein that participates in histone modifying complexes and thereby regulates the expression of a large number of genes. Genetic variants in the BRD1 locus show association with schizophrenia and bipolar disorder and risk alleles in the promoter region correlate with reduced BRD1 expression. Insights into the transcriptional regulation of BRD1 and the pathogenic mechanisms associated with BRD1 risk variants, however, remain sparse. By studying transcripts in human HeLa and SH-SY5Y cells we provide evidence for differences in relative expression of BRD1 transcripts with three alternative 5' UTRs (exon 1C, 1B, and 1A. We further show that expression of these transcript variants covaries negatively with DNA methylation proportions in their upstream promoter regions suggesting that promoter usage might be regulated by DNA methylation. In line with findings that the risk allele of the rs138880 SNP in the BRD1 promoter region correlates with reduced BRD1 expression, we find that it is also associated with moderate regional BRD1 promoter hypermethylation in both adipose tissue and blood. Importantly, we demonstrate by inspecting available DNA methylation and expression data that these regions undergo changes in methylation during fetal brain development and that differences in their methylation proportions in fetal compared to postnatal frontal cortex correlate significantly with BRD1 expression. These findings suggest that BRD1 may be dysregulated in both the developing and mature brain of risk allele carriers. Finally, we demonstrate that commonly used mood stabilizers Lithium, Valproate, and Carbamazepine affect the expression of BRD1 in SH-SY5Y cells. Altogether this study indicates a link between genetic risk and epigenetic dysregulation of BRD1 which raises interesting perspectives for targeting the mechanisms pharmacologically.

  2. Tumour MLH1 promoter region methylation testing is an effective pre-screen for Lynch Syndrome (HNPCC)

    Science.gov (United States)

    Newton, K; Jorgensen, NM; Wallace, AJ; Buchanan, DD; Lalloo, F; McMahon, RFT; Hill, J; Evans, DG

    2016-01-01

    Background & Aims Lynch syndrome patients have DNA mismatch repair deficiency and up to 80% life-time risk of colorectal cancer. Screening of mutation carriers reduces colorectal cancer incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from Lynch Syndrome (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Methods Tumour DNA was extracted (FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Findings Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2–98.4%), specificity 87.7% (95% CI 77.9–94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7–76.5%), specificity 98.6% (95% CI 92.4–100.0%) for the identification of those with pathogenic MLH1 mutations. Conclusions Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. PMID:25280751

  3. Hypermethylation of the DPYD promoter region is not a major predictor of severe toxicity in 5-fluorouracil based chemotherapy

    Directory of Open Access Journals (Sweden)

    Aebi Stefan

    2008-10-01

    Full Text Available Abstract Background The activity of dihydropyrimidine dehydrogenase (DPD, the key enzyme of pyrimidine catabolism, is thought to be an important determinant for the occurrence of severe toxic reactions to 5-fluorouracil (5-FU, which is one of the most commonly prescribed chemotherapeutic agents for the treatment of solid cancers. Genetic variation in the DPD gene (DPYD has been proposed as a main factor for variation in DPD activity in the population. However, only a small proportion of severe toxicities in 5-FU based chemotherapy can be explained with such rare deleterious DPYD mutations resulting in severe enzyme deficiencies. Recently, hypermethylation of the DPYD promoter region has been proposed as an alternative mechanism for DPD deficiency and thus as a major cause of severe 5-FU toxicity. Methods Here, the prognostic significance of this epigenetic marker with respect to severe 5-FU toxicity was assessed in 27 cancer patients receiving 5-FU based chemotherapy, including 17 patients experiencing severe toxic side effects following drug administration, none of which were carriers of a known deleterious DPYD mutation, and ten control patients. The methylation status of the DPYD promoter region in peripheral blood mononuclear cells was evaluated by analysing for each patient between 19 and 30 different clones of a PCR-amplified 209 base pair fragment of the bisulfite-modified DPYD promoter region. The fragments were sequenced to detect bisulfite-induced, methylation-dependent sequence differences. Results No evidence of DPYD promoter methylation was observed in any of the investigated patient samples, whereas in a control experiment, as little as 10% methylated genomic DNA could be detected. Conclusion Our results indicate that DYPD promoter hypermethylation is not of major importance as a prognostic factor for severe toxicity in 5-FU based chemotherapy.

  4. Methods for regional assessment of geothermal resources

    Science.gov (United States)

    Muffler, P.; Cataldi, R.

    1978-01-01

    A consistent, agreed-upon terminology is prerequisite for geothermal resource assessment. Accordingly, we propose a logical, sequential subdivision of the "geothermal resource base", accepting its definition as all the thermal energy in the earth's crust under a given area, measured from mean annual temperature. That part of the resource base which is shallow enough to be tapped by production drilling is termed the "accessible resource base", and it in turn is divided into "useful" and "residual" components. The useful component (i.e. the thermal energy that could reasonably be extracted at costs competitive with other forms of energy at some specified future time) is termed the "geothermal resource". This in turn is divided into "economic" and "subeconomic" components, based on conditions existing at the time of assessment. In the format of a McKelvey diagram, this logic defines the vertical axis (degree of economic feasibility). The horizontal axis (degree of geologic assurance) contains "identified" and "undiscovered" components. "Reserve" is then designated as the identified economic resource. All categories should be expressed in units of thermal energy, with resource and reserve figures calculated at wellhead, prior to the inevitable large losses inherent in any practical thermal use or in conversion to electricity. Methods for assessing geothermal resources can be grouped into 4 classes: (a) surface thermal flux, (b) volume, (c) planar fracture and (d) magmatic heat budget. The volume method appears to be most useful because (1) it is applicable to virtually any geologic environment, (2) the required parameters can in Sprinciple be measured or estimated, (3) the inevitable errors are in part compensated and (4) the major uncertainties (recoverability and resupply) are amenable to resolution in the foreseeable future. The major weakness in all the methods rests in the estimation of how much of the accessible resource base can be extracted at some time in the

  5. Regional Cooperation Efforts in the Mekong River Basin: Mitigating river-related security threats and promoting regional development

    Directory of Open Access Journals (Sweden)

    Susanne Schmeier

    2009-01-01

    Full Text Available The development of international rivers is often perceived as leading to conflicts or even water wars. However, as the development of the Mekong River shows, cooperation has not only prevailed in the last decades, but River Basin Organizations (RBOs, established to mitigate river-related conflicts and/or develop the river basin, have also contributed to the emergence of more general cooperation structures, mainly by creating spill-over effects in other issue-areas, bringing cooperation to policy fields beyond the river itself. This article assesses the contribution of the Mekong River Commission (MRC and the Greater Mekong Sub-Region (GMS to the sustainable development of the Mekong Region as well as to the promotion of regional cooperation in mainland South-East Asia in general. --- Die Entwicklung grenzüberschreitender Flüsse wird oft mit Konflikten oder gar Kriegen um Wasser assoziiert. Wie jedoch die Entwicklung im Mekong-Becken zeigt, waren die vergangenen Jahrzehnte nicht nur von Kooperation gezeichnet, sondern Flussbeckenorganisationen konnten außerdem dazu beitragen, weitreichendere Kooperationsstrukturen zu entwickeln, die sich auf andere Politikfelder ausdehnen. Dieser Artikel beschäftigt sich mit dem Beitrag der Mekong River Commission (MRC und der Greater Mekong Sub-Region (GMS zur nachhaltigen Entwicklung in der Mekong Region sowie zur Förderung allgemeiner regionaler Kooperation im Festländischen Südostasien.

  6. Regional differences in gene expression and promoter usage in aged human brains

    KAUST Repository

    Pardo, Luba M.

    2013-02-19

    To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.

  7. Implementation of Mamdani Fuzzy Method in Employee Promotion System

    Science.gov (United States)

    Zulfikar, W. B.; Jumadi; Prasetyo, P. K.; Ramdhani, M. A.

    2018-01-01

    Nowadays, employees are big assets to an institution. Every employee has a different educational background, degree, work skill, attitude and ethic that affect the performance. An institution including government institution implements a promotion system in order to improve the performance of the employees. Pangandaran Tourism, Industry, Trade, and SME Department is one of government agency that implements a promotion system to discover employees who deserve to get promotion. However, there are some practical deficiencies in the promotion system, one of which is the subjectivity issue. This work proposed a classification model that could minimize the subjectivity issue in employee promotion system. This paper reported a classification employee based on their eligibility for promotion. The degree of membership was decided using Mamdani Fuzzy based on determinant factors of the performance of employees. In the evaluation phase, this model had an accuracy of 91.4%. It goes to show that this model may minimize the subjectivity issue in the promotion system, especially at Pangandaran Tourism, Industry, Trade, and SME Department.

  8. Tumour MLH1 promoter region methylation testing is an effective prescreen for Lynch Syndrome (HNPCC).

    Science.gov (United States)

    Newton, K; Jorgensen, N M; Wallace, A J; Buchanan, D D; Lalloo, F; McMahon, R F T; Hill, J; Evans, D G

    2014-12-01

    Lynch syndrome (LS) patients have DNA mismatch repair deficiency and up to 80% lifetime risk of colorectal cancer (CRC). Screening of mutation carriers reduces CRC incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour-derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from LS (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Tumour DNA was extracted (formalin fixed, paraffin embedded, FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2% to 98.4%), specificity 87.7% (95% CI 77.9% to 94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7% to 76.5%), specificity 98.6% (95% CI 92.4% to 100.0%) for the identification of those with pathogenic MLH1 mutations. Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  9. Genome-wide function of H2B ubiquitylation in promoter and genic regions.

    Science.gov (United States)

    Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin

    2011-11-01

    Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating).

  10. Discovery and Evaluation of Polymorphisms in the and Promoter Regions for Risk of Korean Lung Cancer

    Directory of Open Access Journals (Sweden)

    Jae Sook Sung

    2012-09-01

    Full Text Available AKT is a signal transduction protein that plays a central role in the tumorigenesis. There are 3 mammalian isoforms of this serine/threonine protein kinase-AKT1, AKT2, and AKT3-showing a broad tissue distribution. We first discovered 2 novel polymorphisms (AKT2 -9826 C/G and AKT3 -811 A/G, and we confirmed 6 known polymorphisms (AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, AKT3 -675 A/-, and AKT3 -244 C/T of the AKT2 and AKT3 promoter region in 24 blood samples of Korean lung cancer patients using direct sequencing. To evaluate the role of AKT2 and AKT3 polymorphisms in the risk of Korean lung cancer, genotypes of the AKT2 and AKT3 polymorphisms (AKT2 -9826 C/G, AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, and AKT3 -675 A/- were determined in 360 lung cancer patients and 360 normal controls. Statistical analyses revealed that the genotypes and haplotypes in the AKT2 and AKT3 promoter regions were not significantly associated with the risk of lung cancer in the Korean population. These results suggest that polymorphisms of the AKT2 and AKT3 promoter regions do not contribute to the genetic susceptibility to lung cancer in the Korean population.

  11. A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Lu Ying

    2004-04-01

    Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the

  12. Governmental promotion of the Information Society in the Spanish Region of Valencia

    Directory of Open Access Journals (Sweden)

    Emilio Feliu-García, Ph.D.

    2011-01-01

    Full Text Available Regional spheres are considered essential in the governmental promotion of the Information Society at the international level. The regional initiatives in Spain aim to strengthen and complement the initiatives promoted at the national level. This article analyses ICT penetration in the Valencian Community from 1996 to 2008. The objective is to identify which of the actions carried out by the Valencian Regional Government have had a positive effect on its society.The methodology employed in this study is benchmarking. The selection of indicators is based on the policies evaluation model proposed in the Plan Avanza (Spain’s national Information Society strategy. Data were collected from official statistical sources (like Spain’s National Statistics Institute, INE. Three statistical tests were applied to verify the hypotheses (Pearson’s r2, Chi-square and Student’s t.The results indicate that it is not possible to affirm that the actions implemented by the Valencian Regional Government have had a more positive effect on its society than those implemented by the Spanish Central Government. A reason for this may lie in the specific objectives of the political strategy implemented by the Valencian Government, which has focused primarily on e-Government and does not include enough projects centred on the implementation of new technologies in the private sector. Moreover, the integration of new technologies in everyday life is placed in a second level of importance despite citizens are central actors in the international agenda.

  13. The promotion of regional integration of electricity markets: Lessons for developing countries

    International Nuclear Information System (INIS)

    Oseni, Musiliu O.; Pollitt, Michael G.

    2016-01-01

    This paper focuses on how to promote regional cooperation in electricity. We begin by discussing the theory of international trade cooperation in electricity, with a view to discussing what preconditions might be important in facilitating wide area trading across national borders. We then develop lessons based on the comparison of four case studies. These include three regional developing country power pools – the Southern African Power pool (SAPP), West African Power pool (WAPP) and the Central American Power Market (MER). We contrast these with Northern Europe's Nord Pool. These cases highlight both the potential and difficulty of having cross-jurisdictional power pools. In the light of the theory and evidence we present, we draw key lessons in the areas of: preconditions for trading; necessary institutional arrangements; practicalities of timetabling; reasons to be hopeful about future prospects. - Highlights: • This paper focuses on how to promote regional electricity cooperation. • We develop lessons based on comparison of four international case studies. • The cases highlight both the potential and difficulty of power pools. • We identify preconditions, institutional arrangements and timetabling. • We conclude that the future prospects for regional power pools are good.

  14. Quantifying Surface Coal-Mining Patterns to Promote Regional Sustainability in Ordos, Inner Mongolia

    Directory of Open Access Journals (Sweden)

    Xiaoji Zeng

    2018-04-01

    Full Text Available Ordos became the new “coal capital” of China within a few decades since the country’s economic reform in 1978, as large-scale surface coal mining dramatically propelled its per capita GDP from being one of the lowest to one of the highest in China, exceeding Hong Kong in 2009. Surface coal-mining areas (SCMAs have continued to expand in this region during recent decades, resulting in serious environmental and socioeconomic consequences. To understand these impacts and promote regional sustainability, quantifying the spatiotemporal patterns of SCMAs is urgently needed. Thus, the main objectives of this study were to quantify the spatiotemporal patterns of SCMAs in the Ordos region from 1990 to 2015, and to examine some of the major environmental and socioeconomic impacts in the study region. We extracted the SCMAs using remote-sensing data, and then quantified their spatiotemporal patterns using landscape metrics. The loss of natural habitat and several socioeconomic indicators were examined in relation to surface coal mining. Our results show that the area of SCMAs increased from 7.12 km2 to 355.95 km2, an increase of nearly 49 times from 1990 to 2015 in the Ordos region. The number of SCMAs in this region increased from 82 to 651, a nearly seven-fold increase. In particular, Zhungeer banner (an administrative division, Yijinhuoluo banner, Dongsheng District and Dalate banner in the north-eastern part of the Ordos region had higher growth rates of SCMAs. The income gap between urban and rural residents increased along with the growth in SCMAs, undermining social equity in the Ordos region. Moreover, the rapid increase in SCMAs resulted in natural habitat loss (including grasslands, forests, and deserts across this region. Thus, we suggest that regional sustainability in Ordos needs to emphasize effective measures to curb large-scale surface coal mining in order to reduce the urban–rural income gap, and to restore degraded natural

  15. Regional allocation of carbon emission quotas in China: Evidence from the Shapley value method

    International Nuclear Information System (INIS)

    Zhang, Yue-Jun; Wang, Ao-Dong; Da, Ya-Bin

    2014-01-01

    It is an important task for China to allocate carbon emission quotas among regions so as to realize its carbon reduction targets and establish the national cap-and-trade carbon market. Meanwhile, it is supposed to be cost-effective to jointly reduce China's carbon emissions through some collaborative activities among regions. Then a natural question is how to allocate the quotas among regions in light of the collaboration. For this purpose, the Shapley value method is adopted and the results show that, first, the regions with higher GDP, higher carbon outflow and higher carbon reduction connection should be allocated more carbon quotas. Moreover, when the collaboration is considered, the optimal allocation of carbon quotas among regions will change significantly compared to the basic quotas by the entropy method; and the Central region is allocated the largest proportion of carbon quota among regions, which indicates its largest radiation effect. Besides, the collaboration between the Central region and Northern coast region, and that between the Central region and the Eastern region should be paid close attention. These results may provide insightful support for decision makers to promote collaborative carbon reduction and allocate carbon quotas in China. - Highlights: • The paper allocates carbon quotas given the collaboration among regions in China. • The Shapley value method coupled with the entropy and gravity models is adopted. • The regions with higher GDP, carbon outflow and reduction connection allocate more. • The Central region has the largest radiation effect on others among all regions. • The collaboration of the Central and Northern coast regions should have priority

  16. Richness of lichen species, especially of threatened ones, is promoted by management methods furthering stand continuity.

    Directory of Open Access Journals (Sweden)

    Steffen Boch

    Full Text Available Lichens are a key component of forest biodiversity. However, a comprehensive study analyzing lichen species richness in relation to several management types, extending over different regions and forest stages and including information on site conditions is missing for temperate European forests. In three German regions (Schwäbische Alb, Hainich-Dün, Schorfheide-Chorin, the so-called Biodiversity Exploratories, we studied lichen species richness in 631 forest plots of 400 m(2 comprising different management types (unmanaged, selection cutting, deciduous and coniferous age-class forests resulting from clear cutting or shelterwood logging, various stand ages, and site conditions, typical for large parts of temperate Europe. We analyzed how lichen species richness responds to management and habitat variables (standing biomass, cover of deadwood, cover of rocks. We found strong regional differences with highest lichen species richness in the Schwäbische Alb, probably driven by regional differences in former air pollution, and in precipitation and habitat variables. Overall, unmanaged forests harbored 22% more threatened lichen species than managed age-class forests. In general, total, corticolous, and threatened lichen species richness did not differ among management types of deciduous forests. However, in the Schwäbische-Alb region, deciduous forests had 61% more lichen species than coniferous forests and they had 279% more threatened and 76% more corticolous lichen species. Old deciduous age classes were richer in corticolous lichen species than young ones, while old coniferous age-classes were poorer than young ones. Overall, our findings highlight the importance of stand continuity for conservation. To increase total and threatened lichen species richness we suggest (1 conserving unmanaged forests, (2 promoting silvicultural methods assuring stand continuity, (3 conserving old trees in managed forests, (4 promoting stands of native deciduous

  17. Richness of Lichen Species, Especially of Threatened Ones, Is Promoted by Management Methods Furthering Stand Continuity

    Science.gov (United States)

    Boch, Steffen; Prati, Daniel; Hessenmöller, Dominik; Schulze, Ernst-Detlef; Fischer, Markus

    2013-01-01

    Lichens are a key component of forest biodiversity. However, a comprehensive study analyzing lichen species richness in relation to several management types, extending over different regions and forest stages and including information on site conditions is missing for temperate European forests. In three German regions (Schwäbische Alb, Hainich-Dün, Schorfheide-Chorin), the so-called Biodiversity Exploratories, we studied lichen species richness in 631 forest plots of 400 m2 comprising different management types (unmanaged, selection cutting, deciduous and coniferous age-class forests resulting from clear cutting or shelterwood logging), various stand ages, and site conditions, typical for large parts of temperate Europe. We analyzed how lichen species richness responds to management and habitat variables (standing biomass, cover of deadwood, cover of rocks). We found strong regional differences with highest lichen species richness in the Schwäbische Alb, probably driven by regional differences in former air pollution, and in precipitation and habitat variables. Overall, unmanaged forests harbored 22% more threatened lichen species than managed age-class forests. In general, total, corticolous, and threatened lichen species richness did not differ among management types of deciduous forests. However, in the Schwäbische-Alb region, deciduous forests had 61% more lichen species than coniferous forests and they had 279% more threatened and 76% more corticolous lichen species. Old deciduous age classes were richer in corticolous lichen species than young ones, while old coniferous age-classes were poorer than young ones. Overall, our findings highlight the importance of stand continuity for conservation. To increase total and threatened lichen species richness we suggest (1) conserving unmanaged forests, (2) promoting silvicultural methods assuring stand continuity, (3) conserving old trees in managed forests, (4) promoting stands of native deciduous tree species

  18. Regionalization of Drought across South Korea Using Multivariate Methods

    Directory of Open Access Journals (Sweden)

    Muhammad Azam

    2017-12-01

    Full Text Available Topographic and hydro-climatic features of South Korea are highly heterogeneous and able to influence the drought phenomena in the region. The complex topographical and hydro-climatic features of South Korea need a statistically accurate method to find homogeneous regions. Regionalization of drought in a bivariate framework has scarcely been applied in South Korea before. Hierarchical Classification on Principal Components (HCPC algorithm together with Principal Component Analysis (PCA method and cluster validation indices were investigated and used for the regionalization of drought across the South Korean region. Statistical homogeneity and discordancy of the region was tested on univariate and bivariate frameworks. HCPC indicate that South Korea should be divided into four regions which are closer to being homogeneous. Univariate and bivariate homogeneity and discordancy tests showed the significant difference in their results due to the inability of univariate homogeneity and discordancy measures to consider the joint behavior of duration and severity. Regionalization of drought for SPI time scale of 1, 3, 6, 12, and 24 months showed significant variation in discordancy and homogeneity of the region with the change in SPI time scale. The results of this study can be used as basic data required to establish a drought mitigation plan on regional scales.

  19. Boundary Dpp promotes growth of medial and lateral regions of the Drosophila wing.

    Science.gov (United States)

    Barrio, Lara; Milán, Marco

    2017-07-04

    The gradient of Decapentaplegic (Dpp) in the Drosophila wing has served as a paradigm to characterize the role of morphogens in regulating patterning. However, the role of this gradient in regulating tissue size is a topic of intense debate as proliferative growth is homogenous. Here, we combined the Gal4/UAS system and a temperature-sensitive Gal80 molecule to induce RNAi-mediated depletion of dpp and characterise the spatial and temporal requirement of Dpp in promoting growth. We show that Dpp emanating from the AP compartment boundary is required throughout development to promote growth by regulating cell proliferation and tissue size. Dpp regulates growth and proliferation rates equally in central and lateral regions of the developing wing appendage and reduced levels of Dpp affects similarly the width and length of the resulting wing. We also present evidence supporting the proposal that graded activity of Dpp is not an absolute requirement for wing growth.

  20. THE METHODS FOR ESTIMATING REGIONAL PROFESSIONAL MOBILE RADIO MARKET POTENTIAL

    Directory of Open Access Journals (Sweden)

    Y.À. Korobeynikov

    2008-12-01

    Full Text Available The paper represents the author’s methods of estimating regional professional mobile radio market potential, that belongs to high-tech b2b markets. These methods take into consideration such market peculiarities as great range and complexity of products, technological constraints and infrastructure development for the technological systems operation. The paper gives an estimation of professional mobile radio potential in Perm region. This estimation is already used by one of the systems integrator for its strategy development.

  1. Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Is Not Associated With Paroxetine-Induced Ejaculation Delay in Dutch Men With Lifelong Premature Ejaculation

    NARCIS (Netherlands)

    Janssen, Paddy K C; Zwinderman, Aeilko H; Olivier, Berend; Waldinger, Marcel D

    PURPOSE: To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). MATERIALS AND METHODS: This was a prospective study of 10 weeks of paroxetine

  2. Insulin VNTR and IGF-1 promoter region polymorphisms are not associated with body composition in early childhood: The generation R study

    NARCIS (Netherlands)

    J.A.J.B.M. Maas (Janneke); D.O. Mook-Kanamori (Dennis); L. Ay (Lamise); R.P.M. Steegers-Theunissen (Régine); P. Tikka-Kleemola (Päivi); A. Hofman (Albert); A.C.S. Hokken-Koelega (Anita); V.W.V. Jaddoe (Vincent)

    2010-01-01

    textabstractObjective: The objective of this study was to examine the associations between insulin gene variable number of tandem repeats (INS VNTR) and insulin-like growth factor 1 (IGF1) gene promoter region polymorphisms with body composition in early childhood. Methods: This study was embedded

  3. Libraries of Synthetic TALE-Activated Promoters: Methods and Applications.

    Science.gov (United States)

    Schreiber, T; Tissier, A

    2016-01-01

    The discovery of proteins with programmable DNA-binding specificities triggered a whole array of applications in synthetic biology, including genome editing, regulation of transcription, and epigenetic modifications. Among those, transcription activator-like effectors (TALEs) due to their natural function as transcription regulators, are especially well-suited for the development of orthogonal systems for the control of gene expression. We describe here the construction and testing of libraries of synthetic TALE-activated promoters which are under the control of a single TALE with a given DNA-binding specificity. These libraries consist of a fixed DNA-binding element for the TALE, a TATA box, and variable sequences of 19 bases upstream and 43 bases downstream of the DNA-binding element. These libraries were cloned using a Golden Gate cloning strategy making them usable as standard parts in a modular cloning system. The broad range of promoter activities detected and the versatility of these promoter libraries make them valuable tools for applications in the fine-tuning of expression in metabolic engineering projects or in the design and implementation of regulatory circuits. © 2016 Elsevier Inc. All rights reserved.

  4. Association between VNTR polymorphism in promoter region of prodynorphin (PDYN) gene and heroin dependence.

    Science.gov (United States)

    Saify, Khyber; Saadat, Iraj; Saadat, Mostafa

    2014-11-30

    Within the core promoter region of prodynorphin (PDYN), a 68-bp sequence was found to occur as a polymorphism element, either singular or as tandemly repeated two, three or four times. We report the sequence of a novel allele (5-repeats). Our study revealed the existence of an ancestral nucleotide (A) at 29th position of the VNTR in human. In total, 442 heroin addicts and 799 controls were included in this study. The present findings revealed a male-limited association between VNTR polymorphism and heroin dependence risk. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  5. Promotion of physical activity in the European region: content analysis of 27 national policy documents

    DEFF Research Database (Denmark)

    Daugbjerg, Signe B; Kahlmeier, Sonja; Racioppi, Francesca

    2009-01-01

    . Population groups most in need such as people with low levels of physical activity were rarely specifically targeted. Most policies emphasized the importance of an evaluation. However, only about half of them indicated a related intention or requirement. CONCLUSION: In recent years there has been......BACKGROUND: Over the past years there has been increasing interest in physical activity promotion and the development of appropriate policy. So far, there has been no comprehensive overview of the activities taking place in Europe in this area of public health policy. METHODS: Using different...... search methods, 49 national policy documents on physical activity promotion were identified. An analysis grid covering key features was developed for the analysis of the 27 documents published in English. RESULTS: Analysis showed that many general recommendations for policy developments are being...

  6. Polymorphism in the oxytocin promoter region in patients with lactase non-persistence is not related to symptoms

    Directory of Open Access Journals (Sweden)

    Simrén Magnus

    2009-11-01

    Full Text Available Abstract Background Oxytocin and the oxytocin receptor have been demonstrated in the gastrointestinal (GI tract and have been shown to exert physiological effects on gut motility. The role for oxytocin in the pathophysiology of GI complaints is unknown. The aim of this study was to examine genetic variations or polymorphism of oxytocin (OXT and its receptor (OXTR genes in patients with GI complaints without visible organic abnormalities. Methods Genetic variants in the OXT promoter region, and in the OXTR gene in DNA samples from 131 rigorously evaluated patients with Irritable Bowel Syndrome (IBS, 408 homozygous subjects referred for lactase (LCT-13910 C>T, rs4988235 genotyping, and 299 asymptomatic blood donors were compared. One polymorphism related to the OXT gene (rs6133010 A>G and 4 related to the OXTR gene (rs1465386 G>T, rs3806675 G>A, rs968389 A>G, rs1042778 G>T were selected for genotyping using Applied Biosystems 7900 HT allele discrimination assays. Results There were no statistically significant differences in the genotype or allele frequencies in any of the SNPs when IBS patients were compared to healthy controls. Among subjects referred for lactase genotyping, the rs6133010 A>G OXT promoter A/G genotype tended to be more common in the 154 non-persistent (27.3% subjects than in the 254 lactase persistant (18.1% subjects and in the healthy controls (19.4% (p = 0.08. When direct comparing, the A/G genotype was less common in the OXT promoter region in controls (p = 0.09 and in subjects with lactase persistence (p = 0.03 compared to subjects with lactase non-persistence. When healthy controls were viewed according to their own LCT-13910 genotypes, the C/C lactase non-persistent controls had a higher frequency for the OXT promoter A/G genotype than LCT-13910 T/T lactase persistent controls (41.2% vs 13.1%. No significant differences in frequencies of the investigated OXTR SNPs were noted in this study. Conclusion The results suggest

  7. Association of polymorphisms of interleukin-18 gene promoter region with polycystic ovary syndrome in chinese population

    Directory of Open Access Journals (Sweden)

    Li Mei-zhi

    2010-10-01

    Full Text Available Abstract Background Recent research shows that polycystic ovary syndrome (PCOS may have an association with low-grade chronic inflammation, and that PCOS may induce an increase in serum interleukin-18 (IL-18 levels. Methods To investigate the polymorphisms of the IL-18 gene promoters with PCOS, two single nucleotide polymorphisms (SNPs in the promoter of the IL-18 gene (at positions -607C/A and -137G/C in 118 Chinese women with PCOS and 79 controls were evaluated using polymerase chain reaction (PCR. Results No significant differences were found in the genotype distribution, allele frequency and haplotype frequency between the PCOS and control groups. Further analysis demonstrated a relationship between IL-18 gene promoter polymorphisms and PCOS insulin resistance (IR. Regarding the -137 allele frequency, G and C allele frequencies were 93.5% and 6.5%, respectively, in the PCOS with IR patients; G and C allele frequencies were 85.4% and 14.6%, respectively, in PCOS patients without IR (chi2 = 3.601, P = 0.048. Conclusions The presence of a polymorphism in the IL-18 gene was found to have no correlation with the occurrence of PCOS. Carriage of the C allele at position -137 in the promoter of the IL-18 gene may play a protective role from the development of PCOS IR.

  8. Association of the Resistin Gene Promoter Region Polymorphism with Kawasaki Disease in Chinese Children

    Directory of Open Access Journals (Sweden)

    Ruixi Liu

    2012-01-01

    Full Text Available Objectives. The −420C>G polymorphism located in the resistin gene (RETN promoter has recently been suggested to play a potential role in proinflammatory conditions and cardiovascular disease. This study investigated the association of the RETN promoter polymorphism with Kawasaki disease (KD and its clinical parameters in Chinese children. Methods. We compared patients with complete KD to incomplete KD children. Genotyping of the RETN promoter polymorphism was performed using MassARRAY system, and serum resistin levels were estimated using the sandwich enzyme immunoassay method. Results. There was no significant difference in RETN (−420C>G genotypes between KD and control groups. However, the frequency of the G allele was higher in iKD patients than in cKD children due to a significantly increased frequency of the GG genotypes. Serum levels of resistin were significantly higher in KD patients than in controls regardless of the presence of coronary artery lesions (CALs. Conclusion. The present findings suggest that while resistin may play a role in the pathogenesis of KD, there is no apparent association between CAL and the RETN (−420C>G gene polymorphism in KD children. However, the diagnosis of iKD is challenging but can be supported by the presence of the G allele and the GG genotypes.

  9. Methods for promoting wound healing and muscle regeneration with the cell signaling protein nell1

    Energy Technology Data Exchange (ETDEWEB)

    Culiat, Cymbeline T.

    2018-03-20

    The present invention provides methods for promoting wound healing and treating muscle atrophy in a mammal in need. The method comprises administering to the mammal a Nell1 protein or a Nell1 nucleic acid molecule.

  10. Methods for promoting wound healing and muscle regeneration with the cell signaling protein Nell1

    Science.gov (United States)

    Culiat, Cymbeline T [Oak Ridge, TN

    2011-03-22

    The present invention provides methods for promoting wound healing and treating muscle atrophy in a mammal in need. The method comprises administering to the mammal a Nell1 protein or a Nell1 nucleic acid molecule.

  11. Numerical conformal mapping methods for exterior and doubly connected regions

    Energy Technology Data Exchange (ETDEWEB)

    DeLillo, T.K. [Wichita State Univ., KS (United States); Pfaltzgraff, J.A. [Univ. of North Carolina, Chapel Hill, NC (United States)

    1996-12-31

    Methods are presented and analyzed for approximating the conformal map from the exterior of the disk to the exterior a smooth, simple closed curve and from an annulus to a bounded, doubly connected region with smooth boundaries. The methods are Newton-like methods for computing the boundary correspondences and conformal moduli similar to Fornberg`s method for the interior of the disk. We show that the linear systems are discretizations of the identity plus a compact operator and, hence, that the conjugate gradient method converges superlinearly.

  12. Strategy to Promote Active Learning of an Advanced Research Method

    Science.gov (United States)

    McDermott, Hilary J.; Dovey, Terence M.

    2013-01-01

    Research methods courses aim to equip students with the knowledge and skills required for research yet seldom include practical aspects of assessment. This reflective practitioner report describes and evaluates an innovative approach to teaching and assessing advanced qualitative research methods to final-year psychology undergraduate students. An…

  13. Theories and calculation methods for regional objective ET

    Institute of Scientific and Technical Information of China (English)

    QIN DaYong; LO JinYan; LIU JiaHong; WANG MingNa

    2009-01-01

    The regional objective ET (Evapotranspiration) is a new concept in water resources research, which refers to the total amount of water that could be exhausted from a region in the form of vapor per year. The objective-ET based water resources management allocates water to different regions in terms of ET. It controls the water exhausted from a region to meet the objective ET. The regional objective ET must be adapted to fit the region's local available water resources. By improving the water utilization effi-ciency and reducing the unrecoverable water in the social water circle, it is saved so that water related production is maintained or even increased under the same water consumption conditions. Regional water balance is realized by rationally deploying the available water among different industries, adjusting industrial structures, and adopting new water-saving technologies, therefore to meeting the requirements for groundwater conservation, agricultural income stability, and avoiding environmental damages. Furthermore, water competition among various departments and industries (including envi-ronmental and ecological water use) may be avoided. This paper proposes an innovative definition of objective ET, and its principles, sub-index systems. Besides, a computational method for regional ob-jective ET is developed by combining the distributed hydrological model and the soil moisture model.

  14. Do Elementary Science Methods Textbooks Promote Understanding of Shadows?

    Directory of Open Access Journals (Sweden)

    Lloyd H. Barrow

    2016-02-01

    Full Text Available Elementary science methods textbooks can be an important resource for future elementary teachers of science. Since shadows are a common topic in elementary school and Next Generation Science Standards (NGSS Lead States, 2013. A series of ten shadows concepts were formed into a learning progression by Wizman and Fortus (2007. For this research, ten science methods textbook were read and analyzed about how each of the shadow concepts were addressed. These methods textbooks focused on a limited number of shadow concepts. Consequently, as a future reference, they are very limited in addressing all ten shadow concepts.

  15. The role of COMESA in promoting intra-regional agricultural trade: Case study of Sudan

    Directory of Open Access Journals (Sweden)

    Azharia Abdelbagi Elbushra

    2011-06-01

    Full Text Available African countries have created many regional trade agreements with the economic objectives of reducing trade barriers and encouraging economic growth. The COMESA is an example of regional integration singed on 1993 by 19 African countries including Sudan. COMESA represents a chance for member countries to enhance their economic and social relations through increasing intra-trade. The objective of this paper is to assess the role of COMESA in promoting intra-regional agricultural trade between Sudan and COMESA countries. A multi-market model with Armington non-linear specification was applied. The paper results showed that there is a great potential for Sudan to increase its agricultural exports to other COMESA countries. The domestic agricultural markets are expected to be hampered by imports surge and increase in competition, while the producers of agricultural export commodities will be better off. In order to compete and benefit from potential in the COMESA markets, the paper recommended improving efficiency in the Sudanese agricultural sector through increasing productivity, lowering cost of production, enhancing marketing services, attaining economies of scale and attracting foreign investment.

  16. Perceptions of health promoters about health promotion programmes for families with adolescents orphaned as a result of AIDS in the rural Hammanskraal region in South Africa

    Directory of Open Access Journals (Sweden)

    Maseapo P. Mthobeni

    2013-02-01

    Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information.Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering

  17. Perceptions of health promoters about health promotion programmes for families with adolescents orphaned as a result of AIDS in the rural Hammanskraal region in South Africa

    Directory of Open Access Journals (Sweden)

    Maseapo P. Mthobeni

    2013-02-01

    Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information. Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering

  18. Limited-memory trust-region methods for sparse relaxation

    Science.gov (United States)

    Adhikari, Lasith; DeGuchy, Omar; Erway, Jennifer B.; Lockhart, Shelby; Marcia, Roummel F.

    2017-08-01

    In this paper, we solve the l2-l1 sparse recovery problem by transforming the objective function of this problem into an unconstrained differentiable function and applying a limited-memory trust-region method. Unlike gradient projection-type methods, which uses only the current gradient, our approach uses gradients from previous iterations to obtain a more accurate Hessian approximation. Numerical experiments show that our proposed approach eliminates spurious solutions more effectively while improving computational time.

  19. Use of phytoindication methods for biomonitoring of urbanized regions

    International Nuclear Information System (INIS)

    Holub, Z.; Lackovicova, A.

    1992-01-01

    At the model region in the industrial agglomeration of the town Bratislava the usability of some phytoindication methods for biomonitoring of urban areas has been tested. Following methods there were found as useful: 1. Chemical analyses of the leaves of freely growing ruderal species (Artemisia vulgaris). 2. Using of transplanted and for a certain time exposed lower plants (Hypogymnia physodes, Sphagnum capillifolium). 3. Use of changing the biological parameters of planted pot plants (Fagopyrum esculentum). (orig.)

  20. The search conference as a method in planning community health promotion actions

    Directory of Open Access Journals (Sweden)

    Eva Magnus

    2016-08-01

    Full Text Available Aims: The aim of this article is to describe and discuss how the search conference can be used as a method for planning health promotion actions in local communities. Design and methods: The article draws on experiences with using the method for an innovative project in health promotion in three Norwegian municipalities. The method is described both in general and how it was specifically adopted for the project. Results and conclusions: The search conference as a method was used to develop evidence-based health promotion action plans. With its use of both bottom-up and top-down approaches, this method is a relevant strategy for involving a community in the planning stages of health promotion actions in line with political expectations of participation, ownership, and evidence-based initiatives.

  1. Method of cell transplantation promoting the organization of intraarterial thrombus.

    Science.gov (United States)

    Hirano, Koji; Shimono, Takatsugu; Imanaka-Yoshida, Kyoko; Miyamoto, Keiichi; Fujinaga, Kazuya; Kajimoto, Masaki; Miyake, Yoichiro; Nishikawa, Masakatsu; Yoshida, Toshimichi; Uchida, Atsumasa; Shimpo, Hideto; Yada, Isao; Hirata, Hitoshi

    2005-08-30

    Endovascular aortic repairs have been developed as less invasive treatments for aortic aneurysms. Some aneurismal cavities, however, remain without organization, causing a re-expansion of the aneurysms. We studied cell transplantation into the aneurismal sac to promote the organization of thrombus for the complete healing of aneurysms. Skin fibroblasts and skeletal myoblasts were isolated from rats for cell transplantation. An intraarterial thrombus model was made by ligation of the carotid artery. Culture medium (medium group, n=11), collagen gel (gel group, n=11), fibroblasts with collagen gel (F group, n=15), myoblasts with collagen gel (M group, n=12), or mixture of fibroblasts and myoblasts with collagen gel (F+M group, n=14) were injected into the thrombus. After 28 days, histologically, the arterial lumens of the F and M groups were partly filled with fibrous tissues, whereas in the F+M group organization was almost completed and luminal sizes diminished. Immunohistochemical staining demonstrated that alpha-smooth muscle actin-positive cells were more abundantly contained in the organized area of the F+M group than in the other groups. We also analyzed cellular function in vitro with immunofluorescence; coculture of fibroblasts and myoblasts showed that the fraction of alpha-smooth muscle actin-positive fibroblasts increased. This phenomenon accounts for the rapid organization of thrombus in the F+M group in vivo. Cell transplantation accelerated thrombus organization. Especially, myoblasts enhanced differentiation of fibroblasts into myofibroblasts, contributing to rapid thrombus organization. Cell transplantation into unorganized spaces seems applicable to endovascular treatment of aneurysms.

  2. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

    Science.gov (United States)

    Wyszyńska-Koko, J; Kurył, J

    2004-01-01

    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  3. Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

    Science.gov (United States)

    Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

    2011-09-01

    Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

  4. Allelic polymorphisms in the repeat and promoter regions of the interleukin-4 gene and malaria severity in Ghanaian children

    DEFF Research Database (Denmark)

    Gyan, B A; Goka, B; Cvetkovic, J T

    2004-01-01

    Immunoglobulin E has been associated with severe malaria suggesting a regulatory role for interleukin (IL)-4 and/or IgE in the pathogenesis of severe malaria. We have investigated possible associations between polymorphisms in the IL-4 repeat region (intron 3) and promoter regions (IL-4 +33CT and...

  5. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

    Science.gov (United States)

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

    2014-01-10

    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  6. The Preparation and Selection of Budget Methods for Promotion in Kosovo

    Directory of Open Access Journals (Sweden)

    MSc. Halit Karaxha

    2017-06-01

    Full Text Available Selecting the adequate method for promotion has a huge importance in increasing business’s performance. Selecting the method of the budget depends from a number of factors. The formulation of budget is known as the most critical period which requires special analysis from marketing’s managers. The expenses for promotion are usually high, and every investment made in the field of promotion directly influences in the business situation. Thus, the selection and adequate formulation of budget methods for promotion influences the growth of profit. The allocated amount for promotion depends from a number of factors, such as: the size of the firm, the sector in which it operates, competition etc. After planning the budget, we have to do the budget allocation to select the promotional form which is considered to be successful by the firms in promoting the products and services and that will help the company to connect with its clients. In this paper, I have elaborated the role and importance of the preparation and selection of budget methods for promotion in the theoretical aspect and the practical one as well.

  7. Identification of a single-nucleotide insertion in the promoter region affecting the sodC promoter activity in Brucella neotomae.

    Directory of Open Access Journals (Sweden)

    Dina A Moustafa

    Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.

  8. Stochastic rainfall synthesis for urban applications using different regionalization methods

    Science.gov (United States)

    Callau Poduje, A. C.; Leimbach, S.; Haberlandt, U.

    2017-12-01

    The proper design and efficient operation of urban drainage systems require long and continuous rainfall series in a high temporal resolution. Unfortunately, these time series are usually available in a few locations and it is therefore suitable to develop a stochastic precipitation model to generate rainfall in locations without observations. The model presented is based on an alternating renewal process and involves an external and an internal structure. The members of these structures are described by probability distributions which are site specific. Different regionalization methods based on site descriptors are presented which are used for estimating the distributions for locations without observations. Regional frequency analysis, multiple linear regressions and a vine-copula method are applied for this purpose. An area located in the north-west of Germany is used to compare the different methods and involves a total of 81 stations with 5 min rainfall records. The site descriptors include information available for the whole region: position, topography and hydrometeorologic characteristics which are estimated from long term observations. The methods are compared directly by cross validation of different rainfall statistics. Given that the model is stochastic the evaluation is performed based on ensembles of many long synthetic time series which are compared with observed ones. The performance is as well indirectly evaluated by setting up a fictional urban hydrological system to test the capability of the different methods regarding flooding and overflow characteristics. The results show a good representation of the seasonal variability and good performance in reproducing the sample statistics of the rainfall characteristics. The copula based method shows to be the most robust of the three methods. Advantages and disadvantages of the different methods are presented and discussed.

  9. MICB gene diversity and balancing selection on its promoter region in Yao population in southern China.

    Science.gov (United States)

    Chen, Xiang; Liu, Xuexiang; Wei, Xiaomou; Meng, Yuming; Liu, Limin; Qin, Shini; Liu, Yanyu; Dai, Shengming

    2016-12-01

    To comprehensively examine the MICB gene polymorphism and identify its differences in Chinese Yao population from other ethnic groups, we investigated the polymorphism in the 5'-upstream regulation region (5'-URR), coding region (exons 2-4), and the 3'-untranslated region (3'-UTR) of MICB gene by using PCR-SBT method in 125 healthy unrelated Yao individuals in Guangxi Zhuang Autonomous Region. Higher polymorphism was observed in the 5'-URR, nine single nucleotide polymorphisms (SNPs) and a two base pairs deletion at position -139/-138 were found in our study. Only five different variation sites, however, were detected in exons 2-4 and three were observed in the 3'-UTR. The minor allele frequencies of all variants were greater than 5%, except for rs3828916, rs3131639, rs45627734, rs113620316, rs779737471, and the variation at position +11803 in the 3'-UTR. The first nine SNPs of 5'-URR and rs1065075, rs1051788 of the coding region showed significant linkage disequilibrium with each other. Ten different MICB extended haplotypes (EH) encompassing the 5'-URR, exons 2-4, and 3'-UTR were found in this population, and the most frequent was EH1 (23.2%). We provided several evidences for balancing selection effect on the 5'-URR of MICB gene in Yao population. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  10. Public health and health promotion capacity at national and regional level: a review of conceptual frameworks

    Directory of Open Access Journals (Sweden)

    Christoph Aluttis

    2014-04-01

    Full Text Available The concept of capacity building for public health has gained much attention during the last decade. National as well as international organizations increasingly focus their efforts on capacity building to improve performance in the health sector. During the past two decades, a variety of conceptual frameworks have been developed which describe relevant dimensions for public health capacity. Notably, these frameworks differ in design and conceptualization. This paper therefore reviews the existing conceptual frameworks and integrates them into one framework, which contains the most relevant dimensions for public health capacity at the country or regional level. A comprehensive literature search was performed to identify frameworks addressing public health capacity building at the national or regional level. We content-analysed these frameworks to identify the core dimensions of public health capacity. The dimensions were subsequently synthesized into a set of thematic areas to construct a conceptual framework which describes the most relevant dimensions for capacities at the national or regional level. The systematic review resulted in the identification of seven core domains for public health capacity: resources, organizational structures, workforce, partnerships, leadership and governance, knowledge development and country specific context. Accordingly, these dimensions were used to construct a framework, which describes these core domains more in detail. Our research shows that although there is no generally agreed upon model of public health capacity, a number of key domains for public health and health promotion capacity are consistently recurring in existing frameworks, regardless of their geographical location or thematic area. As only little work on the core concepts of public health capacities has yet taken place, this study adds value to the discourse by identifying these consistencies across existing frameworks and by synthesising

  11. Mutational analysis of the promoter and the coding region of the 5-HT1A gene

    Energy Technology Data Exchange (ETDEWEB)

    Erdmann, J.; Noethen, M.M.; Shimron-Abarbanell, D. [Univ. of Bonn (Germany)] [and others

    1994-09-01

    Disturbances of serotonergic pathways have been implicated in many neuropsychiatric disorders. Serotonin (5HT) receptors can be subdivided into at least three major families (5HT1, 5HT2, and 5HT3). Five human 5HT1 receptor subtypes have been cloned, namely 1A, 1D{alpha}, 1D{beta}, 1E, and 1F. Of these, the 5HT1A receptor is the best characterized subtype. In the present study we sought to identify genetic variation in the 5HT1A receptor gene which through alteration of protein function or level of expression might contribute to the genetics of neuropsychiatric diseases. The coding region and the 5{prime} promoter region of the 5HT1A gene from 159 unrelated subjects (45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 controls) were analyzed using SSCA. SSCA revealed the presence of two mutations both located in the coding region of the 5HT1A receptor gene. The first mutation is a rare silent C{r_arrow}T substitution at nucleotide position 549. The second mutation is characterized by a base pair substitution (A{r_arrow}G) at the first position of codon 28 and results in an amino acid exchange (Ile{r_arrow}Val). Since Val28 was found only in a single schizophrenic patient and in none of the other patients or controls, we decided to extend our samples and to use a restriction assay for screening a further 74 schizophrenic, 95 bipolar affective, and 49 patients with Tourette`s syndrome, as well as 185 controls, for the presence of the mutation. In total, the mutation was found in 2 schizophrenic patients, in 3 bipolars, in 1 Tourette patient, and in 5 controls. To our knowledge the Ile-28-Val substitution reported here is the first natural occuring molecular variant which has been identified for a serotonin receptor so far.

  12. Selection for Unequal Densities of Sigma70 Promoter-like Signalsin Different Regions of Large Bacterial Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Huerta, Araceli M.; Francino, M. Pilar; Morett, Enrique; Collado-Vides, Julio

    2006-03-01

    The evolutionary processes operating in the DNA regions that participate in the regulation of gene expression are poorly understood. In Escherichia coli, we have established a sequence pattern that distinguishes regulatory from nonregulatory regions. The density of promoter-like sequences, that are recognizable by RNA polymerase and may function as potential promoters, is high within regulatory regions, in contrast to coding regions and regions located between convergently-transcribed genes. Moreover, functional promoter sites identified experimentally are often found in the subregions of highest density of promoter-like signals, even when individual sites with higher binding affinity for RNA polymerase exist elsewhere within the regulatory region. In order to investigate the generality of this pattern, we have used position weight matrices describing the -35 and -10 promoter boxes of E. coli to search for these motifs in 43 additional genomes belonging to most established bacterial phyla, after specific calibration of the matrices according to the base composition of the noncoding regions of each genome. We have found that all bacterial species analyzed contain similar promoter-like motifs, and that, in most cases, these motifs follow the same genomic distribution observed in E. coli. Differential densities between regulatory and nonregulatory regions are detectable in most bacterial genomes, with the exception of those that have experienced evolutionary extreme genome reduction. Thus, the phylogenetic distribution of this pattern mirrors that of genes and other genomic features that require weak selection to be effective in order to persist. On this basis, we suggest that the loss of differential densities in the reduced genomes of host-restricted pathogens and symbionts is the outcome of a process of genome degradation resulting from the decreased efficiency of purifying selection in highly structured small populations. This implies that the differential

  13. Genome-wide prediction of cis-regulatory regions using supervised deep learning methods.

    Science.gov (United States)

    Li, Yifeng; Shi, Wenqiang; Wasserman, Wyeth W

    2018-05-31

    In the human genome, 98% of DNA sequences are non-protein-coding regions that were previously disregarded as junk DNA. In fact, non-coding regions host a variety of cis-regulatory regions which precisely control the expression of genes. Thus, Identifying active cis-regulatory regions in the human genome is critical for understanding gene regulation and assessing the impact of genetic variation on phenotype. The developments of high-throughput sequencing and machine learning technologies make it possible to predict cis-regulatory regions genome wide. Based on rich data resources such as the Encyclopedia of DNA Elements (ENCODE) and the Functional Annotation of the Mammalian Genome (FANTOM) projects, we introduce DECRES based on supervised deep learning approaches for the identification of enhancer and promoter regions in the human genome. Due to their ability to discover patterns in large and complex data, the introduction of deep learning methods enables a significant advance in our knowledge of the genomic locations of cis-regulatory regions. Using models for well-characterized cell lines, we identify key experimental features that contribute to the predictive performance. Applying DECRES, we delineate locations of 300,000 candidate enhancers genome wide (6.8% of the genome, of which 40,000 are supported by bidirectional transcription data), and 26,000 candidate promoters (0.6% of the genome). The predicted annotations of cis-regulatory regions will provide broad utility for genome interpretation from functional genomics to clinical applications. The DECRES model demonstrates potentials of deep learning technologies when combined with high-throughput sequencing data, and inspires the development of other advanced neural network models for further improvement of genome annotations.

  14. The Search Conference as a Method in Planning Community Health Promotion Actions

    Science.gov (United States)

    Magnus, Eva; Knudtsen, Margunn Skjei; Wist, Guri; Weiss, Daniel; Lillefjell, Monica

    2016-01-01

    Aims: The aim of this article is to describe and discuss how the search conference can be used as a method for planning health promotion actions in local communities. Design and methods: The article draws on experiences with using the method for an innovative project in health promotion in three Norwegian municipalities. The method is described both in general and how it was specifically adopted for the project. Results and conclusions: The search conference as a method was used to develop evidence-based health promotion action plans. With its use of both bottom-up and top-down approaches, this method is a relevant strategy for involving a community in the planning stages of health promotion actions in line with political expectations of participation, ownership, and evidence-based initiatives. Significance for public health This article describe and discuss how the Search conference can be used as a method when working with knowledge based health promotion actions in local communities. The article describe the sequences of the conference and shows how this have been adapted when planning and prioritizing health promotion actions in three Norwegian municipalities. The significance of the article is that it shows how central elements in the planning of health promotion actions, as participation and involvements as well as evidence was a fundamental thinking in how the conference were accomplished. The article continue discussing how the method function as both a top-down and a bottom-up strategy, and in what way working evidence based can be in conflict with a bottom-up strategy. The experiences described can be used as guidance planning knowledge based health promotion actions in communities. PMID:27747199

  15. The regional approach and regional studies method in the process of geography teaching

    Science.gov (United States)

    Dermendzhieva, Stela; Doikov, Martin

    2017-03-01

    We define the regional approach as a manner of relations among the global trends of development of the "Society-man-nature" system and the local differentiating level of knowledge. Conditionally, interactions interlace under the influence of the character of Geography as a science, education, approaches, goals and teaching methods. Global, national and local development differentiates in three concentric circles at the level of knowledge. It is determined as a conception of modern, complex and effective mechanism for young people, through which knowledge develops in regional historical and cultural perspective; self-consciousness for socio-economic and cultural integration is formed as a part of the. historical-geographical image of the native land. This way an attitude to the. native land is formed as a connecting construct between patriotism to the motherland and the same in global aspect. The possibility for integration and cooperation of the educative geographical content with all the local historical-geographical, regional, profession orientating, artistic, municipal and district institutions, is outlined. Contemporary geographical education appears to be a powerful and indispensable mechanism for organization of human sciences, while the regional approach and the application of the regional studies method stimulate and motivate the development and realization of optimal capacities for direct connection with the local structures and environments.

  16. Quantitative and regional evaluation methods for lung scintigraphs

    International Nuclear Information System (INIS)

    Fichter, J.

    1982-01-01

    For the evaluation of perfusion lung scintigraphs with regard to the quantitative valuation and also with regard to the choice of the regions new criteria were presented. In addition to the usual methods of sectioning each lung lobe into upper, middle and lower level and the determination of the per cent activity share of the total activity the following values were established: the median of the activity distribution and the differences of the per cent counting rate as well as of the median of the corresponding regions of the right and left lung. The individual regions should describe the functional structures (lobe and segment structure). A corresponding computer program takes over the projection of lobe and segment regions in a simplified form onto the scintigraph with consideration of individual lung stretching. With the help of a clinical study on 60 patients and 18 control persons with 99mTc-MAA and 133 Xe-gas lung scintigraphs the following results could be determined: depending on the combination of the 32 parameters available for evaluation and the choice of regions between 4 and 20 of the 60 patients were falsely negatively classified and 1 to 2 of the 18 controls were falsely positive. The accuracy of the Tc-scintigraph proved to be better. All together using the best possible parameter combinations comparative results were attained. (TRV) [de

  17. Green's function matching method for adjoining regions having different masses

    International Nuclear Information System (INIS)

    Morgenstern Horing, Norman J

    2006-01-01

    We present a primer on the method of Green's function matching for the determination of the global Schroedinger Green's function for all space subject to joining conditions at an interface between two (or more) separate parts of the region having different masses. The object of this technique is to determine the full space Schroedinger Green's function in terms of the individual Green's functions of the constituent parts taken as if they were themselves extended to all space. This analytical method has had successful applications in the theory of surface states, and remains of interest for nanostructures

  18. Multi-Electrode Impedance Method for Detection of Regional Ventilation

    International Nuclear Information System (INIS)

    Furuya, Norio; Sakamoto, Katsuyuki

    2013-01-01

    By means of computer simulation and experiment, we investigated the feasibility of simultaneously measuring the transfer impedance changes in the right apex, left apex, right base and left base of the lungs using the multi-electrode impedance method. To obtain the transfer impedance in each region, while suppressing the effects of other regions, changing the amplitude and polarity of the applied current must localize the high sensitivity areas in the interest region. Twelve current and eight voltage electrodes were equidistantly arranged on the anterior and posterior chest walls. The amplitudes and polarities of the currents that were simultaneously applied to the current electrodes, and which provided the appropriate sensitivity distribution, were theoretically obtained. The effects of the localized sensitivity distribution were verified by comparing the simulation results of the investigated method with the results of the conventional four-electrode method. From the results of the computer simulation, we developed a multi-electrode impedance pneumography and applied it to healthy adult volunteers who were both in sitting position and in left decubitus. We found that the measurement results were physiologically reasonable.

  19. Two negative cis-regulatory regions involved in fruit-specific promoter activity from watermelon (Citrullus vulgaris S.).

    Science.gov (United States)

    Yin, Tao; Wu, Hanying; Zhang, Shanglong; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming; Liu, Jingmei

    2009-01-01

    A 1.8 kb 5'-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from -986 to -959 and from -472 to -424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative beta-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were approximately 10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves.

  20. AN ITERATIVE SEGMENTATION METHOD FOR REGION OF INTEREST EXTRACTION

    Directory of Open Access Journals (Sweden)

    Volkan CETIN

    2013-01-01

    Full Text Available In this paper, a method is presented for applications which include mammographic image segmentation and region of interest extraction. Segmentation is a very critical and difficult stage to accomplish in computer aided detection systems. Although the presented segmentation method is developed for mammographic images, it can be used for any medical image which resembles the same statistical characteristics with mammograms. Fundamentally, the method contains iterative automatic thresholding and masking operations which is applied to the original or enhanced mammograms. Also the effect of image enhancement to the segmentation process was observed. A version of histogram equalization was applied to the images for enhancement. Finally, the results show that enhanced version of the proposed segmentation method is preferable because of its better success rate.

  1. Data assimilation method based on the constraints of confidence region

    Science.gov (United States)

    Li, Yong; Li, Siming; Sheng, Yao; Wang, Luheng

    2018-03-01

    The ensemble Kalman filter (EnKF) is a distinguished data assimilation method that is widely used and studied in various fields including methodology and oceanography. However, due to the limited sample size or imprecise dynamics model, it is usually easy for the forecast error variance to be underestimated, which further leads to the phenomenon of filter divergence. Additionally, the assimilation results of the initial stage are poor if the initial condition settings differ greatly from the true initial state. To address these problems, the variance inflation procedure is usually adopted. In this paper, we propose a new method based on the constraints of a confidence region constructed by the observations, called EnCR, to estimate the inflation parameter of the forecast error variance of the EnKF method. In the new method, the state estimate is more robust to both the inaccurate forecast models and initial condition settings. The new method is compared with other adaptive data assimilation methods in the Lorenz-63 and Lorenz-96 models under various model parameter settings. The simulation results show that the new method performs better than the competing methods.

  2. Geoheritage promotion of Thonon-les-Bains (Fr) region by the development of a geotourism product

    Science.gov (United States)

    Fanguin, Pauline

    2014-05-01

    Since 2012, the Chablais region (only in France) has acquired the Geopark label. This Geopark contributes to sustainable economic development of the region through geotourism. Moreover, the three Chablais (figure 1) are concerned by an Interreg IV program since 2009 (program of cooperation between European countries). The main objective of this program is to enhance the heritage resources (nature, culture and lifestyle of the region) (www.interreg-francesuisse.org). Therefore, the geotourism offer in this area just waiting to expand. The geodidactics models like the simplification of the scientific content are essential for geoheritage promotion, because this content must be available to a wide audience, allowing thereby the geoheritage recognition. The geotourism permits to apply different models (Cayla et al. 2010, Sellier, 2009) through a wide range of geotourism products, like guide, educational panels, thematic hikes and recently developed, new medias (website, smartphone applications). A geotourism product is based on four areas of questioning and was developed by Martin et al. (2010): (1) site (choice of sites to be valued), (2) public (a family public, good example of heterogeneous public), (3) contents (reasoning on geodidactics models) and (4) support (smartphone application). These four areas are very fundamental before the creation of any geotourism product. These reflexions aim to obtain a mediation product that integrates into geotourism offer of a region and contributes to its development and meets public expectations. New media, such as digital media - smartphone, tablets, website - become geotourism products more and more attractive. In addition, the necessary technologies to develop new media help to integrate a high interactivity potential with the public and thus get their attention. The architecture of this geotourism product is based on the new application developed by the Institute of Geography and sustainability, and the Bureau Relief. One

  3. Does health promotion need a Code of Ethics? Results from an IUHPE mixed method survey.

    Science.gov (United States)

    Bull, Torill; Riggs, Elisha; Nchogu, Sussy N

    2012-09-01

    Health promotion is an ethically challenging field involving constant reflection of values across multiple cultures of what is regarded as good and bad health promotion practice. While many disciplines are guided by a Code of Ethics (CoE) no such guide is available to health promoters. The International Union for Health Promotion and Education (IUHPE) has been nominated as a suitable candidate for developing such a code. It is within this context that the IUHPE Student and Early Career Network (ISECN), through its Ethics Working Group, has taken up the challenge of preparing the foundations for a CoE for health promotion. An online survey comprising open and closed-answer questions was used to gather the opinions of IUHPE members regarding the need for a CoE for health promotion. The quantitative data were calculated with descriptive analyses. A thematic analysis approach was used to analyze and interpret the qualitative data. IUHPE members (n = 236) from all global regions responded to the survey. The majority (52%) of the respondents had 11 years' experience or more in the field of health promotion. Ethical dilemmas were commonly encountered. The need for a CoE for health promotion was expressed by 83% of respondents. Respondents also offered their views of possibilities, ideas and challenges regarding the development of a CoE for health promotion. Considering that health promoters encounter ethical dilemmas frequently in their practice, this study reinforces the need to develop a CoE for the field. The recommendations from the survey provide a good basis for future work to develop such a code.

  4. Gel shift analysis of the empA promoter region in Vibrio anguillarum

    Directory of Open Access Journals (Sweden)

    Denkin Steven M

    2004-10-01

    Full Text Available Abstract Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20, nine salts solution + 200 μg/ml mucus (NSSM, 3M (marine minimal medium, or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V

  5. Molecular methods for bacterial genotyping and analyzed gene regions

    Directory of Open Access Journals (Sweden)

    İbrahim Halil Yıldırım1, Seval Cing Yıldırım2, Nadir Koçak3

    2011-06-01

    Full Text Available Bacterial strain typing is an important process for diagnosis, treatment and epidemiological investigations. Current bacterial strain typing methods may be classified into two main categories: phenotyping and genotyping. Phenotypic characters are the reflection of genetic contents. Genotyping, which refers discrimination of bacterial strains based on their genetic content, has recently become widely used for bacterial strain typing. The methods already used in genotypingof bacteria are quite different from each other. In this review we tried to summarize the basic principles of DNA-based methods used in genotyping of bacteria and describe some important DNA regions that are used in genotyping of bacteria. J Microbiol Infect Dis 2011;1(1:42-46.

  6. “Fear or Love Thy Neighbour”? The EU Framework for Promoting Regional Cooperation in the South Caucasus

    Directory of Open Access Journals (Sweden)

    Nelli Babayan

    2011-12-01

    Full Text Available Building on the model of the enlargement policy, the European Union (EU designed the European Neighbourhood Policy and the Eastern Partnership to further promote its norms and principles. One of the goals of its new policies has been to foster regional cooperation among partner countries and their neighbours. This article specifies the EU’s framework for promoting regional cooperation through the aforementioned policies and discusses its potential impact on the example of the South Caucasus republics of Armenia, Azerbaijan, and Georgia. The South Caucasus has not only been an arena of intraregional conflicts, but has also often been troubled by disputes between its neighbours. This article argues that, due to a lack of proactive and consistent engagement, the EU’s framework risks leaving regional conflicts in the current state of stagnation and without advancement in regional cooperation.

  7. Regional Differences in Correlates of Daily Walking among Middle Age and Older Australian Rural Adults: Implications for Health Promotion

    Directory of Open Access Journals (Sweden)

    James Dollman

    2016-01-01

    Full Text Available Rural Australians are less physically active than their metropolitan counterparts, and yet very little is known of the candidate intervention targets for promoting physical activity in rural populations. As rural regions are economically, socially and environmentally diverse, drivers of regular physical activity are likely to vary between regions. This study explored the region-specific correlates of daily walking among middle age and older adults in rural regions with contrasting dominant primary industries. Participants were recruited through print and electronic media, primary care settings and community organisations. Pedometers were worn by 153 adults for at least four days, including a weekend day. A questionnaire identified potential intra-personal, social and environmental correlates of physical activity, according to a social ecological framework. Regression modelling identified independent correlates of daily walking separately in the two study regions. In one region, there were independent correlates of walking from all levels of the social ecological framework. In the other region, significant correlates of daily walking were almost all demographic (age, education and marital status. Participants living alone were less likely to be physically active regardless of region. This study highlights the importance of considering region-specific factors when designing strategies for promoting regular walking among rural adults.

  8. Resource potential methods using for efficiency of activities in the region increase

    Directory of Open Access Journals (Sweden)

    M. P. Vasiliev

    2016-01-01

    Full Text Available The article considers impact methods on the economic results, the effectiveness of the regional economic complex should be based on a high quality of the basic characteristics classification of the region state. Application composition techniques to ensure a comprehensive impact on the achievement of this goal should in synthesized form to union, adopt a target orientation of development of the region with the parameters objectively revealing his condition. Ensuring organizational, economic, financial and investment techniques to achieve the planned targets and requires specifying align resource potential of the region with the available capacity of the regional economic complex to promote economic growth, improve the efficiency of operations. The main characteristics of the potential resource opportunities in the region are the skill level of workers, the degree of depreciation of fixed assets and their renewability, increased innovation in the region, its branches and facilities, strengthening of competitive advantages, the annual average number of employees, the cost of fixed and current assets, financial stability. In the region the opportunity to potentially affect the ability of its structural components to achieve the financial and economic performance targets acts as efficiency ability to provide stable dynamics of regional production efficiency, enhance the level of benefits to achieve the planned efficiency used (consumed resource. Applying of certain methods or their entire structure, created to provide a comprehensive impact on the goal achievement, in the synthesized form of target orientation combines regional development with the parameters most objectively revealing his condition. Achieving the appropriate organizational, economic, financial, investment or other measures to achieve planned targets that are expressed by the level of efficiency of activity in the conditions of the most complete involvement and intensity of use in

  9. Press Advertising – Varieties and Sub-Varieties. Methods of Promoting the Press

    OpenAIRE

    Mikosz, Joanna

    2016-01-01

    In the text entitled “Press advertising – varieties and sub-varieties. Methods of promoting the press”, the author discusses press advertising, which is a fast developing mass-media phenomenon. Modernity has granted press advertising a high quality of print and paper, as well as Infinite possibilities of combining various promotional forms with the press. The author argues that press advertising is one of the best ways in which a company can communicate with the market. Its advantage is, abov...

  10. Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

    Science.gov (United States)

    Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

    2014-08-01

    Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

  11. Carcass and meat quality determination as a tool to promote local meat consumption in outermost regions of Europe

    DEFF Research Database (Denmark)

    Hernandez Castellano, Lorenzo E; Morales-delaNuez, Antonio; Moreno-Indias, Isabel

    2013-01-01

    of this study, therefore, was to evaluate local and imported carcasses and meat quality in order to promote the consumption of local breeds, using the Canary Islands (Spain) as a model for other subtropical outermost regions. For this study 20 half-carcasses from Palmera breed and 20 imported half...

  12. Relationship of interleukin-1B gene promoter region polymorphism with Helicobacter pylori infection and gastritis.

    Science.gov (United States)

    Ramis, Ivy Bastos; Vianna, Júlia Silveira; Halicki, Priscila Cristina Bartolomeu; Lara, Caroline; Tadiotto, Thássia Fernanda; da Silva Maciel, João Batista; Gonçalves, Carla Vitola; von Groll, Andrea; Dellagostin, Odir Antônio; da Silva, Pedro Eduardo Almeida

    2015-09-29

    Helicobacter pylori infection is associated with gastritis, peptic ulcer disease and gastric carcinoma. The severity of damage is determined by the interplay between environmental/behavioral factors, bacterial pathogenicity genes and host genetic polymorphisms that can influence the secretion levels of inflammatory cytokines. Accordingly, this study aimed to identify polymorphisms in the IL-1B and IL-1RN genes and their associations with H. pylori infection, cagA gene of H. pylori, and gastroduodenal diseases. Gastric biopsy samples from 151 patients infected with H. pylori and 76 uninfected individuals were analyzed. H. pylori infection was diagnosed by histology and PCR. Polymorphisms at positions -511, -31 and +3954 of the IL-1B gene were detected by PCR-RFLP, and an analysis of the VNTR polymorphism of the IL-1RN gene was performed by PCR. It was observed that the presence of the T/T genotype at position -511 and the C/C genotype at position -31 were associated with H. pylori infection and with an increased risk of gastritis in H. pylori-positive patients. Additionally, strains from patients H. pylori-positive carrying the cagA gene was significantly related with the T/T genotype at position -511 of IL-1B.  No association of polymorphisms at position +3954 of IL-1B and in the IL-1RN with H. pylori infection and with risk of severe gastric diseases was found. We demonstrated that polymorphisms in the promoter region of the IL-1B gene (at positions -511 and -31) are associated with an enhanced risk of H. pylori infection as well as gastritis in H. pylori-positive patients.

  13. Revisiting regional flood frequency analysis in Slovakia: the region-of-influence method vs. traditional regional approaches

    Science.gov (United States)

    Gaál, Ladislav; Kohnová, Silvia; Szolgay, Ján.

    2010-05-01

    During the last 10-15 years, the Slovak hydrologists and water resources managers have been devoting considerable efforts to develop statistical tools for modelling probabilities of flood occurrence in a regional context. Initially, these models followed concepts to regional flood frequency analysis that were based on fixed regions, later the Hosking and Wallis's (HW; 1997) theory was adopted and modified. Nevertheless, it turned out to be that delineating homogeneous regions using these approaches is not a straightforward task, mostly due to the complex orography of the country. In this poster we aim at revisiting flood frequency analyses so far accomplished for Slovakia by adopting one of the pooling approaches, i.e. the region-of-influence (ROI) approach (Burn, 1990). In the ROI approach, unique pooling groups of similar sites are defined for each site under study. The similarity of sites is defined through Euclidean distance in the space of site attributes that had also proved applicability in former cluster analyses: catchment area, afforested area, hydrogeological catchment index and the mean annual precipitation. The homogeneity of the proposed pooling groups is evaluated by the built-in homogeneity test by Lu and Stedinger (1992). Two alternatives of the ROI approach are examined: in the first one the target size of the pooling groups is adjusted to the target return period T of the estimated flood quantiles, while in the other one, the target size is fixed, regardless of the target T. The statistical models of the ROI approach are inter-compared by the conventional regionalization approach based on the HW methodology where the parameters of flood frequency distributions were derived by means of L-moment statistics and a regional formula for the estimation of the index flood was derived by multiple regression methods using physiographic and climatic catchment characteristics. The inter-comparison of different frequency models is evaluated by means of the

  14. A decision support system for the promotion of Employee in Plaza Asia Method Using Weighted Product

    Directory of Open Access Journals (Sweden)

    Egi Badar Sambani

    2016-06-01

    Full Text Available Decision-making in a company is important because decisions taken by managers is the result of a final thought to be carried out by employees. Asia is the largest mall Plaza sepriangan east, where the assessment process includes the promotion employee attendance, productivity (work, integrity (nature, skill (ability and loyalty (faithfulness. Method Using Weighted Product (WP can help in decision-making to determine the promotion of employees in the company, as well as the appraisal process more efficient so the store manager can determine employee promotions quickly. By using decision support system that has a database, employee data can be stored in the database. So that in case of errors in inputting can be corrected without having to re-enter the data. With the Decision Support System will address the issues raised in the Plaza Asia, so the promotion process will be faster.

  15. Coordinated Optimal Operation Method of the Regional Energy Internet

    Directory of Open Access Journals (Sweden)

    Rishang Long

    2017-05-01

    Full Text Available The development of the energy internet has become one of the key ways to solve the energy crisis. This paper studies the system architecture, energy flow characteristics and coordinated optimization method of the regional energy internet. Considering the heat-to-electric ratio of a combined cooling, heating and power unit, energy storage life and real-time electricity price, a double-layer optimal scheduling model is proposed, which includes economic and environmental benefit in the upper layer and energy efficiency in the lower layer. A particle swarm optimizer–individual variation ant colony optimization algorithm is used to solve the computational efficiency and accuracy. Through the calculation and simulation of the simulated system, the energy savings, level of environmental protection and economic optimal dispatching scheme are realized.

  16. RNA polymerase II interacts with the promoter region of the noninduced hsp70 gene in Drosophila melanogaster cells

    International Nuclear Information System (INIS)

    Gilmour, D.S.; Lis, J.T.

    1986-01-01

    By using a protein-DNA cross-linking method, we examined the in vivo distribution of RNA polymerase II on the hsp70 heat shock gene in Drosophila melanogaster Schneider line 2 cells. In heat shock-induced cells, a high level of RNA polymerase II was detected on the entire gene, while in noninduced cells, the RNA polymerase II was confined to the 5' end of the hsp70 gene, predominantly between nucleotides -12 and +65 relative to the start of transcription. This association of RNA polymerase II was apparent whether the cross-linking was performed by a 10-min UV irradiation of chilled cells with mercury vapor lamps or by a 40-microsecond irradiation of cells with a high-energy xenon flash lamp. We hypothesize that RNA polymerase II has access to, and a high affinity for, the promoter region of this gene before induction, and this poised RNA polymerase II may be critical in the mechanism of transcription activation

  17. Building a competitive regional innovation environment : the regional development platform method as a tool for regional innovation policy

    OpenAIRE

    Harmaakorpi, Vesa

    2004-01-01

    The study focuses on building a regional innovation policy tool that takes into account the demands of the present techno-economic and socio-institutional paradigms. Regions are seen to be strongly dependent on their history. The competitiveness of a region is based on the regional resource configurations. In a turbulent world these resource configurations have to be renewed over time setting demands for regional dynamic capabilities. This study emphasises five regional dynamic capabilities: ...

  18. Clinicopathological risk factor distributions for MLH1 promoter region methylation in CIMP positive tumors

    Science.gov (United States)

    Levine, A. Joan; Phipps, Amanda I.; Baron, John A.; Buchanan, Daniel D.; Ahnen, Dennis J.; Cohen, Stacey A.; Lindor, Noralane M.; Newcomb, Polly A.; Rosty, Christophe; Haile, Robert W.; Laird, Peter W.; Weisenberger, Daniel J.

    2015-01-01

    Background The CpG Island Methylator Phenotype (CIMP) is a major molecular pathway in colorectal cancer (CRC). Approximately 25% to 60% of CIMP tumors are microsatellite unstable (MSI-H) due to DNA hypermethylation of the MLH1 gene promoter. Our aim was to determine if the distributions of clinicopathologic factors in CIMP-positive tumors with MLH1 DNA methylation differed from those in CIMP-positive tumors without DNA methylation of MLH1. Methods We assessed the associations between age, sex, tumor-site, MSI status BRAF and KRAS mutations and family CRC history with MLH1 methylation status in a large population-based sample of CIMP-positive CRCs defined by a 5-marker panel using unconditional logistic regression to assess the odds of MLH1 methylation by study variables. Results Subjects with CIMP-positive tumors without MLH1 methylation were significantly younger, more likely to be male, more likely to have distal colon or rectal primaries and the MSI-L phenotype. CIMP-positive MLH1-unmethylated tumors were significantly less likely than CIMP-positive MLH1-methylated tumors to harbor a BRAF V600E mutation and significantly more likely to harbor a KRAS mutation. MLH1 methylation was associated with significantly better overall survival (HR=0.50; 95% Confidence Interval (0.31, 0.82)). Conclusions These data suggest that MLH1 methylation in CIMP-positive tumors is not a completely random event and implies that there are environmental or genetic determinants that modify the probability that MLH1 will become methylated during CIMP pathogenesis. Impact MLH1 DNA methylation status should be taken into account in etiologic studies. PMID:26512054

  19. New PAH gene promoter KLF1 and 3'-region C/EBPalpha motifs influence transcription in vitro.

    Science.gov (United States)

    Klaassen, Kristel; Stankovic, Biljana; Kotur, Nikola; Djordjevic, Maja; Zukic, Branka; Nikcevic, Gordana; Ugrin, Milena; Spasovski, Vesna; Srzentic, Sanja; Pavlovic, Sonja; Stojiljkovic, Maja

    2017-02-01

    Phenylketonuria (PKU) is a metabolic disease caused by mutations in the phenylalanine hydroxylase (PAH) gene. Although the PAH genotype remains the main determinant of PKU phenotype severity, genotype-phenotype inconsistencies have been reported. In this study, we focused on unanalysed sequences in non-coding PAH gene regions to assess their possible influence on the PKU phenotype. We transiently transfected HepG2 cells with various chloramphenicol acetyl transferase (CAT) reporter constructs which included PAH gene non-coding regions. Selected non-coding regions were indicated by in silico prediction to contain transcription factor binding sites. Furthermore, electrophoretic mobility shift assay (EMSA) and supershift assays were performed to identify which transcriptional factors were engaged in the interaction. We found novel KLF1 motif in the PAH promoter, which decreases CAT activity by 50 % in comparison to basal transcription in vitro. The cytosine at the c.-170 promoter position creates an additional binding site for the protein complex involving KLF1 transcription factor. Moreover, we assessed for the first time the role of a multivariant variable number tandem repeat (VNTR) region located in the 3'-region of the PAH gene. We found that the VNTR3, VNTR7 and VNTR8 constructs had approximately 60 % of CAT activity. The regulation is mediated by the C/EBPalpha transcription factor, present in protein complex binding to VNTR3. Our study highlighted two novel promoter KLF1 and 3'-region C/EBPalpha motifs in the PAH gene which decrease transcription in vitro and, thus, could be considered as PAH expression modifiers. New transcription motifs in non-coding regions will contribute to better understanding of the PKU phenotype complexity and may become important for the optimisation of PKU treatment.

  20. TOLERANCE OF REGIONAL HIGH SCHOOL STUDENTS: ASSESSMENT AND DEVELOPMENT METHODS

    Directory of Open Access Journals (Sweden)

    Elena V. Kalachinskaya

    2015-01-01

    Full Text Available The purpose of the investigation is to define the quality and tolerance level among students; and generalize pedagogical experience of intercultural tolerance formation (as exemplified in Vladivostok State University of Economics and Service.Methods. Theoretical methods of research involve analysis of approaches and results of tolerance among young people; Practical methods – content analysis of the essay content on a given topic, questioning. An empirical case study, described in this article, was carried out by questionnaire survey of 200 VSUES (Vladivostok State University of Economics and Service students from 2–3 courses of various undergraduate training areas.Scientific novelty. The level of students’ tolerant attitude to a series of countries and their residents is specified; combined with the respondents’ knowledge on these countries. Most distinctive students’ views on the «tolerance» concept and reasons for their intolerant behavior are analyzed and presented in this article. Pedagogical and educational technologies used by University for the youth tolerance formation are summarized.Results. Based on the survey, the issues such as limits of applicability of “tolerance” concept in students’ perception, declarative and real tolerance level, and tolerance level to certain countries, as well as in business are investigated. According to the survey, the author makes the conclusion of correlation existence between level of tolerance towards country (nation and level of awareness of it. The author has analysed the students’ essays on tolerance problems; and it was found out that international relations are the most relevant aspect to respondents of tolerant or intolerant behavior. Results of students’ sociological research are compared with results of surveys on similar topics made by All-Russia Public Opinion Research Center and other researchers. Implemented VSUES projects aimed at creating and promoting tolerance

  1. Exploring DNA methylation changes in promoter, intragenic, and intergenic regions as early and late events in breast cancer formation

    International Nuclear Information System (INIS)

    Rauscher, Garth H.; Kresovich, Jacob K.; Poulin, Matthew; Yan, Liying; Macias, Virgilia; Mahmoud, Abeer M.; Al-Alem, Umaima; Kajdacsy-Balla, Andre; Wiley, Elizabeth L.; Tonetti, Debra; Ehrlich, Melanie

    2015-01-01

    Breast cancer formation is associated with frequent changes in DNA methylation but the extent of very early alterations in DNA methylation and the biological significance of cancer-associated epigenetic changes need further elucidation. Pyrosequencing was done on bisulfite-treated DNA from formalin-fixed, paraffin-embedded sections containing invasive tumor and paired samples of histologically normal tissue adjacent to the cancers as well as control reduction mammoplasty samples from unaffected women. The DNA regions studied were promoters (BRCA1, CD44, ESR1, GSTM2, GSTP1, MAGEA1, MSI1, NFE2L3, RASSF1A, RUNX3, SIX3 and TFF1), far-upstream regions (EN1, PAX3, PITX2, and SGK1), introns (APC, EGFR, LHX2, RFX1 and SOX9) and the LINE-1 and satellite 2 DNA repeats. These choices were based upon previous literature or publicly available DNA methylome profiles. The percent methylation was averaged across neighboring CpG sites. Most of the assayed gene regions displayed hypermethylation in cancer vs. adjacent tissue but the TFF1 and MAGEA1 regions were significantly hypomethylated (p ≤0.001). Importantly, six of the 16 regions examined in a large collection of patients (105 – 129) and in 15-18 reduction mammoplasty samples were already aberrantly methylated in adjacent, histologically normal tissue vs. non-cancerous mammoplasty samples (p ≤0.01). In addition, examination of transcriptome and DNA methylation databases indicated that methylation at three non-promoter regions (far-upstream EN1 and PITX2 and intronic LHX2) was associated with higher gene expression, unlike the inverse associations between cancer DNA hypermethylation and cancer-altered gene expression usually reported. These three non-promoter regions also exhibited normal tissue-specific hypermethylation positively associated with differentiation-related gene expression (in muscle progenitor cells vs. many other types of normal cells). The importance of considering the exact DNA region analyzed and the

  2. Natural selection in a population of Drosophila melanogaster explained by changes in gene expression caused by sequence variation in core promoter regions.

    Science.gov (United States)

    Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado

    2016-02-09

    Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning

  3. Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III

    OpenAIRE

    Matsutani Sachiko

    2004-01-01

    Abstract Background In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFII...

  4. Seismic data two-step recovery approach combining sparsity-promoting and hyperbolic Radon transform methods

    International Nuclear Information System (INIS)

    Wang, Hanchuang; Chen, Shengchang; Ren, Haoran; Liang, Donghui; Zhou, Huamin; She, Deping

    2015-01-01

    In current research of seismic data recovery problems, the sparsity-promoting method usually produces an insufficient recovery result at the locations of null traces. The HRT (hyperbolic Radon transform) method can be applied to problems of seismic data recovery with approximately hyperbolic events. Influenced by deviations of hyperbolic characteristics between real and ideal travel-time curves, some spurious events are usually introduced and the recovery effect of intermediate and far-offset traces is worse than that of near-offset traces. Sparsity-promoting recovery is primarily dependent on the sparsity of seismic data in the sparse transform domain (i.e. on the local waveform characteristics), whereas HRT recovery is severely affected by the global characteristics of the seismic events. Inspired by the above conclusion, a two-step recovery approach combining sparsity-promoting and time-invariant HRT methods is proposed, which is based on both local and global characteristics of the seismic data. Two implementation strategies are presented in detail, and the selection criteria of the relevant strategies is also discussed. Numerical examples of synthetic and real data verify that the new approach can achieve a better recovery effect by simultaneously overcoming the shortcomings of sparsity-promoting recovery and HRT recovery. (paper)

  5. Promoting effect of ethanol on dewetting transition in the confined region of melittin tetramer

    International Nuclear Information System (INIS)

    Ren Xiuping; Zhou Bo; Wang Chunlei

    2012-01-01

    To study the influence of ethanol molecules on the melittin tetramer folding, we investigated the dewetting transition of the melittin tetramer immersed in pure water and 8% aqueous ethanol solution (mass fraction) by the molecular dynamics simulations. We found that the marked dewetting transitions occurred inside a nanoscale channel of the melittin tetramer both in pure water and in aqueous ethanol solution. Also, ethanol molecules promoted this dewetting transition. We attributed this promoting effect to ethanol molecules which prefer to locate at the liquid-vapor interface and decrease the liquid-vapor surface energy. The results provide insight into the effect of ethanol on the water dewetting phenomena. (authors)

  6. A Participatory Regional Partnership Approach to Promote Nutrition and Physical Activity Through Environmental and Policy Change in Rural Missouri.

    Science.gov (United States)

    Barnidge, Ellen K; Baker, Elizabeth A; Estlund, Amy; Motton, Freda; Hipp, Pamela R; Brownson, Ross C

    2015-06-11

    Rural residents are less likely than urban and suburban residents to meet recommendations for nutrition and physical activity. Interventions at the environmental and policy level create environments that support healthy eating and physical activity. Healthier Missouri Communities (Healthier MO) is a community-based research project conducted by the Prevention Research Center in St. Louis with community partners from 12 counties in rural southeast Missouri. We created a regional partnership to leverage resources and enhance environmental and policy interventions to improve nutrition and physical activity in rural southeast Missouri. Partners were engaged in a participatory action planning process that included prioritizing, implementing, and evaluating promising evidence-based interventions to promote nutrition and physical activity. Group interviews were conducted with Healthier MO community partners post intervention to evaluate resource sharing and sustainability efforts of the regional partnership. Community partners identified the benefits and challenges of resource sharing within the regional partnership as well as the opportunities and threats to long-term partnership sustainability. The partners noted that the regional participatory process was difficult, but the benefits outweighed the challenges. Regional rural partnerships may be an effective way to leverage relationships to increase the capacity of rural communities to implement environmental and policy interventions to promote nutrition and physical activity.

  7. Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents.

    Science.gov (United States)

    Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z

    2014-03-01

    The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P alkylating agents.

  8. A method in search of a theory: peer education and health promotion.

    Science.gov (United States)

    Turner, G; Shepherd, J

    1999-04-01

    Peer education has grown in popularity and practice in recent years in the field of health promotion. However, advocates of peer education rarely make reference to theories in their rationale for particular projects. In this paper the authors review a selection of commonly cited theories, and examine to what extent they have value and relevance to peer education in health promotion. Beginning from an identification of 10 claims made for peer education, each theory is examined in terms of the scope of the theory and evidence to support it in practice. The authors conclude that, whilst most theories have something to offer towards an explanation of why peer education might be effective, most theories are limited in scope and there is little empirical evidence in health promotion practice to support them. Peer education would seem to be a method in search of a theory rather than the application of theory to practice.

  9. Construction Method of Display Proposal for Commodities in Sales Promotion by Genetic Algorithm

    Science.gov (United States)

    Yumoto, Masaki

    In a sales promotion task, wholesaler prepares and presents the display proposal for commodities in order to negotiate with retailer's buyers what commodities they should sell. For automating the sales promotion tasks, the proposal has to be constructed according to the target retailer's buyer. However, it is difficult to construct the proposal suitable for the target retail store because of too much combination of commodities. This paper proposes a construction method by Genetic algorithm (GA). The proposed method represents initial display proposals for commodities with genes, improve ones with the evaluation value by GA, and rearrange one with the highest evaluation value according to the classification of commodity. Through practical experiment, we can confirm that display proposal by the proposed method is similar with the one constructed by a wholesaler.

  10. Evaluation of methylation pattern in promoter region of E-cadherin ...

    African Journals Online (AJOL)

    user

    2011-03-07

    Mar 7, 2011 ... promoter methylation in CDH1 gene inactivation in breast cancer, the CpG methylation status of E- ..... 5'CpG island of CDH1 in prostate, lung, liver, bladder, .... and estrogen receptor alpha from Sp1 sites to induce cell cycle.

  11. The effect of mutations in the AmpC promoter region on β-lactam ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-08-04

    Aug 4, 2008 ... between the -10 and -35 boxes affects the resistance of bacteria to β-lactam antibiotics. .... The chromosomal cephalosporinase gene, ampC, of E. .... mutation in the ampC promoter increasing resistance to β-lactams in.

  12. Regional collaborations and indigenous innovation capabilities in China: A multivariate method for the analysis of regional innovation systems

    OpenAIRE

    Zhao, S.L.; Cacciolatti, L.; Lee, Soo Hee; Song, W.

    2014-01-01

    In this study we analyse the emerging patterns of regional collaboration for innovation projects in China, using official government statistics of 30 Chinese regions. We propose the use of Ordinal Multidimensional Scaling and Cluster analysis as a robust method to study regional innovation systems. Our results show that regional collaborations amongst organisations can be categorised by means of eight dimensions: public versus private organisational mindset; public versus private resources; i...

  13. Promoting University and Industry Links at the Regional Level: Comparing China's Reform and International Experience

    Science.gov (United States)

    Po, Yang; Cai, Yuzhuo; Lyytinen, Anu; Hölttä, Seppo

    2016-01-01

    This paper intends to learn from international experiences in order to facilitating China's ongoing regional university transformation with an ultimate goal to enhance the role of university in regional economic development and innovation. In so doing, this paper compares major models of universities of applied sciences (UAS) around the world from…

  14. Murine leukemia virus vector integration favors promoter regions and regional hot spots in a human T-cell line

    International Nuclear Information System (INIS)

    Tsukahara, Tomonori; Agawa, Hideyuki; Matsumoto, Sayori; Matsuda, Mizuho; Ueno, Shuichi; Yamashita, Yuki; Yamada, Koichiro; Tanaka, Nobuyuki; Kojima, Katsuhiko; Takeshita, Toshikazu

    2006-01-01

    Genomic analysis of integration will be important in evaluating the safety of human gene therapy with retroviral vectors. Here, we investigated MLV vector integration sites in human T-cells, since they are amenable to gene transfer studies, and have been used therapeutically in clinical trials. We mapped 340 MLV vector integration sites in the infected human T-cell clones we established. The data showed that MLV preferred integration near the transcription start sites (±5 kb), near CpG islands (±1 kb), and within the first intron of RefSeq genes. We also identified MLV integration hot spots that contained three or more integrations within a 100 kb region. RT-PCR revealed that mRNA-levels of T-cell clones that contained MLV integrations near transcription start sites or introns were dysregulated compared to the uninfected cells. These studies help define the profile of MLV integration in T-cells and the risks associated with MLV-based gene therapy

  15. Evaluation methods for physical activity-promoting mobile technologies: an interdisciplinary scoping review

    Directory of Open Access Journals (Sweden)

    Claire McCallum

    2015-10-01

    Full Text Available There are many thousands of mobile apps, wearables and other technologies available to support and promote physical activity. However, the rapidly evolving nature of these technologies means that the methodologies traditionally used to evaluate the effectiveness of behaviour change interventions (such as the randomised controlled trial may not be appropriate to evaluate their effectiveness. A scoping review was conducted to identify the methods currently being used to evaluate physical activity-promoting mobile technologies across health and computing science disciplines. In addition to the range of methods used, the review explored their strengths and weaknesses. The results improve understandings of when and why to use existing methods from health and computing science. Opportunities for combining and hybridising methods across the two disciplines are also identified. The review will be used to inform the development and piloting of novel, ‘fit-for-purpose’ research designs that will allow rigorous evaluation of the effectiveness of rapidly-evolving physical activity-promoting mobile technologies and their ‘active ingredients’ to build an evidence base of what works, why and for whom.

  16. Promoting survival: A grounded theory study of consequences of modern health practices in Ouramanat region of Iranian Kurdistan.

    Science.gov (United States)

    Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul

    2010-05-14

    The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society.

  17. Promoting survival: A grounded theory study of consequences of modern health practices in Ouramanat region of Iranian Kurdistan

    Science.gov (United States)

    Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul

    2010-01-01

    The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society. PMID:20640020

  18. Analysis of the Impact of the Flow of Migrant Workers on Regional Economy: Based on the Thought about the Promotion of Jiangxi Regional Economic Competitiveness

    Directory of Open Access Journals (Sweden)

    Sun Yuping

    2016-03-01

    Full Text Available Labor resource is the necessary productive factor in regional economic development, and one of important indexes to evaluate regional economic competitiveness. The great economic achievement brought by the 30-year reform and opening up of China is due to the fact that China brought the backward advantage of “demographic dividend” into play, promoted the fast development of industrialization and urbanization, and became the second largest economy in the world. The entity of “demographic dividend” is the non-agricultural migrant population, i.e., migrant workers. The transfer employment of migrant workers has typical regional liquidity, and the imbalance of regional economy causes the flow of many migrant workers. In order to achieve harmonious development and coordinated development, underdeveloped areas must understand the character and regulation, adopt positive industrial policy and supportive policy, guide the reasonable flow of migrant workers, and realize the transfer of local employment and citizenization of migrant workers, which can enhance regional economic competitiveness

  19. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-12-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  20. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-01-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  1. Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels.

    Directory of Open Access Journals (Sweden)

    Xian-E Peng

    Full Text Available Liver fatty acid-binding protein (L-FABP, also known as fatty acid-binding protein 1 (FABP1, is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182 from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032.Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05. The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01. In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003, while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014. Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans.

  2. DNMT 1 maintains hypermethylation of CAG promoter specific region and prevents expression of exogenous gene in fat-1 transgenic sheep.

    Science.gov (United States)

    Yang, Chunrong; Shang, Xueying; Cheng, Lei; Yang, Lei; Liu, Xuefei; Bai, Chunling; Wei, Zhuying; Hua, Jinlian; Li, Guangpeng

    2017-01-01

    Methylation is an important issue in gene expression regulation and also in the fields of genetics and reproduction. In this study, we created fat-1 transgenic sheep, investigated the fine-mapping and the modulatory mechanisms of promoter methylation. Sheep fetal fibroblasts were transfected by pCAG-fat1-IRES-EGFP. Monoclonal cell line was screened as nuclear donor and carried out nuclear transfer (441 transgenic cloned embryos, 52 synchronism recipient sheep). Six offsprings were obtained. Expressions of exogenous genes fat-1 and EGFP were detectable in 10 examined tissues and upregulated omega-3 fatty acid content. Interestingly, more or less EGFP negative cells were detectable in the positive transgenic fetal skin cells. EGFP negative and positive cells were sorted by flow cytometry, and their methylation status in the whole promoter region (1701 nt) were investigated by bisulphate sequencing. The fine-mapping of methylation in CAG promoter were proposed. The results suggested that exogenous gene expression was determined by the methylation status from 721-1346 nt and modulated by methylation levels at 101, 108 and 115 nt sites in CAG promoter. To clarify the regulatory mechanism of methylation, examination of four DNA methyltransferases (DNMTs) demonstrated that hypermethylation of CAG promoter is mainly maintained by DNMT 1 in EGFP negative cells. Furthermore, investigation of the cell surface antigen CD34, CD45 and CD166 indicated that EGFP positive and negative cells belong to different types. The present study systematically clarified methylation status of CAG promoter in transgenic sheep and regulatory mechanism, which will provide research strategies for gene expression regulation in transgenic animals.

  3. An Innovative Teaching Method To Promote Active Learning: Team-Based Learning

    Science.gov (United States)

    Balasubramanian, R.

    2007-12-01

    Traditional teaching practice based on the textbook-whiteboard- lecture-homework-test paradigm is not very effective in helping students with diverse academic backgrounds achieve higher-order critical thinking skills such as analysis, synthesis, and evaluation. Consequently, there is a critical need for developing a new pedagogical approach to create a collaborative and interactive learning environment in which students with complementary academic backgrounds and learning skills can work together to enhance their learning outcomes. In this presentation, I will discuss an innovative teaching method ('Team-Based Learning (TBL)") which I recently developed at National University of Singapore to promote active learning among students in the environmental engineering program with learning abilities. I implemented this new educational activity in a graduate course. Student feedback indicates that this pedagogical approach is appealing to most students, and promotes active & interactive learning in class. Data will be presented to show that the innovative teaching method has contributed to improved student learning and achievement.

  4. Developing regionally specific grazing practices to promote production, profitability, and environmental quality

    Science.gov (United States)

    Rangelands are valued for their capacity to provide diverse suites of ecosystem services, from food production to carbon storage to biological diversity. Although rangelands worldwide share common characteristics, differences among biogeographic regions result in differences in the types of opportun...

  5. Cytosine deletion at AP2-box region of HSP70 promoter and its ...

    Indian Academy of Sciences (India)

    of thermotolerance in cells (Leung et al. 1996). ... region of HSP70 significantly affected cellular thermotol- erance ... The double PCR-RFLP using ScrFI confirmed the occur- ... suade of HSP70 on defense of proteins related to respiration.

  6. Regional differences in gene expression and promoter usage in aged human brains

    KAUST Repository

    Pardo, Luba M.; Rizzu, Patrizia; Francescatto, Margherita; Vitezic, Morana; Leday, Gwenaë l G.R.; Sanchez, Javier Simon; Khamis, Abdullah M.; Takahashi, Hazuki; van de Berg, Wilma D.J.; Medvedeva, Yulia A.; van de Wiel, Mark A.; Daub, Carsten O.; Carninci, Piero; Heutink, Peter

    2013-01-01

    To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites

  7. Prognostic value of three different methods of MGMT promoter methylation analysis in a prospective trial on newly diagnosed glioblastoma.

    Directory of Open Access Journals (Sweden)

    Arne Christians

    Full Text Available Hypermethylation in the promoter region of the MGMT gene encoding the DNA repair protein O(6-methylguanine-DNA methyltransferase is among the most important prognostic factors for patients with glioblastoma and predicts response to treatment with alkylating agents like temozolomide. Hence, the MGMT status is widely determined in most clinical trials and frequently requested in routine diagnostics of glioblastoma. Since various different techniques are available for MGMT promoter methylation analysis, a generally accepted consensus as to the most suitable diagnostic method remains an unmet need. Here, we assessed methylation-specific polymerase chain reaction (MSP as a qualitative and semi-quantitative method, pyrosequencing (PSQ as a quantitative method, and methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA as a semi-quantitative method in a series of 35 formalin-fixed, paraffin-embedded glioblastoma tissues derived from patients treated in a prospective clinical phase II trial that tested up-front chemoradiotherapy with dose-intensified temozolomide (UKT-05. Our goal was to determine which of these three diagnostic methods provides the most accurate prediction of progression-free survival (PFS. The MGMT promoter methylation status was assessable by each method in almost all cases (n = 33/35 for MSP; n = 35/35 for PSQ; n = 34/35 for MS-MLPA. We were able to calculate significant cut-points for the continuous methylation signals at each CpG site analysed by PSQ (range, 11.5 to 44.9% and at one CpG site assessed by MS-MLPA (3.6% indicating that a dichotomisation of continuous methylation data as a prerequisite for comparative survival analyses is feasible. Our results show that, unlike MS-MLPA, MSP and PSQ provide a significant improvement of predicting PFS compared with established clinical prognostic factors alone (likelihood ratio tests: p<0.001. Conclusively, taking into consideration prognostic value

  8. Development of model for studies on momentum transfer in electrochemical cells with entry region coil as turbulence promoter

    Science.gov (United States)

    Penta Rao, Tamarba; Rajendra Prasad, P.

    2018-04-01

    Entry region swirl promoters gain importance in industry because of its effectiveness in augmentation of mass and heat transfer augmentation. Design of equipment needs momentum transfer data along with mass or heat transfer data. Hence an experimental investigation was carried out with coaxially placed entry region spiral coil as turbulence promoters on momentum transfer in forced convection flow of electrolyte in circular conduits. Aqueous solution of sodium hydroxide and 0.01 M equimolal Ferri-ferro cyanide system was chosen for the study. The study covered parameters like effect of pitch of the coil, effect of length of the coil, diameter of the coil, diameter of the coil wire, diameter of the annular rod. The promoter is measured by limiting current technique using diffusion controlled electrochemical reactions. The study comprises of evaluation of momentum transfer rates at the outer wall of the electrochemical cell. Pressure drop measurements were also made to obtain the energy consumption pattern. Within the range of variables covered. The results are correlated by the momentum transfer similarity function. Momentum transfer coefficients were evaluated from measured limiting currents. Effect of each parameter was studied in terms of friction factor. A model was developed for momentum transfer. The experimental data on momentum transfer was modeled in terms of momentum transfer function and Reynolds number, geometric parameters.

  9. No evidence for promoter region methylation of the succinate dehydrogenase and fumarate hydratase tumour suppressor genes in breast cancer

    Directory of Open Access Journals (Sweden)

    Dobrovic Alexander

    2009-09-01

    Full Text Available Abstract Background Succinate dehydrogenase (SDH and fumarate hydratase (FH are tricarboxylic acid (TCA cycle enzymes that are also known to act as tumour suppressor genes. Increased succinate or fumarate levels as a consequence of SDH and FH deficiency inhibit hypoxia inducible factor-1α (HIF-1α prolyl hydroxylases leading to sustained HIF-1α expression in tumours. Since HIF-1α is frequently expressed in breast carcinomas, DNA methylation at the promoter regions of the SDHA, SDHB, SDHC and SDHD and FH genes was evaluated as a possible mechanism in silencing of SDH and FH expression in breast carcinomas. Findings No DNA methylation was identified in the promoter regions of the SDHA, SDHB, SDHC, SDHD and FH genes in 72 breast carcinomas and 10 breast cancer cell lines using methylation-sensitive high resolution melting which detects both homogeneous and heterogeneous methylation. Conclusion These results show that inactivation via DNA methylation of the promoter CpG islands of SDH and FH is unlikely to play a major role in sporadic breast carcinomas.

  10. Assessing Health Promotion Interventions: Limitations of Traditional Research Methods in Community-Based Studies.

    Science.gov (United States)

    Dressel, Anne; Schneider, Robert; DeNomie, Melissa; Kusch, Jennifer; Welch, Whitney; Sosa, Mirtha; Yeldell, Sally; Maida, Tatiana; Wineberg, Jessica; Holt, Keith; Bernstein, Rebecca

    2017-09-01

    Most low-income Americans fail to meet physical activity recommendations. Inactivity and poor diet contribute to obesity, a risk factor for multiple chronic diseases. Health promotion activities have the potential to improve health outcomes for low-income populations. Measuring the effectiveness of these activities, however, can be challenging in community settings. A "Biking for Health" study tested the impact of a bicycling intervention on overweight or obese low-income Latino and African American adults to reduce barriers to cycling and increase physical activity and fitness. A randomized controlled trial was conducted in Milwaukee, Wisconsin, in summer 2015. A 12-week bicycling intervention was implemented at two sites with low-income, overweight, or obese Latino and African American adults. We found that randomized controlled trial methodology was suboptimal for use in this small pilot study and that it negatively affected participation. More discussion is needed about the effectiveness of using traditional research methods in community settings to assess the effectiveness of health promotion interventions. Modifications or alternative methods may yield better results. The aim of this article is to discuss the effectiveness and feasibility of using traditional research methods to assess health promotion interventions in community-based settings.

  11. Determination of single-nucleotide polymorphism in the proximal promoter region of apolipoprotein M gene in coronary artery diseases

    Directory of Open Access Journals (Sweden)

    Lu Zheng

    2009-09-01

    Full Text Available Lu Zheng1, Guanghua Luo1, Xiaoying Zhang1, Jun Zhang1, Jiang Zhu1, Jiang Wei1, Qinfeng Mu1, Lujun Chen1, Peter Nilsson-Ehle2, Ning Xu21Comprehensive Laboratory, The Third Affiliated Hospital, Suzhou University, Changzhou China; 2Division of Clinical Chemistry and Pharmacology, Department of Laboratory Medicine, Lund University, Lund, SwedenObjective: It has been reported that single-nucleotide polymorphism (SNP in the proximal promoter region of apolipoprotein M (apoM gene may confer the risk in the development of type 2 diabetes (T2D and coronary artery disease (CAD in the Han Chinese. However, in a recent study demonstrated that plasma apoM level did not correlated to the coronary heart disease. In the present studies, we investigated the SNP T-778C of apoM gene in CAD patients and controls in the Han Chinese population. Moreover we examined whether serum apoM levels could be influenced by this promoter mutation.Material and methods: One hundred twenty-six CAD patients and 118 non-CAD patients were subjected in the present study. All patients were confirmed by the angiography. The genotyping of polymorphisms T-778C in apoM promoter was determined by real-time polymerase chain reaction. Serum apoM levels were semi-quantitatively determined by the dot-blotting analysis. Results: Distribution of apoM T-778C genotype in non-CAD patients was as following: 84.7% were T/T, 15.3% were T/C and 0.0% was C/C. T allele frequencies were 92.4% and C allele, 7.6%. In the CAD patients, 99 patients (78.6% had the T/T genotype, 25 patients (19.8% with T/C genotype and 2 patients (1.6% with C/C genotype. The allele frequency was 88.5% for the T allele and 11.5% for the C allele. There was no statistical significant difference of serum apoM levels found in these three genotypes.Conclusions: There was no significant difference in allele or genotype frequencies between CAD patients and non-CAD patients. Binary logistic regression analysis with adjustments for age

  12. Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III

    Directory of Open Access Journals (Sweden)

    Matsutani Sachiko

    2004-08-01

    Full Text Available Abstract Background In eukaryotes, RNA polymerase III (RNAP III transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs. The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Results Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Conclusion Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and α-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants

  13. Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III.

    Science.gov (United States)

    Matsutani, Sachiko

    2004-08-09

    In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.

  14. Hypermethylation of the FANCC and FANCL Promoter Regions in Sporadic Acute Leukaemia

    Directory of Open Access Journals (Sweden)

    C. J. Hess

    2008-01-01

    Full Text Available Objective: Inactivation of the FA-BRCA pathway results in chromosomal instability. Fanconi anaemia (FA patients have an inherited defect in this pathway and are strongly predisposed to the development of acute myeloid leukaemia (AML. Studies in sporadic cancers have shown promoter methylation of the FANCF gene in a significant proportion of various solid tumours. However, only a single leukaemic case with methylation of one of the FA-BRCA genes has been described to date, i.e. methylation of FANCF in cell line CHRF-288. We investigated the presence of aberrant methylation in 11 FA-BRCA genes in sporadic cases of leukaemia.

  15. CAGE-defined promoter regions of the genes implicated in Rett Syndrome

    DEFF Research Database (Denmark)

    Vitezic, Morana; Bertin, Nicolas; Andersson, Robin

    2014-01-01

    BACKGROUND: Mutations in three functionally diverse genes cause Rett Syndrome. Although the functions of Forkhead box G1 (FOXG1), Methyl CpG binding protein 2 (MECP2) and Cyclin-dependent kinase-like 5 (CDKL5) have been studied individually, not much is known about their relation to each other...... reveal the predominantly used transcription start sites (TSSs) for each gene including novel transcription start sites for FOXG1. We show that FOXG1 expression is poorly correlated with the expression of MECP2 and CDKL5. We identify promoter shapes for each TSS, the predicted location of enhancers...

  16. Fish farming as an innovative strategy for promoting food security in drought risk regions of Zimbabwe

    Directory of Open Access Journals (Sweden)

    Elvin Shava

    2017-11-01

    Full Text Available This article examines the implementation of fish farming as an innovative and economic strategy for promoting food security and dietary diversities among vulnerable households in drought risk areas of Zimbabwe. The declining climatic conditions and lack of economic opportunities in Mwenezi district of Zimbabwe attracted the attention of three nongovernmental organisations (NGOs to implement fish farming as an innovative mechanism to stimulate food security and generate employment in the district. The article used a qualitative research approach that includes semi-structured interviews and secondary data. The purposive sampling technique was adopted to interview participants in Mwenezi district who were involved in fish farming to assess and explore the experiences and benefits they derive from such development projects. Results for the article revealed that fish farming was well embraced by local communities as it led to improvements in food security, household income and employment regeneration. The local government including traditional leadership (Chiefs and Headmen’s supported the NGO activities as they benefited local communities. The article concludes that although fish farming was instrumental in regenerating employment, some participants still fail to participate because of laziness and desire to maintain dependency syndrome. The article recommends the NGOs to launch awareness campaigns in rural communities and increase networking with the donor community which is fundamental in attracting sustainable funding. The government can also promote fish farming in vulnerable rural communities by providing funding and capacity building programmes.

  17. Methodical Approaches to Risk Management in a Regional Commercial Bank

    Directory of Open Access Journals (Sweden)

    Elena Vladimirovna Altukhova

    2016-03-01

    Full Text Available The article presents the results of the research of the methodological and information infrastructure of the integrated risk management in a regional commercial bank. Within the study of the general development tendencies of the regional banking services market, the most significant risks for a regional bank are revealed. The analysis is carried out on the basis of the stress testing technique developed at the Plekhanov Russian University of Economics. It is based on a technique of dynamic economic and mathematical modeling with the application of information technologies. The created combination of the methodological and instrumental tools allows to carry out the dynamic scenario analysis of the activity of a commercial bank for the identification of potential risks and for the development of the strategy of financial management reducing the potential risks and leveling the consequences of their realization. The received tool allows during the computer test to watch the predicted dynamics of the condition of the key indicators of the activity of a regional commercial bank changing under the influence of the exogenous regulatory measures and instruments of bank management applied to decrease risk and at the same time to introduce adjustments in the perspective strategy of management. As the result of the analysis, the universal management model of the main bank risks in a regional commercial bank within three alternative scenarios is created. The software product allowing to develop and acquire the practical skills of the students in banking is developed. It also may help to develop the methodological support for the regulation of the organizational procedures of risk management in a regional commercial bank. The received software product may be used in a system of the improving the professional skills, and also for obtaining the expected data in a risk management system in a regional commercial bank.

  18. Variability in the precore and core promoter regions of HBV strains in Morocco: characterization and impact on liver disease progression.

    Directory of Open Access Journals (Sweden)

    Bouchra Kitab

    Full Text Available BACKGROUND: Hepatitis B virus (HBV is one of the most common human pathogens that cause aggressive hepatitis and advanced liver disease (AdLD, including liver cirrhosis and Hepatocellular Carcinoma. The persistence of active HBV replication and liver damage after the loss of hepatitis B e antigen (HBeAg has been frequently associated with mutations in the pre-core (pre-C and core promoter (CP regions of HBV genome that abolish or reduce HBeAg expression. The purpose of this study was to assess the prevalence of pre-C and CP mutations and their impact on the subsequent course of liver disease in Morocco. METHODS/PRINCIPAL FINDINGS: A cohort of 186 patients with HBeAg-negative chronic HBV infection was studied (81 inactive carriers, 69 with active chronic hepatitis, 36 with AdLD. Pre-C and CP mutations were analyzed by PCR-direct sequencing method. The pre-C stop codon G1896A mutation was the most frequent (83.9% and was associated with a lower risk of AdLD development (OR, 0.4; 95% CI, 0.15-1.04; p = 0.04. HBV-DNA levels in patients with G1896A were not significantly different from the other patients carrying wild-type strains (p = 0.84. CP mutations C1653T, T1753V, A1762T/G1764A, and C1766T/T1768A were associated with higher HBV-DNA level and increased liver disease severity. Multiple logistic regression analysis showed that older age (≥ 40 years, male sex, high viral load (>4.3 log(10 IU/mL and CP mutations C1653T, T1753V, A1762T/G1764A, and C1766T/T1768A were independent risk factors for AdLD development. Combination of these mutations was significantly associated with AdLD (OR, 7.52; 95% CI, 4.8-8; p<0.0001. CONCLUSIONS: This study shows for the first time the association of HBV viral load and CP mutations with the severity of liver disease in Moroccan HBV chronic carriers. The examination of CP mutations alone or in combination could be helpful for prediction of the clinical outcome.

  19. Genetic polymorphisms within tumor necrosis factor gene promoter region: a role for susceptibility to ventilator-associated pneumonia.

    Science.gov (United States)

    Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J

    2012-08-01

    Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Regional efforts to promote forestry best management practices: a southern success story

    Science.gov (United States)

    Herb Nicholson; John Colberg; Hughes Simpson; Tom Gerow; Wib Owen

    2016-01-01

    The Southern Group of State Foresters has a long history of water resource protection efforts, providing leadership in BMP development, improvement, and implementation, enhancing state BMP programs, establishing effective partnerships, and standardizing an approach to consistently monitor implementation across the region.

  1. Evaluation of methylation pattern in promoter region of E-cadherin ...

    African Journals Online (AJOL)

    The epithelial cadherin gene (CDH1) has been identified as a tumor suppressor gene located within the 16q22.1 region. The CDH1 gene encodes a transmembrane glycoprotein involved in cell to cell adhesion and loss of CDH1 expression contributes to increased proliferation, invasion and metastasis in breast carcinoma.

  2. Ecosystem assessment methods for cumulative effects at the regional scale

    International Nuclear Information System (INIS)

    Hunsaker, C.T.

    1989-01-01

    Environmental issues such as nonpoint-source pollution, acid rain, reduced biodiversity, land use change, and climate change have widespread ecological impacts and require an integrated assessment approach. Since 1978, the implementing regulations for the National Environmental Policy Act (NEPA) have required assessment of potential cumulative environmental impacts. Current environmental issues have encouraged ecologists to improve their understanding of ecosystem process and function at several spatial scales. However, management activities usually occur at the local scale, and there is little consideration of the potential impacts to the environmental quality of a region. This paper proposes that regional ecological risk assessment provides a useful approach for assisting scientists in accomplishing the task of assessing cumulative impacts. Critical issues such as spatial heterogeneity, boundary definition, and data aggregation are discussed. Examples from an assessment of acidic deposition effects on fish in Adirondack lakes illustrate the importance of integrated data bases, associated modeling efforts, and boundary definition at the regional scale

  3. Novel method to achieve price-optimized, fully nutritious, health-promoting and acceptable national food baskets

    DEFF Research Database (Denmark)

    Parlesak, Alexandr; Robertson, Aileen

    2015-01-01

    available foods. The study was designed to obtain healthy, affordable, and socially acceptable diets for three European countries (Denmark, Slovenia, and Romania) and in three regions within Canada, Argentina, and Switzerland. Moreover, the costs for the “limiting” micronutrients and relative price......Purpose: The purpose of this study was to generate a framework for the development of health-promoting, fully nutritious, socially acceptable, and affordable national food baskets to be used as an advocacy tool by governments. In addition to containing all (micro-)nutrient requirements, food...... baskets should also reflect dietary guidelines to prevent non-communicable diseases and be optimized to achieve the highest possible social acceptance. So far, integrative approaches that include all these aspects are lacking. Methods: Food composition, local availability, food prices, national...

  4. Efficiency of snake sampling methods in the Brazilian semiarid region.

    Science.gov (United States)

    Mesquita, Paula C M D; Passos, Daniel C; Cechin, Sonia Z

    2013-09-01

    The choice of sampling methods is a crucial step in every field survey in herpetology. In countries where time and financial support are limited, the choice of the methods is critical. The methods used to sample snakes often lack objective criteria, and the traditional methods have apparently been more important when making the choice. Consequently researches using not-standardized methods are frequently found in the literature. We have compared four commonly used methods for sampling snake assemblages in a semiarid area in Brazil. We compared the efficacy of each method based on the cost-benefit regarding the number of individuals and species captured, time, and financial investment. We found that pitfall traps were the less effective method in all aspects that were evaluated and it was not complementary to the other methods in terms of abundance of species and assemblage structure. We conclude that methods can only be considered complementary if they are standardized to the objectives of the study. The use of pitfall traps in short-term surveys of the snake fauna in areas with shrubby vegetation and stony soil is not recommended.

  5. 3. Promotion of environment protection of sea and near-sea region. Swinoujscie 12-14 October 1994

    International Nuclear Information System (INIS)

    1994-01-01

    The great number of problems connected with environment protection near shore marine zone, beach protection, effluent transport in ground and surface waters in region of North Port of Poland as well as technical solutions of water purification and legal problems have been discussed during the conference. All observations and experimental works have been carried out in that region. Among reported works two of them have been devoted to application of nuclear methods in interesting merit

  6. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    Energy Technology Data Exchange (ETDEWEB)

    Rundle-Thiele, Dayle [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Day, Bryan; Stringer, Brett [Brain Cancer Research Unit, Queensland Institute of Medical Research, Brisbane, Queensland (Australia); Fay, Michael [Department of Radiation Oncology, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Martin, Jennifer [Discipline of Clinical Pharmacology, School of Medicine and Public Health, University of Newcastle, Newcastle, New South Wales (Australia); Jeffree, Rosalind L [Department of Neurosurgery, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Thomas, Paul [Queensland PET Service, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Bell, Christopher [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Salvado, Olivier [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Gal, Yaniv [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Coulthard, Alan [Discipline of Medical Imaging, University of Queensland, St Lucia, Queensland (Australia); Department of Medical Imaging, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Crozier, Stuart [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Rose, Stephen, E-mail: stephen.rose@csiro.au [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia)

    2015-06-15

    Accurate knowledge of O{sup 6}-methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling.

  7. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    International Nuclear Information System (INIS)

    Rundle-Thiele, Dayle; Day, Bryan; Stringer, Brett; Fay, Michael; Martin, Jennifer; Jeffree, Rosalind L; Thomas, Paul; Bell, Christopher; Salvado, Olivier; Gal, Yaniv; Coulthard, Alan; Crozier, Stuart; Rose, Stephen

    2015-01-01

    Accurate knowledge of O 6 -methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling

  8. Epigenetic changes within the promoter region of the HLA-G gene in ovarian tumors

    Directory of Open Access Journals (Sweden)

    Matyunina Lilya V

    2008-05-01

    Full Text Available Abstract Background Previous findings have suggested that epigenetic-mediated HLA-G expression in tumor cells may be associated with resistance to host immunosurveillance. To explore the potential role of DNA methylation on HLA-G expression in ovarian cancer, we correlated differences in HLA-G expression with methylation changes within the HLA-G regulatory region in an ovarian cancer cell line treated with 5-aza-deoxycytidine (5-aza-dC and in malignant and benign ovarian tumor samples and ovarian surface epithelial cells (OSE isolated from patients with normal ovaries. Results A region containing an intact hypoxia response element (HRE remained completely methylated in the cell line after treatment with 5-aza-dC and was completely methylated in all of the ovarian tumor (malignant and benign samples examined, but only variably methylated in normal OSE samples. HLA-G expression was significantly increased in the 5-aza-dC treated cell line but no significant difference was detected between the tumor and OSE samples examined. Conclusion Since HRE is the binding site of a known repressor of HLA-G expression (HIF-1, we hypothesize that methylation of the region surrounding the HRE may help maintain the potential for expression of HLA-G in ovarian tumors. The fact that no correlation exists between methylation and HLA-G gene expression between ovarian tumor samples and OSE, suggests that changes in methylation may be necessary but not sufficient for HLA-G expression in ovarian cancer.

  9. Nuclear proteins interacting with the promoter region of the human granulocyte/macrophage colony-stimulating factor gene

    International Nuclear Information System (INIS)

    Shannon, M.F.; Gamble, J.R.; Vadas, M.A.

    1988-01-01

    The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription

  10. Inter-organizational relations for regional development: an expansion policy promoted by the federal network of professional education, science & technology

    Directory of Open Access Journals (Sweden)

    Cleidson Nogueira Dias

    2014-12-01

    Full Text Available This research paper examines the importance of inter-organizational network management as a government policy tool to promote regional development. This pattern requires Federal Government intervention so as to compensate for the imbalance that this causes and to guarantee that economic growth resulting from government actions leads to development in all regions of the country, thereby avoiding the traditional mechanisms of wealth concentration. For this, a methodology of content analysis was used based on a relevant public policy aimed at promoting development within Brazil and by analyzing the data collected in relation to the current theory related to strategy, local development and inter-organizational networks in general.  The analysis results show that, when the policy studied in this work, applied in the federal network of professional education, science & technology, was implemented the networks had a positive influence on the outcome of the policy objectives and represented an extremely powerful support tool, being one of the most important factors to boost development.

  11. Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S; Drusiani, E; Battini, R; Fregni, M

    1988-01-11

    Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

  12. Export Promotion Aims and Reality: A Comparison of the Iberian, Baltic and Central European Region

    Directory of Open Access Journals (Sweden)

    Éltető Andrea

    2017-06-01

    Full Text Available As a consequence of the international crisis in 2008-2009, the role of exports in economic growth came into focus in most countries. Exports of EU Member States gained momentum from 2010 onward but with certain changes in their structure and direction. In several countries, the turn towards non-EU areas, such as China or Latin America was part of the state export strategy. On the one hand, our article describes these foreign trade strategies and their institutional framework of the Iberian, Baltic and Central European governments, detecting possible similarities. On the other hand, we analyse recent export data. This way we can get a picture on the structure and direction of exports of periphery economies and this can be compared to the aims of the given states. Our hypothesis is that there is a gap between the reality and the intentions of the governments. The size of this gap varies and is influenced by certain factors such as the different involvement of multinational companies in foreign trade or the different economic structure of these countries. In our paper we list which countries adopted a government strategy and with what aim. We provide a short literature review on state trade promotion policies and discuss these policies and their institutions in the Baltic, Visegrád and Iberian countries.

  13. Methylation of Promoter Regions of Genes of the Human Intrauterine Renin Angiotensin System and Their Expression

    Directory of Open Access Journals (Sweden)

    Shane D. Sykes

    2015-01-01

    Full Text Available The intrauterine renin angiotensin system (RAS is implicated in placentation and labour onset. Here we investigate whether promoter methylation of RAS genes changes with gestation or labour and if it affects gene expression. Early gestation amnion and placenta were studied, as were term amnion, decidua, and placenta collected before labour (at elective caesarean section or after spontaneous labour and delivery. The expression and degree of methylation of the prorenin receptor (ATP6AP2, angiotensin converting enzyme (ACE, angiotensin II type 1 receptor (AGTR1, and two proteases that can activate prorenin (kallikrein, KLK1, and cathepsin D, CTSD were measured by qPCR and a DNA methylation array. There was no effect of gestation or labour on the methylation of RAS genes and CTSD. Amnion and decidua displayed strong correlations between the percent hypermethylation of RAS genes and CTSD, suggestive of global methylation. There were no correlations between the degree of methylation and mRNA abundance of any genes studied. KLK1 was the most methylated gene and the proportion of hypermethylated KLK1 alleles was lower in placenta than decidua. The presence of intermediate methylated alleles of KLK1 in early gestation placenta and in amnion after labour suggests that KLK1 methylation is uniquely dynamic in these tissues.

  14. Trithorax dependent changes in chromatin landscape at enhancer and promoter regions drive female puberty.

    Science.gov (United States)

    Toro, Carlos A; Wright, Hollis; Aylwin, Carlos F; Ojeda, Sergio R; Lomniczi, Alejandro

    2018-01-04

    Polycomb group (PcG) proteins control the timing of puberty by repressing the Kiss1 gene in hypothalamic arcuate nucleus (ARC) neurons. Here we identify two members of the Trithorax group (TrxG) of modifiers, mixed-lineage leukemia 1 (MLL1), and 3 (MLL3), as central components of an activating epigenetic machinery that dynamically counteracts PcG repression. Preceding puberty, MLL1 changes the chromatin configuration at the promoters of Kiss1 and Tac3, two genes required for puberty to occur, from repressive to permissive. Concomitantly, MLL3 institutes a chromatin structure that changes the functional status of a Kiss1 enhancer from poised to active. RNAi-mediated, ARC-specific Mll1 knockdown reduced Kiss1 and Tac3 expression, whereas CRISPR-Cas9-directed epigenome silencing of the Kiss1 enhancer selectively reduced Kiss1 activity. Both interventions delay puberty and disrupt reproductive cyclicity. Our results demonstrate that an epigenetic switch from transcriptional repression to activation is crucial to the regulatory mechanism controlling the timing of mammalian puberty.

  15. A mixed methods evaluation of televised health promotion advertisements targeted at older adults.

    Science.gov (United States)

    Berry, Tanya R; Spence, John C; Plotnikoff, Ronald C; Bauman, Adrian; McCargar, Linda; Witcher, Chad; Clark, Marianne; Stolp, Sean

    2009-08-01

    The purpose of this research was to evaluate television advertisements targeted at 55-70-year olds that promoted physical activity and fruit and vegetable consumption. Awareness of the campaign, perceived credibility of the source, intentions to visit a promoted website, and intentions to perform the healthy behaviors were evaluated using mixed methods research. Results from a population level survey (n=1600) showed low unprompted and prompted awareness of the campaign and no differences in intentions or behaviors among those who were aware of the campaign. Unprompted recall resulted in a very wide range of responses including the citation of many commercial advertisers. Qualitative themes that emerged from the focus groups included neutral, positive, and negative comments about the advertisements, source credibility, website considerations specific to seniors, and suggestions about appropriate advertising for older adults. This research showed that the increased attention paid to the advertisements was due in a large part to negative reactions to the character used in the advertisements. Another important finding was the government was not considered to be a credible source of health information. Finally, health promoters should be cautious about websites as the primary source of information, particularly for older adults.

  16. Tobacco advertising, promotion and sponsorship in entertainment media: a phenomenon requiring stronger controls in the Eastern Mediterranean Region.

    Science.gov (United States)

    El-Awa, Fatimah M S; El Naga, Randa Abou; Labib, Sahar; Latif, Nisreen Abdel

    2018-04-05

    Tobacco use and placement of tobacco products in television (TV) productions and movies is a way to promote tobacco use while avoiding tobacco advertising bans that exist in most countries. The fact that such productions are broadcast widely and viewed by millions, including children and young people, is of concern. This paper reviews the evidence on the use of tobacco advertising, promotion and sponsorship (TAPS) in TV and films in the Eastern Mediterranean Region and the ways to combat it. Evidence from Egypt shows considerable and increasing use of tobacco products by actors on screen, including female actors, in programmes aired during Ramadan in 2015-2017. A study of Iranian movies in 2015 showed that tobacco scenes in Iranian movies were increasing. In 2014, the WHO Regional Office for the Eastern Mediterranean held a consultative meeting on TAPS in drama. The consultation recommended regulating the tobacco presence in movies and TV through complete implementation of Article 13 of the WHO FCTC, and raising the issue to the WHO FCTC Conference of the Parties. In 2016, the Conference of the Parties called on parties to consider scaling up the implementation of WHO FCTC Article 13 and monitoring the use of TAPS in entertainment media in accordance with national legislation. A comprehensive approach is essential to end the tobacco industry's use of TV productions and movies to promote their products. Copyright © World Health Organization (WHO) 2018. Some rights reserved. This work is available under the CC BY-NC-SA 3.0 IGO license (https://creativecommons.org/licenses/by-nc-sa/3.0/igo).

  17. Knowledge and usage of methods of online promotion by students as potential entrepreneurs

    Directory of Open Access Journals (Sweden)

    Siemieniak Paulina

    2017-01-01

    Full Text Available According to popular belief, it has never been easier to raise funds to run and manage one’s own business. In an era of startups popping up like mushrooms, crowdfunding, business angels, venture capital and mobile Internet, investing in a business is a much easier undertaking than it was two decades ago. Furthermore, Augmented Reality available through mobile devices like smartphones or tablets, the Internet of Things, which makes the consumer feel like a science fiction character in their own home, or Virtual Reality shopping, a Matrix movie-like experience in a testing phase at the moment, provide increasingly more innovative ways to take one’s first steps in business, gather momentum, and win loyal customers. According to the results, running one’s own business is not a popular professional plan among young people, which is especially surprising given the fact that the majority of the respondents were students of specialisations that equipped them with knowledge facilitating entrepreneurial activities. Running one’s own business seemed to be an attractive career path for about 30% of the respondents. Although they realise the significance of the Internet in running their own business, they do not believe that this is always a necessary tool. The students declared knowledge of multiple methods of communication and promotion and often use social media channels, but rarely expressed the desire to use these measures. A particular way of using the Internet to foster entrepreneurship are methods of online promotion like Social Media Marketing or Search Engine Optimization. Those tools enable reaching potential customers and engaging in an active dialogue with them about their favourite brands, products and services. They also allow exchange of information with the entrepreneur and are currently one of the fundamental tools for creating a company’s success. The article presents the results of research on the knowledge of methods of online

  18. IκBα polymorphism at promoter region (rs2233408 influences the susceptibility of gastric cancer in Chinese

    Directory of Open Access Journals (Sweden)

    Sung Joseph JY

    2010-02-01

    Full Text Available Abstract Background Nuclear factor of kappa B inhibitor alpha (IκBα protein is implicated in regulating a variety of cellular process from inflammation to tumorigenesis. The objective of this study was to investigate the susceptibility of rs2233408 T/C genotype in the promoter region of IκBα to gastric cancer and the association of this polymorphism with clinicopathologic variables in gastric cancer patients. Methods A population-based case-control study was conducted between 1999 and 2006 in Guangdong Province, China. A total of 564 gastric cancer patients and 566 healthy controls were enrolled in this study. rs2233408 genotypes in IκBα were analyzed by TaqMan SNP genotyping assay. Results Both rs2233408 T homozygote (TT and T heterozygotes (TC and TT had significantly reduced gastric cancer risk (TT: OR = 0.250, 95% CI = 0.069-0.909, P = 0.035; TC and TT: OR = 0.721, 95% CI = 0.530-0.981, P = 0.037, compared with rs2233408 C homozygote (CC. rs2233408 T heterozygotes were significantly associated with reduced risk of intestinal-type gastric cancer with ORs of 0.648 (95% CI = 0.459-0.916, P = 0.014, but not with the diffuse or mix type of gastric cancer. The association between rs2233408 T heterozygotes and gastric cancer appeared more apparent in the older patients (age>40 (OR = 0.674, 95% CI = 0.484-0.939, P = 0.02. rs2233408 T heterozygotes was associated with non-cardiac gastric cancer (OR = 0.594, 95% CI = 0.411-0.859, P = 0.006, but not with cardiac gastric cancer. However, rs2233408 polymorphism was not associated with the prognosis of gastric cancer patients. Conclusions IκBα rs2233408 T heterozygotes were associated with reduced risk of gastric cancer, especially for the development of certain subtypes of gastric cancer in Chinese population.

  19. Cloning and analysis of the promoter region of the human fibronectin gene

    International Nuclear Information System (INIS)

    Dean, D.C.; Bowlus, C.L.; Bourgeois, S.

    1987-01-01

    Human fibronectin (FN) genomic clones were isolated by screening a human genomic library with a 75-base oligonucleotide. The sequence of the oligonucleotide corresponds to a region near the 5' end of the human FN cDNA clone pFH6 that contains the amino-terminal coding sequences but does not extend to the 5' end of the mRNA. The 5' end of the FN gene is found on a 3.7-kilobase-pair EcoRI fragment that contains about 2.7 kilobase pairs of flanking sequence. The first exon is 414 base pairs long, with a 5' untranslated region of 267 base pairs. As deduced on the basis of the position of the initiation codon, FN is synthesized with a 31-residue amino acid extension on the amion terminus that is not present in the mature polypeptide. This amino-terminal extension appears to contain both a signal peptide and a propeptide. The first 200 base pairs of 5'-flanking sequence is very G+C rich. Upstream of this the sequence becomes relatively A+T rich. The sequence ATATAA is found at -25 and the sequence CAAT is present at -150. The sequence GGGGCGGGGC at -102 exhibits homology to the binding site for the transcription factor SP1, and the sequence TGACGTCA at -173 exhibits homology to 5'-flanking sequences important for induction by cAMP

  20. Methods and Practices of Urban Filipino Parents in Promoting Mabuting Asal among Preschool Children

    Directory of Open Access Journals (Sweden)

    Maria Perlita E. de Leon

    2012-12-01

    Full Text Available This paper is a portion of an ethnographic study conducted in an urbanizing community in Valenzuela City. The study aimed to investigate and discuss the concepts and practices that parents have in promoting mabuting asal or positive social behavior among their preschool children. The participantswere 15 two-parent families with at least two children, one of whom was between ages 3 and 6 years. Seven of the participating families were dualearner while the rest were single-earner. They were visited at home for at leastan hour twice a week for a period of six months. Afterwards, face-to-face interviews were conducted with the parents in each family. Results suggested that the methods that parents use to promote mabuting asal among the young ones can be categorized into three – physical, verbal, and cognitivetypes. Mothers in both income groups used the physical and cognitive types, although single-earner families would use physical methods more often than cognitive ones. On the other hand, fathers in both income groups would useverbal methods more, possibly as a result of their compensating behavior for their own experiences of harsh and coercive upbringing as young children. The study recommends comprehensive, integrative, sensitive, and flexible child-rearing seminars for parents as well as health and day care workers in the community. In terms of methodology, conducting the research in several localities, across different social groups, with a larger sample could provideanother perspective to the relationships between variables utilized in this research.

  1. Method of Promoting Single Crystal Growth During Melt Growth of Semiconductors

    Science.gov (United States)

    Su, Ching-Hua (Inventor)

    2013-01-01

    The method of the invention promotes single crystal growth during fabrication of melt growth semiconductors. A growth ampoule and its tip have a semiconductor source material placed therein. The growth ampoule is placed in a first thermal environment that raises the temperature of the semiconductor source material to its liquidus temperature. The growth ampoule is then transitioned to a second thermal environment that causes the semiconductor source material in the growth ampoule's tip to attain a temperature that is below the semiconductor source material's solidus temperature. The growth ampoule so-transitioned is then mechanically perturbed to induce single crystal growth at the growth ampoule's tip.

  2. Promoters and Barriers to Implementation of Tracheal Intubation Airway Safety Bundle: A Mixed-Method Analysis.

    Science.gov (United States)

    Finn Davis, Katherine; Napolitano, Natalie; Li, Simon; Buffman, Hayley; Rehder, Kyle; Pinto, Matthew; Nett, Sholeen; Jarvis, J Dean; Kamat, Pradip; Sanders, Ronald C; Turner, David A; Sullivan, Janice E; Bysani, Kris; Lee, Anthony; Parker, Margaret; Adu-Darko, Michelle; Giuliano, John; Biagas, Katherine; Nadkarni, Vinay; Nishisaki, Akira

    2017-10-01

    To describe promoters and barriers to implementation of an airway safety quality improvement bundle from the perspective of interdisciplinary frontline clinicians and ICU quality improvement leaders. Mixed methods. Thirteen PICUs of the National Emergency Airway Registry for Children network. Remote or on-site focus groups with interdisciplinary ICU staff. Two semistructured interviews with ICU quality improvement leaders with quantitative and qualitative data-based feedbacks. Bundle implementation success (compliance) was defined as greater than or equal to 80% use for tracheal intubations for 3 consecutive months. ICUs were classified as early or late adopters. Focus group discussions concentrated on safety concerns and promoters and barriers to bundle implementation. Initial semistructured quality improvement leader interviews assessed implementation tactics and provided recommendations. Follow-up interviews assessed degree of acceptance and changes made after initial interview. Transcripts were thematically analyzed and contrasted by early versus late adopters. Median duration to achieve success was 502 days (interquartile range, 182-781). Five sites were early (median, 153 d; interquartile range, 146-267) and eight sites were late adopters (median, 783 d; interquartile range, 773-845). Focus groups identified common "promoter" themes-interdisciplinary approach, influential champions, and quality improvement bundle customization-and "barrier" themes-time constraints, competing paperwork and quality improvement activities, and poor engagement. Semistructured interviews with quality improvement leaders identified effective and ineffective tactics implemented by early and late adopters. Effective tactics included interdisciplinary quality improvement team involvement (early adopter: 5/5, 100% vs late adopter: 3/8, 38%; p = 0.08); ineffective tactics included physician-only rollouts, lack of interdisciplinary education, lack of data feedback to frontline clinicians

  3. Efforts to promote regional security dialogue and cooperation in the North Pacific

    International Nuclear Information System (INIS)

    Mason, P.

    1994-01-01

    Indifference to the new realities of the post-cold war era does nothing to preserve the traditional priorities laid down in the Final Document of the first special session on disarmament. On the contrary, such attitudes directly contribute to the trend towards marginalization which began when publics no longer feared the threat of a nuclear holocaust. It is believed that the expertise of forty years of multilateral arms control and disarmament efforts is directly relevant to the broader efforts of the international community to restore, maintain and promote international peace and security. Who can deny that confidence-building is central to preventive diplomacy? Or that the arms control component-from disarming to demobilization-is not equally central to peace operations whether they be traditional peace-keeping or post-conflict peace-building? Indeed the success or failure of the disarmament aspect of a peace operation is often critical to its overall success-Somalia surely being one recent sad example. The multilateral disarmament community must apply itself more directly and systematically to these broader problems - just as the United Nations Secretariat has increasingly begun to do - or risk indifference from Governments forced to make tough choices against a range of competing priorities. It is undeniably true that the post-cold war has significantly increased the potential for the international community to negotiate historic new multilateral disarmament treaties. And this window of opportunity must be utilized to the fullest. At the same time, due account must be taken of the hard fact that, for an increasing number of countries, expensive obligations in relation to advanced unconventional weapons which neither they nor their neighbours seek to possess may count for less than practical assistance in finding solutions to more parochial, but no less urgent, problems

  4. Clinicopathologic Risk Factor Distributions for MLH1 Promoter Region Methylation in CIMP-Positive Tumors.

    Science.gov (United States)

    Levine, A Joan; Phipps, Amanda I; Baron, John A; Buchanan, Daniel D; Ahnen, Dennis J; Cohen, Stacey A; Lindor, Noralane M; Newcomb, Polly A; Rosty, Christophe; Haile, Robert W; Laird, Peter W; Weisenberger, Daniel J

    2016-01-01

    The CpG island methylator phenotype (CIMP) is a major molecular pathway in colorectal cancer. Approximately 25% to 60% of CIMP tumors are microsatellite unstable (MSI-H) due to DNA hypermethylation of the MLH1 gene promoter. Our aim was to determine if the distributions of clinicopathologic factors in CIMP-positive tumors with MLH1 DNA methylation differed from those in CIMP-positive tumors without DNA methylation of MLH1. We assessed the associations between age, sex, tumor-site, MSI status BRAF and KRAS mutations, and family colorectal cancer history with MLH1 methylation status in a large population-based sample of CIMP-positive colorectal cancers defined by a 5-marker panel using unconditional logistic regression to assess the odds of MLH1 methylation by study variables. Subjects with CIMP-positive tumors without MLH1 methylation were significantly younger, more likely to be male, and more likely to have distal colon or rectal primaries and the MSI-L phenotype. CIMP-positive MLH1-unmethylated tumors were significantly less likely than CIMP-positive MLH1-methylated tumors to harbor a BRAF V600E mutation and significantly more likely to harbor a KRAS mutation. MLH1 methylation was associated with significantly better overall survival (HR, 0.50; 95% confidence interval, 0.31-0.82). These data suggest that MLH1 methylation in CIMP-positive tumors is not a completely random event and implies that there are environmental or genetic determinants that modify the probability that MLH1 will become methylated during CIMP pathogenesis. MLH1 DNA methylation status should be taken into account in etiologic studies. ©2015 American Association for Cancer Research.

  5. Promoting Vehicle to Grid (V2G) in the Nordic Region

    DEFF Research Database (Denmark)

    Kester, Johannes; Noel, Lance; Zarazua de Rubens, Gerardo

    2018-01-01

    Vehicle to Grid (V2G) holds the promise of cheap, flexible, and fast-responding storage through the use of electric vehicle batteries. Unfortunately, infrastructure, battery degradation and consumer awareness are only some of the challenges to a faster development of this technology. This paper...... offers a qualitative comparative analysis that draws on a subsample of 227 semistructured interviews on electric vehicles with both transportation and electricity experts from 201 institutions and 17 cities within the Nordic region to discuss the reasoning and arguments behind V2G incentives and policy...... mechanisms. A frequency analysis of the most coded V2G responses favoured an update of the electricity market regulation – in particular in relation to electricity taxation and aggregator markets – and support for pilot projects. However, the analysis overall implies that V2G, in contrast to EVs...

  6. Cis-acting elements in the promoter region of the human aldolase C gene.

    Science.gov (United States)

    Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F

    1993-08-16

    We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.

  7. Economics methods in Cochrane systematic reviews of health promotion and public health related interventions.

    Science.gov (United States)

    Shemilt, Ian; Mugford, Miranda; Drummond, Michael; Eisenstein, Eric; Mallender, Jacqueline; McDaid, David; Vale, Luke; Walker, Damian

    2006-11-15

    Provision of evidence on costs alongside evidence on the effects of interventions can enhance the relevance of systematic reviews to decision-making. However, patterns of use of economics methods alongside systematic review remain unclear. Reviews of evidence on the effects of interventions are published by both the Cochrane and Campbell Collaborations. Although it is not a requirement that Cochrane or Campbell Reviews should consider economic aspects of interventions, many do. This study aims to explore and describe approaches to incorporating economics methods in a selection of Cochrane systematic reviews in the area of health promotion and public health, to help inform development of methodological guidance on economics for reviewers. The Cochrane Database of Systematic Reviews was searched using a search strategy for potential economic evaluation studies. We included current Cochrane reviews and review protocols retrieved using the search that are also identified as relevant to health promotion or public health topics. A reviewer extracted data which describe the economics components of included reviews. Extracted data were summarised in tables and analysed qualitatively. Twenty-one completed Cochrane reviews and seven review protocols met inclusion criteria. None incorporate formal economic evaluation methods. Ten completed reviews explicitly aim to incorporate economics studies and data. There is a lack of transparent reporting of methods underpinning the incorporation of economics studies and data. Some reviews are likely to exclude useful economics studies and data due to a failure to incorporate search strategies tailored to the retrieval of such data or use of key specialist databases, and application of inclusion criteria designed for effectiveness studies. There is a need for consistency and transparency in the reporting and conduct of the economics components of Cochrane reviews, as well as regular dialogue between Cochrane reviewers and economists to

  8. Promoter Boundaries for the luxCDABE and betIBA-proXWV Operons in Vibrio harveyi Defined by the Method Rapid Arbitrary PCR Insertion Libraries (RAIL).

    Science.gov (United States)

    Hustmyer, Christine M; Simpson, Chelsea A; Olney, Stephen G; Rusch, Douglas B; Bochman, Matthew L; van Kessel, Julia C

    2018-06-01

    Experimental studies of transcriptional regulation in bacteria require the ability to precisely measure changes in gene expression, often accomplished through the use of reporter genes. However, the boundaries of promoter sequences required for transcription are often unknown, thus complicating the construction of reporters and genetic analysis of transcriptional regulation. Here, we analyze reporter libraries to define the promoter boundaries of the luxCDABE bioluminescence operon and the betIBA-proXWV osmotic stress operon in Vibrio harveyi We describe a new method called r apid a rbitrary PCR i nsertion l ibraries (RAIL) that combines the power of arbitrary PCR and isothermal DNA assembly to rapidly clone promoter fragments of various lengths upstream of reporter genes to generate large libraries. To demonstrate the versatility and efficiency of RAIL, we analyzed the promoters driving expression of the luxCDABE and betIBA-proXWV operons and created libraries of DNA fragments from these loci fused to fluorescent reporters. Using flow cytometry sorting and deep sequencing, we identified the DNA regions necessary and sufficient for maximum gene expression for each promoter. These analyses uncovered previously unknown regulatory sequences and validated known transcription factor binding sites. We applied this high-throughput method to gfp , mCherry , and lacZ reporters and multiple promoters in V. harveyi We anticipate that the RAIL method will be easily applicable to other model systems for genetic, molecular, and cell biological applications. IMPORTANCE Gene reporter constructs have long been essential tools for studying gene regulation in bacteria, particularly following the recent advent of fluorescent gene reporters. We developed a new method that enables efficient construction of promoter fusions to reporter genes to study gene regulation. We demonstrate the versatility of this technique in the model bacterium Vibrio harveyi by constructing promoter libraries

  9. Evaluation of health promotion in schools: a realistic evaluation approach using mixed methods

    Science.gov (United States)

    2010-01-01

    Background Schools are key settings for health promotion (HP) but the development of suitable approaches for evaluating HP in schools is still a major topic of discussion. This article presents a research protocol of a program developed to evaluate HP. After reviewing HP evaluation issues, the various possible approaches are analyzed and the importance of a realistic evaluation framework and a mixed methods (MM) design are demonstrated. Methods/Design The design is based on a systemic approach to evaluation, taking into account the mechanisms, context and outcomes, as defined in realistic evaluation, adjusted to our own French context using an MM approach. The characteristics of the design are illustrated through the evaluation of a nationwide HP program in French primary schools designed to enhance children's social, emotional and physical health by improving teachers' HP practices and promoting a healthy school environment. An embedded MM design is used in which a qualitative data set plays a supportive, secondary role in a study based primarily on a different quantitative data set. The way the qualitative and quantitative approaches are combined through the entire evaluation framework is detailed. Discussion This study is a contribution towards the development of suitable approaches for evaluating HP programs in schools. The systemic approach of the evaluation carried out in this research is appropriate since it takes account of the limitations of traditional evaluation approaches and considers suggestions made by the HP research community. PMID:20109202

  10. ESR1 gene promoter region methylation in free circulating DNA and its correlation with estrogen receptor protein expression in tumor tissue in breast cancer patients

    International Nuclear Information System (INIS)

    Martínez-Galán, Joaquina; Ríos, Sandra; Delgado, Juan Ramón; Torres-Torres, Blanca; Núñez, María Isabel; López-Peñalver, Jesús; Del Moral, Rosario; Ruiz De Almodóvar, José Mariano; Menjón, Salomón; Concha, Ángel; Chamorro, Clara

    2014-01-01

    Tumor expression of estrogen receptor (ER) is an important marker of prognosis, and is predictive of response to endocrine therapy in breast cancer. Several studies have observed that epigenetic events, such methylation of cytosines and deacetylation of histones, are involved in the complex mechanisms that regulate promoter transcription. However, the exact interplay of these factors in transcription activity is not well understood. In this study, we explored the relationship between ER expression status in tumor tissue samples and the methylation of the 5′ CpG promoter region of the estrogen receptor gene (ESR1) isolated from free circulating DNA (fcDNA) in plasma samples from breast cancer patients. Patients (n = 110) with non-metastatic breast cancer had analyses performed of ER expression (luminal phenotype in tumor tissue, by immunohistochemistry method), and the ESR1-DNA methylation status (fcDNA in plasma, by quantitative methylation specific PCR technique). Our results showed a significant association between presence of methylated ESR1 in patients with breast cancer and ER negative status in the tumor tissue (p = 0.0179). There was a trend towards a higher probability of ESR1-methylation in those phenotypes with poor prognosis i.e. 80% of triple negative patients, 60% of HER2 patients, compared to 28% and 5.9% of patients with better prognosis such as luminal A and luminal B, respectively. Silencing, by methylation, of the promoter region of the ESR1 affects the expression of the estrogen receptor protein in tumors of breast cancer patients; high methylation of ESR1-DNA is associated with estrogen receptor negative status which, in turn, may be implicated in the patient’s resistance to hormonal treatment in breast cancer. As such, epigenetic markers in plasma may be of interest as new targets for anticancer therapy, especially with respect to endocrine treatment

  11. Revolutionising engineering education in the Middle East region to promote earthquake-disaster mitigation

    Science.gov (United States)

    Baytiyeh, Hoda; Naja, Mohamad K.

    2014-09-01

    Due to the high market demands for professional engineers in the Arab oil-producing countries, the appetite of Middle Eastern students for high-paying jobs and challenging careers in engineering has sharply increased. As a result, engineering programmes are providing opportunities for more students to enrol on engineering courses through lenient admission policies that do not compromise academic standards. This strategy has generated an influx of students who must be carefully educated to enhance their professional knowledge and social capital to assist in future earthquake-disaster risk-reduction efforts. However, the majority of Middle Eastern engineering students are unaware of the valuable acquired engineering skills and knowledge in building the resilience of their communities to earthquake disasters. As the majority of the countries in the Middle East are exposed to seismic hazards and are vulnerable to destructive earthquakes, engineers have become indispensable assets and the first line of defence against earthquake threats. This article highlights the contributions of some of the engineering innovations in advancing technologies and techniques for effective disaster mitigation and it calls for the incorporation of earthquake-disaster-mitigation education into academic engineering programmes in the Eastern Mediterranean region.

  12. Possible association between serotonin transporter promoter region polymorphism and extremely violent crime in Chinese males.

    Science.gov (United States)

    Liao, Ding-Lieh; Hong, Chen-Jee; Shih, Hao-Ling; Tsai, Shih-Jen

    2004-01-01

    The neurotransmitter, serotonin, has been implicated in aggressive behavior. The serotonin transporter (5-HTT), which reuptakes serotonin into the nerve terminal, plays a critical role in the regulation of serotonergic function. Previous western reports have demonstrated that the low-activity short (S) allele of the 5-HTT gene-linked polymorphic-region (5-HTTLPR) polymorphism is associated with aggressive behavior and associated personality traits. In the present study, we investigated this 5-HTTLPR genetic polymorphism in a group of Chinese males who had been convicted for extremely violent crime (n = 135) and a normal control group (n = 111). The proportion of S-allele carriers was significantly higher in the criminal group than in the controls (p = 0.006). A significant association was not demonstrated for the relationship between the 5-HTTLPR polymorphism and antisocial personality disorder, substance abuse or alcohol abuse in the criminal group. Our findings demonstrate that carriage of the low-activity S allele is associated with extremely violent criminal behavior in Chinese males, and suggests that the 5-HTT may be implicated in the mechanisms underlying violent behaviors.

  13. E-Cigarettes: Implications for Health Promotion in the Asian Pacific Region.

    Science.gov (United States)

    Jancey, Jonine; Maycock, Bruce; McCausland, Kahlia; Howat, Peter

    2018-03-01

    Since their introduction to the United States in 2007, electronic cigarettes (e-cigarettes) use has grown exponentially. This rapid growth in e-cigarette use has been heralded by some as a potential important public health measure that could ultimately replace tobacco cigarettes, while others recommend a cautionary approach until there is clear evidence they will not become "new tobacco" bringing a possible myriad of other problems. E-cigarettes may have real benefits, however they do expose users and those nearby to organic compounds, solvents and particulate matter, with there being limited data relating to their health impact. It is unclear as to whether this relatively new device has the potential to exacerbate nicotine addictions, or play a part in reducing harm and smoking cessation. The fundamental requirement of public health practice is to do no harm and from the inconclusive evidence we have to date on e-cigarettes, it appears a cautious approach is warranted. This commentary reviews evidence that supports a cautious approach to e-cigarette availability in Australia and the Asian Pacific region.

  14. Principles of the tracer method in assessing regional blood flow

    International Nuclear Information System (INIS)

    Potchen, E.J.; Siegel, B.; Meidinger, R.

    1972-01-01

    The standard brain scan is abnormal when there is relative increase in blood volume or when there is an abnormal permeability to substances which normally cannot enter the brain tissue. The usual mechanism of abnormal permeability is based upon neovascularity in tissues which do not maintain the tight junctions one sees in the normal brain endothelium. These tight junctions prohibit the leakage of materials from the intra- to extravascular space, and when they are not available many materials can readily transit into the abnormal tissue substance and can therefore be discerned on a standard brain scan. In many instances, however, there is no gross breakdown in this blood-brain barrier, but more subtle derangement may be detected by determining changes in regional brain blood volume or the relative volume of distribution of various labeled materials. We have studied whether or not we can discern differences in brain spaces of two isotopes in experimental situations where the brain scan would be normal. For these models, we have used water-induced brain edema and triethyl-tin-induced brain edema in the experimental animal. In water intoxication, there is no difference in the microvascular anatomy or change in the 99 /sup m/Tc pertechnetate space, but it is apparent from our studies that the brain swells at the expense of brain blood volume and by measuring brain blood volume against brain mass, i.e., transit of 131 I antipyrine versus 51 Cr labeled red cells, one can detect brain edema in a situation where the brain scan would be normal. It is these approaches with cameras and computers using dual energies that may afford a more simplified estimation of altered regional brain function than is now available with the internal carotid injection technique. (U.S.)

  15. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

    1994-01-01

    To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

  16. Promotion of a healthy work life at small enterprises in Thailand by participatory methods.

    Science.gov (United States)

    Krungkraiwong, Sudthida; Itani, Toru; Amornratanapaichit, Ratanaporn

    2006-01-01

    The major problems of small enterprises include unfavourable working conditions and environment that affect safety and health of workers. The WISE (Work Improvement in Small Enterprises) methodology developed by the ILO has been widely applied to improve occupational safety and health in small enterprises in Thailand. The participatory methods building on local good practices and focusing on practicable improvements have proven effective in controlling the occupational hazards in these enterprises at their sources. As a result of applying the methods in small-scale industries, the frequency of occupational accidents was reduced and the working environment actually improved in the cases studied. The results prove that the participatory approach taken by the WISE activities is a useful and effective tool to make owner/managers and workers in small enterprises voluntarily improve their own working conditions and environment. In promoting a healthy work life at small enterprises in Thailand, it is important to further develop and spread the approach.

  17. A Method for Promoting Assembly of Metallic and Nonmetallic Nanoparticles into Interfacial Monolayer Films.

    Science.gov (United States)

    Xu, Yikai; Konrad, Magdalena P; Lee, Wendy W Y; Ye, Ziwei; Bell, Steven E J

    2016-08-10

    Two-dimensional metal nanoparticle arrays are normally constructed at liquid-oil interfaces by modifying the surfaces of the constituent nanoparticles so that they self-assemble. Here we present a general and facile new approach for promoting such interfacial assembly without any surface modification. The method use salts that have hydrophobic ions of opposite charge to the nanoparticles, which sit in the oil layer and thus reduce the Coulombic repulsion between the particles in the organic phase, allowing the particles to sit in close proximity to each other at the interface. The advantage of this method is that because it does not require the surface of the particles to be modified it allows nonmetallic particles including TiO2 and SiO2 to be assembled into dense interfacial layers using the same procedure as is used for metallic particles. This opens up a route to a new family of nanostructured functional materials.

  18. A proposed assessment method for image of regional educational institutions

    Directory of Open Access Journals (Sweden)

    Kataeva Natalya

    2017-01-01

    Full Text Available Market of educational services in the current Russian economic conditions is a complex of a huge variety of educational institutions. Market of educational services is already experiencing a significant influence of the demographic situation in Russia. This means that higher education institutions are forced to fight in a tough competition for high school students. Increased competition in the educational market forces universities to find new methods of non-price competition in attraction of potential students and throughout own educational and economic activities. Commercialization of education places universities in a single plane with commercial companies who study a positive perception of the image and reputation as a competitive advantage, which is quite acceptable for use in strategic and current activities of higher education institutions to ensure the competitiveness of educational services and educational institution in whole. Nevertheless, due to lack of evidence-based proposals in this area there is a need for scientific research in terms of justification of organizational and methodological aspects of image use as a factor in the competitiveness of the higher education institution. Theoretically and practically there are different methods and ways of evaluating the company’s image. The article provides a comparative assessment of the existing valuation methods of corporate image and the author’s method of estimating the image of higher education institutions based on the key influencing factors. The method has been tested on the Vyatka State Agricultural Academy (Russia. The results also indicate the strengths and weaknesses of the institution, highlights ways of improving, and adjusts the efforts for image improvement.

  19. Identification of a 450-bp region of human papillomavirus type 1 that promotes episomal replication in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Chattopadhyay, Anasuya; Schmidt, Martin C.; Khan, Saleem A.

    2005-01-01

    Human papillomaviruses (HPVs) replicate as nuclear plasmids in infected cells. Since the DNA replication machinery is generally conserved between humans and Saccharomyces cerevisiae, we studied whether HPV-1 DNA can replicate in yeast. Plasmids containing a selectable marker (with or without a yeast centromere) and either the full-length HPV-1 genome or various regions of the viral long control region (LCR) and the 3' end of the L1 gene were introduced into S. cerevisiae and their ability to replicate episomally was investigated. Our results show that HPV-1 sequences promote episomal replication of plasmids although the yeast centromere is required for plasmid retention. We have mapped the autonomously replicating sequence activity of HPV-1 DNA to a 450 base-pair sequence (HPV-1 nt 6783-7232) that includes 293 nucleotides from the 5' region of the viral LCR and 157 nucleotides from the 3' end of the L1 gene. The HPV-1 ARS does not include the binding sites for the viral E1 and E2 proteins, and these proteins are dispensable for replication in S. cerevisiae

  20. Analysis of upstream promoter region and corresponding 5’ UTR of glucokinase (GCK gene in horse breeds

    Directory of Open Access Journals (Sweden)

    L. Minieri

    2010-04-01

    Full Text Available A region of glucokinase (GCK gene was sequenced in 14 horses of 14 different breeds. The resulting GCK nucleotide sequence (GenBank number EF136885 showed 77% homology with human GCK gene portion containing the upstream promoter region and the corresponding 5’ UTR of the exon 1. Conserved regulatory sequences near the putative transcriptional start site were identified. The obtained sequences were aligned to detect polymorphism. A new C>T transition within the 5’ UTR of exon 1 was found. Allele frequencies of this polymorphism were studied by PCR-RFLP in 193 horses of 14 breeds (Bardigiano, 21; Esperia Pony, 5; Haflinger, 10; Italian Heavy Draught Horse, 28; Italian Saddle, 25; Italian Trotter, 16; Lipizzan, 12; Maremmano, 15; Murgese, 14; Norico, 10; Salernitano, 12; Thoroughbred, 10; Tolfetano, 7 and Ventasso Horse, 8. The polymorphism was found in all breeds and differences in allelic frequencies among the breeds were observed. The new SNP identified within a regulative region of GCK gene, which plays an important role in insulin secretion and feeding behaviour, could be used for association studies with performance traits of the horses.

  1. Comparison of different methods for assessment of left ventricular regional motility using the gated blood pool method

    International Nuclear Information System (INIS)

    Neumann, P.; Schicha, H.; Karsch, K.R.; Kreuzer, H.; Emrich, D.

    1983-01-01

    The following methods of evaluation were compared: qualitative analysis of cine mode; qualitative analysis of parametric scans obtained by Fourier analysis including the phase histogram; quantitative analysis of regional ejection fraction (EF). Regional wall motion abnormalities of high degree (akinesia, dyskinesia) were recognized by all three methods with a high sensitivity of 89.7-96.6% without statistically significant differences. The sensitivity for detecting hypokinetic segments was significantly lower (50.0-68.2%) without statistically significant differences between the three methods. Sensitivity for all kinds of wall motion abnormalities could be increased by combining the quantitative method of regional EF with the qualitative evaluation after Fourier analysis

  2. A novel method to quantify local CpG methylation density by regional methylation elongation assay on microarray

    Directory of Open Access Journals (Sweden)

    Qiao Yingjuan

    2008-01-01

    Full Text Available Abstract Background DNA methylation based techniques are important tools in both clinical diagnostics and therapeutics. But most of these methods only analyze a few CpG sites in a target region. Indeed, difference of site-specific methylation may also lead to a change of methylation density in many cases, and it has been found that the density of methylation is more important than methylation of single CpG site for gene silencing. Results We have developed a novel approach for quantitative analysis of CpG methylation density on the basis of microarray-based hybridization and incorporation of Cy5-dCTP into the Cy3 labeled target DNA by using Taq DNA Polymerase on microarray. The quantification is achieved by measuring Cy5/Cy3 signal ratio which is proportional to methylation density. This methylation-sensitive technique, termed RMEAM (regional methylation elongation assay on microarray, provides several advantages over existing methods used for methylation analysis. It can determine an exact methylation density of the given region, and has potential of high throughput. We demonstrate a use of this method in determining the methylation density of the promoter region of the tumor-related gene MLH1, TERT and MGMT in colorectal carcinoma patients. Conclusion This technique allows for quantitative analysis of regional methylation density, which is the representative of all allelic methylation patterns in the sample. The results show that this technique has the characteristics of simplicity, rapidness, specificity and high-throughput.

  3. Nonrandom community assembly and high temporal turnover promote regional coexistence in tropics but not temperate zone.

    Science.gov (United States)

    Freestone, Amy L; Inouye, Brian D

    2015-01-01

    A persistent challenge for ecologists is understanding the ecological mechanisms that maintain global patterns of biodiversity, particularly the latitudinal diversity gradient of peak species richness in the tropics. Spatial and temporal variation in community composition contribute to these patterns of biodiversity, but how this variation and its underlying processes change across latitude remains unresolved. Using a model system of sessile marine invertebrates across 25 degrees of latitude, from the temperate zone to the tropics, we tested the prediction that spatial and temporal patterns of taxonomic richness and composition, and the community assembly processes underlying these patterns, will differ across latitude. Specifically, we predicted that high beta diversity (spatial variation in composition) and high temporal turnover contribute to the high species richness of the tropics. Using a standardized experimental approach that controls for several confounding factors that hinder interpretation of prior studies, we present results that support our predictions. In the temperate zone, communities were more similar across spatial scales from centimeters to tens of kilometers and temporal scales up to one year than at lower latitudes. Since the patterns at northern latitudes were congruent with a null model, stochastic assembly processes are implicated. In contrast, the communities in the tropics were a dynamic spatial and temporal mosaic, with low similarity even across small spatial scales and high temporal turnover at both local and regional scales. Unlike the temperate zone, deterministic community assembly processes such as predation likely contributed to the high beta diversity in the tropics. Our results suggest that community assembly processes and temporal dynamics vary across latitude and help structure and maintain latitudinal patterns of diversity.

  4. Attitudes, Beliefs and Predictors of Male Circumcision Promotion among Medical University Students in a Traditionally Non-Circumcising Region

    Directory of Open Access Journals (Sweden)

    Maria Ganczak

    2017-09-01

    Full Text Available Objective: To evaluate the beliefs of medical university students regarding male circumcision (MC, as well as attitudes and the predictors of its promotion in the case of adults at risk of HIV. Methods: A cross-sectional survey was conducted between 2013–2016 at the Medical University in Szczecin, Poland, among final year Polish/foreign students from Northern Europe, using a standardized questionnaire. Results: There were 539 participants, median age 25 years, 40.8% males, and 66.8% were Polish nationals. The MC rate was 16.7%. Regarding HIV/AIDS knowledge, 66.6% of the students scored more than 75%; and, 34.2% knew that MC reduces the risk of HIV infection. One in eleven respondents (9.1% believed that circumcised men felt more intense sexual pleasure. More than half of the respondents (54.8% declared that they would recommend MC to adult patients at risk for HIV. The belief that circumcised men felt more intense sexual pleasure, and knowledge on MC regarding HIV risk reduction was associated with greater odds of recommending adult MC (OR = 3.35 and OR = 2.13, respectively. Conclusions: Poor knowledge of its benefits and a low willingness to promote the procedure—strongly dependent on personal beliefs—suggest that medical students may need additional training to help them to discuss MC more openly with adult men at risk for HIV infection. Knowledge may be an effective tool when making decisions regarding MC promotion.

  5. Evaluation process radiological in ternopil region method of box models

    Directory of Open Access Journals (Sweden)

    І.В. Матвєєва

    2006-02-01

    Full Text Available  Results of radionuclides Sr-90 flows analyses in the ecosystem of Kotsubinchiky village of Ternopolskaya oblast were analyzed. The block-scheme of ecosystem and its mathematical model using the box models method were made. It allowed us to evaluate the ways of dose’s loadings formation of internal irradiation for miscellaneous population groups – working people, retirees, children, and also to prognose the dynamic of these loadings during the years after the Chernobyl accident.

  6. The effect of phenobarbital on the methylation level of the p16 promoter region in rat liver

    International Nuclear Information System (INIS)

    Kostka, Grazyna; Urbanek, Katarzyna; Ludwicki, Jan K.

    2007-01-01

    It has been suggested that non-genotoxic carcinogens (NGCs) may cause modification of the DNA methylation status. We studied the effects of phenobarbital (PB) - a non-genotoxic rodent liver carcinogen - on the methylation level of the promoter region of the p16 suppressor gene, as well as on hepatomegaly, DNA synthesis, and DNA-methyltransferase (DNMTs) activity in the rat liver. Male Wistar rats received PB in 1, 3 or 14 daily oral doses (at 24-h intervals), each equivalent to 1/10 of the LD 50 value. The study showed that PB has caused persistent elevation in relative liver weight (RLW) as well as a transient increase in DNA synthesis. This suggests that the PB-induced increase in RLW was due to a combination of both hyperplasia and hypertrophy of liver cells. The effect of PB on DNA synthesis corresponded to an increase in the methylation pattern of the p16 promoter sequence. Methylation of cytosine in the analyzed CpG sites of the p16 gene was found after short exposure of the animals to PB. Treatment of rats with PB for 1 and 3 days also produced an increase in nuclear DNMTs activity. After prolonged administration (14 days), DNA synthesis declined, returning to the control level. No changes in methylation of the p16 gene nor in DNMTs activity were observed. The reversibility of early induced changes in target tissues is a mark characteristic of tumor promoters. Thus, transient changes in methylation of the p16 gene, although their direct role in the mechanisms of PB toxicity, including its carcinogenic action, remains doubtful, may therefore be a significant element of such processes

  7. THE ANALYSIS OF THE ASYMMETRICAL RISK IN TOURISM FOR THE DEVELOPMENT AND PROMOTION OF A LASTING REGIONAL TOURISM IDENTITY

    Directory of Open Access Journals (Sweden)

    Alexandru NEDELEA

    2009-06-01

    Full Text Available In order to establish an adequate balance between tourists' welfare, the needs of the natural and cultural environment, as well as to develop tourist destinations and organizations' competitiveness, it is necessary to carry out a global and integrated approach, where all interested parties share the same goals regarding the durability of tourism and the approached challenges. The purpose of this work is to identify the factors of reduced risk having a major impact over the sustainability of the tourist region under analysis and to highlight the risk factors' connections and impact in order to minimize and eliminate them, with direct effects over the awareness of tourist industry's values. The identification of lasting development's indicators will take into account all these three aspects of the durable development of tourism, namely ecological, economical and social factors, that play a part in highlighting the real performance of a tourist destination. All these aspects are absolutely necessary for the promotion of the Danube's tourist potential, achievable through the emphasis of the relevant values from the tourist patrimony of the county of Galati. The promotion of the Danube' tourist potential presupposes a series of objectives that are subordinated to the general direction that is marked at the national level, respectively Romania's transformation into a qualitative tourist destination based on its natural and cultural patrimony, in order to correspond to the European Union standards. The new policy regarding tourism proposed by the European Commission aims at offering constant support for this industry to be able to face different challenges, by promoting also competitiveness in general.

  8. The partial duration series method in regional index-flood modeling

    DEFF Research Database (Denmark)

    Madsen, Henrik; Rosbjerg, Dan

    1997-01-01

    A regional index-flood method based on the partial duration series model is introduced. The model comprises the assumptions of a Poisson-distributed number of threshold exceedances and generalized Pareto (GP) distributed peak magnitudes. The regional T-year event estimator is based on a regional...... estimator is superior to the at-site estimator even in extremely heterogenous regions, the performance of the regional estimator being relatively better in regions with a negative shape parameter. When the record length increases, the relative performance of the regional estimator decreases, but it is still...

  9. On evaluating the robustness of spatial-proximity-based regionalization methods.

    OpenAIRE

    Lebecherel , L.; Andréassian , V.; Perrin , C.

    2016-01-01

    International audience; In absence of streamflow data to calibrate a hydrological model, its parameters are to be inferred by a regionalization method. In this technical note, we discuss a specific class of regionalization methods, those based on spatial proximity, which transfers hydrological information (typically calibrated parameter sets) from neighbor gauged stations to the target ungauged station. The efficiency of any spatialproximity-based regionalization method will depend on the den...

  10. On evaluating the robustness of spatial-proximity-based regionalization methods.

    OpenAIRE

    Lebecherel, L.; Andréassian, V.; Perrin, C.

    2016-01-01

    In absence of streamflow data to calibrate a hydrological model, its parameters are to be inferred by a regionalization method. In this technical note, we discuss a specific class of regionalization methods, those based on spatial proximity, which transfers hydrological information (typically calibrated parameter sets) from neighbor gauged stations to the target ungauged station. The efficiency of any spatialproximity-based regionalization method will depend on the density of the available st...

  11. Combgap Promotes Ovarian Niche Development and Chromatin Association of EcR-Binding Regions in BR-C.

    Science.gov (United States)

    Hitrik, Anna; Popliker, Malka; Gancz, Dana; Mukamel, Zohar; Lifshitz, Aviezer; Schwartzman, Omer; Tanay, Amos; Gilboa, Lilach

    2016-11-01

    The development of niches for tissue-specific stem cells is an important aspect of stem cell biology. Determination of niche size and niche numbers during organogenesis involves precise control of gene expression. How this is achieved in the context of a complex chromatin landscape is largely unknown. Here we show that the nuclear protein Combgap (Cg) supports correct ovarian niche formation in Drosophila by controlling ecdysone-Receptor (EcR)- mediated transcription and long-range chromatin contacts in the broad locus (BR-C). Both cg and BR-C promote ovarian growth and the development of niches for germ line stem cells. BR-C levels were lower when Combgap was either reduced or over-expressed, indicating an intricate regulation of the BR-C locus by Combgap. Polytene chromosome stains showed that Cg co-localizes with EcR, the major regulator of BR-C, at the BR-C locus and that EcR binding to chromatin was sensitive to changes in Cg levels. Proximity ligation assay indicated that the two proteins could reside in the same complex. Finally, chromatin conformation analysis revealed that EcR-bound regions within BR-C, which span ~30 KBs, contacted each other. Significantly, these contacts were stabilized in an ecdysone- and Combgap-dependent manner. Together, these results highlight Combgap as a novel regulator of chromatin structure that promotes transcription of ecdysone target genes and ovarian niche formation.

  12. High fructose consumption induces DNA methylation at PPARα and CPT1A promoter regions in the rat liver

    Energy Technology Data Exchange (ETDEWEB)

    Ohashi, Koji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Munetsuna, Eiji [Department of Biochemistry, Fujita Health University School of Medicine, Toyoake (Japan); Yamada, Hiroya, E-mail: hyamada@fujita-hu.ac.jp [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan); Ando, Yoshitaka [Department of Joint Research Laboratory of Clinical Medicine, Fujita Health University Hospital, Toyoake (Japan); Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Suzuki, Koji [Department of Public Health, Fujita Health University School of Health Sciences, Toyoake (Japan); Teradaira, Ryoji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Hashimoto, Shuji [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan)

    2015-12-04

    DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.

  13. Competitive Promoter-Associated Matrix Attachment Region Binding of the Arid3a and Cux1 Transcription Factors

    Directory of Open Access Journals (Sweden)

    Dongkyoon Kim

    2017-12-01

    Full Text Available Arid3a/Bright/Dril1 is a B cell-specific transactivator that regulates immunoglobulin heavy chain (IgH gene transcription by binding promoter and enhancer-associated matrix attachment regions (MARs within the IgH gene locus. Promoter MAR-mediated Arid3a transactivation is antagonized by direct competition of MAR binding by Cux1/CDP—a ubiquitously expressed repressor originally termed NF-μNR. We report that the NF-μNR complex includes Arid3a in B cells but not in non-B cells through mobility shift assays. The binding activity of NF-μNR and Arid3a in B cells is reciprocally altered during the cell division cycle and by the B cell mitogen lipopolysaccharide LPS. LPS treatment had no effect on Arid3a localization but increased its total abundance within the nucleus and cytoplasm. We show that this increased level of Arid3a is capable of displacing Cux from the MARs to facilitate IgH gene transcription. Finally, we showed that the MARs (termed Bf150 and Tx125 associated with the VH1 rearranged variable region expressed in the S107 murine plasmacytoma, can repress reporter gene transcription in non-B cells and that they can relieve the repression mediated by Eμ enhancer in B cells. These results have significant implications for early human development and demonstrate that MARs in IgH locus, NF-µNR and Arid3a regulate IgH gene expression in a concerted fashion. This paves the way for future studies examining the misregulation of this pathway in pediatric disease.

  14. High fructose consumption induces DNA methylation at PPARα and CPT1A promoter regions in the rat liver

    International Nuclear Information System (INIS)

    Ohashi, Koji; Munetsuna, Eiji; Yamada, Hiroya; Ando, Yoshitaka; Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki; Suzuki, Koji; Teradaira, Ryoji; Hashimoto, Shuji

    2015-01-01

    DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.

  15. PROGRESSIVE DENSIFICATION AND REGION GROWING METHODS FOR LIDAR DATA CLASSIFICATION

    Directory of Open Access Journals (Sweden)

    J. L. Pérez-García

    2012-07-01

    Full Text Available At present, airborne laser scanner systems are one of the most frequent methods used to obtain digital terrain elevation models. While having the advantage of direct measurement on the object, the point cloud obtained has the need for classification of their points according to its belonging to the ground. This need for classification of raw data has led to appearance of multiple filters focused LiDAR classification information. According this approach, this paper presents a classification method that combines LiDAR data segmentation techniques and progressive densification to carry out the location of the points belonging to the ground. The proposed methodology is tested on several datasets with different terrain characteristics and data availability. In all case, we analyze the advantages and disadvantages that have been obtained compared with the individual techniques application and, in a special way, the benefits derived from the integration of both classification techniques. In order to provide a more comprehensive quality control of the classification process, the obtained results have been compared with the derived from a manual procedure, which is used as reference classification. The results are also compared with other automatic classification methodologies included in some commercial software packages, highly contrasted by users for LiDAR data treatment.

  16. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3' untranslated region and intronic cis-elements.

    Science.gov (United States)

    Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A

    2009-11-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var

  17. Innovative method of RES integration into the regional energy development scenarios

    International Nuclear Information System (INIS)

    Klevas, Valentinas; Biekša, Kestutis; Murauskaitė, Lina

    2014-01-01

    Scarcity or abundance of energy resources usually depends on physical and geographical conditions in the region. However, the energy flow in the region also depends on the efficient use of energy resources, the consumption rate of energy and the possibility to use local renewable and non-renewable energy resources. Production, distribution and the use of energy resources in the region are the challenges for central and local government, business and social service, customers and other stakeholders. Development of regional energy economy should be optimized according to the available energy flow in the region using a network system analysis method, which provides solutions for developing sustainable energy economy models. The network system analysis method enables to optimize the use of local and renewable resources at the regional level and reveals available local energy resources. An efficient use of available regional resources and the use of renewable energy sources (RES) should be the main goals for the development of regional energy system. RES can compete with traditional fossil fuel with the condition that all hidden aspects are revealed. The network system analysis method enables to indicate energy flows in the region as well as indicate pros and cons of using renewable energy technologies. - Highlights: • RES integration into the regional energy development scenarios is done. • Innovative process network system (PNS) analysis method is used. • PNS method is used to optimize the use of local and renewable resources. • Analysis of energy flow in region using PNS method is done

  18. Green Tourism in Mountain Regions - Reducing Vulnerability and Promoting People and Place Centric Development in the Himalayas

    Institute of Scientific and Technical Information of China (English)

    R. B. Singh; D. K. Mishra

    2004-01-01

    In recent years, mountain regions are attracting great attention to Indian tourists in general and foreign tourists in particular. The potential mountain resources for promoting green tourism are enormous in the form of natural and cultural heritage such as biosphere reserves, flora and fauna, lakes and rivers and traditional rural resources. In order to utilise tourism industry market, uncontrolled numbers of tourists and related haphazard infrastructural facilities in the vulnerable mountain regions pose serious environmental implications. The ecological pressures are threatening land, water and wild life resources through direct and indirect environmental impacts together with generation of solid and liquid wastes, so green tourism is emerging as an important task in order to develop new relationship between communities, government agencies and private sectors. The strategy focuses on ecological understanding, environmental protection and ecodevelopment. The major attributes of the green tourism include environmental conservation and education and distribution of income to local people based on strong partnership. Various knowledge systems go a long way for achieving the goals of the green tourism, which creates awareness about the value of environmental resources.Mountains have ecological, recreational, educational and scientific values, which need to be utilised in sustainable way. Various tourist activities and facilities need to be diversified in order to achieve multiple benefits including scientific field excursion,recreation in natural and cultural areas, community festivals and sport tourisms. Green tourism considers tourism development as an integral part of a national and regional development. The paper discusses the social, economic and environmental dimensions of the green tourism with particular reference to village tourism development programme taking empirical evidences from the Himalaya. Such programme also minimises biophysical and human

  19. Spatial Data Envelopment Analysis Method for the Evaluation of Regional Infrastructure Disparities

    Directory of Open Access Journals (Sweden)

    Birutė Galinienė

    2012-12-01

    Full Text Available Purpose—to achieve a more detailed assessment of regional differences, exploring regional infrastructure and human capital usage efficiency and to display analysis capabilities of spatial data efficient frontier method.Design/methodology/approach—the data envelopment analysis (DEA is applied to find the efficient frontier, which extends the application of production function of the regions. This method of mathematical programming optimization allows assessing the effectiveness of the regional spatial aspects presented. In recent studies this method is applied for evaluating the European Union regional policy issues.Findings—the application of DEA reveals its feasibility for regional input and output studies to evaluate more detailed and more reasonable fund allocation between Lithuanian regions. This analysis shows that in the comparatively efficient Lithuanian regions, such as Vilnius and Klaipėda, “the bottleneck” of usage of transport infrastructure and regional specific human capital is reached. It is stated that decision-making units could enhance region attractiveness for private investors by improving indirect factors in these regions. For practical significance of the study the results are compared with German regional analysis, conducted by Schaffer and other researchers (2011.Practical implications—the practical value of this work is based on giving more accurate planning tools for fund allocation decisions in Lithuanian regions while planning infrastructure and human capital development. The regional indicators were analyzed for 2010.Research type—case study.

  20. Promoting Healthy Development among Adolescent Girls: A Mixed-Methods Evaluation of the HERstory Program

    Directory of Open Access Journals (Sweden)

    Emily MacFarlane

    2013-03-01

    Full Text Available The Leadership Program’s HERstory is a school-based, universal, preventative intervention designed to promote healthy youth development among adolescent girls by increasing their connections to pro-social peers and to school and community while developing social-emotional skills that serve as protective factors. In this school-year-long program, a facilitator implements three program phases: group development activities in Community Building, self-reflective Writing Workshop exercises, and a final Creative Output project, an ethnographic theater production or literary journal developed from participants’ Writing Workshop responses. The current mixed-methods study presents early evidence of program effectiveness based on focus groups and school record data review at two NYC public schools during the 2010-2011 school year. Participants reported improvements in key areas targeted by HERstory, including peer connectedness, academic achievement, and a range of protective factors including future orientation and goal setting. Results suggest this program approach may be suitable promoting healthy adolescent development for girls.

  1. Participatory methods for Inuit public health promotion and programme evaluation in Nunatsiavut, Canada.

    Science.gov (United States)

    Saini, Manpreet

    2017-01-01

    Engaging stakeholders is crucial for health promotion and programme evaluations; understanding how to best engage stakeholders is less clear, especially within Indigenous communities. The objectives of this thesis research were to use participatory methods to: (1) co-develop and evaluate a whiteboard video for use as a public health promotion tool in Rigolet, Nunatsiavut, and (2) develop and validate a framework for participatory evaluation of Inuit public health initiatives in Nunatsiavut, Labrador. Data collection tools included interactive workshops, community events, interviews, focus-group discussions and surveys. Results indicated the whiteboard video was an engaging and suitable medium for sharing public health messaging due to its contextually relevant elements. Participants identified 4 foundational evaluation framework components necessary to conduct appropriate evaluations, including: (1) community engagement, (2) collaborative evaluation development, (3) tailored evaluation data collection and (4) evaluation scope. This research illustrates stakeholder participation is critical to develop and evaluate contextually relevant public health initiatives in Nunatsiavut, Labrador and should be considered in other Indigenous communities.

  2. Economics methods in Cochrane systematic reviews of health promotion and public health related interventions

    Directory of Open Access Journals (Sweden)

    McDaid David

    2006-11-01

    Full Text Available Abstract Background Provision of evidence on costs alongside evidence on the effects of interventions can enhance the relevance of systematic reviews to decision-making. However, patterns of use of economics methods alongside systematic review remain unclear. Reviews of evidence on the effects of interventions are published by both the Cochrane and Campbell Collaborations. Although it is not a requirement that Cochrane or Campbell Reviews should consider economic aspects of interventions, many do. This study aims to explore and describe approaches to incorporating economics methods in a selection of Cochrane systematic reviews in the area of health promotion and public health, to help inform development of methodological guidance on economics for reviewers. Methods The Cochrane Database of Systematic Reviews was searched using a search strategy for potential economic evaluation studies. We included current Cochrane reviews and review protocols retrieved using the search that are also identified as relevant to health promotion or public health topics. A reviewer extracted data which describe the economics components of included reviews. Extracted data were summarised in tables and analysed qualitatively. Results Twenty-one completed Cochrane reviews and seven review protocols met inclusion criteria. None incorporate formal economic evaluation methods. Ten completed reviews explicitly aim to incorporate economics studies and data. There is a lack of transparent reporting of methods underpinning the incorporation of economics studies and data. Some reviews are likely to exclude useful economics studies and data due to a failure to incorporate search strategies tailored to the retrieval of such data or use of key specialist databases, and application of inclusion criteria designed for effectiveness studies. Conclusion There is a need for consistency and transparency in the reporting and conduct of the economics components of Cochrane reviews, as

  3. Control of growth promotion (CGP) and screening for malnutrition in central region and Lomé-Commune, January to June 2013 Togo

    International Nuclear Information System (INIS)

    Touglo, Adavi Lonlon; Bouraima, Mouawiyatou; Agbozouhoue, A. Eya; Bebou, Midassirou; Tchapo, Dapou; Akolly, Koffi

    2014-01-01

    Full text: Background: Control of Growth Promotion (CGP) is an activity that can detect early if the child has a developmental problem and investigate the cause and take appropriate decisions to overcome the consequences. In Togo, the goal in 2013 is to weigh at least 80 % of children 0-5 years during the sessions of CGP. What are the levels achieved this goal after the first semester and the problems of malnutrition detected? Method: We conducted a descriptive cross-sectional study data collected in the quarterly reports in two regions of Togo, Lomé - Commune in the South and Central Region in the North. The study involved data from the first semester of 2013 in all districts of the two regions. Database monitoring activities at national level CGP was used. Data from the two regions were separated and analyzed using Excel. Comparison tests of proportions were made using Epi Info 7. Results: Detection rate of nutritional status by the CGP in the first half of 2013 was 29% of the total target of 155,423 children under 5 years in the two regions. This rate was higher for the Central region (33 %) than for Lomé-Commune (26 %). No district has reached half of the goals. Their rates vary from 17.9 % and 18 % respectively for District No. 2 and District No. 4 of Lomé-Commune to 39.7% for the District of Tchaoudjo. The malnutrition rate was 8.8 %. This rate is higher in the Central region (10.9 %) than in Lomé-Commune (6.8 %) with a RR = 1.59, 95% CI = [1.50 to 1.69]. Severe malnutrition was 1.4 %. It is predominant in Lomé-commune (1.7 %) than in the Central region (1.1%) with a RR = 1.55, 95% CI = [1.32 to 1.82]. Conclusion: All districts in the two regions are below the target detection rate in the first half. The CGP has detected cases of moderate and severe malnutrition. To compare that rates with the survey data, the screening tools must be standard and adequate. (author)

  4. Functional Analysis of Promoter Region from Eel Cytochrome P450 1A1 Gene in Transgenic Medaka.

    Science.gov (United States)

    Ogino; Itakura; Kato; Aoki; Sato

    1999-07-01

    : Transcription of the CYP1A1 genes in mammals and fish is stimulated by polyaromatic hydrocarbons. DNA sequencing analysis revealed that CYP1A1 gene in eel (Anguilla japonica) contains two kinds of putative cis-acting regulatory elements, XRE (xenobiotic-responsive element) and ERE (estrogen-responsive element). XRE is known as the enhancer that is responsible for the inducibility of the genes of CYP1A1 and some other drug-metabolizing enzymes. In the eel CYP1A1 gene, XRE motifs are distributed as follows: five times in the region from -2136 to -1125 bp, XRE(-6) to (-2); once in the proximal basal promoter region, XRE(-1); and once in the first intron, XRE(+1). The region between XRE(-2) and XRE(-1) contains three ERE motifs. To investigate the function of the cis-acting regulatory elements in the eel CYP1A1 gene, recombinant plasmids prepared with its 5' upstream sequence and the structural gene for luciferase were microinjected into fertilized eggs of medaka at the one-cell stage. Hatched fry were treated with 3-methylcholanthrene, and the transcription efficiency was assayed using competitive polymerase chain reaction analysis. Deletion of the region containing the five XREs, XRE(-6) to XRE(-2), and the point mutation of XRE(-1) reduced the inducible expressions by 75% and 56%, respectively, showing apparent dependency of the drug induction on the XREs. Constitutive expression, however, was not significantly affected by deletion or disruption of the XREs. When the region between XRE(-2) and XRE(-1) containing no XREs but three ERE motifs was internally deleted, the inducible expression and the constitutive expression were reduced by 88% and 75%, respectively. Replacement of this region with a partial fragment of eel CYP1A1 complementary DNA, with slight alteration of the distance between the five XREs and XRE(-1), reduced the inducible expression and the constitutive expression by 91% and 60%, respectively. These results strongly suggest that not only XRE but

  5. The FLUKA code for application of Monte Carlo methods to promote high precision ion beam therapy

    CERN Document Server

    Parodi, K; Cerutti, F; Ferrari, A; Mairani, A; Paganetti, H; Sommerer, F

    2010-01-01

    Monte Carlo (MC) methods are increasingly being utilized to support several aspects of commissioning and clinical operation of ion beam therapy facilities. In this contribution two emerging areas of MC applications are outlined. The value of MC modeling to promote accurate treatment planning is addressed via examples of application of the FLUKA code to proton and carbon ion therapy at the Heidelberg Ion Beam Therapy Center in Heidelberg, Germany, and at the Proton Therapy Center of Massachusetts General Hospital (MGH) Boston, USA. These include generation of basic data for input into the treatment planning system (TPS) and validation of the TPS analytical pencil-beam dose computations. Moreover, we review the implementation of PET/CT (Positron-Emission-Tomography / Computed- Tomography) imaging for in-vivo verification of proton therapy at MGH. Here, MC is used to calculate irradiation-induced positron-emitter production in tissue for comparison with the +-activity measurement in order to infer indirect infor...

  6. An Alternative Method for Identifying Interplanetary Magnetic Cloud Regions

    Energy Technology Data Exchange (ETDEWEB)

    Ojeda-Gonzalez, A.; Prestes, A.; Klausner, V. [Laboratory of Physics and Astronomy, IP and D/Universidade do Vale do Paraíba—UNIVAP, São José dos Campos, SP (Brazil); Mendes, O. [Division of Space Geophysics, National Institute for Space Research, São José dos Campos, SP (Brazil); Calzadilla, A. [Department of Space Geophysics, Institute of Geophysics and Astronomy, Havana (Cuba); Domingues, M. O., E-mail: ojeda.gonzalez.a@gmail.com [Associate Laboratory of Applied Computing and Mathematics, National Institute for Space Research, São José dos Campos, SP (Brazil)

    2017-03-10

    Spatio-temporal entropy (STE) analysis is used as an alternative mathematical tool to identify possible magnetic cloud (MC) candidates. We analyze Interplanetary Magnetic Field (IMF) data using a time interval of only 10 days. We select a convenient data interval of 2500 records moving forward by 200 record steps until the end of the time series. For every data segment, the STE is calculated at each step. During an MC event, the STE reaches values close to zero. This extremely low value of STE is due to MC structure features. However, not all of the magnetic components in MCs have STE values close to zero at the same time. For this reason, we create a standardization index (the so-called Interplanetary Entropy, IE, index). This index is a worthwhile effort to develop new tools to help diagnose ICME structures. The IE was calculated using a time window of one year (1999), and it has a success rate of 70% over other identifiers of MCs. The unsuccessful cases (30%) are caused by small and weak MCs. The results show that the IE methodology identified 9 of 13 MCs, and emitted nine false alarm cases. In 1999, a total of 788 windows of 2500 values existed, meaning that the percentage of false alarms was 1.14%, which can be considered a good result. In addition, four time windows, each of 10 days, are studied, where the IE method was effective in finding MC candidates. As a novel result, two new MCs are identified in these time windows.

  7. National Survey on Access, Use and Promotion of Rational Use of Medicines (PNAUM: household survey component methods

    Directory of Open Access Journals (Sweden)

    Sotero Serrate Mengue

    Full Text Available ABSTRACT OBJECTIVE To describe methodological aspects of the household survey National Survey on Access, Use and Promotion of Rational Use of Medicines (PNAUM related to sampling design and implementation, the actual obtained sample, instruments and fieldwork. METHODS A cross-sectional, population-based study with probability sampling in three stages of the population living in households located in Brazilian urban areas. Fieldwork was carried out between September 2013 and February 2014. The data collection instrument included questions related to: information about households, residents and respondents; chronic diseases and medicines used; use of health services; acute diseases and events treated with drugs; use of contraceptives; use of pharmacy services; behaviors that may affect drug use; package inserts and packaging; lifestyle and health insurance. RESULTS In total, 41,433 interviews were carried out in 20,404 households and 576 urban clusters corresponding to 586 census tracts distributed in the five Brazilian regions, according to eight domains defined by age and gender. CONCLUSIONS The results of the survey may be used as a baseline for future studies aiming to assess the impact of government action on drug access and use. For local studies using a compatible method, PNAUM may serve as a reference point to evaluate variations in space and population. With a comprehensive evaluation of drug-related aspects, PNAUM is a major source of data for a variety of analyses to be carried out both at academic and government level.

  8. DNA methylation in Cosmc promoter region and aberrantly glycosylated IgA1 associated with pediatric IgA nephropathy.

    Directory of Open Access Journals (Sweden)

    Qiang Sun

    Full Text Available IgA nephropathy (IgAN is one of the most common glomerular diseases leading to end-stage renal failure. Elevation of aberrantly glycosylated IgA1 is a key feature of it. The expression of the specific molecular chaperone of core1ß1, 3galactosyl transferase (Cosmc is known to be reduced in IgAN. We aimed to investigate whether the methylation of CpG islands of Cosmc gene promoter region could act as a possible mechanism responsible for down-regulation of Cosmc and related higher secretion of aberrantly glycosylated IgA1in lymphocytes from children with IgA nephropathy. Three groups were included: IgAN children (n = 26, other renal diseases (n = 11 and healthy children (n = 13. B-lymphocytes were isolated and cultured, treated or not with IL-4 or 5-Aza-2'-deoxycytidine (AZA. The levels of DNA methylation of Cosmc promotor region were not significantly different between the lymphocytes of the three children populations (P = 0.113, but there were significant differences between IgAN lymphocytes and lymphocytes of the other two children populations after IL-4 (P<0.0001 or AZA (P<0.0001. Cosmc mRNA expression was low in IgAN lymphocytes compared to the other two groups (P<0.0001. The level of aberrantly glycosylated IgA1 was markedly higher in IgAN group compared to the other groups (P<0.0001. After treatment with IL-4, the levels of Cosmc DNA methylation and aberrantly glycosylated IgA1 in IgAN lymphocytes were remarkably higher than the other two groups (P<0.0001 with more markedly decreased Cosmc mRNA content (P<0.0001. After treatment with AZA, the levels in IgAN lymphocytes were decreased, but was still remarkably higher than the other two groups (P<0.0001, while Cosmc mRNA content in IgAN lymphocytes were more markedly increased than the other two groups (P<0.0001. The alteration of DNA methylation by IL-4 or AZA specifically correlates in IgAN lymphocytes with alterations in Cosmc mRNA expression and with the level of aberrantly glycosylated

  9. Systematic screening for mutations in the promoter and the coding region of the 5-HT{sub 1A} gene

    Energy Technology Data Exchange (ETDEWEB)

    Erdmann, J.; Shimron-Abarbanell, D.; Cichon, S. [Univ. of Bonn (Germany)] [and others

    1995-10-09

    In the present study we sought to identify genetic variation in the 5-HT{sub 1A} receptor gene which through alteration of protein function or level of expression might contribute to the genetic predisposition to neuropsychiatric diseases. Genomic DNA samples from 159 unrelated subjects (including 45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 healthy controls) were investigated by single-strand conformation analysis. Overlapping PCR (polymerase chain reaction) fragments covered the whole coding sequence as well as the 5{prime} untranslated region of the 5-HT{sub 1A} gene. The region upstream to the coding sequence we investigated contains a functional promoter. We found two rare nucleotide sequence variants. Both mutations are located in the coding region of the gene: a coding mutation (A{yields}G) in nucleotide position 82 which leads to an amino acid exchange (Ile{yields}Val) in position 28 of the receptor protein and a silent mutation (C{yields}T) in nucleotide position 549. The occurrence of the Ile-28-Val substitution was studied in an extended sample of patients (n = 352) and controls (n = 210) but was found in similar frequencies in all groups. Thus, this mutation is unlikely to play a significant role in the genetic predisposition to the diseases investigated. In conclusion, our study does not provide evidence that the 5-HT{sub 1A} gene plays either a major or a minor role in the genetic predisposition to schizophrenia, bipolar affective disorder, or Tourette`s syndrome. 29 refs., 4 figs., 1 tab.

  10. Increased fire frequency promotes stronger spatial genetic structure and natural selection at regional and local scales in Pinus halepensis Mill.

    Science.gov (United States)

    Budde, Katharina B; González-Martínez, Santiago C; Navascués, Miguel; Burgarella, Concetta; Mosca, Elena; Lorenzo, Zaida; Zabal-Aguirre, Mario; Vendramin, Giovanni G; Verdú, Miguel; Pausas, Juli G; Heuertz, Myriam

    2017-04-01

    The recurrence of wildfires is predicted to increase due to global climate change, resulting in severe impacts on biodiversity and ecosystem functioning. Recurrent fires can drive plant adaptation and reduce genetic diversity; however, the underlying population genetic processes have not been studied in detail. In this study, the neutral and adaptive evolutionary effects of contrasting fire regimes were examined in the keystone tree species Pinus halepensis Mill. (Aleppo pine), a fire-adapted conifer. The genetic diversity, demographic history and spatial genetic structure were assessed at local (within-population) and regional scales for populations exposed to different crown fire frequencies. Eight natural P. halepensis stands were sampled in the east of the Iberian Peninsula, five of them in a region exposed to frequent crown fires (HiFi) and three of them in an adjacent region with a low frequency of crown fires (LoFi). Samples were genotyped at nine neutral simple sequence repeats (SSRs) and at 251 single nucleotide polymorphisms (SNPs) from coding regions, some of them potentially important for fire adaptation. Fire regime had no effects on genetic diversity or demographic history. Three high-differentiation outlier SNPs were identified between HiFi and LoFi stands, suggesting fire-related selection at the regional scale. At the local scale, fine-scale spatial genetic structure (SGS) was overall weak as expected for a wind-pollinated and wind-dispersed tree species. HiFi stands displayed a stronger SGS than LoFi stands at SNPs, which probably reflected the simultaneous post-fire recruitment of co-dispersed related seeds. SNPs with exceptionally strong SGS, a proxy for microenvironmental selection, were only reliably identified under the HiFi regime. An increasing fire frequency as predicted due to global change can promote increased SGS with stronger family structures and alter natural selection in P. halepensis and in plants with similar life history traits

  11. Qualitative analysis of Adenomatous Polyposis Coli promoter: Hypermethylation, engagement and effects on survival of patients with esophageal cancer in a high risk region of the world, a potential molecular marker

    Directory of Open Access Journals (Sweden)

    Nasseri Negin

    2009-01-01

    Full Text Available Abstract Background Squamous cell carcinoma of esophagus (SCCE occurs at a high incidence rate in certain parts of the world. This feature necessitates that different aspects of the disease and in particular genetic characteristics be investigated in such regions. In addition, such investigations might lead to achievement of molecular markers helpful for early detection, successful treatment and follow up of the disease. Adenomatous Polyposis Coli (APC promoter hypermethylation has been shown to be a suitable marker for both serum and solid tumors of adenocarcinoma of esophagus. We investigated the status of APC promoter hypermethylation in Iranian patients, compared the results with the former studies, and evaluated its applicability as a candidate molecular marker by examining association between survival of SCCE patients and APC promoter methylation. Methods For evaluating the status of APC promoter hypermethylation and its association with SCCE, a qualitative methylation specific PCR (MSP was used. DNA was extracted and digested with an appropriate restriction enzyme, treated with sodium bisulfite in agarose beads and amplified in two-step PCR reaction by applying either methylated or unmethylated promoter specific primers. Universally methylated DNA and methylase treated blood DNA of healthy donors were used as positive controls as well. Survival of patients was followed up for two years after treatment and survival rate of patients with methylated APC promoter was compared with that of unmethylated patients. Results Assessment of APC promoter methylation revealed that normal tissues were unmethylated, while twenty out of forty five (44.4% tumor tissues were hypermethylated either in one or both alleles of APC. Among the tissues in which methylation was detected, seven were hypermethylated in both alleles while the other thirteen were hypermethylated in one of the two alleles of APC. Analyzing two-year survival rate of patients with respect

  12. Creating multithemed ecological regions for macroscale ecology: Testing a flexible, repeatable, and accessible clustering method

    Science.gov (United States)

    Cheruvelil, Kendra Spence; Yuan, Shuai; Webster, Katherine E.; Tan, Pang-Ning; Lapierre, Jean-Francois; Collins, Sarah M.; Fergus, C. Emi; Scott, Caren E.; Norton Henry, Emily; Soranno, Patricia A.; Filstrup, Christopher T.; Wagner, Tyler

    2017-01-01

    Understanding broad-scale ecological patterns and processes often involves accounting for regional-scale heterogeneity. A common way to do so is to include ecological regions in sampling schemes and empirical models. However, most existing ecological regions were developed for specific purposes, using a limited set of geospatial features and irreproducible methods. Our study purpose was to: (1) describe a method that takes advantage of recent computational advances and increased availability of regional and global data sets to create customizable and reproducible ecological regions, (2) make this algorithm available for use and modification by others studying different ecosystems, variables of interest, study extents, and macroscale ecology research questions, and (3) demonstrate the power of this approach for the research question—How well do these regions capture regional-scale variation in lake water quality? To achieve our purpose we: (1) used a spatially constrained spectral clustering algorithm that balances geospatial homogeneity and region contiguity to create ecological regions using multiple terrestrial, climatic, and freshwater geospatial data for 17 northeastern U.S. states (~1,800,000 km2); (2) identified which of the 52 geospatial features were most influential in creating the resulting 100 regions; and (3) tested the ability of these ecological regions to capture regional variation in water nutrients and clarity for ~6,000 lakes. We found that: (1) a combination of terrestrial, climatic, and freshwater geospatial features influenced region creation, suggesting that the oft-ignored freshwater landscape provides novel information on landscape variability not captured by traditionally used climate and terrestrial metrics; and (2) the delineated regions captured macroscale heterogeneity in ecosystem properties not included in region delineation—approximately 40% of the variation in total phosphorus and water clarity among lakes was at the regional

  13. Methylation in the promoter regions of WT1, NKX6-1 and DBC1 genes in cervical cancer tissues of Uygur women in Xinjiang

    Directory of Open Access Journals (Sweden)

    Dan Wu

    Full Text Available Abstract This study aimed to explore: 1 DNA methylation in the promoter regions of Wilms tumor gene 1 (WT1, NK6 transcription factor related locus 1 gene (NKX6-1 and Deleted in bladder cancer 1 (DBC1 gene in cervical cancer tissues of Uygur women in Xinjiang, and 2 the correlation of gene methylation with the infection of HPV16/18 viruses. We detected HPV16/18 infection in 43 normal cervical tissues, 30 cervical intraepithelial neoplasia lesions (CIN and 48 cervical cancer tissues with polymerase chain reaction (PCR method. Methylation in the promoter regions of the WT1, NKX6-1 and DBC1 genes in the above-mentioned tissues was measured by methylation-specific PCR (MSP and cloning sequencing. The expression level of these three genes was measured by real-time PCR (qPCR in 10 methylation-positive cervical cancer tissues and 10 methylation-negative normal cervical tissues. We found that the infection of HPV16 in normal cervical tissues, CIN and cervical cancer tissues was 14.0, 36.7 and 66.7%, respectively. The infection of HPV18 was 0, 6.7 and 10.4%, respectively. The methylation rates of WT1, NKX6-1 and DBC1 genes were 7.0, 11.6 and 23.3% in normal cervical tissues, 36.7, 46.7 and 30.0% in CIN tissues, and 89.6, 77.1 and 85.4% in cervical cancer tissues. Furthermore, WT1, NKX6-1 and DBC1 genes were hypermethylated in the high-grade squamous intraepithelial lesion (CIN2, CIN3 and in the cervical cancer tissues with infection of HPV16/18 (both P< 0.05. The expression of WT1, NKX6-1 and DBC1 was significantly lower in the methylation-positive cervical cancer tissues than in methylation-negative normal cervical tissues. Our findings indicated that methylation in the promoter regions of WT1, NKX6-1 and DBC1 is correlated with cervical cancer tumorigenesis in Uygur women. The infection of HPV16/18 might be correlated with methylation in these genes. Gene inactivation caused by methylation might be related to the incidence and development of cervical

  14. A General Method to Estimate Earthquake Moment and Magnitude using Regional Phase Amplitudes

    Energy Technology Data Exchange (ETDEWEB)

    Pasyanos, M E

    2009-11-19

    This paper presents a general method of estimating earthquake magnitude using regional phase amplitudes, called regional M{sub o} or regional M{sub w}. Conceptually, this method uses an earthquake source model along with an attenuation model and geometrical spreading which accounts for the propagation to utilize regional phase amplitudes of any phase and frequency. Amplitudes are corrected to yield a source term from which one can estimate the seismic moment. Moment magnitudes can then be reliably determined with sets of observed phase amplitudes rather than predetermined ones, and afterwards averaged to robustly determine this parameter. We first examine in detail several events to demonstrate the methodology. We then look at various ensembles of phases and frequencies, and compare results to existing regional methods. We find regional M{sub o} to be a stable estimator of earthquake size that has several advantages over other methods. Because of its versatility, it is applicable to many more events, particularly smaller events. We make moment estimates for earthquakes ranging from magnitude 2 to as large as 7. Even with diverse input amplitude sources, we find magnitude estimates to be more robust than typical magnitudes and existing regional methods and might be tuned further to improve upon them. The method yields a more meaningful quantity of seismic moment, which can be recast as M{sub w}. Lastly, it is applied here to the Middle East region using an existing calibration model, but it would be easy to transport to any region with suitable attenuation calibration.

  15. Analysis of polymorphisms in the promoter region and protein levels of interleukin-6 gene among gout patients.

    Science.gov (United States)

    Tsai, P-C; Chen, C-J; Lai, H-M; Chang, S-J

    2008-01-01

    To explore the associations between the polymorphisms and protein levels of interleukin-6 (IL-6) gene and gout disease. A total of 120 male gout patients and 184 healthy controls were enrolled. Each patient was matched with 1-2 gout-free controls by age within three years. Four polymorphisms in the promoter of IL-6 gene, including -597G/A, -572C/G, -373A(m)T(n), and -174G/C, and the IL-6 levels were analyzed. The clinical characteristics and biochemical markers in plasma were measured, including age of gout onset, duration of gout history, tophus number, gout attack frequency, uric acid, total cholesterol, triglycerides and creatinine. The mean IL-6 level for gout patients was 9.80 (+/-11.76 pg/ml) which showed no significant difference from the controls (7.06+/-7.58 pg/ml, p=0.230). When the IL-6 levels were dichotomized according to the median value (5 pg/ml), there were significantly higher proportions of the gout patients (59.66%) than controls (44%) with high IL-6 levels (OR=1.88, 95% CI=1.17-3.02, p=0.008). Unique genotype was found at polymorphisms -174G/C and -597G/A. Neither the polymorphisms -572C/G nor -373A(m)T(n) in the genotype or allele distributions showed a significant association related to clinical characteristics, biochemical markers, IL-6 levels or gout disease (all p>0.05). Those with gout disease have greater proportions of high IL-6 levels in plasma than controls, and there is no significant association between the four polymorphisms in the promoter region of IL-6 gene and gout disease.

  16. [Ecological regionalization of national cotton fiber quality in China using GGE biplot analysis method].

    Science.gov (United States)

    Xu, Nai Yin; Jin, Shi Qiao; Li, Jian

    2017-01-01

    The distinctive regional characteristics of cotton fiber quality in the major cotton-producing areas in China enhance the textile use efficiency of raw cotton yarn by improving fiber quality through ecological regionalization. The "environment vs. trait" GGE biplot analysis method was adopted to explore the interaction between conventional cotton sub-regions and cotton fiber quality traits based on the datasets collected from the national cotton regional trials from 2011 to 2015. The results showed that the major cotton-producing area in China were divided into four fiber quality ecological regions, namely, the "high fiber quality ecological region", the "low micronaire ecological region", the "high fiber strength and micronaire ecological region", and the "moderate fiber quality ecological region". The high fiber quality ecological region was characterized by harmonious development of cotton fiber length, strength, micronaire value and the highest spinning consistency index, and located in the conventional cotton regions in the upper and lower reaches of Yangtze River Valley. The low micronaire value ecological region composed of the northern and south Xinjiang cotton regions was characterized by low micronaire value, relatively lower fiber strength, and relatively high spinning consistency index performance. The high fiber strength and micronaire value ecological region covered the middle reaches of Yangtze River Valley, Nanxiang Basin and Huaibei Plain, and was prominently characterized by high strength and micronaire value, and moderate performance of other traits. The moderate fiber quality ecological region included North China Plain and Loess Plateau cotton growing regions in the Yellow River Valley, and was characterized by moderate or lower performances of all fiber quality traits. This study effectively applied "environment vs. trait" GGE biplot to regionalize cotton fiber quality, which provided a helpful reference for the regiona-lized cotton growing

  17. Effect of Promoter Region Mutations and mgrA Overexpression on Transcription of norA, Which Encodes a Staphylococcus aureus Multidrug Efflux Transporter

    OpenAIRE

    Kaatz, Glenn W.; Thyagarajan, Rama V.; Seo, Susan M.

    2005-01-01

    NorA is a Staphylococcus aureus multidrug transporter that confers resistance to structurally distinct compounds. The MgrA global regulatory protein is reported to augment norA expression when mgrA is overexpressed from an undefined plasmid-based promoter. Further details about norA regulatory mechanisms are scant. A chromosomal norA::lacZ transcriptional fusion was constructed in different S. aureus strains, and allele replacement was used to define the relevance of promoter region sequences...

  18. Bringing numerous methods for expression and promoter analysis to a public cloud computing service.

    Science.gov (United States)

    Polanski, Krzysztof; Gao, Bo; Mason, Sam A; Brown, Paul; Ott, Sascha; Denby, Katherine J; Wild, David L

    2018-03-01

    Every year, a large number of novel algorithms are introduced to the scientific community for a myriad of applications, but using these across different research groups is often troublesome, due to suboptimal implementations and specific dependency requirements. This does not have to be the case, as public cloud computing services can easily house tractable implementations within self-contained dependency environments, making the methods easily accessible to a wider public. We have taken 14 popular methods, the majority related to expression data or promoter analysis, developed these up to a good implementation standard and housed the tools in isolated Docker containers which we integrated into the CyVerse Discovery Environment, making these easily usable for a wide community as part of the CyVerse UK project. The integrated apps can be found at http://www.cyverse.org/discovery-environment, while the raw code is available at https://github.com/cyversewarwick and the corresponding Docker images are housed at https://hub.docker.com/r/cyversewarwick/. info@cyverse.warwick.ac.uk or D.L.Wild@warwick.ac.uk. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  19. Effect of metallothionein core promoter region polymorphism on cadmium, zinc and copper levels in autopsy kidney tissues from a Turkish population

    International Nuclear Information System (INIS)

    Kayaalti, Zeliha; Mergen, Goerkem; Soeylemezoglu, Tuelin

    2010-01-01

    Metallothioneins (MTs) are metal-binding, low molecular weight proteins and are involved in pathophysiological processes like metabolism of essential metals, metal ion homeostasis and detoxification of heavy metals. Metallothionein expression is induced by various heavy metals especially cadmium, mercury and zinc; MTs suppress toxicity of heavy metals by binding themselves to these metals. The aim of this study was to investigate the association between the - 5 A/G metallothionein 2A (MT2A) single nucleotide polymorphism (SNP) and Cd, Zn and Cu levels in the renal cortex from autopsy cases. MT2A core promoter region - 5 A/G SNP was analyzed by PCR-RFLP method using 114 autopsy kidney tissues and the genotype frequencies of this polymorphism were found as 87.7% homozygote typical (AA), 11.4% heterozygote (AG) and 0.9% homozygote atypical (GG). In order to assess the Cd, Zn and Cu levels in the same autopsy kidney tissues, a dual atomic absorption spectrophotometer system was used and the average levels of Cd, Zn and Cu were measured as 95.54 ± 65.58 μg/g, 181.20 ± 87.72 μg/g and 17.14 ± 16.28 μg/g, respectively. As a result, no statistical association was found between the - 5 A/G SNP in the MT2A gene and the Zn and Cu levels in the renal cortex (p > 0.05), but considerably high accumulation of Cd was monitored for individuals having AG (151.24 ± 60.21 μg/g) and GG genotypes (153.09 μg/g) compared with individuals having AA genotype (87.72 ± 62.98 μg/g) (p < 0.05). These results show that the core promoter region polymorphism of metallothionein 2A increases the accumulation of Cd in human renal cortex.

  20. Polymorphism of the promoter region and exon 1 of the CTLA4 gene in endemic pemphigus foliaceus (fogo selvagem

    Directory of Open Access Journals (Sweden)

    D.P. Pavoni

    2006-09-01

    Full Text Available Endemic pemphigus foliaceus (EPF is an autoimmune bullous skin disease characterized by acantholysis and antibodies against a desmosomal protein, desmoglein 1. Genetic and environmental factors contribute to development of this multifactorial disease. HLA class II and some cytokine gene polymorphisms are the only genetic markers thus far known to be associated with susceptibility to or protection from EPF. The cytotoxic T-lymphocyte antigen-4 gene (CTLA4 encodes a key immunoreceptor molecule that regulates and inhibits T-cell proliferation. It participates in the regulatory process controlling autoreactivity and therefore has been considered a strong candidate gene in autoimmune diseases. In the search for genes that might influence EPF pathogenesis, we analyzed variants of the CTLA4 gene in a sample of 118 patients and 291 controls from a Brazilian population. This is the first study investigating the possible role of polymorphisms of the 2q33 chromosomal region in differential susceptibility to pemphigus foliaceus. Promoter region and exon 1 single nucleotide polymorphisms -318 (C,T and 49 (A,G were genotyped using sequence-specific oligonucleotide probes after amplification by the polymerase chain reaction. The allelic and genotypic frequencies did not differ significantly between the patient and the control groups (-318T: 9.8 and 10.9%, 49G: 33.0 and 35.2% were the allelic frequencies in patients and controls, respectively. In addition, no significant difference was found when the patient and control population samples were stratified by the presence of HLA-DRB1 alleles. We conclude that the CTLA4 -318 (C,T and 49 (A,G polymorphisms do not play a major role in EPF development.

  1. Toward a regional power plant siting method: AEC-Maryland regional siting factors study, FY 1974 progress report

    International Nuclear Information System (INIS)

    Yaffee, S.L.; Miller, C.A.

    1974-11-01

    The ''AEC-Maryland Regional Siting Factors Study'' examines the process of siting in a regional context. It is developing an analysis method to delineate candidate areas for siting of several power plant technology packages, including both fossil-fueled and nuclear options. Tools that are being used include simulation modeling, economic and demographic forecasting, spatial analysis, and computer graphics and numerical manipulation. The approach will describe the trade-offs incurred if a power plant is located in one candidate area rather than in another. In FY 1974, a suitability analysis method was developed which uses engineering and environmental parameters to define a level of environmental cost incurred if a segment of land is used to site a specific technology package. (U.S.)

  2. ChIPnorm: a statistical method for normalizing and identifying differential regions in histone modification ChIP-seq libraries.

    Science.gov (United States)

    Nair, Nishanth Ulhas; Sahu, Avinash Das; Bucher, Philipp; Moret, Bernard M E

    2012-01-01

    The advent of high-throughput technologies such as ChIP-seq has made possible the study of histone modifications. A problem of particular interest is the identification of regions of the genome where different cell types from the same organism exhibit different patterns of histone enrichment. This problem turns out to be surprisingly difficult, even in simple pairwise comparisons, because of the significant level of noise in ChIP-seq data. In this paper we propose a two-stage statistical method, called ChIPnorm, to normalize ChIP-seq data, and to find differential regions in the genome, given two libraries of histone modifications of different cell types. We show that the ChIPnorm method removes most of the noise and bias in the data and outperforms other normalization methods. We correlate the histone marks with gene expression data and confirm that histone modifications H3K27me3 and H3K4me3 act as respectively a repressor and an activator of genes. Compared to what was previously reported in the literature, we find that a substantially higher fraction of bivalent marks in ES cells for H3K27me3 and H3K4me3 move into a K27-only state. We find that most of the promoter regions in protein-coding genes have differential histone-modification sites. The software for this work can be downloaded from http://lcbb.epfl.ch/software.html.

  3. Multiple 5' ends of human cytomegalovirus UL57 transcripts identify a complex, cycloheximide-resistant promoter region that activates oriLyt

    International Nuclear Information System (INIS)

    Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.

    2003-01-01

    The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation

  4. A statistical method (cross-validation) for bone loss region detection after spaceflight

    Science.gov (United States)

    Zhao, Qian; Li, Wenjun; Li, Caixia; Chu, Philip W.; Kornak, John; Lang, Thomas F.

    2010-01-01

    Astronauts experience bone loss after the long spaceflight missions. Identifying specific regions that undergo the greatest losses (e.g. the proximal femur) could reveal information about the processes of bone loss in disuse and disease. Methods for detecting such regions, however, remains an open problem. This paper focuses on statistical methods to detect such regions. We perform statistical parametric mapping to get t-maps of changes in images, and propose a new cross-validation method to select an optimum suprathreshold for forming clusters of pixels. Once these candidate clusters are formed, we use permutation testing of longitudinal labels to derive significant changes. PMID:20632144

  5. A comparison study of Agrobacterium-mediated transformation methods for root-specific promoter analysis in soybean.

    Science.gov (United States)

    Li, Caifeng; Zhang, Haiyan; Wang, Xiurong; Liao, Hong

    2014-11-01

    Both in vitro and in vivo hairy root transformation systems could not replace whole plant transformation for promoter analysis of root-specific and low-P induced genes in soybean. An efficient genetic transformation system is crucial for promoter analysis in plants. Agrobacterium-mediated transformation is the most popular method to produce transgenic hairy roots or plants. In the present study, first, we compared the two different Agrobacterium rhizogenes-mediated hairy root transformation methods using either constitutive CaMV35S or the promoters of root-preferential genes, GmEXPB2 and GmPAP21, in soybean, and found the efficiency of in vitro hairy root transformation was significantly higher than that of in vivo transformation. We compared Agrobacterium rhizogenes-mediated hairy root and Agrobacterium tumefaciens-mediated whole plant transformation systems. The results showed that low-phosphorous (P) inducible GmEXPB2 and GmPAP21 promoters could not induce the increased expression of the GUS reporter gene under low P stress in both in vivo and in vitro transgenic hairy roots. Conversely, GUS activity of GmPAP21 promoter was significantly higher at low P than high P in whole plant transformation. Therefore, both in vitro and in vivo hairy root transformation systems could not replace whole plant transformation for promoter analysis of root-specific and low-P induced genes in soybean.

  6. Contemporary methods and means of monitoring for Karabach region's forest ecosystems

    International Nuclear Information System (INIS)

    Aliyev, N.R.; Abdurahmanova, I.G.; Askerov, R.A.

    2010-01-01

    Full Text: In the article is analyzed the changing of a condition in the Karabach regions forests. The negative influence to region as well as in other regions of Azerbaijan of a mass cutting down of forests because of need for energy and wood industry, life conditions and also the results of military operations were lighted. The effective methods of reception of the operative information on an ecological condition of wood ecological systems on the basis of modern technical means are offered

  7. An overview of translation in language teaching methods: implications for EFL in secondary education in the region of Murcia

    Directory of Open Access Journals (Sweden)

    Teresa Marqués Aguado

    2013-07-01

    Full Text Available Various activities and resources have been used across time to promote and enhance the learning of foreign languages. Among these, translation has been cherished or dismissed depending on the preferred teaching method at each period. With the arrival of the Communicative approach, which focuses on communicative competence, its role has apparently become even more unstable.This article seeks to explore the role of translation in the main teaching methods used in Spain. This will in turn serve as the background against which the current educational scenario (with the communicative approach and the tenets of the Common European Framework of Reference for Languages will be measured with a view to ascertaining the role that translation may currently play. The particular situation of Secondary Education in the Region of Murcia will be discussed in the light of the curricula for this stage.

  8. Risk-based prioritization method for the classification of groundwater pesticide pollution from agricultural regions.

    Science.gov (United States)

    Yang, Yu; Lian, Xin-Ying; Jiang, Yong-Hai; Xi, Bei-Dou; He, Xiao-Song

    2017-11-01

    Agricultural regions are a significant source of groundwater pesticide pollution. To ensure that agricultural regions with a significantly high risk of groundwater pesticide contamination are properly managed, a risk-based ranking method related to groundwater pesticide contamination is needed. In the present paper, a risk-based prioritization method for the classification of groundwater pesticide pollution from agricultural regions was established. The method encompasses 3 phases, including indicator selection, characterization, and classification. In the risk ranking index system employed here, 17 indicators involving the physicochemical properties, environmental behavior characteristics, pesticide application methods, and inherent vulnerability of groundwater in the agricultural region were selected. The boundary of each indicator was determined using K-means cluster analysis based on a survey of a typical agricultural region and the physical and chemical properties of 300 typical pesticides. The total risk characterization was calculated by multiplying the risk value of each indicator, which could effectively avoid the subjectivity of index weight calculation and identify the main factors associated with the risk. The results indicated that the risk for groundwater pesticide contamination from agriculture in a region could be ranked into 4 classes from low to high risk. This method was applied to an agricultural region in Jiangsu Province, China, and it showed that this region had a relatively high risk for groundwater contamination from pesticides, and that the pesticide application method was the primary factor contributing to the relatively high risk. The risk ranking method was determined to be feasible, valid, and able to provide reference data related to the risk management of groundwater pesticide pollution from agricultural regions. Integr Environ Assess Manag 2017;13:1052-1059. © 2017 SETAC. © 2017 SETAC.

  9. Structural study in ''ITASY'' volcanic region (centre of Madagascar) by geophysical methods (magnetic and audiomagnetotelluric)

    International Nuclear Information System (INIS)

    Ratsimbazafy, J.B.

    1988-10-01

    The results obtained by magnetic and magnetotelluric methods of survey of ''ITASY'' volcanic region (centre of Madagascar) and their interpretation in correlation with geological data are presented. 27 refs, 18 figs

  10. The -2549 insertion/deletion polymorphism in the promoter region of VEGF is associated with the risk of recurrent spontaneous abortion.

    Science.gov (United States)

    Hashemi, Mohammad; Danesh, Hiva; Bizhani, Fatemeh; Mokhtari, Mojgan; Bahari, Gholamreza; Tabasi, Farhad; Taheri, Mohsen

    2018-03-01

    Recurrent spontaneous abortion (RSA) is a common health problem affecting women of reproductive age. Altered expression of vascular endothelial growth factor ( VEGF ) has been associated with spontaneous abortion. The present case-control study aimed to evaluate the impact of the 18-bp insertion/deletion (ins/del) polymorphism (rs35569394) in the promoter region of the VEGF gene on idiopathic RSA. Genomic DNA from 93 patients with RSA and 93 healthy fertile women of southeastern Iran was isolated using the salting-out method. Genotyping of the rs35569394 variant was performed by a polymerase chain reaction (PCR) method. The findings indicated that the VEGF 18-bp ins/del variant significantly increased the risk of RSA under codominant (ins/ins vs. del/del; OR=2.85, 95% CI=1.31-6.22, P=0.019), dominant (del/ins+ins/ins vs. del/del; OR=2.19, 95% CI=1.20-4.01, P=0.015) and allelic (ins vs. del; OR=1.90, 95% CI=1.25-2.88, P=0.003) inheritance models. In summary, the findings propose a significant association between the VEGF 18-bp ins/del polymorphism and risk of RSA in a sample of the southeast Iranian population. Further studies on larger sample sizes and different ethnicities are required to validate the present findings.

  11. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3’ untranslated region and intronic cis-elements

    Science.gov (United States)

    Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.

    2009-01-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of

  12. An analog computer method for solving flux distribution problems in multi region nuclear reactors

    Energy Technology Data Exchange (ETDEWEB)

    Radanovic, L; Bingulac, S; Lazarevic, B; Matausek, M [Boris Kidric Institute of Nuclear Sciences Vinca, Beograd (Yugoslavia)

    1963-04-15

    The paper describes a method developed for determining criticality conditions and plotting flux distribution curves in multi region nuclear reactors on a standard analog computer. The method, which is based on the one-dimensional two group treatment, avoids iterative procedures normally used for boundary value problems and is practically insensitive to errors in initial conditions. The amount of analog equipment required is reduced to a minimum and is independent of the number of core regions and reflectors. (author)

  13. The relationship in Japanese infants between a genetic polymorphism in the promoter region of the insulin-like growth factor I gene and the plasma level.

    Science.gov (United States)

    Kinoshita, Yumiko; Kizaki, Zenro; Ishihara, Yasunori; Nakajima, Hisakazu; Adachi, Shinsuke; Kosaka, Kitaro; Kinugasa, Akihiko; Sugimoto, Tohru

    2007-01-01

    Evidence is accumulating that the promoter region of the insulin-like growth factor I (IGF-I) gene polymorphism and low levels of IGF-I are associated with type 2 diabetes, cardiovascular disease and birth weight; however, the number of wild-type alleles is different in each country. This study aimed to examine the 737/738 marker, a cytosine-adenine repeat in the promoter region of the IGF-I gene polymorphism, and plasma IGF-I levels in Japanese infants and analyze the genetic background. Data were collected for 15 months in Kyoto Prefectural University of Medicine. The body composition parameters of all infants were determined at birth. At 5 days after birth, we took blood samples to measure the product size of the promoter region of the IGF-I gene polymorphism and plasma IGF-I. In a population-based sample of 160 subjects, 6 different alleles and 16 genotypes were identified in the promoter region of the IGF-I gene polymorphism. The existence of a 196-bp allele has proved to result in a low plasma IGF-I level, a small head and chest circumference (p body composition parameters in Japanese infants. Our results suggest genetical influence on prenatal growth and serum IGF-I levels.

  14. ARCAL. Regional co-operative arrangements for the promotion of nuclear science and technology in Latin America, Phase I (1985-1990)

    International Nuclear Information System (INIS)

    Gillen, V.A.

    1990-09-01

    The Regional Co-operative Arrangement for the Promotion of Nuclear Science and Technology in Latin America, ARCAL, has completed its first five-year phase (1985-1989). This booklet summarizes the first phase of the ARCAL programme and contains descriptions of projects in the fields of agriculture, medicine, industry and energy

  15. Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Is Not Associated With Paroxetine-Induced Ejaculation Delay in Dutch Men With Lifelong Premature Ejaculation

    NARCIS (Netherlands)

    Janssen, Paddy K. C.; Zwinderman, Aeilko H.; Olivier, Berend; Waldinger, Marcel D.

    2014-01-01

    To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). This was a prospective study of 10 weeks of paroxetine treatment in 54 men with LPE.

  16. Association of human liver bilirubin UDP-glucuronyltransferase activity with a polymorphism in the promoter region of the UGT1A1 gene

    NARCIS (Netherlands)

    Raijmakers, MTM; Jansen, PLM; Steegers, EAP; Peters, WHM

    Background/Aims: Gilbert's syndrome is a benign form of a deficiency in bilirubin glucuronidation. It is associated with a homozygous polymorphism, A(TA)(7)TAA instead of A(TA)(6)TAA, in the TATA-box of the promoter region of the bilirubin UDP-glucuronyltransferase gene. In this study the

  17. An engineering inviscid-boundary layer method for calculation of aerodynamic heating in the leeward region

    International Nuclear Information System (INIS)

    Dirin, M.M.; Karimian, S.M.H.; Maerefat, M.

    2003-01-01

    An engineering method has been modified for the prediction of aerodynamic heating of the hypersonic bodies in the leeward region. This is achieved using our proposed new method for determining streamlines in the leeward region. The modified form of Maslen's second order relation, which calculates pressure in the shock layer explicitly, is employed. The inviscid outer flow within the shock layer is first solved. The calculated solution, then, is used to determine the flow properties at the boundary layer edge and the orientation of the surface streamlines. Boundary layer equations, written in the streamline coordinates, are integrated along the surface to obtain the rate of heat transferred to the body surface. The present method is an inverse method in which the body shape is obtained according to the shape of the shock. In general, inviscid-boundary layer engineering methods calculate accurately the orientation of streamlines in the windward side only, and therefore they are not usually applicable in the leeward region. In the present study, a new method is proposed to determine the orientation of the surface streamlines in the leeward region. Using the present method, three-dimensional hypersonic flow is solved fast and easy all around a cone. The obtained results show that the corrections presented in this study extend excellently the application of the method to the leeward region. (author)

  18. A method to quantitate regional wall motion in left ventriculography using Hildreth algorithm

    Energy Technology Data Exchange (ETDEWEB)

    Terashima, Mikio [Hyogo Red Cross Blood Center (Japan); Naito, Hiroaki; Sato, Yoshinobu; Tamura, Shinichi; Kurosawa, Tsutomu

    1998-06-01

    Quantitative measurement of ventricular wall motion is indispensable for objective evaluation of cardiac function associated with coronary artery disease. We have modified the Hildreth`s algorithm to estimate excursions of the ventricular wall on left ventricular images yielded by various imaging techniques. Tagging cine-MRI was carried out on 7 healthy volunteers. The original Hildreth method, the modified Hildreth method and the centerline method were applied to the outlines of the images obtained, to estimate excursion of the left ventricular wall and regional shortening and to evaluate the accuracy of these methods when measuring these parameters, compared to the values of these parameters measured actually using the attached tags. The accuracy of the original Hildreth method was comparable to that of the centerline method, while the modified Hildreth method was significantly more accurate than the centerline method (P<0.05). Regional shortening as estimated using the modified Hildreth method differed less from the actually measured regional shortening than did the shortening estimated using the centerline method (P<0.05). The modified Hildreth method allowed reasonable estimation of left ventricular wall excursion in all cases where it was applied. These results indicate that when applied to left ventriculograms for ventricular wall motion analysis, the modified Hildreth method is more useful than the original Hildreth method. (author)

  19. Social networks and regional recruitment of foreign labour: Firm recruitment methods and spatial sorting in Denmark

    DEFF Research Database (Denmark)

    Schmidt, Torben Dall; Jensen, Peter Sandholt

    2012-01-01

    This paper tests the hypothesis that social networks are crucial for regional recruitment and inflows of foreign labour. New survey data on 971 firms located in Region Southern Denmark show that the predominant recruitment method of foreign labour was through networks. Danish municipal data from...... 1997–2006 furthermore reveal spatial sorting since initial shares of employees with a foreign background out of total regional employment predict foreign labour inflow rates to regional employment. Thus, social networks appear crucial for the recruitment and inflows of foreign labour, suggesting...

  20. A common polymorphism in the promoter region of the TNFSF4 gene is associated with lower allele-specific expression and risk of myocardial infarction.

    Directory of Open Access Journals (Sweden)

    Massimiliano Ria

    Full Text Available BACKGROUND: The TNFSF4/TNFRSF4 system, along with several other receptor-ligand pairs, is involved in the recruitment and activation of T-cells and is therefore tentatively implicated in atherosclerosis and acute coronary syndromes. We have previously shown that genetic variants in TNFSF4 are associated with myocardial infarction (MI in women. This prompted functional studies of TNFSF4 expression. METHODS AND RESULTS: Based on a screening of the TNFSF4 genomic region, a promoter polymorphism (rs45454293 and a haplotype were identified, conceivably involved in gene regulation. The rs45454293T-allele, in agreement with the linked rs3850641G-allele, proved to be associated with increased risk of MI in women. Haplotype-specific chromatin immunoprecipitation of activated polymerase II, as a measure of transcriptional activity in vivo, suggested that the haplotype including the rs45454293 and rs3850641 polymorphisms is functionally important, the rs45454293T- and rs3850641G-alleles being associated with lower transcriptional activity in cells heterozygous for both polymorphisms. The functional role of rs45454293 on transcriptional levels of TNFSF4 was clarified by luciferase reporter assays, where the rs45454293T-allele decreased gene expression when compared with the rs45454293C-allele, while the rs3850641 SNP did not have any effect on TNFSF4 promoter activity. Electromobility shift assay showed that the rs45454293 polymorphism, but not rs3850641, affects the binding of nuclear factors, thus suggesting that the lower transcriptional activity is attributed to binding of one or more transcriptional repressor(s to the T-allele. CONCLUSIONS: Our data indicate that the TNFSF4 rs45454293T-allele is associated with lower TNFSF4 expression and increased risk of MI.

  1. On evaluating the robustness of spatial-proximity-based regionalization methods

    Science.gov (United States)

    Lebecherel, Laure; Andréassian, Vazken; Perrin, Charles

    2016-08-01

    In absence of streamflow data to calibrate a hydrological model, its parameters are to be inferred by a regionalization method. In this technical note, we discuss a specific class of regionalization methods, those based on spatial proximity, which transfers hydrological information (typically calibrated parameter sets) from neighbor gauged stations to the target ungauged station. The efficiency of any spatial-proximity-based regionalization method will depend on the density of the available streamgauging network, and the purpose of this note is to discuss how to assess the robustness of the regionalization method (i.e., its resilience to an increasingly sparse hydrometric network). We compare two options: (i) the random hydrometrical reduction (HRand) method, which consists in sub-sampling the existing gauging network around the target ungauged station, and (ii) the hydrometrical desert method (HDes), which consists in ignoring the closest gauged stations. Our tests suggest that the HDes method should be preferred, because it provides a more realistic view on regionalization performance.

  2. A method to the impact assessment of the returning grazing land to grassland project on regional eco-environmental vulnerability

    International Nuclear Information System (INIS)

    Shao, Huaiyong; Sun, Xiaofei; Wang, Haoxue; Zhang, Xiaoxue; Xiang, Zhiying; Tan, Rui; Chen, Xuanyi; Xian, Wei; Qi, Jiaguo

    2016-01-01

    The Chinese government has conducted the Returning Grazing Land to Grassland Project (RGLGP) across large portions of grasslands from western China since 2003. In order to explore and understand the impact in the grassland's eco-environment during the RGLGP, we utilized Projection Pursuit Model (PPM) and Geographic Information System (GIS) to develop a spatial assessment model to examine the ecological vulnerability of the grassland. Our results include five indications: (1) it is practical to apply the spatial PPM on ecological vulnerability assessment for the grassland. This methodology avoids creating an artificial hypothesis, thereby providing objective results that successfully execute a multi-index assessment process and analysis under non-linear systems in eco-environments; (2) the spatial PPM is not only capable of evaluating regional eco-environmental vulnerability in a quantitative way, but also can quantitatively demonstrate the degree of effect in each evaluation index for regional eco-environmental vulnerability; (3) the eco-environment of the Xianshui River Basin falls into the medium range level. The normalized difference vegetation index (NDVI) and land use cover and change (LUCC) crucially influence the Xianshui River Basin's eco-environmental vulnerability. Generally, in the Xianshui River Basin, regional eco-environmental conditions improved during 2000 and 2010. The RGLGP positively affected NDVI and LUCC structure, thereby promoting the enhancement of the regional eco-environment; (4) the Xianshui River Basin divides its ecological vulnerability across different levels; therefore our study investigates three ecological regions and proposes specific suggestions for each in order to assist in eco-environmental protection and rehabilitation; and lastly that (5) the spatial PPM established by this study has the potential to be applied on all types of grassland eco-environmental vulnerability assessments under the RGLGP and under the similar

  3. A method to the impact assessment of the returning grazing land to grassland project on regional eco-environmental vulnerability

    Energy Technology Data Exchange (ETDEWEB)

    Shao, Huaiyong, E-mail: huaiyongshao@163.com [Key Laboratory of Geoscience Spatial Information Technology, Ministry of Land and Resources of China, Chengdu University of Technology, Chengdu 610059, Sichuan (China); Center for Global Change and Earth Observations, Michigan State University, East Lansing 48823, MI (United States); Sun, Xiaofei; Wang, Haoxue; Zhang, Xiaoxue [Key Laboratory of Geoscience Spatial Information Technology, Ministry of Land and Resources of China, Chengdu University of Technology, Chengdu 610059, Sichuan (China); Xiang, Zhiying [School of Earth Sciences, Zhejiang University, Hangzhou 310027, Zhejiang (China); Tan, Rui; Chen, Xuanyi [Key Laboratory of Geoscience Spatial Information Technology, Ministry of Land and Resources of China, Chengdu University of Technology, Chengdu 610059, Sichuan (China); Xian, Wei [College of Resources and Environment, Chengdu University of Information Technology, Chengdu 610225, Sichuan (China); Qi, Jiaguo [Center for Global Change and Earth Observations, Michigan State University, East Lansing 48823, MI (United States)

    2016-01-15

    The Chinese government has conducted the Returning Grazing Land to Grassland Project (RGLGP) across large portions of grasslands from western China since 2003. In order to explore and understand the impact in the grassland's eco-environment during the RGLGP, we utilized Projection Pursuit Model (PPM) and Geographic Information System (GIS) to develop a spatial assessment model to examine the ecological vulnerability of the grassland. Our results include five indications: (1) it is practical to apply the spatial PPM on ecological vulnerability assessment for the grassland. This methodology avoids creating an artificial hypothesis, thereby providing objective results that successfully execute a multi-index assessment process and analysis under non-linear systems in eco-environments; (2) the spatial PPM is not only capable of evaluating regional eco-environmental vulnerability in a quantitative way, but also can quantitatively demonstrate the degree of effect in each evaluation index for regional eco-environmental vulnerability; (3) the eco-environment of the Xianshui River Basin falls into the medium range level. The normalized difference vegetation index (NDVI) and land use cover and change (LUCC) crucially influence the Xianshui River Basin's eco-environmental vulnerability. Generally, in the Xianshui River Basin, regional eco-environmental conditions improved during 2000 and 2010. The RGLGP positively affected NDVI and LUCC structure, thereby promoting the enhancement of the regional eco-environment; (4) the Xianshui River Basin divides its ecological vulnerability across different levels; therefore our study investigates three ecological regions and proposes specific suggestions for each in order to assist in eco-environmental protection and rehabilitation; and lastly that (5) the spatial PPM established by this study has the potential to be applied on all types of grassland eco-environmental vulnerability assessments under the RGLGP and under the

  4. Digital Sequences and a Time Reversal-Based Impact Region Imaging and Localization Method

    Science.gov (United States)

    Qiu, Lei; Yuan, Shenfang; Mei, Hanfei; Qian, Weifeng

    2013-01-01

    To reduce time and cost of damage inspection, on-line impact monitoring of aircraft composite structures is needed. A digital monitor based on an array of piezoelectric transducers (PZTs) is developed to record the impact region of impacts on-line. It is small in size, lightweight and has low power consumption, but there are two problems with the impact alarm region localization method of the digital monitor at the current stage. The first one is that the accuracy rate of the impact alarm region localization is low, especially on complex composite structures. The second problem is that the area of impact alarm region is large when a large scale structure is monitored and the number of PZTs is limited which increases the time and cost of damage inspections. To solve the two problems, an impact alarm region imaging and localization method based on digital sequences and time reversal is proposed. In this method, the frequency band of impact response signals is estimated based on the digital sequences first. Then, characteristic signals of impact response signals are constructed by sinusoidal modulation signals. Finally, the phase synthesis time reversal impact imaging method is adopted to obtain the impact region image. Depending on the image, an error ellipse is generated to give out the final impact alarm region. A validation experiment is implemented on a complex composite wing box of a real aircraft. The validation results show that the accuracy rate of impact alarm region localization is approximately 100%. The area of impact alarm region can be reduced and the number of PZTs needed to cover the same impact monitoring region is reduced by more than a half. PMID:24084123

  5. A Sequential Kriging reliability analysis method with characteristics of adaptive sampling regions and parallelizability

    International Nuclear Information System (INIS)

    Wen, Zhixun; Pei, Haiqing; Liu, Hai; Yue, Zhufeng

    2016-01-01

    The sequential Kriging reliability analysis (SKRA) method has been developed in recent years for nonlinear implicit response functions which are expensive to evaluate. This type of method includes EGRA: the efficient reliability analysis method, and AK-MCS: the active learning reliability method combining Kriging model and Monte Carlo simulation. The purpose of this paper is to improve SKRA by adaptive sampling regions and parallelizability. The adaptive sampling regions strategy is proposed to avoid selecting samples in regions where the probability density is so low that the accuracy of these regions has negligible effects on the results. The size of the sampling regions is adapted according to the failure probability calculated by last iteration. Two parallel strategies are introduced and compared, aimed at selecting multiple sample points at a time. The improvement is verified through several troublesome examples. - Highlights: • The ISKRA method improves the efficiency of SKRA. • Adaptive sampling regions strategy reduces the number of needed samples. • The two parallel strategies reduce the number of needed iterations. • The accuracy of the optimal value impacts the number of samples significantly.

  6. Teaching Methods in Biology Education and Sustainability Education Including Outdoor Education for Promoting Sustainability--A Literature Review

    Science.gov (United States)

    Jeronen, Eila; Palmberg, Irmeli; Yli-Panula, Eija

    2017-01-01

    There are very few studies concerning the importance of teaching methods in biology education and environmental education including outdoor education for promoting sustainability at the levels of primary and secondary schools and pre-service teacher education. The material was selected using special keywords from biology and sustainable education…

  7. Sustainability assessment of one industrial region: A combined method of emergy analysis and IPAT (Human Impact Population Affluence Technology)

    International Nuclear Information System (INIS)

    Yu, Xiaoman; Geng, Yong; Dong, Huijuan; Ulgiati, Sergio; Liu, Zhe; Liu, Zuoxi; Ma, Zhixiao; Tian, Xu; Sun, Lu

    2016-01-01

    Resource over-exploitation and resource depletion have received increasing attentions, especially for industrial regions. In this paper an innovative method that combines emergy analysis and an IPAT (Human Impact Population Affluence Technology) equation is developed in order to create an integrated framework for uncovering the driving forces on resource consumption in one industrial region. Liaoning province, one of the old heavy industrial bases in China, is selected as the case study region. The main results show that total emergy of Liaoning province increased from 9.25E + 23 sej in 2002 to 1.92E + 24 sej in 2012, with 165% growth on non-renewable emergy and 250% growth on imported emergy. Regional emergy/RMB ratio was higher than other developed regions and the average value of China, indicating that this province consumed more local free non-renewable resources to support its own development. The lower ESI (emergy sustainability index) indicates that Liaoning province's sustainability is still weak and far away from sustainable development. IPAT analysis further identifies that rapid economic growth was the main driving force to increase its total emergy use, while technology innovation offset the increase of total emergy use. Policy insights suggest that industrial regions should improve their energy efficiency and optimize their economic and energy structure by applying economic instruments and capacity building efforts. - Highlights: • Emergy analysis and IPAT are combined to evaluate the sustainability of Liaoning. • Total emergy of Liaoning increased from 2002 to 2011 and then decreased in 2012. • Economic scale is the key driving force to induce higher emergy consumption. • Valuable policy insights are proposed in order to promote sustainable development.

  8. Development of a forecasting method of a region`s electric power demand. 1. Forecasting economic and social indexes; Chiikibetsu denryoku juyo yosoku shuhono kaihatsu ni tsuite. 1. Keizai shakai shihyo no yosoku

    Energy Technology Data Exchange (ETDEWEB)

    Minato, Y. [Shikoku Research Institute Inc., Kagawa (Japan); Yokoi, Y. [The University of Tokushima, Tokushima (Japan)

    1996-01-20

    This paper relates to the forecasting method of the electric power demands (kWh and kW) of a region, approached by not only time series analysis but economic and social indexes. Those indexes, based on historical statistics such as census and establishment statistics, are rearranged from an administrative division to a managerial division of the electric power company, and applied as fundamental information for forecasting the area`s kWh and also sales promotion. This method of forecasting the area`s kWh is based on the concept that area`s kWh is strongly connected with the population their lifestyle and their activity within the region. In the paper, the framework of the computational model system and forecast result are discussed. The population, number of households and their members, and number of employed persons, are all evaluated. The forecasting method of the area`s population proposed here is based on the concept that the transition of population consists of both natural growth and immigration. By estimating both factors, the future area`s population can be easily forecasted. The information of whether the population is increasing or decreasing is useful for forecasting the region`s kWh and required sales promotion. 8 refs., 8 figs., 3 tabs.

  9. Proposing water balance method for water availability estimation in Indonesian regional spatial planning

    Science.gov (United States)

    Juniati, A. T.; Sutjiningsih, D.; Soeryantono, H.; Kusratmoko, E.

    2018-01-01

    The water availability (WA) of a region is one of important consideration in both the formulation of spatial plans and the evaluation of the effectiveness of actual land use in providing sustainable water resources. Information on land-water needs vis-a-vis their availability in a region determines the state of the surplus or deficit to inform effective land use utilization. How to calculate water availability have been described in the Guideline in Determining the Carrying Capacity of the Environment in Regional Spatial Planning. However, the method of determining the supply and demand of water on these guidelines is debatable since the determination of WA in this guideline used a rational method. The rational method is developed the basis for storm drain design practice and it is essentially a peak discharge method peak discharge calculation method. This paper review the literature in methods of water availability estimation which is described descriptively, and present arguments to claim that water balance method is a more fundamental and appropriate tool in water availability estimation. A better water availability estimation method would serve to improve the practice in preparing formulations of Regional Spatial Plan (RSP) as well as evaluating land use capacity in providing sustainable water resources.

  10. Radiation transport benchmarks for simple geometries with void regions using the spherical harmonics method

    International Nuclear Information System (INIS)

    Kobayashi, K.

    2009-01-01

    In 2001, an international cooperation on the 3D radiation transport benchmarks for simple geometries with void region was performed under the leadership of E. Sartori of OECD/NEA. There were contributions from eight institutions, where 6 contributions were by the discrete ordinate method and only two were by the spherical harmonics method. The 3D spherical harmonics program FFT3 by the finite Fourier transformation method has been improved for this presentation, and benchmark solutions for the 2D and 3D simple geometries with void region by the FFT2 and FFT3 are given showing fairly good accuracy. (authors)

  11. Double tracer autoradiographic method for sequential evaluation of regional cerebral perfusion

    International Nuclear Information System (INIS)

    Matsuda, H.; Tsuji, S.; Oba, H.; Kinuya, K.; Terada, H.; Sumiya, H.; Shiba, K.; Mori, H.; Hisada, K.; Maeda, T.

    1989-01-01

    A new double tracer autoradiographic method for the sequential evaluation of altered regional cerebral perfusion in the same animal is presented. This method is based on the sequential injection of two tracers, 99m Tc-hexamethylpropyleneamine oxime and N-isopropyl-( 125 I)p-iodoamphetamine. This method is validated in the assessment of brovincamine effects on regional cerebral perfusion in an experimental model of chronic brain ischemia in the rat. The drug enhanced perfusion recovery in low-flow areas, selectively in surrounding areas of infarction. The results suggest that this technique is of potential use in the study of neuropharmacological effects applied during the experiment

  12. An improved principal component analysis based region matching method for fringe direction estimation

    Science.gov (United States)

    He, A.; Quan, C.

    2018-04-01

    The principal component analysis (PCA) and region matching combined method is effective for fringe direction estimation. However, its mask construction algorithm for region matching fails in some circumstances, and the algorithm for conversion of orientation to direction in mask areas is computationally-heavy and non-optimized. We propose an improved PCA based region matching method for the fringe direction estimation, which includes an improved and robust mask construction scheme, and a fast and optimized orientation-direction conversion algorithm for the mask areas. Along with the estimated fringe direction map, filtered fringe pattern by automatic selective reconstruction modification and enhanced fast empirical mode decomposition (ASRm-EFEMD) is used for Hilbert spiral transform (HST) to demodulate the phase. Subsequently, windowed Fourier ridge (WFR) method is used for the refinement of the phase. The robustness and effectiveness of proposed method are demonstrated by both simulated and experimental fringe patterns.

  13. [Health education, patient education and health promotion: educational methods and strategies].

    Science.gov (United States)

    Sandrin, Brigitte

    2013-01-01

    The purpose of this paper is to help public health actors with an interest in health promotion and health care professionals involved in therapeutic education to develop and implement an educational strategy consistent with their vision of health and health care. First, we show that the Ottawa Charter for Health Promotion and the French Charter for Popular Education share common values. Second, an examination of the career and work of Paulo Freire, of Ira Shor's pedagogical model and of the person-centered approach of Carl Rogers shows how the work of educational practitioners, researchers and theorists can help health professionals to implement a truly "health-promoting" or "therapeutic" educational strategy. The paper identifies a number of problems facing health care professionals who become involved in education without reflecting on the values underlying the pedagogical models they use.

  14. Automatic segmentation of MRI head images by 3-D region growing method which utilizes edge information

    International Nuclear Information System (INIS)

    Jiang, Hao; Suzuki, Hidetomo; Toriwaki, Jun-ichiro

    1991-01-01

    This paper presents a 3-D segmentation method that automatically extracts soft tissue from multi-sliced MRI head images. MRI produces a sequence of two-dimensional (2-D) images which contains three-dimensional (3-D) information of organs. To utilize such information we need effective algorithms to treat 3-D digital images and to extract organs and tissues of interest. We developed a method to extract the brain from MRI images which uses a region growing procedure and integrates information of uniformity of gray levels and information of the presence of edge segments in the local area around the pixel of interest. First we generate a kernel region which is a part of brain tissue by simple thresholding. Then we grow the region by means of a region growing algorithm under the control of 3-D edge existence to obtain the region of the brain. Our method is rather simple because it uses basic 3-D image processing techniques like spatial difference. It is robust for variation of gray levels inside a tissue since it also refers to the edge information in the process of region growing. Therefore, the method is flexible enough to be applicable to the segmentation of other images including soft tissues which have complicated shapes and fluctuation in gray levels. (author)

  15. Health Promotion Behaviours and Level of Activities of Daily Living and Instrumental Activities of Daily Living Among Elderly People in West Region of Tehran: A Cross-Sectional Survey

    Directory of Open Access Journals (Sweden)

    Aghil Habibi Sola

    2007-10-01

    Full Text Available Objectives: As individuals live longer, health promotion behaviors get even more important, particularly with regard to maintaining functional independence and improving quality of life. The purpose of this study was to explore the relationship between health promotion behaviors and level of Activities of Daily Living (ADL and Instrumental Activities of Daily Living (IADL among elderly people in west region of Tehran. Methods & Materials: This was a descriptive-correlational study. A multi-stage sample of 410 community residents who were over 60 years old were selected from west region of Tehran. Participants who consented to participate in the study were interviewed with a structured questionnaire. The questionnaire consisted of 2-part; Health Promotion Behavior Checklist and questions related to status of physical functioning, which includes activities of daily living (ADLs and instrumental activities of daily living (IADLs. Descriptive statistics and T-test were used to data analysis. Results: The results of the study showed that there were significant relations between ADLs and ' exercise or walking', 'drinking milk, eating dairy and meat', 'eating vegetables and fruits', 'low salt diet' and 'low fat diet' (P<0.05. Furthermore there were significant relations between the IADLs and 'smoking cessation', 'alcohol abstinence', 'exercise or walking', 'drinking milk, eating dairy and meat', 'eating vegetables and fruits', 'low salt diet' and 'low fat diet' (P<0.05. Conclusion: Study showed, health promotion behaviors and level of ADL and IADL are related meaningfully. Health care professionals should enhance the physical functioning in elderly people by facilitating health promotion behaviors through formal health promotion programs which focus on regular diet, exercise, and regular physical check-ups which will maintain and increase a healthy and active life.

  16. Comparison of eight degree-days estimation methods in four agroecological regions in Colombia

    Directory of Open Access Journals (Sweden)

    Daniel Rodríguez Caicedo

    2012-01-01

    Full Text Available Eight methods were used to estimate degree-days in four Colombian localities. Four methods have been previously proposed in literature: Simple Sine, Double Sine, Simple Triangle, and Double Triangle methods. The other four methods are proposed in this research: Simple Logistic, Double Logistic, Simple Normal, and Double Normal. The estimation of the degree-days through hourly temperature values was used as the reference standard method, and the four localities from where the temperature values were taken were the municipalities of Cajicá (Cundinamarca, Santa Elena (Antioquia, Carepa (Urabá Antioqueño, and Ciudad Bolivar (Zona cafetera Antioqueña. Degree-days obtained by all methods under study were compared through linear regression to those obtained by the reference standard method. There were differences in the correlation of each method to the reference when compared within each region and among regions. The Simple Logistic and Double Logistic methods showed the best performance with acceptable R² values and considerably lower bias than the other methods. The poorest fit was found in Cajicá, where the average R² was 0.571. For the regions of Santa Elena and Carepa, the average R² was 0.756 and 0.733. The best fit was found in Ciudad Bolivar, with an average R² of 0.826.

  17. Development of an Agrobacterium-Mediated Transformation Method and Evaluation of Two Exogenous Constitutive Promoters in Oleaginous Yeast Lipomyces starkeyi.

    Science.gov (United States)

    Lin, Xinping; Liu, Sasa; Bao, Ruiqi; Gao, Ning; Zhang, Sufang; Zhu, Rongqian; Zhao, Zongbao Kent

    2017-11-01

    Oleaginous yeast Lipomyces starkeyi, a promising strain of great biotechnical importance, is able to accumulate over 60% of its cell biomass as triacylglycerols (TAGs). It is promising to directly produce the derivatives of TAGs, such as long-chain fatty acid methyl esters and alkanes, in L. starkeyi. However, techniques for genetic modification of this oleaginous yeast are lacking, thus, further research is needed to develop genetic tools and functional elements. Here, we used two exogenous promoters (pGPD and pPGK) from oleaginous yeast Rhodosporidium toruloides to establish a simpler Agrobacterium-mediated transformation (AMT) method for L. starkeyi. Hygromycin-resistant transformants were obtained on antibiotic-contained plate. Mitotic stability test, genotype verification by PCR, and protein expression confirmation all demonstrated the success of this method. Furthermore, the strength of these two promoters was evaluated at the phenotypic level on a hygromycin-gradient plate and at the transcriptional level by real-time quantitative PCR. The PGK promoter strength was 2.2-fold as that of GPD promoter to initiate the expression of the hygromycin-resistance gene. This study provided an easy and efficient genetic manipulation method and elements of the oleaginous yeast L. starkeyi for constructing superior strains to produce advanced biofuels.

  18. Health Promotion Methods for Smoking Prevention and Cessation: A Comprehensive Review of Effectiveness and the Way Forward.

    Science.gov (United States)

    Golechha, Mahaveer

    2016-01-01

    Tobacco smoking is one of the greatest causes of mortality in the world, responsible for over 5 million deaths per annum. The prevalence of smoking is over 1 billion people, with the majority coming from low or middle income countries. Yet, the incidence of smoking varies vastly between many countries. Some countries have been able to decline the smoking and tobacco related morbidity and mortality through the introduction of health promotion initiatives and effective policies in order to combat tobacco usage. However, on the other hand, in some countries, the incidence of smoking is increasing still further. With the growing body of evidence of detriment of tobacco to health, many control policies have been implemented as health promotion actions. Such methods include taxation of smoking, mass advertising campaigns in the media, peer education programs, community mobilization, motivational interviewing, health warnings on tobacco products, marketing restrictions, and banning smoking in public places. However, the review of the effectiveness of various health promotion methods used for smoking prevention and cessation is lacking. Therefore, the aim of this review is to identify and critically review the effectiveness of health promotion methods used for smoking prevention and cessation. All available studies and reports published were considered. Searches were conducted using PubMed, MEDLINE, Ovid, Karger, ProQuest, Sage Journals, Science Direct, Springer, Taylor and Francis, EMBASE, CINAHL, and Cochrane and Wiley Online Library. Various relevant search terms and keywords were used. After considering the inclusion and exclusion criteria, we selected 23 articles for the present review.

  19. TSA-induced DNMT1 down-regulation represses hTERT expression via recruiting CTCF into demethylated core promoter region of hTERT in HCT116.

    Science.gov (United States)

    Choi, Jee-Hye; Min, Na Young; Park, Jina; Kim, Jin Hong; Park, Soo Hyun; Ko, Young Jong; Kang, Yoonsung; Moon, Young Joon; Rhee, Sangmyung; Ham, Seung Wook; Park, Ae Ja; Lee, Kwang-Ho

    2010-01-01

    Trichostatin A (TSA), an inhibitor of histone deacetylase, is a well-known antitumor agent that effectively and selectively induces tumor growth arrest and apoptosis. Recently, it was reported that hTERT is one of the primary targets for TSA-induced apoptosis in cancer cells but the mechanism of which has not yet been elucidated. In the present study, to better understand the epigenetic regulation mechanism responsible for the repression of hTERT by TSA, we examined expression of hTERT in the HCT116 colon cancer cell line after treatment with TSA and performed site-specific CpG methylation analysis of the hTERT promoter. We found that TSA-induced the demethylation of site-specific CpGs on the promoter of hTERT, which was caused by down-regulation of DNA methyltransferase 1 (DNMT1). Among the demethylated region, the 31st-33rd CpGs contained a binding site for CTCF, an inhibitor of hTERT transcription. ChIP analysis revealed that TSA-induced demethylation of the 31st-33rd CpGs promoted CTCF binding on hTERT promoter, leading to repression of hTERT. Taken together, down-regulation of DNMT1 by TSA caused demethylation of a CTCF binding site on the hTERT promoter, the result of which was repression of hTERT via recruitment of CTCF to the promoter. Copyright 2009 Elsevier Inc. All rights reserved.

  20. IkappaBalpha polymorphism at promoter region (rs2233408) influences the susceptibility of gastric cancer in Chinese.

    Science.gov (United States)

    Wang, Shiyan; Tian, Linwei; Zeng, Zhirong; Zhang, Mingdong; Wu, Kaichun; Chen, Minhu; Fan, Daiming; Hu, Pinjin; Sung, Joseph J Y; Yu, Jun

    2010-02-05

    Nuclear factor of kappa B inhibitor alpha (I kappaB alpha) protein is implicated in regulating a variety of cellular process from inflammation to tumorigenesis. The objective of this study was to investigate the susceptibility of rs2233408 T/C genotype in the promoter region of I kappaB alpha to gastric cancer and the association of this polymorphism with clinicopathologic variables in gastric cancer patients. A population-based case-control study was conducted between 1999 and 2006 in Guangdong Province, China. A total of 564 gastric cancer patients and 566 healthy controls were enrolled in this study. rs2233408 genotypes in I kappaB alpha were analyzed by TaqMan SNP genotyping assay. Both rs2233408 T homozygote (TT) and T heterozygotes (TC and TT) had significantly reduced gastric cancer risk (TT: OR = 0.250, 95% CI = 0.069-0.909, P = 0.035; TC and TT: OR = 0.721, 95% CI = 0.530-0.981, P = 0.037), compared with rs2233408 C homozygote (CC). rs2233408 T heterozygotes were significantly associated with reduced risk of intestinal-type gastric cancer with ORs of 0.648 (95% CI = 0.459-0.916, P = 0.014), but not with the diffuse or mix type of gastric cancer. The association between rs2233408 T heterozygotes and gastric cancer appeared more apparent in the older patients (age>40) (OR = 0.674, 95% CI = 0.484-0.939, P = 0.02). rs2233408 T heterozygotes was associated with non-cardiac gastric cancer (OR = 0.594, 95% CI = 0.411-0.859, P = 0.006), but not with cardiac gastric cancer. However, rs2233408 polymorphism was not associated with the prognosis of gastric cancer patients. I kappaB alpha rs2233408 T heterozygotes were associated with reduced risk of gastric cancer, especially for the development of certain subtypes of gastric cancer in Chinese population.

  1. Application of qualitative biospeckle methods for the identification of scar region in a green orange

    Science.gov (United States)

    Retheesh, R.; Ansari, Md. Zaheer; Radhakrishnan, P.; Mujeeb, A.

    2018-03-01

    This study demonstrates the feasibility of a view-based method, the motion history image (MHI) to map biospeckle activity around the scar region in a green orange fruit. The comparison of MHI with the routine intensity-based methods validated the effectiveness of the proposed method. The results show that MHI can be implementated as an alternative online image processing tool in the biospeckle analysis.

  2. Assessment of geothermal energy potential by geophysical methods: Nevşehir Region, Central Anatolia

    Science.gov (United States)

    Kıyak, Alper; Karavul, Can; Gülen, Levent; Pekşen, Ertan; Kılıç, A. Rıza

    2015-03-01

    In this study, geothermal potential of the Nevşehir region (Central Anatolia) was assessed by using vertical electrical sounding (VES), self-potential (SP), magnetotelluric (MT), gravity and gravity 3D Euler deconvolution structure analysis methods. Extensive volcanic activity occurred in this region from Upper Miocene to Holocene time. Due to the young volcanic activity Nevşehir region can be viewed as a potential geothermal area. We collected data from 54 VES points along 5 profiles, from 28 MT measurement points along 2 profiles (at frequency range between 320 and 0.0001 Hz), and from 4 SP profiles (total 19 km long). The obtained results based on different geophysical methods are consistent with each other. Joint interpretation of all geological and geophysical data suggests that this region has geothermal potential and an exploration well validated this assessment beyond doubt.

  3. Tenure and Promotion Experiences of Music Teacher Educators: A Mixed-Methods Study

    Science.gov (United States)

    Pellegrino, Kristen; Conway, Colleen M.; Millican, J. Si

    2018-01-01

    To examine music education faculty members' promotion and tenure experiences, we interviewed (N = 9) and surveyed (N = 124) music teacher educators (MTEs) who were pretenure or tenured within the past 3 years. Findings highlighted MTE's perceptions of evaluative criteria and standards, mentoring programs and experiences, professional identity, and…

  4. What's for Sale at Canadian Universities? A Mixed-Methods Analysis of Promotional Strategies

    Science.gov (United States)

    Pizarro Milian, Roger

    2017-01-01

    The current fiscal environment has driven Canadian universities to become more entrepreneurial, seeking out and competing over new sources of funding. Despite such intensifying competition, little effort has been made to document the promotional tactics that Canadian universities are using to render themselves appealing to external audiences. This…

  5. Is the method for succesful health promotion, public involvement and the everyday life?

    DEFF Research Database (Denmark)

    Schøler, Maja

    The everyday life as a platform for health practices as well as the citizens’ perceptions of health and healthy aging has traditionally not been the core part of health promotion strategies. The project focuses on a groups of citizens and how they interpret and interact with health information...

  6. Methods for deconvoluting and interpreting complex gamma- and x-ray spectral regions

    International Nuclear Information System (INIS)

    Gunnink, R.

    1983-06-01

    Germanium and silicon detectors are now widely used for the detection and measurement of x and gamma radiation. However, some analysis situations and spectral regions have heretofore been too complex to deconvolute and interpret by techniques in general use. One example is the L x-ray spectrum of an element taken with a Ge or Si detector. This paper describes some new tools and methods that were developed to analyze complex spectral regions; they are illustrated with examples

  7. A probabilistic method for streamflow projection and associated uncertainty analysis in a data sparse alpine region

    Science.gov (United States)

    Ren, Weiwei; Yang, Tao; Shi, Pengfei; Xu, Chong-yu; Zhang, Ke; Zhou, Xudong; Shao, Quanxi; Ciais, Philippe

    2018-06-01

    Climate change imposes profound influence on regional hydrological cycle and water security in many alpine regions worldwide. Investigating regional climate impacts using watershed scale hydrological models requires a large number of input data such as topography, meteorological and hydrological data. However, data scarcity in alpine regions seriously restricts evaluation of climate change impacts on water cycle using conventional approaches based on global or regional climate models, statistical downscaling methods and hydrological models. Therefore, this study is dedicated to development of a probabilistic model to replace the conventional approaches for streamflow projection. The probabilistic model was built upon an advanced Bayesian Neural Network (BNN) approach directly fed by the large-scale climate predictor variables and tested in a typical data sparse alpine region, the Kaidu River basin in Central Asia. Results show that BNN model performs better than the general methods across a number of statistical measures. The BNN method with flexible model structures by active indicator functions, which reduce the dependence on the initial specification for the input variables and the number of hidden units, can work well in a data limited region. Moreover, it can provide more reliable streamflow projections with a robust generalization ability. Forced by the latest bias-corrected GCM scenarios, streamflow projections for the 21st century under three RCP emission pathways were constructed and analyzed. Briefly, the proposed probabilistic projection approach could improve runoff predictive ability over conventional methods and provide better support to water resources planning and management under data limited conditions as well as enable a facilitated climate change impact analysis on runoff and water resources in alpine regions worldwide.

  8. Development and standardization of methods for promoting products on the example of bakery products

    Directory of Open Access Journals (Sweden)

    O. A. Orlovtseva

    2018-01-01

    Full Text Available The popularity of products depends not only on its quality, but also on the activities that have been undertaken to promote it in the market. The media plan developed for this purpose should be based on the use of scientific approaches, since the success of an advertising campaign directly depends on the correctness of the selected promotion channels and the level of the developed advertising and information materials. At the same time, it is necessary to optimize the media plan, which makes it possible to ensure the effectiveness of advertising by attracting consumers, advancing competitors and rational use of resources, including material ones. The article gives an example of a developed advertising campaign for the promotion of bakery products: advertising channels in magazines, a radio commercial in shopping centers, advertising stand and distribution of flyers were chosen as channels for promotion. The general concept of this advertising is the promotion of various types of fresh hot products, so the main character is Red Riding Hood. The article gives examples of layouts of printed materials, an approximate scenario of a radio commercial and a description of the layout of magazine advertising. To assess the adequacy of the developed advertising company, the media plan and expenses for creating and conducting an advertising campaign are calculated.. On its basis, a methodology is formulated and an algorithm for performing these marketing activities is constructed. An important step in the application of this technique is its standardization - the creation of an organization standard. The standardization document containing the rules, regulations and requirements will allow optimizing production processes and increasing the competitiveness of the enterprise's products, and also contributes to a common understanding of marketing concepts and advertising policy in the enterprise.

  9. A three-region conduction-controlled rewetting analysis by the Heat Balance Integral Method

    International Nuclear Information System (INIS)

    Sahu, S.K.; Das, P.K.; Bhattacharyya, S.

    2009-01-01

    Conduction-controlled rewetting of two-dimensional objects is analyzed by the Heat Balance Integral Method (HBIM) considering three distinct regions: a dry region ahead of wet front, the sputtering region immediately behind the wet front and a continuous film region further upstream. The HBIM yields solutions for wet front velocity, sputtering length and temperature field with respect to wet front. Employing this method, it is seen that heat transfer mechanism is dependent upon two temperature parameters. One of them characterizes the initial wall temperature while the other specifies the range of temperature for sputtering region. Additionally, the mechanism of heat transfer is found to be dependent on two Biot numbers comprising a convective heat transfer in the wet region and a boiling heat transfer in the sputtering region. The present solution exactly matches with the one-dimensional analysis of K.H. Sun, G.E. Dix, C.L. Tien [Cooling of a very hot vertical surface by falling liquid film, ASME J. Heat Transf. 96 (1974) 126-131] for low Biot numbers. Good agreement with experimental results is also observed. (authors)

  10. A Method for Automatic Extracting Intracranial Region in MR Brain Image

    Science.gov (United States)

    Kurokawa, Keiji; Miura, Shin; Nishida, Makoto; Kageyama, Yoichi; Namura, Ikuro

    It is well known that temporal lobe in MR brain image is in use for estimating the grade of Alzheimer-type dementia. It is difficult to use only region of temporal lobe for estimating the grade of Alzheimer-type dementia. From the standpoint for supporting the medical specialists, this paper proposes a data processing approach on the automatic extraction of the intracranial region from the MR brain image. The method is able to eliminate the cranium region with the laplacian histogram method and the brainstem with the feature points which are related to the observations given by a medical specialist. In order to examine the usefulness of the proposed approach, the percentage of the temporal lobe in the intracranial region was calculated. As a result, the percentage of temporal lobe in the intracranial region on the process of the grade was in agreement with the visual sense standards of temporal lobe atrophy given by the medical specialist. It became clear that intracranial region extracted by the proposed method was good for estimating the grade of Alzheimer-type dementia.

  11. Preclinical evaluation of gene delivery methods for the treatment of loco-regional disease in breast cancer.

    LENUS (Irish Health Repository)

    Rajendran, Simon

    2011-04-01

    Preclinical results with various gene therapy strategies indicate significant potential for new cancer treatments. However, many therapeutics fail at clinical trial, often due to differences in tissue physiology between animal models and humans, and tumor phenotype variation. Clinical data relevant to treatment strategies may be generated prior to clinical trial through experimentation using intact patient tissue ex vivo. We developed a novel tumor slice model culture system that is universally applicable to gene delivery methods, using a realtime luminescence detection method to assess gene delivery. Methods investigated include viruses (adenovirus [Ad] and adeno-associated virus), lipofection, ultrasound (US), electroporation and naked DNA. Viability and tumor populations within the slices were well maintained for seven days, and gene delivery was qualitatively and quantitatively examinable for all vectors. Ad was the most efficient gene delivery vector with transduction efficiency >50%. US proved the optimal non-viral gene delivery method in human tumor slices. The nature of the ex vivo culture system permitted examination of specific elements. Parameters shown to diminish Ad gene delivery included blood, regions of low viability and secondary disease. US gene delivery was significantly reduced by blood and skin, while tissue hyperthermia improved gene delivery. US achieved improved efficacy for secondary disease. The ex vivo model was also suitable for examination of tissue-specific effects on vector expression, with Ad expression mediated by the CXCR4 promoter shown to provide a tumor selective advantage over the ubiquitously active cytomegalovirus promoter. In conclusion, this is the first study incorporating patient tissue models in comparing gene delivery from various vectors, providing knowledge on cell-type specificity and examining the crucial biological factors determining successful gene delivery. The results highlight the importance of in

  12. Preclinical evaluation of gene delivery methods for the treatment of loco-regional disease in breast cancer.

    LENUS (Irish Health Repository)

    Rajendran, Simon

    2012-01-31

    Preclinical results with various gene therapy strategies indicate significant potential for new cancer treatments. However, many therapeutics fail at clinical trial, often due to differences in tissue physiology between animal models and humans, and tumor phenotype variation. Clinical data relevant to treatment strategies may be generated prior to clinical trial through experimentation using intact patient tissue ex vivo. We developed a novel tumor slice model culture system that is universally applicable to gene delivery methods, using a realtime luminescence detection method to assess gene delivery. Methods investigated include viruses (adenovirus [Ad] and adeno-associated virus), lipofection, ultrasound (US), electroporation and naked DNA. Viability and tumor populations within the slices were well maintained for seven days, and gene delivery was qualitatively and quantitatively examinable for all vectors. Ad was the most efficient gene delivery vector with transduction efficiency >50%. US proved the optimal non-viral gene delivery method in human tumor slices. The nature of the ex vivo culture system permitted examination of specific elements. Parameters shown to diminish Ad gene delivery included blood, regions of low viability and secondary disease. US gene delivery was significantly reduced by blood and skin, while tissue hyperthermia improved gene delivery. US achieved improved efficacy for secondary disease. The ex vivo model was also suitable for examination of tissue-specific effects on vector expression, with Ad expression mediated by the CXCR4 promoter shown to provide a tumor selective advantage over the ubiquitously active cytomegalovirus promoter. In conclusion, this is the first study incorporating patient tissue models in comparing gene delivery from various vectors, providing knowledge on cell-type specificity and examining the crucial biological factors determining successful gene delivery. The results highlight the importance of in

  13. Using Social Network Analysis as a Method to Assess and Strengthen Participation in Health Promotion Programs in Vulnerable Areas.

    Science.gov (United States)

    Hindhede, Anette Lykke; Aagaard-Hansen, Jens

    2017-03-01

    This article provides an example of the application of social network analysis method to assess community participation thereby strengthening planning and implementation of health promotion programming. Community health promotion often takes the form of services that reach out to or are located within communities. The concept of community reflects the idea that people's behavior and well-being are influenced by interaction with others, and here, health promotion requires participation and local leadership to facilitate transmission and uptake of interventions for the overall community to achieve social change. However, considerable uncertainty exists over exact levels of participation in these interventions. The article draws on a mixed methods research within a community development project in a vulnerable neighborhood of a town in Denmark. It presents a detailed analysis of the way in which social network analysis can be used as a tool to display participation and nonparticipation in community development and health promotion activities, to help identify capacities and assets, mobilize resources, and finally to evaluate the achievements. The article concludes that identification of interpersonal ties among people who know one another well as well as more tenuous relationships in networks can be used by community development workers to foster greater cohesion and cooperation within an area.

  14. The first year experience of occupational therapy students at an Australian regional university: Promoting student retention and developing a regional and remote workforce.

    Science.gov (United States)

    Boehm, Jackie; Cordier, Reinie; Thomas, Yvonne; Tanner, Bronwyn; Salata, Karen

    2017-02-01

    Student retention at regional universities is important in addressing regional and remote workforce shortages. Students attending regional universities are more likely to work in regional areas. First year experience at university plays a key role in student retention. This study aimed to explore factors influencing the first year experience of occupational therapy students at a regional Australian university. Surveys were administered to 58 second year occupational therapy students in the first week of second year. Data were analysed using descriptive statistics, inferential statistics (Pearson χ 2 ; Spearman rho) and summarising descriptive responses. An Australian regional university. Second year undergraduate occupational therapy students. Factors influencing students' decisions to study and continue studying occupational therapy; factors enhancing first year experience of university. Fifty-four students completed the survey (93.1%). A quarter (25.9%) of students considered leaving the course during the first year. The primary influence for continuing was the teaching and learning experience. Most valued supports were orientation week (36.7%) and the first year coordinator (36.7%). The importance of the first year experience in retaining occupational therapy students is highlighted. Engagement with other students and staff and academic support are important factors in facilitating student retention. It is important to understand the unique factors influencing students' decisions, particularly those from regional and remote areas, to enter and continue in tertiary education to assist in implementing supports and strategies to improve student retention. © 2015 National Rural Health Alliance Inc.

  15. Regional differences in awareness of tobacco advertising and promotion in China: findings from the ITC China Survey.

    Science.gov (United States)

    Yang, Yan; Li, Lin; Yong, Hua-Hie; Borland, Ron; Wu, Xi; Li, Qiang; Wu, Changbao; Foong, Kin

    2010-04-01

    To examine whether levels of, and factors related to, awareness of tobacco advertising and promotion differ across six cities in China. Data from wave 1 of the International Tobacco Control (ITC) China Survey (April to August 2006) were analysed. The ITC China Survey employed a multistage sampling design in Beijing, Shenyang, Shanghai, Changsha, Guangzhou and Yinchuan. Face-to-face interviews were conducted with a total of 4763 smokers and 1259 non-smokers. Multivariate logistic regression models were used to identify factors associated with awareness of tobacco advertising and promotion. The overall levels of noticing advertisements varied considerably by city. Cities reporting lower levels of advertising tended to report higher levels of point of sale activity. Noticing tobacco industry promotions was associated with more positive attitudes to tobacco companies. The awareness of tobacco advertising and promotional activities was not homogeneous across the six Chinese cities, suggesting variations in the tobacco industry's activities and the diversity of implementing a central set of laws to restrict tobacco promotion. This study clearly demonstrates the need to work with the implementation agencies if national laws are to be properly enforced.

  16. Identification of the promoter region required for human adiponectin gene transcription: Association with CCAAT/enhancer binding protein-β and tumor necrosis factor-α

    International Nuclear Information System (INIS)

    Kita, Atsushi; Yamasaki, Hironori; Kuwahara, Hironaga; Moriuchi, Akie; Fukushima, Keiko; Kobayashi, Masakazu; Fukushima, Tetsuya; Takahashi, Ryoko; Abiru, Norio; Uotani, Shigeo; Kawasaki, Eiji; Eguchi, Katsumi

    2005-01-01

    Adiponectin, an adipose tissue-specific plasma protein, is involved in insulin sensitizing and has anti-atherosclerotic properties. Plasma levels of adiponectin are decreased in obese individuals and patients with type 2 diabetes with insulin resistance. Tumor necrosis factor-α (TNF-α) decreases the expression of adiponectin in adipocytes. The aims of the present study were: (1) to identify the promoter region responsible for basal transcription of the human adiponectin gene, and (2) to investigate the mechanism by which adiponectin was regulated by TNF-α. The human adiponectin promoter (2.1 kb) was isolated and used for luciferase reporter analysis by transient transfection into 3T3-L1 adipocytes. Deletion analysis demonstrated that the promoter region from -676 to +41 was sufficient for basal transcriptional activity. Mutation analysis of putative response elements for sterol regulatory element binding protein (SREBP) (-431 to -423) and CCAAT/enhancer binding protein (C/EBP) (-230 to -224) showed that both elements were required for basal promoter activity. Adiponectin transcription was increased 3-fold in cells that over-expressed constitutively active C/EBP-β. Electrophoretic mobility shift assay, using nuclear extract from 3T3-L1 cells and the -258 to -199 region as a probe, demonstrated specific DNA-protein binding, which was abolished by TNF-α treatment. The present data indicate that the putative response elements for SREBP and C/EBP are required for human adiponectin promoter activity, and that suppression by TNF-α may, at least in part, be associated with inactivation of C/EBP-β

  17. A method for detecting IBD regions simultaneously in multiple individuals--with applications to disease genetics

    DEFF Research Database (Denmark)

    Moltke, Ida; Albrechtsen, Anders; Hansen, Thomas V O

    2011-01-01

    genome containing disease-causing variants. However, IBD regions can be difficult to detect, especially in the common case where no pedigree information is available. In particular, all existing non-pedigree based methods can only infer IBD sharing between two individuals. Here, we present a new Markov...... Chain Monte Carlo method for detection of IBD regions, which does not rely on any pedigree information. It is based on a probabilistic model applicable to unphased SNP data. It can take inbreeding, allele frequencies, genotyping errors, and genomic distances into account. And most importantly, it can...

  18. Promoter-region hypermethylation and expression downregulation of Yy1 (Yin yang 1) in preneoplastic liver lesions in a thioacetamide rat hepatocarcinogenesis model

    International Nuclear Information System (INIS)

    Abe, Hajime; Ogawa, Takashi; Wang, Liyun; Kimura, Masayuki; Tanaka, Takeshi; Morita, Reiko; Yoshida, Toshinori; Shibutani, Makoto

    2014-01-01

    Thioacetamide (TAA) has been used to develop a rodent model for hepatocarcinogenesis. To determine the genes with epigenetic modifications in early hepatocarcinogenesis, we did a genome-wide scan for hypermethylated promoter regions using CpG island microarrays in TAA-promoted rat liver tissue. Eight genes were selected based on the microarray profile; of these, Yy1 and Wdr45b were confirmed to be hypermethylated by methylation-specific polymerase chain reaction (PCR) and pyrosequencing and downregulated by real-time reverse transcription PCR. Non-neoplastic liver cells had nuclear Yy1 immunoreactivity, while preneoplastic foci with glutathione S-transferase placental form (GST-P) immunoreactivity had decreased Yy1 immunoreactivity. The incidence of these foci was proportional to the dose of TAA administered. Co-expression analysis of gene products downstream of Yy1 revealed increased nuclear phospho-c-Myc + foci as well as nuclear and cytoplasmic p21 Cip1+ foci in Yy1 − or GST-P + foci in response to TAA-promotion dose. Although the absolute number of cells was low, the incidence of death receptor 5 − foci was increased in Yy1 − foci in proportion to the TAA dose. Yy1 − /GST-P + foci revealed a higher number of proliferating cell nuclear antigen (PCNA)-immunoreactive cells than Yy1 + /GST-P + foci, while cleaved caspase-3 + cells were unchanged between Yy1 – /GST-P + and Yy1 + /GST-P + foci. In the case of Wdr45b, most GST-P + foci were Wdr45b – and were not increased by TAA promotion. These results suggest involvement of Yy1 in the epigenetic gene regulation at the early stages of TAA promoted cell proliferation and concomitant cell cycle arrest in preneoplastic lesions. - Highlights: • Epigenetically downregulated genes were searched in TAA-promnoted rat livers. • Yy1 and Wdr45b showed promoter-region hypermethylation and mRNA downregulation. • TAA promoted increase of preneoplastic Yy1 – /GST-P + foci showing high proliferation. • TAA

  19. A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

    DEFF Research Database (Denmark)

    Hansen, Martin A; Nielsen, John E; Retelska, Dorota

    2008-01-01

    , sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...

  20. Mindfulness and motivational interviewing: two candidate methods for promoting self-management.

    Science.gov (United States)

    Benzo, Roberto P

    2013-08-01

    There is no conclusive evidence about the way to a promote behavior change in self-management programs for patients with chronic obstructive pulmonary disease (COPD). The latter is a significant knowledge gap as there is a need to promote a sustained effect in interventions like Pulmonary Rehabilitation or Supporting Programs. Embracing patient's values seems to be a key ingredient to ignite genuine motivation for behavior change. This manuscript describes two pilot qualitative studies carried out in patients with severe COPD aimed to engage the patient inner experience and promote self-management: a trial testing motivational interviewing (MI) as one style of helping patients with severe COPD make changes in their behavior and second a trial testing a mindfulness-based intervention. The MI study consisted of a 3-month program of weekly coaching phone calls after one face-to-face visit. The following themes were outstanding: patients value the supportive communication with coach and believe the MI-based coaching created increased level of awareness and accountability. They perceived an increase in physical activity and reported "feeling better" or other benefits not directly related to exercise. The Mindfulness for Health Program was a mandatory 8-week program that consisted on 2-hour classes aimed to cultivate nonjudgmental attention in the moment (through different meditative practices and sharing) plus monthly face-to-face encounters aimed to sustain practice and sharing of life experiences for 1 year. The following themes (at 1 year) were outstanding: appreciating life by seeing hardships as opportunities, valuing the self through compassion and awareness, cultivating connectedness with others, acquiring joy, and adopting healthy behaviors. In the search for the "holy grail" for self-management programs that can promote a behavior change, mindfulness and MI seem promising for cultivating a way to live a life in which people are fully present and consciously

  1. Critical effective methods to detect genotoxic carcinogens and neoplasm-promoting agents.

    OpenAIRE

    Weisburger, J H; Williams, G M

    1991-01-01

    Neoplasia in fish can result from contamination of waters with carcinogens and promoters. Cancer in fish, therefore, is a possible indicator of cancer risk to man and serves as a guide to the need for preventive approaches involving improved means of waste disposal and environmental hygiene. Moreover, cancer in fish indicates that this important food source may be contaminated. Detection of genotoxic carcinogens to which fish are exposed can be achieved quickly and efficiently by carefully se...

  2. [Health promotion in primary care: study based on the Paulo Freire method].

    Science.gov (United States)

    Heidemann, Ivonete Teresinha Schülter Buss; Wosny, Antonio de Miranda; Boehs, Astrid Eggert

    2014-08-01

    The scope of this study is to analyze the implementation of health promotion actions in the working process of the Family Health Teams of a city in the state of Santa Catarina. It involves research adopting a qualitative approach linked to the methodological benchmark of Paulo Freire, consisting of three dialectic moments: thematic investigation; encoding and decoding; critical revelation. Fifteen Culture Circles were conducted, covering five district health units, with the participation of 70 professionals. Each meeting was scheduled to last two hours with an average attendance of thirteen participants of the Family Health teams. The research revealed that there are limitations to the implementation of health promotion as a key element of participatory action together with the community. It also highlighted the importance of interdisciplinarity and intersectorality between workers and the city, state and federal manager. The commitment to the principles of the Unified Health System (SUS) and health promotion also presents itself as a challenge to improve the quality of life of the population.

  3. PTSD and DNA Methylation in Select Immune Function Gene Promoter Regions: A Repeated Measures Case-control Study of U.S. Military Service Members

    Science.gov (United States)

    2013-06-24

    other relevant exposures which may influ- ence DNA methylation , such as dietary factors ( folate , vitamin B12 intake) (Fenech, 2001; Piyathilake and...ARTICLE published: 24 June 2013 doi: 10.3389/fpsyt.2013.00056 PTSD and DNA methylation in select immune function gene promoter regions: a repeated measures...largely unknown. Dis- tinct expression signatures for PTSD have been found, in particular for immune activation transcripts. DNA methylation may be

  4. Regional economic impacts of the unconventional promotion of natural gas (Hydraulic Fracturing). Preliminary study; Regionaloekonomische Auswirkungen der unkonventionellen Erdgasfoerderung (Hydraulic Fracturing). Vorstudie

    Energy Technology Data Exchange (ETDEWEB)

    Bizer, Kilian; Bossmeyer, Christoph

    2012-07-01

    Actually, there is a controversial public discussion on the exploitation of conventional natural gas by means of hydraulic fracturing (Fracking). The contribution under consideration examines the geologic, toxicological or technical as well as legal points of contact with respect to the different effects for the actor groups. Based on the existing scientific realizations, the regional economic effects of the fracking technology and the subsequent promotion of unconventional natural gas deposits have to be worked out.

  5. Qualitative Research Methods in Visual Communication. Case Study: Visual Networks in the Promotional Videos of the European Year of Volunteering

    Directory of Open Access Journals (Sweden)

    Camelia Cmeciu

    2013-05-01

    Full Text Available European Years are a means of promoting European issues at a macro and micro-level. The objective of this paper is to provide the visual differences in the framing of the issue of volunteering at a European and national level. The approach focuses on a blending of two qualitative research methods in visual communication: ATLAS.ti (computer assisted/ aided qualitative data analysis software and social semiotics. The results of our analysis highlight two network views on volunteering promoted through videos, a salience of transactional processes in the implementation of volunteering at a European and national level, and a classification of various types of social practices specific to Romania. This study provides an insight into the way in which two different qualitative methods may be combined in order to provide a visual representation and interpretation to a European issue.

  6. Effective management models and methods of economic educations in regional industrial complexes

    Directory of Open Access Journals (Sweden)

    Andrey Gennadyevich Butrin

    2014-06-01

    Full Text Available In the article, the methodical bases of management by the integrated industrial enterprises is developed according to the indicators of sustainable economic development of the region. The scope of the research is the region as the difficult mesosystem consisting of logistic clusters. The subject matter of the research is the organizational and economic relations developing in the course of interaction of participants of the regional economy as mesosystems. The models and methods of management by the large economic systems in the economy of the industrially developed region are developed; the organizational and economic essence of a logistic cluster as the subject of the regional economy us revealed. The mechanism of management by the integrated enterprises with using the cluster approach, technologies of logistics, management of supply chains is offered. They allow to the management of an enterprises to make scientifically reasonable effective decisions developing programs of supply, economic production and realization of finished goods in the close connection with programs of regional economic development.

  7. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset.

    Science.gov (United States)

    Ignatieva, Elena V; Levitsky, Victor G; Yudin, Nikolay S; Moshkin, Mikhail P; Kolchanov, Nikolay A

    2014-01-01

    The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors), which are activated by olfactory stimuli (ligands). Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter [a region of DNA about 100-1000 base pairs long located upstream of the transcription start site (TSS)]. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.). In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

  8. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset

    Directory of Open Access Journals (Sweden)

    Elena V. Ignatieva

    2014-03-01

    Full Text Available The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors, which are activated by olfactory stimuli (ligands. Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter (a region of DNA about 100–1000 base pairs long located upstream of the transcription start site. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.. In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

  9. Identification, occurrence, and validation of DRE and ABRE Cis-regulatory motifs in the promoter regions of genes of Arabidopsis thaliana.

    Science.gov (United States)

    Mishra, Sonal; Shukla, Aparna; Upadhyay, Swati; Sanchita; Sharma, Pooja; Singh, Seema; Phukan, Ujjal J; Meena, Abha; Khan, Feroz; Tripathi, Vineeta; Shukla, Rakesh Kumar; Shrama, Ashok

    2014-04-01

    Plants posses a complex co-regulatory network which helps them to elicit a response under diverse adverse conditions. We used an in silico approach to identify the genes with both DRE and ABRE motifs in their promoter regions in Arabidopsis thaliana. Our results showed that Arabidopsis contains a set of 2,052 genes with ABRE and DRE motifs in their promoter regions. Approximately 72% or more of the total predicted 2,052 genes had a gap distance of less than 400 bp between DRE and ABRE motifs. For positional orientation of the DRE and ABRE motifs, we found that the DR form (one in direct and the other one in reverse orientation) was more prevalent than other forms. These predicted 2,052 genes include 155 transcription factors. Using microarray data from The Arabidopsis Information Resource (TAIR) database, we present 44 transcription factors out of 155 which are upregulated by more than twofold in response to osmotic stress and ABA treatment. Fifty-one transcripts from the one predicted above were validated using semiquantitative expression analysis to support the microarray data in TAIR. Taken together, we report a set of genes containing both DRE and ABRE motifs in their promoter regions in A. thaliana, which can be useful to understand the role of ABA under osmotic stress condition. © 2013 Institute of Botany, Chinese Academy of Sciences.

  10. An improved method for pancreas segmentation using SLIC and interactive region merging

    Science.gov (United States)

    Zhang, Liyuan; Yang, Huamin; Shi, Weili; Miao, Yu; Li, Qingliang; He, Fei; He, Wei; Li, Yanfang; Zhang, Huimao; Mori, Kensaku; Jiang, Zhengang

    2017-03-01

    Considering the weak edges in pancreas segmentation, this paper proposes a new solution which integrates more features of CT images by combining SLIC superpixels and interactive region merging. In the proposed method, Mahalanobis distance is first utilized in SLIC method to generate better superpixel images. By extracting five texture features and one gray feature, the similarity measure between two superpixels becomes more reliable in interactive region merging. Furthermore, object edge blocks are accurately addressed by re-segmentation merging process. Applying the proposed method to four cases of abdominal CT images, we segment pancreatic tissues to verify the feasibility and effectiveness. The experimental results show that the proposed method can make segmentation accuracy increase to 92% on average. This study will boost the application process of pancreas segmentation for computer-aided diagnosis system.

  11. Comparison of different wind data interpolation methods for a region with complex terrain in Central Asia

    Science.gov (United States)

    Reinhardt, Katja; Samimi, Cyrus

    2018-01-01

    While climatological data of high spatial resolution are largely available in most developed countries, the network of climatological stations in many other regions of the world still constitutes large gaps. Especially for those regions, interpolation methods are important tools to fill these gaps and to improve the data base indispensible for climatological research. Over the last years, new hybrid methods of machine learning and geostatistics have been developed which provide innovative prospects in spatial predictive modelling. This study will focus on evaluating the performance of 12 different interpolation methods for the wind components \\overrightarrow{u} and \\overrightarrow{v} in a mountainous region of Central Asia. Thereby, a special focus will be on applying new hybrid methods on spatial interpolation of wind data. This study is the first evaluating and comparing the performance of several of these hybrid methods. The overall aim of this study is to determine whether an optimal interpolation method exists, which can equally be applied for all pressure levels, or whether different interpolation methods have to be used for the different pressure levels. Deterministic (inverse distance weighting) and geostatistical interpolation methods (ordinary kriging) were explored, which take into account only the initial values of \\overrightarrow{u} and \\overrightarrow{v} . In addition, more complex methods (generalized additive model, support vector machine and neural networks as single methods and as hybrid methods as well as regression-kriging) that consider additional variables were applied. The analysis of the error indices revealed that regression-kriging provided the most accurate interpolation results for both wind components and all pressure heights. At 200 and 500 hPa, regression-kriging is followed by the different kinds of neural networks and support vector machines and for 850 hPa it is followed by the different types of support vector machine and

  12. Measurement of sequential change of regional ventilation by new developed Kr-81m method in asthmatics

    International Nuclear Information System (INIS)

    Shimada, Takao; Narita, Hiroto; Ishida, Hirohide; Terashima, Yoichi; Hirasawa, Korenori; Mori, Yutaka; Kawakami, Kenji

    1991-01-01

    Fazio has reported the distribution of Kr-81m by the continuous inhalation method indicates distribution of ventilation. To estimate sequential ventilation change with the continuous Kr-81m inhalation method, it is necessary to keep the concentration of Kr-81m constant. However this is frequently ignored. Because of this, we have developed the new method to maintain constant concentration of Kr-81m and compared the reliability of this method to the conventional method. The results of phantom study showed that the concentration of Kr-81m is kept constant, and sequential change of ventilation can be estimated only by our new method. On application of this method in asthmatics, we have discovered the existence of the region where ventilation reduced by inhalation of a bronchodilator. (author)

  13. Mathematical models and methods of assisting state subsidy distribution at the regional level

    Science.gov (United States)

    Bondarenko, Yu V.; Azarnova, T. V.; Kashirina, I. L.; Goroshko, I. V.

    2018-03-01

    One of the most common forms of state support in the world is subsidization. By providing direct financial support to businesses, local authorities get an opportunity to set certain performance targets. Successful achievement of such targets depends not only on the amount of the budgetary allocations, but also on the distribution mechanisms adopted by the regional authorities. Analysis of the existing mechanisms of subsidies distribution in Russian regions shows that in most cases the choice of subsidy calculation formula and its parameters depends on the experts’ subjective opinion. The authors offer a new approach to assisting subsidy distribution at the regional level, which is based on mathematical models and methods, allowing to evaluate the influence of subsidy distribution on the region’s social and economic development. The results of calculations were discussed with the regional administration representatives who confirmed their significance for decision-making in the sphere of state control.

  14. A method of acoustic wave registration and determination their generation region

    International Nuclear Information System (INIS)

    Kozin, I.D.; Marchenko, M.V.

    1998-01-01

    Here is presented a method of acoustic wave registration with using of a synchronous LF broadcasting system. This method of detection and determination of underground nuclear explosion location is based on a registration of ionospheric disturbances induced by acoustic waves at the region of LF sign al reflection. The measuring complex created in the institute of the Ionosphere /1/ allows to register amplitude-frequency characteristics of composite signal from synchronous broadcasting net

  15. Methods of formation of efficiency indexes of electric power sources integration in regional electric power systems

    International Nuclear Information System (INIS)

    Marder, L.I.; Myzin, A.I.

    1993-01-01

    A methodic approach to the grounding of the integration process efficiency within the Unified electric power system is given together with the selection of a rational areal structure and concentration of power-generating source capacities. Formation of an economic functional according to alternative scenavies including the cost components taking account of the regional interests is considered. A method for estimation and distribution of the effect from electric power production integration in the power systems under new economic conditions is proposed

  16. Isolation and analysis of a multifunctional triterpene synthase KcMS promoter region from mangrove plant kandelia candel

    Science.gov (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of Kandelia candel KcMS gene has previously been cloned and encoded a multifunctional triterpene synthase. In this study, the KcMS gene promoter was cloned through Genome walking, sequenced, and analyzed. A 1,358 bp genomic DNA fragment of KcMS promoter was obtained. PLACE and PlantCARE analysis of the KcMS promoter revealed that there was some regulatory elements in response to environmental signals and involved in the regulation of gene expression. Results showed that four kinds of elements are regulated by hormone binding, namely 2 MeJA-responsiveness elements (CGTCA-motif and TGACG-motif), the ABRE (TACGTG) involved in abscisic acid responsiveness, gibberellin-related GARE-motif (AAACAGA), and the TGA-element (AACGAC) as an auxin-responsive element. Several elements in the KcMS have been shown in other plants to be responsive to abiotic stress. These motifs were MBS (CAACTG), TC-rich repeats, and eight light responsive elements. The KcMS promoter was also involved in the activation of defense genes in plants such as HSE (AAAAAATTC) and four circadian control elements (CAANNNNATC). The presence of multipotential regulatory motifs suggested that KcMS may be involved in regulation of plant tolerance to several types of stresses.

  17. Promoting sustainable potato agriculture in the Andean region by supplemental calcium nutrition and breeding for frost tolerance

    Science.gov (United States)

    Collaborative research in Peru sought to promote sustainable potato production and, mitigate adverse impacts of climate change through two approaches: first calcium amendments to increase crop yield and, second to enhance frost tolerance in native potatoes. All the multi-year, multi-location experim...

  18. Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

    DEFF Research Database (Denmark)

    Elholm, M; Bjerking, G; Knudsen, J

    1996-01-01

    for the ACBP DR-1 element. Addition of peroxisome proliferators (PP) to H4IIEC3 rat hepatoma cells led to an increase in the ACBP mRNA level, indicating that the DR-1 element could be a functional peroxisome proliferator responsive element (PPRE). Analysis of the ACBP promoter by transient transfection showed...

  19. Detection method of elastic scattering in the Coulomb interference region: scintillation target

    International Nuclear Information System (INIS)

    Azaiez, Hamza.

    1981-01-01

    Measurement of polarization in (p-p) elastic scattering in the Coulomb interference region is considered as a valid method for calibrating high energy polarized proton beams. Possibility of using a scintillation target to detect low energy recoil protons in this /t/ region has been studied by using a 4 GeV/c π - beam from CERN PS. The results obtained with a steack of thin plastic scintillators, each 1 mm thick, showed the feasibility of detecting recoil protons in a /t/ range as low a 5.10 -3 (GeV/c) 2 . This method thus confirmed experimentally can be used also to measure, using a polarized beam, polarization in Coulomb interference region [fr

  20. Application of Monte Carlo filtering method in regional sensitivity analysis of AASHTOWare Pavement ME design

    Directory of Open Access Journals (Sweden)

    Zhong Wu

    2017-04-01

    Full Text Available Since AASHTO released the Mechanistic-Empirical Pavement Design Guide (MEPDG for public review in 2004, many highway research agencies have performed sensitivity analyses using the prototype MEPDG design software. The information provided by the sensitivity analysis is essential for design engineers to better understand the MEPDG design models and to identify important input parameters for pavement design. In literature, different studies have been carried out based on either local or global sensitivity analysis methods, and sensitivity indices have been proposed for ranking the importance of the input parameters. In this paper, a regional sensitivity analysis method, Monte Carlo filtering (MCF, is presented. The MCF method maintains many advantages of the global sensitivity analysis, while focusing on the regional sensitivity of the MEPDG model near the design criteria rather than the entire problem domain. It is shown that the information obtained from the MCF method is more helpful and accurate in guiding design engineers in pavement design practices. To demonstrate the proposed regional sensitivity method, a typical three-layer flexible pavement structure was analyzed at input level 3. A detailed procedure to generate Monte Carlo runs using the AASHTOWare Pavement ME Design software was provided. The results in the example show that the sensitivity ranking of the input parameters in this study reasonably matches with that in a previous study under a global sensitivity analysis. Based on the analysis results, the strengths, practical issues, and applications of the MCF method were further discussed.

  1. Statistical Analysis of the labor Market in Ukraine Using Multidimensional Classification Methods: the Regional Aspect

    Directory of Open Access Journals (Sweden)

    Korepanov Oleksiy S.

    2017-12-01

    Full Text Available The aim of the article is to study the labor market in Ukraine in the regional context using cluster analysis methods. The current state of the labor market in regions of Ukraine is analyzed, and a system of statistical indicators that influence the state and development of this market is formed. The expediency of using cluster analysis for grouping regions according to the level of development of the labor market is substantiated. The essence of cluster analysis is revealed, its main goal, key tasks, which can be solved by means of such analysis, are presented, basic stages of the analysis are considered. The main methods of clustering are described and, based on the results of the simulation, the advantages and disadvantages of each method are justified. In the work the clustering of regions of Ukraine by the level of labor market development using different methods of cluster analysis is carried out, conclusions on the results of the calculations performed are presented, and the main directions for further research are outlined.

  2. An AHP-derived method for mapping the physical vulnerability of coastal areas at regional scales

    Directory of Open Access Journals (Sweden)

    G. Le Cozannet

    2013-05-01

    Full Text Available Assessing coastal vulnerability to climate change at regional scales is now mandatory in France since the adoption of recent laws to support adaptation to climate change. However, there is presently no commonly recognised method to assess accurately how sea level rise will modify coastal processes in the coming decades. Therefore, many assessments of the physical component of coastal vulnerability are presently based on a combined use of data (e.g. digital elevation models, historical shoreline and coastal geomorphology datasets, simple models and expert opinion. In this study, we assess the applicability and usefulness of a multi-criteria decision-mapping method (the analytical hierarchy process, AHP to map physical coastal vulnerability to erosion and flooding in a structured way. We apply the method in two regions of France: the coastal zones of Languedoc-Roussillon (north-western Mediterranean, France and the island of La Réunion (south-western Indian Ocean, notably using the regional geological maps. As expected, the results show not only the greater vulnerability of sand spits, estuaries and low-lying areas near to coastal lagoons in both regions, but also that of a thin strip of erodible cliffs exposed to waves in La Réunion. Despite gaps in knowledge and data, the method is found to provide a flexible and transportable framework to represent and aggregate existing knowledge and to support long-term coastal zone planning through the integration of such studies into existing adaptation schemes.

  3. DNA methylation of specific CpG sites in the promoter region regulates the transcription of the mouse oxytocin receptor.

    Directory of Open Access Journals (Sweden)

    Shimrat Mamrut

    Full Text Available Oxytocin is a peptide hormone, well known for its role in labor and suckling, and most recently for its involvement in mammalian social behavior. All central and peripheral actions of oxytocin are mediated through the oxytocin receptor, which is the product of a single gene. Transcription of the oxytocin receptor is subject to regulation by gonadal steroid hormones, and is profoundly elevated in the uterus and mammary glands during parturition. DNA methylation is a major epigenetic mechanism that regulates gene transcription, and has been linked to reduced expression of the oxytocin receptor in individuals with autism. Here, we hypothesized that transcription of the mouse oxytocin receptor is regulated by DNA methylation of specific sites in its promoter, in a tissue-specific manner. Hypothalamus-derived GT1-7, and mammary-derived 4T1 murine cell lines displayed negative correlations between oxytocin receptor transcription and methylation of the gene promoter, and demethylation caused a significant enhancement of oxytocin receptor transcription in 4T1 cells. Using a reporter gene assay, we showed that methylation of specific sites in the gene promoter, including an estrogen response element, significantly inhibits transcription. Furthermore, methylation of the oxytocin receptor promoter was found to be differentially correlated with oxytocin receptor expression in mammary glands and the uterus of virgin and post-partum mice, suggesting that it plays a distinct role in oxytocin receptor transcription among tissues and under different physiological conditions. Together, these results support the hypothesis that the expression of the mouse oxytocin receptor gene is epigenetically regulated by DNA methylation of its promoter.

  4. Genome-wide Anaplasma phagocytophilum AnkA-DNA interactions are enriched in intergenic regions and gene promoters and correlate with infection-induced differential gene expression.

    Directory of Open Access Journals (Sweden)

    J Stephen Dumler

    2016-09-01

    Full Text Available Anaplasma phagocytophilum, an obligate intracellular prokaryote, infects neutrophils and alters cardinal functions via reprogrammed transcription. Large contiguous regions of neutrophil chromosomes are differentially expressed during infection. Secreted A. phagocytophilum effector AnkA transits into the neutrophil or granulocyte nucleus to complex with DNA in heterochromatin across all chromosomes. AnkA binds to gene promoters to dampen cis-transcription and also has features of matrix attachment region (MAR-binding proteins that regulate three-dimensional chromatin architecture and coordinate transcriptional programs encoded in topologically-associated chromatin domains. We hypothesize that identification of additional AnkA binding sites will better delineate how A. phagocytophilum infection results in reprogramming of the neutrophil genome. Using AnkA-binding ChIP-seq, we showed that AnkA binds broadly throughout all chromosomes in a reproducible pattern, especially at: i intergenic regions predicted to be matrix attachment regions (MARs; ii within predicted lamina-associated domains; and iii at promoters ≤3,000 bp upstream of transcriptional start sites. These findings provide genome-wide support for AnkA as a regulator of cis-gene transcription. Moreover, the dominant mark of AnkA in distal intergenic regions known to be AT-enriched, coupled with frequent enrichment in the nuclear lamina, provides strong support for its role as a MAR-binding protein and genome re-organizer. AnkA must be considered a prime candidate to promote neutrophil reprogramming and subsequent functional changes that belie improved microbial fitness and pathogenicity.

  5. Methods of promotion of nuclear research and development in the Federal Republic of Germany and international cooperation

    International Nuclear Information System (INIS)

    Lehr, G.

    1987-01-01

    The promotion of nuclear research and development in the Federal Republic of Germany is part of the overall R and D policy and is geared to the long-term energy policy goals. Nuclear energy development has been successfully promoted for more than thirty years, the non-nuclear energy technologies for almost 15 years. As a result of this support for new technologies, energy production has become more efficient and cost-effective and with regard to fossil energy sources also markedly less detrimental to the environment. Nuclear energy research policy is an integral part of energy research policy as a whole, which particularly aims to increasingly promote renewable energy sources, above all photovoltaic and wind energy, the utilization of biomass and geothermal energy as well as the development of various energy storage methods. In addition to some mining projects which aim to reduce coal production costs, promotion in the field of fossil energy sources concentrates above all on power plant engineering and combustion techniques - i.e. environment-oriented technologies. In view of future supply patterns, projects on coal conversion are continued; with present supply and price structures for mineral oil and natural gas, however, commercialization of coal conversion cannot be expected to be launched on a large scale. (J.P.N.)

  6. Regional Attenuation in Northern California: A Comparison of Five 1-D Q Methods

    Energy Technology Data Exchange (ETDEWEB)

    Ford, S R; Dreger, D S; Mayeda, K; Walter, W R; Malagnini, L; Phillips, W S

    2007-08-03

    The determination of regional attenuation Q{sup -1} can depend upon the analysis method employed. The discrepancies between methods are due to differing parameterizations (e.g., geometrical spreading rates), employed datasets (e.g., choice of path lengths and sources), and the methodologies themselves (e.g., measurement in the frequency or time domain). Here we apply five different attenuation methodologies to a Northern California dataset. The methods are: (1) coda normalization (CN), (2) two-station (TS), (3) reverse two-station (RTS), (4) source-pair/receiver-pair (SPRP), and (5) coda-source normalization (CS). The methods are used to measure Q of the regional phase, Lg (Q{sub Lg}), and its power-law dependence on frequency of the form Q{sub 0}f{sup {eta}} with controlled parameterization in the well-studied region of Northern California using a high-quality dataset from the Berkeley Digital Seismic Network. We investigate the difference in power-law Q calculated among the methods by focusing on the San Francisco Bay Area, where knowledge of attenuation is an important part of seismic hazard mitigation. This approximately homogeneous subset of our data lies in a small region along the Franciscan block. All methods return similar power-law parameters, though the range of the joint 95% confidence regions is large (Q{sub 0} = 85 {+-} 40; {eta} = 0.65 {+-} 0.35). The RTS and TS methods differ the most from the other methods and from each other. This may be due to the removal of the site term in the RTS method, which is shown to be significant in the San Francisco Bay Area. In order to completely understand the range of power-law Q in a region, it is advisable to use several methods to calculate the model. We also test the sensitivity of each method to changes in geometrical spreading, Lg frequency bandwidth, the distance range of data, and the Lg measurement window. For a given method, there are significant differences in the power-law parameters, Q{sub 0} and {eta

  7. Building an Entrepreneurial University in Brazil: The Role and Potential of University-Industry Linkages in Promoting Regional Economic Development

    Science.gov (United States)

    Amaral, Marcelo; Ferreira, Andre; Teodoro, Pitias

    2011-01-01

    This study is part of a broader research project, conducted by the Triple Helix Research Group--Brazil, focusing on university-industry-government linkages in the state of Rio de Janeiro. The case study reported here is that of the Regional University of Volta Redonda: the aim was to develop an understanding of how a regional university can be…

  8. Health promotion methods for smoking prevention and cessation: A comprehensive review of effectiveness and the way forward

    Directory of Open Access Journals (Sweden)

    Mahaveer Golechha

    2016-01-01

    Full Text Available Tobacco smoking is one of the greatest causes of mortality in the world, responsible for over 5 million deaths per annum. The prevalence of smoking is over 1 billion people, with the majority coming from low or middle income countries. Yet, the incidence of smoking varies vastly between many countries. Some countries have been able to decline the smoking and tobacco related morbidity and mortality through the introduction of health promotion initiatives and effective policies in order to combat tobacco usage. However, on the other hand, in some countries, the incidence of smoking is increasing still further. With the growing body of evidence of detriment of tobacco to health, many control policies have been implemented as health promotion actions. Such methods include taxation of smoking, mass advertising campaigns in the media, peer education programs, community mobilization, motivational interviewing, health warnings on tobacco products, marketing restrictions, and banning smoking in public places. However, the review of the effectiveness of various health promotion methods used for smoking prevention and cessation is lacking. Therefore, the aim of this review is to identify and critically review the effectiveness of health promotion methods used for smoking prevention and cessation. All available studies and reports published were considered. Searches were conducted using PubMed, MEDLINE, Ovid, Karger, ProQuest, Sage Journals, Science Direct, Springer, Taylor and Francis, EMBASE, CINAHL, and Cochrane and Wiley Online Library. Various relevant search terms and keywords were used. After considering the inclusion and exclusion criteria, we selected 23 articles for the present review.

  9. Delayed peripheral nerve repair: methods, including surgical 'cross-bridging' to promote nerve regeneration.

    Science.gov (United States)

    Gordon, Tessa; Eva, Placheta; Borschel, Gregory H

    2015-10-01

    Despite the capacity of Schwann cells to support peripheral nerve regeneration, functional recovery after nerve injuries is frequently poor, especially for proximal injuries that require regenerating axons to grow over long distances to reinnervate distal targets. Nerve transfers, where small fascicles from an adjacent intact nerve are coapted to the nerve stump of a nearby denervated muscle, allow for functional return but at the expense of reduced numbers of innervating nerves. A 1-hour period of 20 Hz electrical nerve stimulation via electrodes proximal to an injury site accelerates axon outgrowth to hasten target reinnervation in rats and humans, even after delayed surgery. A novel strategy of enticing donor axons from an otherwise intact nerve to grow through small nerve grafts (cross-bridges) into a denervated nerve stump, promotes improved axon regeneration after delayed nerve repair. The efficacy of this technique has been demonstrated in a rat model and is now in clinical use in patients undergoing cross-face nerve grafting for facial paralysis. In conclusion, brief electrical stimulation, combined with the surgical technique of promoting the regeneration of some donor axons to 'protect' chronically denervated Schwann cells, improves nerve regeneration and, in turn, functional outcomes in the management of peripheral nerve injuries.

  10. Delayed peripheral nerve repair: methods, including surgical ′cross-bridging′ to promote nerve regeneration

    Directory of Open Access Journals (Sweden)

    Tessa Gordon

    2015-01-01

    Full Text Available Despite the capacity of Schwann cells to support peripheral nerve regeneration, functional recovery after nerve injuries is frequently poor, especially for proximal injuries that require regenerating axons to grow over long distances to reinnervate distal targets. Nerve transfers, where small fascicles from an adjacent intact nerve are coapted to the nerve stump of a nearby denervated muscle, allow for functional return but at the expense of reduced numbers of innervating nerves. A 1-hour period of 20 Hz electrical nerve stimulation via electrodes proximal to an injury site accelerates axon outgrowth to hasten target reinnervation in rats and humans, even after delayed surgery. A novel strategy of enticing donor axons from an otherwise intact nerve to grow through small nerve grafts (cross-bridges into a denervated nerve stump, promotes improved axon regeneration after delayed nerve repair. The efficacy of this technique has been demonstrated in a rat model and is now in clinical use in patients undergoing cross-face nerve grafting for facial paralysis. In conclusion, brief electrical stimulation, combined with the surgical technique of promoting the regeneration of some donor axons to ′protect′ chronically denervated Schwann cells, improves nerve regeneration and, in turn, functional outcomes in the management of peripheral nerve injuries.

  11. [Identification of Good-Practice Projects in Promoting Physical Activity - Methods, Pitfalls and Sampled Outcomes].

    Science.gov (United States)

    Henn, Annette; Karger, Claudia; Wöhlken, Katrin; Meier, Diana; Ungerer-Röhrich, Ulrike; Graf, Christine; Woll, Alexander

    2017-03-01

    The aim of this paper is to identify and show examples of good practice of public health promotion. For this, uniform quality criteria were worked out under consideration of national and international scientific literature.For the identification of examples of good practice, a comparison of different quality criteria was carried out and combined with each other in a first step. In the following step, examples of good practice were identified after a comprehensive search. The choice of the "good-practice" projects is exemplary and lays no claim to completeness.6 main quality criteria (QC) of programs promoting physical activity could be identified in the national and international context. The analysis showed altogether 10 projects which can exemplarily be classified as examples of good practice of the target groups of children and teenagers, adults, older people and people with pre-existing illnesses. These projects, however, show major differences in their (methodological) quality.The analysis reports a lack of "Good-Practice" examples. Deficits lie mainly in documentation and sustainability. Because of incomplete documentation, an assessment as a "Good-Practice" example is only possible to a limited extent; a lot of information, particularly in the evaluation, is missing. © Georg Thieme Verlag KG Stuttgart · New York.

  12. Critical effective methods to detect genotoxic carcinogens and neoplasm-promoting agents.

    Science.gov (United States)

    Weisburger, J H; Williams, G M

    1991-01-01

    Neoplasia in fish can result from contamination of waters with carcinogens and promoters. Cancer in fish, therefore, is a possible indicator of cancer risk to man and serves as a guide to the need for preventive approaches involving improved means of waste disposal and environmental hygiene. Moreover, cancer in fish indicates that this important food source may be contaminated. Detection of genotoxic carcinogens to which fish are exposed can be achieved quickly and efficiently by carefully selected batteries of complementary in vitro and in vivo bioassays. One such battery consists of the Ames test, a reverse mutation assay in prokaryotic Salmonella typhimurium, and the Williams test, involving DNA repair in freshly explanted metabolically highly competent liver cells from diverse species, including humans. Determination of DNA-carcinogen adducts by varied techniques, including 32P-postlabeling, as well as DNA breakage, mammalian cell mutagenicity, chromosome aberrations, sister chromatid exchange, or cell transformation represent additional approaches, each with its own advantages and disadvantages. More research is needed on systems to apprehend neoplasm promoters, but tests to determine interruption of intercellular communications through gap junctions appear promising. Other approaches rely on measurement of enzymes such as ornithine decarboxylase and protein kinase C. Approaches to the definition of risk to fish or humans require characterization of the genotoxic or nongenotoxic properties of a chemical, relative potency data obtained in select, limited rodent bioassays, and knowledge of prevailing environmental concentrations of specific carcinogens.

  13. Guide for Regional Integrated Assessments: Handbook of Methods and Procedures, Version 5.1. Appendix 1

    Science.gov (United States)

    Rosenzweig, Cynthia E.; Jones, James W.; Hatfield, Jerry; Antle, John; Ruane, Alex; Boote, Ken; Thorburn, Peter; Valdivia, Roberto; Porter, Cheryl; Janssen, Sander; hide

    2015-01-01

    The purpose of this handbook is to describe recommended methods for a trans-disciplinary, systems-based approach for regional-scale (local to national scale) integrated assessment of agricultural systems under future climate, bio-physical and socio-economic conditions. An earlier version of this Handbook was developed and used by several AgMIP Regional Research Teams (RRTs) in Sub-Saharan Africa (SSA) and South Asia (SA)(AgMIP handbook version 4.2, www.agmip.org/regional-integrated-assessments-handbook/). In contrast to the earlier version, which was written specifically to guide a consistent set of integrated assessments across SSA and SA, this version is intended to be more generic such that the methods can be applied to any region globally. These assessments are the regional manifestation of research activities described by AgMIP in its online protocols document (available at www.agmip.org). AgMIP Protocols were created to guide climate, crop modeling, economics, and information technology components of its projects.

  14. Promoting biogas production and using it as transport fuel in the Helsinki region; Suunnitelma liikennebiokaasun tuotannon ja kaeytoen edistaemiseksi Helsingin seudulla

    Energy Technology Data Exchange (ETDEWEB)

    Rasi, S.; Havukainen, J.; Uusitalo, V.; Andersson, R.; Manninen, K.; Aro-Heinilae, E.; Rintala, J.

    2012-11-01

    The main objective of the project was to promote biogas production and its use as transport fuel. The aims in the four Finnish and two Estonian case areas were to reduce the amount and improve the sustainable use of waste and sludge, to promote biogas production, to start biogas use as transport fuel and to provide tools for implementing the aims. The total biomethane potential in the Helsinki region corresponds to approximately 450 GWh/a. The most potential user for biomethane is public transport. The total amount of biomethane would suffice for 80% of the busses operating in the Helsinki region. Using biogas as a transport fuel instead of energy production in the Helsinki region would result in emission reductions (13 000 t{sub CO2,eq}/a). However if the fuel replacing biogas in energy production would be renewable, the emission reductions would be significantly greater. The economical assessment indicates that the production of biogas is economically feasible if all the produced gas can be sold. Biogas produced near the natural gas grid can also be transported to the Helsinki region where there are better possibilities to find uses for it. In this way, for example, gas that is produced in Kymenlaakso but is not consumed there can be transported via the natural gas grid, assuming that the production plant is reasonably close to the grid. (orig.)

  15. Development of a localized probabilistic sensitivity method to determine random variable regional importance

    International Nuclear Information System (INIS)

    Millwater, Harry; Singh, Gulshan; Cortina, Miguel

    2012-01-01

    There are many methods to identify the important variable out of a set of random variables, i.e., “inter-variable” importance; however, to date there are no comparable methods to identify the “region” of importance within a random variable, i.e., “intra-variable” importance. Knowledge of the critical region of an input random variable (tail, near-tail, and central region) can provide valuable information towards characterizing, understanding, and improving a model through additional modeling or testing. As a result, an intra-variable probabilistic sensitivity method was developed and demonstrated for independent random variables that computes the partial derivative of a probabilistic response with respect to a localized perturbation in the CDF values of each random variable. These sensitivities are then normalized in absolute value with respect to the largest sensitivity within a distribution to indicate the region of importance. The methodology is implemented using the Score Function kernel-based method such that existing samples can be used to compute sensitivities for negligible cost. Numerical examples demonstrate the accuracy of the method through comparisons with finite difference and numerical integration quadrature estimates. - Highlights: ► Probabilistic sensitivity methodology. ► Determines the “region” of importance within random variables such as left tail, near tail, center, right tail, etc. ► Uses the Score Function approach to reuse the samples, hence, negligible cost. ► No restrictions on the random variable types or limit states.

  16. A Local Region of Interest Imaging Method for Electrical Impedance Tomography with Internal Electrodes

    Directory of Open Access Journals (Sweden)

    Hyeuknam Kwon

    2013-01-01

    Full Text Available Electrical Impedance Tomography (EIT is a very attractive functional imaging method despite the low sensitivity and resolution. The use of internal electrodes with the conventional reconstruction algorithms was not enough to enhance image resolution and accuracy in the region of interest (ROI. We propose a local ROI imaging method with internal electrodes developed from careful analysis of the sensitivity matrix that is designed to reduce the sensitivity of the voxels outside the local region and optimize the sensitivity of the voxel inside the local region. We perform numerical simulations and physical measurements to demonstrate the localized EIT imaging method. In preliminary results with multiple objects we show the benefits of using an internal electrode and the improved resolution due to the local ROI image reconstruction method. The sensitivity is further increased by allowing the surface electrodes to be unevenly spaced with a higher density of surface electrodes near the ROI. Also, we analyse how much the image quality is improved using several performance parameters for comparison. While these have not yet been studied in depth, it convincingly shows an improvement in local sensitivity in images obtained with an internal electrode in comparison to a standard reconstruction method.

  17. MRS algorithm: a new method for searching myocardial region in SPECT myocardial perfusion images.

    Science.gov (United States)

    He, Yuan-Lie; Tian, Lian-Fang; Chen, Ping; Li, Bin; Mao, Zhong-Yuan

    2005-10-01

    First, the necessity of automatically segmenting myocardium from myocardial SPECT image is discussed in Section 1. To eliminate the influence of the background, the optimal threshold segmentation method modified for the MRS algorithm is explained in Section 2. Then, the image erosion structure is applied to identify the myocardium region and the liver region. The contour tracing method is introduced to extract the myocardial contour. To locate the centriod of the myocardium, the myocardial centriod searching method is developed. The protocol of the MRS algorithm is summarized in Section 6. The performance of the MRS algorithm is investigated and the conclusion is drawn in Section 7. Finally, the importance of the MRS algorithm and the improvement of the MRS algorithm are discussed.

  18. Health-care users, key community informants and primary health care workers' views on health, health promotion, health assets and deficits: qualitative study in seven Spanish regions.

    Science.gov (United States)

    Pons-Vigués, Mariona; Berenguera, Anna; Coma-Auli, Núria; Pombo-Ramos, Haizea; March, Sebastià; Asensio-Martínez, Angela; Moreno-Peral, Patricia; Mora-Simón, Sara; Martínez-Andrés, Maria; Pujol-Ribera, Enriqueta

    2017-06-13

    Although some articles have analysed the definitions of health and health promotion from the perspective of health-care users and health care professionals, no published studies include the simultaneous participation of health-care users, primary health care professionals and key community informants. Understanding the perception of health and health promotion amongst these different stakeholders is crucial for the design and implementation of successful, equitable and sustainable measures that improve the health and wellbeing of populations. Furthermore, the identification of different health assets and deficits by the different informants will generate new evidence to promote healthy behaviours, improve community health and wellbeing and reduce preventable inequalities. The objective of this study is to explore the concept of health and health promotion and to compare health assets and deficits as identified by health-care users, key community informants and primary health care workers with the ultimate purpose to collect the necessary data for the design and implementation of a successful health promotion intervention. A descriptive-interpretive qualitative research was conducted with 276 participants from 14 primary care centres of 7 Spanish regions. Theoretical sampling was used for selection. We organized 11 discussion groups and 2 triangular groups with health-care users; 30 semi-structured interviews with key community informants; and 14 discussion groups with primary health care workers. A thematic content analysis was carried out. Health-care users and key community informants agree that health is a complex, broad, multifactorial concept that encompasses several interrelated dimensions (physical, psychological-emotional, social, occupational, intellectual, spiritual and environmental). The three participants' profiles consider health promotion indispensable despite defining it as complex and vague. In fact, most health-care users admit to having

  19. A Novel Method Describing the Space Charge Limited Region in a Planar Diode

    Directory of Open Access Journals (Sweden)

    Mitra Ghergherehchi

    2017-11-01

    Full Text Available A novel and rather simple method is presented to describe the physics of space-charge region in a planar diode. The method deals with the issue in the time domain and as a consequence transient time behavior can be achieved. Potential distributions and currents obtained using this technique, supposing zero initial velocity for electrons, reveal absolute agreement with Child's results. Moreover, applying the method for non-zero uniform initial velocity for electrons, gives results which are in good agreement with previous works

  20. Do regional methods really help reduce uncertainties in flood frequency analyses?

    Science.gov (United States)

    Cong Nguyen, Chi; Payrastre, Olivier; Gaume, Eric

    2013-04-01

    Flood frequency analyses are often based on continuous measured series at gauge sites. However, the length of the available data sets is usually too short to provide reliable estimates of extreme design floods. To reduce the estimation uncertainties, the analyzed data sets have to be extended either in time, making use of historical and paleoflood data, or in space, merging data sets considered as statistically homogeneous to build large regional data samples. Nevertheless, the advantage of the regional analyses, the important increase of the size of the studied data sets, may be counterbalanced by the possible heterogeneities of the merged sets. The application and comparison of four different flood frequency analysis methods to two regions affected by flash floods in the south of France (Ardèche and Var) illustrates how this balance between the number of records and possible heterogeneities plays in real-world applications. The four tested methods are: (1) a local statistical analysis based on the existing series of measured discharges, (2) a local analysis valuating the existing information on historical floods, (3) a standard regional flood frequency analysis based on existing measured series at gauged sites and (4) a modified regional analysis including estimated extreme peak discharges at ungauged sites. Monte Carlo simulations are conducted to simulate a large number of discharge series with characteristics similar to the observed ones (type of statistical distributions, number of sites and records) to evaluate to which extent the results obtained on these case studies can be generalized. These two case studies indicate that even small statistical heterogeneities, which are not detected by the standard homogeneity tests implemented in regional flood frequency studies, may drastically limit the usefulness of such approaches. On the other hand, these result show that the valuation of information on extreme events, either historical flood events at gauged

  1. Susceptibility to gastric cancer and polymorphisms of insertion/deletion at the intron 3 of the XRCC4 and VNTR at the promoter region of the XRCC5.

    Science.gov (United States)

    Saadat, Mostafa; Pashaei, Samira; Amerizade, Foroozan

    2015-07-01

    The genes encoding X-ray repair cross-complementing group 4 (XRCC4; OMIM: 194363) and 5 (XRCC5; OMIM: 194364) are involved in repair of DNA double-strand breaks. To investigating the associations between polymorphisms of Insertion/Deletion (I/D, rs28360071) in the intron 3 of the XRCC4 and VNTR in the promoter region of the XRCC5 and risk of gastric cancer, the present study was carried out. We included 159 (56 females, 103 males) with gastric cancer and 242 (75 females, 167 males) healthy blood donors frequency matched for age and gender. Using PCR-based methods, the genotypes of the study polymorphisms were determined. The alleles of VNTR XRCC5 polymorphism divided into two groups: L (0 and 1 repeats) and H (2 and 3 repeats) alleles. For the I/D XRCC4 polymorphism, after stratification of the subjects according to their family history (FH) of cancer, either the ID (OR = 3.19, 95%CI: 1.35-7.50, P = 0.008) or the DD genotypes (OR = 4.62, 95%CI: 1.63-13.0, P = 0.004) among positive FH persons, increased the risk of gastric cancer compared with the reference group (persons who have negative FH and II genotype). For the VNTR XRCC5 polymorphism, the LH + HH genotypes among positive FH persons, increased the risk of gastric cancer compared with the reference group (persons who have negative FH and LL genotype) (OR = 2.88, 95%CI: 1.34-6.18, P = 0.006). Sensitivity analysis showed that the above mentioned associations were not occurred due to the maldistribution of the genotypes among missing data. The present study suggests that both polymorphisms of the XRCC4 and XRCC5 might be risk factors for gastric cancer development especially among persons with positive FH.

  2. Wake-promoting actions of median nerve stimulation in TBI-induced coma: An investigation of orexin-A and orexin receptor 1 in the hypothalamic region.

    Science.gov (United States)

    Zhong, Ying-Jun; Feng, Zhen; Wang, Liang; Wei, Tian-Qi

    2015-09-01

    A coma is a serious complication, which can occur following traumatic brain injury (TBI), for which no effective treatment has been established. Previous studies have suggested that neural electrical stimulation, including median nerve stimulation (MNS), may be an effective method for treating patients in a coma, and orexin‑A, an excitatory hypothalamic neuropeptide, may be involved in wakefulness. However, the exact mechanisms underlying this involvement remain to be elucidated. The present study aimed to examine the arousal‑promoting role of MNS in rats in a TBI‑induced coma and to investigate the potential mechanisms involved. A total of 90 rats were divided into three groups, comprising a control group, sham‑stimulated (TBI) group and a stimulated (TBI + MNS) group. MNS was performed on the animals, which were in a TBI‑induced comatose state. Changes in the behavior of the rats were observed following MNS. Subsequently, hypothalamic tissues were extracted from the rats 6, 12 and 24 h following TBI or MNS, respectively. The expression levels of orexin‑A and orexin receptor‑1 (OX1R) in the hypothalamus were examined using immunohistochemistry, western blotting and an enzyme‑linked immunosorbent assay. The results demonstrated that 21 rats subjected to TBI‑induced coma exhibited a restored righting reflex and response to pain stimuli following MNS. In addition, ignificant differences in the expression levels of orexin‑A and OXIR were observed among the three groups and among the time‑points. Orexin‑A and OX1R were upregulated following MNS. The rats in the stimulated group reacted to the MNS and exhibited a re‑awakening response. The results of the present study indicated that MNS may be a therapeutic option for TBI‑induced coma. The mechanism may be associated with increasing expression levels of the excitatory hypothalamic neuropeptide, orexin-A, and its receptor, OX1R, in the hypothalamic region.

  3. Influence of A-21T and C-262T genetic polymorphisms at the promoter region of the catalase (CAT) on gene expression.

    Science.gov (United States)

    Saify, Khyber; Saadat, Iraj; Saadat, Mostafa

    2016-09-01

    Catalase (CAT, OMIM: 115500) is one of the major antioxidant enzymes, which plays an important role in the clearance of reactive oxygen species. Three genetic polymorphisms of A-21T (rs7943316), C-262T (rs1001179), and C-844T (rs769214) in the promoter region of the CAT have been reported. It has been suggested that these polymorphisms may alter the recognition sites of transcriptional factors, therefore it might be concluded that these polymorphisms may alter the expression levels of the gene. The aim of the present study is to evaluate the associations between these genetic variations and the CAT mRNA levels in human peripheral blood cells. The present study consisted of 47 healthy students of Shiraz University (south-west Iran). Genotypes of the CAT polymorphisms were determined by PCR based method. The quantitative CAT mRNA expression levels were investigated using quantitative real-time PCR. Analysis of variance revealed significant differences between the study genotypes (For A-21T polymorphism: F = 7.45; df = 2, 44; P = 0.002; For C-262T polymorphism: F = 15.17; df = 2, 44; P CAT in the AC/TT, TC/TC, TC/TT, and TC/TC diplotypes significantly were higher than the mRNA levels in AC/AC diplotype. There was a significant difference between the study genotypes (F = 9.24; df = 5, 41; P CAT mRNA levels compared with the AC/AC diplotype. The present findings indicated that these polymorphisms were significantly associated with the gene expression.

  4. Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Is Not Associated With Paroxetine-Induced Ejaculation Delay in Dutch Men With Lifelong Premature Ejaculation

    Science.gov (United States)

    Janssen, Paddy K.C.; Zwinderman, Aeilko H.; Olivier, Berend

    2014-01-01

    Purpose To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). Materials and Methods This was a prospective study of 10 weeks of paroxetine treatment in 54 men with LPE. Intravaginal ejaculation latency time (IELT) was measured by stopwatch. Controls consisted of 92 Caucasian men. All men with LPE were genotyped for the 5-HTTLPR polymorphism. Allele frequencies and genotypes of short (S) and long (L) variants of the polymorphism were compared between patients and controls. Associations between the LL, SL, and SS genotypes and fold increase of mean IELT were investigated. Results Of the 54 patients, 43 (79.6%) responded to 20-mg paroxetine treatment with an ejaculation delay, whereas 11 patients (20.4%) did not respond; 44%, 18%, and 18% of the patients showed a fold increase in mean IELT of 2-10, 10-20, and more than 20, respectively. Of the 54 men, 14 (25.9%) had the LL genotype, 29 (53.7%) had the SL genotype, and 11 (20.4%) had the SS genotype. In the 92 controls, the LL, SL, and SS genotypes were present in 27 (29.3%), 41 (44.6%), and 24 (26.1%), respectively. No statistically significant differences were found in 5-HTTLPR allelic variations or in 5-HTTLPR gene variations. In all men treated with 20 mg paroxetine, analysis of variance of the natural logarithm of fold increase in the IELT showed no statistically significant difference according to genotype (p=0.83). Conclusions The 5-HTTLPR polymorphism is not associated with daily 20-mg paroxetine treatment-induced ejaculation delay in men with LPE. PMID:24578810

  5. Regional analysis of annual maximum rainfall using TL-moments method

    Science.gov (United States)

    Shabri, Ani Bin; Daud, Zalina Mohd; Ariff, Noratiqah Mohd

    2011-06-01

    Information related to distributions of rainfall amounts are of great importance for designs of water-related structures. One of the concerns of hydrologists and engineers is the probability distribution for modeling of regional data. In this study, a novel approach to regional frequency analysis using L-moments is revisited. Subsequently, an alternative regional frequency analysis using the TL-moments method is employed. The results from both methods were then compared. The analysis was based on daily annual maximum rainfall data from 40 stations in Selangor Malaysia. TL-moments for the generalized extreme value (GEV) and generalized logistic (GLO) distributions were derived and used to develop the regional frequency analysis procedure. TL-moment ratio diagram and Z-test were employed in determining the best-fit distribution. Comparison between the two approaches showed that the L-moments and TL-moments produced equivalent results. GLO and GEV distributions were identified as the most suitable distributions for representing the statistical properties of extreme rainfall in Selangor. Monte Carlo simulation was used for performance evaluation, and it showed that the method of TL-moments was more efficient for lower quantile estimation compared with the L-moments.

  6. Automated Segmentation of Coronary Arteries Based on Statistical Region Growing and Heuristic Decision Method

    Directory of Open Access Journals (Sweden)

    Yun Tian

    2016-01-01

    Full Text Available The segmentation of coronary arteries is a vital process that helps cardiovascular radiologists detect and quantify stenosis. In this paper, we propose a fully automated coronary artery segmentation from cardiac data volume. The method is built on a statistics region growing together with a heuristic decision. First, the heart region is extracted using a multi-atlas-based approach. Second, the vessel structures are enhanced via a 3D multiscale line filter. Next, seed points are detected automatically through a threshold preprocessing and a subsequent morphological operation. Based on the set of detected seed points, a statistics-based region growing is applied. Finally, results are obtained by setting conservative parameters. A heuristic decision method is then used to obtain the desired result automatically because parameters in region growing vary in different patients, and the segmentation requires full automation. The experiments are carried out on a dataset that includes eight-patient multivendor cardiac computed tomography angiography (CTA volume data. The DICE similarity index, mean distance, and Hausdorff distance metrics are employed to compare the proposed algorithm with two state-of-the-art methods. Experimental results indicate that the proposed algorithm is capable of performing complete, robust, and accurate extraction of coronary arteries.

  7. Allelic variation of the inducible costimulator (ICOS) gene: detection of polymorphisms, analysis of the promoter region, and extended haplotype estimation

    DEFF Research Database (Denmark)

    Andersen, A.D.H.; Lange, Marianne; Lillevang, S.T.

    2003-01-01

    The human chromosome region 2q33 including the three costimulatory molecules CD28, CTLA-4 and ICOS, has been subject to much attention due to its linkage to a number of autoimmune diseases. The search for the causal relationship of this linkage has revealed several polymorphisms, but no variations...... in the amino acid sequences except for one polymorphism in, the leader sequence of CTLA-4. In the present study, we examined the ICOS gene of an unrelated group of healthy donors from the Danish population. We were able to report 16 intronic SNP, one intronic G-insert and two repeat regions in intron 4......, consistent with the [T](n) and the [GT](n) regions reported in a Japanese study. Putative haplotypes for the established SNP and repeat polymorphisms have been estimated by computational analysis. Sequencing of similar to3500 by of the upstream region of ICOS revealed an additional eight SNP of which two...

  8. European network for promoting the physical health of residents in psychiatric and social care facilities (HELPS: background, aims and methods

    Directory of Open Access Journals (Sweden)

    Marginean Roxana

    2009-08-01

    Full Text Available Abstract Background People with mental disorders have a higher prevalence of physical illnesses and reduced life expectancy as compared with the general population. However, there is a lack of knowledge across Europe concerning interventions that aim at reducing somatic morbidity and excess mortality by promoting behaviour-based and/or environment-based interventions. Methods and design HELPS is an interdisciplinary European network that aims at (i gathering relevant knowledge on physical illness in people with mental illness, (ii identifying health promotion initiatives in European countries that meet country-specific needs, and (iii at identifying best practice across Europe. Criteria for best practice will include evidence on the efficacy of physical health interventions and of their effectiveness in routine care, cost implications and feasibility for adaptation and implementation of interventions across different settings in Europe. HELPS will develop and implement a "physical health promotion toolkit". The toolkit will provide information to empower residents and staff to identify the most relevant risk factors in their specific context and to select the most appropriate action out of a range of defined health promoting interventions. The key methods are (a stakeholder analysis, (b international literature reviews, (c Delphi rounds with experts from participating centres, and (d focus groups with staff and residents of mental health care facilities. Meanwhile a multi-disciplinary network consisting of 15 European countries has been established and took up the work. As one main result of the project they expect that a widespread use of the HELPS toolkit could have a significant positive effect on the physical health status of residents of mental health and social care facilities, as well as to hold resonance for community dwelling people with mental health problems. Discussion A general strategy on health promotion for people with mental

  9. European network for promoting the physical health of residents in psychiatric and social care facilities (HELPS): background, aims and methods

    Science.gov (United States)

    Weiser, Prisca; Becker, Thomas; Losert, Carolin; Alptekin, Köksal; Berti, Loretta; Burti, Lorenzo; Burton, Alexandra; Dernovsek, Mojca; Dragomirecka, Eva; Freidl, Marion; Friedrich, Fabian; Genova, Aneta; Germanavicius, Arunas; Halis, Ulaş; Henderson, John; Hjorth, Peter; Lai, Taavi; Larsen, Jens Ivar; Lech, Katarzyna; Lucas, Ramona; Marginean, Roxana; McDaid, David; Mladenova, Maya; Munk-Jørgensen, Povl; Paziuc, Alexandru; Paziuc, Petronela; Priebe, Stefan; Prot-Klinger, Katarzyna; Wancata, Johannes; Kilian, Reinhold

    2009-01-01

    Background People with mental disorders have a higher prevalence of physical illnesses and reduced life expectancy as compared with the general population. However, there is a lack of knowledge across Europe concerning interventions that aim at reducing somatic morbidity and excess mortality by promoting behaviour-based and/or environment-based interventions. Methods and design HELPS is an interdisciplinary European network that aims at (i) gathering relevant knowledge on physical illness in people with mental illness, (ii) identifying health promotion initiatives in European countries that meet country-specific needs, and (iii) at identifying best practice across Europe. Criteria for best practice will include evidence on the efficacy of physical health interventions and of their effectiveness in routine care, cost implications and feasibility for adaptation and implementation of interventions across different settings in Europe. HELPS will develop and implement a "physical health promotion toolkit". The toolkit will provide information to empower residents and staff to identify the most relevant risk factors in their specific context and to select the most appropriate action out of a range of defined health promoting interventions. The key methods are (a) stakeholder analysis, (b) international literature reviews, (c) Delphi rounds with experts from participating centres, and (d) focus groups with staff and residents of mental health care facilities. Meanwhile a multi-disciplinary network consisting of 15 European countries has been established and took up the work. As one main result of the project they expect that a widespread use of the HELPS toolkit could have a significant positive effect on the physical health status of residents of mental health and social care facilities, as well as to hold resonance for community dwelling people with mental health problems. Discussion A general strategy on health promotion for people with mental disorders must take into

  10. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  11. Promoter trans-activation of protooncogenes c-fos and c-myc, but not c-Ha-ras, by products of adenovirus early region 1A

    International Nuclear Information System (INIS)

    Sassone-Corsi, P.; Borrelli, E.

    1987-01-01

    The E1A (early region 1A) oncogene products of adenovirus type 2 trans-activate the other early viral transcription units, as well as some cellular promoters. Using a short-term cotransfection assay in murine NIH 3T3 fibroblasts, we show that c-fos and c-myc promoter activities are stimulated by the E1A proteins, whereas c-Ha-ras transcription is not affected. The product of E1A 13S mRNA is responsible for the trans-activation, whereas the 12S mRNA product has no effect. Analysis of the c-fos promoter sequences required for the E1A stimulation shows that responsive sequences are located between positions -402 and -240 upstream of the transcription initiation site. This same region also contains the c-fos serum-responsive element. Furthermore, transcription of the endogenous c-fos gene in HeLa cells is increased after E1A transfection

  12. A Peptide Derived from the HIV-1 gp120 Coreceptor-Binding Region Promotes Formation of PAP248-286 Amyloid Fibrils to Enhance HIV-1 Infection.

    Directory of Open Access Journals (Sweden)

    Jinquan Chen

    Full Text Available Semen is a major vehicle for HIV transmission. Prostatic acid phosphatase (PAP fragments, such as PAP248-286, in human semen can form amyloid fibrils to enhance HIV infection. Other endogenous or exogenous factors present during sexual intercourse have also been reported to promote the formation of seminal amyloid fibrils.Here, we demonstrated that a synthetic 15-residue peptide derived from the HIV-1 gp120 coreceptor-binding region, designated enhancing peptide 2 (EP2, can rapidly self-assemble into nanofibers. These EP2-derivated nanofibers promptly accelerated the formation of semen amyloid fibrils by PAP248-286, as shown by Thioflavin T (ThT and Congo red assays. The amyloid fibrils presented similar morphology, assessed via transmission electron microscopy (TEM, in the presence or absence of EP2. Circular dichroism (CD spectroscopy revealed that EP2 accelerates PAP248-286 amyloid fibril formation by promoting the structural transition of PAP248-286 from a random coil into a cross-β-sheet. Newly formed semen amyloid fibrils effectively enhanced HIV-1 infection in TZM-bl cells and U87 cells by promoting the binding of HIV-1 virions to target cells.Nanofibers composed of EP2 promote the formation of PAP248-286 amyloid fibrils and enhance HIV-1 infection.

  13. Regional frequency analysis of extreme rainfalls using partial L moments method

    Science.gov (United States)

    Zakaria, Zahrahtul Amani; Shabri, Ani

    2013-07-01

    An approach based on regional frequency analysis using L moments and LH moments are revisited in this study. Subsequently, an alternative regional frequency analysis using the partial L moments (PL moments) method is employed, and a new relationship for homogeneity analysis is developed. The results were then compared with those obtained using the method of L moments and LH moments of order two. The Selangor catchment, consisting of 37 sites and located on the west coast of Peninsular Malaysia, is chosen as a case study. PL moments for the generalized extreme value (GEV), generalized logistic (GLO), and generalized Pareto distributions were derived and used to develop the regional frequency analysis procedure. PL moment ratio diagram and Z test were employed in determining the best-fit distribution. Comparison between the three approaches showed that GLO and GEV distributions were identified as the suitable distributions for representing the statistical properties of extreme rainfall in Selangor. Monte Carlo simulation used for performance evaluation shows that the method of PL moments would outperform L and LH moments methods for estimation of large return period events.

  14. Applicability of an innovative steroid-profiling method to determine synthetic growth promoter abuse in cattle

    NARCIS (Netherlands)

    Blokland, M.H.; Tricht, van E.F.; Ginkel, van L.A.; Sterk, S.S.

    2017-01-01

    A robust LC–MS/MS method was developed to quantify a large number of phase I and phase II steroids in urine. The decision limit is for most compounds lower than 1 ng ml−1 with a measurement uncertainty smaller than 30%. The method is fully validated and was applied to assess the influence of

  15. Numerical method of applying shadow theory to all regions of multilayered dielectric gratings in conical mounting.

    Science.gov (United States)

    Wakabayashi, Hideaki; Asai, Masamitsu; Matsumoto, Keiji; Yamakita, Jiro

    2016-11-01

    Nakayama's shadow theory first discussed the diffraction by a perfectly conducting grating in a planar mounting. In the theory, a new formulation by use of a scattering factor was proposed. This paper focuses on the middle regions of a multilayered dielectric grating placed in conical mounting. Applying the shadow theory to the matrix eigenvalues method, we compose new transformation and improved propagation matrices of the shadow theory for conical mounting. Using these matrices and scattering factors, being the basic quantity of diffraction amplitudes, we formulate a new description of three-dimensional scattering fields which is available even for cases where the eigenvalues are degenerate in any region. Some numerical examples are given for cases where the eigenvalues are degenerate in the middle regions.

  16. Innovative Methods of Anthropogenic Landscape Reconstruction in the Urbanized Oil and Gas Region Environment

    Science.gov (United States)

    Shabatura, L. N.; Bauer, N. V.; Speranskaya, N. I.; Iatsevich, O. E.

    2016-10-01

    The article deals with the problems of the urbanized environment appearing as a result of intensive region developing. The state neglect towards people affects the population life quality of the of oil and gas extraction areas as well as problems resolving, and it provokes enormous losses for manufacturing and the whole region. The environment influences the person behaviour, one's perception and space understanding. The city environment is considered as the human existence space influencing on it directly, so it is necessary to renovate it. The authentic region developing cannot be reduced to "pure" economics (for not to be deserted), but needs to be fully mastered. To renovate the destroyed landscapes, it is necessary to use the landscape design methods making a cultural landscape. They help to increase the natural components of the city environment and to make it more harmonious, more harmless, more comfortable for residents.

  17. Regional cerebral blood flow in schizophrenics. Tests using the xenon Xe 133 inhalation method

    International Nuclear Information System (INIS)

    Ariel, R.N.; Golden, C.J.; Berg, R.A.; Quaife, M.A.; Dirksen, J.W.; Forsell, T.; Wilson, J.; Graber, B.

    1983-01-01

    Measurements of intrahemispheric and bilateral regional cerebral blood flow (CBF) for gray and white matter were compared in 29 schizophrenic patients and 22 normal controls, using the xenon Xe 133 inhalation method. Results showed significantly lower CBF values for all brain regions in the schizophrenic group, and post hoc comparisons showed relatively greater reduced gray-matter CBF values in the anterior areas of the brain. There was also a left-hemisphere frontal loss similar to that reported previously, although it was in the context of a generalized loss in anterior functioning. Interhemispheric comparison within both groups showed no differences between homologous regions for gray matter, and greater white-matter CBF values in the right hemisphere than in the left hemisphere. The findings support a hypothesis of a bilateral anterior deficit in schizophrenia

  18. Attenuation correction with region growing method used in the positron emission mammography imaging system

    Science.gov (United States)

    Gu, Xiao-Yue; Li, Lin; Yin, Peng-Fei; Yun, Ming-Kai; Chai, Pei; Huang, Xian-Chao; Sun, Xiao-Li; Wei, Long

    2015-10-01

    The Positron Emission Mammography imaging system (PEMi) provides a novel nuclear diagnosis method dedicated for breast imaging. With a better resolution than whole body PET, PEMi can detect millimeter-sized breast tumors. To address the requirement of semi-quantitative analysis with a radiotracer concentration map of the breast, a new attenuation correction method based on a three-dimensional seeded region growing image segmentation (3DSRG-AC) method has been developed. The method gives a 3D connected region as the segmentation result instead of image slices. The continuity property of the segmentation result makes this new method free of activity variation of breast tissues. The threshold value chosen is the key process for the segmentation method. The first valley in the grey level histogram of the reconstruction image is set as the lower threshold, which works well in clinical application. Results show that attenuation correction for PEMi improves the image quality and the quantitative accuracy of radioactivity distribution determination. Attenuation correction also improves the probability of detecting small and early breast tumors. Supported by Knowledge Innovation Project of The Chinese Academy of Sciences (KJCX2-EW-N06)

  19. Quantitative sacroiliac scintigraphy. The effect of method of selection of region of interest

    International Nuclear Information System (INIS)

    Davis, M.C.; Turner, D.A.; Charters, J.R.; Golden, H.E.; Ali, A.; Fordham, E.W.

    1984-01-01

    Various authors have advocated quantitative methods of evaluating bone scintigrams to detect sacroiliitis, while others have not found them useful. Many explanations for this disagreement have been offered, including differences in the method of case selection, ethnicity, gender, and previous drug therapy. It would appear that one of the most important impediments to consistent results is the variability of selecting sacroiliac joint and reference regions of interest (ROIs). The effect of ROI selection would seem particularly important because of the normal variability of radioactivity within the reference regions that have been used (sacrum, spine, iliac wing) and the inhomogeneity of activity in the SI joints. We have investigated the effect of ROI selection, using five different methods representative of, though not necessarily identical to, those found in the literature. Each method produced unique mean indices that were different for patients with ankylosing spondylitis (AS) and controls. The method of Ayres (19) proved superior (largest mean difference, smallest variance), but none worked well as a diagnostic tool because of substantial overlap of the distributions of indices of patient and control groups. We conclude that ROI selection is important in determining results, and quantitative scintigraphic methods in general are not effective tools for diagnosing AS. Among the possible factors limiting success, difficulty in selecting a stable reference area seems of particular importance

  20. A method of identifying social structures in siting regions for deep geological repositories in Switzerland

    International Nuclear Information System (INIS)

    Brander, Simone

    2010-09-01

    Acceptance is a key element in the site selection process for deep geological repositories for high-level and low and intermediate-level radioactive waste in Switzerland. Participation requirements such as comprehensive negotiation issues and adequate resources have thus been defined by the Swiss Federal Office of Energy (SFOE). In 2008, on the basis of technical criteria Nagra (National Cooperative for the Disposal of Radioactive Waste) proposed several potential areas for deep geological repositories. The number of potential areas will be narrowed down within the next few years. All municipalities within the planning perimeter (the area in which surface facilities can be realised) are affected and form the siting region. In order to ensure that the local population have their say in the forthcoming discussions, regional participation bodies including all municipalities within a siting region are being set up by the SFOE. Regional participation ensures that local interests, needs and values are taken into account in the site selection process. Assembling the regional participation bodies is therefore of great importance. Before such bodies can be formed, however, the various interests, needs and values have to be identified, and special attention has to be paid to long-term interests of future generations, as well as to non-organised and under-represented interests. According to the concept of proportional representation, the interests, needs and values that are identified and weighted by the local population are to be represented in the regional participation procedure. The aim of this study is to share a method of mapping existing social structures in a defined geographical area. This involves a combination of an analysis of socio-economic statistical data and qualitative and quantitative social research methods

  1. Imaging of 3-D seismic velocity structure of Southern Sumatra region using double difference tomographic method

    Energy Technology Data Exchange (ETDEWEB)

    Lestari, Titik, E-mail: t2klestari@gmail.com [Meteorological Climatological and Geophysical Agency (MCGA), Jalan Angkasa I No.2 Kemayoran, Jakarta Pusat, 10720 (Indonesia); Faculty of Earth Science and Technology, Bandung Institute of Technology, Jalan Ganesa No.10, Bandung 40132 (Indonesia); Nugraha, Andri Dian, E-mail: nugraha@gf.itb.ac.id [Global Geophysical Research Group, Faculty of Mining and Petroleum Engineering, Bandung Institute of Technology, Jalan Ganesa 10 Bandung 40132 (Indonesia)

    2015-04-24

    Southern Sumatra region has a high level of seismicity due to the influence of the subduction system, Sumatra fault, Mentawai fault and stretching zone activities. The seismic activities of Southern Sumatra region are recorded by Meteorological Climatological and Geophysical Agency (MCGA’s) Seismograph network. In this study, we used earthquake data catalog compiled by MCGA for 3013 events from 10 seismic stations around Southern Sumatra region for time periods of April 2009 – April 2014 in order to invert for the 3-D seismic velocities structure (Vp, Vs, and Vp/Vs ratio). We applied double-difference seismic tomography method (tomoDD) to determine Vp, Vs and Vp/Vs ratio with hypocenter adjustment. For the inversion procedure, we started from the initial 1-D seismic velocity model of AK135 and constant Vp/Vs of 1.73. The synthetic travel time from source to receiver was calculated using ray pseudo-bending technique, while the main tomographic inversion was applied using LSQR method. The resolution model was evaluated using checkerboard test and Derivative Weigh Sum (DWS). Our preliminary results show low Vp and Vs anomalies region along Bukit Barisan which is may be associated with weak zone of Sumatran fault and migration of partial melted material. Low velocity anomalies at 30-50 km depth in the fore arc region may indicated the hydrous material circulation because the slab dehydration. We detected low seismic seismicity in the fore arc region that may be indicated as seismic gap. It is coincides contact zone of high and low velocity anomalies. And two large earthquakes (Jambi and Mentawai) also occurred at the contact of contrast velocity.

  2. Specific interactions between transcription factors and the promoter-regulatory region of the human cytomegalovirus major immediate-early gene

    International Nuclear Information System (INIS)

    Ghazal, P.; Lubon, H.; Hennighausen, L.

    1988-01-01

    Repeat sequence motifs as well as unique sequences between nucleotides -150 and -22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides -91 and -65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene

  3. Calculation of the Local Free Energy Landscape in the Restricted Region by the Modified Tomographic Method.

    Science.gov (United States)

    Chen, Changjun

    2016-03-31

    The free energy landscape is the most important information in the study of the reaction mechanisms of the molecules. However, it is difficult to calculate. In a large collective variable space, a molecule must take a long time to obtain the sufficient sampling during the simulation. To save the calculation quantity, decreasing the sampling region and constructing the local free energy landscape is required in practice. However, the restricted region in the collective variable space may have an irregular shape. Simply restricting one or more collective variables of the molecule cannot satisfy the requirement. In this paper, we propose a modified tomographic method to perform the simulation. First, it divides the restricted region by some hyperplanes and connects the centers of hyperplanes together by a curve. Second, it forces the molecule to sample on the curve and the hyperplanes in the simulation and calculates the free energy data on them. Finally, all the free energy data are combined together to form the local free energy landscape. Without consideration of the area outside the restricted region, this free energy calculation can be more efficient. By this method, one can further optimize the path quickly in the collective variable space.

  4. Synthesis method based on solution regions for planar four bar straight line linkages

    International Nuclear Information System (INIS)

    Lai Rong, Yin; Cong, Mao; Jian you, Han; Tong, Yang; Juan, Huang

    2012-01-01

    An analytical method for synthesizing and selecting desired four-bar straight line mechanisms based on solution regions is presented. Given two fixed pivots, the point position and direction of the target straight line, an infinite number of mechanism solutions can be produced by employing this method, both in the general case and all three special cases. Unifying the straight line direction and the displacement from the given point to the instant center into the same form with different angles as parameters, infinite mechanism solutions can be expressed with different solution region charts. The mechanism property graphs have been computed to enable the designers to find out the involved mechanism information more intuitively and avoid aimlessness in selecting optimal mechanisms

  5. A filtering method for signal equalization in region-of-interest fluoroscopy

    International Nuclear Information System (INIS)

    Robert, Normand; Komljenovic, Philip T; Rowlands, J. A.

    2002-01-01

    A method to significantly reduce the exposure area product in fluoroscopy using a pre-patient region-of-interest (ROI) attenuator is presented. The attenuator has a thin central region and a gradually increasing thickness away from the center. It is shown that the unwanted brightening artifact caused by the attenuator can be eliminated by attenuating the low spatial frequencies in the detected image using digital image processing techniques. An investigation of the best image processing method to correct for the presence of the attenuator is undertaken. The correction procedure selected is suitable for use with real-time image processors and the ROI attenuator can be permitted to move during image acquisition. Images of an anthropomorphic chest phantom acquired in the presence of the ROI attenuator using an x-ray image intensifier/video chain are corrected to illustrate the clinical feasibility of our approach

  6. Assessment and Improving Methods of Reliability Indices in Bakhtar Regional Electricity Company

    Directory of Open Access Journals (Sweden)

    Saeed Shahrezaei

    2013-04-01

    Full Text Available Reliability of a system is the ability of a system to do prospected duties in future and the probability of desirable operation for doing predetermined duties. Power system elements failures data are the main data of reliability assessment in the network. Determining antiseptic parameters is the goal of reliability assessment by using system history data. These parameters help to recognize week points of the system. In other words, the goal of reliability assessment is operation improving and decreasing of the failures and power outages. This paper is developed to assess reliability indices of Bakhtar Regional Electricity Company up to 1393 and the improving methods and their effects on the reliability indices in this network. DIgSILENT Power Factory software is employed for simulation. Simulation results show the positive effect of improving methods in reliability indices of Bakhtar Regional Electricity Company.

  7. [Drug registries: post-marketing evaluation of the benefit-risk profile and promotion of appropriateness. The regional point of view].

    Science.gov (United States)

    Martelli, Luisa; Venegoni, Mauro

    2013-06-01

    Italian Regions and the Italian regulatory agency share a common interest in promoting the appropriateness of drug use, containing drug expenditure and acquiring additional evidence on the effectiveness and safety of drugs. Drug registries can help attaining these objectives. Specifically, the registries implemented in Italy were able to cover the first two objectives, whereas some critical issues were raised on the third one. For instance, the data recorded in the registries are not available at regional level to conduct safety and effectiveness investigations. This is a paradox, when considering that drugs included in the registries have a risk-benefit profile that is only partially defined at the moment of marketing. Currently, researchers and regions can conduct epidemiological research (cohort and case control studies), on the basis of record-linkage procedures, on all drugs prescribed in general practice (which are older drugs with a better defined risk-benefit profile). The expected outcomes of registries should be more clearly defined: when the main aim is to promote appropriateness, the recording of only a very limited amount of data should be required (to avoid a bureaucratic burden on clinicians).The Italian centers of the ENCePP network might play an important role in planning and conducting drug registries: through the presence in the steering committees of the registries, and in conducting epidemiological studies that make the most of this powerful instrument.

  8. M-Arctan estimator based on the trust-region method

    Energy Technology Data Exchange (ETDEWEB)

    Hassaine, Yacine; Delourme, Benoit; Panciatici, Patrick [Gestionnaire du Reseau de Transport d Electricite Departement Methodes et appui Immeuble Le Colbert 9, Versailles Cedex (France); Walter, Eric [Laboratoire des signaux et systemes (L2S) Supelec, Gif-sur-Yvette (France)

    2006-11-15

    In this paper a new approach is proposed to increase the robustness of the classical L{sub 2}-norm state estimation. To achieve this task a new formulation of the Levemberg-Marquardt algorithm based on the trust-region method is applied to a new M-estimator, which we called M-Arctan. Results obtained on IEEE networks up to 300 buses are presented. (author)

  9. A Method for Co-Designing Theory-Based Behaviour Change Systems for Health Promotion.

    Science.gov (United States)

    Janols, Rebecka; Lindgren, Helena

    2017-01-01

    A methodology was defined and developed for designing theory-based behaviour change systems for health promotion that can be tailored to the individual. Theories from two research fields were combined with a participatory action research methodology. Two case studies applying the methodology were conducted. During and between group sessions the participants created material and designs following the behaviour change strategy themes, which were discussed, analysed and transformed into a design of a behaviour change system. Theories in behavioural change and persuasive technology guided the data collection, data analyses, and the design of a behaviour change system. The methodology has strong emphasis on the target group's participation in the design process. The different aspects brought forward related to behaviour change strategies defined in literature on persuasive technology, and the dynamics of these are associated to needs and motivation defined in literature on behaviour change. It was concluded that the methodology aids the integration of theories into a participatory action research design process, and aids the analyses and motivations of design choices.

  10. The isotope effect and enthalpy of a base-promoted 1,4-elimination reaction by a thermokinetic method

    International Nuclear Information System (INIS)

    Ahlberg, P.

    1974-01-01

    Microcalorimetry (MC) has been used to measure the second order rate constants (k) for the base-promoted 1,4-elimination reactions of 3-(2-acetoxy-2-propyl)indene (B sub (H)) and 3-di-d-3-(2-acetoxy-2-propyl)indene (B sub (D)). Triethylamine (TEA) was used as eliminating base in methanol buffered with TEAH + AcO - as solvent. The MC-rate constants agreed with those obtained by an independent method, a calibrated quench-extraction-NMR (Q-E-NMR) method. In the present case the MC-method yields k/s with a precision of -1 (-9.5 kcal/mol) for B sub (H). The usefulness microcalorimetry in the study of reaction mechanisms is discussed. (author)

  11. Array Manipulation And Matrix-Tree Method To Identify High Concentration Regions HCRs

    Directory of Open Access Journals (Sweden)

    Rachana Arora

    2015-08-01

    Full Text Available Abstract-Sequence Alignment and Analysis is one of the most important applications of bioinformatics. It involves alignment a pair or more sequences with each other and identify a common pattern that would ultimately lead to conclusions of homology or dissimilarity. A number of algorithms that make use of dynamic programming to perform alignment between sequences are available. One of their main disadvantages is that they involve complicated computations and backtracking methods that are difficult to implement. This paper describes a much simpler method to identify common regions in 2 sequences and align them based on the density of common sequences identified.

  12. A Nonmonotone Trust Region Method for Nonlinear Programming with Simple Bound Constraints

    International Nuclear Information System (INIS)

    Chen, Z.-W.; Han, J.-Y.; Xu, D.-C.

    2001-01-01

    In this paper we propose a nonmonotone trust region algorithm for optimization with simple bound constraints. Under mild conditions, we prove the global convergence of the algorithm. For the monotone case it is also proved that the correct active set can be identified in a finite number of iterations if the strict complementarity slackness condition holds, and so the proposed algorithm reduces finally to an unconstrained minimization method in a finite number of iterations, allowing a fast asymptotic rate of convergence. Numerical experiments show that the method is efficient

  13. CRA-1 uncovers a double-strand break-dependent pathway promoting the assembly of central region proteins on chromosome axes during C. elegans meiosis.

    Science.gov (United States)

    Smolikov, Sarit; Schild-Prüfert, Kristina; Colaiácovo, Mónica P

    2008-06-06

    The synaptonemal complex (SC), a tripartite proteinaceous structure that forms between homologous chromosomes during meiosis, is crucial for faithful chromosome segregation. Here we identify CRA-1, a novel and conserved protein that is required for the assembly of the central region of the SC during C. elegans meiosis. In the absence of CRA-1, central region components fail to extensively localize onto chromosomes at early prophase and instead mostly surround the chromatin at this stage. Later in prophase, central region proteins polymerize along chromosome axes, but for the most part fail to connect the axes of paired homologous chromosomes. This defect results in an inability to stabilize homologous pairing interactions, altered double-strand break (DSB) repair progression, and a lack of chiasmata. Surprisingly, DSB formation and repair are required to promote the polymerization of the central region components along meiotic chromosome axes in cra-1 mutants. In the absence of both CRA-1 and any one of the C. elegans homologs of SPO11, MRE11, RAD51, or MSH5, the polymerization observed along chromosome axes is perturbed, resulting in the formation of aggregates of the SC central region proteins. While radiation-induced DSBs rescue this polymerization in cra-1; spo-11 mutants, they fail to do so in cra-1; mre-11, cra-1; rad-51, and cra-1; msh-5 mutants. Taken together, our studies place CRA-1 as a key component in promoting the assembly of a tripartite SC structure. Moreover, they reveal a scenario in which DSB formation and repair can drive the polymerization of SC components along chromosome axes in C. elegans.

  14. A Modified Water-Table Fluctuation Method to Characterize Regional Groundwater Discharge

    Directory of Open Access Journals (Sweden)

    Lihong Yang

    2018-04-01

    Full Text Available A modified Water-Table Fluctuation (WTF method is developed to quantitatively characterize the regional groundwater discharge patterns in stressed aquifers caused by intensive agricultural pumping. Two new parameters are defined to express the secondary information in the observed data. One is infiltration efficiency and the other is discharge modulus (recurring head loss due to aquifer discharge. An optimization procedure is involved to estimate these parameters, based on continuous groundwater head measurements and precipitation records. Using the defined parameters and precipitation time series, water level changes are calculated for individual wells with fidelity. The estimated parameters are then used to further address the characterization of infiltration and to better quantify the discharge at the regional scale. The advantage of this method is that it considers recharge and discharge simultaneously, whereas the general WTF methods mostly focus on recharge. In the case study, the infiltration efficiency reveals that the infiltration is regionally controlled by the intrinsic characteristics of the aquifer, and locally distorted by engineered hydraulic structures that alter surface water-groundwater interactions. The seasonality of groundwater discharge is characterized by the monthly discharge modulus. These results from individual wells are clustered into groups that are consistent with the local land use pattern and cropping structures.

  15. Study of regional cerebral blood flow in obsessive compulsive disorder patients with SPM and ROI method

    International Nuclear Information System (INIS)

    Li Peiyong; Jiang Xufeng; Zhang Liying; Guo Wanhua; Zhu Chengmo

    2002-01-01

    Objective: To investigate the alternations in regional cerebral blood flow (rCBF) in obsessive compulsive disorder (OCD) patients using statistical parametric mapping (SPM). Methods: rCBF measurements using 99 Tc m -ethyl cysteinate dimer (ECD) SPECT was performed on 14 OCD patients and 23 age-matched healthy volunteers. The rCBF distribution was compared between these two groups with SPM under the conditions of increased and decreased perfusion, and with regions of interest (ROIs) using cerebral template. P value was set at 0.01 level. Results: SPM analysis showed that rCBF decreased in cerebral areas including bilateral putamen, superior temporal gyrus and precuneus, and right orbital gyrus, superior and middle frontal gyrus, and left temporo-occipital lobule and superior parietal gyrus, and vermis. rCBF was also increased in left inferior frontal gyrus and posterior cingulate gyrus. With ROIs method, rCBF was decreased in right anterior frontal, temporo-parietal lobule and left temporo-occipital lobule. Conclusions: The study supports the viewpoint that rCBF abnormality of fronto-striatal circuits is involved in OCD patients. SPM method is a forceful tool in analyzing cerebral regional characters

  16. Reference methods and materials. A programme of support for regional and global marine pollution assessments

    International Nuclear Information System (INIS)

    1990-01-01

    This document describes a programme of comprehensive support for regional and global marine pollution assessments developed by the United Nations Environment Programme (UNEP) in cooperation with the International Atomic Energy Agency (IAEA) and the Intergovernmental Oceanographic Commission (IOC) and with the collaboration of a number of other United Nations Specialized agencies including the Food and Agriculture Organisation (FAO), the World Meteorological Organisation (WMO), the World Health Organisation (WHO) and the International Maritime Organisation (IMO). Two of the principle components of this programme, Reference Methods and Reference materials are given special attention in this document and a full Reference Method catalogue is included, giving details of over 80 methods currently available or in an advanced stage of preparation and testing. It is important that these methods are seen as a functional component of a much wider strategy necessary for assuring good quality and intercomparable data for regional and global pollution monitoring and the user is encouraged to read this document carefully before employing Reference Methods and Reference Materials in his/her laboratory. 3 figs

  17. A novel method for identification and quantification of consistently differentially methylated regions.

    Directory of Open Access Journals (Sweden)

    Ching-Lin Hsiao

    Full Text Available Advances in biotechnology have resulted in large-scale studies of DNA methylation. A differentially methylated region (DMR is a genomic region with multiple adjacent CpG sites that exhibit different methylation statuses among multiple samples. Many so-called "supervised" methods have been established to identify DMRs between two or more comparison groups. Methods for the identification of DMRs without reference to phenotypic information are, however, less well studied. An alternative "unsupervised" approach was proposed, in which DMRs in studied samples were identified with consideration of nature dependence structure of methylation measurements between neighboring probes from tiling arrays. Through simulation study, we investigated effects of dependencies between neighboring probes on determining DMRs where a lot of spurious signals would be produced if the methylation data were analyzed independently of the probe. In contrast, our newly proposed method could successfully correct for this effect with a well-controlled false positive rate and a comparable sensitivity. By applying to two real datasets, we demonstrated that our method could provide a global picture of methylation variation in studied samples. R source codes to implement the proposed method were freely available at http://www.csjfann.ibms.sinica.edu.tw/eag/programlist/ICDMR/ICDMR.html.

  18. Local region power spectrum-based unfocused ship detection method in synthetic aperture radar images

    Science.gov (United States)

    Wei, Xiangfei; Wang, Xiaoqing; Chong, Jinsong

    2018-01-01

    Ships on synthetic aperture radar (SAR) images will be severely defocused and their energy will disperse into numerous resolution cells under long SAR integration time. Therefore, the image intensity of ships is weak and sometimes even overwhelmed by sea clutter on SAR image. Consequently, it is hard to detect the ships from SAR intensity images. A ship detection method based on local region power spectrum of SAR complex image is proposed. Although the energies of the ships are dispersed on SAR intensity images, their spectral energies are rather concentrated or will cause the power spectra of local areas of SAR images to deviate from that of sea surface background. Therefore, the key idea of the proposed method is to detect ships via the power spectra distortion of local areas of SAR images. The local region power spectrum of a moving target on SAR image is analyzed and the way to obtain the detection threshold through the probability density function (pdf) of the power spectrum is illustrated. Numerical P- and L-band airborne SAR ocean data are utilized and the detection results are also illustrated. Results show that the proposed method can well detect the unfocused ships, with a detection rate of 93.6% and a false-alarm rate of 8.6%. Moreover, by comparing with some other algorithms, it indicates that the proposed method performs better under long SAR integration time. Finally, the applicability of the proposed method and the way of parameters selection are also discussed.

  19. 40Ar-39Ar method for age estimation: principles, technique and application in orogenic regions

    International Nuclear Information System (INIS)

    Dalmejer, R.

    1984-01-01

    A variety of the K-Ar method for age estimation by 40 Ar/ 39 Ar recently developed is described. This method doesn't require direct analysis of potassium, its content is calculated as a function of 39 Ar, which is formed from 39 K under neutron activation. Errors resulted from interactions between potassium and calcium nuclei with neutrons are considered. The attention is paid to the technique of gradual heating, used in 40 Ar- 39 Ar method, and of obtaining age spectrum. Aplicabilities of isochronous diagram is discussed for the case of presence of excessive argon in a sample. Examples of 40 Ar- 39 Ar method application for dating events in orogenic regions are presented

  20. A Sparsity-Promoted Method Based on Majorization-Minimization for Weak Fault Feature Enhancement.

    Science.gov (United States)

    Ren, Bangyue; Hao, Yansong; Wang, Huaqing; Song, Liuyang; Tang, Gang; Yuan, Hongfang

    2018-03-28

    Fault transient impulses induced by faulty components in rotating machinery usually contain substantial interference. Fault features are comparatively weak in the initial fault stage, which renders fault diagnosis more difficult. In this case, a sparse representation method based on the Majorzation-Minimization (MM) algorithm is proposed to enhance weak fault features and extract the features from strong background noise. However, the traditional MM algorithm suffers from two issues, which are the choice of sparse basis and complicated calculations. To address these challenges, a modified MM algorithm is proposed in which a sparse optimization objective function is designed firstly. Inspired by the Basis Pursuit (BP) model, the optimization function integrates an impulsive feature-preserving factor and a penalty function factor. Second, a modified Majorization iterative method is applied to address the convex optimization problem of the designed function. A series of sparse coefficients can be achieved through iterating, which only contain transient components. It is noteworthy that there is no need to select the sparse basis in the proposed iterative method because it is fixed as a unit matrix. Then the reconstruction step is omitted, which can significantly increase detection efficiency. Eventually, envelope analysis of the sparse coefficients is performed to extract weak fault features. Simulated and experimental signals including bearings and gearboxes are employed to validate the effectiveness of the proposed method. In addition, comparisons are made to prove that the proposed method outperforms the traditional MM algorithm in terms of detection results and efficiency.

  1. A region-based segmentation method for ultrasound images in HIFU therapy

    International Nuclear Information System (INIS)

    Zhang, Dong; Liu, Yu; Yang, Yan; Xu, Menglong; Yan, Yu; Qin, Qianqing

    2016-01-01

    Purpose: Precisely and efficiently locating a tumor with less manual intervention in ultrasound-guided high-intensity focused ultrasound (HIFU) therapy is one of the keys to guaranteeing the therapeutic result and improving the efficiency of the treatment. The segmentation of ultrasound images has always been difficult due to the influences of speckle, acoustic shadows, and signal attenuation as well as the variety of tumor appearance. The quality of HIFU guidance images is even poorer than that of conventional diagnostic ultrasound images because the ultrasonic probe used for HIFU guidance usually obtains images without making contact with the patient’s body. Therefore, the segmentation becomes more difficult. To solve the segmentation problem of ultrasound guidance image in the treatment planning procedure for HIFU therapy, a novel region-based segmentation method for uterine fibroids in HIFU guidance images is proposed. Methods: Tumor partitioning in HIFU guidance image without manual intervention is achieved by a region-based split-and-merge framework. A new iterative multiple region growing algorithm is proposed to first split the image into homogenous regions (superpixels). The features extracted within these homogenous regions will be more stable than those extracted within the conventional neighborhood of a pixel. The split regions are then merged by a superpixel-based adaptive spectral clustering algorithm. To ensure the superpixels that belong to the same tumor can be clustered together in the merging process, a particular construction strategy for the similarity matrix is adopted for the spectral clustering, and the similarity matrix is constructed by taking advantage of a combination of specifically selected first-order and second-order texture features computed from the gray levels and the gray level co-occurrence matrixes, respectively. The tumor region is picked out automatically from the background regions by an algorithm according to a priori

  2. A region-based segmentation method for ultrasound images in HIFU therapy

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Dong, E-mail: dongz@whu.edu.cn; Liu, Yu; Yang, Yan; Xu, Menglong; Yan, Yu [School of Physics and Technology, Wuhan University, Wuhan 430072 (China); Qin, Qianqing [State Key Laboratory of Information Engineering in Surveying, Mapping and Remote Sensing, Wuhan University, Wuhan 430072 (China)

    2016-06-15

    Purpose: Precisely and efficiently locating a tumor with less manual intervention in ultrasound-guided high-intensity focused ultrasound (HIFU) therapy is one of the keys to guaranteeing the therapeutic result and improving the efficiency of the treatment. The segmentation of ultrasound images has always been difficult due to the influences of speckle, acoustic shadows, and signal attenuation as well as the variety of tumor appearance. The quality of HIFU guidance images is even poorer than that of conventional diagnostic ultrasound images because the ultrasonic probe used for HIFU guidance usually obtains images without making contact with the patient’s body. Therefore, the segmentation becomes more difficult. To solve the segmentation problem of ultrasound guidance image in the treatment planning procedure for HIFU therapy, a novel region-based segmentation method for uterine fibroids in HIFU guidance images is proposed. Methods: Tumor partitioning in HIFU guidance image without manual intervention is achieved by a region-based split-and-merge framework. A new iterative multiple region growing algorithm is proposed to first split the image into homogenous regions (superpixels). The features extracted within these homogenous regions will be more stable than those extracted within the conventional neighborhood of a pixel. The split regions are then merged by a superpixel-based adaptive spectral clustering algorithm. To ensure the superpixels that belong to the same tumor can be clustered together in the merging process, a particular construction strategy for the similarity matrix is adopted for the spectral clustering, and the similarity matrix is constructed by taking advantage of a combination of specifically selected first-order and second-order texture features computed from the gray levels and the gray level co-occurrence matrixes, respectively. The tumor region is picked out automatically from the background regions by an algorithm according to a priori

  3. Teaching Methods in Biology Education and Sustainability Education Including Outdoor Education for Promoting Sustainability—A Literature Review

    Directory of Open Access Journals (Sweden)

    Eila Jeronen

    2016-12-01

    Full Text Available There are very few studies concerning the importance of teaching methods in biology education and environmental education including outdoor education for promoting sustainability at the levels of primary and secondary schools and pre-service teacher education. The material was selected using special keywords from biology and sustainable education in several scientific databases. The article provides an overview of 24 selected articles published in peer-reviewed scientific journals from 2006–2016. The data was analyzed using qualitative content analysis. Altogether, 16 journals were selected and 24 articles were analyzed in detail. The foci of the analyses were teaching methods, learning environments, knowledge and thinking skills, psychomotor skills, emotions and attitudes, and evaluation methods. Additionally, features of good methods were investigated and their implications for teaching were emphasized. In total, 22 different teaching methods were found to improve sustainability education in different ways. The most emphasized teaching methods were those in which students worked in groups and participated actively in learning processes. Research points toward the value of teaching methods that provide a good introduction and supportive guidelines and include active participation and interactivity.

  4. Sequence analysis of the Epstein-Barr virus (EBV) latent membrane protein-1 gene and promoter region

    DEFF Research Database (Denmark)

    Sandvej, Kristian; Gratama, J W; Munch, M

    1997-01-01

    Sequence variations in the Epstein-Barr virus (EBV) encoded latent membrane protein-1 (LMP-1) gene have been described in a Chinese nasopharyngeal carcinoma-derived isolate (CAO), and in viral isolates from various EBV-associated tumors. It has been suggested that these genetic changes, which...... include loss of a Xho I restriction site (position 169425) and a C-terminal 30-base pair (bp) deletion (position 168287-168256), define EBV genotypes associated with increased tumorigenicity or with disease among particular geographic populations. To determine the frequency of LMP-1 variations in European...... wild-type virus isolates, we sequenced the LMP-1 promoter and gene in EBV from lymphoblastoid cell lines from healthy carriers and patients without EBV-associated disease. Sequence changes were often present, and defined at least four main groups of viral isolates, which we designate Groups A through D...

  5. Trends in Accounting Education: Decreasing Accounting Anxiety and Promoting New Methods

    Science.gov (United States)

    Buckhaults, Jessica; Fisher, Diane

    2011-01-01

    In this paper, authors (a) identified accounting anxiety for the educator and the student as a possible explanation for the decline in accounting education and (b) investigated new methods for teaching accounting at the secondary and postsecondary levels that will increase interest in accounting education as well as decrease educator and student…

  6. Soil preparation methods promoting ectomycorrhizal colonization and American chestnut Castanea dentata establishment in coal mine restoration

    Science.gov (United States)

    Jenise M. Bauman; Carolyn H. Keiffer; Shiv Hiremath; Brian C. McCarthy

    2013-01-01

    The objective of this research was to evaluate soil subsurface methods that may aid in seedling establishment and encourage root colonization from a diverse group of ectomycorrhizal (ECM) fungi during restoration projects. American chestnut Castanea dentata Marsh. Borkh. and backcrossed chestnuts seedlings were planted on a reclaimed coal mine site...

  7. Farmers' participation in knowledge circulation and the promotion of agroecological methods in South India

    NARCIS (Netherlands)

    Arora, S.

    2012-01-01

    In the context of widespread agrarian distress in rural India, finding ways to secure livelihood sustainability of small farmers have become urgent concerns. Agroecological methods (AEMs) are considered by some to be effective in solving structural problems with farmers' production processes

  8. Utilizing the Lead User Method for Promoting Innovation in E-Recuiting

    NARCIS (Netherlands)

    Furtmueller-Ettinger, Elfriede; Wilderom, Celeste P.M.; van Dick, Rolf; Bondarouk, Tatiana; Ruel, Hubertus Johannes Maria; Guiderdoni-Jourdain, Karine; Oiry, Ewan

    2009-01-01

    In order to maintain their customer base, many e-recruiting firms are in need of developing innovations. The Lead User (LU) Method has been heralded in the new product innovation literature but not yet applied often in e-service settings. Based on an e-recruiting portal, the authors compare new

  9. Type of aphasia and regional cerebral blood flow. A study with /sup 133/Xe inhalation method

    Energy Technology Data Exchange (ETDEWEB)

    Tagawa, Koichi; Sugimoto, Keiko; Minematsu, Kazuo; Yamaguchi, Takenori; Naritomi, Hiroaki; Sawada, Tohru (National Cardiovascular Center, Suita, Osaka (Japan))

    1982-11-01

    In 40 patients with aphasia due to cerebral infarction, regional cerebral blood flow (rCBF) was measured after 2 months of ictus with /sup 133/Xe inhalation method. There were 18 cases with motor aphasia and 22 with sensory aphasia. On the measurements of rCBF, 3 detectors were placed over frontal region (group F), 3 over temporal region (group T), and remaining 3 over parietal region (group P), of the dominant hemisphere. The flow values were compared with the rCBF values obtained from 21 control subjects who had no abnormality in CT scan and on neurological examinations. The control subjects revealed the hyperfrontal pattern of flow distribution; rCBF values in groups F, T and P, which were expressed as an initial slope index, were 50.0 +- 4.8, 48.0 +- 5.1 and 47.4 +- 4.5, respectively. The hyperfrontal pattern was absent in cases with motor aphasia. In this group, rCBF in groups F, T and P were 42.0 +- 8.3, 44.7 +- 8.4 and 41.0 +- 8.5, respectively, and rCBF in frontal region was significantly reduced compared with that in the control group. In sensory aphasia, rCBF values in groups F, T and P were all significantly reduced compared to the controls showing 44.0 +- 5.7, 42.8 +- 5.1 and 40.6 +- 5.4, respectively. In this group, the hyperfrontal pattern was maintained at a low flow level. When absolute rCBF values were compared between motor and sensory aphasia, there was no significant difference between these 2 groups. However, regional flow distribution in motor aphasia was significantly different from that of sensory aphasia, and the cases having the lowest value in group F were more frequently found in the former than in the latter.

  10. Temporal transcription of the lactococcal temperate phage TP901-1 and DNA sequence of the early promoter region

    DEFF Research Database (Denmark)

    Madsen, Hans Peter Lynge; Hammer, Karin

    1998-01-01

    to a phage repressor, a single-stranded DNA-binding protein, a topoisomerase, a Cro-like protein and two other phage proteins of unknown function were detected. The gene arrangement in the early transcribed region of TP901-1 thus consists of two transcriptional units: one from PR containing four genes......, of which at least two (the integrase gene and putative repressor) are needed for lysogeny, and the divergent and longer transcriptional unit from PL, presumably encoding functions required for the lytic life cycle. ORFs with homology to proteins involved in DNA replication were identified on the latter......Transcriptional analysis by Northern blotting identified clusters of early, middle and late transcribed regions of the temperate lactococcal bacteriophage TP901-1 during one-step growth experiments. The latent period was found to be 65 min and the burst size 40 +/- 10. The eight early transcripts...

  11. Effect of price and in-store promotion on sales: a study of distinct regions in an emerging market

    OpenAIRE

    Sanchez, Juan Machado

    2016-01-01

    Increasing competition caused by globalization, high growth of some emerging markets and stagnation of developed economies motivate Consumer Packaged Goods (CPGs) manufacturers to drive their attention to emerging markets. These companies are expected to adapt their marketing activities to the particularities of these markets in order to succeed. In a country classified as emerging market, regions are not alike and some contrasts can be identified. In addition, divergences of marketing variab...

  12. Immediate-early gene region of human cytomegalovirus trans-activates the promoter of human immunodeficiency virus

    International Nuclear Information System (INIS)

    Davis, M.G.; Kenney, S.C.; Kamine, J.; Pagano, J.S.; Huang, E.S.

    1987-01-01

    Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection

  13. Transient Stability Promotion by FACTS Controller Based on Adaptive Inertia Weight Particle Swarm Optimization Method

    Directory of Open Access Journals (Sweden)

    Ghazanfar Shahgholian

    2018-01-01

    Full Text Available This paper examines the influence of Static Synchronous Series Compensator (SSSC on the oscillation damping control in the network. The performance of Flexible AC Transmission System (FACTS controller highly depends upon its parameters and appropriate location in the network. A new Adaptive Inertia Weight Particle Swarm Optimization (AIWPSO method is employed to design the parameters of the SSSC-base controller. In the proposed controller, the proper signal of the power system such as rotor angle is used as the feedback. AIWPSO technique has high flexibility and balanced mechanism for the local and global research. The proposed controller is compared with a Genetic Algorithm (GA based controller that confirms the operation of the controller. To show the integrity of the proposed controller method, the achievement of the simulations is done out in a single-machine infinite-bus and multi-machine grid under multi turmoil.

  14. [Application of extended exergy method in driving mechanism and efficiency of regional eco-economy].

    Science.gov (United States)

    Fan, Xin Gang; Mi, Wen Bao; Hou, Jing Wei

    2017-01-01

    To analyze social-economic causes of the regional ecological degradation, and avoid such problems as the complex circulation network and difficulty to identify laws caused by extended exergy analysis (EEA) previously applied at the national scale, this paper reduced spatial scale to the county scale and took Pengyang County in Ningxia as an example. Eco-economic system in Peng-yang County was divided into seven interrelated sectors. The exergy value of circulations in the eco-economic system including materials, labor and capital were calculated respectively to analyze the extended exergy characteristics of the driving sectors, factors and paths and evaluate their ecological efficiency. The results showed that agriculture and households were the main driving sectors of the eco-economic system in Pengyang County. The average exergy value of 31 flow paths among the sectors was 0.80 PJ. There were only 8 flow paths whose exergy values were higher than the average value. Eco-economic system in Pengyang County development was driven by two continuous flow paths, labor output of the households sector and demands of the households sector supported by other sectors. The mineral resources were massively exploited, and then directly exported to the outside, which could not promote the local development from the inside, but, on the contrary, increase the ecological environment pressure because of the over-exploitation. The eco-efficiency of Pengyang County in 2014 was 68.1%, almost equivalent to the by-level of the national scale at home and abroad ten years ago, mainly because of the lower eco-efficiencies of the service sector and households sector. EEA had the advantage of networking and structuring, could specify the sectors, factors and driven paths, and break through the bottleneck of driving mechanism research of the eco-economic system. EEA had certain adaptability to explore the operational principle and optimal pattern of the regional eco-economic system. Compared

  15. A method for discrimination of noise and EMG signal regions recorded during rhythmic behaviors.

    Science.gov (United States)

    Ying, Rex; Wall, Christine E

    2016-12-08

    Analyses of muscular activity during rhythmic behaviors provide critical data for biomechanical studies. Electrical potentials measured from muscles using electromyography (EMG) require discrimination of noise regions as the first step in analysis. An experienced analyst can accurately identify the onset and offset of EMG but this process takes hours to analyze a short (10-15s) record of rhythmic EMG bursts. Existing computational techniques reduce this time but have limitations. These include a universal threshold for delimiting noise regions (i.e., a single signal value for identifying the EMG signal onset and offset), pre-processing using wide time intervals that dampen sensitivity for EMG signal characteristics, poor performance when a low frequency component (e.g., DC offset) is present, and high computational complexity leading to lack of time efficiency. We present a new statistical method and MATLAB script (EMG-Extractor) that includes an adaptive algorithm to discriminate noise regions from EMG that avoids these limitations and allows for multi-channel datasets to be processed. We evaluate the EMG-Extractor with EMG data on mammalian jaw-adductor muscles during mastication, a rhythmic behavior typified by low amplitude onsets/offsets and complex signal pattern. The EMG-Extractor consistently and accurately distinguishes noise from EMG in a manner similar to that of an experienced analyst. It outputs the raw EMG signal region in a form ready for further analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Increasing the utility of regional water table maps: a new method for estimating groundwater recharge

    Science.gov (United States)

    Gilmore, T. E.; Zlotnik, V. A.; Johnson, M.

    2017-12-01

    Groundwater table elevations are one of the most fundamental measurements used to characterize unconfined aquifers, groundwater flow patterns, and aquifer sustainability over time. In this study, we developed an analytical model that relies on analysis of groundwater elevation contour (equipotential) shape, aquifer transmissivity, and streambed gradient between two parallel, perennial streams. Using two existing regional water table maps, created at different times using different methods, our analysis of groundwater elevation contours, transmissivity and streambed gradient produced groundwater recharge rates (42-218 mm yr-1) that were consistent with previous independent recharge estimates from different methods. The three regions we investigated overly the High Plains Aquifer in Nebraska and included some areas where groundwater is used for irrigation. The three regions ranged from 1,500 to 3,300 km2, with either Sand Hills surficial geology, or Sand Hills transitioning to loess. Based on our results, the approach may be used to increase the value of existing water table maps, and may be useful as a diagnostic tool to evaluate the quality of groundwater table maps, identify areas in need of detailed aquifer characterization and expansion of groundwater monitoring networks, and/or as a first approximation before investing in more complex approaches to groundwater recharge estimation.

  17. Measurement of circumsolar ratio in high dust loading regions using a photographic method

    Science.gov (United States)

    Al-Ansary, Hany; Shafiq, Talha; Rizvi, Arslan; El-Leathy, Abdelrahman

    2017-06-01

    Performance of concentrating solar power (CSP) plants is highly affected by direct normal irradiance (DNI). However, it is also important to consider circumsolar radiation in any simulation of a CSP plant, especially in desert regions where dust loading in the atmosphere is expected. There are a number of methods to measure circumsolar radiation. However, most of them require expensive instrumentation. This work introduces a simple method to estimate circumsolar radiation. It involves taking high-resolution photographs of the sun and processing them using a computer code that identifies the sun's disk. The code then uses pixel intensities to obtain the solar intensity distribution across the sun's disk and in the aureole region. The solar intensity distribution is then used to obtain the circumsolar ratio (CSR) which represents the shape of the sun. To test this method, numerous photos of the sun were taken during the month of April and September 2016 at King Saud University in Riyadh, Saudi Arabia. Riyadh is a region that is well known for high dust-loading, especially during the summer. Two days of different atmospheric conditions were selected in September for comparative analysis. Results show that this method produces repeatable results, and that the CSR can increase significantly due to high dust loading and passing clouds. The CSR is found to be a strong function of DNI, ranging from about 4.5% at DNI values above 800 W/m2 and increasing to as much as 8.5% when DNI drops to about 400 W/m2, due to passing clouds. Furthermore, the results show that circumsolar ratio tends to be high in the early morning and late afternoon due to the high air mass, while its values tend to be lowest around solar noon when the air mass is lowest.

  18. An Evaluation of Two Hydrograph Separation Methods of Potential Use in Regional Water Quality Assessment

    Energy Technology Data Exchange (ETDEWEB)

    Huff, D.D.

    1999-01-01

    Streamflow data are more useful for evaluating hydrologic model results and studying water quality once baseflow and storm runoff have been separated. However, it is important to select an appropriate hydrograph separation method. They examined tow methods and evaluated their conceptual basis, ease of application, cost of data processing, and acceptability of results. they chose the quick flow hydrograph separation method, which is in use at the Coweeta Hydrologic Laboratory, because it gives acceptable results and is easy and inexpensive to use. For regional assessment, they anticipate that the Coweeta program will be useful as an aid in developing general quantitative relationships between changes in land use and the associated changes in surface runoff yield and water quality degradation.

  19. The Linearized Bregman Method for Frugal Full-waveform Inversion with Compressive Sensing and Sparsity-promoting

    Science.gov (United States)

    Chai, Xintao; Tang, Genyang; Peng, Ronghua; Liu, Shaoyong

    2018-03-01

    Full-waveform inversion (FWI) reconstructs the subsurface properties from acquired seismic data via minimization of the misfit between observed and simulated data. However, FWI suffers from considerable computational costs resulting from the numerical solution of the wave equation for each source at each iteration. To reduce the computational burden, constructing supershots by combining several sources (aka source encoding) allows mitigation of the number of simulations at each iteration, but it gives rise to crosstalk artifacts because of interference between the individual sources of the supershot. A modified Gauss-Newton FWI (MGNFWI) approach showed that as long as the difference between the initial and true models permits a sparse representation, the ℓ _1-norm constrained model updates suppress subsampling-related artifacts. However, the spectral-projected gradient ℓ _1 (SPGℓ _1) algorithm employed by MGNFWI is rather complicated that makes its implementation difficult. To facilitate realistic applications, we adapt a linearized Bregman (LB) method to sparsity-promoting FWI (SPFWI) because of the efficiency and simplicity of LB in the framework of ℓ _1-norm constrained optimization problem and compressive sensing. Numerical experiments performed with the BP Salt model, the Marmousi model and the BG Compass model verify the following points. The FWI result with LB solving ℓ _1-norm sparsity-promoting problem for the model update outperforms that generated by solving ℓ _2-norm problem in terms of crosstalk elimination and high-fidelity results. The simpler LB method performs comparably and even superiorly to the complicated SPGℓ _1 method in terms of computational efficiency and model quality, making the LB method a viable alternative for realistic implementations of SPFWI.

  20. Method of decision tree applied in adopting the decision for promoting a company

    Directory of Open Access Journals (Sweden)

    Cezarina Adina TOFAN

    2015-09-01

    Full Text Available The decision can be defined as the way chosen from several possible to achieve an objective. An important role in the functioning of the decisional-informational system is held by the decision-making methods. Decision trees are proving to be very useful tools for taking financial decisions or regarding the numbers, where a large amount of complex information must be considered. They provide an effective structure in which alternative decisions and the implications of their choice can be assessed, and help to form a correct and balanced vision of the risks and rewards that may result from a certain choice. For these reasons, the content of this communication will review a series of decision-making criteria. Also, it will analyse the benefits of using the decision tree method in the decision-making process by providing a numerical example. On this basis, it can be concluded that the procedure may prove useful in making decisions for companies operating on markets where competition intensity is differentiated.

  1. Study on simulation methods of atrium building cooling load in hot and humid regions

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Yiqun; Li, Yuming; Huang, Zhizhong [Institute of Building Performance and Technology, Sino-German College of Applied Sciences, Tongji University, 1239 Siping Road, Shanghai 200092 (China); Wu, Gang [Weldtech Technology (Shanghai) Co. Ltd. (China)

    2010-10-15

    In recent years, highly glazed atria are popular because of their architectural aesthetics and advantage of introducing daylight into inside. However, cooling load estimation of such atrium buildings is difficult due to complex thermal phenomena that occur in the atrium space. The study aims to find out a simplified method of estimating cooling loads through simulations for various types of atria in hot and humid regions. Atrium buildings are divided into different types. For every type of atrium buildings, both CFD and energy models are developed. A standard method versus the simplified one is proposed to simulate cooling load of atria in EnergyPlus based on different room air temperature patterns as a result from CFD simulation. It incorporates CFD results as input into non-dimensional height room air models in EnergyPlus, and the simulation results are defined as a baseline model in order to compare with the results from the simplified method for every category of atrium buildings. In order to further validate the simplified method an actual atrium office building is tested on site in a typical summer day and measured results are compared with simulation results using the simplified methods. Finally, appropriate methods of simulating different types of atrium buildings are proposed. (author)

  2. GIS-Based Integration of Subjective and Objective Weighting Methods for Regional Landslides Susceptibility Mapping

    Directory of Open Access Journals (Sweden)

    Suhua Zhou

    2016-04-01

    Full Text Available The development of landslide susceptibility maps is of great importance due to rapid urbanization. The purpose of this study is to present a method to integrate the subjective weight with objective weight for regional landslide susceptibility mapping on the geographical information system (GIS platform. The analytical hierarchy process (AHP, which is subjective, was employed to weight predictive factors’ contribution to landslide occurrence. The frequency ratio (FR method, which is objective, was used to derive subclasses’ frequency ratio with respect to landslides that indicate the relative importance of a subclass within each predictive factor. A case study was carried out at Tsushima Island, Japan, using a historical inventory of 534 landslides and seven predictive factors: elevation, slope, aspect, terrain roughness index (TRI, lithology, land cover and mean annual precipitation (MAP. The landslide susceptibility index (LSI was calculated using the weighted linear combination of factors’ weights and subclasses’ weights. The study area was classified into five susceptibility zones according to the LSI. In addition, the produced susceptibility map was compared with maps generated using the conventional FR and AHP method and validated using the relative landslide index (RLI. The validation result showed that the proposed method performed better than the conventional application of the FR method and AHP method. The obtained landslide susceptibility maps could serve as a scientific basis for urban planning and landslide hazard management.

  3. A meta-analysis of the effects of the 5-hydroxytryptamine transporter gene-linked promoter region polymorphism on susceptibility to lifelong premature ejaculation.

    Directory of Open Access Journals (Sweden)

    Lijie Zhu

    Full Text Available OBJECTIVE: Premature ejaculation (PE has been reported as the most common male sexual dysfunction with global prevalence rates estimated at approximately 30%. The neurobiogenesis of ejaculation is very complex and involves the serotoninergic (5-hydroxytryptamine, 5-HT system. Recently, genetic polymorphisms located on SLC6A4 gene codifying for 5-HT transporter (5-HTT, the major regulator of serotonic neurotransmission, have been linked with the pathogenesis and risk of PE. Apparently studies of this type of polymorphism in PE have show conflicting results. METHODS: A meta-analysis was performed that are available in relation with 5-HTT gene-linked promoter region (5-HTTLPR polymorphism and the risk of lifelong PE (LPE in men to clarify this relationship. We searched Pubmed and Embase (last search updated on Aug 2012 using 'premature ejaculation', 'polymorphism or variant', 'genotype', 'ejaculatory function', and 'rapid ejaculation' as keywords and reference lists of studies corresponded to the inclusion criteria for meta-analysis. These studies involved the total number of 481 LPE men and 466 health control men subjects. Odds ratio (OR and 95% confidence intervals (CIs were used to evaluate this relationship. RESULTS: In the overall analysis, significant associations between LPE risk and 5-HTTLPR polymorphism were found (L-allele vs. S-allele OR = 0.86, 95% CI = 0.79-0.95, P = 0.002; LL vs. SS: OR = 0.80, 95% CI = 0.68-0.95, P = 0.009; LS vs. SS: OR = 0.85, 95% CI = 0.76-0.97, P = 0.012 and LL+LS vs. SS: OR = 0.88, 95% CI = 0.81-0.95, P = 0.002. Moreover, in subgroup analysis based on ethnicity, similar significant associations were detected. The Egger's test did not reveal presence of a publication bias. CONCLUSIONS: Our investigations demonstrate that 5-HTTLPR (L>S polymorphism might protect men against LPE risk. Further studies based on larger sample size and gene-environment interactions should

  4. Regional-Scale Differential Time Tomography Methods: Development and Application to the Sichuan, China, Dataset

    Science.gov (United States)

    Zhang, H.; Thurber, C.; Wang, W.; Roecker, S. W.

    2008-12-01

    We extended our recent development of double-difference seismic tomography [Zhang and Thurber, BSSA, 2003] to the use of station-pair residual differences in addition to event-pair residual differences. Tomography using station- pair residual differences is somewhat akin to teleseismic tomography but with the sources contained within the model region. Synthetic tests show that the inversion using both event- and station-pair residual differences has advantages in terms of more accurately recovering higher-resolution structure in both the source and receiver regions. We used the Spherical-Earth Finite-Difference (SEFD) travel time calculation method in the tomographic system. The basic concept is the extension of a standard Cartesian FD travel time algorithm [Vidale, 1990] to the spherical case by developing a mesh in radius, co-latitude, and longitude, expressing the FD derivatives in a form appropriate to the spherical mesh, and constructing"stencil" to calculate extrapolated travel times. The SEFD travel time calculation method is more advantageous in dealing with heterogeneity and sphericity of the Earth than the simple Earth flattening transformation and the"sphere-in-a-bo" approach [Flanagan et al., 2007]. We applied this method to the Sichuan, China data set for the period of 2001 to 2004. The Vp, Vs and Vp/Vs models show that there is a clear contrast across the Longmenshan Fault, where the 2008 M8 Wenchuan earthquake initiated.

  5. Workshop to promote the ratification of the protocol on heavy metals across the entire UN ECE region

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2009-12-15

    Within the workshop of the German Federal Environment Agency (Dessau-Rosslau, Federal Republic of Germany) at 14th to 16th May, 2008 in Yerevan (Armenia), the following lectures were held: (1) The convention and its protocols - framework and requirements (Tea Aulavuo); (2) Development of the heavy metals protocol up to now (D. Jost); (3) Experiences in transposing the obligations of the HM protocol into national law (Ivan Angelov); (4) Evaluation of concentrations of air pollutants and depositions of HM over the EECCA region (Ilia Ilyin); (5) The effectiveness of the HM protocol - emission reductions and costs (TNO-study) (M. van het Bolscher); (6) Technologies and techniques and their emission reduction potential and costs (Andre Peeters Weem); (7) Synergies of reduction of HM and particulate matter (Katja Kraus); (8) Critical loads / critical levels and effects of HM - integrated assessment (Jean-Paul Hettelingh); (9) Additional technical measures / options and their reduction potential (M. van het Bolscher); (10) Overview of the situation in the EECCA region - evaluation of a questionnaire of the Secretariat of the LRTAP Convention and ideas on revising the protocol and its annexes (Johan Sliggers); (11) Future aims of the TF (Katja Kraus).

  6. How guiding coalitions promote positive culture change in hospitals: a longitudinal mixed methods interventional study.

    Science.gov (United States)

    Bradley, Elizabeth H; Brewster, Amanda L; McNatt, Zahirah; Linnander, Erika L; Cherlin, Emily; Fosburgh, Heather; Ting, Henry H; Curry, Leslie A

    2018-03-01

    Quality collaboratives are widely endorsed as a potentially effective method for translating and spreading best practices for acute myocardial infarction (AMI) care. Nevertheless, hospital success in improving performance through participation in collaboratives varies markedly. We sought to understand what distinguished hospitals that succeeded in shifting culture and reducing 30-day risk-standardised mortality rate (RSMR) after AMI through their participation in the Leadership Saves Lives (LSL) collaborative. We conducted a longitudinal, mixed methods intervention study of 10 hospitals over a 2-year period; data included surveys of 223 individuals (response rates 83%-94% depending on wave) and 393 in-depth interviews with clinical and management staff most engaged with the LSL intervention in the 10 hospitals. We measured change in culture and RSMR, and key aspects of working related to team membership, turnover, level of participation and approaches to conflict management. The six hospitals that experienced substantial culture change and greater reductions in RSMR demonstrated distinctions in: (1) effective inclusion of staff from different disciplines and levels in the organisational hierarchy in the team guiding improvement efforts (referred to as the 'guiding coalition' in each hospital); (2) authentic participation in the work of the guiding coalition; and (3) distinct patterns of managing conflict. Guiding coalition size and turnover were not associated with success (p values>0.05). In the six hospitals that experienced substantial positive culture change, staff indicated that the LSL learnings were already being applied to other improvement efforts. Hospitals that were most successful in a national quality collaborative to shift hospital culture and reduce RSMR showed distinct patterns in membership diversity, authentic participation and capacity for conflict management. © Article author(s) (or their employer(s) unless otherwise stated in the text of the

  7. "Every method seems to have its problems"- Perspectives on side effects of hormonal contraceptives in Morogoro Region, Tanzania.

    Science.gov (United States)

    Chebet, Joy J; McMahon, Shannon A; Greenspan, Jesse A; Mosha, Idda H; Callaghan-Koru, Jennifer A; Killewo, Japhet; Baqui, Abdullah H; Winch, Peter J

    2015-11-03

    Family planning has been shown to be an effective intervention for promoting maternal, newborn and child health. Despite family planning's multiple benefits, women's experiences of - or concerns related to - side effects present a formidable barrier to the sustained use of contraceptives, particularly in the postpartum period. This paper presents perspectives of postpartum, rural, Tanzanian women, their partners, public opinion leaders and community and health facility providers related to side effects associated with contraceptive use. Qualitative interviews were conducted with postpartum women (n = 34), their partners (n = 23), community leaders (n = 12) and health providers based in both facilities (n = 12) and communities (n = 19) across Morogoro Region, Tanzania. Following data collection, digitally recorded data were transcribed, translated and coded using thematic analysis. Respondents described family planning positively due to the health and economic benefits associated with limiting and spacing births. However, side effects were consistently cited as a reason that women and their partners choose to forgo family planning altogether, discontinue methods, switch methods or use methods in an intermittent (and ineffective) manner. Respondents detailed side effects including excessive menstrual bleeding, missed menses, weight gain and fatigue. Women, their partners and community leaders also described concerns that contraceptives could induce sterility in women, or harm breastfeeding children via contamination of breast milk. Use of family planning during the postpartum period was viewed as particularly detrimental to a newborn's health in the first months of life. To meet Tanzania's national target of increasing contraceptive use from 34 to 60 % by 2015, appropriate counseling and dialogue on contraceptive side effects that speaks to pressing concerns outlined by women, their partners, communities and service providers are needed.

  8. Full Seismic Waveform Tomography of the Japan region using Adjoint Methods

    Science.gov (United States)

    Steptoe, Hamish; Fichtner, Andreas; Rickers, Florian; Trampert, Jeannot

    2013-04-01

    We present a full-waveform tomographic model of the Japan region based on spectral-element wave propagation, adjoint techniques and seismic data from dense station networks. This model is intended to further our understanding of both the complex regional tectonics and the finite rupture processes of large earthquakes. The shallow Earth structure of the Japan region has been the subject of considerable tomographic investigation. The islands of Japan exist in an area of significant plate complexity: subduction related to the Pacific and Philippine Sea plates is responsible for the majority of seismicity and volcanism of Japan, whilst smaller micro-plates in the region, including the Okhotsk, and Okinawa and Amur, part of the larger North America and Eurasia plates respectively, contribute significant local intricacy. In response to the need to monitor and understand the motion of these plates and their associated faults, numerous seismograph networks have been established, including the 768 station high-sensitivity Hi-net network, 84 station broadband F-net and the strong-motion seismograph networks K-net and KiK-net in Japan. We also include the 55 station BATS network of Taiwan. We use this exceptional coverage to construct a high-resolution model of the Japan region from the full-waveform inversion of over 15,000 individual component seismograms from 53 events that occurred between 1997 and 2012. We model these data using spectral-element simulations of seismic wave propagation at a regional scale over an area from 120°-150°E and 20°-50°N to a depth of around 500 km. We quantify differences between observed and synthetic waveforms using time-frequency misfits allowing us to separate both phase and amplitude measurements whilst exploiting the complete waveform at periods of 15-60 seconds. Fréchet kernels for these misfits are calculated via the adjoint method and subsequently used in an iterative non-linear conjugate-gradient optimization. Finally, we employ

  9. Risk Reduction Methods for Managing the Development of Regional Electric Power Industry

    Directory of Open Access Journals (Sweden)

    Mikhail Kozhevnikov

    2017-11-01

    Full Text Available The development of the regional electric power industry has come to the forefront due to the changing scale, quality, and configuration of electric power infrastructure, and the spread of distributed generation. This gives rise to more stringent requirements regarding the reliability, safety, and environmental impact of electric power supply. This article aims to justify a package of methods that make it possible to identify and minimize investment, production, financial, and environmental risks in order to ensure sustainable development of the regional electric power industry that performs anti-crisis functions, and of individual energy companies. The key method to be employed is integrated resource planning (IRP. As a part of the method, energy conservation, renewable energy sources, and combined heat and power production are considered as equally valid ways of meeting future demand. The authors have designed a methodology for taking into account uncertainty and risk when implementing IRP. The methodology includes analysis of scenarios and decision making processes by calculating past and projected values of profit indicators. When conducting the environmental and economic assessment of an investment project in the electric power industry, the authors suggest using an aggregate indicator of environmental and economic effectiveness that is calculated on the basis of a combination of locally significant positive and negative environmental and economic impacts of the project. The authors formulate conceptual provisions that serve as the foundation for a promising model of the regional electric power industry and which contain recommendations for managing the development of the industry while minimizing organizational, market, and technological risks.

  10. Computerized detection of multiple sclerosis candidate regions based on a level set method using an artificial neural network

    International Nuclear Information System (INIS)

    Kuwazuru, Junpei; Magome, Taiki; Arimura, Hidetaka; Yamashita, Yasuo; Oki, Masafumi; Toyofuku, Fukai; Kakeda, Shingo; Yamamoto, Daisuke

    2010-01-01

    Yamamoto et al. developed the system for computer-aided detection of multiple sclerosis (MS) candidate regions. In a level set method in their proposed method, they employed the constant threshold value for the edge indicator function related to a speed function of the level set method. However, it would be appropriate to adjust the threshold value to each MS candidate region, because the edge magnitudes in MS candidates differ from each other. Our purpose of this study was to develop a computerized detection of MS candidate regions in MR images based on a level set method using an artificial neural network (ANN). To adjust the threshold value for the edge indicator function in the level set method to each true positive (TP) and false positive (FP) region, we constructed the ANN. The ANN could provide the suitable threshold value for each candidate region in the proposed level set method so that TP regions can be segmented and FP regions can be removed. Our proposed method detected MS regions at a sensitivity of 82.1% with 0.204 FPs per slice and similarity index of MS candidate regions was 0.717 on average. (author)

  11. Effects of changes in Italian bioenergy promotion schemes for agricultural biogas projects: Insights from a regional optimization model

    International Nuclear Information System (INIS)

    Chinese, D.; Patrizio, P.; Nardin, G.

    2014-01-01

    Italy has witnessed an extraordinary growth in biogas generation from livestock effluents and agricultural activities in the last few years as well as a severe isomorphic process, leading to a market dominance of 999 kW power plants owned by “entrepreneurial farms”. Under the pressure of the economic crisis in the country, the Italian government has restructured renewable energy support schemes, introducing a new program in 2013. In this paper, the effects of the previous and current support schemes on the optimal plant size, feedstock mix and profitability were investigated by introducing a spatially explicit biogas supply chain optimization model, which accounts for different incentive structures. By applying the model to a regional case study, homogenization observed to date is recognized as a result of former incentive structures. Considerable reductions in local economic potentials for agricultural biogas power plants without external heat use, are estimated. New plants are likely to be manure-based and due to the lower energy density of such feedstock, wider supply chains are expected although optimal plant size will be smaller. The new support scheme will therefore most likely eliminate past distortions but also slow down investments in agricultural biogas plants. - Highlights: • We review the evolution of agricultural biogas support schemes in Italy over last 20 years. • A biogas supply chain optimization model which accounts for feed-in-tariffs is introduced. • The model is applied to a regional case study under the two most recent support schemes. • Incentives in force until 2013 caused homogenization towards maize based 999 kW el plants. • Wider, manure based supply chains feeding smaller plants are expected with future incentives

  12. Way of thinking and method of promotion of disposal of high level radioactive waste

    International Nuclear Information System (INIS)

    Toyota, Masatoshi

    1993-01-01

    It is decided that the high level waste separated from spent fuel is solidified with glass, stored for 30-50 years to cool it down, and the final disposal is done under the responsibility of the government. As to the final disposal of high level waste, the method of enclosing glass-solidified waste in robust containers and burying them in deep stable strata to isolate from human environment is considered to be the safest. The significance of fuel reprocessing is the proper and safe separation and control of high level waste besides the reuse of unburned uranium and newly formed plutonium in spent fuel. The features of the high level waste solids are that their amount to be generated is little, the radioactivity attenuates with the lapse of time, the heat generation decreases with the lapse of time, and they are hard to elute and move. In order to prevent radioactive substances from appearing in human environment by being dissolved in groundwater, those are isolated with the combination of natural and artificial barriers. The requirements for the barriers are discussed. The research and development are in progress on the establishment of stratum disposal technology, the evaluation of suitability of geological environment and the selection of expected disposal grounds. (K.I.)

  13. An Inquiry-Based Laboratory Module to Promote Understanding of the Scientific Method and Bacterial Conjugation

    Directory of Open Access Journals (Sweden)

    Melanie B. Berkmen

    2014-08-01

    Full Text Available Students are engaged and improve their critical thinking skills in laboratory courses when they have the opportunity to design and conduct inquiry-based experiments that generate novel results. A discovery-driven project for a microbiology, genetics, or multidisciplinary research laboratory course was developed to familiarize students with the scientific method. In this multi-lab module, students determine whether their chosen stress conditions induce conjugation and/or cell death of the model BSL-1 Gram-positive bacterium Bacillus subtilis. Through consultation of the primary literature, students identify conditions or chemicals that can elicit DNA damage, the SOS response, and/or cellular stress.  In groups, students discuss their selected conditions, develop their hypotheses and experimental plans, and formulate their positive and negative controls. Students then subject the B. subtilis donor cells to the stress conditions, mix donors with recipients to allow mating, and plate serial dilutions of the mixtures on selective plates to measure how the treatments affect conjugation frequency and donor cell viability.  Finally, students analyze and discuss their collective data in light of their controls. The goals of this module are to encourage students to be actively involved in the scientific process while contributing to our understanding of the conditions that stimulate horizontal gene transfer in bacteria.

  14. Concept mapping as an empowering method to promote learning, thinking, teaching and research

    Directory of Open Access Journals (Sweden)

    Mauri Kalervo Åhlberg

    2013-01-01

    Full Text Available Results and underpinning of over twenty years of research and development program of concept mapping is presented. Different graphical knowledge presentation tools, especially concept mapping and mind mapping, are compared. There are two main dimensions that differentiate graphical knowledge presentation methods: The first dimension is conceptual explicitness: from mere concepts to flexibly named links and clear propositions in concept maps. The second dimension in the classification system I am suggesting is whether there are pictures or not. Åhlbergʼs and his research groupʼs applications and developments of Novakian concept maps are compared to traditional Novakian concept maps. The main innovations include always using arrowheads to show direction of reading the concept map. Centrality of each concept is estimated from number of links to other concepts. In our empirical research over two decades, number of relevant concepts, and number of relevant propositions in studentsʼ concept maps, have been found to be the best indicators and predictors of meaningful learning. This is used in assessment of learning. Improved concept mapping is presented as a tool to analyze texts. The main innovation is numbering the links to show order of reading the concept map and to make it possible to transform concept map back to the original prose text as closely as possible. In Åhlberg and his research groupʼs research, concept mapping has been tested in all main phases of research, teaching and learning.

  15. C-terminal region of MAP7 domain containing protein 3 (MAP7D3 promotes microtubule polymerization by binding at the C-terminal tail of tubulin.

    Directory of Open Access Journals (Sweden)

    Saroj Yadav

    Full Text Available MAP7 domain containing protein 3 (MAP7D3, a newly identified microtubule associated protein, has been shown to promote microtubule assembly and stability. Its microtubule binding region has been reported to consist of two coiled coil motifs located at the N-terminus. It possesses a MAP7 domain near the C-terminus and belongs to the microtubule associated protein 7 (MAP7 family. The MAP7 domain of MAP7 protein has been shown to bind to kinesin-1; however, the role of MAP7 domain in MAP7D3 remains unknown. Based on the bioinformatics analysis of MAP7D3, we hypothesized that the MAP7 domain of MAP7D3 may have microtubule binding activity. Indeed, we found that MAP7 domain of MAP7D3 bound to microtubules as well as enhanced the assembly of microtubules in vitro. Interestingly, a longer fragment MDCT that contained the MAP7 domain (MD with the C-terminal tail (CT of the protein promoted microtubule polymerization to a greater extent than MD and CT individually. MDCT stabilized microtubules against dilution induced disassembly. MDCT bound to reconstituted microtubules with an apparent dissociation constant of 3.0 ± 0.5 µM. An immunostaining experiment showed that MDCT localized along the length of the preassembled microtubules. Competition experiments with tau indicated that MDCT shares its binding site on microtubules with tau. Further, we present evidence indicating that MDCT binds to the C-terminal tail of tubulin. In addition, MDCT could bind to tubulin in HeLa cell extract. Here, we report a microtubule binding region in the C-terminal region of MAP7D3 that may have a role in regulating microtubule assembly dynamics.

  16. Quality parameters and pattern recognition methods as a tool in tracing regional origin of multifloral honey

    Directory of Open Access Journals (Sweden)

    Lazarević Kristina B.

    2013-01-01

    Full Text Available The characterization of multifloral honey regarding the mineral composition, sugar content and basic physicochemical properties has been done. The total of 164 honey samples was collected from six regions of Serbia during 2009 harvesting season. Univariate data analysis (descriptive statistics and analysis of variance, geographic information system and pattern recognition methods (principal component analysis and cluster analysis have been performed in order to identify geographical origin of honey. The content of Mg, K, and Cu, electrical conductivity, and optical rotation were established as useful indicators in tracing regional differences between honey samples. Samples originated from Zlatibor region were clearly distinguished from those from the rest of Serbia showing higher K and Mg content, as well as higher values of optical rotation, electrical conductivity, and free acidity. The influence of the soil composition, and climate conditions, as well as the presence of particular flora on the honey composition is stressed out. The modeling of geographic origin of honey has been attempted by the means of linear discriminant analysis. [Projekat Ministarstva nauke Republike Srbije, br. 172017 and 451-03-2372-IP i FP7 RegPot project FCUB ERA GA No. 256716

  17. Surface temperature and evapotranspiration: application of local scale methods to regional scales using satellite data

    International Nuclear Information System (INIS)

    Seguin, B.; Courault, D.; Guerif, M.

    1994-01-01

    Remotely sensed surface temperatures have proven useful for monitoring evapotranspiration (ET) rates and crop water use because of their direct relationship with sensible and latent energy exchange processes. Procedures for using the thermal infrared (IR) obtained with hand-held radiometers deployed at ground level are now well established and even routine for many agricultural research and management purposes. The availability of IR from meteorological satellites at scales from 1 km (NOAA-AVHRR) to 5 km (METEOSAT) permits extension of local, ground-based approaches to larger scale crop monitoring programs. Regional observations of surface minus air temperature (i.e., the stress degree day) and remote estimates of daily ET were derived from satellite data over sites in France, the Sahel, and North Africa and summarized here. Results confirm that similar approaches can be applied at local and regional scales despite differences in pixel size and heterogeneity. This article analyzes methods for obtaining these data and outlines the potential utility of satellite data for operational use at the regional scale. (author)

  18. Calculating regional tissue volume for hyperthermic isolated limb perfusion: Four methods compared.

    Science.gov (United States)

    Cecchin, D; Negri, A; Frigo, A C; Bui, F; Zucchetta, P; Bodanza, V; Gregianin, M; Campana, L G; Rossi, C R; Rastrelli, M

    2016-12-01

    Hyperthermic isolated limb perfusion (HILP) can be performed as an alternative to amputation for soft tissue sarcomas and melanomas of the extremities. Melphalan and tumor necrosis factor-alpha are used at a dosage that depends on the volume of the limb. Regional tissue volume is traditionally measured for the purposes of HILP using water displacement volumetry (WDV). Although this technique is considered the gold standard, it is time-consuming and complicated to implement, especially in obese and elderly patients. The aim of the present study was to compare the different methods described in the literature for calculating regional tissue volume in the HILP setting, and to validate an open source software. We reviewed the charts of 22 patients (11 males and 11 females) who had non-disseminated melanoma with in-transit metastases or sarcoma of the lower limb. We calculated the volume of the limb using four different methods: WDV, tape measurements and segmentation of computed tomography images using Osirix and Oncentra Masterplan softwares. The overall comparison provided a concordance correlation coefficient (CCC) of 0.92 for the calculations of whole limb volume. In particular, when Osirix was compared with Oncentra (validated for volume measures and used in radiotherapy), the concordance was near-perfect for the calculation of the whole limb volume (CCC = 0.99). With methods based on CT the user can choose a reliable plane for segmentation purposes. CT-based methods also provides the opportunity to separate the whole limb volume into defined tissue volumes (cortical bone, fat and water). Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Detection of smaller Jc region and damage in YBCO coated conductors by using permanent magnet method

    International Nuclear Information System (INIS)

    Hattori, K.; Saito, A.; Takano, Y.; Suzuki, T.; Yamada, H.; Takayama, T.; Kamitani, A.; Ohshima, S.

    2011-01-01

    We developed a non-destructive method for measuring the critical current density (J c ) in YBCO-coated conductors by using a permanent magnet (Sm 2 Co 17 ). J c could be determined from the repulsive force (F r ) generated between a permanent magnet and a coated conductor where shielding current flows. We also examined the influence of damage to the film on the J c distribution. The measured F r when the permanent magnet approached the cut part was smaller than that of the undamaged area. We developed a non-destructive method for measuring the critical current density (J c ) in YBCO-coated conductors by using a permanent magnet (Sm 2 Co 17 ). J c could be determined from the repulsive force (F r ) generated between a permanent magnet and a coated conductor where shielding current flows. We tried to detect a smaller J c region in the coated conductor by using the system. The J c distribution could be determined without influence from the thick copper film on YBCO thin film. We also examined the influence of damage to the film on the J c distribution. The surface of the coated conductors was cut by using a knife. The measured F r when the permanent magnet approached the cut part was smaller than that of the undamaged area. This J c measurement technique will be useful for detecting smaller J c regions and defects in coated conductors.

  20. CAMSHIFT IMPROVEMENT WITH MEAN-SHIFT SEGMENTATION, REGION GROWING, AND SURF METHOD

    Directory of Open Access Journals (Sweden)

    Ferdinan Ferdinan

    2013-10-01

    Full Text Available CAMSHIFT algorithm has been widely used in object tracking. CAMSHIFT utilizescolor features as the model object. Thus, original CAMSHIFT may fail when the object color issimilar with the background color. In this study, we propose CAMSHIFT tracker combined withmean-shift segmentation, region growing, and SURF in order to improve the tracking accuracy.The mean-shift segmentation and region growing are applied in object localization phase to extractthe important parts of the object. Hue-distance, saturation, and value are used to calculate theBhattacharyya distance to judge whether the tracked object is lost. Once the object is judged lost,SURF is used to find the lost object, and CAMSHIFT can retrack the object. The Object trackingsystem is built with OpenCV. Some measurements of accuracy have done using frame-basedmetrics. We use datasets BoBoT (Bonn Benchmark on Tracking to measure accuracy of thesystem. The results demonstrate that CAMSHIFT combined with mean-shift segmentation, regiongrowing, and SURF method has higher accuracy than the previous methods.

  1. Calculation method of passive tracer using regional ocean modeling system (ROMS)

    International Nuclear Information System (INIS)

    Tubono, Takaki; Tsumune, Daisuke; Misumi, Kazuhiro; Yoshida, Yoshikatsu

    2010-01-01

    A dose assessments method for packages shipping radioactive materials was developed to calculate concentrations of radioactive materials discharged from the hypothetically sinking point using Regional Ocean Modeling System (ROMS). The programs of ROMS were improved for simultaneously calculating the flow fields around Japan and the concentrations discharged from several bottom points in the continental shelf. The model domain covered the northeast pacific region around Japan, 20degN-65degN, 120degE-165degE, with 1/10 degree horizontal resolution and 30 sigma-levels. The ROMS model captured main features such as Kuroshio currents, including the separation location and the Kuroshio extension, and Oyashio currents. The calculated volume transports through the main straits such as Tokara strait, Tsushima strait and Tsugaru strait were compared well to the measured or estimated that. The calculated concentrations discharged from 12 bottom points showed mixing associated with the eddies of ocean currents. This method is available to evaluate effectively the concentrations of radioactive materials only by setting the subsidence location and the concentrations and volume discharged. (author)

  2. Adapting health promotion interventions to meet the needs of ethnic minority groups: mixed-methods evidence synthesis.

    Science.gov (United States)

    Liu, Jj; Davidson, E; Bhopal, Rs; White, M; Johnson, Mrd; Netto, G; Deverill, M; Sheikh, A

    2012-01-01

    There is now a considerable body of evidence revealing that a number of ethnic minority groups in the UK and other economically developed countries experience disproportionate levels of morbidity and mortality compared with the majority white European-origin population. Across these countries, health-promoting approaches are increasingly viewed as the long-term strategies most likely to prove clinically effective and cost-effective for preventing disease and improving health outcomes in those with established disease. To identify, appraise and interpret research on the approaches employed to maximise the cross-cultural appropriateness and effectiveness of health promotion interventions for smoking cessation, increasing physical activity and improving healthy eating for African-, Chinese- and South Asian-origin populations. Two national conferences; seven databases of UK guidelines and international systematic reviews of health promotion interventions aimed at the general population, including the Clinical Evidence, National Institute for Health and Clinical Excellence and Scottish Intercollegiate Guidelines Network databases (1950-2009); 11 databases of research on adapted health promotion interventions for ethnic minority populations, including BIOSIS, EMBASE and MEDLINE (1950-2009); and in-depth qualitative interviews with a purposive sample of researchers and health promoters. Theoretically based, mixed-methods, phased programme of research that involved user engagement, systematic reviews and qualitative interviews, which were integrated through a realist synthesis. Following a launch conference, two reviewers independently identified and extracted data from guidelines and systematic reviews on the effectiveness of interventions for the general population and any guidance offered in relation to how to interpret this evidence for ethnic minority populations. Data were thematically analysed. Reviewers then independently identified and critically appraised studies

  3. The use of satellite data assimilation methods in regional NWP for solar irradiance forecasting

    Science.gov (United States)

    Kurzrock, Frederik; Cros, Sylvain; Chane-Ming, Fabrice; Potthast, Roland; Linguet, Laurent; Sébastien, Nicolas

    2016-04-01

    As an intermittent energy source, the injection of solar power into electricity grids requires irradiance forecasting in order to ensure grid stability. On time scales of more than six hours ahead, numerical weather prediction (NWP) is recognized as the most appropriate solution. However, the current representation of clouds in NWP models is not sufficiently precise for an accurate forecast of solar irradiance at ground level. Dynamical downscaling does not necessarily increase the quality of irradiance forecasts. Furthermore, incorrectly simulated cloud evolution is often the cause of inaccurate atmospheric analyses. In non-interconnected tropical areas, the large amplitudes of solar irradiance variability provide abundant solar yield but present significant problems for grid safety. Irradiance forecasting is particularly important for solar power stakeholders in these regions where PV electricity penetration is increasing. At the same time, NWP is markedly more challenging in tropic areas than in mid-latitudes due to the special characteristics of tropical homogeneous convective air masses. Numerous data assimilation methods and strategies have evolved and been applied to a large variety of global and regional NWP models in the recent decades. Assimilating data from geostationary meteorological satellites is an appropriate approach. Indeed, models converting radiances measured by satellites into cloud properties already exist. Moreover, data are available at high temporal frequencies, which enable a pertinent cloud cover evolution modelling for solar energy forecasts. In this work, we present a survey of different approaches which aim at improving cloud cover forecasts using the assimilation of geostationary meteorological satellite data into regional NWP models. Various approaches have been applied to a variety of models and satellites and in different regions of the world. Current methods focus on the assimilation of cloud-top information, derived from infrared

  4. Down-regulation of human topoisomerase IIα expression correlates with relative amounts of specificity factors Sp1 and Sp3 bound at proximal and distal promoter regions

    Directory of Open Access Journals (Sweden)

    Isaacs Richard J

    2007-05-01

    Full Text Available Abstract Background Topoisomerase IIα has been shown to be down-regulated in doxorubicin-resistant cell lines. The specificity proteins Sp1 and Sp3 have been implicated in regulation of topoisomerase IIα transcription, although the mechanism by which they regulate expression is not fully understood. Sp1 has been shown to bind specifically to both proximal and distal GC elements of the human topoisomerase IIα promoter in vitro, while Sp3 binds only to the distal GC element unless additional flanking sequences are included. While Sp1 is thought to be an activator of human topoisomerase IIα, the functional significance of Sp3 binding is not known. Therefore, we sought to determine the functional relationship between Sp1 and Sp3 binding to the topoisomerase IIα promoter in vivo. We investigated endogenous levels of Sp1, Sp3 and topoisomerase IIα as well as binding of both Sp1 and Sp3 to the GC boxes of the topoisomerase IIα promoter in breast cancer cell lines in vivo after short term doxorubicin exposure. Results Functional effects of Sp1 and Sp3 were studied using transient cotransfection assays using a topoisomerase IIα promoter reporter construct. The in vivo interactions of Sp1 and Sp3 with the GC elements of the topoisomerase IIα promoter were studied in doxorubicin-treated breast cancer cell lines using chromatin immunoprecipitation assays. Relative amounts of endogenous proteins were measured using immunoblotting. In vivo DNA looping mediated by proteins bound at the GC1 and GC2 elements was studied using the chromatin conformation capture assay. Both Sp1 and Sp3 bound to the GC1 and GC2 regions. Sp1 and Sp3 were transcriptional activators and repressors respectively, with Sp3 repression being dominant over Sp1-mediated activation. The GC1 and GC2 elements are linked in vivo to form a loop, thus bringing distal regulatory elements and their cognate transcription factors into close proximity with the transcription start site

  5. Working conditions and workplace health and safety promotion in home care: A mixed-method study from Swedish managers' perspectives.

    Science.gov (United States)

    Gard, Gunvor; Larsson, Agneta

    2017-11-02

    Today, we can see a trend toward increased psychosocial strain at work among home-care managers and staff. The aim of this study is to describe home care managers' views on their own psychosocial working conditions and on how to promote workplace health and safety in a municipality in northern Sweden. A mixed-methods design was used, including questionnaire and qualitative focus group data. The qualitative data were analyzed by manifest content analysis. The results indicate that most managers perceived increased variety in work and opportunities for development at work, but at the same time increased demands. The managers suggested that workplace health and safety could be improved by risk assessment and improved communication, a clear communication chain by a real as well as a virtual platform for communication. In summary, workplace health and safety could be improved by risk assessments and by a physical as well as a virtual platform for communication.

  6. The European Partnership for Alternative Approaches to Animal Testing (EPAA): promoting alternative methods in Europe and beyond.

    Science.gov (United States)

    Cozigou, Gwenole; Crozier, Jonathan; Hendriksen, Coenraad; Manou, Irene; Ramirez-Hernandez, Tzutzuy; Weissenhorn, Renate

    2015-03-01

    Here in we introduce the European Partnership for Alternative Approaches to Animal Testing (EPAA) and its activities, which are focused on international cooperation toward alternative methods. The EPAA is one of the leading organizations in Europe for the promotion of alternative approaches to animal testing. Its innovative public-private partnership structure enables a consensus-driven dialogue across 7 industry sectors to facilitate interaction between regulators and regulated stakeholders. Through a brief description of EPAA's activities and organizational structure, we first articulate the value of this collaboration; we then focus on 2 key projects driven by EPAA. The first project aims to address research gaps on stem cells for safety testing, whereas the second project strives for an approach toward demonstration of consistency in vaccine batch release testing. We highlight the growing need for harmonization of international acceptance and implementation of alternative approaches and for increased international collaboration to foster progress on nonanimal alternatives.

  7. Investigation Into the Humaneness of Slaughter Methods for Guinea Pigs (Cavia porcelus) in the Andean Region.

    Science.gov (United States)

    Limon, Georgina; Gonzales-Gustavson, Eloy A; Gibson, Troy J

    2016-01-01

    Guinea pigs (Cavia porcelus) are an important source of nonhuman animal protein in the Andean region of South America. Specific guidelines regarding the welfare of guinea pigs before and during slaughter have yet to be developed. This study critically assessed the humaneness of 4 different stunning/slaughter methods for guinea pigs: cervical neck dislocation (n = 60), electrical head-only stunning (n = 83), carbon dioxide (CO2) stunning (n = 21), and penetrating captive bolt (n = 10). Following cervical neck dislocation, 97% of guinea pigs had at least 1 behavioral or cranial/spinal response. Six percent of guinea pigs were classified as mis-stunned after electrical stunning, and 1% were classified as mis-stunned after captive bolt. Increased respiratory effort was observed during CO2 stunning. Apart from this finding, there were no other obvious behavioral responses that could be associated with suffering. Of the methods assessed, captive bolt was deemed the most humane, effective, and practical method of stunning guinea pigs. Cervical neck dislocation should not be recommended as a slaughter method for guinea pigs.

  8. A study on measurement of the regional cerebral blood flow using autoradiographic method in moyamoya disease

    International Nuclear Information System (INIS)

    Sasaki, Tomohiro; Kiya, Katsuzo; Yuki, Kiyoshi; Kawamoto, Hitoshi; Mizoue, Tatsuya; Kiura, Yoshihiro; Uozumi, Tohru; Ikawa, Fusao

    1997-01-01

    Development of Autoradiographic method (ARG) has provided measurement of cerebral blood flow in moyamoya disease. We evaluate a cerebral vasodilatory capacity (CVC) for moyamoya disease using ARG method. We used 5 patients with moyamoya disease as a candidate for measurement of the cerebral blood flow (CBF) who admitted to Hiroshima Prefectural Hospital during the past one year. There were 3 patients in an adult age and 2 patients in a young age. We tried to measure the regional CBF (rCBF) using ARG method which was a easy way to estimate the rCBF on SPECT. The CVC was calculated from the difference of the rCBF between resting SPECT and Diamox-loading SPECT. Results were as follows; Reactivity of cerebral vessels to CO 2 loading and CVC weakened in moyamoya disease. The rCBF and CVC in the territories of anterior and middle cerebral arteries reduced in comparison with those in the area supplied by the posterior cerebral artery. The CVC at the treated side with surgical reconstruction recovered somewhat in an adult type. From these results, measurement of CBF using ARG method seems to be useful for evaluation of the CVC in moyamoya disease. (author)

  9. Double-label autoradiographic deoxyglucose method for sequential measurement of regional cerebral glucose utilization

    Energy Technology Data Exchange (ETDEWEB)

    Redies, C; Diksic, M; Evans, A C; Gjedde, A; Yamamoto, Y L

    1987-08-01

    A new double-label autoradiographic glucose analog method for the sequential measurement of altered regional cerebral metabolic rates for glucose in the same animal is presented. This method is based on the sequential injection of two boluses of glucose tracer labeled with two different isotopes (short-lived /sup 18/F and long-lived /sup 3/H, respectively). An operational equation is derived which allows the determination of glucose utilization for the time period before the injection of the second tracer; this equation corrects for accumulation and loss of the first tracer from the metabolic pool occurring after the injection of the second tracer. An error analysis of this operational equation is performed. The double-label deoxyglucose method is validated in the primary somatosensory (''barrel'') cortex of the anesthetized rat. Two different rows of whiskers were stimulated sequentially in each rat; the two periods of stimulation were each preceded by an injection of glucose tracer. After decapitation, dried brain slices were first exposed, in direct contact, to standard X-ray film and then to uncoated, ''tritium-sensitive'' film. Results show that the double-label deoxyglucose method proposed in this paper allows the quantification and complete separation of glucose utilization patterns elicited by two different stimulations sequentially applied in the same animal.

  10. A speeded-up saliency region-based contrast detection method for small targets

    Science.gov (United States)

    Li, Zhengjie; Zhang, Haiying; Bai, Jiaojiao; Zhou, Zhongjun; Zheng, Huihuang

    2018-04-01

    To cope with the rapid development of the real applications for infrared small targets, the researchers have tried their best to pursue more robust detection methods. At present, the contrast measure-based method has become a promising research branch. Following the framework, in this paper, a speeded-up contrast measure scheme is proposed based on the saliency detection and density clustering. First, the saliency region is segmented by saliency detection method, and then, the Multi-scale contrast calculation is carried out on it instead of traversing the whole image. Second, the target with a certain "integrity" property in spatial is exploited to distinguish the target from the isolated noises by density clustering. Finally, the targets are detected by a self-adaptation threshold. Compared with time-consuming MPCM (Multiscale Patch Contrast Map), the time cost of the speeded-up version is within a few seconds. Additional, due to the use of "clustering segmentation", the false alarm caused by heavy noises can be restrained to a lower level. The experiments show that our method has a satisfied FASR (False alarm suppression ratio) and real-time performance compared with the state-of-art algorithms no matter in cloudy sky or sea-sky background.

  11. The OSMATER project: promotion of stone materials from the Verbano-Cusio-Ossola region (Italy) and the Canton Ticino (Switzerland).

    Science.gov (United States)

    Cavallo, Alessandro; Antonella Dino, Giovanna

    2013-04-01

    The OSMATER (sub-Alpine Observatory Materials Territory Restoration) project, funded by the Piedmont Region (Italy) and the European Community, involved four Italian scientific bodies (Polytechnic of Turin, University of Turin, University of Milan-Bicocca, University of Bologna) and Switzerland (SUPSI). The aim was to investigate the present and historical quarrying and processing activities in the cross-border area between the Ossola Valley (Italy) and the Canton Ticino (Switzerland), and the use of dimension stones in local and national architecture. These materials are in many ways a "unique case", for their abundance and lithological variety. In the past, their extraction, processing and application characterized in a decisive way the architectural and constructive culture, both in terms of prestigious architecture and civil buildings, establishing a relationship between "stones and culture", "territory and its resources". In recent years, many of these traditions are losing importance and interest: this results in a loss of knowledge and historical memory, due mainly to the drastic changes in the market. The loss of this knowledge is likely to become irreversible in the short term, with the disappearance of people and social groups depositary of tradition. We can deduce that the creation of an "observatory", like OSMATER, is desirable and essential indeed, if we want to preserve the historical memory of the stone industry of an entire production area. The OSMATER project aimed the knowledge, recovery and enhancement of the architectural and cultural heritage of the cross-border area, through the census and classification of rocks, quarries (both active and historical - since Roman age), monuments and construction techniques typical of the sub-Alpine region, in order to create a documentation centre through a dedicated website. The first phase of the project was devoted to the identification of architectural works built with stone materials, with particular

  12. Application of Adjoint Method and Spectral-Element Method to Tomographic Inversion of Regional Seismological Structure Beneath Japanese Islands

    Science.gov (United States)

    Tsuboi, S.; Miyoshi, T.; Obayashi, M.; Tono, Y.; Ando, K.

    2014-12-01

    Recent progress in large scale computing by using waveform modeling technique and high performance computing facility has demonstrated possibilities to perform full-waveform inversion of three dimensional (3D) seismological structure inside the Earth. We apply the adjoint method (Liu and Tromp, 2006) to obtain 3D structure beneath Japanese Islands. First we implemented Spectral-Element Method to K-computer in Kobe, Japan. We have optimized SPECFEM3D_GLOBE (Komatitsch and Tromp, 2002) by using OpenMP so that the code fits hybrid architecture of K-computer. Now we could use 82,134 nodes of K-computer (657,072 cores) to compute synthetic waveform with about 1 sec accuracy for realistic 3D Earth model and its performance was 1.2 PFLOPS. We use this optimized SPECFEM3D_GLOBE code and take one chunk around Japanese Islands from global mesh and compute synthetic seismograms with accuracy of about 10 second. We use GAP-P2 mantle tomography model (Obayashi et al., 2009) as an initial 3D model and use as many broadband seismic stations available in this region as possible to perform inversion. We then use the time windows for body waves and surface waves to compute adjoint sources and calculate adjoint kernels for seismic structure. We have performed several iteration and obtained improved 3D structure beneath Japanese Islands. The result demonstrates that waveform misfits between observed and theoretical seismograms improves as the iteration proceeds. We now prepare to use much shorter period in our synthetic waveform computation and try to obtain seismic structure for basin scale model, such as Kanto basin, where there are dense seismic network and high seismic activity. Acknowledgements: This research was partly supported by MEXT Strategic Program for Innovative Research. We used F-net seismograms of the National Research Institute for Earth Science and Disaster Prevention.

  13. Development of a method for a quantitative evaluation of region oriented policy

    NARCIS (Netherlands)

    Soest, van F.; Stein, A.; Dekkers, A.L.M.; Duijvenboden, van W.

    2001-01-01

    Modern environmental policy implementation in many developed countries is increasingly regionally oriented. Regional governments have undertaken measures designed for the specific needs of the region but, so far, the resulting change in environmental quality has hardly been monitored. This study

  14. Region of interest evaluation of SPECT image reconstruction methods using a realistic brain phantom

    International Nuclear Information System (INIS)

    Xia, Weishi; Glick, S.J.; Soares, E.J.

    1996-01-01

    A realistic numerical brain phantom, developed by Zubal et al, was used for a region-of-interest evaluation of the accuracy and noise variance of the following SPECT reconstruction methods: (1) Maximum-Likelihood reconstruction using the Expectation-Maximization (ML-EM) algorithm; (2) an EM algorithm using ordered-subsets (OS-EM); (3) a re-scaled block iterative EM algorithm (RBI-EM); and (4) a filtered backprojection algorithm that uses a combination of the Bellini method for attenuation compensation and an iterative spatial blurring correction method using the frequency-distance principle (FDP). The Zubal phantom was made from segmented MRI slices of the brain, so that neuro-anatomical structures are well defined and indexed. Small regions-of-interest (ROIs) from the white matter, grey matter in the center of the brain and grey matter from the peripheral area of the brain were selected for the evaluation. Photon attenuation and distance-dependent collimator blurring were modeled. Multiple independent noise realizations were generated for two different count levels. The simulation study showed that the ROI bias measured for the EM-based algorithms decreased as the iteration number increased, and that the OS-EM and RBI-EM algorithms (16 and 64 subsets were used) achieved the equivalent accuracy of the ML-EM algorithm at about the same noise variance, with much fewer number of iterations. The Bellini-FDP restoration algorithm converged fast and required less computation per iteration. The ML-EM algorithm had a slightly better ROI bias vs. variance trade-off than the other algorithms

  15. Engineering students' and faculty perceptions of teaching methods and the level of faculty involvement that promotes academic success

    Science.gov (United States)

    Karpilo, Lacy N.

    Student academic success is a top priority of higher education institutions in the United States and the trend of students leaving school prior to finishing their degree is a serious concern. Accountability has become a large part of university and college ratings and perceived success. Retention is one component of the accountability metrics used by accreditation agencies. In addition, there are an increasing number of states allocating funds based in part on retention (Seidman, 2005). Institutions have created initiatives, programs, and even entire departments to address issues related to student academic success to promote retention. Universities and colleges have responded by focusing on methods to retain and better serve students. Retention and student academic success is a primary concern for high education institutions; however, engineering education has unique retention issues. The National Science Board (2004) reports a significant decline in the number of individuals in the United States who are training to become engineers, despite the fact that the number of jobs that utilize an engineering background continues to increase. Engineering education has responded to academic success issues by changing curriculum and pedagogical methods (Sheppard, 2001). This descriptive study investigates the perception of engineering students and faculty regarding teaching methods and faculty involvement to create a picture of what is occurring in engineering education. The population was the engineering students and faculty of Colorado State University's College of Engineering. Data from this research suggests that engaging teaching methods are not being used as often as research indicates they should and that there is a lack of student-faculty interaction outside of the classroom. This research adds to the breadth of knowledge and understanding of the current environment of engineering education. Furthermore, the data allows engineering educators and other higher

  16. Eukaryotic elongation factor 1-beta interacts with the 5' untranslated region of the M gene of Nipah virus to promote mRNA translation.

    Science.gov (United States)

    Uchida, Shotaro; Sato, Hiroki; Yoneda, Misako; Kai, Chieko

    2016-09-01

    Nipah virus belongs to the genus Henipavirus in the family Paramyxoviridae, and its RNA genome is larger than those of other paramyxoviruses because it has long untranslated regions (UTRs) in each gene. However, the functions of these UTRs are not fully understood. In this study, we investigated the functions of the 5' UTRs and found that the 5' UTR of the M gene upregulated the translation of a reporter gene. Using an RNA pull-down assay, we showed that eukaryotic elongation factor 1-beta (EEF1B2) interacts with nucleotides 81-100 of the M 5' UTR and specifically enhances its translation efficiency. Our results suggest that the M 5' UTR promotes the production of M protein and viral budding by recruiting EEF1B2.

  17. Factor H binds to the hypervariable region of many Streptococcus pyogenes M proteins but does not promote phagocytosis resistance or acute virulence

    DEFF Research Database (Denmark)

    Gustafsson, Caj Ulrik Mattias; Lannergård, Jonas; Nilsson, Olof Rickard

    2013-01-01

    Many pathogens express a surface protein that binds the human complement regulator factor H (FH), as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against...... represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited...... to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed...

  18. Imperial Tax System and Regional Development in the Eighteenth Century. The Monopoly of Tobacco as a Means for Economic Promotion in Louisiana

    Directory of Open Access Journals (Sweden)

    Laura Náter

    2004-07-01

    Full Text Available This paper analyzes Spain's Eighteenth-century tobacco policies in Louisiana, where it created a fiscal institution for mainly political reasons, subordinating economical yields and revenues to the  region's political  and  strategic needs.  This  case contrasts with the management  and exploitation of the same institution in other  Spanish colonial  properties,  which  also held monopolies of different products, including tobacco.  This study  shows that the tobacco monopoly was during the Eighteenth-century one of the Real Hacienda's favorite fiscal instruments for increasing revenues with which to promote economic development in certain colonies. The author's main conclusions refer to the mechanisms  through which the Real Hacienda de la Nueva  España used tobacco revenues to strengthen the economy of Louisiana.

  19. A Specific Mutation in the Promoter Region of the Silent cel Cluster Accounts for the Appearance of Lactose-Utilizing Lactococcus lactis MG1363

    Science.gov (United States)

    Solopova, Ana; Bachmann, Herwig; Teusink, Bas; Kok, Jan; Neves, Ana Rute

    2012-01-01

    The Lactococcus lactis laboratory strain MG1363 has been described to be unable to utilize lactose. However, in a rich medium supplemented with lactose as the sole carbon source, it starts to grow after prolonged incubation periods. Transcriptome analyses showed that L. lactis MG1363 Lac+ cells expressed celB, encoding a putative cellobiose-specific phosphotransferase system (PTS) IIC component, which is normally silent in MG1363 Lac− cells. Nucleotide sequence analysis of the cel cluster of a Lac+ isolate revealed a change from one of the guanines to adenine in the promoter region. We showed here that one particular mutation, taking place at increased frequency, accounts for the lactose-utilizing phenotype occurring in MG1363 cultures. The G-to-A transition creates a −10 element at an optimal distance from the −35 element. Thus, a fully active promoter is created, allowing transcription of the otherwise cryptic cluster. Nuclear magnetic resonance (NMR) spectroscopy results show that MG1363 Lac+ uses a novel pathway of lactose utilization. PMID:22660716

  20. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  1. Clinical significance of SNP (rs2596542 in histocompatibility complex class I-related gene A promoter region among hepatitis C virus related hepatocellular carcinoma cases

    Directory of Open Access Journals (Sweden)

    Amal A. Mohamed

    2017-07-01

    Full Text Available The major histocompatibility complex class I-related gene A (MICA is an antigen induced by stress and performs an integral role in immune responses as an anti-infectious and antitumor agent. This work was designed to investigate whether (SNP rs2596542C/T in MICA promoter region is predictive of liver cirrhosis (LC and hepatocellular carcinoma (HCC or not. Forty-seven healthy controls and 94 HCV-infected patients, subdivided into 47 LC and 47 HCC subjects were enrolled in this study. SNP association was studied using real time PCR and soluble serum MICA concentration was measured using ELISA. Results showed that heterozygous genotype rs2596542CT was significantly (P = 0.022 distributed between HCC and LC related CHC patients. The sMICA was significantly higher (P = 0.0001 among HCC and LC. No significant association (P = 0.56 between rs2596542CT genotypes and sMICA levels was observed. Studying SNP rs2596542C/T association with HCC and LC susceptibility revealed that statistical significant differences (P = 0.013, P = 0.027 were only observed between SNP rs2596542C/T and each of HCC and LC, respectively, versus healthy controls, indicating that the rs2596542C/T genetic variation is not a significant contributor to HCC development in LC patients. Moreover, the T allele was considered a risk factor for HCC and LC vulnerability in HCV patients (OR = 1.93 and 2.1, respectively, while the C allele contributes to decreasing HCC risk. Therefore, SNP (rs2596542C/T in MICA promoter region and sMICA levels might be potential useful markers in the assessment of liver disease progression to LC and HCC.

  2. Radiation dozes reconstruction of Semipalatinsk region Beskaragai area's population by the method of biological measure

    International Nuclear Information System (INIS)

    Bigaliev, A.; Kundakbaeva, G.; Bigalieva, R.

    2001-01-01

    Full text: The study of radiation situation (on the position of May 1989) in Beskaragai area of Semipalatinsk region showed that the level of γ-radiation on it's territory reached 13-20 μR/hour, which was determined by the traces of long living radionuclides. In the inhabited regions of Dolon, Kanonerka, Buras, Ramadan villages the effect of deepening was noticed, α-particle's density level has reached maximum on the depth of approximately 10 cm, and further it decreases up to the 30 cm depth, This circumstance witnesses about the fact that we are talking about radioactive traces of many years ago happening with a time going to the depth from the upper coverage of soil. We've made the evaluation of radiation influence's genetic effects on the man's population. Cytogenetic analysis (with the use of G-method of chromosome's coloring) at whole in Beskaragai region shows that the frequency of aberrations for the cell among the inhabitants of the region is obviously higher 3.3 times at average in the region than among the population of the controlled area. During the study of the cytogenetic effects of increased radiation level's influence it is important first of all to determine the frequency of chromosome type aberrations - dicentric chromosomes, centric circles, acentric pair fragments. As it is known, the level of chromosome type aberrations is sufficiently well correlated with the doze, We have determined accumulative doze of radiation using the formula (D.C. Lloyd at all. 1992) for the calculation of dicentrics under the chronical influence of the small dozes of ionized radiation. According to the made calculations the oriented reconstruction of radiation dozes in Beskaragai region made 11 ber = 0.11 Sv, for the Dolon village - 14 ber, Kanonerka village - 13 ber, Buras village - 6 ber, Ramadan - 9.5 ber. Presented data allows to ask the question about the more spread use of cytogenetic method of research among the different population's categories living at

  3. Agroecology to Promote Just Sustainability Transitions: Analysis of a Civil Society Network in the Rwenzori Region, Western Uganda

    Directory of Open Access Journals (Sweden)

    Ellinor Isgren

    2017-08-01

    Full Text Available Agroecology is gaining ground within the debate on how to address systemic social and environmental problems in agriculture. However, it remains marginalized in agricultural research and development plans around the world. This paper analyzes agroecology as a socio-technical niche in Uganda, where its emergence in part can be seen as an unintended consequence of neoliberalist development. The case studied is a civil society network that links farmer groups and non-governmental organizations across different levels. Through the analytical lens of regime dimensions, we find that agroecology is practiced as a smallholder-centric approach that champions collective action, locally appropriate technologies, participatory methods in research and extension, and calls for more active state guidance of agricultural change along specific principles. However, two major concerns are raised; the niche converges with the dominant discourse around commercialization, and policy advocacy is hampered by the apolitical history of NGOs and an increasingly tense political climate. These two areas are critical for agroecology to contribute to just sustainability transitions, and civil society organizations with strong links to smallholder farmers need to be included in the growing scholarly debate both to inform it and to receive guidance from it. Transition frameworks can help facilitate the development of viable institutional designs and explicitly transformative strategies, but we also point towards the need for engagement with theories on civil society collective action and political mobilization.

  4. Method to acquire regions of fruit, branch and leaf from image of red apple in orchard

    Science.gov (United States)

    Lv, Jidong; Xu, Liming

    2017-07-01

    This work proposed a method to acquire regions of fruit, branch and leaf from red apple image in orchard. To acquire fruit image, R-G image was extracted from the RGB image for corrosive working, hole filling, subregion removal, expansive working and opening operation in order. Finally, fruit image was acquired by threshold segmentation. To acquire leaf image, fruit image was subtracted from RGB image before extracting 2G-R-B image. Then, leaf image was acquired by subregion removal and threshold segmentation. To acquire branch image, dynamic threshold segmentation was conducted in the R-G image. Then, the segmented image was added to fruit image to acquire adding fruit image which was subtracted from RGB image with leaf image. Finally, branch image was acquired by opening operation, subregion removal and threshold segmentation after extracting the R-G image from the subtracting image. Compared with previous methods, more complete image of fruit, leaf and branch can be acquired from red apple image with this method.

  5. Effectiveness of Different Urban Heat Island Mitigation Methods and Their Regional Impacts

    Science.gov (United States)

    Zhang, N.

    2017-12-01

    Cool roofs and green roofs are two popular methods to mitigate urban heat island and improve urban climate. The effectiveness of different urban heat island mitigation strategies in the summer of 2013 in the Yangtze River Delta, China is investigated using the WRF (Weather Research and Forecasting) model coupled with a physically based urban canopy model. The modifications to the roof surface changed the urban surface radiation balance and then modified the local surface energy budget. Both cool roofs and green roofs led to lower surface skin temperature and near-surface air temperature. Increasing the roof albedo to 0.5 caused a similar effectiveness as covering 25% of urban roofs with vegetation; increasing roof albedo to 0.7 caused a similar near-surface air temperature decrease as 75% green roof coverage. The near-surface relative humidity increased in both cool roof and green roof experiments because of the combination of the impacts of increases in specific humidity and decreases in air temperature. The regional impacts of cool roofs and green roofs were evaluated using the regional effect index. The regional effect could be found in both near-surface air temperature and surface specific/relative humidity when the percentage of roofs covered with high albedo materials or green roofs reached a higher fraction (greater than 50%). The changes in the vertical profiles of temperature cause a more stable atmospheric boundary layer over the urban area; at the same time, the crossover phenomena occurred above the boundary layer due to the decrease in vertical wind speed.

  6. Feasibility of Rainfed Viticulture in Marivan Rural Region Using SWOT Method, Sarkal County

    Directory of Open Access Journals (Sweden)

    Rehaneh soltani moqadas

    2016-02-01

    Full Text Available Abstract Due to being in mountainous regions, Sarkal County has not developed much either physically or agriculturally. However, its specific climatic conditions have provided an opportunity to establish rainfed vineyards. The aim of this study was to evaluate the potentials and capability of the region for establishing rainfed vineyards as well as identify the benefits of rainfed vineyards for future planning. For this purpose, a questionnaire was prepared and sent to 83 grape growers in 31 villages. In addition, associated managers were interviewed according to 343 Kookran formula. The current study offers solutions for developing rainfed vineyards, applying the measurement method, case studies, and also enumerating the pros and cons, and opportunities as well as threats based on SWOT. As the next step, the provided solutions were prioritized based on QSPM matrix. The results showed that the solutions for developing rainfed vineyards are kind of aggressive solutions. According to the internal factors assessment Matrix, the final score of 2.52 shows that establishing and developing rainfed vineyards based on internal factors in Sarkal County is highly possible. Moreover, the external factors assessment Matrix with a total score of 3.44 shows that in the present conditions, the development of rainfed vineyards in Sarkal County reinforces the opportunities. Finally, SO6 approach titled “constructing Agro-processing industries to save the vintage and cut down the damages” was selected and introduced using QSPM matrix, which reads.

  7. Methods and calculations for regional, continental, and global dose assessments from a hypothetical fuel reprocessing facility

    International Nuclear Information System (INIS)

    Schubert, J.F.; Kern, C.D.; Cooper, R.E.; Watts, J.R.

    1978-01-01

    The Savannah River Laboratory (SRL) is coordinating an interlaboratory effort to provide, test, and use state-of-the-art methods for calculating the environmental impact to an offsite population from the normal releases of radionuclides during the routine operation of a fuel-reprocessing plant. Results of this effort are the estimated doses to regional, continental, and global populations. Estimates are based upon operation of a hy