STUDY OF ACAROID MITES POLLUTION IN STORED FRUIT-DERIVED CHINESE MEDICINAL MATERIALS.

Science.gov (United States)

Xu, Li-fa; Li, He-xia; Xu, Peng-fei; Xu, Hai-feng; Li, Chao-pin

2015-08-01

to investigate the species and breeding density of acaroid mites in stored fruit-derived Chinese medicinal materials in Anhui province. samples of stored fruit-derived Chinese medicinal materials were collected from 30 herb stores and storehouses in 17 Anhui cities, where the breeding acaroids mites were detected. 20 species of acaroids mites were found in 33 samples, belonging to 15 genus, 5 families of the acaridae respectively, among which T. putrescentiae, A. farinae, C. lactis, and C. berlesei are predominant species. stored fruit-derived Chinese medicinal materials in Anhui areas suffer from serious acaroid mites pollution. Therefore, proactive measures should be taken to control acaroid mites from breeding in an effort to reduce the harm on medicinal materials. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

Search of new scintillation materials for nuclear medicine application

CERN Document Server

Korzhik, M

2001-01-01

Oxide crystals have a great potential to develop new advanced scintillation materials which are dense, fast, and bright. This combination of parameters, when combined to affordable price, gives a prospect for materials to be applied in nuclear medicine devices. Some of them have been developed for the last two decades along the line of rear-earth (RE) garnet (RE//3Al//5O//1//2) oxiorthosilicate (RE//2SiO//5) and perovskite (REAlO//3) crystals doped with Ce ions. Among recently developed oxide materials the lead tungstate scintillator (PWO) becomes the most used scintillation materials in high energy physics experiments due to its application in CMS and ALICE experiments at LHC. In this paper we discuss scintillation properties of some new heavy compounds doped with Ce as well as light yield improvement of PWO crystals to apply them in low energy physics and nuclear medicine. 18 Refs.

New applications of particle accelerators in medicine, materials science, and industry

International Nuclear Information System (INIS)

Knapp, E.A.

1981-01-01

Recently, the application of particle accelerators to medicine, materials science, and other industrial uses has increased dramatically. A random sampling of some of these new programs is discussed, primarily to give the scope of these new applications. The three areas, medicine, materials science or solid-state physics, and industrial applications, are chosen for their diversity and are representative of new accelerator applications for the future

Analysis of medicinal plant extracts by neutron activation method

International Nuclear Information System (INIS)

Vaz, Sandra Muntz

1995-01-01

This dissertation has presented the results from analysis of medicinal plant extracts using neutron activation method. Instrumental neutron activation analysis was applied to the determination of the elements Al, Br, Ca, Ce, Cl, Cr, Cs, Fe, K, La, Mg, Mn, Na, Rb, Sb, Sc and Zn in medicinal extracts obtained from Achyrolcline satureoides DC, Casearia sylvestris, Centella asiatica, Citrus aurantium L., Solano lycocarpum, Solidago microglossa, Stryphnondedron barbatiman and Zingiber officinale R. plants. The elements Hg and Se were determined using radiochemical separation by means of retention of Se in HMD inorganic exchanger and solvent extraction of Hg by bismuth diethyl-dithiocarbamate solution. Precision and accuracy of the results have been evaluated by analysing reference materials. The therapeutic action of some elements found in plant extracts analyzed was briefly discussed

Multiscale Inorganic Hierarchically Materials: Towards an Improved Orthopaedic Regenerative Medicine.

Science.gov (United States)

Ruso, Juan M; Sartuqui, Javier; Messina, Paula V

2015-01-01

Bone is a biologically and structurally sophisticated multifunctional tissue. It dynamically responds to biochemical, mechanical and electrical clues by remodelling itself and accordingly the maximum strength and toughness are along the lines of the greatest applied stress. The challenge is to develop an orthopaedic biomaterial that imitates the micro- and nano-structural elements and compositions of bone to locally match the properties of the host tissue resulting in a biologically fixed implant. Looking for the ideal implant, the convergence of life and materials sciences occurs. Researchers in many different fields apply their expertise to improve implantable devices and regenerative medicine. Materials of all kinds, but especially hierarchical nano-materials, are being exploited. The application of nano-materials with hierarchical design to calcified tissue reconstructive medicine involve intricate systems including scaffolds with multifaceted shapes that provides temporary mechanical function; materials with nano-topography modifications that guarantee their integration to tissues and that possesses functionalized surfaces to transport biologic factors to stimulate tissue growth in a controlled, safe, and rapid manner. Furthermore materials that should degrade on a timeline coordinated to the time that takes the tissues regrow, are prepared. These implantable devices are multifunctional and for its construction they involve the use of precise strategically techniques together with specific material manufacturing processes that can be integrated to achieve in the design, the required multifunctionality. For such reasons, even though the idea of displacement from synthetic implants and tissue grafts to regenerative-medicine-based tissue reconstruction has been guaranteed for well over a decade, the reality has yet to emerge. In this paper, we examine the recent approaches to create enhanced bioactive materials. Their design and manufacturing procedures as well

[Correlation research of photosynthetic characteristics and medicinal materials production with 4 Uncariae Cum Uncis].

Science.gov (United States)

Luo, Min; Song, Zhi-Qin; Yang, Ping-Fei; Liu, Hai; Yang, Zai-Gang; Wu, Ming-Kai

2017-01-01

Using four Uncariae Cum Uncis materials including Uncaria sinensis (HGT), U. hirsutea (MGT), Jianhe U. rhynchophylla (JHGT) and U. rhynchophylla(GT) as the research objects, the correlations between medicinal materials' yield and photosynthetic ecophysiology-factors in the plant exuberant growth period were studied. Results showed that the Uncaria plants net photosynthetic rate (Pn) changed by unimodal curve. There was not "midday depression" phenomenon. There was a different relationship among the photosynthetic ecophysiology-factors and between photosynthetic ecophysiology-factors and medicinal materials' yield. Pn,Tl,Gs had a significant correlation with medicinal materials' yield（M）and were the most important factors of growth. Copyright© by the Chinese Pharmaceutical Association.

Material science as basis for nuclear medicine: Holmium irradiation for radioisotopes production

Science.gov (United States)

Usman, Ahmed Rufai; Khandaker, Mayeen Uddin; Haba, Hiromitsu; Otuka, Naohiko

2018-05-01

Material Science, being an interdisciplinary field, plays important roles in nuclear science. These applications are seen in weaponry, armoured vehicles, accelerator structure and development, semiconductor detectors, nuclear medicine and many more. Present study presents the applications of some metals in nuclear medicine (radioisotope production). The charged-particle-induced nuclear reactions by using cyclotrons or accelerators have become a very vital feature of the modern nuclear medicine. Realising the importance of excitation functions for the efficient production of medical radionuclides, some very high purity holmium metals are generally prepared or purchased for bombardment in nuclear accelerators. In the present work, various methods to obtain pure holmium for radioisotope production have been discussed while also presenting details of our present studies. From the experimental work of the present studies, some very high purity holmium foils have been used in the work for a comprehensive study of residual radionuclides production cross-sections. The study was performed using a stacked-foil activation technique combined with γ-ray spectrometry. The stack was bombarded with 50.4 MeV alpha particle beam from AVF cyclotron of RI Beam Factory, Nishina Centre for Accelerator-Based Science, RIKEN, Japan. The work produced thulium radionuclides useful in nuclear medicine.

Readability of sports medicine-related patient education materials from the American Academy of Orthopaedic Surgeons and the American Orthopaedic Society for Sports Medicine.

Science.gov (United States)

Ganta, Abhishek; Yi, Paul H; Hussein, Khalil; Frank, Rachel M

2014-04-01

Although studies have revealed high readability levels of orthopedic patient education materials, no study has evaluated sports medicine-related patient education materials. We conducted a study to assess the readability of sports medicine-related patient education materials from the American Academy of Orthopaedic Surgeons (AAOS) and the American Orthopaedic Society for Sports Medicine (AOSSM). All sports medicine patient education articles available online in 2012 from the AAOS and the AOSSM, including the Stop Sports Injuries Campaign (STOP), were identified, and their readability was assessed with the Flesch-Kinkaid (FK) readability test. Mean overall FK grade level of the 170 articles reviewed (104 from AAOS, 36 from AOSSM, 30 from STOP) was 10.2. Mean FK levels for the 3 sources were 9.5 (AAOS), 11.0 (AOSSM), and 11.5 (STOP) (P = .16). Fifteen (8.8%) of the 170 articles had a readability level at or below eighth grade (average reading level of US adults); only 2 (1.2%) of the 170 articles were at or below the recommended sixth-grade level. The majority of sports medicine-related patient education materials from AAOS and AOSSM had reading levels higher than recommended, indicating that the majority of the patient population may find it difficult to comprehend these articles.

Current Perspective in the International Trade of Medicinal Plants Material: An Update.

Science.gov (United States)

Vasisht, Karan; Sharma, Neetika; Karan, Maninder

2016-01-01

The recent years have seen an increased interest in medicinal plants together with the therapeutic use of phytochemicals. Medicinal plants are utilized by the industry for the production of extracts, phytopharmaceuticals, nutraceuticals and cosmeceuticals and their use is expected to grow faster than the conventional drugs. The enormous demand of medicinal plant material has resulted in huge trade both at domestic and international levels. The trade data of medicinal plant material with commodity code HS 1211 (SITC.4, code 292.4) and their derived/related products which are traded under different commodity codes has been acquired from COMTRADE, Trade Map, country reports, technical documents etc for the period 2001 to 2014. The data was analyzed using statistical tools to draw conclusions. The significant features of the global trade; the leading source, consumer, import and export countries; and the striking trends are presented. The trade of the ten key countries and the selected important items is also discussed in detail. The conservative figure of trade of medicinal plants materials and their derived/related products including extracts, essential oils, phytopharmaceuticals, gums, spices used in medicine, tannins for pharmaceutical use, ingredients for cosmetics etc. as calculated from the global export data for the year 2014 is estimated at USD 33 billion. The average global export in medicinal plants under HS 1211 for the fourteen year period was USD 1.92 billion for 601,357 tons per annum and for the year 2014 it stood at 702,813 tons valued at USD 3.60 billion. For the studied period, an annual average growth rate (AAGR) of 2.4% in volumes and 9.2% in values of export was observed. Nearly 30% of the global trade is made up by top two countries of the import and export. China and India from Asia; Egypt and Morocco from Africa; Poland, Bulgaria and Albania from Europe; Chile and Peru from South America are important supply sources. The USA, Japan and Europe

Integrative methods for analyzing big data in precision medicine.

Science.gov (United States)

Gligorijević, Vladimir; Malod-Dognin, Noël; Pržulj, Nataša

2016-03-01

We provide an overview of recent developments in big data analyses in the context of precision medicine and health informatics. With the advance in technologies capturing molecular and medical data, we entered the area of "Big Data" in biology and medicine. These data offer many opportunities to advance precision medicine. We outline key challenges in precision medicine and present recent advances in data integration-based methods to uncover personalized information from big data produced by various omics studies. We survey recent integrative methods for disease subtyping, biomarkers discovery, and drug repurposing, and list the tools that are available to domain scientists. Given the ever-growing nature of these big data, we highlight key issues that big data integration methods will face. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Alternative methods for evaluation of non-uniformity in nuclear medicine images

International Nuclear Information System (INIS)

Rasaneh, S.; Rajabi, H.; Hajizadeh, E.

2005-01-01

Non-uniformity test is the most essential in daily quality control procedures of nuclear medicine equipment's. However, the calculation of non-uniformity is hindered due to high level of noise in nuclear medicine data. Non-uniformity may be considered as a type of systematic error while noise is certainly a random error. The present methods of uniformity evaluation are not able to distinguish between systematic and random error and therefore produce incorrect results when noise is significant. In the present study, two hypothetical methods have been tested for evaluation of non-uniformity in nuclear medicine images. Materials and Methods: Using the Monte Carlo method, uniform and non-uniform flood images of different matrix sizes and different counts were generated. The uniformity of the images was calculated using the conventional method and proposed methods. The results were compared with the known non-uniformity data of simulated images. Results: It was observed that the value of integral uniformity never went below the recommended values except in small matrix size of high counts (more than 80 millions counts). The differential uniformity was quite insensitive to the degree of non-uniformity in large matrix size. Matrix size of 64*64 was only found to be suitable for the calculation of differential uniformity. It was observed that in uniform images, a small amount of non-uniformity changes the p-value of Kolmogorov-Smirnov test and noise amplitude of fast fourier transformation test significantly while the conventional methods failed to detect the nonuniformity. Conclusion: The conventional methods do not distinguish noise, which is always present in the data and occasional non-uniformity at low count density. In a uniform intact flood image, the difference between maximum and minimum pixel count (the value of integral uniformity) is much more than the recommended values for non-uniformity. After filtration of image, this difference decreases, but remains high

Manual of use and accounting of radioactive material and procedures of radiological protection for nuclear medicine

International Nuclear Information System (INIS)

Chavez, Miguel

1997-03-01

This manual of use and accounting of material radioactive and procedures of radiological safety tries to facilitate workings of protection of material radioactive in services of medicine nuclear, during diagnosis (examinations with x-rays, or those that are made in nuclear medicine), or during the processing of diseases, mainly of the carcinomas (x-ray)

[Ideas and methods of two-dimensional zebrafish model combined with chromatographic techniques in high-throughput screening of active anti-osteoporosis components of traditional Chinese medicines].

Science.gov (United States)

Wei, Ying-Jie; Jing, Li-Jun; Zhan, Yang; Sun, E; Jia, Xiao-Bin

2014-05-01

To break through the restrictions of the evaluation model and the quantity of compounds by using the two-dimensional zebrafish model combined with chromatographic techniques, and establish a new method for the high-throughput screening of active anti-osteoporosis components. According to the research group-related studies and relevant foreign literatures, on the basis of the fact that the zebrafish osteoporosis model could efficiently evaluate the activity, the zebrafish metabolism model could efficiently enrich metabolites and the chromatographic techniques could efficiently separate and analyze components of traditional Chinese medicines, we proposed that the inherent combination of the three methods is expected to efficiently decode in vivo and in vitro efficacious anti-osteoporosis materials of traditional Chinese medicines. The method makes it simple and efficient in the enrichment, separation and analysis on components of traditional Chinese medicines, particularly micro-components and metabolites and the screening anti-osteoporosis activity, fully reflects that efficacious materials of traditional Chinese medicines contain original components and metabolites, with characteristic of "multi-components, multi-targets and integral effect", which provides new ideas and methods for the early and rapid discovery of active anti-osteoporosis components of traditional Chinese medicines.

Materials and methods for higher performance screen-printed flexible MRI receive coils.

Science.gov (United States)

Corea, Joseph R; Lechene, P Balthazar; Lustig, Michael; Arias, Ana C

2017-08-01

To develop methods for characterizing materials used in screen-printed MRI coils and improve signal-to-noise ratio (SNR) with new lower-loss materials. An experimental apparatus was created to characterize dielectric properties of plastic substrates used in receive coils. Coils were fabricated by screen printing conductive ink onto several plastic substrates. Unloaded and sample loaded quality factor (Q Unloaded /Q Loaded ) measurements and scans on a 3T scanner were used to characterize coil performance. An experimental method was developed to describe the relationship between a coil's Q Unloaded and the SNR it provides in images of a phantom. In addition, 3T scans of a phantom and the head of a volunteer were obtained with a proof-of-concept printed eight-channel array, and the results were compared with a commercial 12-channel array. Printed coils with optimized substrates exhibited up to 97% of the image SNR when compared with a traditional coil on a loading phantom. Q Unloaded and the SNR of coils were successfully correlated. The printed array resulted in images comparable to the quality given by the commercial array. Using the proposed methods and materials, the SNR of printed coils approached that of commercial coils while using a new fabrication technique that provided more flexibility and close contact with the patient's body. Magn Reson Med 78:775-783, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.

Sampling and sample preparation methods for the analysis of trace elements in biological material

International Nuclear Information System (INIS)

Sansoni, B.; Iyengar, V.

1978-05-01

The authors attempt to give a most systamtic possible treatment of the sample taking and sample preparation of biological material (particularly in human medicine) for trace analysis (e.g. neutron activation analysis, atomic absorption spectrometry). Contamination and loss problems are discussed as well as the manifold problems of the different consistency of solid and liquid biological materials, as well as the stabilization of the sample material. The process of dry and wet ashing is particularly dealt with, where new methods are also described. (RB) [de

[Sampling in quality control of medicinal materials-A case of Epimedium].

Science.gov (United States)

Wang, Chuanyi; Cao, Jinyi; Liang, Yun; Huang, Wenhua; Guo, Baolin

2009-04-01

To investigate the effect of the different individual number of sampling on the assay results of the medicinal materials. Epimedium pubescens and E. brevicornu were used as samples. The 6 sampling levels were formulated as 1 individual, 5, 10, 20, 30, 50 individuals mix, each level with 3 parallels and 1 individual level5 parallels. The contents of epimedin C and icariin, and the peak areas of epimedin A, epimedin B, rhamnosyl icarisid II and icarisid II in all samples were analyzed by HPLC. The variation degree varied with species and chemical constituents, but the RSD and the deviation from the true value decreased with the increase of individual number on the same chemical constituent. The sampling number should be more than 10 individuals in quality control of Epimedium, and 50 or more individuals would be better for representing the quality of medicinal materials.

Harmonization of monographic standards is needed to ensure the quality of Chinese medicinal materials

Directory of Open Access Journals (Sweden)

Zhao Sandy

2009-09-01

Full Text Available Abstract This article provides an overview on the regulations of Chinese medicinal materials (CMMs in various countries and regions. Harmonization of CMM monographs would provide standards for the quality control of CMM products and play an important role in the modernization and globalization of Chinese medicine. A harmonized regulatory system would improve the quality of CMMs thereby ensuring the safety of the products and assisting Chinese medicine practitioners in their practice. The fast growing demand worldwide for traditional medicines calls for harmonized monographic standards to safeguard the safety and quality of CMM products.

Mathematical methods in medicine: neuroscience, cardiology and pathology

Science.gov (United States)

Amigó, José M.

2017-01-01

The application of mathematics, natural sciences and engineering to medicine is gaining momentum as the mutual benefits of this collaboration become increasingly obvious. This theme issue is intended to highlight the trend in the case of mathematics. Specifically, the scope of this theme issue is to give a general view of the current research in the application of mathematical methods to medicine, as well as to show how mathematics can help in such important aspects as understanding, prediction, treatment and data processing. To this end, three representative specialties have been selected: neuroscience, cardiology and pathology. Concerning the topics, the 12 research papers and one review included in this issue cover biofluids, cardiac and virus dynamics, computational neuroscience, functional magnetic resonance imaging data processing, neural networks, optimization of treatment strategies, time-series analysis and tumour growth. In conclusion, this theme issue contains a collection of fine contributions at the intersection of mathematics and medicine, not as an exercise in applied mathematics but as a multidisciplinary research effort that interests both communities and our society in general. This article is part of the themed issue ‘Mathematical methods in medicine: neuroscience, cardiology and pathology’. PMID:28507240

Mathematical methods in medicine: neuroscience, cardiology and pathology.

Science.gov (United States)

Amigó, José M; Small, Michael

2017-06-28

The application of mathematics, natural sciences and engineering to medicine is gaining momentum as the mutual benefits of this collaboration become increasingly obvious. This theme issue is intended to highlight the trend in the case of mathematics. Specifically, the scope of this theme issue is to give a general view of the current research in the application of mathematical methods to medicine, as well as to show how mathematics can help in such important aspects as understanding, prediction, treatment and data processing. To this end, three representative specialties have been selected: neuroscience, cardiology and pathology. Concerning the topics, the 12 research papers and one review included in this issue cover biofluids, cardiac and virus dynamics, computational neuroscience, functional magnetic resonance imaging data processing, neural networks, optimization of treatment strategies, time-series analysis and tumour growth. In conclusion, this theme issue contains a collection of fine contributions at the intersection of mathematics and medicine, not as an exercise in applied mathematics but as a multidisciplinary research effort that interests both communities and our society in general.This article is part of the themed issue 'Mathematical methods in medicine: neuroscience, cardiology and pathology'. © 2017 The Author(s).

Physical foundations of image quality in nuclear medicine. Methods for its evaluation

International Nuclear Information System (INIS)

Perez Diaz, Marlen; Diaz Rizo, Oscar

2007-01-01

The present paper describes the main physical factors which characterize image quality in Nuclear Medicine from the physical and mathematical point of view. A conceptual description of how image system (gamma camera) degrades the information emitted by the object is also presented. A critical review of some qualitative and quantitative methods for grading image quality, collateral to equipment quality control, follows this material. Among these methods we present the ROC analysis, Clustering Techniques and Discriminant Analysis. As a part of the two last ones, we also analyze the main factors which determine image quality and how they produce changes in the quantitative physical variables measured on the images. A comparison among the methods is also presented, remarking their utility to check image quality, as well as the main advantages and disadvantages of each one (au)

An Investigation of the Variety and Complexity of Statistical Methods Used in Current Internal Medicine Literature.

Science.gov (United States)

Narayanan, Roshni; Nugent, Rebecca; Nugent, Kenneth

2015-10-01

Accreditation Council for Graduate Medical Education guidelines require internal medicine residents to develop skills in the interpretation of medical literature and to understand the principles of research. A necessary component is the ability to understand the statistical methods used and their results, material that is not an in-depth focus of most medical school curricula and residency programs. Given the breadth and depth of the current medical literature and an increasing emphasis on complex, sophisticated statistical analyses, the statistical foundation and education necessary for residents are uncertain. We reviewed the statistical methods and terms used in 49 articles discussed at the journal club in the Department of Internal Medicine residency program at Texas Tech University between January 1, 2013 and June 30, 2013. We collected information on the study type and on the statistical methods used for summarizing and comparing samples, determining the relations between independent variables and dependent variables, and estimating models. We then identified the typical statistics education level at which each term or method is learned. A total of 14 articles came from the Journal of the American Medical Association Internal Medicine, 11 from the New England Journal of Medicine, 6 from the Annals of Internal Medicine, 5 from the Journal of the American Medical Association, and 13 from other journals. Twenty reported randomized controlled trials. Summary statistics included mean values (39 articles), category counts (38), and medians (28). Group comparisons were based on t tests (14 articles), χ2 tests (21), and nonparametric ranking tests (10). The relations between dependent and independent variables were analyzed with simple regression (6 articles), multivariate regression (11), and logistic regression (8). Nine studies reported odds ratios with 95% confidence intervals, and seven analyzed test performance using sensitivity and specificity calculations

Materials of All-Polish Symposium Nuclear Techniques in Industry, Medicine, Agriculture and Environment Protection

International Nuclear Information System (INIS)

1998-01-01

The All-Polish Symposium Nuclear Techniques in Industry, Medicine, Agriculture and Environment Protection is cyclic (in 3 year period) conference being a broad review of state of art and development of all nuclear branches cooperated with industry and other branches of national economy and public life in Poland. The conference has been divided in one plenary session and 8 problem sessions as follow: Radiation technologies of flue gas purification; radiation technologies in food and cosmetic industry; application of nuclear techniques in environmental studies and earth science; radiometric methods in material engineering; isotope tracers in biological studies and medical diagnostics; radiometric industrial measuring systems; radiation detectors and device; nuclear methods in cultural objects examination. The poster section as well as small exhibition have been also organised

Determination of elementary composition of medicinal plants by Neutron Activation Analysis method

International Nuclear Information System (INIS)

Takamoto, Árissa; Saiki, Mitiko

2017-01-01

The analyzes of medicinal plants are of great interest for the study of the correlation between elements present in them with their therapeutic activities, as well as to identify the toxic elements harmful to health human. In the work, applying the method of analysis by activation with neutrons (NAA), the medicinal plants: Aloe vera (Babosa), Morus nigra sp. (Amoreira) and Moringa oleifera (Moringa) were analysed. The samples were collected in different locations and purchased in a natural products store. The preparation consisted in the cleaning, drying and milling of the leaves. Aliquots of the samples were irradiated with synthetic elements over a period of 16 h and under thermal neutron flux of 5 x 1012 n cm -2 s -1 of the nuclear reactor IEAR-1. The gamma-induced activities were measured on a gamma-ray spectrometer coupled to a detector high resolution. The radioisotopes formed were identified by half-life and energy of the gamma rays and the concentrations of the elements were calculated by the comparative method. The results of the certified reference materials INCT-TL-1 Tea Leaves and INCT-MPH-2 Mixed Polish Herbs showed good precision and accuracy. In the analyzed plants, toxic elements such as Cu and Cd were not detected. Already the As and Sb were detected, but at very low concentrations, on the order of ng g -1 . By NAA method it was possible to determine the concentration of elements As, Br, Ca, Co, Cr, Cs, Fe, K, La, Na, Rb, Sb, Sc and Zn. Results obtained in this work demonstrated the feasibility of applying NAA in the study of medicinal plants

African palm ethno-medicine

DEFF Research Database (Denmark)

Gruca, Marta; Blach-Overgaard, Anne; Balslev, Henrik

2015-01-01

-medicinal data on African palms, and investigate patterns of palm uses in traditional medicine; and highlight possible under-investigated areas. Materials and methods References were found through bibliographic searches using several sources including PubMed, Embase, and Google Scholar and search engines...... in traditional medicine, with most of the uses related to fruit (and palm oil), root, seed and leaf. Palms were used in traditional medicine mostly without being mixed with other plants, and less commonly in mixtures, sometimes in mixture with products of animal origin. Future ethno-botanical surveys should...... were able to demonstrate the value of palms in traditional medicine, and provide recommendations for the areas that should be targeted in future ethno-botanical surveys....

Reliability studies of diagnostic methods in Indian traditional Ayurveda medicine

DEFF Research Database (Denmark)

Kurande, Vrinda Hitendra; Waagepetersen, Rasmus; Toft, Egon

2013-01-01

as prakriti classification), method development (pulse diagnosis), quality assurance for diagnosis and treatment and in the conduct of clinical studies. Several reliability studies are conducted in western medicine. The investigation of the reliability of traditional Chinese, Japanese and Sasang medicine...

Substance and materiality? The archaeology of Talensi medicine shrines and medicinal practices.

Science.gov (United States)

Insoll, Timothy

2011-08-01

Talensi materia medica is varied, encompassing plant, mineral, and animal substances. Healing, medicines, and medicinal practices and knowledge can be shrine-based and linked with ritual practices. This is explored utilising ethnographic data and from an archaeological perspective with reference to future possibilities for research both on Talensi medicine and, by implication, more generally through considering the archaeology of Talensi medicine preparation, use, storage, spread, and disposal. It is suggested that configuring the archaeology of medicine shrines and practices more broadly in terms of health would increase archaeological visibility and research potential.

Methods and quality assurance in environmental medicine. Formation of a RKI-Commission

International Nuclear Information System (INIS)

Eis, D.

2000-01-01

An almost bewildering number of widely differing methods and techniques, often not validated, are being applied often inappropriately in the field of environmental medicine to answer questions regarding exposure assessment, diagnosis, treatment, counselling and prevention. Therefore, quality control within the field of environmental medicine is quite problematic. A primary goal of the newly formed RKI-Commission 'Methods and Quality Assurance in Environmental Medicine' is to form a panel of experts in the field, who evaluate the situation and generate consensus documents containing respective recommendations. By this the commission will contribute to standardization and agreement on appropriate methods, procedures and their correct application in the practice of environmental medicine. Hopefully it will also achieve a stronger, more consistent use of evidence-based-medicine and improve the quality of the structure, processes and results of research and practice in this field. The committee will initially deal with the issue of clinical environmental medicine, because here the largest problems in quality assurance are seen. In this context the commission will look at the problem areas of environmental-medical outpatient units and environmental clinics. The work of the commission will be supported by the newly formed Documentation and Evaluation Center for Methods in Environmental Medicine (Zentrale Erfassungs- und Bewertungsstelle fuer umweltmedizinische Methoden, ZEBUM) at the Robert Koch Institute. (orig.) [de

Evaluation of internet-based patient education materials from internal medicine subspecialty organizations: will patients understand them?

Science.gov (United States)

Hansberry, David R; Agarwal, Nitin; John, Elizabeth S; John, Ann M; Agarwal, Prateek; Reynolds, James C; Baker, Stephen R

2017-06-01

The majority of Americans use the Internet daily, if not more often, and many search online for health information to better understand a diagnosis they have been given or to research treatment options. The average American reads at an eighth-grade level. The purpose of this study is to evaluate the readability of online patient education materials on the websites of 14 professional organizations representing the major internal medicine subspecialties. We used ten well-established quantitative readability scales to assess written text from patient education materials published on the websites of the major professional organizations representing the following subspecialty groups: allergy and immunology, cardiology, endocrinology, gastroenterology, geriatrics, hematology, hospice and palliative care, infectious disease, nephrology, oncology, pulmonology and critical care, rheumatology, sleep medicine, and sports medicine. Collectively the 540 articles analyzed were written at an 11th-grade level (SD 1.4 grade levels). The sleep medicine and nephrology websites had the most readable materials, written at an academic grade level of 8.5 ± 1.5 and 9.0 ± 0.2, respectively. Material at the infectious disease site was written at the most difficult level, with average readability corresponding to grades 13.9 ± 0.3. None of the patient education materials we reviewed conformed to the American Medical Association (AMA) and the National Institutes of Health (NIH) guidelines requiring that patient education articles be written at a third- to seventh-grade reading level. If these online resources were rewritten, it is likely that more patients would derive benefit from reading them.

3D material cytometry (3DMaC): a very high-replicate, high-throughput analytical method using microfabricated, shape-specific, cell-material niches.

Science.gov (United States)

Parratt, Kirsten; Jeong, Jenny; Qiu, Peng; Roy, Krishnendu

2017-08-08

Studying cell behavior within 3D material niches is key to understanding cell biology in health and diseases, and developing biomaterials for regenerative medicine applications. Current approaches to studying these cell-material niches have low throughput and can only analyze a few replicates per experiment resulting in reduced measurement assurance and analytical power. Here, we report 3D material cytometry (3DMaC), a novel high-throughput method based on microfabricated, shape-specific 3D cell-material niches and imaging cytometry. 3DMaC achieves rapid and highly multiplexed analyses of very high replicate numbers ("n" of 10 4 -10 6 ) of 3D biomaterial constructs. 3DMaC overcomes current limitations of low "n", low-throughput, and "noisy" assays, to provide rapid and simultaneous analyses of potentially hundreds of parameters in 3D biomaterial cultures. The method is demonstrated here for a set of 85 000 events containing twelve distinct cell-biomaterial micro-niches along with robust, customized computational methods for high-throughput analytics with potentially unprecedented statistical power.

Mixed Methods Designs for Sports Medicine Research.

Science.gov (United States)

Kay, Melissa C; Kucera, Kristen L

2018-07-01

Mixed methods research is a relatively new approach in the field of sports medicine, where the benefits of qualitative and quantitative research are combined while offsetting the other's flaws. Despite its known and successful use in other populations, it has been used minimally in sports medicine, including studies of the clinician perspective, concussion, and patient outcomes. Therefore, there is a need for this approach to be applied in other topic areas not easily addressed by one type of research approach in isolation, such as the retirement from sport, effects of and return from injury, and catastrophic injury. Copyright © 2018 Elsevier Inc. All rights reserved.

Two-dimensional correlation infrared spectroscopy applied to analyzing and identifying the extracts of Baeckea frutescens medicinal materials.

Science.gov (United States)

Adib, Adiana Mohamed; Jamaludin, Fadzureena; Kiong, Ling Sui; Hashim, Nuziah; Abdullah, Zunoliza

2014-08-05

Baeckea frutescens or locally known as Cucur atap is used as antibacterial, antidysentery, antipyretic and diuretic agent. In Malaysia and Indonesia, they are used as an ingredient of the traditional medicine given to mothers during confinement. A three-steps infra-red (IR) macro-fingerprinting method combining conventional IR spectra, and the secondary derivative spectra with two dimensional infrared correlation spectroscopy (2D-IR) have been proved to be effective methods to examine a complicated mixture such as herbal medicines. This study investigated the feasibility of employing multi-steps IR spectroscopy in order to study the main constituents of B. frutescens and its different extracts (extracted by chloroform, ethyl acetate, methanol and aqueous in turn). The findings indicated that FT-IR and 2D-IR can provide many holistic variation rules of chemical constituents. The structural information of the samples indicated that B. frutescens and its extracts contain a large amount of flavonoids, since some characteristic absorption peaks of flavonoids, such as ∼1600cm(-1), ∼1500cm(-1), ∼1450cm(-1), and ∼1270cm(-1) can be observed. The macroscopical fingerprint characters of FT-IR and 2D-IR spectra can not only provide the information of main chemical constituents in medicinal materials and their different extracts, but also compare the components differences among the similar samples. In conclusion, the multi-steps IR macro-fingerprint method is rapid, effective, visual and accurate for pharmaceutical research. Copyright © 2014 Elsevier B.V. All rights reserved.

Methods for extraction and determination of phenolic acids in medicinal plants: a review.

Science.gov (United States)

Arceusz, Agnieszka; Wesolowski, Marek; Konieczynski, Pawel

2013-12-01

Phenolic acids constitute a group of potentially immunostimulating compounds. They occur in all medicinal plants and are widely used in phytotherapy and foods of plant origin. In recent years, phenolic acids have attracted much interest owing to their biological functions. This paper reviews the extraction and determination methods of phenolic acids in medicinal plants over the last 10 years. Although Soxhlet extraction and ultrasonic assisted extraction (UAE) are commonly used for the extraction of phenolic acids from plant materials, alternative techniques such as supercritical fluid extraction (SFE), and accelerated solvent extraction (ASE) can also be used. After extraction, phenolic acids are determined usually by liquid chromatography (LC) owing to the recent developments in this technique, especially when it is coupled with mass spectrometry (MS). Also detection systems are discussed, including UV-Vis, diode array, electrochemical and fluorimetric. Other popular techniques for the analysis of this group of secondary metabolites are gas chromatography coupled with mass spectrometry (GC-MS) and capillary electrophoresis (CE).

[Establishment of prescription research technology system in Chinese medicine secondary exploitation based on "component structure" theory].

Science.gov (United States)

Cheng, Xu-Dong; Feng, Liang; Gu, Jun-Fei; Zhang, Ming-Hua; Jia, Xiao-Bin

2014-11-01

Chinese medicine prescriptions are the wisdom outcomes of traditional Chinese medicine (TCM) clinical treatment determinations which based on differentiation of symptoms and signs. Chinese medicine prescriptions are also the basis of secondary exploitation of TCM. The study on prescription helps to understand the material basis of its efficacy, pharmacological mechanism, which is an important guarantee for the modernization of traditional Chinese medicine. Currently, there is not yet dissertation n the method and technology system of basic research on the prescription of Chinese medicine. This paper focuses on how to build an effective system of prescription research technology. Based on "component structure" theory, a technology system contained four-step method that "prescription analysis, the material basis screening, the material basis of analysis and optimization and verify" was proposed. The technology system analyzes the material basis of the three levels such as Chinese medicine pieces, constituents and the compounds which could respect the overall efficacy of Chinese medicine. Ideas of prescription optimization, remodeling are introduced into the system. The technology system is the combination of the existing research and associates with new techniques and methods, which used for explore the research thought suitable for material basis research and prescription remodeling. The system provides a reference for the secondary development of traditional Chinese medicine, and industrial upgrading.

[Applications of mathematical statistics methods on compatibility researches of traditional Chinese medicines formulae].

Science.gov (United States)

Mai, Lan-Yin; Li, Yi-Xuan; Chen, Yong; Xie, Zhen; Li, Jie; Zhong, Ming-Yu

2014-05-01

The compatibility of traditional Chinese medicines (TCMs) formulae containing enormous information, is a complex component system. Applications of mathematical statistics methods on the compatibility researches of traditional Chinese medicines formulae have great significance for promoting the modernization of traditional Chinese medicines and improving clinical efficacies and optimizations of formulae. As a tool for quantitative analysis, data inference and exploring inherent rules of substances, the mathematical statistics method can be used to reveal the working mechanisms of the compatibility of traditional Chinese medicines formulae in qualitatively and quantitatively. By reviewing studies based on the applications of mathematical statistics methods, this paper were summarized from perspective of dosages optimization, efficacies and changes of chemical components as well as the rules of incompatibility and contraindication of formulae, will provide the references for further studying and revealing the working mechanisms and the connotations of traditional Chinese medicines.

A Model for Producing and Sharing Instructional Materials in Veterinary Medicine. Final Report.

Science.gov (United States)

Ward, Billy C.; Niec, Alphonsus P.

This report describes a study of factors which appear to influence the "shareability" of audiovisual materials in the field of veterinary medicine. Specific factors addressed are content quality, instructional effectiveness, technical quality, institutional support, organization, logistics, and personal attitudes toward audiovisuals. (Author/CO)

Optimization of the Method of Active Ingredients Adding to the Base of Medicinal Films Depending on Certain Variables

Directory of Open Access Journals (Sweden)

L. L. Davtian

2018-03-01

Full Text Available The influence of variables of pharmaceutical factors on the technological processes of drugs manufacturing is incredibly important. Thus, in the development of a new drug in the form of medicinal films, the relevance and necessity of determining the effect of the methods of active substances adding on the effectiveness of the drug was determined. The aim is rationalization of the method of the active pharmaceutical ingredients adding into the composition of the developed drug. Materials and methods. As experimental samples we used medicinal films, which were made using various methods of active ingredients adding. The quality of the samples was evaluated by the antimicrobial activity against Clostridium sporogenes and Staphylococcus aureus, which was determined by the diffusion method in agar. Results. The study of the antimicrobial activity of medicinal films with various methods of active ingredients adding showed that the adding of metronidazole as an aqueous solution increases the antimicrobial activity of the films by 21.23%, 16.89%, 28.59%, respectively, compared with films of similar composition, in which metronidazole was added as a suspension, and the remaining ingredients were added by the same way. The introduction of chlorhexidine bigluconate and glucosamine hydrochloride in the film-forming solution lastly together with the solution of metronidazole increases the antimicrobial activity by 24.67%, which is probably due to the absence of contact between thermolabile ingredients and solutions of film-forming substances having a high dissolution temperature. Conclusions. The most rational is adding of metronidazole to the medicinal films in the form of a 0.01% aqueous solution in a mixture with the chlorhexidine bigluconate and glucosamine hydrochloride solution to the final film-forming solution.

The characteristics of the medicinal plants used in the herbal medicine оf type 2 diabetes

Directory of Open Access Journals (Sweden)

Sergei Kalmykov

2016-06-01

Full Text Available Purpose: consider the rational combination of the herbs in fytocomplexes applied in the rehabilitation of the type 2 diabetes. Material & Methods: analysis of scientific and methodical literature on the use of herbal medicine in the complex rehabilitation for patients with diabetes. Results: modern views on the necessity and the features of the use of herbal remedies especially in the diabetes type 2 are presented; the main medicinal plants used in this pathology are described. The main attention is paid to the peculiarities of forming up an integrated cure that contains a mixture of several kinds of medicinal plants. The classification of herbal drugs used for diabetes is given. Conclusions: advantages of application of collection of medicinal plants over synthetic drugs in the complex treatment of the type 2 diabetes are proved.

Nuclear medicine. Clinical value of the medicine methods. Nuklearmedizin. Klinische Bedeutung nuklearmedizinischer Diagnostik und Therapie

Energy Technology Data Exchange (ETDEWEB)

Schmidt, H A.E. [Evangelisches Krankenhaus Bethesda Gemeinnuetzige G.m.b.H., Duisburg (Germany, F.R.). Nuklearmedizinische Klinik und Poliklinik; Ortiz Berrocal, J [Universidad Autonoma de Madrid (Spain). Dept. of Nuclear Medicine; eds.

1979-01-01

This proceedings volume of the 16th International Annual Meeting of the Gesellschaft fuer Nuklearmedizin, which took place in Madrid on October 24-27, 1978, contains 183 compacts on the following subjects: Metrology and data processing, cyclotron products and radiopharmaceuticals, nuclear medicine as compared with computerized tomography and sonography, radioimmunoassay, haematology, thyreology, osteology, pulmonology, cardiology, angiology, nephrology, gastroenterology and hepatology, oncology, nuclear therapy methods and some free lectures and thus give a good picture of the state of the art in nuclear medicine at the time.

The effects of packaging materials on microbe population in irradiated traditional herbal medicines

International Nuclear Information System (INIS)

Bagiawati, Sri; Hilmy, Nazly

1983-01-01

Microbial population and moisture content of traditional herbal medicines contaminated with 3 kinds of aerobic microbes, packed in 5 kinds of plastic packaging materials, followed by irradiation at minimum dose of 5 kGy and stored for 6 months were investigated. The highest reduction of microbial counts during storage was observed on samples packed in polyethylene bags. All of packaging materials used were found to be impermeable to microbes and water vapour. Radiation and packaging materials used acted synergistically to inactivate microbes durind storage. The microbial counts decreased as much as 2 to 4 log cycles during storage. (author)

Vitreous humour - routine or alternative material for analysis in forensic medicine.

Science.gov (United States)

Markowska, Joanna; Szopa, Monika; Zawadzki, Marcin; Piekoszewski, Wojciech

2017-01-01

Biological materials used in toxicological analyses in forensic medicine traditionally include blood, urine and vitreous humour. Forensic use of the vitreous body is mostly due to the need to assess the endogenous concentration of ethyl alcohol in the process of human body decomposition. The vitreous body is an underestimated biological material, even though its biochemical properties and anatomical location make it suitable for specific forensic toxicology tests as a reliable material for the preparation of forensic expert opinions. Based on the available literature the paper gathers information on the biochemical structure of the vitreous body, ways to secure the material after collection and its use in postmortem diagnostics. Specific applications of the vitreous humour for biochemical and toxicological tests are discussed, with a focus on its advantages and limitations in forensic medical assessment which are attributable to its biochemical properties, anatomical location and limited scientific studies on the distribution of xenobiotics in the vitreous body.

QUANTITATIVE DETERMINATION OF MAIN GROUPS OF SUBSTANCES IN GRANULES ON THE BASIS OF MEDICINAL VEGETABLE RAW MATERIAL FOR TREATING GASTROINTESTINAL DISEASES

Directory of Open Access Journals (Sweden)

Spiridonov S.V.

2014-12-01

Full Text Available In the last time a significant increasing of gastrointestinal tract diseases has been observed. The poor quality and irrational feeding, environmental pollution, psychological and other factors is the causes of this. Very often the gastrointestinal tract has a multifactorial pathological effects, also affecting the hepatosphere organs and urogenital system. Also a great importance have accompanying disorders of the central nervous system. Thus we must to require a comprehensive approach to the creation of drugs for use in gastroenterology, the assortment range of which should be expanded. Advantageous position in this case takes a phytotherapy using drugs based on medicinal plant raw material, which acting on the main areas of the pathological process. For this purpose the scientists from the National University of Pharmacy (Kharkov, Ukraine was created a complex herbal drug in the form of granules under the code name "Poligerbagastrin", includes the following types of medicinal plant raw material powders: helichrysum arenarium flowers, corn stigmas, horsetail grass, knotweed grass, horse chestnut seeds, licorice roots and wheat bran. Materials and methods To determine the quantity of biologically active substances the method of spectrophotometry in the visible and UV spectral region was used. This method is well studied and available, equipped with high-precision hardware. He also described in the Ukrainian normative documents and contained in the world's leading pharmacopoeias. For determination was used the unifieds methods, which shown in pharmacopoeia monographs and other reference literature. Determination was carried out with a spectrophotometer HP 8543 UV-VIZ of «Hewlett Packard» company, USA. Results and discussion For the quantitative determination of flavonoids was used a methodology, which based on the complexation reaction of isolated by acid hydrolysis and extraction with ethylacetate hydrolysis products with aluminum chloride in

How often do patients in primary care use the methods of traditional medicine

Directory of Open Access Journals (Sweden)

Petrov-Kiurski Miloranka

2014-01-01

Full Text Available Introduction: Traditional medicine is a comprehensive system of theory and practice, implemented in the prevention, diagnostics and treatment of diseases, which utilizes preparations of vegetable, animal and mineral origin, as well as methods of spiritual therapy Objective: 1. To estimate how many patients in primary care use traditional medicine for diagnostics, treatment and prevention of diseases, and to establish possible differences regarding gender, age and urban or rural location. 2. What methods of traditional medicine are the most often used, and for which diseases and conditions? 3. Why did the subjects opted for this type of treatment, and what was the effect of the therapy? Method: Multicentric research based on interviewing patients in five outpatient health centers in Serbia. As a survey instrument was used a questionnaire with 10 questions. Results: The study included 1157 subjects, 683 women and 474 men, mean age 60.22±14.54, The traditional medicine was used by 83.66% (79.96% males and 86.245% females. Information about the methods of traditional medicine subjects usually received from their friends and acquaintances (54.9% and the media (39.3%. There is no significant difference in the way of obtaining information in relation to gender. Information on the internet was obtained more often in subjects younger than 65 (p=0.000 and in urban population (p=0.000. The same is true for information obtained from doctor or pharmacist (p=0.003. They opted for this method because in their opinion it is less harmful and have less adverse effects (72.8%. This type of treatment patients used for treatment of muscles, bone and joint diseases - 28.5%, diseases of the heart and blood vessels -21,1 %, and for the treatment of pain 19.7%. Patients from rural areas more often used traditional medicine for treatment of cardiovascular diseases (p=0.000. Outcome of treatment was good or satisfactory in 45.3%, moderate in 32%, and in 15.8% effect was

Method for forming materials

Science.gov (United States)

Tolle, Charles R [Idaho Falls, ID; Clark, Denis E [Idaho Falls, ID; Smartt, Herschel B [Idaho Falls, ID; Miller, Karen S [Idaho Falls, ID

2009-10-06

A material-forming tool and a method for forming a material are described including a shank portion; a shoulder portion that releasably engages the shank portion; a pin that releasably engages the shoulder portion, wherein the pin defines a passageway; and a source of a material coupled in material flowing relation relative to the pin and wherein the material-forming tool is utilized in methodology that includes providing a first material; providing a second material, and placing the second material into contact with the first material; and locally plastically deforming the first material with the material-forming tool so as mix the first material and second material together to form a resulting material having characteristics different from the respective first and second materials.

Nanophase materials produced by physical methods

International Nuclear Information System (INIS)

Noda, Shoji

1992-01-01

A nanophase material is mainly characterized by the component's size and the large interface area. Some nanophase materials are briefly described. Ion implantation and oblique vapor deposition are taken as the methods to provide nanophase materials, and their features are described. These physical methods are non-equilibrium material processes, and the unique nanophase materials are demonstrated to be provided by these methods with little thermodynamic restriction. (author)

[Research on resources chemistry of Chinese medicinal materials and resources recycling utilization ways and goals and tasks].

Science.gov (United States)

Duan, Jin-ao; Su, Shu-lan; Guo, Sheng; Jiang, Shu; Liu, Pei; Yan, Hui; Qian, Da-wei; Zhu, Hua-xu; Tang, Yu-ping; Wu, Qi-nan

2015-09-01

The objects of research on the resources chemistry of Chinese medicinal materials (RCCMM) are promotion of efficient production, rational utilization and improving quality of CMM and natural products. The development of TCM cause depends on the efficient utilization and sustainable development of CMM, hinges on the technologies and methods for using and discovering medicinal biological resources, stand or fall on the extension of industy chains, detailed utilizaion of resource chemical components by multi-way, multi-level. All of these may help to the recycling utilization and sound development of RCMM. In this article, five respects were discussed to the RCCMM researches and resources recycling utilization ways and goals and tasks. First, based on the principle of resource scarcity, discovering or replacing CMM resources, protecting the rare or endangered species or resources. Second, based on the multifunctionality of CMM, realizing the value-added and value compensation, and promoting the utilization efficiency through systermatic and detailed exploitation and utilization. Third, based on the resource conservation and environment-friendly, reducing raw material consumption, lowering cost, promoting recycling utilization and elevating utilization efficiency. Fourth, based on the stratege of turning harm into good, using the invasive alien biological resources by multi-ways and enriching the medicial resources. Fifth, based on the method of structure modification of chemical components, exploring and enhancing the utility value of resouces chemical substances. These data should provide references and attention for improving the utilization efficiency, promoting the development of recycling economy, and changing the mode of economic growth of agriculture and industry of CMM fundamentally.

Introduction to mathematical and informatics methods in Nuclear Medicine

International Nuclear Information System (INIS)

Martin, J.; Monot, C.; Legras, B.

1975-01-01

Mathematical and statistical methods are widely used in nuclear medicine because of the abundance and precision of the data obtained during morphological and dynamic explorations, and the number and complexity of the calculations involved has led to the use of informatics. Very elaborate techniques may be employed with the help of the computer. In spite of its cost it is closely associated with exploration techniques, especially in conjunction with the scintillation camera. To keep the machine in full-time use and ensure its profitability it is employed in other capacities, for an service management in particular. Each subject is dealt with from its fundamental aspect: nuclear medicine and biomathematics, statistics, informatics; compartment models in nuclear medicine (interpretation of dynamic examinations); quantitive image processing; special computer services (connections with apparatus, service and records management problems) [fr

Methods of synthesizing thermoelectric materials

Science.gov (United States)

Ren, Zhifeng; Chen, Shuo; Liu, Wei-Shu; Wang, Hengzhi; Wang, Hui; Yu, Bo; Chen, Gang

2016-04-05

Methods for synthesis of thermoelectric materials are disclosed. In some embodiments, a method of fabricating a thermoelectric material includes generating a plurality of nanoparticles from a starting material comprising one or more chalcogens and one or more transition metals; and consolidating the nanoparticles under elevated pressure and temperature, wherein the nanoparticles are heated and cooled at a controlled rate.

Statistical methods for nuclear material management

International Nuclear Information System (INIS)

Bowen, W.M.; Bennett, C.A.

1988-12-01

This book is intended as a reference manual of statistical methodology for nuclear material management practitioners. It describes statistical methods currently or potentially important in nuclear material management, explains the choice of methods for specific applications, and provides examples of practical applications to nuclear material management problems. Together with the accompanying training manual, which contains fully worked out problems keyed to each chapter, this book can also be used as a textbook for courses in statistical methods for nuclear material management. It should provide increased understanding and guidance to help improve the application of statistical methods to nuclear material management problems

Statistical methods for nuclear material management

Energy Technology Data Exchange (ETDEWEB)

Bowen W.M.; Bennett, C.A. (eds.)

1988-12-01

This book is intended as a reference manual of statistical methodology for nuclear material management practitioners. It describes statistical methods currently or potentially important in nuclear material management, explains the choice of methods for specific applications, and provides examples of practical applications to nuclear material management problems. Together with the accompanying training manual, which contains fully worked out problems keyed to each chapter, this book can also be used as a textbook for courses in statistical methods for nuclear material management. It should provide increased understanding and guidance to help improve the application of statistical methods to nuclear material management problems.

Nuclear medicine methods in the assessment of acupuncture effects: a short review

International Nuclear Information System (INIS)

Souza, Deise Elisabete; Rebello, Bernardo Machado; Agostinho, Raquel Terra; Silva Filho, Reginaldo de Carvalho; Bernardo-Filho, Mario

2007-01-01

The mechanisms of acupuncture are poorly understood. In consequence, numerous investigators have conducted clinical trials to test the efficacy of acupuncture in various conditions. We have used PubMed database system to evaluate the number of publications in acupuncture and nuclear medicine procedures in the period from 1964 to 2007, using the keywords: 'nuclear medicine and acupuncture', 'SPECT and acupuncture, 'PET and acupuncture', 'scintigraphy and acupuncture, 'radionuclide and acupuncture', 'radiopharmaceutical and acupuncture', 'radioisotope and acupuncture' and 99m Tc and acupuncture'. Some papers published in English language were selected and a short review is presented The analysis of the number of publications shows that when a method is well accepted by the scientific community, as the methods used in nuclear medicine, the interest in the development of research increases. Moreover, important findings are presented when the nuclear medicine image is used to evaluate the effect of the acupuncture. (author)

Soft Material-Enabled, Flexible Hybrid Electronics for Medicine, Healthcare, and Human-Machine Interfaces.

Science.gov (United States)

Herbert, Robert; Kim, Jong-Hoon; Kim, Yun Soung; Lee, Hye Moon; Yeo, Woon-Hong

2018-01-24

Flexible hybrid electronics (FHE), designed in wearable and implantable configurations, have enormous applications in advanced healthcare, rapid disease diagnostics, and persistent human-machine interfaces. Soft, contoured geometries and time-dynamic deformation of the targeted tissues require high flexibility and stretchability of the integrated bioelectronics. Recent progress in developing and engineering soft materials has provided a unique opportunity to design various types of mechanically compliant and deformable systems. Here, we summarize the required properties of soft materials and their characteristics for configuring sensing and substrate components in wearable and implantable devices and systems. Details of functionality and sensitivity of the recently developed FHE are discussed with the application areas in medicine, healthcare, and machine interactions. This review concludes with a discussion on limitations of current materials, key requirements for next generation materials, and new application areas.

Botanical drugs in Ayurveda and Traditional Chinese Medicine.

Science.gov (United States)

Jaiswal, Yogini; Liang, Zhitao; Zhao, Zhongzhen

2016-12-24

China and India have a long history in the therapeutic application of botanical drugs in traditional medicine. Traditional Chinese Medicine (TCM) and Ayurveda are considered as two of the most ancient systems of medicine, with history of more than two millennia. Medicinal plants are the principal medicinal materials used in both these systems. This review discusses about the histories of Ayurveda and TCM, the common medicinal plants species, the drug processing strategies used, and the current statuses of these traditional systems of medicine (TSM). Through the views presented in this article, we aim to provide a new perspective to herbal drug researchers for expanding and improving the utilization of botanical drugs and their therapeutic applications. A bibliographic investigation of Chinese and Indian pharmacopoeias, monographs and official websites was performed. Furthermore, information was obtained from scientific databases on ethnobotany and ethno medicines. The review of Ayurveda and TCM ethno medicine indicates that both these systems have many medicinal materials in common. The studies carried out by the authors for comparison of plants from same genus from both these TSM's have been discussed to further bring focus to the utilization of "qualitatively" similar species which can be utilized and substituted for endangered or economically valued species. The overview of ancient literature and scientific findings for drugs in both these systems suggests that, the botanical drugs used in common and their processing methods can be explored further for extensive utilization in traditional medicine. This review describes the histories, common medicinal plant species, their processing methods and therapeutic applications in Ayurveda and TCM. The insights provided through this article may be used by herbal drug researchers and pharmacologists for further exploration of botanical drugs from these two traditional systems of medicine. Copyright © 2016. Published by

Nondestructive evaluation ultrasonic methods for construction materials

International Nuclear Information System (INIS)

Chilibon, I.; Zisu, T.; Raetchi, V.

2002-01-01

The paper presents some ultrasonic methods for evaluation of physical-mechanical properties of construction materials (bricks, concrete, BCA), such as: pulse method, examination methods, and direct measurement of the propagation velocity and impact-echo method. Utilizing these nondestructive evaluation ultrasonic methods it can be determined the main material parameters and material characteristics (elasticity coefficients, density, propagation velocity, ultrasound attenuation, etc.) of construction materials. These method are suitable for construction materials because the defectoscopy methods for metallic materials cannot be utilized, due to its rugged and non-homogeneous structures and grate attenuation coefficients of ultrasound propagation through materials. Also, the impact-echo method is a technique for flaw detection in concrete based on stress wave propagation. Studies have shown that the impact-echo method is effective for locating voids, honeycombing, delaminating, depth of surface opening cracks, and measuring member thickness

EFFECTIVENESS OF ACTIVE TEACHING METHODS FOR THE RESIDENTS OF PHYSICAL MEDICINE AND REHABILITATION

Directory of Open Access Journals (Sweden)

Mohan Raj Manjalavil

2017-03-01

Full Text Available BACKGROUND Lecture is the most common teaching aid not only for medical undergraduates, but also specialty residents. There are many disadvantages for this type of teaching. Active teaching methods include didactic lectures followed by interactive sessions, problem-based teaching and hands on demonstration apart from the traditional didactic lecture. The aim of this project was to compare the effectiveness of active teaching method over the didactic lecture to the first year residents of Physical Medicine and Rehabilitation. MATERIALS AND METHODS Settings- Physical Medicine and Rehabilitation Department among first year residents. Study Design- Educational intervention. Didactic lecture followed by active teaching method. Statistical Analysis- Analysed using SPSS-16 package software. Initially, the first year students were subjected to a pretest, which consists of ten single responses multiple choice questions regarding - “The Carpel Tunnel Syndrome.” This is followed by didactic lecture about the above topic. After this lecture, a post test was conducted with identical questions as the pretest. Then, an interactive session and hands on demonstration of confirming the carpel tunnel syndrome by nerve conduction studies were given. Following this, the same post test was then repeated. RESULTS The arithmetic mean value of pretest score was 3.5, which improved to 8.33 after the lecture session. After the live demonstration of nerve conduction studies, the mean value further increased to 9.8333. The ‘p’ value of the paired t-test after the lecture session was 0.000113, which is significant. The ‘p’ value after the live demonstration session was 0.008612, which is also significant. CONCLUSION The active teaching learning method is found to be more effective than the didactic lecture. Immediate and short-term gains are seen with such programmes.

IDENTIFICATION OF SOME COMPOSITE MEDICINAL DRUGS CONTAINING PARACETAMOL, WITH IR-SPECTROMETRY METHOD

Directory of Open Access Journals (Sweden)

A. S. Saushkina

2017-01-01

Full Text Available A serious threat to the health of the population is falsified medicines. In a number of cases, they are identified in the process of incoming quality control for compliancewith the requirements of regulatory documents for indicators “Description”, “Packaging”, “Marking”. However, in order to identify sophisticated counterfeits, only a visual assessment of the drug is not enough. Purpose screening evaluation of potentiallycounterfeited or poor-quality drugs using the IR spectrometry along the total spectrum.Materials and methods. The objects of research were available in freely availablecommercially available tablets produced by domestic and foreign manufacturers“Paracetamol Extratab”, “Solpadein fast”, “Citrapac”, “Citramon P”, “Ascofen-P”,  corresponding to the requirements of the current regulatory documents. The studies were carried out on a Fourier-Spectrophotometer infrared “FSM 1201”. Results and discussion. On the example of the tablets “Citramon P”, “Ascophen-P”, “Citrapac”, “Paracetamol Extratab”, “Solpadein Fast” the possibility of using the total IR spectra as a primary screening index of authenticity is shown. It was established that the total IR spectra of medicines of similar composition reflect the similarity of serial samples of the products ofone manufacturer and the difference in serial samples of products of different manufacturers.

Nuclear medicine methods in the assessment of acupuncture effects: a short review

Energy Technology Data Exchange (ETDEWEB)

Souza, Deise Elisabete; Rebello, Bernardo Machado; Agostinho, Raquel Terra [Universidade do Estado do Rio de Janeiro (UERJ), RJ (Brazil). Inst. de Biologia Roberto Alcantara Gomes. Lab. de Radiofarmacia Experimental; Academia Brasileira de Arte e Ciencia Oriental, Rio de Janeiro, RJ (Brazil); E-mail: deise_desouza@yahoo.com.br; Silva Filho, Reginaldo de Carvalho [Escola Brasileira de Medicina Chinesa, Sao Paulo, SP (Brazil). Centro Avancado de Pesquisas em Ciencias Orientais; Bastos, Sohaku R.C. [Academia Brasileira de Arte e Ciencia Oriental, Rio de Janeiro, RJ (Brazil); Bernardo-Filho, Mario [Instituto Nacional de Cancer (INCa), Rio de Janeiro, RJ (Brazil). Centro de Pesquisa Basica

2007-09-15

The mechanisms of acupuncture are poorly understood. In consequence, numerous investigators have conducted clinical trials to test the efficacy of acupuncture in various conditions. We have used PubMed database system to evaluate the number of publications in acupuncture and nuclear medicine procedures in the period from 1964 to 2007, using the keywords: 'nuclear medicine and acupuncture', 'SPECT and acupuncture, 'PET and acupuncture', 'scintigraphy and acupuncture, 'radionuclide and acupuncture', 'radiopharmaceutical and acupuncture', 'radioisotope and acupuncture' and {sup 99m}Tc and acupuncture'. Some papers published in English language were selected and a short review is presented The analysis of the number of publications shows that when a method is well accepted by the scientific community, as the methods used in nuclear medicine, the interest in the development of research increases. Moreover, important findings are presented when the nuclear medicine image is used to evaluate the effect of the acupuncture. (author)

In-plane Material Filters for the Discrete Material Optimization Method

DEFF Research Database (Denmark)

Sørensen, Rene; Lund, Erik

2015-01-01

, because the projection filter is a non-linear function of the design variables, the projected variables have to be re-scaled in a final so-called normalization filter. This is done to prevent the optimizer in creating superior, but non-physical pseudo-materials. The method is demonstrated on a series......This paper presents in-plane material filters for the Discrete Material Optimization method used for optimizing laminated composite structures. The filters make it possible for engineers to specify a minimum length scale which governs the minimum size of areas with constant material continuity....... Consequently, engineers can target the available production methods, and thereby increase its manufacturability while the optimizer is free to determine which material to apply together with an optimum location, shape, and size of these areas with constant material continuity. By doing so, engineers no longer...

Computational Methods in Medicine

Directory of Open Access Journals (Sweden)

Angel Garrido

2010-01-01

Full Text Available Artificial Intelligence requires Logic. But its Classical version shows too many insufficiencies. So, it is absolutely necessary to introduce more sophisticated tools, such as Fuzzy Logic, Modal Logic, Non-Monotonic Logic, and so on [2]. Among the things that AI needs to represent are Categories, Objects, Properties, Relations between objects, Situations, States, Time, Events, Causes and effects, Knowledge about knowledge, and so on. The problems in AI can be classified in two general types
[3, 4], Search Problems and Representation Problem. There exist different ways to reach this objective. So, we have [3] Logics, Rules, Frames, Associative Nets, Scripts and so on, that are often interconnected. Also, it will be very useful, in dealing with problems of uncertainty and causality, to introduce Bayesian Networks and particularly, a principal tool as the Essential Graph. We attempt here to show the scope of application of such versatile methods, currently fundamental in Medicine.

Soft Material-Enabled, Flexible Hybrid Electronics for Medicine, Healthcare, and Human-Machine Interfaces

Science.gov (United States)

Herbert, Robert; Kim, Jong-Hoon; Kim, Yun Soung; Lee, Hye Moon

2018-01-01

Flexible hybrid electronics (FHE), designed in wearable and implantable configurations, have enormous applications in advanced healthcare, rapid disease diagnostics, and persistent human-machine interfaces. Soft, contoured geometries and time-dynamic deformation of the targeted tissues require high flexibility and stretchability of the integrated bioelectronics. Recent progress in developing and engineering soft materials has provided a unique opportunity to design various types of mechanically compliant and deformable systems. Here, we summarize the required properties of soft materials and their characteristics for configuring sensing and substrate components in wearable and implantable devices and systems. Details of functionality and sensitivity of the recently developed FHE are discussed with the application areas in medicine, healthcare, and machine interactions. This review concludes with a discussion on limitations of current materials, key requirements for next generation materials, and new application areas. PMID:29364861

Soft Material-Enabled, Flexible Hybrid Electronics for Medicine, Healthcare, and Human-Machine Interfaces

Directory of Open Access Journals (Sweden)

Robert Herbert

2018-01-01

Full Text Available Flexible hybrid electronics (FHE, designed in wearable and implantable configurations, have enormous applications in advanced healthcare, rapid disease diagnostics, and persistent human-machine interfaces. Soft, contoured geometries and time-dynamic deformation of the targeted tissues require high flexibility and stretchability of the integrated bioelectronics. Recent progress in developing and engineering soft materials has provided a unique opportunity to design various types of mechanically compliant and deformable systems. Here, we summarize the required properties of soft materials and their characteristics for configuring sensing and substrate components in wearable and implantable devices and systems. Details of functionality and sensitivity of the recently developed FHE are discussed with the application areas in medicine, healthcare, and machine interactions. This review concludes with a discussion on limitations of current materials, key requirements for next generation materials, and new application areas.

Medicinal plants of Lorestan

Directory of Open Access Journals (Sweden)

shahla ahmadi

2010-03-01

Full Text Available Collection and determination of medicinal plants in Lorestan province have been carried out for 6 years in the agriculture and natural resources research of center of Lorestan. The aims of this study were collection and identification the medicinal plans that grow in Loretta province, their distribution, habitat, traditional uses, utilized organ, manner of usage, botany specification, local name, Persian name and scientific name. Material and methods: Medicinal plants were collected from different regions by using field and library study for these goals we prepared a list of recorded medicinal plants from Lorestan, identified the local herbal experts. Results: Finally we collected 151 medicinal plant identified that related to 63 families and 90 genuses. The Lamiaceae, Compositae, Legominosae , Liliaceae, Umbelliferae and . Rosaceae are the greatest family in the Lorestan province. Diction: According to the literature 96 medicinal plans were recorded from Lorestan, but during this study we collected and identified 151 medicinal plants in Lorestan province. Comparing with those that recorded from Bushehr 70 sp.(9, Hormozgan 113 sp.(10, Markazi 144 sp. And Kordestan 144 sp(11. We have more diversity but comparing with Zanjan 163 sp.(13, Hamedan 315 sp.(14 And Qazvin 250 sp.(15 We have less diversity in medicinal plants.

Children's (Pediatric) Nuclear Medicine

Medline Plus

Full Text Available ... Nuclear Medicine Children’s (pediatric) nuclear medicine imaging uses small amounts of radioactive materials called radiotracers, a special ... is a branch of medical imaging that uses small amounts of radioactive material to diagnose and determine ...

An Observational Study of 3 Different Transfusion Medicine Teaching Methods for Medical Students.

Science.gov (United States)

Konia, Mojca Remskar; Richtsfeld, Martina; Johnson, Andrew D; Lougee, Michael; Cohn, Claudia; Morgan, Shanna

2018-04-01

Knowledge deficits of transfusion medicine are prevalent among learners and practicing physicians. In the past, the transfusion medicine community has thoughtfully defined the content of transfusion medicine curriculums through Transfusion Medicine Academic Award Group and The Academy of Clinical Laboratory Physicians and Scientists. The manner in which the curriculum should be delivered has been less carefully examined and defined. We completed an observational study in which we analyzed 3 different teaching techniques: in-person faculty-led simulation curriculum consisting of didactic session and simulation ("Simulation group"); hybrid education with a combination of online materials and short in-person simulation ("Hybrid group"); and online-only education module, which delivered the whole curricular content through a variety of online materials and videos ("Online-only group"). Knowledge acquisition was assessed with a 10-question multiple-choice questionnaire, and satisfaction was assessed by a 9-question online student satisfaction survey. A total of 276second-year medical students participated in the study. There was statistically significant difference between pre- and posttest results and in knowledge gain favoring the Simulation group as compared with the Online-only group (P=.03, P<.0001) and favoring the Simulation group as compared with the Hybrid group (P=.004, P<.0001). The Simulation group and Hybrid group medical students were also more satisfied with the education activity as compared with the Online-only group (P<.0001, P<.001). Our study demonstrated that a faculty-run transfusion medicine simulation curriculum consisting of an in-person didactic session and simulation session for the second-year medical students produced greater immediate knowledge acquisition compared with an online only or a hybrid curriculum. Furthermore, any curriculum that contained in-person teaching by faculty was preferred over the online only education. Copyright �

Proposal of a monitoring program of occupational exposure by incorporation of radioactive material for nuclear medicine services in the Caja Costarricense del Seguro Social

International Nuclear Information System (INIS)

Badilla Segura, Mirta

2013-01-01

A monitoring program of the occupational exposure by incorporation of radioactive material is proposed. Nuclear medicine services of the Caja Costarricense del Seguro Social (CCSS) are evaluated. The monitoring program is based on the provisions of the International Atomic Energy Agency and of study of nuclear medicine services of the CCSS. Radionuclides are determined for monitoring of the occupational exposure, according to the radioactive material that is worked in nuclear medicine services of the CCSS. The appropriate and alternative techniques are established for the monitoring of the occupational exposure by incorporation of radioactive material, depending on the type of radionuclide that is worked in nuclear medicine services. The worker occupationally exposed (TOE) should be subject of monitoring and how often should be realized the monitoring of the occupational exposure. The monitoring of the radiation by radioactive material must be applied to personnel working in radiopharmacies and the worker has carried out therapeutic procedures for handling of significant amounts of 13 1 I. The calculation of the committed effective dose is proposed by incorporation of radioactive material with the TOE [es

[Policy recommendations based on SWOT analysis for agricultural industrialization of traditional Chinese medicinal materials--a case study of uncariae ramulus cum uncis from Jianhe county in Guizhou province].

Science.gov (United States)

Hu, Yong; Huo, Ke-Yi; Xiang, Hua

2013-09-01

This thesis reviews the historical background of agricultural industrialization, and analyzes the major theories of agricultural industrialization. It also utilizes SWOT analysis method to discuss the industrialization of traditional Chinese medicinal materials in Jianhe county, and finally it puts forward the recommendations for its further development.

Systems and methods for treating material

Science.gov (United States)

Scheele, Randall D; McNamara, Bruce K

2014-10-21

Systems for treating material are provided that can include a vessel defining a volume, at least one conduit coupled to the vessel and in fluid communication with the vessel, material within the vessel, and NF.sub.3 material within the conduit. Methods for fluorinating material are provided that can include exposing the material to NF.sub.3 to fluorinate at least a portion of the material. Methods for separating components of material are also provided that can include exposing the material to NF.sub.3 to at least partially fluorinate a portion of the material, and separating at least one fluorinated component of the fluorinated portion from the material. The materials exposed to the NF.sub.3 material can include but are not limited to one or more of U, Ru, Rh, Mo, Tc, Np, Pu, Sb, Ag, Am, Sn, Zr, Cs, Th, and/or Rb.

Nuclear medicine and imaging research (instrumentation and quantitative methods of evaluation)

International Nuclear Information System (INIS)

Beck, R.N.; Cooper, M.; Chen, C.T.

1992-07-01

This document is the annual progress report for project entitled ''Instrumentation and Quantitative Methods of Evaluation.'' Progress is reported in separate sections individually abstracted and indexed for the database. Subject areas reported include theoretical studies of imaging systems and methods, hardware developments, quantitative methods of evaluation, and knowledge transfer: education in quantitative nuclear medicine imaging

[Application of Delphi method in traditional Chinese medicine clinical research].

Science.gov (United States)

Bi, Ying-fei; Mao, Jing-yuan

2012-03-01

In recent years, Delphi method has been widely applied in traditional Chinese medicine (TCM) clinical research. This article analyzed the present application situation of Delphi method in TCM clinical research, and discussed some problems presented in the choice of evaluation method, classification of observation indexes and selection of survey items. On the basis of present application of Delphi method, the author analyzed the method on questionnaire making, selection of experts, evaluation of observation indexes and selection of survey items. Furthermore, the author summarized the steps of application of Delphi method in TCM clinical research.

Quantitative Nuclear Medicine Imaging: Concepts, Requirements and Methods

Energy Technology Data Exchange (ETDEWEB)

NONE

2014-01-15

The absolute quantification of radionuclide distribution has been a goal since the early days of nuclear medicine. Nevertheless, the apparent complexity and sometimes limited accuracy of these methods have prevented them from being widely used in important applications such as targeted radionuclide therapy or kinetic analysis. The intricacy of the effects degrading nuclear medicine images and the lack of availability of adequate methods to compensate for these effects have frequently been seen as insurmountable obstacles in the use of quantitative nuclear medicine in clinical institutions. In the last few decades, several research groups have consistently devoted their efforts to the filling of these gaps. As a result, many efficient methods are now available that make quantification a clinical reality, provided appropriate compensation tools are used. Despite these efforts, many clinical institutions still lack the knowledge and tools to adequately measure and estimate the accumulated activities in the human body, thereby using potentially outdated protocols and procedures. The purpose of the present publication is to review the current state of the art of image quantification and to provide medical physicists and other related professionals facing quantification tasks with a solid background of tools and methods. It describes and analyses the physical effects that degrade image quality and affect the accuracy of quantification, and describes methods to compensate for them in planar, single photon emission computed tomography (SPECT) and positron emission tomography (PET) images. The fast paced development of the computational infrastructure, both hardware and software, has made drastic changes in the ways image quantification is now performed. The measuring equipment has evolved from the simple blind probes to planar and three dimensional imaging, supported by SPECT, PET and hybrid equipment. Methods of iterative reconstruction have been developed to allow for

Post-Processing in the Material-Point Method

DEFF Research Database (Denmark)

Andersen, Søren; Andersen, Lars Vabbersgaard

The material-point method (MPM) is a numerical method for dynamic or static analysis of solids using a discretization in time and space. The method has shown to be successful in modelling physical problems involving large deformations, which are difficult to model with traditional numerical tools...... such as the finite element method. In the material-point method, a set of material points is utilized to track the problem in time and space, while a computational background grid is utilized to obtain spatial derivatives relevant to the physical problem. Currently, the research within the material-point method......-point method. The first idea involves associating a volume with each material point and displaying the deformation of this volume. In the discretization process, the physical domain is divided into a number of smaller volumes each represented by a simple shape; here quadrilaterals are chosen for the presented...

Applied computing in medicine and health

CERN Document Server

Al-Jumeily, Dhiya; Mallucci, Conor; Oliver, Carol

2015-01-01

Applied Computing in Medicine and Health is a comprehensive presentation of on-going investigations into current applied computing challenges and advances, with a focus on a particular class of applications, primarily artificial intelligence methods and techniques in medicine and health. Applied computing is the use of practical computer science knowledge to enable use of the latest technology and techniques in a variety of different fields ranging from business to scientific research. One of the most important and relevant areas in applied computing is the use of artificial intelligence (AI) in health and medicine. Artificial intelligence in health and medicine (AIHM) is assuming the challenge of creating and distributing tools that can support medical doctors and specialists in new endeavors. The material included covers a wide variety of interdisciplinary perspectives concerning the theory and practice of applied computing in medicine, human biology, and health care. Particular attention is given to AI-bas...

Significance of roentgenologic and nuclear medicine methods in diagnosis and operative indications of coronary artery disease

Energy Technology Data Exchange (ETDEWEB)

Felix, R [Bonn Univ. (F.R. Germany). Radiologische Klinik; Winkler, C [Bonn Univ. (F.R. Germany). Inst. fuer Klinische und Experimentelle Nuklearmedizin; Schaede, A [Bonn Univ. (F.R. Germany). Medizinische Klinik

1976-03-01

Significance and technique of roentgenologic and nuclear medicine methods for evaluation of coronary artery disease and myocardial perfusion are presented. Some routinely used methods in nuclear medicine are briefly discussed concerning the evaluation of left ventricular function.

Hartree-fock-slater method for materials science the DV-X alpha method for design and characterization of materials

CERN Document Server

Adachi, H; Kawai, J

2006-01-01

Molecular-orbital calculations for materials design such as alloys, ceramics, and coordination compounds are now possible for experimentalists. Molecuar-orbital calculations for the interpretation of chemical effect of spectra are also possible for experimentalists. The most suitable molecular-orbital calculation method for these purpose is the DV-Xa method, which is robust in such a way that the calculation converges to a result even if the structure of the molecule or solid is impossible in the pressure and temperature ranges on earth. This book specially addresses the methods to design novel materials and to predict the spectralline shape of unknown materials using the DV-Xa molecular-orbital method, but is also useful for those who want to calculate electronic structures of materials using any kind of method.

[Discussion on appraisal methods and key technologies of arbuscular mycorrhizal fungi and medicinal plant symbiosis system].

Science.gov (United States)

Chen, Meilan; Guo, Lanping; Yang, Guang; Chen, Min; Yang, Li; Huang, Luqi

2011-11-01

Applications of arbuscular mycorrhizal fungi in research of medicinal plant cultivation are increased in recent years. Medicinal plants habitat is complicated and many inclusions are in root, however crop habitat is simple and few inclusions in root. So appraisal methods and key technologies about the symbiotic system of crop and arbuscular mycorrhizal fungi can't completely suitable for the symbiotic system of medicinal plants and arbuscular mycorrhizal fungi. This article discuss the appraisal methods and key technologies about the symbiotic system of medicinal plant and arbuscular mycorrhizal fungi from the isolation and identification of arbuscular mycorrhiza, and the appraisal of colonization intensity. This article provides guidance for application research of arbuscular mycorrhizal fungi in cultivation of medicinal plants.

Methods of fabricating cermet materials and methods of utilizing same

Science.gov (United States)

Kong, Peter C.

2006-04-04

Methods of fabricating cermet materials and methods of utilizing the same such as in filtering particulate and gaseous pollutants from internal combustion engines having intermetallic and ceramic phases. The cermet material may be made from a transition metal aluminide phase and an aluminia phase. The mixture may be pressed to form a green compact body and then heated in a nitrogen-containing atmosphere so as to melt aluminum particles and form the cermet. Filler materials may be added to increase the porosity or tailor the catalytic properties of the cermet material. Additionally, the cermet material may be reinforced with fibers or screens. The cermet material may also be formed so as to pass an electrical current therethrough to heat the material during use.

Methods of producing cermet materials and methods of utilizing same

Science.gov (United States)

Kong, Peter C [Idaho Falls, ID

2008-12-30

Methods of fabricating cermet materials and methods of utilizing the same such as in filtering particulate and gaseous pollutants from internal combustion engines having intermetallic and ceramic phases. The cermet material may be made from a transition metal aluminide phase and an alumina phase. The mixture may be pressed to form a green compact body and then heated in a nitrogen-containing atmosphere so as to melt aluminum particles and form the cermet. Filler materials may be added to increase the porosity or tailor the catalytic properties of the cermet material. Additionally, the cermet material may be reinforced with fibers or screens. The cermet material may also be formed so as to pass an electrical current therethrough to heat the material during use.

Modern nuclear medicine methods as a topic of biophysics in veterinary training at UVM in Kosice

International Nuclear Information System (INIS)

Stanicova, J.; Lohajova, L.

2004-01-01

Diagnostic and therapeutic application of ionising radiation is very important in all of branches of medicine including veterinary medicine. In veterinary training at University of Veterinary Medicine in Kosice (UVM), biophysics is a basic subject and it grants physical basis necessary for understanding subsequent subjects such as veterinary surgery, roentgenology, orthopedics. In view of this, traditional methods of radiology such as fluoroscopy, skiagraphy and tomography are explaining. The appearance and application of the theory so called reconstruction of image and also computers led to qualitatively new solutions via the development of modern methods in radiology. Explaining of physical principles, advantages or disadvantages of these new methods is also important in veterinary training although some of them do not use in veterinary practice yet. Two modern methods of nuclear medicine using in diagnostic (SPECT and PET) are discussed bellow. (authors)

Urban forest justice and the rights to wild foods, medicines, and materials in the city

Science.gov (United States)

Melissa R. Poe; Rebecca J. McClain; Marla Emery; Patrick. Hurley

2013-01-01

Urban forests are multifunctional socio-ecological landscapes, yet some of their social benefits remain poorly understood. This paper draws on ethnographic evidence from Seattle, Washington to demonstrate that urban forests contain nontimber forest products that contribute a variety of wild foods, medicines, and materials for the wellbeing of urban residents. We show...

[Study on material base of Carthamus tinctorius with antioxidant effect based on selective knock-out].

Science.gov (United States)

Wang, Lin-Yan; Tang, Yu-Ping; Liu, Xin; Ge, Ya-Hui; Li, Shu-Jiao; Shang, Er-Xin; Duan, Jin-Ao

2014-04-01

To establish a method for studying efficacious materials of traditional Chinese medicines from an overall perspective. Carthamus tinctorius was taken the example. Its major components were depleted by preparing liquid chromatography. Afterwards, the samples with major components depleted were evaluated for their antioxidant effect, so as to compare and analyze the major efficacious materials of C. tinctorius with antioxidant activity and the contributions. Seven major components were depleted from C. tinctorius samples, and six of them were identified with MS data and control comparison. After all of the samples including depleted materials are compared and evaluated for their antioxidant effect, the findings showed that hydroxysafflor yellow A, anhydrosafflor yellow B and 6-hydroxykaempferol-3, 6-di-O-glucoside-7-O-glucuronide were the major efficacious materials. This study explored a novel and effective method for studying efficacious materials of traditional Chinese medicines. Through this method, we could explain the direct and indirect contributions of different components to the efficacy of traditional Chinese medicines, and make the efficacious material expression of traditional Chinese medicines clearer.

Exploring in integrated quality evaluation of Chinese herbal medicines: the integrated quality index (IQI) for aconite.

Science.gov (United States)

Zhang, Ding-kun; Wang, Jia-bo; Yang, Ming; Peng, Cheng; Xiao, Xiao-he

2015-07-01

Good medicinal herbs, good drugs. Good evaluation method and indices are the prerequisite of good medicinal herbs. However, there exist numerous indices for quality evaluation and control in Chinese medicinal materials. However, most of these indices are non-interrelated each other, as well as having little relationship with efficiency and safety. The results of different evaluatior methods may not be consistent, even contradictory. Considering the complex material properties of Chinese medicinal materials, single method and index is difficult to objectively and comprehensively reflect the quality. Therefore, it is essential to explore the integrated evaluation methods. In this paper, oriented by the integrated evaluation strategies for traditional Chinese medicine quality, a new method called integrated quality index (IQI) by the integration of empirical evaluation, chemical evaluation, and biological evaluation was proposed. In addition, a study case of hypertoxic herb Aconitum carmichaelii Debx. was provided to explain this method in detail. The results suggested that in the view of specifications, the average weight of Jiangyou aconite was the greatest, followed by Weishan aconite, Butuo aconite, Hanzhong aconite, and Anxian aconite; from the point of chemical components, Jiangyou aconite had the characteristic with strong efficacy and weak toxicity, next was Hanzhong aconite, Butuo aconite, Weishan aconite, and Anxian aconite; taking toxicity price as the index, Hanzhong aconite and Jiangyou aconite have the lower toxicity, while Butuo aconite, Weishan aconite, and Anxian aconite have the relatively higher one. After the normalization and integration of evaluation results, we calculated the IQI value of Jiangyou aconite, Hanzhong aconite, Butuo aconite, Weishan aconite, and Anxian aconite were 0.842 +/- 0.091, 0.597 +/- 0.047, 0.442 +/- 0.033, 0.454 +/- 0.038, 0.170 +/- 0.021, respectively. The quality of Jiangyou aconite is significantly better than the

Method of treating radioactive waste material

International Nuclear Information System (INIS)

Allison, W.

1980-01-01

A method of treating radioactive waste material, particularly a radioactive sludge, is described comprising separating solid material from liquid material, compressing the solid material and encapsulating the solid material in a hardenable composition such as cement, bitumen or a synthetic resin. The separation and compaction stages are conveniently effected in a tube press. (author)

Materials For Gas Capture, Methods Of Making Materials For Gas Capture, And Methods Of Capturing Gas

KAUST Repository

Polshettiwar, Vivek

2013-06-20

In accordance with the purpose(s) of the present disclosure, as embodied and broadly described herein, embodiments of the present disclosure, in one aspect, relate to materials that can be used for gas (e.g., CO.sub.2) capture, methods of making materials, methods of capturing gas (e.g., CO.sub.2), and the like, and the like.

IDENTIFYING CONCERNS OF POSTGRADUATES IN COMMUNITY MEDICINE USING A QUALITATIVE RESEARCH METHOD- VISUALISATION IN PARTICIPATORY PROGRAMMES (VIPP

Directory of Open Access Journals (Sweden)

Vinay Babu Koganti

2017-06-01

Full Text Available BACKGROUND Postgraduation in Community Medicine finds few takers and those who do take it up as a career option have many concerns regarding the course. To understand the issues involved, a qualitative method called VIPP was used, which is a people centered approach to identify issues from the perspectives of those involved. This study is set to identify the problems faced by postgraduate students in Community Medicine regarding their course of study. MATERIALS AND METHODS This study was conducted during a regional postgraduate CME of the NTR University of Health Sciences, Andhra Pradesh. Postgraduates and junior faculty from 5 medical colleges in the region were involved in the exercise after taking their informed consent. Visualisation in Participatory Programmes (VIPP, a qualitative method was used as a means of obtaining information followed by a discussion with visual display of all the mentioned items. RESULTS The themes that emerged are problems faced due to the student’s felt inadequacies, faculty shortcomings, issues regarding the department/college management and lacunae in the course structure and implementation. CONCLUSION In VIPP, sensitive issues are visually displayed for all to see and contemplate. Many of the student’s issues were actually brought on by poor curriculum planning and implementation. This was also undermining students’ self-esteem and causing anxiety about future career prospects.

Students’ perception of teaching-learning methods in Community Medicine at a Government Medical College in Rajasthan

Directory of Open Access Journals (Sweden)

Rupa Sharma

2017-06-01

Full Text Available Background: Knowledge of Community Medicine plays a pivot role in effective delivery of health care services. Effective Teaching-Learning (T-L of a class of 150-200 students is a challenge. Research is needed to identify methods suitable to the needs of the students. Students’ perspective is an important diagnostic feedback tool in this context. Aims & Objectives: To know the students’ preferences and perceptions regarding current T-L methods and their felt need for modification in the T-L approach. Material & Methods: Responses were collected from students pursuing internship regarding their preferences and perception on a pretested, validated semi structured questionnaire, most of the responses were collected on a Likert type five point scale. The data was analyzed by calculating percentage, mean and Standard Deviation (SD. Result: Majority (66.2% felt a need for modification in T-L Approach and 74% of these opined that it will improve their performance in assessments. Presentation of content was voted as most important component for effective T-L (mean 3.9± 1.39. Desirable modifications was more time allotment to integrated modular T-L (51% and field visits (26%. Conclusion: A judicious combination of Power point presentations with Modular T-L sessions and Field visits can be a more effective T-L approach in Community Medicine from the students’ perspective.

[Herbal textual research of common Mongolian medicine "Du Ge Mo Nong"].

Science.gov (United States)

Xi, Jie; Zhong, Hua-Rong; Wucharila-Tu; Buhe Bater; Li, Hui-Hu; Zhong, Guo-Yue

2016-11-01

This study is aimed to provide the source for clinical medication by clarifing the common base of Mongolia medicinal materials "Du Ge Mo Nong". In this paper literature research and plant taxonomy method were adopted combined with investigation of the markets and clinical use status to clarify the origin of common traditional Mongolian medicine "Du Ge Mo Nong". The results showed that the Mongolian medicine "Du Ge Mo Nong" and Tibetan medicine "Du Mu Niu" were the same crude drug and originated from the seeds of Holarrhena antidysenteriaca of family Apocynaceae in earliest time. In Mongolian medicine clinic, the seed of Cynanchum thesioides of family Asclepiadaceae and the fruit of Forsythia suspense of family Oleaceae was used respectively about 18 century and recent time, as the substitutes of H. antidysenteriaca. In present standards on Mongolian material medicine, C. thesioides is including only, and H. antidysenterica is not used almost. In Tibetan medicine clinic, H. antidysenterica is being used so far. But there are various substitutes including the seeds, fruits or grass of many species classified to family Apocynaceae, Asclepiadaceae and Onagraceae from ancient time to the present, and C. forrestii and C. komarovii may be used at present. It's necessary to strengthen the arrangement on Mongolian medicine's varieties by the multidisciplinary methods including literature research, investigation of resources and the use state, and comparison of active substances and biological activities between the different substitutes,and so on. Copyright© by the Chinese Pharmaceutical Association.

Nuclear methods in medicine

International Nuclear Information System (INIS)

Wolfe, D.M.

1997-01-01

Physicists have created remarkably sophisticated instruments for the performance of experiments. With variable phase lags many of these have become useful in technology. In the medical field NMD techniques have become commonplace under the rubric of Magnetic Resonance Imaging. Particle physics has developed sophisticated detectors for both charged and neutral particles. Many of these also have been adapted to medical uses. In both radiology and nuclear medicine, pixel detectors based on designs originating at large-scale colliders, are becoming highly useful in replacing film and NaI as the primary means of X-ray and (-ray detection. Coupled with high-speed work stations, these new techniques allow exciting new imagining modalities. Many of these are based on the handling of digital images originally developed for astronomy. Thus, once again, fundamental science is making large contributions to the development of technology. In this talk, various examples of developments in digital mammography and digital detectors for nuclear medicine will be given. The possibilities for telemedicine will be discussed. (author)

Early Patient Access to Medicines: Health Technology Assessment Bodies Need to Catch Up with New Marketing Authorization Methods.

Science.gov (United States)

Leyens, Lada; Brand, Angela

National and international medicines agencies have developed innovative methods to expedite promising new medicines to the market and facilitate early patient access. Some of these approval pathways are the conditional approval and the adaptive pathways by the European Medicines Agency (EMA); the Promising Innovative Medicine (PIM) designation and the Early Access to Medicines Scheme (EAMS) by the Medicines and Healthcare Products Regulatory Agency (MHRA), as well as the Fast Track, Breakthrough or Accelerated Approval methods by the Food and Drug Administration (FDA). However, at least in Europe, these methods cannot achieve the goal of improving timely access for patients to new medicines on their own; the reimbursement process also has to become adaptive and flexible. In the past 2 years, the effective access (national patient access) to newly approved oncology drugs ranged from 1 to 30 months, with an extremely high variability between European countries. The goal of early patient access in Europe can only be achieved if the national health technology assessment bodies, such as NICE (ENG), HAS (FR), G-BA (DE) or AIFA (IT), provide harmonized, transparent, flexible, conditional and adaptive methods that adopt the level of evidence accepted by the medicines agencies. The efforts from medicines agencies are welcome but will be in vain if health technology assessments do not follow with similar initiatives, and the European 'postcode' lottery will continue. © 2016 S. Karger AG, Basel.

Statistical methods and materials characterisation

International Nuclear Information System (INIS)

Wallin, K.R.W.

2010-01-01

Statistics is a wide mathematical area, which covers a myriad of analysis and estimation options, some of which suit special cases better than others. A comprehensive coverage of the whole area of statistics would be an enormous effort and would also be outside the capabilities of this author. Therefore, this does not intend to be a textbook on statistical methods available for general data analysis and decision making. Instead it will highlight a certain special statistical case applicable to mechanical materials characterization. The methods presented here do not in any way rule out other statistical methods by which to analyze mechanical property material data. (orig.)

Impact of medicine-related information on medicine purchase and use by literate consumers

OpenAIRE

Thawani, Vijay R.; Gharpure, Kunda J.; Sontakke, Smita D.

2014-01-01

Aims: To measure impact of information, education, and communication intervention (IEC) on rational medicine use, purchase, and stocking behavior. Materials and Methods: This was a pre- and post-design, interventional study. Base data were collected in first visit, using pre tested questionnaire from 500 respondents, who were of either gender, English speaking, at least graduates, permanent residents, and willing to participate. IEC was framed based on problems identified from this data. ...

Nuclear medicine

International Nuclear Information System (INIS)

Kand, Purushottam

2012-01-01

Nuclear medicine is a specialized area of radiology that uses very small amounts of radioactive materials to examine organ function and structure. Nuclear medicine is older than CT, ultrasound and MRI. It was first used in patients over 60-70 years ago. Today it is an established medical specialty and offers procedures that are essential in many medical specialities like nephrology, pediatrics, cardiology, psychiatry, endocrinology and oncology. Nuclear medicine refers to medicine (a pharmaceutical) that is attached to a small quantity of radioactive material (a radioisotope). This combination is called a radiopharmaceutical. There are many radiopharmaceuticals like DTPA, DMSA, HIDA, MIBI and MDP available to study different parts of the body like kidneys, heart and bones etc. Nuclear medicine uses radiation coming from inside a patient's body where as conventional radiology exposes patients to radiation from outside the body. Thus nuclear imaging study is a physiological imaging, whereas diagnostic radiology is anatomical imaging. It combines many different disciplines like chemistry, physics mathematics, computer technology, and medicine. It helps in diagnosis and to treat abnormalities very early in the progression of a disease. The information provides a quick and accurate diagnosis of wide range of conditions and diseases in a person of any age. These tests are painless and most scans expose patients to only minimal and safe amounts of radiation. The amount of radiation received from a nuclear medicine procedure is comparable to, or often many times less than, that of a diagnostic X-ray. Nuclear medicine provides an effective means of examining whether some tissues/organs are functioning properly. Therapy using nuclear medicine in an effective, safe and relatively inexpensive way of controlling and in some cases eliminating, conditions such as overactive thyroid, thyroid cancer and arthritis. Nuclear medicine imaging is unique because it provides doctors with

Method of forming aluminum oxynitride material and bodies formed by such methods

Science.gov (United States)

Bakas, Michael P [Ammon, ID; Lillo, Thomas M [Idaho Falls, ID; Chu, Henry S [Idaho Falls, ID

2010-11-16

Methods of forming aluminum oxynitride (AlON) materials include sintering green bodies comprising aluminum orthophosphate or another sacrificial material therein. Such green bodies may comprise aluminum, oxygen, and nitrogen in addition to the aluminum orthophosphate. For example, the green bodies may include a mixture of aluminum oxide, aluminum nitride, and aluminum orthophosphate or another sacrificial material. Additional methods of forming aluminum oxynitride (AlON) materials include sintering a green body including a sacrificial material therein, using the sacrificial material to form pores in the green body during sintering, and infiltrating the pores formed in the green body with a liquid infiltrant during sintering. Bodies are formed using such methods.

POSSIBILITY OF NATURAL RAW MATERIALS USE IN THE FORMULATION OF ADJUVANT THERAPY OF TUBERCULOSIS: EXPERIENCE OF FOLK MEDICINE, MODERN STATE OF STUDIES

Directory of Open Access Journals (Sweden)

M. E. Kim

2017-01-01

Full Text Available The signs of growth in the prevalence of multidrug-resistant tuberculosis, low effectiveness of therapy indicate the urgent need to solve problems aimed at the improvement of the effectiveness of treatment: the reduction of toxicity and side effects of anti-tuberculosis drugs, the provision of good tolerability and continuity of chemotherapy; the removal of symptoms of intoxication associated with the action of the pathogen on the body, the improvement of the quality of life of patients during therapy and remission.The aim of the investigation is to study the data of folk medicine, scientific research data concerning the use of raw materials of natural (vegetable, animal and mineral origin in the adjuvant therapy of tuberculosis.Materials and methods. The study was carried out using information retrieval and library databases (PubMed, eLIBRARY, Cyberleninka, technical information of manufacturers of dietary supplements to food, as well as site materials dedicated to the use of vegetable, animal and mineral raw materials in folk medicine.Results and discussion. The adjuvant therapy of tuberculosis includes remedies of natural origin: vegetable, animal and mineral ones. According to the research data, the use of phytotherapy is aimed at enhancing diuresis, which ensures the elimination of toxic substances and their metabolites, as well as the decrease of the overall level of toxins; the strengthening of the body’s antioxidant defense, and liver specificity, the compensation for the increased consumption of vitamins, amino acids and microelements by the liver, which actively metabolizes xenobiotics, as well as the increase of the body’s overall resistance. A long-term benefit of using natural mineral raw materials in adjuvant therapy of tuberculosis is also observed.Conclusion. Thus, adjuvant therapy of tuberculosis includes the use of raw materials of natural (vegetable, animal and mineral origin, the effectiveness of which is confirmed by

Handbook of Coherent-Domain Optical Methods Biomedical Diagnostics, Environmental Monitoring, and Materials Science

CERN Document Server

2013-01-01

This Handbook provides comprehensive coverage of laser and coherent-domain methods as applied to biomedicine, environmental monitoring, and materials science. Worldwide leaders in these fields describe the fundamentals of light interaction with random media and present an overview of basic research. The latest results on coherent and polarization properties of light scattered by random media, including tissues and blood, speckles formation in multiple scattering media, and other non-destructive interactions of coherent light with rough surfaces and tissues, allow the reader to understand the principles and applications of coherent diagnostic techniques. The expanded second edition has been thoroughly updated with particular emphasis on novel coherent-domain techniques and their applications in medicine and environmental science. Volume 1 describes state-of-the-art methods of coherent and polarization optical imaging, tomography and spectroscopy; diffusion wave spectroscopy; elastic, quasi-elastic and inelasti...

Nuclear physics methods in materials research

International Nuclear Information System (INIS)

Bethge, K.; Baumann, H.; Jex, H.; Rauch, F.

1980-01-01

Proceedings of the seventh divisional conference of the Nuclear Physics Division held at Darmstadt, Germany, from 23rd through 26th of September, 1980. The scope of this conference was defined as follows: i) to inform solid state physicists and materials scientists about the application of nuclear physics methods; ii) to show to nuclear physicists open questions and problems in solid state physics and materials science to which their methods can be applied. According to the intentions of the conference, the various nuclear physics methods utilized in solid state physics and materials science and especially new developments were reviewed by invited speakers. Detailed aspects of the methods and typical examples extending over a wide range of applications were presented as contributions in poster sessions. The Proceedings contain all the invited papers and about 90% of the contributed papers. (orig./RW)

The new generation of packing materials

International Nuclear Information System (INIS)

Malikov, T.S.; Dzhonmurodov, A.S.; Usmanova, S.R.; Teshaev, Kh.I.; Mukhidinov, Z.K.

2016-01-01

Present article is devoted to new generation of packing materials. The methods of extraction and investigation of component composition and properties of whey protein, zein, carboxymethylcellulose, hyaluronic acid and pectins were elaborated in order to further application them in pharmaceutical industry as composite materials and for capsulation of medicines.

Selective Integration in the Material-Point Method

DEFF Research Database (Denmark)

Andersen, Lars; Andersen, Søren; Damkilde, Lars

2009-01-01

The paper deals with stress integration in the material-point method. In order to avoid parasitic shear in bending, a formulation is proposed, based on selective integration in the background grid that is used to solve the governing equations. The suggested integration scheme is compared...... to a traditional material-point-method computation in which the stresses are evaluated at the material points. The deformation of a cantilever beam is analysed, assuming elastic or elastoplastic material behaviour....

Materials of All-Polish Symposium Nuclear Techniques in Industry, Medicine, Agriculture and Environment Protection

International Nuclear Information System (INIS)

2005-01-01

The All-Polish Symposium Nuclear Techniques in Industry, Medicine, Agriculture and Environment Protection is cyclic (in 3 year period) conference being a broad review of state of art and development of all nuclear branches cooperated with industry and other branches of national economy and public life in Poland. The conference has been divided in one plenary session and 6 problem sessions as follow: Environmental protection, earth sciences, protection of cultural objects; Industrial applications; applications in medicine, medical apparatus; measurement methods, simulations, experiment planning; radiation techniques; laboratories, metrology

Analysis of medicinal plant extracts by neutron activation method; Analise de extratos de plantas medicinais pelo metodo de ativacao com neutrons

Energy Technology Data Exchange (ETDEWEB)

Vaz, Sandra Muntz

1996-12-31

This dissertation has presented the results from analysis of medicinal plant extracts using neutron activation method. Instrumental neutron activation analysis was applied to the determination of the elements Al, Br, Ca, Ce, Cl, Cr, Cs, Fe, K, La, Mg, Mn, Na, Rb, Sb, Sc and Zn in medicinal extracts obtained from Achyrolcline satureoides DC, Casearia sylvestris, Centella asiatica, Citrus aurantium L., Solano lycocarpum, Solidago microglossa, Stryphnondedron barbatiman and Zingiber officinale R. plants. The elements Hg and Se were determined using radiochemical separation by means of retention of Se in HMD inorganic exchanger and solvent extraction of Hg by bismuth diethyl-dithiocarbamate solution. Precision and accuracy of the results have been evaluated by analysing reference materials. The therapeutic action of some elements found in plant extracts analyzed was briefly discussed 70 refs., 13 figs., 15 tabs

Analysis of medicinal plant extracts by neutron activation method; Analise de extratos de plantas medicinais pelo metodo de ativacao com neutrons

Energy Technology Data Exchange (ETDEWEB)

Vaz, Sandra Muntz

1995-12-31

This dissertation has presented the results from analysis of medicinal plant extracts using neutron activation method. Instrumental neutron activation analysis was applied to the determination of the elements Al, Br, Ca, Ce, Cl, Cr, Cs, Fe, K, La, Mg, Mn, Na, Rb, Sb, Sc and Zn in medicinal extracts obtained from Achyrolcline satureoides DC, Casearia sylvestris, Centella asiatica, Citrus aurantium L., Solano lycocarpum, Solidago microglossa, Stryphnondedron barbatiman and Zingiber officinale R. plants. The elements Hg and Se were determined using radiochemical separation by means of retention of Se in HMD inorganic exchanger and solvent extraction of Hg by bismuth diethyl-dithiocarbamate solution. Precision and accuracy of the results have been evaluated by analysing reference materials. The therapeutic action of some elements found in plant extracts analyzed was briefly discussed 70 refs., 13 figs., 15 tabs

Rapid Radiochemical Methods for Asphalt Paving Material ...

Science.gov (United States)

Technical Brief Validated rapid radiochemical methods for alpha and beta emitters in solid matrices that are commonly encountered in urban environments were previously unavailable for public use by responding laboratories. A lack of tested rapid methods would delay the quick determination of contamination levels and the assessment of acceptable site-specific exposure levels. Of special concern are matrices with rough and porous surfaces, which allow the movement of radioactive material deep into the building material making it difficult to detect. This research focuses on methods that address preparation, radiochemical separation, and analysis of asphalt paving materials and asphalt roofing shingles. These matrices, common to outdoor environments, challenge the capability and capacity of very experienced radiochemistry laboratories. Generally, routine sample preparation and dissolution techniques produce liquid samples (representative of the original sample material) that can be processed using available radiochemical methods. The asphalt materials are especially difficult because they do not readily lend themselves to these routine sample preparation and dissolution techniques. The HSRP and ORIA coordinate radiological reference laboratory priorities and activities in conjunction with HSRP’s Partner Process. As part of the collaboration, the HSRP worked with ORIA to publish rapid radioanalytical methods for selected radionuclides in building material matrice

Herbal and Alternative Medicine Use in Tanzanian Adults Admitted with Hypertension-Related Diseases: A Mixed-Methods Study

Science.gov (United States)

Roediger, Rebecca; Jaka, Hyasinta; Bougaila, Amina; Smart, Luke; Langwick, Stacey

2017-01-01

Background Hypertension is increasingly common in sub-Saharan Africa where traditional medicine use is also common. We conducted a hospital-based, mixed-methods study to determine prevalence, pattern, and correlates of herbal and alternative medicine use in Tanzanian adults hospitalized with hypertension. Methods A standardized questionnaire was administered. In-depth interviews were performed on a subset of participants. Factors associated with herbal medicine use were determined by logistic regression. The association between traditional medicine uses and allopathic medication adherence was determined using ordinal logistic regression. Qualitative data were analyzed according to grounded theory. Results Of 213 adults enrolled, 52 (24.4%) reported using herbs during the previous month and 47 (22.1%) reported concurrent use of herbs and allopathic medicines. Lower educational level, nonprofessional employment, and lack of health insurance were significantly associated with herbal medicine use. Alternative medicines use was not associated with lower medication adherence. Qualitative interviews identified several important themes including reasons for herbal medicine use. Conclusion The use of traditional medicines is very common among patients with hypertension. Adults from low socioeconomic status, those with misunderstandings about hypertension, and those without health insurance were more likely to take herbs. Open, nonjudgmental communication between healthcare workers and patients regarding use of traditional medicines must be encouraged in Africa. PMID:28634545

Herbal and Alternative Medicine Use in Tanzanian Adults Admitted with Hypertension-Related Diseases: A Mixed-Methods Study

Directory of Open Access Journals (Sweden)

Anthony Liwa

2017-01-01

Full Text Available Background. Hypertension is increasingly common in sub-Saharan Africa where traditional medicine use is also common. We conducted a hospital-based, mixed-methods study to determine prevalence, pattern, and correlates of herbal and alternative medicine use in Tanzanian adults hospitalized with hypertension. Methods. A standardized questionnaire was administered. In-depth interviews were performed on a subset of participants. Factors associated with herbal medicine use were determined by logistic regression. The association between traditional medicine uses and allopathic medication adherence was determined using ordinal logistic regression. Qualitative data were analyzed according to grounded theory. Results. Of 213 adults enrolled, 52 (24.4% reported using herbs during the previous month and 47 (22.1% reported concurrent use of herbs and allopathic medicines. Lower educational level, nonprofessional employment, and lack of health insurance were significantly associated with herbal medicine use. Alternative medicines use was not associated with lower medication adherence. Qualitative interviews identified several important themes including reasons for herbal medicine use. Conclusion. The use of traditional medicines is very common among patients with hypertension. Adults from low socioeconomic status, those with misunderstandings about hypertension, and those without health insurance were more likely to take herbs. Open, nonjudgmental communication between healthcare workers and patients regarding use of traditional medicines must be encouraged in Africa.

Price and availability survey of essential medicines in the Harare ...

African Journals Online (AJOL)

their innovator and/or generic equivalents) in both private retail and public pharmacies. Setting: Private and public sector retail pharmacies in Harare metropolitan province, Zimbabwe. Materials and Methods: Forty medicines were selected for ...

The use of ayurvedic medicine in the context of health promotion--a mixed methods case study of an ayurvedic centre in Sweden.

Science.gov (United States)

Niemi, Maria; Ståhle, Göran

2016-02-17

Ayurveda has its historical roots in India, but has also been internationalised, partly via migration and partly through an increased interest in alternative medicine in the West, where studies point toward increased use. However, there is to date scarce knowledge about the use and experiences of ayurveda in Sweden. We have conducted a case study of a center for ayurvedic healthcare in Sweden. We have collected information on client background data from the center's documentation, and compiled data from all clients who visited the centre for ayurvedic consultation during spring 2014. In total, 55 individuals were included in the study, and 18 of them were chosen for individual semi-structured interviews, to gain a deeper understanding of their motives for seeking, and experiences of ayurvedic health care. The material was analysed and compiled through a mix of qualitative and quantitative methods. Among the 55 clients, 91% were female the mean age was 47 years, and 64% gave a specific illness as a reason for seeking ayurveda. The most common illnesses were respiratory, musculoskeletal, circulatory, tumor, and cutaneous illnesses. The qualitative results showed that ayurveda was being used in combination with other methods, including various diets, other alternative medicine methods and conventional medicine. Some participants recounted having sought ayurveda as a complement to conventional medicine, or in cases when conventional medicine had been experienced as insufficient in terms of diagnosis or treatment. However, some participants experienced it as difficult to follow the ayurvedic life-style advice in the midst of their everyday life. Many participants reported positive experiences of pulse diagnostics, which was the main diagnostic method used in ayurvedic consultation. Some reported concrete, physical improvement of their symptoms. This study points towards important aspects of participant experience of ayurveda, that may be subject to further research. The

Techniques and methods in nuclear materials traceability

International Nuclear Information System (INIS)

Persiani, P.J.

1996-01-01

The nonproliferation community is currently addressing concerns that the access to special nuclear materials may increase the illicit trafficking in weapons-usable materials from civil and/or weapons material stores and/or fuel cycles systems. Illicit nuclear traffic usually involves reduced quantities of nuclear materials perhaps as samplings of a potential protracted diversionary flow from sources to users. To counter illicit nuclear transactions requires the development of techniques and methods in nuclear material traceability as an important phase of a broad forensic analysis capability. This report discusses how isotopic signatures and correlation methods were applied to determine the origins of Highly Enriched Uranium (HEU) and Plutonium samples reported as illicit trafficking in nuclear materials

Molecular methods in nuclear medicine therapy

International Nuclear Information System (INIS)

Lee, Kyung Han

2001-01-01

Nuclear medicine has traditionally contributed to molecular oncology by allowing noninvasive monitoring of tumor metabolism, growth and genetic changes, thereby providing a basis for appropriate biology-based treatment planning. However, NM techniques are now being applied as an active therapeutic tool in novel molecular approaches for cancer treatment. Such areas include research on cancer therapy with radiolabeled ligands or oligonucleotides, and utilization of synergism between NM radiotherapy and gene transfer techniques. Here we will focus on novel aspects of nuclear medicine therapy

Medicine authentication technology as a counterfeit medicine-detection tool: a Delphi method study to establish expert opinion on manual medicine authentication technology in secondary care.

Science.gov (United States)

Naughton, Bernard; Roberts, Lindsey; Dopson, Sue; Brindley, David; Chapman, Stephen

2017-05-06

This study aims to establish expert opinion and potential improvements for the Falsified Medicines Directive mandated medicines authentication technology. A two-round Delphi method study using an online questionnaire. Large National Health Service (NHS) foundation trust teaching hospital. Secondary care pharmacists and accredited checking technicians. Seven-point rating scale answers which reached a consensus of 70-80% with a standard deviation (SD) of <1.0. Likert scale questions which reached a consensus of 70-80%, a SD of <1.0 and classified as important according to study criteria. Consensus expert opinion has described database cross-checking technology as quick and user friendly and suggested the inclusion of an audio signal to further support the detection of counterfeit medicines in secondary care (70% consensus, 0.9 SD); other important consensus with a SD of <1.0 included reviewing the colour and information in warning pop up screens to ensure they were not mistaken for the 'already dispensed here' pop up, encouraging the dispenser/checker to act on the warnings and making it mandatory to complete an 'action taken' documentation process to improve the quarantine of potentially counterfeit, expired or recalled medicines. This paper informs key opinion leaders and decision makers as to the positives and negatives of medicines authentication technology from an operator's perspective and suggests the adjustments which may be required to improve operator compliance and the detection of counterfeit medicines in the secondary care sector. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

A comparative study on medicinal plants used in Akha's traditional medicine in China and Thailand, cultural coherence or ecological divergence?

DEFF Research Database (Denmark)

Inta, A.; Shengji, P.; Balslev, Henrik

2008-01-01

Aim of the study : The survey aims to study the effect of geographic separation of ethnic groups on local knowledge of medicinal plants used by Akha people in Thailand and China, who were separated 100-120 years ago, to see how different the two geographically distinct but culturally similar groups...... were in this respect. Materials and methods : Interviewing 10 villagers in each of five Akha villages, three in Thailand and two in China, about which plants they used and how they used them. Results : A total of 95 medicinal plants registered in the five villages only 16 were shared between China......, but that when using these new species they have maintained other traditions relating to medicinal plants....

Thinking and practice of accelerating transformation of traditional Chinese medicine from experience medicine to evidence-based medicine.

Science.gov (United States)

Liu, Baoyan; Zhang, Yanhong; Hu, Jingqing; He, Liyun; Zhou, Xuezhong

2011-06-01

The gradual development of Chinese medicine is based on constant accumulation and summary of experience in clinical practice, but without the benefit of undergoing the experimental medicine stage. Although Chinese medicine has formed a systematic and unique theory system through thousands of years, with the development of evidence-based medicine, the bondage of the research methods of experience medicine to Chinese medicine is appearing. The rapid transition and transformation from experience medicine to evidence-based medicine have become important content in the development of Chinese medicine. According to the features of Chinese medicine, we propose the research idea of "taking two ways simultaneously," which is the study both in the ideal condition and in the real world. Analyzing and constructing the theoretical basis and methodology of clinical research in the real world, and building the stage for research technique is key to the effective clinical research of Chinese medicine. Only by gradually maturing and completing the clinical research methods of the real world could we realize "taking two ways simultaneously" and complementing each other, continuously produce scientific and reliable evidence of Chinese medicine, as well as transform and develop Chinese medicine from experience medicine to evidence-based medicine.

The Prevalence of Complementary and Alternative Medicine Use Among Dermatology Outpatients in Shiraz, Iran.

Science.gov (United States)

Dastgheib, Ladan; Farahangiz, Saman; Adelpour, Zeinab; Salehi, Alireza

2017-10-01

The objective of this study was to assess complementary and alternative medicine use and its related factors among Iranian dermatology outpatients. In this cross-sectional study, a self-structured questionnaire was administered to 600 dermatology outpatients. Mann-Whitney U test, chi-square test, and binary logistic regression test were used. A total of 188 (31.3%) patients had used one of complementary and alternative medicine methods. The most frequent method used was herbal medicine (89.9%). The mean years of duration of the skin condition were significantly higher in complementary and alternative medicine users compared with nonusers ( P = .037). Patients with acne and alopecia significantly used more complementary and alternative medicine (odds ratio: 2.48 and 3.19, respectively). There was a significant relationship between education and using complementary and alternative medicine ( P alternative medicine use is prevalent among our patients and we should think of ways of educating general population about complementary and alternative medicine methods and their potential risks and benefits and encourage our health care workers to communicate these materials with their patients.

Feasibility study of structured diagnosis methods for functional dyspepsia in Korean medicine clinics

Directory of Open Access Journals (Sweden)

Jeong Hwan Park

2017-12-01

Full Text Available Background: Functional dyspepsia (FD is the seventh most common disease encountered in Korean medicine (KM clinics. Despite the large number of FD patients visiting KM clinics, the accumulated medical records have no utility in evidence development, due to being unstructured. This study aimed to construct a standard operating procedure (SOP with appropriate structured diagnostic methods for FD, and assess the feasibility for use in KM clinics. Methods: Two rounds of professional surveys were conducted by 10 Korean internal medicine professors to select the representative diagnostic methods. A feasibility study was conducted to evaluate compliance and time required for using the structured diagnostic methods by three specialists in two hospitals. Results: As per the results of the professional survey, five questionnaires and one basic diagnostic method were selected. An SOP was constructed based on the survey results, and a feasibility study showed that the SOP compliance score (out of 5 was 3.45 among the subjects, and 3.25 among the practitioners. The SOP was acceptable and was not deemed difficult to execute. The total execution time was 136.5 minutes, out of which the gastric emptying test time was 129 minutes. Conclusion: This feasibility study of the SOP with structured diagnostic methods for FD confirmed it was adequate for use in KM clinics. It is expected that these study findings will be helpful to clinicians who wish to conduct observational studies as well as to generate quantitative medical records to facilitate Big Data research. Keywords: Big Data, Dyspepsia, Korean medicine, Feasibility studies, Observational study

Study on color difference estimation method of medicine biochemical analysis

Science.gov (United States)

Wang, Chunhong; Zhou, Yue; Zhao, Hongxia; Sun, Jiashi; Zhou, Fengkun

2006-01-01

The biochemical analysis in medicine is an important inspection and diagnosis method in hospital clinic. The biochemical analysis of urine is one important item. The Urine test paper shows corresponding color with different detection project or different illness degree. The color difference between the standard threshold and the test paper color of urine can be used to judge the illness degree, so that further analysis and diagnosis to urine is gotten. The color is a three-dimensional physical variable concerning psychology, while reflectance is one-dimensional variable; therefore, the estimation method of color difference in urine test can have better precision and facility than the conventional test method with one-dimensional reflectance, it can make an accurate diagnose. The digital camera is easy to take an image of urine test paper and is used to carry out the urine biochemical analysis conveniently. On the experiment, the color image of urine test paper is taken by popular color digital camera and saved in the computer which installs a simple color space conversion (RGB -> XYZ -> L *a *b *)and the calculation software. Test sample is graded according to intelligent detection of quantitative color. The images taken every time were saved in computer, and the whole illness process will be monitored. This method can also use in other medicine biochemical analyses that have relation with color. Experiment result shows that this test method is quick and accurate; it can be used in hospital, calibrating organization and family, so its application prospect is extensive.

Method and apparatus for semi-solid material processing

Science.gov (United States)

Han, Qingyou [Knoxville, TN; Jian, Xiaogang [Knoxville, TN; Xu, Hanbing [Knoxville, TN; Meek, Thomas T [Knoxville, TN

2009-02-24

A method of forming a material includes the steps of: vibrating a molten material at an ultrasonic frequency while cooling the material to a semi-solid state to form non-dendritic grains therein; forming the semi-solid material into a desired shape; and cooling the material to a solid state. The method makes semi-solid castings directly from molten materials (usually a metal), produces grain size usually in the range of smaller than 50 .mu.m, and can be easily retrofitted into existing conventional forming machine.

Composite material and method of making

Science.gov (United States)

Fryxell, Glen E.; Samuels, William D.; Simmons, Kevin L.

2004-04-20

The composite material and methods of making the present invention rely upon a fully dense monolayer of molecules attached to an oxygenated surface at one end, and an organic terminal group at the other end, which is in turn bonded to a polymer. Thus, the composite material is a second material chemically bonded to a polymer with fully dense monolayer there between.

[Design of traditional Chinese medicines with antihypertensive components based on medicinal property combination modes].

Science.gov (United States)

Liao, Su-Fen; Yan, Su-Rong; Guo, Wei-Jia; Luo, Ji; Sun, Jing; Dong, Fang; Wang, Yun; Qiao, Yan-Jiang

2014-07-01

Multi-component traditional Chinese medicines are an innovative research mode for traditional Chinese medicines. Currently, there are many design methods for developing multi-component traditional Chinese medicines, but their common feature is the lack of effective connection of the traditional Chinese medicine theory. In this paper, the authors discussed the multi-component traditional Chinese medicine design methods based on medicinal property combination modes, provided the combination methods with the characteristics of traditional Chinese medicine for the prescription combinations, and proved its feasibly with hypertension cases.

A novel classification method for aid decision of traditional Chinese patent medicines for stroke treatment.

Science.gov (United States)

Zhao, Yufeng; Liu, Bo; He, Liyun; Bai, Wenjing; Yu, Xueyun; Cao, Xinyu; Luo, Lin; Rong, Peijing; Zhao, Yuxue; Li, Guozheng; Liu, Baoyan

2017-09-01

Traditional Chinese patent medicines are widely used to treat stroke because it has good efficacy in the clinical environment. However, because of the lack of knowledge on traditional Chinese patent medicines, many Western physicians, who are accountable for the majority of clinical prescriptions for such medicine, are confused with the use of traditional Chinese patent medicines. Therefore, the aid-decision method is critical and necessary to help Western physicians rationally use traditional Chinese patent medicines. In this paper, Manifold Ranking is employed to develop the aid-decision model of traditional Chinese patent medicines for stroke treatment. First, 115 stroke patients from three hospitals are recruited in the cross-sectional survey. Simultaneously, traditional Chinese physicians determine the traditional Chinese patent medicines appropriate for each patient. Second, particular indicators are explored to characterize the population feature of traditional Chinese patent medicines for stroke treatment. Moreover, these particular indicators can be easily obtained byWestern physicians and are feasible for widespread clinical application in the future. Third, the aid-decision model of traditional Chinese patent medicines for stroke treatment is constructed based on Manifold Ranking. Experimental results reveal that traditional Chinese patent medicines can be differentiated. Moreover, the proposed model can obtain high accuracy of aid decision.

Application of photonuclear methods of analysis in biology, medicine, ecological studies

International Nuclear Information System (INIS)

Burmistenko, Yu.N.

1986-01-01

Examples of application of photonuclear methods of analysis (PhMA) of the substance composition in biology, medicine, ecology are considered. The methods for determining the element composition of soft and bone tissues, blood, urine are developed. The results of studying the limits of determination of different elements are presented. In ecological investigations PhMA is applied for studying the composition of atmospheric aerosols, industrial sewage, canalization wastes, pollution of soil, plants, animals with toxic elements

Comparison of Leiomyoma of Modern Medicine and Traditional Persian Medicine.

Science.gov (United States)

Tansaz, Mojgan; Tajadini, Haleh

2016-04-01

Leiomyoma is the most common benign tumor of the pelvic that is associated with reproductive problems such as infertility, frequent abortions, and undesirable prenatal outcomes. High prevalence of leiomyoma and its relation with important gynecological complications, especially during reproductive ages, on the one hand, and high medical expenses and significant complications of common treatments, on the other, made us search traditional Persian medicine texts for a similar disease. In traditional Persian medicine, a condition has been introduced similar to leiomyoma (Oram-e-rahem). In this article, by collecting materials from traditional medicine texts on leiomyoma, we aim to provide theories for further studies on this topic, as there is an obvious difference between traditional Persian medicine and modern medicine with regard to leiomyoma. When modern medicine has not found a suitable response to treatment, reviewing of traditional Persian medicine for finding better treatment strategies is wise. © The Author(s) 2015.

Medicinal plants used as excipients in the history in Ghanaian herbal medicine

DEFF Research Database (Denmark)

Freiesleben, Sara Holm; Soelberg, Jens; Jäger, Anna

2015-01-01

Ethnopharmacological relevance The present study was carried out to investigate the traditional use, pharmacology and active compounds of four plants commonly used as excipients in herbal medicine in Ghana. Materials and methods A comprehensive literature search was conducted to gain knowledge....... melegueta could act as an antioxidant to preserve herbal preparations. None of the plant excipients had antibacterial activity against the bacteria tested in this study. Compounds with an aromatic or pungent smell had been identified in all the plant excipients. An explanation for the use of the plants...... as excipients could rely on their taste properties. Conclusion The present study suggests that there may be more than one simple explanation for the use of these four plants as excipients. Plausible explanations have been proven to be: (1) a way to increase the effect of the medicine, (2) a way to make...

Device and method for traditional chinese medicine diagnosis using radioactive tracer method

Energy Technology Data Exchange (ETDEWEB)

Wu, Shanling; Shen, Miaohe

1997-05-29

Disclosed is a device and method for traditional chinese medicine diagnosis using radioactive-tracer method. At least two nuclear radiation probes are arranged apart along the channels to detect the changing with time and on space of the intensity of radioactivity of the nuclear radioactive tracer which has been injected into the body in the channel position. The detected signals are amplified by amplifiers, and the outputs of the amplifiers are applied to data processing means which monitor the whole detecting process in real time and analyse and process the detected information about the changing of the intensity of radioactivity with time and on space indicating the operating of vital energy and blood, and obtain state parameters about operating of vital energy and blood in the body which is then output through data output means. (author) figs.

Children's (Pediatric) Nuclear Medicine

Medline Plus

Full Text Available ... Tell your doctor about your child’s recent illnesses, medical conditions, medications and allergies. Depending on the type ... Nuclear Medicine? Nuclear medicine is a branch of medical imaging that uses small amounts of radioactive material ...

[Research on medical speciality of traditional Chinese medicines using dot-immunoblotting method based on polyclonal antibody prepared from traditional Chinese medicines with hot/cold nature].

Science.gov (United States)

Wang, Houwei; Dou, Yanling; Tian, Jingzhen; Li, Feng; Wang, Shijun; Wang, Zhenguo

2009-02-01

To research on the substantial foundation of the medical speciality of Chinese traditional medicines from immunogenicity. Control antigen with hot nature was prepared from the mixture of the aqueous extracts of three Chinese traditional medicines with three typical hot nature of Alpinia officinarum, Cinnamomum cassia and Curculigo orchioides, while that with cold nature prepared with Rheum palmatum, Anemarrhena asphodeloides, Coptis chinensis, and polyclonal antibody was prepared by immunizing rabbit with control antigen. Dot blotting was performed between the polyclonal antibody of control antigen and the aqueous extracts of nine Chinese traditional medicines on a piece of PVDF membrane, and the blotting signals were analyzed by the software of Quantity One. Blotting signals with hot control antigen of nine Chinese traditional medicines in descending were Zingiber officinale, Aconitum carmichaeli, Eucommia ulmoides, Fraxinus rhynchophylla, Lonicera japonica, Anemarrhena asphodeloides, Coptis chinensis, Rheum palmatum and Phellodendron chinense, which degree of similarity to control antigen in peak value were 57.33%, 43.56 %, 34.16%, 30.2%, 28.81%, 26.53%, 21.68%, 17.62% and 14.85%, respectively. Blotting signals with cold control antigen were Rheum palmatum, Anemarrhena asphodeloides, Coptis chinensis, Phellodendron chinense, Zingiber officinale, Lonicera japonica, Fraxinus rhynchophylla, Eucommia ulmoides and Aconitum carmichaeli in descending, of which degree of similarity to cold control antigen in peak value were 55.22%, 54.23%, 46.72%, 34.08%, 30.3%, 24.48%, 24.33%, 20.35% and 15.17%, respectively. Results of cluster analysis with Wistar's method showed that nine medicines were classified into two groups, one group included Phellodendron chinense, Anemarrhena asphodeloides, Coptis chinensis, Rheum palmatum, another was Zingiber officinale, Aconitum carmichaeli, Eucommia ulmoides, Fraxinus rhynchophylla, Lonicera japonica. Blotting signals of nine medicines

Verification of biological activity of irradiated Sopoongsan, an oriental medicinal prescription, for industrial application of functional cosmetic material

Energy Technology Data Exchange (ETDEWEB)

Lee, Jin-Young; Park, Tae-Soon; Ho Son, Jun [Department of Cosmeceutical Science, Daegu Haany University, Kyungsan 712-715 (Korea, Republic of); Jo, Cheorun [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Woo Byun, Myung [Radiation Food Science and Biotechnology Team, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of); Jeun An, Bong [Department of Cosmeceutical Science, Daegu Haany University, Kyungsan 712-715 (Korea, Republic of)], E-mail: anbj@dhu.ac.kr

2007-11-15

Sopoongsan is an oriental medicinal prescription including 12 medicinal herbs. Sopoongsan is known to have anti-inflammatory, anti-microbial, anti-allergic, and anti-cancer effects on human skin. To use Sopoongsan extract for functional cosmetic composition, its dark color should be brighter for seeking consumer demand, clear products, without any adverse change in its function. Irradiation with doses 0, 5, 10, and 20 kGy was applied to improve color of ethanol- or water-extracted Sopoongsan and also superoxide dismutase (SOD), xanthine oxidase (XO), melanoma cell growth inhibition, and anti-microbial activity was investigated. Generally, ethanol extract was better than water extract in function and irradiation up to 20 kGy did not change any functional effect. Especially, the inhibition of melanin deposition on skin measured by inhibition of B16F10 (melanoma) cell growth was as high as arbutin, commercially available product, when the ethanol-extracted Sopoongsan was irradiated for 20 kGy. Results showed that when irradiation technology is used, the limitation of addition amount of natural materials for food or cosmetic composition caused by color problem can be decreased significantly with time saving and cost benefit compared to conventional color removal process. Therefore, irradiation would be one of the good methods to pose an additional value for related industry.

Verification of biological activity of irradiated Sopoongsan, an oriental medicinal prescription, for industrial application of functional cosmetic material

International Nuclear Information System (INIS)

Lee, Jin-Young; Park, Tae-Soon; Ho Son, Jun; Jo, Cheorun; Woo Byun, Myung; Jeun An, Bong

2007-01-01

Sopoongsan is an oriental medicinal prescription including 12 medicinal herbs. Sopoongsan is known to have anti-inflammatory, anti-microbial, anti-allergic, and anti-cancer effects on human skin. To use Sopoongsan extract for functional cosmetic composition, its dark color should be brighter for seeking consumer demand, clear products, without any adverse change in its function. Irradiation with doses 0, 5, 10, and 20 kGy was applied to improve color of ethanol- or water-extracted Sopoongsan and also superoxide dismutase (SOD), xanthine oxidase (XO), melanoma cell growth inhibition, and anti-microbial activity was investigated. Generally, ethanol extract was better than water extract in function and irradiation up to 20 kGy did not change any functional effect. Especially, the inhibition of melanin deposition on skin measured by inhibition of B16F10 (melanoma) cell growth was as high as arbutin, commercially available product, when the ethanol-extracted Sopoongsan was irradiated for 20 kGy. Results showed that when irradiation technology is used, the limitation of addition amount of natural materials for food or cosmetic composition caused by color problem can be decreased significantly with time saving and cost benefit compared to conventional color removal process. Therefore, irradiation would be one of the good methods to pose an additional value for related industry

Capturing indigenous knowledge on medicinal plants use: Case ...

African Journals Online (AJOL)

Background: Understanding the intricate link between humans and the plants use is needed to address some of to-day's socio-economic and health challenges. Materials and Methods: The study focused on plants that have high cultural and medicinal values for the host communities of Old Oyo National Park, Nigeria. Local ...

Children's (Pediatric) Nuclear Medicine

Medline Plus

Full Text Available ... Nuclear Medicine? Nuclear medicine is a branch of medical imaging that uses small amounts of radioactive material to ... a radiologist or other physician. To locate a medical imaging or radiation oncology provider in your community, you ...

[Design and implementation of supply security monitoring and analysis system for Chinese patent medicines supply in national essential medicines].

Science.gov (United States)

Wang, Hui; Zhang, Xiao-Bo; Huang, Lu-Qi; Guo, Lan-Ping; Wang, Ling; Zhao, Yu-Ping; Yang, Guang

2017-11-01

The supply of Chinese patent medicine is influenced by the price of raw materials (Chinese herbal medicines) and the stock of resources. On the one hand, raw material prices show cyclical volatility or even irreversible soaring, making the price of Chinese patent medicine is not stable or even the highest cost of hanging upside down. On the other hand, due to lack of resources or disable some of the proprietary Chinese medicine was forced to stop production. Based on the micro-service architecture and Redis cluster deployment Based on the micro-service architecture and Redis cluster deployment, the supply security monitoring and analysis system for Chinese patent medicines in national essential medicines has realized the dynamic monitoring and intelligence warning of herbs and Chinese patent medicine by connecting and integrating the database of Chinese medicine resources, the dynamic monitoring system of traditional Chinese medicine resources and the basic medicine database of Chinese patent medicine. Copyright© by the Chinese Pharmaceutical Association.

Optimization, validation and application of UV-Vis spectrophotometric-colorimetric methods for determination of trimethoprim in different medicinal products

Directory of Open Access Journals (Sweden)

Goran Stojković

2016-03-01

Full Text Available Two simple, sensitive, selective, precise, and accurate methods for determination of trimethoprim in different sulfonamide formulations intended for use in human and veterinary medicine were optimized and validated. The methods are based on the trimethoprim reaction with bromcresol green (BCG and 2,4-dinitro-1-fluorobenzene (DNFB. As extraction solvents we used 10 % N,N-dimethylacetamide in methanol and acetone for both methods, respectively. The colored products are quantified applying visible spectrophotometry at their corresponding absorption maxima. The methods were validated for linearity, sensitivity, accuracy, and precision. We tested the method applicability on four different medicinal products in tablet and powder forms containing sulfametrole and sulfamethoxazole in combination with trimethoprim. The results revealed that both methods are equally accurate with recoveries within the range 95-105 %. The obtained between-day precision for both methods, when applied on four different medicinal products, was within in the range 1.08-3.20 %. By applying the F-statistical test (P<0.05, it was concluded that for three medicinal products tested both methods are applicable with statistically insignificant difference in precision. The optimized and validated BCG and DNFB methods could find application in routine quality control of trimethoprim in various formulation forms, at different concentration levels, and in combination with different sulfonamides.

Socializing Identity Through Practice: A Mixed Methods Approach to Family Medicine Resident Perspectives on Uncertainty.

Science.gov (United States)

Ledford, Christy J W; Cafferty, Lauren A; Seehusen, Dean A

2015-01-01

Uncertainty is a central theme in the practice of medicine and particularly primary care. This study explored how family medicine resident physicians react to uncertainty in their practice. This study incorporated a two-phase mixed methods approach, including semi-structured personal interviews (n=21) and longitudinal self-report surveys (n=21) with family medicine residents. Qualitative analysis showed that though residents described uncertainty as an implicit part of their identity, they still developed tactics to minimize or manage uncertainty in their practice. Residents described increasing comfort with uncertainty the longer they practiced and anticipated that growth continuing throughout their careers. Quantitative surveys showed that reactions to uncertainty were more positive over time; however, the difference was not statistically significant. Qualitative and quantitative results show that as family medicine residents practice medicine their perception of uncertainty changes. To reduce uncertainty, residents use relational information-seeking strategies. From a broader view of practice, residents describe uncertainty neutrally, asserting that uncertainty is simply part of the practice of family medicine.

Materials and Methods

African Journals Online (AJOL)

RamalivhanaJN

2014-01-22

Jan 22, 2014 ... There has been a steady rise in antibiotic resistance of bacteria and this ... against an extensive spectrum of microorganisms, it differs depending on the type of honey. ... on the antibacterial activities of medicinal plants against.

Attitude and knowledge of family medicine practitioners towards the ...

African Journals Online (AJOL)

Objectives: To assess the attitude and knowledge of family medicine practitioners (FMPs) towards the association between periodontal disease and obesity. Materials and Methods: A cross-sectional study was performed and a 13-item survey questionnaire was given to FMPs practicing in 12 different teaching hospitals in ...

Inventory of Medicinal Flora from Thal Desert, Punjab, Pakistan ...

African Journals Online (AJOL)

Materials and Methods: The whole area was surveyed for inventorying medicinal flora by using a semi-structured questionnaire. Results: The people of the study area are extremely knowledgeable, hence reported 120 plants which are being used in treating various human diseases. The detailed inventory including ...

14 CFR 35.17 - Materials and manufacturing methods.

Science.gov (United States)

2010-01-01

... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Materials and manufacturing methods. 35.17... AIRWORTHINESS STANDARDS: PROPELLERS Design and Construction § 35.17 Materials and manufacturing methods. (a) The... and manufacturing methods must conform to specifications acceptable to the Administrator. (c) The...

Empirical methods for systematic reviews and evidence-based medicine

NARCIS (Netherlands)

van Enst, W.A.

2014-01-01

Evidence-Based Medicine is the integration of best research evidence with clinical expertise and patient values. Systematic reviews have become the cornerstone of evidence-based medicine, which is reflected in the position systematic reviews have in the pyramid of evidence-based medicine. Systematic

Proceedings of computational methods in materials science

International Nuclear Information System (INIS)

Mark, J.E. Glicksman, M.E.; Marsh, S.P.

1992-01-01

The Symposium on which this volume is based was conceived as a timely expression of some of the fast-paced developments occurring throughout materials science and engineering. It focuses particularly on those involving modern computational methods applied to model and predict the response of materials under a diverse range of physico-chemical conditions. The current easy access of many materials scientists in industry, government laboratories, and academe to high-performance computers has opened many new vistas for predicting the behavior of complex materials under realistic conditions. Some have even argued that modern computational methods in materials science and engineering are literally redefining the bounds of our knowledge from which we predict structure-property relationships, perhaps forever changing the historically descriptive character of the science and much of the engineering

New materials through a variety of sintering methods

Science.gov (United States)

Jaworska, L.; Cyboroń, J.; Cygan, S.; Laszkiewicz-Łukasik, J.; Podsiadło, M.; Novak, P.; Holovenko, Y.

2018-03-01

New sintering techniques make it possible to obtain materials with special properties that are impossible to obtain by conventional sintering techniques. This issue is especially important for ceramic materials for application under extreme conditions. Following the tendency to limit critical materials in manufacturing processes, the use of W, Si, B, Co, Cr should be limited, also. One of the cheapest and widely available materials is aluminum oxide, which shows differences in phase composition, grain size, hardness, strain and fracture toughness of the same type of powder, sintered via various methods. In this paper the alumina was sintered using the conventional free sintering process, microwave sintering, Spark Plasma Sintering (SPS), high pressure-high temperature method (HP-HT) and High Pressure Spark Plasma Sintering (HP SPS). Phase composition analysis, by X-ray diffraction of the alumina materials sintered using various methods, was carried out. For the conventional sintering method, compacts are composed of α-Al2O3 and θ-Al2O3. For compacts sintered using SPS, microwave and HP-HT methods, χ-Al2O3 and γ-Al2O3 phases were additionally present. Mechanical and physical properties of the obtained materials were compared between the methods of sintering. On the basis of images from scanning electron microscope quantitative analysis was performed to determine the degree of grain growth of alumina after sintering.

Methods for the measurement of micro material evidence

International Nuclear Information System (INIS)

Yang Mingtai; Wang Wen; Wu Lunqiang; Dai Changsong

2012-01-01

The micro material evidence has been used in judicature litigation successfully, that must base on impersonal authentication with the advanced and proper methods. The basic principle, main trait, applicable range, analysis minimum and sensitive limit of twelve type instruments used in micro material evidence analysis have been related. Those could supply optional proper methods for micro material evidence. (authors)

Complementary and Alternative Medicine Methods in Chronic Renal Failure

Directory of Open Access Journals (Sweden)

Zeynep Erdogan

2014-08-01

Full Text Available Despite its long history, use of complementary and alternative medicine (CAM methods has increased dramatically only after 1990s. Up to 57% of patients with chronic renal use CAM methods.These patienys use CAM methods to overcome hypertension, fatigue, constipation, leg edema, pain, cramps, anxiety, depression, sleep disorders, to cope with symptoms such as itching, to stop the progression of kidney disease and to improve their quality of life. Methods used are herbal products and food supplements, acupressure, acupuncture, homeopathy, exercise, aromatherapy, yoga and reflexology. Nephrotoxic effect of several CAM therapies used in patients with renal impairment could disturb hemodynamics by reducing the glomerular filtration rate. For this reason, health care providers should question patients about used of CAM, methods. Communication with patients should be clear and should not act judgmental. Health care personnel should learn more about CAM methods in order to avoid unwanted situations that could develop after the application of CAM methods. Patients should be informed correctly and scientifically about these methods to avoid harmful and unnecessary uses. [Archives Medical Review Journal 2014; 23(4.000: 770-786

Reliability studies of diagnostic methods in Indian traditional Ayurveda medicine: An overview

Science.gov (United States)

Kurande, Vrinda Hitendra; Waagepetersen, Rasmus; Toft, Egon; Prasad, Ramjee

2013-01-01

Recently, a need to develop supportive new scientific evidence for contemporary Ayurveda has emerged. One of the research objectives is an assessment of the reliability of diagnoses and treatment. Reliability is a quantitative measure of consistency. It is a crucial issue in classification (such as prakriti classification), method development (pulse diagnosis), quality assurance for diagnosis and treatment and in the conduct of clinical studies. Several reliability studies are conducted in western medicine. The investigation of the reliability of traditional Chinese, Japanese and Sasang medicine diagnoses is in the formative stage. However, reliability studies in Ayurveda are in the preliminary stage. In this paper, examples are provided to illustrate relevant concepts of reliability studies of diagnostic methods and their implication in practice, education, and training. An introduction to reliability estimates and different study designs and statistical analysis is given for future studies in Ayurveda. PMID:23930037

Constipation due to Liver Disorder in Iranian Traditional Medicine`s Viewpoint

Directory of Open Access Journals (Sweden)

R Choopani

2014-04-01

Full Text Available Introduction: Constipation is one of the most common pediatric disorders.In many cases, there is no anatomic endocrineor metabolic cause in explanation of chronic constipation.More than 85% of them called functional or idiopathic.Constipation is one of the serious disease in Iranian Traditional Medicine. Besides the problem it causes, chronic constipation can be the origin of many disease. That is why, ithas been called Mother of disease.The purpose of this study is to investigate the Constipation in children and the role of other organs such as the liver by view of Iranian Traditional Medicine   Materials and Method: This study is a review through Iranian traditional medicine references. At first, all the main available traditional books were reviewed. All the data about therapies of vaginal discharge in ITM were collected then classified.   Results: In traditional medicine different reasons have been mentioned for constipation especially for childrenwhich most of them are similar to etiology in Modern Medicine.Constipation due to liver disorder is one of the causes of constipation.In Iranian Traditional medicine` viewpoint, one of the mechanism for excretion is existence of secreted bile in intestine.If by any reason,measure or quality of its which secreted in intestine through bile changes or if intestinal mucous secretion becomes barrier for absorbing the food,it will caused disorder in excretion and finally will lead to constipation.Well known Iranian Traditional Medicine scientists, has mentioned all reasons for liver disorders and changing quality& quantity of secreted bile .he has mentioned the solutions as well.   Conclusion: It is hoped that by paying attention to constipation and with advanced clinical research we will be able to explain idiopathic constipation and prepare new ways of treatments for constipation. New researches have approved the effectiveness of these foods and drugs for treating the constipation.   Keywords

The determinants of traditional medicine use in Northern Tanzania: a mixed-methods study.

Directory of Open Access Journals (Sweden)

John W Stanifer

Full Text Available Traditional medicines are an important part of healthcare in sub-Saharan Africa, and building successful disease treatment programs that are sensitive to traditional medicine practices will require an understanding of their current use and roles, including from a biomedical perspective. Therefore, we conducted a mixed-method study in Northern Tanzania in order to characterize the extent of and reasons for the use of traditional medicines among the general population so that we can better inform public health efforts in the region.Between December 2013 and June 2014 in Kilimanjaro, Tanzania, we conducted 5 focus group discussions and 27 in-depth interviews of key informants. The data from these sessions were analyzed using an inductive framework method with cultural insider-outsider coding. From these results, we developed a structured survey designed to test different aspects of traditional medicine use and administered it to a random sample of 655 adults from the community. The results were triangulated to explore converging and diverging themes.Most structured survey participants (68% reported knowing someone who frequently used traditional medicines, and the majority (56% reported using them themselves in the previous year. The most common uses were for symptomatic ailments (42%, chronic diseases (15%, reproductive problems (11%, and malaria/febrile illnesses (11%. We identified five major determinants for traditional medicine use in Northern Tanzania: biomedical healthcare delivery, credibility of traditional practices, strong cultural identities, individual health status, and disease understanding.In order to better formulate effective local disease management programs that are sensitive to TM practices, we described the determinants of TM use. Additionally, we found TM use to be high in Northern Tanzania and that its use is not limited to lower-income areas or rural settings. After symptomatic ailments, chronic diseases were reported as

Training Methods to Improve Evidence-Based Medicine Skills

Directory of Open Access Journals (Sweden)

Filiz Ozyigit

2010-06-01

Full Text Available Evidence based medicine (EBM is the conscientious, explicit and judicious use of current best evidence in making decisions about the care of individual patients. It is estimated that only 15% of medical interventions is evidence-based. Increasing demand, new technological developments, malpractice legislations, a very speed increase in knowledge and knowledge sources push the physicians forward for EBM, but at the same time increase load of physicians by giving them the responsibility to improve their skills. Clinical maneuvers are needed more, as the number of clinical trials and observational studies increase. However, many of the physicians, who are in front row of patient care do not use this increasing evidence. There are several examples related to different training methods in order to improve skills of physicians for evidence based practice. There are many training methods to improve EBM skills and these trainings might be given during medical school, during residency or as continuous trainings to the actual practitioners in the field. It is important to discuss these different training methods in our country as well and encourage dissemination of feasible and effective methods. [TAF Prev Med Bull 2010; 9(3.000: 245-254

Analysis of Stress Updates in the Material-point Method

DEFF Research Database (Denmark)

Andersen, Søren; Andersen, Lars

2009-01-01

The material-point method (MPM) is a new numerical method for analysis of large strain engineering problems. The MPM applies a dual formulation, where the state of the problem (mass, stress, strain, velocity etc.) is tracked using a finite set of material points while the governing equations...... are solved on a background computational grid. Several references state, that one of the main advantages of the material-point method is the easy application of complicated material behaviour as the constitutive response is updated individually for each material point. However, as discussed here, the MPM way...

The Gender Lens: Development of a learning aid to introduce gender medicine

Directory of Open Access Journals (Sweden)

Weyers, Simone

2017-05-01

Full Text Available Background and aim: Gender medicine takes into account biological and social differences between men and women in terms of prevalence and course of disease, diagnosis and therapy. Medical students should be made aware of this in the early stages of medical education. However, there is hardly any teaching material currently available. This article presents the adaption and first use of the German “Gender Lens,” a tool to introduce gender medicine to medical students. Method: The original Canadian ”Gender Lens Tool” was translated into German, tested by (n=5 teachers and adapted based on current scientific concepts. The instrument was applied and evaluated using qualitative methods in a student focus group (n=4. It was then piloted in a cohort of fourth-semester students (n=247 in a seminar addressing gender medicine. These experiences were evaluated using quantitative methods.Results: The German translation of the Gender Lens offers students a framework with which to analyze sex and gender differences in terms of the “prevalence, diagnosis, course, therapy and prevention” of a specific disease. Furthermore, it enables a refined search for causes such as “biological disposition, attitudes and behaviors, family and social networks, occupational and material circumstances and experiences with the health care system.” Recommendations were received from the student groups regarding teaching methods. Male and female fourth-semester students agreed that the Gender Lens is useful as an introduction to gender medicine. Discussion: Initial experiences with the Gender Lens adapted for the German curriculum suggest that such a learning aid can contribute to raising awareness of gender medicine in medical students.

Loop-Mediated Isothermal Amplification (LAMP): Emergence As an Alternative Technology for Herbal Medicine Identification.

Science.gov (United States)

Li, Jing-Jian; Xiong, Chao; Liu, Yue; Liang, Jun-Song; Zhou, Xing-Wen

2016-01-01

Correct identification of medicinal plant ingredients is essential for their safe use and for the regulation of herbal drug supply chain. Loop-mediated isothermal amplification (LAMP) is a recently developed approach to identify herbal medicine species. This novel molecular biology technique enables timely and accurate testing, especially in settings where infrastructures to support polymerase chain reaction facilities are lacking. Studies that used this method have altered our view on the extent and complexity of herbal medicine identification. In this review, we give an introduction into LAMP analysis, covers the basic principles and important aspects in the development of LAMP analysis method. Then we presented a critical review of the application of LAMP-based methods in detecting and identifying raw medicinal plant materials and their processed products. We also provide a practical standard operating procedure (SOP) for the utilization of the LAMP protocol in herbal authentication, and consider the prospects of LAMP technology in the future developments of herbal medicine identification and the challenges associated with its application.

Energetic materials and methods of tailoring electrostatic discharge sensitivity of energetic materials

Energy Technology Data Exchange (ETDEWEB)

Daniels, Michael A.; Heaps, Ronald J.; Wallace, Ronald S.; Pantoya, Michelle L.; Collins, Eric S.

2016-11-01

An energetic material comprising an elemental fuel, an oxidizer or other element, and a carbon nanofiller or carbon fiber rods, where the carbon nanofiller or carbon fiber rods are substantially homogeneously dispersed in the energetic material. Methods of tailoring the electrostatic discharge sensitivity of an energetic material are also disclosed.

Ceramic luminescent radiographic materials for medicine and tool construction

International Nuclear Information System (INIS)

Winnacker, A.

1991-01-01

X-ray recording luminescent materials form the basis of a new concept for X ray imaging. Essential advantages as compared to the conventional film systems are the digitalisation of the X ray as well as the high dynamics of registration. Modern methods of image processing and video recording can be applied. Advantages also show where a very extensive video material must be filed. Compared to the films used up to now, one expects higher sensitivity, higher homogeneity and higher spatial resolution of pictures taken with ceramic films. (BaFBr:Eu, RbJ:Tl). (orig.) [de

Qualitative research methods in renal medicine: an introduction.

Science.gov (United States)

Bristowe, Katherine; Selman, Lucy; Murtagh, Fliss E M

2015-09-01

Qualitative methodologies are becoming increasingly widely used in health research. However, within some specialties, including renal medicine, qualitative approaches remain under-represented in the high-impact factor journals. Qualitative research can be undertaken: (i) as a stand-alone research method, addressing specific research questions; (ii) as part of a mixed methods approach alongside quantitative approaches or (iii) embedded in clinical trials, or during the development of complex interventions. The aim of this paper is to introduce qualitative research, including the rationale for choosing qualitative approaches, and guidance for ensuring quality when undertaking and reporting qualitative research. In addition, we introduce types of qualitative data (observation, interviews and focus groups) as well as some of the most commonly encountered methodological approaches (case studies, ethnography, phenomenology, grounded theory, thematic analysis, framework analysis and content analysis). © The Author 2015. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved.

Calibration and intercomparison methods of dose calibrators used in nuclear medicine facilities

International Nuclear Information System (INIS)

Costa, Alessandro Martins da

1999-01-01

Dose calibrators are used in most of the nuclear medicine facilities to determine the amount of radioactivity administered to a patient in a particular investigation or therapeutic procedure. It is therefore of vital importance that the equipment used presents good performance and is regular;y calibrated at a authorized laboratory. This occurs of adequate quality assurance procedures are carried out. Such quality control tests should be performed daily, other biannually or yearly, testing, for example, its accuracy and precision, the reproducibility and response linearity. In this work a commercial dose calibrator was calibrated with solution of radionuclides used in nuclear medicine. Simple instrument tests, such as response linearity and the response variation of the source volume increase at a constant source activity concentration, were performed. This instrument can now be used as a working standard for calibration of other dose calibrators/ An intercomparison procedure was proposed as a method of quality control of dose calibrators used in nuclear medicine facilities. (author)

Toward a more materialistic medicine: the value of authentic materialism within current and future medical practice.

Science.gov (United States)

Leder, Drew; Krucoff, Mitchell W

2011-09-01

Modern medicine is often accused by diverse critics of being "too materialistic" and therefore insufficiently holistic and effective. Yet, this critique can be misleading, dependent upon the ambiguous meanings of "materialism." The term can refer to the prevalence of financial concerns in driving medical practice. Alternatively, it can refer to "mechanistic materialism," the patient viewed as a body-machine. In each case, this article shows that this represents not authentic "materialism" at play, but a focus upon high-level abstractions. "Bottom-line" financial or diagnostic numbers can distract practitioners from the embodied needs of sick patients. In this sense, medical practice is not materialist enough. Through a series of clinical examples, this article explores how an authentic materialism would look in current and future practice. The article examines the use of prayer/comfort shawls at the bedside; hospitals and nursing homes redesigned as enriched healing environments; and a paradigmatic medical device--the implantable cardioverter defibrillator--as it might be presented to patients, in contrast to current practice.

Comparison of Sasang Constitutional Medicine, Traditional Chinese Medicine and Ayurveda

Science.gov (United States)

Kim, Jong Yeol; Pham, Duong Duc; Koh, Byung Hee

2011-01-01

Sasang constitutional medicine (SCM), traditional Chinese medicine (TCM) and Ayurveda are three different forms of Asian traditional medicine. Although these traditions share a lot in common as holistic medicines, the different philosophical foundations found in each confer distinguishing attributes and unique qualities. SCM is based on a constitution-based approach, and is in this way relatively more similar to the Ayurvedic tradition than to the TCM, although many of the basic SCM theories were originally derived from TCM, a syndrome-based medicine. SCM and TCM use the same botanical materials that are distributed mainly in the East Asian region, but the basic principles of usage and the underlying rationale are completely different from each other. Meanwhile, the principles of the Ayurvedic use of botanical resources are very similar to those seen in SCM, but the medicinal herbs used in Ayurveda generally originate from the West Asian region which displays a different spectrum of flora. PMID:21949669

Comparison of Sasang Constitutional Medicine, Traditional Chinese Medicine and Ayurveda

Directory of Open Access Journals (Sweden)

Jong Yeol Kim

2011-01-01

Full Text Available Sasang constitutional medicine (SCM, traditional Chinese medicine (TCM and Ayurveda are three different forms of Asian traditional medicine. Although these traditions share a lot in common as holistic medicines, the different philosophical foundations found in each confer distinguishing attributes and unique qualities. SCM is based on a constitution-based approach, and is in this way relatively more similar to the Ayurvedic tradition than to the TCM, although many of the basic SCM theories were originally derived from TCM, a syndrome-based medicine. SCM and TCM use the same botanical materials that are distributed mainly in the East Asian region, but the basic principles of usage and the underlying rationale are completely different from each other. Meanwhile, the principles of the Ayurvedic use of botanical resources are very similar to those seen in SCM, but the medicinal herbs used in Ayurveda generally originate from the West Asian region which displays a different spectrum of flora.

Methods for purifying carbon materials

Science.gov (United States)

Dailly, Anne [Pasadena, CA; Ahn, Channing [Pasadena, CA; Yazami, Rachid [Los Angeles, CA; Fultz, Brent T [Pasadena, CA

2009-05-26

Methods of purifying samples are provided that are capable of removing carbonaceous and noncarbonaceous impurities from a sample containing a carbon material having a selected structure. Purification methods are provided for removing residual metal catalyst particles enclosed in multilayer carbonaceous impurities in samples generate by catalytic synthesis methods. Purification methods are provided wherein carbonaceous impurities in a sample are at least partially exfoliated, thereby facilitating subsequent removal of carbonaceous and noncarbonaceous impurities from the sample. Methods of purifying carbon nanotube-containing samples are provided wherein an intercalant is added to the sample and subsequently reacted with an exfoliation initiator to achieve exfoliation of carbonaceous impurities.

Emergency medicine clerkship curriculum in a high-income developing country: methods for development and application.

Science.gov (United States)

Cevik, Arif Alper; Cakal, Elif Dilek; Abu-Zidan, Fikri M

2018-06-07

The published recommendations for international emergency medicine curricula cover the content, but exclude teaching and learning methods, assessment, and evaluation. We aim to provide an overview on available emergency medicine clerkship curricula and report the development and application experience of our own curriculum. Our curriculum is an outcome-based education, enriched by e-learning and various up-to-date pedagogic principles. Teaching and learning methods, assessment, and evaluation are described. The theory behind our practice in the light of recent literature is discussed aiming to help other colleagues from developing countries to have a clear map for developing and tailoring their own curricula depending on their needs. The details of our emergency medicine clerkship will serve as an example for developing and developed countries having immature undergraduate emergency medicine clerkship curricula. However, these recommendations will differ in various settings depending on available resources. The main concept of curriculum development is to create a curriculum having learning outcomes and content relevant to the local context, and then align the teaching and learning activities, assessments, and evaluations to be in harmony. This may assure favorable educational outcome even in resource limited settings.

Methods for treating lignocellulosic materials

Science.gov (United States)

Jansen, Robert; Travisano, Philip; Madsen, Lee; Matis, Neta; Lawson, James Alan; Lapidot, Noa; Eyal, Aharon M.; Bauer, Timothy Allen; Belman, Ziv-Vladimir; Hallac, Bassem; Zviely, Michael

2017-10-10

The present invention relates to methods of processing lignocellulosic material to obtain hemicellulose sugars, cellulose sugars, lignin, cellulose and other high-value products. Also provided are hemicellulose sugars, cellulose sugars, lignin, cellulose, and other high-value products.

Methods for treating lignocellulosic materials

Energy Technology Data Exchange (ETDEWEB)

Jansen, Robert; Gregoire, Claire; Travisano, Philip; Madsen, Lee; Matis, Neta; Har-Tal, Yael Miriam; Eliahu, Shay; Lawson, James Alan; Lapidot, Noa; Eyal, Aharon M.; Bauer, Timothy Allen; McWilliams, Paul; Zviely, Michael; Carden, Adam

2017-05-16

The present invention relates to methods of processing lignocellulosic material to obtain hemicellulose sugars, cellulose sugars, lignin, cellulose and other high-value products. Also provided are hemicellulose sugars, cellulose sugars, lignin, cellulose, and other high-value products.

Methods for treating lignocellulosic materials

Energy Technology Data Exchange (ETDEWEB)

Jansen, Robert; Gregoire, Claire; Travisano, Philip; Madsen, Lee; Matis, Neta; Har-Tal, Yael Miriam; Eliahu, Shay; Lawson, James Alan; Lapidot, Noa; Burke, Luke; Eyal, Aharon M.; Bauer, Timothy Allen; Sade, Hagit; McWilliams, Paul; Zviely, Michael; Carden, Adam

2017-04-25

The present invention relates to methods of processing lignocellulosic material to obtain hemicellulose sugars, cellulose sugars, lignin, cellulose and other high-value products. Also provided are hemicellulose sugars, cellulose sugars, lignin, cellulose, and other high-value products.

Between the Living and the Dead: Trauma Medicine and Forensic Medicine in the Mid-Qing.

Science.gov (United States)

Wu, Yi-Li

2015-03-01

This paper analyzes the influence of forensic medicine on therapeutic medicine through a case study of Qian Xiuchang and Hu Tingguang, two Chinese doctors who specialized in treating traumatic injuries. During the early nineteenth century, both men compiled medical treatises that sought to improve on a scholarly model of "rectifying bones" articulated in 1742 by the Imperially-Compiled Golden Mirror of the Medical Lineage . Both texts also incorporated information from forensic medicine, including official inquest diagrams and checklists promulgated by the Qing government. I show that they drew on these forensic materials to help address two interlinked medical issues: understanding the effects of injury on different parts of the body, and clarifying the location and form of the body's bones. Overall, I suggest that the exchange of ideas between the realm of therapeutic medicine and forensic medicine was an important epistemological strategy that doctors and officials alike employed to improve their knowledge of the material body.

Polyurethanes Crosslinked with Poly(vinyl alcohol as a Slowly-Degradable and Hydrophilic Materials of Potential Use in Regenerative Medicine

Directory of Open Access Journals (Sweden)

Justyna Kucińska-Lipka

2018-02-01

Full Text Available Novel, slowly-degradable and hydrophilic materials with proper mechanical properties and surface characteristics are in great demand within the biomedical field. In this paper, the design, synthesis, and characterization of polyurethanes (PUR crosslinked with poly(vinyl alcohol (PVA as a new proposition for regenerative medicine is described. PVA-crosslinked PURs were synthesized by a two-step polymerization performed in a solvent (dimethylsulfoxide, DMSO. The raw materials used for the synthesis of PVA-crosslinked PURs were poly(ε-caprolactone (PCL, 1,6-hexamethylene diisocyanate (HDI, and PVA as a crosslinking agent. The obtained materials were studied towards their physicochemical, mechanical, and biological performance. The tests revealed contact angle of the materials surface between 38–47° and tensile strength in the range of 41–52 MPa. Mechanical characteristics of the obtained PURs was close to the characteristics of native human bone such as the cortical bone (TSb = 51–151 MPa or the cancellous bone (TSb = 10–20 MPa. The obtained PVA-crosslinked PURs did not show significant progress of degradation after 3 months of incubation in a phosphate-buffered saline (PBS. Accordingly, the obtained materials may behave similar to slowly-degradable materials, which can provide long-term physical support in, for example, tissue regeneration, as well as providing a uniform calcium deposition on the material surface, which may influence, for example, bone restoration. A performed short-term hemocompatibility study showed that obtained PVA-crosslinked PURs do not significantly influence blood components, and a cytotoxicity test performed with the use of MG 63 cell line revealed the great cytocompatibility of the obtained materials. According to the performed studies, such PVA-crosslinked PURs may be a suitable proposition for the field of tissue engineering in regenerative medicine.

Method and apparatus for modeling, visualization and analysis of materials

KAUST Repository

Aboulhassan, Amal

2016-08-25

A method, apparatus, and computer readable medium are provided for modeling of materials and visualization of properties of the materials. An example method includes receiving data describing a set of properties of a material, and computing, by a processor and based on the received data, geometric features of the material. The example method further includes extracting, by the processor, particle paths within the material based on the computed geometric features, and geometrically modeling, by the processor, the material using the geometric features and the extracted particle paths. The example method further includes generating, by the processor and based on the geometric modeling of the material, one or more visualizations regarding the material, and causing display, by a user interface, of the one or more visualizations.

Nuclear medicine statistics

International Nuclear Information System (INIS)

Martin, P.M.

1977-01-01

Numerical description of medical and biologic phenomena is proliferating. Laboratory studies on patients now yield measurements of at least a dozen indices, each with its own normal limits. Within nuclear medicine, numerical analysis as well as numerical measurement and the use of computers are becoming more common. While the digital computer has proved to be a valuable tool for measurment and analysis of imaging and radioimmunoassay data, it has created more work in that users now ask for more detailed calculations and for indices that measure the reliability of quantified observations. The following material is presented with the intention of providing a straight-forward methodology to determine values for some useful parameters and to estimate the errors involved. The process used is that of asking relevant questions and then providing answers by illustrations. It is hoped that this will help the reader avoid an error of the third kind, that is, the error of statistical misrepresentation or inadvertent deception. This occurs most frequently in cases where the right answer is found to the wrong question. The purposes of this chapter are: (1) to provide some relevant statistical theory, using a terminology suitable for the nuclear medicine field; (2) to demonstrate the application of a number of statistical methods to the kinds of data commonly encountered in nuclear medicine; (3) to provide a framework to assist the experimenter in choosing the method and the questions most suitable for the experiment at hand; and (4) to present a simple approach for a quantitative quality control program for scintillation cameras and other radiation detectors

Personalized medicine: a confluence of traditional and contemporary medicine.

Science.gov (United States)

Jafari, Samineh; Abdollahi, Mohammad; Saeidnia, Soodabeh

2014-01-01

Traditional systems of medicine have attained great popularity among patients in recent years. Success of this system in the treatment of disease warrants consideration, particularly in cases for which conventional medicine has been insufficient. This study investigates the similarities in principles and approaches of 3 traditional systems and explores whether conventional medicine is able to exploit the advantages of traditional systems. This study first identifies and explores the advantages of 3 well-known systems-traditional Iranian medicine (TIM), ayurveda, and traditional Chinese medicine (TCM)-that are similar in their basic principles and methods. Second, it clarifies whether and how conventional medicine could exploit the advantages of traditional systems as it modernizes, to become more personalized. Finally, this study investigates the possibility that conventional medicine could benefit from traditional typology to improve its personalization. The acknowledgment of the unity of humans and nature, applying rational methods, and personalized approaches is fundamentally similar in the 3 systems. Additionally, they all promote the holistic view that health is harmony and disease is disharmony of the body. Other similarities include their recognition of the unique nature of every person and their categorization of people into different body types. Although conventional medicine has mostly failed to incorporate the advantages of traditional medicine, its integration with traditional medicine is achievable. For instance, exploiting traditional typologies in genomic and other studies may facilitate personalization of conventional medicine. From its review, the research team concludes that prospects are bright for the integration of traditional and conventional medicines and, consequently, for a dramatic improvement in health systems.

The Significance of Ayurvedic Medicinal Plants

Science.gov (United States)

Kumar, Syal; Dobos, Gustav J.; Rampp, Thomas

2016-01-01

Traditional Indian medicine (ayurveda) is becoming increasingly popular, with many chronic conditions responding to it well. Most patients begin to take conventional medications as soon as their diagnoses are made, so ayurvedic treatments are usually undergone alongside and/or after conventional medical approaches. A detailed knowledge of the action of food, spices, and medicinal plants is needed in order to understand their potential influence fully. While societal use of ayurvedic plants and Indian spices is commonplace, without ill effect, the use of more concentrated products made from single plants, often in the form of teas or tablets, is of more concern. The mechanisms by which polyherbal drugs and their extracts act differ in many respects from the actions of single substances or synthetic drugs. Despite the fact that ayurvedic medicines are based on natural herbal materials, their safety depends on their method of administration, taking into account individuals’ needs and their specific disease conditions. PMID:27707902

Spectral Analysis of Chinese Medicinal Herbs Based on Delayed Luminescence

Directory of Open Access Journals (Sweden)

Jingxiang Pang

2016-01-01

Full Text Available Traditional Chinese medicine (TCM plays a critical role in healthcare; however, it lacks scientific evidence to support the multidimensional therapeutic effects. These effects are based on experience, and, to date, there is no advanced tool to evaluate these experience based effects. In the current study, Chinese herbal materials classified with different cold and heat therapeutic properties, based on Chinese medicine principles, were investigated using spectral distribution, as well as the decay probability distribution based on delayed luminescence (DL. A detection system based on ultraweak biophoton emission was developed to determine the DL decay kinetics of the cold and heat properties of Chinese herbal materials. We constructed a mathematical model to fit the experimental data and characterize the properties of Chinese medicinal herbs with different parameters. The results demonstrated that this method has good reproducibility. Moreover, there is a significant difference (p<0.05 in the spectral distribution and the decay probability distribution of Chinese herbal materials with cold and heat properties. This approach takes advantage of the comprehensive nature of DL compared with more reductionist approaches and is more consistent with TCM principles, in which the core comprises holistic views.

Choose of standard materials in the method of β-testing new materials' mass thickness

International Nuclear Information System (INIS)

Chen Zhong

2007-01-01

To make sure of the standard mass thickness in beta radials testing mass thickness, this paper calculate using M. C. method and get the result of the relations between the beta radials' transmission rate of different energies and mass thickness in different materials. This result prove that in method of beta test mass thickness choosing materials whose elements are close as standard materials are viable. (authors)

New developments in nuclear medicine technology

International Nuclear Information System (INIS)

Ziegler, S.I.; Pichler, B.J.

2000-01-01

During the past few years, there have been new impulses in the development of a number of technologies employed in Nuclear Medicine imaging. These include new scintillation materials, the way of detecting the scintillation light, and completely novel methods to detect gamma rays by means of semiconductor detectors. In addition to combined instrumentation that can be used for SPECT and PET, already in clinical use, combined scintigraphic and anatomic imaging devices are now becoming available, for example SPECT/CT or PET/CT. This review article describes the most important of the new components, part of which have already entered product development and part of which are still in the research phase. The review focus on the employment of modern semiconductor detectors in Nuclear Medicine. (orig.) [de

Efficacy of the core DNA barcodes in identifying processed and poorly conserved plant materials commonly used in South African traditional medicine

Directory of Open Access Journals (Sweden)

Ledile Mankga

2013-12-01

Full Text Available Medicinal plants cover a broad range of taxa, which may be phylogenetically less related but morphologically very similar. Such morphological similarity between species may lead to misidentification and inappropriate use. Also the substitution of a medicinal plant by a cheaper alternative (e.g. other non-medicinal plant species, either due to misidentification, or deliberately to cheat consumers, is an issue of growing concern. In this study, we used DNA barcoding to identify commonly used medicinal plants in South Africa. Using the core plant barcodes, matK and rbcLa, obtained from processed and poorly conserved materials sold at the muthi traditional medicine market, we tested efficacy of the barcodes in species discrimination. Based on genetic divergence, PCR amplification efficiency and BLAST algorithm, we revealed varied discriminatory potentials for the DNA barcodes. In general, the barcodes exhibited high discriminatory power, indicating their effectiveness in verifying the identity of the most common plant species traded in South African medicinal markets. BLAST algorithm successfully matched 61% of the queries against a reference database, suggesting that most of the information supplied by sellers at traditional medicinal markets in South Africa is correct. Our findings reinforce the utility of DNA barcoding technique in limiting false identification that can harm public health.

Anorexia: Highlights in Traditional Persian medicine and conventional medicine

Science.gov (United States)

Nimrouzi, Majid; Zarshenas, Mohammad Mehdi

2018-01-01

Objective: Anorexia and impaired appetite (Dysorexia) are common symptoms with varying causes, and often need no serious medical intervention. Anorexia nervosa (AN) is a chronic psychiatric disease with a high mortality rate. In Traditional Persian Medicine (TPM), anorexia is a condition in which anorexic patients lose appetite due to dystemperament. This review aims to discuss the common points of traditional and conventional approaches rather than introducing Persian medical recommendations suitable for nowadays use. Materials and Methods: For this purpose, Avicenna's Canon of Medicine, main TPM resources and important databases were reviewed using the related keywords. Results: Despite complex hormonal explanation, etiology of AN in conventional approach is not completely understood. In TPM approach, the etiology and recommended interventions are thoroughly defined based on humoral pathophysiology. In TPM approach, disease states are regarded as the result of imbalances in organs’ temperament and humors. In anorexia with simple dystemperament, the physician should attempt to balance the temperament using foods and medicaments which have opposite quality of temperament. Lifestyle, spiritual diseases (neuro – psychological) and gastrointestinal worms are the other causes for reducing appetite. Also, medicines and foods with warm temperaments (such as Pea soup and Mustard) are useful for these patients (cold temperament). Conclusion: Although the pathophysiology of AN in TPM is different in comparison with conventional views, TPM criteria for treatment this disorder is similar to those of current medicine. Recommending to have spiritual support and a healthy lifestyle are common in both views. Simple safe interventions recommended by TPM may be considered as alternative medical modalities after being confirmed by well-designed clinical trials. PMID:29387569

Method to assist conception of collimators in nuclear medicine

International Nuclear Information System (INIS)

Gantet, P.; Esquerre, J.P.; Danet, B.; Roux, G.; Guiraud, R.

1990-01-01

Designing a collimator should begin by an accurate computation of its performances in order to minimize the usual expensive and time consuming phase of trial and error. The authors briefly describe several methods currently used, and present a method of simulation of the percussional response of collimators. The computation takes into account the attenuation of photons by the collimator septas. An other benefit is its ability to be used whatever the geometric specifications of the collimator. The program computes spatial resolution, geometric efficiency, septal penetration, as well as slice thickness when the collimator is used with a SPECT device. The study presents the results concerning two collimators: a general purpose parallel hole commercially available and a focused parallel one dedicated to a single slice SPECT system. In conclusion, this deterministic method which takes attenuation into account for collimators performances computation should be useful tool to assist conception of new collimators in nuclear medicine [fr

Finite Element Method for Analysis of Material Properties

DEFF Research Database (Denmark)

Rauhe, Jens Christian

and the finite element method. The material microstructure of the heterogeneous material is non-destructively determined using X-ray microtomography. A software program has been generated which uses the X-ray tomographic data as an input for the mesh generation of the material microstructure. To obtain a proper...... which are used for the determination of the effective properties of the heterogeneous material. Generally, the properties determined using the finite element method coupled with X-ray microtomography are in good agreement with both experimentally determined properties and properties determined using......The use of cellular and composite materials have in recent years become more and more common in all kinds of structural components and accurate knowledge of the effective properties is therefore essential. In this wok the effective properties are determined using the real material microstructure...

Materials for Molybdenum 99 purification

International Nuclear Information System (INIS)

Wilkinson, M. Victoria; Mondino, Angel V.; Manzini, Alberto C.

2003-01-01

The National Atomic Energy Commission (CNEA) produces fission Mo 99, an isotope of wide use in nuclear medicine. In order to simplify the current Mo 99 production process, to shorten its duration and reduce impurities in the final product, alternative methods for purification steps were looked for. In this work a variety of new materials for the purification columns were designed, all of them with carbon. These materials were studied and a material which contribute with the best results for molybdenum retention, was selected. The preparation procedure and the working conditions were determined. (author)

Integrative medicine is a future medicine

International Nuclear Information System (INIS)

Samosyuk, I.Z.; Chukhraev, N.V.

2001-01-01

An analysis is given of the modern integrative medicine basis which is the synthesis of: 1. Theology, philosophy and sociology; 2. Physico-mathematical sciences, cybernetics, chemistry and astrology; 3. Medico-biological and clinical experience; 4. Traditional and scientific medicine; 5. Use of traditional and new medical technologies. Problems of 'holistic' medicine which considers Man as a unity of biological, emotional, psychological and social phenomena are exposed. Advantages in combining the drug therapy with modern physiotherapy and physioacupuncture methods seem to be obvious. All visible effects of a disease can de represented in the following forms of changes: information-energy - biochemical - ultrastructure - tissue - clinical diseases. Self-regulation of functional systems has a multilevel structure and needs application of different methods for body recovery. Short-wave irradiation (lasers, magnetotherapy) can be used for energy restoration in functional systems or meridians, and acupuncture plays the role of a 'trigger' which activises the body recovery. Integration of Western and Oriental medicines is the way for achieving the qualitative new level of health protection

Tomographic methods in nuclear medicine

International Nuclear Information System (INIS)

Ahluwalia, B.D.

1989-01-01

This book is a review of the various approaches to tomographic imaging that have been pursued in nuclear medicine. The evolution of single photon emission computed tomography (SPECT) is discussed in detail, and the major classes of instrumentation are represented. A section on positron emission tomography is also included, but is rather brief and may serve only as a general introduction

[Application of image recognition technology in census of national traditional Chinese medicine resources].

Science.gov (United States)

Zhang, Xiao-Bo; Ge, Xiao-Guang; Jin, Yan; Shi, Ting-Ting; Wang, Hui; Li, Meng; Jing, Zhi-Xian; Guo, Lan-Ping; Huang, Lu-Qi

2017-11-01

With the development of computer and image processing technology, image recognition technology has been applied to the national medicine resources census work at all stages.Among them: ①In the preparatory work, in order to establish a unified library of traditional Chinese medicine resources, using text recognition technology based on paper materials, be the assistant in the digitalization of various categories related to Chinese medicine resources; to determine the representative area and plots of the survey from each census team, based on the satellite remote sensing image and vegetation map and other basic data, using remote sensing image classification and other technical methods to assist in determining the key investigation area. ②In the process of field investigation, to obtain the planting area of Chinese herbal medicine was accurately, we use the decision tree model, spectral feature and object-oriented method were used to assist the regional identification and area estimation of Chinese medicinal materials.③In the process of finishing in the industry, in order to be able to relatively accurately determine the type of Chinese medicine resources in the region, based on the individual photos of the plant, the specimens and the name of the use of image recognition techniques, to assist the statistical summary of the types of traditional Chinese medicine resources. ④In the application of the results of transformation, based on the pharmaceutical resources and individual samples of medicinal herbs, the development of Chinese medicine resources to identify APP and authentic herbs 3D display system, assisted the identification of Chinese medicine resources and herbs identification characteristics. The introduction of image recognition technology in the census of Chinese medicine resources, assisting census personnel to carry out related work, not only can reduce the workload of the artificial, improve work efficiency, but also improve the census results

The stress analysis method for three-dimensional composite materials

Science.gov (United States)

Nagai, Kanehiro; Yokoyama, Atsushi; Maekawa, Zen'ichiro; Hamada, Hiroyuki

1994-05-01

This study proposes a stress analysis method for three-dimensionally fiber reinforced composite materials. In this method, the rule-of mixture for composites is successfully applied to 3-D space in which material properties would change 3-dimensionally. The fundamental formulas for Young's modulus, shear modulus, and Poisson's ratio are derived. Also, we discuss a strength estimation and an optimum material design technique for 3-D composite materials. The analysis is executed for a triaxial orthogonally woven fabric, and their results are compared to the experimental data in order to verify the accuracy of this method. The present methodology can be easily understood with basic material mechanics and elementary mathematics, so it enables us to write a computer program of this theory without difficulty. Furthermore, this method can be applied to various types of 3-D composites because of its general-purpose characteristics.

Method of distillation of bituminous material

Energy Technology Data Exchange (ETDEWEB)

Gustafsson, E G.T.

1919-11-12

A method is described of dry distillation of bituminous materials by leading warm combustible gases, mixed or not mixed with steam, through the distillation chamber in direct contact with the materials, during which process the distillation chamber may be heated by other means. It is characterized by the mixture of distillation products (formed by the vapors produced by heating the raw materials) and the gas (circulating gas) used for heating in the process, being led through coolers or similar contrivances, in order to separate through condensation the greater part of the content of the products or materials condensable at ordinary temperatures, and also to recover as much as possible of the highly volatile oils in the gas. Thereafter the gas is split, one part is, without further cleaning, and led through the distillation chamber, after this gas has been reheated in suitable apparatus. The other part (surplus gas), which in volume corresponds approximately to the new-formed distillation gases, is treated according to known methods for the extraction of the remaining products of the distillation, such as volatile oils, ammonia, methyl alcohol, sulfuretted hydrogen, and others. The patent contains three other claims.

[Social medicine in medical faculties: realisation of the topic in the specialty "social medicine, occupational health"].

Science.gov (United States)

Behmann, M; Bisson, S; Walter, U

2011-12-01

The 9 (th) Revision of German Medical Licensing Regulations for Physicians has come into effect on October 1 (st) 2003. Social medicine was separated into the fields "occupational health, social medicine" and the various cross-sectional modules: epidemiology, biometry, medical computer science; health economics, health-care system, public health; prevention, health promotion; rehabilitation, physical medicine, naturopathic treatment. This paper studies the realisation of teaching in the field social medicine at German medical faculties. The survey was conducted in collaboration with the German Association for Social Medicine and Prevention (DGSMP). A survey was conducted at 38 institutes of 36 German medical faculties. The written questionnaire contained mostly selection items in which chances and barriers of the field were queried with supply items. Information about time scale, general conditions and resources was aked for. On the basis of the guidelines of the DGSMP, the topics to be taught were evaluated concerning their relevance and integration into education. The response rate was 68% (n=26). Social insurance, basic principles, responsibility in the Social Security Code and the different providers were judged as the most important topics. There was a strong demand for lecturing material. 82% (n=18) of the faculties wished to have specific material, for example e-learning, examples, lesson plans, curricula and also textbooks. 91% (n=19) of the faculties requested an exchange of information between the faculties concerning educational contents, motivation of students and e-learning. The realisation of teaching is different between the faculties concerning the number of hours, teaching methods and number of students per year. The motivation of the students is one of the problems, but also the lack of acceptance within the clinic. Specific resources and exchange between the faculties are necessary concerning e-learning, which is offered at only few faculties so

An improved method for basic hydrolysis of isoflavone malonylglucosides and quality evaluation of Chinese soy materials.

Science.gov (United States)

Yuan, Dan; Pan, Yingni; Chen, Yan; Uno, Toshio; Zhang, Shaohui; Kano, Yoshihiro

2008-01-01

Basic hydrolysis procedure is often included in the sample preparation in order to quantify malonylglucosides or acetylglucosides of soy materials. However, it is preferable not to use NaOH as a hydrolytic reagent considering the effect of its alkalinity on the successive injection to HPLC and low acidity of soy isoflavones. This paper presents an improved method for basic hydrolysis using ammonia as a hydrolytic reagent without the additional neutralization step. Moreover, by means of HPLC and LC-MS methods, a systematic quality evaluation of natural soy materials from Chinese markets were established and discussed, inclusive of soybeans, black soybeans, defatted soy flours, as well as the distribution of isoflavones in the seed coat, hypocotyl and cotyledon. The results indicate that HPLC profiling patterns of originating various isoflavone constituents of Chinese soybeans was similar to those of Japanese ones, and those of Chinese black soybeans was similar to those of American ones. The average content level of total soy isoflavones of Chinese soybeans and black soybeans were a little lower than that of American and Japanese ones. Additionally, the thorough analysis for Semen Sojae Praeparatum, a Chinese herbal medicine made from fermented black soybeans or soybeans was done for the first time and the characteristic of its HPLC profiling patterns shows the higher content of isoflavone glucosides and aglycones than those of natural soy materials.

Fundamentals of nuclear medicine

Energy Technology Data Exchange (ETDEWEB)

Alazraki, N.P.; Mishkin, F.S.

1984-01-01

This guidebook for clinical nuclear medicine is written as a description of how nuclear medicine procedures should be used by clinicians in evaluating their patients. It is designed to assist medical students and physicians in becoming acquainted with nuclear medicine techniques for detecting and evaluating most common disorders. The material provides an introduction to, not a textbook of, nuclear medicine. Each chapter is devoted to a particular organ system or topic relevant to the risks and benefits involved in nuclear medicine studies. The emphasis is on presenting the rationales for ordering the various clinical imaging procedures performed in most nuclear medicine departments. Where appropriate, alternative imaging modalities including ultrasound, computed tomography imaging, and radiographic special procedures are discussed. Comparative data between nuclear medicine imaging and other modalities are presented to help guide the practicing clinician in the selection of the most appropriate procedure for a given problem.

Nuclear medicine methods used in diagnosing diseases of the gastrointestinal tract

International Nuclear Information System (INIS)

Kostadinova, I.

2001-01-01

Using physiologic tracer scintigraphy may give unique information on gastrointestinal (GI) motility and function, supplementing the findings of rather invasive methods. Conventional barium-contrast x-ray studies of the GI tract, computed tomography, ultrasonography and magnetic resonance imaging afford high resolution images of the GI anatomy, but have a serious shortcoming - hardly lending themselves to quantification. As shown by the results functional scintigraphy is a sensitive, quantitative and noninvasive procedure. The potential of nuclear medicine methods to diagnose successfully diseases of the salivary glands, esophagus, stomach and visualization of GI bleeding and hepatobiliary system are comprehensively discussed. The advantages and drawbacks of radionuclide techniques are outlined, and compared with other methods of visualization. (author)

Integration of Chinese medicine with Western medicine could lead to future medicine: molecular module medicine.

Science.gov (United States)

Zhang, Chi; Zhang, Ge; Chen, Ke-ji; Lu, Ai-ping

2016-04-01

The development of an effective classification method for human health conditions is essential for precise diagnosis and delivery of tailored therapy to individuals. Contemporary classification of disease systems has properties that limit its information content and usability. Chinese medicine pattern classification has been incorporated with disease classification, and this integrated classification method became more precise because of the increased understanding of the molecular mechanisms. However, we are still facing the complexity of diseases and patterns in the classification of health conditions. With continuing advances in omics methodologies and instrumentation, we are proposing a new classification approach: molecular module classification, which is applying molecular modules to classifying human health status. The initiative would be precisely defining the health status, providing accurate diagnoses, optimizing the therapeutics and improving new drug discovery strategy. Therefore, there would be no current disease diagnosis, no disease pattern classification, and in the future, a new medicine based on this classification, molecular module medicine, could redefine health statuses and reshape the clinical practice.

Standard Test Methods for Constituent Content of Composite Materials

CERN Document Server

American Society for Testing and Materials. Philadelphia

2009-01-01

1.1 These test methods determine the constituent content of composite materials by one of two approaches. Method I physically removes the matrix by digestion or ignition by one of seven procedures, leaving the reinforcement essentially unaffected and thus allowing calculation of reinforcement or matrix content (by weight or volume) as well as percent void volume. Method II, applicable only to laminate materials of known fiber areal weight, calculates reinforcement or matrix content (by weight or volume), and the cured ply thickness, based on the measured thickness of the laminate. Method II is not applicable to the measurement of void volume. 1.1.1 These test methods are primarily intended for two-part composite material systems. However, special provisions can be made to extend these test methods to filled material systems with more than two constituents, though not all test results can be determined in every case. 1.1.2 The procedures contained within have been designed to be particularly effective for ce...

World Workshop on Oral Medicine VI

DEFF Research Database (Denmark)

Villa, Alessandro; Wolff, Andy; Narayana, Nagamani

2016-01-01

OBJECTIVE: To perform a systematic review of the pathogenesis of medication-induced salivary gland dysfunction (MISGD). MATERIALS AND METHODS: Review of the identified papers was based on the standards regarding the methodology for systematic reviews set forth by the World Workshop on Oral Medicine...... of the studies considered only xerostomia. Thus, further human studies are necessary to improve our understanding of the association between MISGD and the underlying pathophysiology. This article is protected by copyright. All rights reserved....

[Study on incompatibility of traditional Chinese medicines].

Science.gov (United States)

Fan, Xin-sheng; Duan, Jin-ao; Hua, Hao-ming; Qian, Da-wei; Shang, Er-xin; Guo, Jian-ming

2015-04-01

The incompatibility of traditional Chinese medicines is related to the clinical medication safety, so has attracted wide attentions from the public. With the deepening of studies on the incompatibility of traditional Chinese medicines represented by 18 incompatible herbs, the incompatibility of theory traditional Chinese medicines has raised to new heights. From the origin of incompatibility theory of traditional Chinese medicines, relationship of herbs, harms of incompatible herbs and principle of prevention to toxic effects of specific incompatible medicines, the innovation and development of the traditional Chinese medicine incompatibility theory was explored. Structurally, the incompatibility of traditional Chinese medicines refers to the opposition of two herbs based on seven emotions and clinical experience. The combination of incompatible herbs may lead to human harms, especially latent harm and inefficacy of intervention medicines. The avoidance of the combination of incompatible herbs and the consideration of both symptoms and drug efficacy are the basic method to prevent adverse reactions. The recent studies have revealed five characteristics of incompatible herbs. Toxicity potentiation, toxication, efficacy reduction and inefficacy are the four manifestations of the incompatible relations. The material changes can reflect the effects of toxicity potentiation and toxication of opposite herbs. The accumulation of toxicity and metabolic changes are the basis for latent harms. The antagonistic effect of main efficacies and the coexistence of positive and negative effects are the distinctive part of the incompatibility. The connotation of incompatible herbs plays an important role in the innovation of the traditional Chinese medicine incompatibility theory.

ECM and ECM-like materials - Biomaterials for applications in regenerative medicine and cancer therapy.

Science.gov (United States)

Hinderer, Svenja; Layland, Shannon Lee; Schenke-Layland, Katja

2016-02-01

Regenerative strategies such as stem cell-based therapies and tissue engineering applications are being developed with the aim to replace, remodel, regenerate or support damaged tissues and organs. In addition to careful cell type selection, the design of appropriate three-dimensional (3D) scaffolds is essential for the generation of bio-inspired replacement tissues. Such scaffolds are usually made of degradable or non-degradable biomaterials and can serve as cell or drug carriers. The development of more effective and efficient drug carrier systems is also highly relevant for novel cancer treatment strategies. In this review, we provide a summary of current approaches that employ ECM and ECM-like materials, or ECM-synthetic polymer hybrids, as biomaterials in the field of regenerative medicine. We further discuss the utilization of such materials for cell and drug delivery, and highlight strategies for their use as vehicles for cancer therapy. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Method of measurement on materials shielding effectiveness test in time domain

International Nuclear Information System (INIS)

Liu Shunkun; Han Jun; Chen Xiangyue

2009-01-01

Windows method is a measurement of slot coupling effect in nature when it is used to measure material's shielding effectiveness. The error of measurement will become serious when it is used to measure material's shielding effectiveness in low frequency band. It is difficult to measure material's shielding effectiveness of electromagnetic pulse with Windows method. Device under test method (DUT method) was presented in this paper to overcome the limitations of Windows method in material's shielding effectiveness test. The method can be used to measure any material's shielding Effectiveness effectively through the design and the test of the DUT.The method was used to measure shielding effectiveness of special cement .Compared with theoretical analysis,the measurement result prove the DUT method to be very efficient in material's shielding effectiveness test. (authors)

Method of producing catalytic material for fabricating nanostructures

Science.gov (United States)

Seals, Roland D.; Menchhofer, Paul A.; Howe, Jane Y.; Wang, Wei

2018-01-30

Methods of fabricating nano-catalysts are described. In some embodiments the nano-catalyst is formed from a powder-based substrate material and is some embodiments the nano-catalyst is formed from a solid-based substrate material. In some embodiments the substrate material may include metal, ceramic, or silicon or another metalloid. The nano-catalysts typically have metal nanoparticles disposed adjacent the surface of the substrate material. The methods typically include functionalizing the surface of the substrate material with a chelating agent, such as a chemical having dissociated carboxyl functional groups (--COO), that provides an enhanced affinity for metal ions. The functionalized substrate surface may then be exposed to a chemical solution that contains metal ions. The metal ions are then bound to the substrate material and may then be reduced, such as by a stream of gas that includes hydrogen, to form metal nanoparticles adjacent the surface of the substrate.

Preliminary investigation of the possibility for implementation of modified pharmacopoeial HPLC methods for quality control of metronidazole and ciprofloxacin in medicinal products used in veterinary medicine

Directory of Open Access Journals (Sweden)

Marjan Piponski

2015-03-01

Full Text Available Quality control of veterinary medicine products containing two different frequently used antibiotics metronidazole and ciprofloxacin hydrochloride, was considered and performed, using modified pharmacopoeial HPLC methods. Three different HPLC systems were used: Varian ProStar, Perkin Elmer Series and UPLC Shimadzu Prominence XR. The chromatographic columns used were LiChropher RP Select B 75 mm x 4 mm with 5 μm particles and Discovery C18 100 mm x 4,6 mm with 5 μm particles. Chromatographic methods used for both analytes were compendial, with minor modifications made for experimental purposes. Minor modifications of the pharmacopoeia prescribed chromatographic conditions, in both cases, led to better chromatographic parameters, good resolution and shorter analysis times. Optimized methods can be used for: determination of metronidazole in gel formulation, for its simultaneous quantification with preservatives present in the formulation and even for identification and quantification of its specified impurity, 2-methyl-5-nitroimidazole; determination of ciprofloxacin hydrochloride in film coated tablets and eye drops and identification and quantification of its specified impurities. These slightly modified and optimized pharmacopoeial methods for quality control of metronidazole and ciprofloxacin dosage forms used in veterinary medicine can be successfully applied in laboratories for quality control of veterinary medicines.

Agreement between self-reported data on medicine use and prescription records vary according to method of analysis and therapeutic group

DEFF Research Database (Denmark)

Nielsen, Merete Willemoes; Søndergaard, Birthe; Kjøller, Mette

2008-01-01

OBJECTIVE: This study compared national self-reported data on medicine use and national prescription records at the individual level. STUDY DESIGN AND SETTING: Data from the nationally representative Danish health survey conducted in 2000 (n=16,688) were linked at the individual level to national...... prescription records covering 1999-2000. Kappa statistics and 95% confidence intervals were calculated. RESULTS: Applying the legend time method to medicine groups used mainly on a chronic basis revealed good to very good agreement between the two data sources, whereas medicines used as needed showed fair...... to moderate agreement. When a fixed-time window was applied for analysis, agreement was unchanged for medicines used mainly on a chronic basis, whereas agreement increased somewhat compared to the legend time method when analyzing medicines used as needed. CONCLUSION: Agreement between national self...

Experience with Nuclear Medicine Information System

Directory of Open Access Journals (Sweden)

Bilge Volkan-Salanci

2012-12-01

Full Text Available Objective: Radiology information system (RIS is basically evolved for the need of radiologists and ignores the vital steps needed for a proper work flow of Nuclear Medicine Department. Moreover, CT/MRI oriented classical PACS systems are far from satisfying Nuclear Physicians like storing dynamic data for reprocessing and quantitative analysis of colored images. Our purpose was to develop a workflow based Nuclear Medicine Information System (NMIS that fulfills the needs of Nuclear Medicine Department and its integration to hospital PACS system. Material and Methods: Workflow in NMIS uses HL7 (health level seven and steps include, patient scheduling and retrieving information from HIS (hospital information system, radiopharmacy, acquisition, digital reporting and approval of the reports using Nuclear Medicine specific diagnostic codes. Images and dynamic data from cameras of are sent to and retrieved from PACS system (Corttex© for reprocessing and quantitative analysis. Results: NMIS has additional functions to the RIS such as radiopharmaceutical management program which includes stock recording of both radioactive and non-radioactive substances, calculation of the radiopharmaceutical dose for individual patient according to body weight and maximum permissible activity, and calculation of radioactivity left per unit volume for each radionuclide according their half lives. Patient scheduling and gamma camera patient work list settings were arranged according to specific Nuclear Medicine procedures. Nuclear Medicine images and reports can be retrieved and viewed from HIS. Conclusion: NMIS provides functionality to standard RIS and PACS system according to the needs of Nuclear Medicine. (MIRT 2012;21:97-102

GEPSI: A Gene Expression Profile Similarity-Based Identification Method of Bioactive Components in Traditional Chinese Medicine Formula.

Science.gov (United States)

Zhang, Baixia; He, Shuaibing; Lv, Chenyang; Zhang, Yanling; Wang, Yun

2018-01-01

The identification of bioactive components in traditional Chinese medicine (TCM) is an important part of the TCM material foundation research. Recently, molecular docking technology has been extensively used for the identification of TCM bioactive components. However, target proteins that are used in molecular docking may not be the actual TCM target. For this reason, the bioactive components would likely be omitted or incorrect. To address this problem, this study proposed the GEPSI method that identified the target proteins of TCM based on the similarity of gene expression profiles. The similarity of the gene expression profiles affected by TCM and small molecular drugs was calculated. The pharmacological action of TCM may be similar to that of small molecule drugs that have a high similarity score. Indeed, the target proteins of the small molecule drugs could be considered TCM targets. Thus, we identified the bioactive components of a TCM by molecular docking and verified the reliability of this method by a literature investigation. Using the target proteins that TCM actually affected as targets, the identification of the bioactive components was more accurate. This study provides a fast and effective method for the identification of TCM bioactive components.

[Children's and adolescent's use of medicine for aches and psychological problems: secular trends from 1988 to 2006.

DEFF Research Database (Denmark)

Holstein, Bjørn; Andersen, Anette; Due, Pernille

2009-01-01

INTRODUCTION: Medicine use for aches and psychological problems is common among adolescents. Medicines are toxic and may have harmful side effects. It is therefore important to study change over time and patterns of medicine use. The objective of this paper is to describe self-reported medicine use...... for headaches, stomach-aches, difficulties in falling asleep, and nervousness among 11-, 13-, and 15-year-old boys and girls from 1968 to 2006. MATERIAL AND METHODS: The data material is 6 comparable and representative cross-sectional studies of 11-, 13-, and 15-year-olds from 1988, 1991, 1994, 1998, 2002......: There was a significant increase in 11-, 13-, and 15-year-old student's use of medicine for aches and psychological problems from 1988 to 2006. In the same period, there was a decrease in the prevalence of students who reported pains monthly. Udgivelsesdato: 2009-Jan-5...

Basis material decomposition method for material discrimination with a new spectrometric X-ray imaging detector

Science.gov (United States)

Brambilla, A.; Gorecki, A.; Potop, A.; Paulus, C.; Verger, L.

2017-08-01

Energy sensitive photon counting X-ray detectors provide energy dependent information which can be exploited for material identification. The attenuation of an X-ray beam as a function of energy depends on the effective atomic number Zeff and the density. However, the measured attenuation is degraded by the imperfections of the detector response such as charge sharing or pile-up. These imperfections lead to non-linearities that limit the benefits of energy resolved imaging. This work aims to implement a basis material decomposition method which overcomes these problems. Basis material decomposition is based on the fact that the attenuation of any material or complex object can be accurately reproduced by a combination of equivalent thicknesses of basis materials. Our method is based on a calibration phase to learn the response of the detector for different combinations of thicknesses of the basis materials. The decomposition algorithm finds the thicknesses of basis material whose spectrum is closest to the measurement, using a maximum likelihood criterion assuming a Poisson law distribution of photon counts for each energy bin. The method was used with a ME100 linear array spectrometric X-ray imager to decompose different plastic materials on a Polyethylene and Polyvinyl Chloride base. The resulting equivalent thicknesses were used to estimate the effective atomic number Zeff. The results are in good agreement with the theoretical Zeff, regardless of the plastic sample thickness. The linear behaviour of the equivalent lengths makes it possible to process overlapped materials. Moreover, the method was tested with a 3 materials base by adding gadolinium, whose K-edge is not taken into account by the other two materials. The proposed method has the advantage that it can be used with any number of energy channels, taking full advantage of the high energy resolution of the ME100 detector. Although in principle two channels are sufficient, experimental measurements show

Historical versus contemporary medicinal plant uses in the US Virgin Islands

DEFF Research Database (Denmark)

Soelberg, Jens; Davis, Olasee; Jäger, Anna K

2016-01-01

West Indies (now US Virgin Islands), we identify pre-1900 medicinal plants and their historical uses, and trace their status in the traditional medicine of St. Croix today (2014). By a combined historical and ethnobotanical approach we assess the scale of loss and preservation of traditional medicinal...... knowledge on St. Croix, and explore the drivers involved in the disappearance of knowledge in the oral tradition of medicine. MATERIALS AND METHODS: Names, uses and identities of 18th and 19th century medicinal plant uses in the Danish West Indies were derived from manuscripts and publications of Von Rohr...... (1757/58), Oldendorp (1777), West (1793), Benzon (1822), Riise (1853), Eggers (1876;1879) and Berg and Eggers (1888). The presence of the plant species in the pre-1900 Danish West Indies was confirmed by review of herbarium specimens in the University of Copenhagen Herbarium (C). The same species were...

The model of Western integrative medicine: the role of Chinese medicine.

Science.gov (United States)

Dobos, Gustav; Tao, Iven

2011-01-01

The basic concept of integrative medicine (IM) is that by combining mainstream (biomedicine) with complementary and alternative medicine (CAM), synergistic therapeutic effects can be attained. When the methods of mind/body medicine (MBM) are added to this combination, as in Western countries, a new concept emerges that drastically changes the approach toward illness.It is interesting to note that the joining of traditional Chinese medicine and Western medicine in the early days of the Peoples' Republic of China preceded the Western model of IM by almost 50 years. Several elements that make up the key components of IM as practiced today in the West were already present in the Chinese version of IM, and Chinese medicine has played and continues to play an important role in advancing IM. However, one of the major differences between the Chinese and the Western models of IM today, besides MBM and some other treatment options, is that Western integrative medicine (WIM) strictly requires its CAM methods to be supported by scientific evidence.The therapeutic methods of IM and their applications are many and varied. However, they are most frequently employed to treat chronic medical conditions, e.g., bronchial asthma, rheumatic disease, chronic inflammatory bowel disorder and chronic pain. Other fields in which IM may be applied are internal medicine (inflammatory bowel diseases and cardiovascular diseases), musculoskeletal disorders, oncology (chemotherapy-induced side effects), obstetrics and gynecology (dysmenorrhea, endometriosis, infertility and menopausal complaints), pediatrics, geriatrics, neurology (migraine and chronic headache), and psychiatry (anxiety and depression).The concept of WIM is discussed here in detail by reviewing its scope and implications for the practice of medicine and focusing on the role of Chinese medicine in WIM.

METHODS FOR DETECTING BACTERIA USING POLYMER MATERIALS

NARCIS (Netherlands)

Van Grinsven Bart Robert, Nicolaas; Cleij, Thomas

2017-01-01

A method for characterizing bacteria includes passing a liquid containing an analyte comprising a first bacteria and a second bacteria over and in contact with a polymer material on a substrate. The polymer material is formulated to bind to the first bacteria, and the first bacteria binds to the

Use of radioactive materials in Medicine

International Nuclear Information System (INIS)

Martinez-Duncker R, C.

1999-01-01

The diagnostic studies of Molecular Nuclear Medicine allow diagnose, to confirm and characterize a large variety of illnesses avoiding at the same time the cost and or the risk or other studies for confirming or excluding the illness, providing new information which can characterize more accurately the syndrome which would be present the patient. The new information is reliable since it can be reproduced and with this to make a follow-up adequate of the person. The new and trusty information obtained allows to increase or diminish quickly the probability which the patient had a specific illness. (Author)

NREL Patents Method for Continuous Monitoring of Materials During

Science.gov (United States)

Manufacturing | News | NREL NREL Patents Method for Continuous Monitoring of Materials During Manufacturing News Release: NREL Patents Method for Continuous Monitoring of Materials During Manufacturing NREL's Energy Systems Integration Facility (ESIF). More information, including the published patent, can

Standard test method for galling resistance of material couples

CERN Document Server

American Society for Testing and Materials. Philadelphia

2008-01-01

1.1 This test method covers a laboratory test that ranks the galling resistance of material couples using a quantitative measure. Bare metals, alloys, nonmetallic materials, coatings, and surface modified materials may be evaluated by this test method. 1.2 This test method is not designed for evaluating the galling resistance of material couples sliding under lubricated conditions, because galling usually will not occur under lubricated sliding conditions using this test method. 1.3 The values stated in SI units are to be regarded as standard. No other units of measurement are included in this standard. 1.4 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

A new criterion of photostimulated luminescence (PSL) method to detect irradiated traditional Chinese medicinal herbs

International Nuclear Information System (INIS)

Zhang, Liwen; Lin, Tong; Jiang, Yingqiao; Bi, Fujun

2013-01-01

This work used a new criterion to analyze 162 varieties (222 batches) of traditional Chinese medicinal herbs based on the European Standard EN 13751 (2009. Foodstuffs—Detection of Irradiated Food Using Photostimulated Luminescence. European Committee for Standardization, Brussels, Belgium). The characteristics of PSL signals are described, and a new criterion is established. Compared to EN 13751, the new criterion uses clearer definition to evaluate instead of the ambiguous descriptions in EN Standard, such as “much greater than” and “within the same order of magnitude”. Moreover, the accuracy of the new criterion is as good as or better than EN Standard in regard to classifying irradiated and non-irradiated traditional Chinese medicinal herbs. It can help to avoid false positive result when a non-irradiated herb got a screening PSL measurement above 5000 counts/60 s. This new criterion of photostimulated luminescence method can be applied to identify the irradiation status of traditional Chinese medicinal herbs, even if the medicinal herbs were irradiated at a low dose (0.3 kGy) or stored in the dark at room temperature for 24 months after the irradiation treatment. - Highlights: • Clearer evaluation criterion instead of the ambiguous descriptions in EN 13751. • Accuracy satisfied. • Large sample size provides outstanding representativeness. • Systematical evaluation on PSL method

Material-Point Method Analysis of Bending in Elastic Beams

DEFF Research Database (Denmark)

Andersen, Søren Mikkel; Andersen, Lars

2007-01-01

The aim of this paper is to test different types of spatial interpolation for the material-point method. The interpolations include quadratic elements and cubic splines. A brief introduction to the material-point method is given. Simple liner-elastic problems are tested, including the classical...... cantilevered beam problem. As shown in the paper, the use of negative shape functions is not consistent with the material-point method in its current form, necessitating other types of interpolation such as cubic splines in order to obtain smoother representations of field quantities. It is shown...

A Review of Current Methods for Analysis of Mycotoxins in Herbal Medicines

Science.gov (United States)

Zhang, Lei; Dou, Xiao-Wen; Zhang, Cheng; Logrieco, Antonio F.; Yang, Mei-Hua

2018-01-01

The presence of mycotoxins in herbal medicines is an established problem throughout the entire world. The sensitive and accurate analysis of mycotoxin in complicated matrices (e.g., herbs) typically involves challenging sample pretreatment procedures and an efficient detection instrument. However, although numerous reviews have been published regarding the occurrence of mycotoxins in herbal medicines, few of them provided a detailed summary of related analytical methods for mycotoxin determination. This review focuses on analytical techniques including sampling, extraction, cleanup, and detection for mycotoxin determination in herbal medicines established within the past ten years. Dedicated sections of this article address the significant developments in sample preparation, and highlight the importance of this procedure in the analytical technology. This review also summarizes conventional chromatographic techniques for mycotoxin qualification or quantitation, as well as recent studies regarding the development and application of screening assays such as enzyme-linked immunosorbent assays, lateral flow immunoassays, aptamer-based lateral flow assays, and cytometric bead arrays. The present work provides a good insight regarding the advanced research that has been done and closes with an indication of future demand for the emerging technologies. PMID:29393905

A measurement method for piezoelectric material properties under longitudinal compressive stress–-a compression test method for thin piezoelectric materials

International Nuclear Information System (INIS)

Kang, Lae-Hyong; Lee, Dae-Oen; Han, Jae-Hung

2011-01-01

We introduce a new compression test method for piezoelectric materials to investigate changes in piezoelectric properties under the compressive stress condition. Until now, compression tests of piezoelectric materials have been generally conducted using bulky piezoelectric ceramics and pressure block. The conventional method using the pressure block for thin piezoelectric patches, which are used in unimorph or bimorph actuators, is prone to unwanted bending and buckling. In addition, due to the constrained boundaries at both ends, the observed piezoelectric behavior contains boundary effects. In order to avoid these problems, the proposed method employs two guide plates with initial longitudinal tensile stress. By removing the tensile stress after bonding a piezoelectric material between the guide layers, longitudinal compressive stress is induced in the piezoelectric layer. Using the compression test specimens, two important properties, which govern the actuation performance of the piezoelectric material, the piezoelectric strain coefficients and the elastic modulus, are measured to evaluate the effects of applied electric fields and re-poling. The results show that the piezoelectric strain coefficient d 31 increases and the elastic modulus decreases when high voltage is applied to PZT5A, and the compression in the longitudinal direction decreases the piezoelectric strain coefficient d 31 but does not affect the elastic modulus. We also found that the re-poling of the piezoelectric material increases the elastic modulus, but the piezoelectric strain coefficient d 31 is not changed much (slightly increased) by re-poling

Application of radiochemical determination methods in cleanability research of building materials

International Nuclear Information System (INIS)

Maeaettae, Jenni; Kymaelaeinen, Hanna-Riitta; Sjoeberg, Anna-Maija

2011-01-01

During recent years increasing effort has been made to modify surface properties with easy-to-clean or self-cleaning characteristics, and concomitantly there is a need to be able to quantify cleanability. Methodology is a complex issue, including aspects of selection and characterization of the surface materials, the soiling materials (contaminants), soiling and cleaning methods, and the detection methods. Different biological, chemical, physical and visual methods have been included in studies of surface cleanability. One challenge has been to obtain quantitative information about soiling. The radiochemical methods, gamma spectrometry (NaI(Tl)-crystal) and liquid scintillation counting, have been shown to be suitable for evaluating cleanability of different surface materials and different soiling material types, providing quantitative information about the amount of soiling material both on and beneath the surface. Due to the different labelled soiling components, the interaction of the surface with different soiling material types can be evaluated. Radiochemical methods have unique benefits particularly for examining porous materials and surfaces. However, they are suitable only for highly controlled studies because of the hazards. Different features and details of radiochemical methods are discussed with the view to aid planning of future cleanability studies. - Highlights: → Radiochemical methods can be used for cleanability studies. → These methods give quantitative information about the amount of soiling material. → These methods are suitable particularly for examining porous materials. → These methods are suitable for highly controlled studies because of the hazards.

Nuclear Medicine and Application of Nuclear Techniques in Medicine

International Nuclear Information System (INIS)

Wiharto, Kunto

1996-01-01

The use of nuclear techniques medicine covers not only nuclear medicine and radiology in strict sense but also determination of body mineral content by neutron activation analysis and x-ray fluorescence technique either in vitro or in vivo, application of radioisotopes as tracers in pharmacology and biochemistry, etc. This paper describes the ideal tracer in nuclear medicine, functional and morphological imaging, clinical aspect and radiation protection in nuclear medicine. Nuclear technique offers facilities and chances related to research activities and services in medicine. The development of diagnostic as well as therapeutic methods using monoclonal antibodies labeled with radioisotope will undoubtedly play an important role in the disease control

The Development of Ojibway Language Materials.

Science.gov (United States)

Pheasant-Williams, Shirley

2003-01-01

Revitalization of the Nishinaabeg language started in 1998 with the development of language materials. A committee on Nishinaabemwin orthography advised on the development of the text and writing system. Teaching methods follow the four parts of Medicine Wheel teachings: spiritual, emotional, physical, and mental. An interactive hockey game and a…

Efficacy of DNA typing as an accurate method in forensic medicine

Directory of Open Access Journals (Sweden)

Namazi H

2000-08-01

Full Text Available DNA typing is a new method with important applications in forensic medicine. In the present study, we evaluated application of DNA typing in Iran. Loci Hum LPL, Hum Tpox, Hum F13, Hum vw 31A, Hum TH01 and Hum FES/FPS of DNA short tandem repeats were studied. To determine sensitivity of the test, 85 mother-child couples (1020 chromosomes that were referred to DNA section of legal medicine organization of Iran were included and for determination of it's specificity 42 brother-sister couples (1200 chromosomes and 58 non-relative couples were examined. The results show lack of mutations in the studied loci and acceptable sensitivity of the test. Of 12 alleles of siblings, there were 2-6 differences, in contrast with 3-9 differences in non-relatives, so the test has 100% specificity in these loci. Considering polymorphism, power of exclusion of these 6 sites was 99%.

Method of melting and decontaminating radioactive contaminated aluminum material

International Nuclear Information System (INIS)

Uda, Tatsuhiko; Miura, Noboru; Kawasaki, Katsuo; Iba, Hajime.

1986-01-01

Purpose: To improve the decontaminating efficiency upon melting decontamination of radioactive-contaminated aluminum materials. Method: This invention concerns an improvement for the method of melting decontamination by adding slug agent composed of organic compound to contaminated aluminum material and extracting the radioactive materials into the slug thereby decontaminating the aluminum material. Specifically metals effective for reducing the active amount of aluminum are added such that the content is greater than a predetermined value in the heat melting process. The metal comprises Mg, Cu or a mixture thereof and the content is more than 4 % including those previously contained in the aluminum material. (Ikeda, J.)

Development of methods for forecasting properties of polymer packaging materials which do not cause any change in medicinal preparation during their sterilization

International Nuclear Information System (INIS)

Krivonosov, A.I.; Postrigan, M.V.

1975-01-01

The authors present the results of an investigation of the effect of gamma radiation on the properties of low-molecular moulded polymethyl methacrylates (molecular weight distribution, physicomechanical properties, resistance to the effects of aqueous media and physiological solution) in the form of copolymers of methyl methacrylate with methyl (MA) or butyl acrylate (BA) with the brand names Dacryl-4B, Dacryl-2M and Dacryl-4M (4% BA; 2 and 4% MA respectively) having a molecular weight of around 10 5 . For comparison, block polymethyl methacrylate with a molecular weight of 3 x 10 6 was used. The results of experiments on the ageing of unirradiated and irradiated specimens in a heated store-room (t = 10 - 20 0 C) and at high temperatures (90 0 C) are also given. It is shown that irradiation with doses of 2.5-20 Mrad leads to radiolysis of the above copolymers, accompanied by destructive processes. Evidence of this is an increase in the polydispersity of the materials and a reduction in their mean molecular weight. These changes impair their physicomechanical characteristics to some extent. Irradiation with a sterilizing dose of 2.5 Mrad reduces the strength indices by around 15%, which is quite acceptable for polymer products having high initial physicomechanical characteristics. Irradiation has practically no effect on the molecular and strength characteristics of Dacryl products in a heated room, and the change in physicomechanical properties resulting from storage at high temperatures is practically the same for unirradiated specimens. On the basis of these results the materials investigated can be recommended for the packaging of medicinal preparations. (author)

Effects of calibration methods on quantitative material decomposition in photon-counting spectral computed tomography using a maximum a posteriori estimator.

Science.gov (United States)

Curtis, Tyler E; Roeder, Ryan K

2017-10-01

magnitude by comparison. The material basis matrix calibration was more sensitive to changes in the calibration methods than the scaling factor calibration. The material basis matrix calibration significantly influenced both the quantitative and spatial accuracy of material decomposition, while the scaling factor calibration influenced quantitative but not spatial accuracy. Importantly, the median RMSE of material decomposition was as low as ~1.5 mM (~0.24 mg/mL gadolinium), which was similar in magnitude to that measured by optical spectroscopy on the same samples. The accuracy of quantitative material decomposition in photon-counting spectral CT was significantly influenced by calibration methods which must therefore be carefully considered for the intended diagnostic imaging application. © 2017 American Association of Physicists in Medicine.

Method and apparatus for vibrating a substrate during material formation

Science.gov (United States)

Bailey, Jeffrey A [Richland, WA; Roger, Johnson N [Richland, WA; John, Munley T [Benton City, WA; Walter, Park R [Benton City, WA

2008-10-21

A method and apparatus for affecting the properties of a material include vibrating the material during its formation (i.e., "surface sifting"). The method includes the steps of providing a material formation device and applying a plurality of vibrations to the material during formation, which vibrations are oscillations having dissimilar, non-harmonic frequencies and at least two different directions. The apparatus includes a plurality of vibration sources that impart vibrations to the material.

[Diversity and distribution of the threatened medicinal vascular plants in Lancang].

Science.gov (United States)

Chi, Xiu-Lian; Yuan, Yi-Kai; Fang, Bo; Zhang, Xiao-Bo; Yang, Han-Yu; Zhao, Zhi-Ping; Li, Guo; Fu, Kai-Cong; Guo, Lan-Ping; Huang, Lu-Qi

2017-11-01

The rich diversity in medicinal plants provides an important material basic for the development of Traditional Chinese medicine in China. It is important to explore the present situation of medicinal plants within special regions in order to provide scientific instructions for their sustainable protection and exploitation and utilization. In this study, we carried out the field survey according to the guideline of national survey of Chinese material medica resources and the guideline of plant species diversity survey and estimation at county level with the line transect method. With the field surveyed data, we explored the diversity and distribution of the threatened medicinal vascular plants in Lancang. We found that there were 33 species of the threatened medicinal vascular plants in this county. These species were from 23 genera and 17 families, and were composed of one critical endangered, 10 endangered and 22 vulnerable species. They were widely distributed across the whole county and were most concentrated in the town of Nuozhadu, Fazhanhe, Nuofu and Zhutang, which were located in the southeastern, southwestern and western of Lancang, respectively. We also found that the plant species richness followed a unimodal pattern along elevation. In addition, we found that the areas of Nuozhadu Nature Reserve in Lancang only covered six threatened medicinal vascular plants, while most of the regions with high species richness were not well protected. Therefore, we proposed to make more efforts to improve the protection measurements in order to better protect and utilize the medicinal plants in Lancang. Copyright© by the Chinese Pharmaceutical Association.

Method and apparatus for altering material

Science.gov (United States)

Stinnett, Regan W.; Greenly, John B.

2002-02-05

Methods and apparatus for thermally altering the near surface characteristics of a material are described. In particular, a repetitively pulsed ion beam system comprising a high energy pulsed power source and an ion beam generator are described which are capable of producing single species high voltage ion beams (0.25-2.5 MeV) at 1-1000 kW average power and over extended operating cycles (10.sup.8). Irradiating materials with such high energy, repetitively pulsed ion beams can yield surface treatments including localized high temperature anneals to melting, both followed by rapid thermal quenching to ambient temperatures to achieve both novel and heretofore commercially unachievable physical characteristics in a near surface layer of material.

Materials For Gas Capture, Methods Of Making Materials For Gas Capture, And Methods Of Capturing Gas

KAUST Repository

Polshettiwar, Vivek; Patil, Umesh

2013-01-01

In accordance with the purpose(s) of the present disclosure, as embodied and broadly described herein, embodiments of the present disclosure, in one aspect, relate to materials that can be used for gas (e.g., CO.sub.2) capture, methods of making

Aims and methods of nuclear materials management

International Nuclear Information System (INIS)

Leven, D.; Schier, H.

1979-05-01

Whilst international safeguarding of fissile materials against abuse has been the subject of extensive debate, little public attention has so far been devoted to the internal security of these materials. All countries using nuclear energy for peaceful purposes have laid down appropriate regulations. In the Federal Republic of Germany safeguards are required, for instance, by the Atomic Energy Act, and are therefore a prerequisite for licensing. The aims and methods of national nuclear materials management are contrasted with viewpoints on international safeguards

[Analysis of varieties and standards of Scrophulariaceae plants used in Tibetan medicine].

Science.gov (United States)

Cao, Lan; Mu, Ze-jing; Zhong, Wei-hong; Zhong, Wei-jin; He, Jun-wei; Du, Xiao-lang; Zhong, Guo-yue

2015-12-01

In this paper, the popular domestic varieties and quality standard of Scrophulariaceae plants used in Tibetan medicine were analyzed. The results showed that there were 11 genera and 99 species (including varieties), as well as 28 medicinal materials varieties of Scrophulariaceae plants were recorded in the relevant literatures. In relevant Tibetan standards arid literatures, there are great differences in varieties, sources, parts, and efficacies of medicinal plant. Among them, about 41.4% (including 41 species) of endemic plants, about 15.2% (including 15 species) of the original plants have medicinal standard legal records, except the medicinal materials of Scrophalaria ningpoensis, Lagotis brevituba, Picrorhiza scrophulariiflora, Veronica eriogyne general, most varieties have not completed quality standard. Consequently it is necessary to reinforce the herbal textual, resources and the use present situation investigation, the effects of the species resources material foundation and biological activity, quality standard, specification the medical terms of the plants, and promote Tibetan medicinal vareties-terminologies-sources such as the criterion and quality standard system for enriching the varieties of Tibetan medicinal materials and Chinese medicinal resources.

Methods for evaluation of mechanical stress condition of materials

Directory of Open Access Journals (Sweden)

Mirchev Yordan

2018-01-01

Full Text Available Primary attention is given to the following methods: method by drilling cylindrical holes (drill method and integrated ultrasonic method using volume (longitudinal and transverse, surface, and sub-surface waves. Drill method allows determination of residual mechanical stress in small depth of material surfaces, assessing type, size, and orientation of principal stresses. For the first time, parallel studies are carried out of mechanical stress in materials using the electroacoustic effect of volume, surface and sub-surface waves on the one hand, and effective mechanical stresses on the other. The experimental results present electroacoustic coefficients for different types of waves in the material of gas pipeline tube of 243 mm diameter and 14 mm thickness. These are used to evaluate mechanical stresses in pipelines, according to active GOST standards.

[The transition of acupuncture and moxibustion in Japan in modern times after western medicine spreading to the East].

Science.gov (United States)

Li, Su-Yun

2014-04-01

The research methods, such as philology of medicine history and comparison between tradition and modern and so on were adopted in this article to study the acupuncture-moxibustion development after western medicine spreading to the East in Japan and its main transition under the impact of western medicine. The results showed that from Meiji to Showa period, under the influence of western medicine, the transition of Japanese acupuncture-moxibustion mainly embodied in following three aspects, incuinng acupuncture works absorbing western medicine knowledge, applying experiment measures to explore acupuncture principle and launching acupuncture teaching in accordance with Europe and America academy educational pattern. The changes on acupuncture works, teaching materials and methods of researching and teaching have triggered the transition and transformation of Japanese acupuncture-moxibustion from tradition to modern.

Methods for removing contaminant matter from a porous material

Science.gov (United States)

Fox, Robert V [Idaho Falls, ID; Avci, Recep [Bozeman, MT; Groenewold, Gary S [Idaho Falls, ID

2010-11-16

Methods of removing contaminant matter from porous materials include applying a polymer material to a contaminated surface, irradiating the contaminated surface to cause redistribution of contaminant matter, and removing at least a portion of the polymer material from the surface. Systems for decontaminating a contaminated structure comprising porous material include a radiation device configured to emit electromagnetic radiation toward a surface of a structure, and at least one spray device configured to apply a capture material onto the surface of the structure. Polymer materials that can be used in such methods and systems include polyphosphazine-based polymer materials having polyphosphazine backbone segments and side chain groups that include selected functional groups. The selected functional groups may include iminos, oximes, carboxylates, sulfonates, .beta.-diketones, phosphine sulfides, phosphates, phosphites, phosphonates, phosphinates, phosphine oxides, monothio phosphinic acids, and dithio phosphinic acids.

Adopting a blended learning approach to teaching evidence based medicine: a mixed methods study

OpenAIRE

Ilic, Dragan; Hart, William; Fiddes, Patrick; Misso, Marie; Villanueva, Elmer

2013-01-01

Background Evidence Based Medicine (EBM) is a core unit delivered across many medical schools. Few studies have investigated the most effective method of teaching a course in EBM to medical students. The objective of this study was to identify whether a blended-learning approach to teaching EBM is more effective a didactic-based approach at increasing medical student competency in EBM. Methods A mixed-methods study was conducted consisting of a controlled trial and focus groups with second ye...

[Application of chemometrics in composition-activity relationship research of traditional Chinese medicine].

Science.gov (United States)

Han, Sheng-Nan

2014-07-01

Chemometrics is a new branch of chemistry which is widely applied to various fields of analytical chemistry. Chemometrics can use theories and methods of mathematics, statistics, computer science and other related disciplines to optimize the chemical measurement process and maximize access to acquire chemical information and other information on material systems by analyzing chemical measurement data. In recent years, traditional Chinese medicine has attracted widespread attention. In the research of traditional Chinese medicine, it has been a key problem that how to interpret the relationship between various chemical components and its efficacy, which seriously restricts the modernization of Chinese medicine. As chemometrics brings the multivariate analysis methods into the chemical research, it has been applied as an effective research tool in the composition-activity relationship research of Chinese medicine. This article reviews the applications of chemometrics methods in the composition-activity relationship research in recent years. The applications of multivariate statistical analysis methods (such as regression analysis, correlation analysis, principal component analysis, etc. ) and artificial neural network (such as back propagation artificial neural network, radical basis function neural network, support vector machine, etc. ) are summarized, including the brief fundamental principles, the research contents and the advantages and disadvantages. Finally, the existing main problems and prospects of its future researches are proposed.

DNA Barcoding for the Identification and Authentication of Animal Species in Traditional Medicine

Directory of Open Access Journals (Sweden)

Fan Yang

2018-01-01

Full Text Available Animal-based traditional medicine not only plays a significant role in therapeutic practices worldwide but also provides a potential compound library for drug discovery. However, persistent hunting and illegal trade markedly threaten numerous medicinal animal species, and increasing demand further provokes the emergence of various adulterants. As the conventional methods are difficult and time-consuming to detect processed products or identify animal species with similar morphology, developing novel authentication methods for animal-based traditional medicine represents an urgent need. During the last decade, DNA barcoding offers an accurate and efficient strategy that can identify existing species and discover unknown species via analysis of sequence variation in a standardized region of DNA. Recent studies have shown that DNA barcoding as well as minibarcoding and metabarcoding is capable of identifying animal species and discriminating the authentics from the adulterants in various types of traditional medicines, including raw materials, processed products, and complex preparations. These techniques can also be used to detect the unlabelled and threatened animal species in traditional medicine. Here, we review the recent progress of DNA barcoding for the identification and authentication of animal species used in traditional medicine, which provides a reference for quality control and trade supervision of animal-based traditional medicine.

DNA Barcoding for the Identification and Authentication of Animal Species in Traditional Medicine.

Science.gov (United States)

Yang, Fan; Ding, Fei; Chen, Hong; He, Mingqi; Zhu, Shixin; Ma, Xin; Jiang, Li; Li, Haifeng

2018-01-01

Animal-based traditional medicine not only plays a significant role in therapeutic practices worldwide but also provides a potential compound library for drug discovery. However, persistent hunting and illegal trade markedly threaten numerous medicinal animal species, and increasing demand further provokes the emergence of various adulterants. As the conventional methods are difficult and time-consuming to detect processed products or identify animal species with similar morphology, developing novel authentication methods for animal-based traditional medicine represents an urgent need. During the last decade, DNA barcoding offers an accurate and efficient strategy that can identify existing species and discover unknown species via analysis of sequence variation in a standardized region of DNA. Recent studies have shown that DNA barcoding as well as minibarcoding and metabarcoding is capable of identifying animal species and discriminating the authentics from the adulterants in various types of traditional medicines, including raw materials, processed products, and complex preparations. These techniques can also be used to detect the unlabelled and threatened animal species in traditional medicine. Here, we review the recent progress of DNA barcoding for the identification and authentication of animal species used in traditional medicine, which provides a reference for quality control and trade supervision of animal-based traditional medicine.

Overcoming immunological barriers in regenerative medicine.

Science.gov (United States)

Zakrzewski, Johannes L; van den Brink, Marcel R M; Hubbell, Jeffrey A

2014-08-01

Regenerative therapies that use allogeneic cells are likely to encounter immunological barriers similar to those that occur with transplantation of solid organs and allogeneic hematopoietic stem cells (HSCs). Decades of experience in clinical transplantation hold valuable lessons for regenerative medicine, offering approaches for developing tolerance-induction treatments relevant to cell therapies. Outside the field of solid-organ and allogeneic HSC transplantation, new strategies are emerging for controlling the immune response, such as methods based on biomaterials or mimicry of antigen-specific peripheral tolerance. Novel biomaterials can alter the behavior of cells in tissue-engineered constructs and can blunt host immune responses to cells and biomaterial scaffolds. Approaches to suppress autoreactive immune cells may also be useful in regenerative medicine. The most innovative solutions will be developed through closer collaboration among stem cell biologists, transplantation immunologists and materials scientists.

Use of diagnostic radionuclides in medicine

International Nuclear Information System (INIS)

Early, R.J.

1996-01-01

The purpose of this paper is to follow the course of historical development in the use of radiopharmaceuticals as a diagnostic tool in nuclear medicine. This course has been a series of plateaus and growth spurts throughout its history. This article is designed to identify the different phases of the development of nuclear medicine, pointing out the events which most shaped its history along the way. Those events included such things as the discovery of radioactivity, the development of the cyclotron and nuclear reactor as a method of producing high specific activity radioactive material, the development of imaging equipment such as the rectilinear scanner, scintillation camera, PET and SPECT, the application of computers, and the discovery of 99 m Tc and the development of associated kits designed to image many organs and processes in human body. (author). 9 Refs., 11 Figs., 2 tabs

Nuclear medicine physics

CERN Document Server

De Lima, Joao Jose

2011-01-01

Edited by a renowned international expert in the field, Nuclear Medicine Physics offers an up-to-date, state-of-the-art account of the physics behind the theoretical foundation and applications of nuclear medicine. It covers important physical aspects of the methods and instruments involved in modern nuclear medicine, along with related biological topics. The book first discusses the physics of and machines for producing radioisotopes suitable for use in conventional nuclear medicine and PET. After focusing on positron physics and the applications of positrons in medicine and biology, it descr

Materials of All-Polish Symposium Nuclear Techniques in Industry, Medicine, Agriculture and Environment Protection; Materialy Krajowego Sympozjum Technika Jadrowa w Przemysle, Medycynie, Rolnictwie i Ochronie Srodowiska

Energy Technology Data Exchange (ETDEWEB)

NONE

1998-07-01

The All-Polish Symposium Nuclear Techniques in Industry, Medicine, Agriculture and Environment Protection is cyclic (in 3 year period) conference being a broad review of state of art and development of all nuclear branches cooperated with industry and other branches of national economy and public life in Poland. The conference has been divided in one plenary session and 8 problem sessions as follow: Radiation technologies of flue gas purification; radiation technologies in food and cosmetic industry; application of nuclear techniques in environmental studies and earth science; radiometric methods in material engineering; isotope tracers in biological studies and medical diagnostics; radiometric industrial measuring systems; radiation detectors and device; nuclear methods in cultural objects examination. The poster section as well as small exhibition have been also organised.

Downhole fluid injection systems, CO2 sequestration methods, and hydrocarbon material recovery methods

Science.gov (United States)

Schaef, Herbert T.; McGrail, B. Peter

2015-07-28

Downhole fluid injection systems are provided that can include a first well extending into a geological formation, and a fluid injector assembly located within the well. The fluid injector assembly can be configured to inject a liquid CO2/H2O-emulsion into the surrounding geological formation. CO2 sequestration methods are provided that can include exposing a geological formation to a liquid CO2/H2O-emulsion to sequester at least a portion of the CO2 from the emulsion within the formation. Hydrocarbon material recovery methods are provided that can include exposing a liquid CO2/H2O-emulsion to a geological formation having the hydrocarbon material therein. The methods can include recovering at least a portion of the hydrocarbon material from the formation.

Dense Plasma Focus: physics and applications (radiation material science, single-shot disclosure of hidden illegal objects, radiation biology and medicine, etc.)

International Nuclear Information System (INIS)

Gribkov, V A; Miklaszewski, R; Paduch, M; Zielinska, E; Chernyshova, M; Pisarczyk, T; Sadowski, M J; Pimenov, V N; Demina, E V; Niemela, J; Crespo, M-L; Cicuttin, A; Tomaszewski, K; Skladnik-Sadowska, E; Pytel, K; Zawadka, A; Giannini, G; Longo, F; Talab, A; Ul'yanenko, S E

2015-01-01

The paper presents some outcomes obtained during the year of 2013 of the activity in the frame of the International Atomic Energy Agency Co-ordinated research project 'Investigations of Materials under High Repetition and Intense Fusion-Relevant Pulses'. The main results are related to the effects created at the interaction of powerful pulses of different types of radiation (soft and hard X-rays, hot plasma and fast ion streams, neutrons, etc. generated in Dense Plasma Focus (DPF) facilities) with various materials including those that are counted as perspective ones for their use in future thermonuclear reactors. Besides we discuss phenomena observed at the irradiation of biological test objects. We examine possible applications of nanosecond powerful pulses of neutrons to the aims of nuclear medicine and for disclosure of hidden illegal objects. Special attention is devoted to discussions of a possibility to create extremely large and enormously diminutive DPF devices and probabilities of their use in energetics, medicine and modern electronics. (paper)

Dense Plasma Focus: physics and applications (radiation material science, single-shot disclosure of hidden illegal objects, radiation biology and medicine, etc.)

Science.gov (United States)

Gribkov, V. A.; Miklaszewski, R.; Paduch, M.; Zielinska, E.; Chernyshova, M.; Pisarczyk, T.; Pimenov, V. N.; Demina, E. V.; Niemela, J.; Crespo, M.-L.; Cicuttin, A.; Tomaszewski, K.; Sadowski, M. J.; Skladnik-Sadowska, E.; Pytel, K.; Zawadka, A.; Giannini, G.; Longo, F.; Talab, A.; Ul'yanenko, S. E.

2015-03-01

The paper presents some outcomes obtained during the year of 2013 of the activity in the frame of the International Atomic Energy Agency Co-ordinated research project "Investigations of Materials under High Repetition and Intense Fusion-Relevant Pulses". The main results are related to the effects created at the interaction of powerful pulses of different types of radiation (soft and hard X-rays, hot plasma and fast ion streams, neutrons, etc. generated in Dense Plasma Focus (DPF) facilities) with various materials including those that are counted as perspective ones for their use in future thermonuclear reactors. Besides we discuss phenomena observed at the irradiation of biological test objects. We examine possible applications of nanosecond powerful pulses of neutrons to the aims of nuclear medicine and for disclosure of hidden illegal objects. Special attention is devoted to discussions of a possibility to create extremely large and enormously diminutive DPF devices and probabilities of their use in energetics, medicine and modern electronics.

Methods of humidity determination Part II: Determination of material humidity

OpenAIRE

Rübner, Katrin; Balköse, Devrim; Robens, E.

2008-01-01

Part II covers the most common methods of measuring the humidity of solid material. State of water near solid surfaces, gravimetric measurement of material humidity, measurement of water sorption isotherms, chemical methods for determination of water content, measurement of material humidity via the gas phase, standardisation, cosmonautical observations are reviewed.

Your Radiologist Explains Nuclear Medicine

Medline Plus

Full Text Available ... can be detected with other diagnostic tests. Nuclear medicine imaging procedures use small amounts of radioactive materials – called radiotracers – that ... outweighs any risk. To learn more about nuclear medicine, visit Radiology Info dot org. Thank you for your ... of Use | Links | Site Map Copyright © 2018 Radiological Society of ...

A New Strategy for Deleting Animal drugs from Traditional Chinese Medicines based on Modified Yimusake Formula.

Science.gov (United States)

Wang, Jinghui; Li, Yan; Yang, Yinfeng; Chen, Xuetong; Du, Jian; Zheng, Qiusheng; Liang, Zongsuo; Wang, Yonghua

2017-05-04

Traditional Chinese medicine (TCM), such as Uyghur Medicine (UM) has been used in clinical treatment for many years. TCM is featured as multiple targets and complex mechanisms of action, which is normally a combination of medicinal herbs and sometimes even contains certain rare animal medicinal ingredients. A question arises as to whether these animal materials can be removed replaced from TCM applications due to their valuable rare resources or animal ethics. Here, we select a classical UM Yimusake formula, which contains 3 animal drugs and other 8 herbs, and has got wealthy experience and remarkable achievements in treating erectile dysfunction (ED) in China. The active components, drug targets and therapeutic mechanisms have been comprehensively analyzed by systems-pharmacology methods. Additionally, to validate the inhibitory effects of all candidate compounds on their related targets, in vitro experiments, computational analysis and molecular dynamics simulations were performed. The results show that the modified, original and three animal materials display very similar mechanisms for an effective treatment of ED, indicating that it is quite possible to remove these three animal drugs from the original formula while still keep its efficiency. This work provides a new attempt for deleting animal materials from TCM, which should be important for optimization of traditional medicines.

Flexible energetic materials and related methods

Energy Technology Data Exchange (ETDEWEB)

Heaps, Ronald J.

2018-03-06

Energetic compositions and methods of forming components from the compositions are provided. In one embodiment, a composition includes aluminum, molybdenum trioxide, potassium perchlorate, and a binder. In one embodiment, the binder may include a silicone material. The materials may be mixed with a solvent, such as xylene, de-aired, shaped and cured to provide a self-supporting structure. In one embodiment, one or more reinforcement members may be added to provide additional strength to the structure. For example, a weave or mat of carbon fiber material may be added to the mixture prior to curing. In one embodiment, blade casting techniques may be used to form a structure. In another embodiment, a structure may be formed using 3-dimensional printing techniques.

What can acute medicine learn from qualitative methods?

Science.gov (United States)

Heasman, Brett; Reader, Tom W

2015-10-01

The contribution of qualitative methods to evidence-based medicine is growing, with qualitative studies increasingly used to examine patient experience and unsafe organizational cultures. The present review considers qualitative research recently conducted on teamwork and organizational culture in the ICU and also other acute domains. Qualitative studies have highlighted the importance of interpersonal and social aspects of healthcare on managing and responding to patient care needs. Clear/consistent communication, compassion, and trust underpin successful patient-physician interactions, with improved patient experiences linked to patient safety and clinical effectiveness across a wide range of measures and outcomes. Across multidisciplinary teams, good communication facilitates shared understanding, decision-making and coordinated action, reducing patient risk in the process. Qualitative methods highlight the complex nature of risk management in hospital wards, which is highly contextualized to the demands and resources available, and influenced by multilayered social contexts. In addition to augmenting quantitative research, qualitative investigations enable the investigation of questions on social behaviour that are beyond the scope of quantitative assessment alone. To develop improved patient-centred care, health professionals should therefore consider integrating qualitative procedures into their existing assessments of patient/staff satisfaction.

The Kjeldahl method as a primary reference procedure for total protein in certified reference materials used in clinical chemistry. II. Selection of direct Kjeldahl analysis and its preliminary performance parameters.

Science.gov (United States)

Vinklárková, Bára; Chromý, Vratislav; Šprongl, Luděk; Bittová, Miroslava; Rikanová, Milena; Ohnútková, Ivana; Žaludová, Lenka

2015-01-01

To select a Kjeldahl procedure suitable for the determination of total protein in reference materials used in laboratory medicine, we reviewed in our previous article Kjeldahl methods adopted by clinical chemistry and found an indirect two-step analysis by total Kjeldahl nitrogen corrected for its nonprotein nitrogen and a direct analysis made on isolated protein precipitates. In this article, we compare both procedures on various reference materials. An indirect Kjeldahl method gave falsely lower results than a direct analysis. Preliminary performance parameters qualify the direct Kjeldahl analysis as a suitable primary reference procedure for the certification of total protein in reference laboratories.

Internationalization of traditional Chinese medicine: current international market, internationalization challenges and prospective suggestions.

Science.gov (United States)

Lin, Annie Xianghong; Chan, Ging; Hu, Yuanjia; Ouyang, Defang; Ung, Carolina Oi Lam; Shi, Luwen; Hu, Hao

2018-01-01

Through reviewing the current international market for traditional Chinese medicine (TCM), this paper identified the internationalization challenges for TCM, including unclear therapeutic material basis and mechanism, difficulty of quality control, low preparation level, registration/policy barriers, and shortage of intellectual property. To deal with these challenges, suggestions were given including: (1) product innovation of TCM (study the TCM by using the methods and means of western medicine; innovate the basic theory of TCM; develop TCM health product); (2) standard innovation of TCM; (3) building big data platform of Chinese medicine (big data platform of TCM preparation; big data platform on the quality of TCM).

Teaching emergency medicine with workshops improved medical student satisfaction in emergency medicine education

Directory of Open Access Journals (Sweden)

Sricharoen P

2015-02-01

Full Text Available Pungkava Sricharoen,1 Chaiyaporn Yuksen,1 Yuwares Sittichanbuncha,1 Kittisak Sawanyawisuth2,3 1Department of Emergency Medicine, Faculty of Medicine, Ramathibodi Hospital, Mahidol University, Bangkok, Thailand; 2Department of Medicine, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand; 3The Research Center in Back, Neck, Other Joint Pain and Human Performance (BNOJPH, Khon Kaen University, Khon Kaen, Thailand Background: There are different teaching methods; such as traditional lectures, bedside teaching, and workshops for clinical medical clerkships. Each method has advantages and disadvantages in different situations. Emergency Medicine (EM focuses on emergency medical conditions and deals with several emergency procedures. This study aimed to compare traditional teaching methods with teaching methods involving workshops in the EM setting for medical students. Methods: Fifth year medical students (academic year of 2010 at Ramathibodi Hospital, Faculty of Medicine, Mahidol University, Bangkok, Thailand participated in the study. Half of students received traditional teaching, including lectures and bedside teaching, while the other half received traditional teaching plus three workshops, namely, airway workshop, trauma workshop, and emergency medical services workshop. Student evaluations at the end of the clerkship were recorded. The evaluation form included overall satisfaction, satisfaction in overall teaching methods, and satisfaction in each teaching method. Results: During the academic year 2010, there were 189 students who attended the EM rotation. Of those, 77 students (40.74% were in the traditional EM curriculum, while 112 students were in the new EM curriculum. The average satisfaction score in teaching method of the new EM curriculum group was higher than the traditional EM curriculum group (4.54 versus 4.07, P-value <0.001. The top three highest average satisfaction scores in the new EM curriculum group were trauma

Non-Adiabatic Molecular Dynamics Methods for Materials Discovery

Energy Technology Data Exchange (ETDEWEB)

Furche, Filipp [Univ. of California, Irvine, CA (United States); Parker, Shane M. [Univ. of California, Irvine, CA (United States); Muuronen, Mikko J. [Univ. of California, Irvine, CA (United States); Roy, Saswata [Univ. of California, Irvine, CA (United States)

2017-04-04

The flow of radiative energy in light-driven materials such as photosensitizer dyes or photocatalysts is governed by non-adiabatic transitions between electronic states and cannot be described within the Born-Oppenheimer approximation commonly used in electronic structure theory. The non-adiabatic molecular dynamics (NAMD) methods based on Tully surface hopping and time-dependent density functional theory developed in this project have greatly extended the range of molecular materials that can be tackled by NAMD simulations. New algorithms to compute molecular excited state and response properties efficiently were developed. Fundamental limitations of common non-linear response methods were discovered and characterized. Methods for accurate computations of vibronic spectra of materials such as black absorbers were developed and applied. It was shown that open-shell TDDFT methods capture bond breaking in NAMD simulations, a longstanding challenge for single-reference molecular dynamics simulations. The methods developed in this project were applied to study the photodissociation of acetaldehyde and revealed that non-adiabatic effects are experimentally observable in fragment kinetic energy distributions. Finally, the project enabled the first detailed NAMD simulations of photocatalytic water oxidation by titania nanoclusters, uncovering the mechanism of this fundamentally important reaction for fuel generation and storage.

A no-gold-standard technique for objective assessment of quantitative nuclear-medicine imaging methods.

Science.gov (United States)

Jha, Abhinav K; Caffo, Brian; Frey, Eric C

2016-04-07

The objective optimization and evaluation of nuclear-medicine quantitative imaging methods using patient data is highly desirable but often hindered by the lack of a gold standard. Previously, a regression-without-truth (RWT) approach has been proposed for evaluating quantitative imaging methods in the absence of a gold standard, but this approach implicitly assumes that bounds on the distribution of true values are known. Several quantitative imaging methods in nuclear-medicine imaging measure parameters where these bounds are not known, such as the activity concentration in an organ or the volume of a tumor. We extended upon the RWT approach to develop a no-gold-standard (NGS) technique for objectively evaluating such quantitative nuclear-medicine imaging methods with patient data in the absence of any ground truth. Using the parameters estimated with the NGS technique, a figure of merit, the noise-to-slope ratio (NSR), can be computed, which can rank the methods on the basis of precision. An issue with NGS evaluation techniques is the requirement of a large number of patient studies. To reduce this requirement, the proposed method explored the use of multiple quantitative measurements from the same patient, such as the activity concentration values from different organs in the same patient. The proposed technique was evaluated using rigorous numerical experiments and using data from realistic simulation studies. The numerical experiments demonstrated that the NSR was estimated accurately using the proposed NGS technique when the bounds on the distribution of true values were not precisely known, thus serving as a very reliable metric for ranking the methods on the basis of precision. In the realistic simulation study, the NGS technique was used to rank reconstruction methods for quantitative single-photon emission computed tomography (SPECT) based on their performance on the task of estimating the mean activity concentration within a known volume of interest

A no-gold-standard technique for objective assessment of quantitative nuclear-medicine imaging methods

International Nuclear Information System (INIS)

Jha, Abhinav K; Frey, Eric C; Caffo, Brian

2016-01-01

The objective optimization and evaluation of nuclear-medicine quantitative imaging methods using patient data is highly desirable but often hindered by the lack of a gold standard. Previously, a regression-without-truth (RWT) approach has been proposed for evaluating quantitative imaging methods in the absence of a gold standard, but this approach implicitly assumes that bounds on the distribution of true values are known. Several quantitative imaging methods in nuclear-medicine imaging measure parameters where these bounds are not known, such as the activity concentration in an organ or the volume of a tumor. We extended upon the RWT approach to develop a no-gold-standard (NGS) technique for objectively evaluating such quantitative nuclear-medicine imaging methods with patient data in the absence of any ground truth. Using the parameters estimated with the NGS technique, a figure of merit, the noise-to-slope ratio (NSR), can be computed, which can rank the methods on the basis of precision. An issue with NGS evaluation techniques is the requirement of a large number of patient studies. To reduce this requirement, the proposed method explored the use of multiple quantitative measurements from the same patient, such as the activity concentration values from different organs in the same patient. The proposed technique was evaluated using rigorous numerical experiments and using data from realistic simulation studies. The numerical experiments demonstrated that the NSR was estimated accurately using the proposed NGS technique when the bounds on the distribution of true values were not precisely known, thus serving as a very reliable metric for ranking the methods on the basis of precision. In the realistic simulation study, the NGS technique was used to rank reconstruction methods for quantitative single-photon emission computed tomography (SPECT) based on their performance on the task of estimating the mean activity concentration within a known volume of interest

Extraction and Analysis of Traditional Chinese Medicine Crops Based on Multitemporal High Resolution Data-Taking Qiaocheng District of Bozhou as AN Example

Science.gov (United States)

Yu, H.; He, J.; Zhou, H.; Guan, F.; Li, L.; Ren, B.; Wang, Z.

2018-04-01

Remote sensing technology has become an important method to rapidly acquireing of planting layout and composition of regional crops.It is very important to accurately master the planting area of Chinese medicine crops in the Characteristic planting area because it relations to accurately master the cultivation of Chinese medicine crops, formulate related policies and adjustment of crop planting structure.The author puts forward a method of using remote sencing technology for momitoring Chinese medicine which has good applicability and generalization. This paper took Qiaocheng District of Bozhou as an example to Verify the feasibility of the method, providing a reference for solving the problem of interpretation and extraction of Chinese medicinal materials in the region.

Editorial Nano structures for Medicine and Pharmaceuticals

International Nuclear Information System (INIS)

Xing-Jie, L.; Kumar, A.; Donglu, S.; Daxiang, C.

2012-01-01

The rapid developments in nano structured materials and nano technology will have profound impact in many areas of biomedical applications including delivery of drugs and biomolecules, tissue engineering, detection of bio markers, cancer diagnosis, cancer therapy, and imaging. This field is expanding quickly, and a lot of work is ongoing in the design, characterization, synthesis, and application of materials, for controlling shape and size at nanometer scale to develop highly advanced materials for biomedical application and even to design better pharmaceutical products. In recent years, novel nano structure with multi functionalities has been focused on the use of nano structures toward solving problems of biology and medicine. The main scope of this special issue is to demonstrate the latest achievement of nano technology and its application in nano medicine particularly in new approaches for drug delivery such as targeted drug delivery system, nano structure for drug storage, nano materials for tissue engineering, medical diagnosis and treatment, and generation of new kinds of materials from biological sources. Therefore, many critical issues in nano structured materials, particularly their applications in biomedicine, must be addressed before clinical applications. This special issue devotes several review and research articles encompassing various aspects of nano materials for medicine and pharmaceuticals.

Method of processing radioactive materials

International Nuclear Information System (INIS)

Kondo, Susumu; Moriya, Tetsuo; Ishibashi, Tadashi; Kariya, Masahiro.

1986-01-01

Purpose: To improve contamination proofness, water proofness, close bondability and stretching performance of strippable paints coated to substrates liable to be contaminated with radioactive materials. Method: Strippable paints are previously coated on substrates which may possibly be contaminated with radioactive materials. After the contamination, the coated membranes are stripped and removed. Alternatively, the strippable paints may be coated on the already contaminated substrates and, after drying, the paints are stripped and removed. The strippable paints used herein have a composition comprising a styrene-butadiene block copolymer containing from 60 to 80 wt% of styrene as a main ingredient and from 0.3 to 5 % by weight of a higher alkyl amine compound having 12 to 18 carbon atoms blended with the copolymer. (Ikeda, J.)

Medicinal Chemistry Projects Requiring Imaginative Structure-Based Drug Design Methods.

Science.gov (United States)

Moitessier, Nicolas; Pottel, Joshua; Therrien, Eric; Englebienne, Pablo; Liu, Zhaomin; Tomberg, Anna; Corbeil, Christopher R

2016-09-20

Computational methods for docking small molecules to proteins are prominent in drug discovery. There are hundreds, if not thousands, of documented examples-and several pertinent cases within our research program. Fifteen years ago, our first docking-guided drug design project yielded nanomolar metalloproteinase inhibitors and illustrated the potential of structure-based drug design. Subsequent applications of docking programs to the design of integrin antagonists, BACE-1 inhibitors, and aminoglycosides binding to bacterial RNA demonstrated that available docking programs needed significant improvement. At that time, docking programs primarily considered flexible ligands and rigid proteins. We demonstrated that accounting for protein flexibility, employing displaceable water molecules, and using ligand-based pharmacophores improved the docking accuracy of existing methods-enabling the design of bioactive molecules. The success prompted the development of our own program, Fitted, implementing all of these aspects. The primary motivation has always been to respond to the needs of drug design studies; the majority of the concepts behind the evolution of Fitted are rooted in medicinal chemistry projects and collaborations. Several examples follow: (1) Searching for HDAC inhibitors led us to develop methods considering drug-zinc coordination and its effect on the pKa of surrounding residues. (2) Targeting covalent prolyl oligopeptidase (POP) inhibitors prompted an update to Fitted to identify reactive groups and form bonds with a given residue (e.g., a catalytic residue) when the geometry allows it. Fitted-the first fully automated covalent docking program-was successfully applied to the discovery of four new classes of covalent POP inhibitors. As a result, efficient stereoselective syntheses of a few screening hits were prioritized rather than synthesizing large chemical libraries-yielding nanomolar inhibitors. (3) In order to study the metabolism of POP inhibitors by

Nuclear medicine and mathematics

Energy Technology Data Exchange (ETDEWEB)

Pedroso de Lima, J.J. [Dept. de Biofisica e Proc. de Imagem, IBILI - Faculdade de Medicina, Coimbra (Portugal)

1996-06-01

The purpose of this review is not to present a comprehensive description of all the mathematical tools used in nuclear medicine, but to emphasize the importance of the mathematical method in nuclear medicine and to elucidate some of the mathematical concepts currently used. We can distinguish three different areas in which mathematical support has been offered to nuclear medicine: Physiology, methodology and data processing. Nevertheless, the boundaries between these areas can be indistinct. It is impossible in a single article to give even an idea of the extent and complexity of the procedures currently usede in nuclear medicine, such as image processing, reconstruction from projections and artificial intelligence. These disciplines do not belong to nuclear medicine: They are already branches of engineering, and my interest will reside simply in revealing a little of the elegance and the fantastic potential of these new `allies` of nuclear medicine. In this review the mathematics of physiological interpretation and methodology are considered together in the same section. General aspects of data-processing methods, including image processing and artificial intelligence, are briefly analysed. The mathematical tools that are most often used to assist the interpretation of biological phenomena in nuclear medicine are considered; these include convolution and deconvolution methods, Fourier analysis, factorial analysis and neural networking. (orig.)

Nuclear medicine and mathematics

International Nuclear Information System (INIS)

Pedroso de Lima, J.J.

1996-01-01

The purpose of this review is not to present a comprehensive description of all the mathematical tools used in nuclear medicine, but to emphasize the importance of the mathematical method in nuclear medicine and to elucidate some of the mathematical concepts currently used. We can distinguish three different areas in which mathematical support has been offered to nuclear medicine: Physiology, methodology and data processing. Nevertheless, the boundaries between these areas can be indistinct. It is impossible in a single article to give even an idea of the extent and complexity of the procedures currently usede in nuclear medicine, such as image processing, reconstruction from projections and artificial intelligence. These disciplines do not belong to nuclear medicine: They are already branches of engineering, and my interest will reside simply in revealing a little of the elegance and the fantastic potential of these new 'allies' of nuclear medicine. In this review the mathematics of physiological interpretation and methodology are considered together in the same section. General aspects of data-processing methods, including image processing and artificial intelligence, are briefly analysed. The mathematical tools that are most often used to assist the interpretation of biological phenomena in nuclear medicine are considered; these include convolution and deconvolution methods, Fourier analysis, factorial analysis and neural networking. (orig.)

Development of a nationwide consensus syllabus of palliative medicine for undergraduate medical education in Japan: a modified Delphi method.

Science.gov (United States)

Kizawa, Yoshiyuki; Tsuneto, Satoru; Tamba, Kaichiro; Takamiya, Yusuke; Morita, Tatsuya; Bito, Seiji; Otaki, Junji

2012-07-01

There is currently no consensus syllabus of palliative medicine for undergraduate medical education in Japan, although the Cancer Control Act proposed in 2007 covers the dissemination of palliative care. To develop a nationwide consensus syllabus of palliative medicine for undergraduate medical education in Japan using a modified Delphi method. We adopted the following three-step method: (1) a workshop to produce the draft syllabus; (2) a survey-based provisional syllabus; (3) Delphi rounds and a panel meeting (modified Delphi method) to produce the working syllabus. Educators in charge of palliative medicine from 63% of the medical schools in Japan collaborated to develop a survey-based provisional syllabus before the Delphi rounds. A panel of 32 people was then formed for the modified Delphi rounds comprising 28 educators and experts in palliative medicine, one cancer survivor, one bereaved family member, and two medical students. The final consensus syllabus consists of 115 learning objectives across seven sections as follows: basic principles; disease process and comprehensive assessment; symptom management; psychosocial care; cultural, religious, and spiritual issues; ethical issues; and legal frameworks. Learning objectives were categorized as essential or desirable (essential: 66; desirable: 49). A consensus syllabus of palliative medicine for undergraduate medical education was developed using a clear and innovative methodology. The final consensus syllabus will be made available for further dissemination of palliative care education throughout the country.

Medicinal Mushrooms

NARCIS (Netherlands)

Lindequist, U.; Won Kim, H.; Tiralongo, E.; Griensven, van L.J.L.D.

2014-01-01

Since beginning of mankind nature is the most important source of medicines. Bioactive compounds produced by living organisms can be used directly as drugs or as lead compounds for drug development. Besides, the natural material can be used as crude drug for preparation of powder or extracts. Plants

A fuzzy logic based PROMETHEE method for material selection problems

Directory of Open Access Journals (Sweden)

Muhammet Gul

2018-03-01

Full Text Available Material selection is a complex problem in the design and development of products for diverse engineering applications. This paper presents a fuzzy PROMETHEE (Preference Ranking Organization Method for Enrichment Evaluation method based on trapezoidal fuzzy interval numbers that can be applied to the selection of materials for an automotive instrument panel. Also, it presents uniqueness in making a significant contribution to the literature in terms of the application of fuzzy decision-making approach to material selection problems. The method is illustrated, validated, and compared against three different fuzzy MCDM methods (fuzzy VIKOR, fuzzy TOPSIS, and fuzzy ELECTRE in terms of its ranking performance. Also, the relationships between the compared methods and the proposed scenarios for fuzzy PROMETHEE are evaluated via the Spearman’s correlation coefficient. Styrene Maleic Anhydride and Polypropylene are determined optionally as suitable materials for the automotive instrument panel case. We propose a generic fuzzy MCDM methodology that can be practically implemented to material selection problem. The main advantages of the methodology are consideration of the vagueness, uncertainty, and fuzziness to decision making environment.

Nuclear medicine methods in the assessment of acupuncture effects: a short review

Directory of Open Access Journals (Sweden)

Deise Elisabete Souza

2007-09-01

Full Text Available The mechanisms of acupuncture are poorly understood. In consequence, numerous investigators have conducted clinical trials to test the efficacy of acupuncture in various conditions. We have used PubMed database system to evaluate the number of publications in acupuncture and nuclear medicine procedures in the period from 1964 to 2007, using the keywords: "nuclear medicine and acupuncture", "SPECT and acupuncture", "PET and acupuncture", "scintigraphy and acupuncture", "radionuclide and acupuncture", "radiopharmaceutical and acupuncture", "radioisotope and acupuncture" and "99mTc and acupuncture". Some papers published in English language were selected and a short review is presented The analysis of the number of publications shows that when a method is well accepted by the scientific community, as the methods used in nuclear medicine, the interest in the development of research increases. Moreover, important findings are presented when the nuclear medicine image is used to evaluate the effect of the acupuncture.Os mecanismos de ação da acupuntura ainda não são completamente esclarecidos. Em conseqüência, diversos pesquisadores têm conduzido testes clínicos para verificar a eficiência da acupuntura em condições diversas. Nós utilizamos o sistema de base de dados PubMed para avaliar o número de publicações em acupuntura e procedimentos em medicina nuclear no período de 1964 até 2007, usando as palavras-chaves: "medicina nuclear e acupuntura", "SPECT e acupuntura", "PET e acupuntura", "cintilografia e acupuntura", "radionuclídeo e acupuntura", "radiofármaco e acupuntura", "radioisótopo e acupuntura" e "99mTc e acupuntura". Alguns artigos publicados em inglês foram selecionados e uma pequena revisão é apresentada. A análise do número de publicações mostra que quando um método é bem aceito pela comunidade científica, como os métodos utilizados em medicina nuclear, o interesse em desenvolver novos estudos aumenta. Al

Survey on supply and demand of medicinal plants in Lorestan province groceries

Directory of Open Access Journals (Sweden)

fatemeh Naderi

2010-03-01

Full Text Available The results of activities related to medicinal plant industry lead to maintenance and progress (improvement of society health. Attention to situation of medicinal plants in groceries, diagnosis different species, Value of consumption and supplier regions as most important factors in medicinal plants forum can be used for programming and politics in medicinal industry in our country. So via proper scientific programming we can achieve to better culture of medicinal plants consumption and we can improve health parameters in lorestan province. Materials and methods The research was accomplished with Cross-Sectional study and questionary technique was used for data collection. The questionnaire consist of 3 parts were included questions related to socioeconomic trait, number of medicinal plant and medicinal properties. All of the groceries in the lorestan province were studied as statistical society. Sampling method was availability sample and samples size was 69 groceries. Results Results showed that the numbers of medicinal plants in groceries were about 336 species, mean of sold weight Was 128.48 kg. 94.5% and 5.5% of medicinal plants were supplied from out of Lorestan and Lorestan province respectively. Conclusion Existence of special plains and mountains plentiful running water, high storage of under round water and different Climate in the lorestan province cause a considerable diversity in this province. Whereas the results of this study showed that the most important suppliers of medicinal plants were located out of this province therefore programming in the case of these valuable sources of medicinal plants will be because higher preoccupation and existence of these crops in the groceries of lorestan province, even can export these to other countries.

INFLUENCE OF AEROSPACE MEDICINE ACHIEVEMENTS ON THE DEVELOPMENT OF SPORT MEDICINE METHODOLOGY.

Science.gov (United States)

R Yashina, E R; Kurashvili, V A; Turzin, P S

Modern technologies of aerospace medicine develop at rapid pace pulling on its orbit all spheres of the human activity, including sport. Innovations play a major role in the progress of sport medicine areas related to the biomedical support of precontest training. Overview of the most important aerospace medicine achievements and their methodical implications for sport medicine is presented. Discussion is devoted to how the aerospace medicine technologies can raise effectiveness of the biomedical support to different sectors of sport and fitness.

Readability of written medicine information materials in Arabic language: expert and consumer evaluation.

Science.gov (United States)

Al Aqeel, Sinaa; Abanmy, Norah; Aldayel, Abeer; Al-Khalifa, Hend; Al-Yahya, Maha; Diab, Mona

2018-02-27

Written Medicine Information (WMI) is one of the sources that patients use to obtain information concerning medicine. This paper aims to assess the readability of two types of WMIs in Arabic language based on vocabulary use and sentence structure using a panel of experts and consumers. This is a descriptive study. Two different types of materials, including the online text from King Abdullah Bin Abdulaziz Arabic Health Encyclopaedia (KAAHE) and medication leaflets submitted by the manufacturers to the Saudi Food and Drug Authority (SFDA) were evaluated. We selected a group of sentences from each WMI. The readability was assessed by experts (n = 5) and consumers (n = 5). The sentence readability of each measured using a specific criteria and rated as 1 = easy, 2 = intermediate, or 3 = difficult. A total of 4476 sentences (SFDA 2231; KAHEE 2245) extracted from websites or patient information leaflets on 50 medications and evaluated. The majority of the vocabulary and sentence structure was considered easy by both expert (SFDA: 68%; KAAHE: 76%) and consumer (SFDA: 76%; KAAHE: 84%) groups. The sentences with difficult or intermediate vocabulary and sentence structure are derived primarily from the precautions and side effects sections. The SFDA and KAAHE WMIs are easy to read and understand as judged by our study sample. However; there is room for improvement, especially in sections related to the side effects and precautions.

Textbook of respiratory medicine

International Nuclear Information System (INIS)

Murray, J.F.; Nadel, J.

1987-01-01

This book presents a clinical reference of respiratory medicine. It also details basic science aspects of pulmonary physiology and describes recently developed, sophisticated diagnostic tools and therapeutic methods. It also covers anatomy, physiology, pharmacology, and pathology; microbiologic, radiologic, nuclear medicine, and biopsy methods for diagnosis

Attitude and opinion towards essential medicine formulary

Science.gov (United States)

Sharma, Sangeeta; Kh, Reeta; Chaudhury, R. Roy

2010-01-01

Objective: The Delhi State Drug Policy was adopted in 1994 following which the first Essential Medicines List (EML) was developed in 1996. The Delhi State Essential Medicines Formulary was brought out in 1997. A need was felt to revise the formulary to match with the EML as the EML is renewed every 2 years. Materials and Methods: A survey was undertaken to elicit the opinions of the doctors practicing in the state on the usefulness of the formulary before revising and printing the updated version. The survey covered dispensaries, 10–20 bedded hospitals, 100-bedded hospitals and two tertiary care hospitals. Discussions were focused on questionnaires on attitudes toward adopting Essential Medicines Formulary using a 10-point scale. Results: Of the 200 doctors approached, only 90 doctors completed the questionnaire. Sixty-nine respondents (76.6%) had received the copy of the formulary. Most practitioners welcomed the formulary and were satisfied with the coverage and selection of the medicines. Most respondents (76.9%) agreed that a well-developed formulary would improve the quality of the public health care system, although they had reservations about the authority, relevance and effect on professional autonomy. Conclusion: About 74% of the respondents used the formulary in clinical practice as a source of medicine information, which makes its regular revision necessary. PMID:20871765

Studies on compatibility of energetic materials by thermal methods

Directory of Open Access Journals (Sweden)

Maria Alice Carvalho Mazzeu

2010-04-01

Full Text Available The chemical compatibility of explosives, pyrotechnics and propellants with those materials is studied to evaluate potential hazards when in contact with other materials during production, storage and handling. Compatibility can be studied by several thermal methods as DSC (differential scanning calorimetry, TG (Thermogravimetry, VST (Vacuum stability test and others. The test methods and well defined criteria are the most important elements when a compatibility study is being accomplished. In this paper, the compatibility of two very important high explosives used in ammunition, RDX (Cyclo-1,3,5-trimethylene-2,4,6-trinitramine and HMX (Cyclotetramethylene tetranitramine was studied with the materials: fluoroelastomer (Viton and powdered aluminum (Al, using DSC and VST methods. The criteria to judge the compatibility between materials is based on a standardization agreement (STANAG 4147, 2001, and the final conclusion is that explosives and this materials are compatible, but in DSC it was observed that the peak of decomposition temperature of the admixture of RDX with Al decreased in 3º C and another peak appeared after the decomposition peak.

[Developing traditional Chinese medicine injection is the need for curing sickness to save patients].

Science.gov (United States)

He, Ping; Li, Feng-Jie; Li, Lian-da; Li, Yi-Kui

2017-03-01

Safety issues of traditional Chinese medicine injections has been heated debate. There are two diametrically opposed views: it should be used reasonable and developed healthily or be forbidden to use. Some people have many misunderstandings and prejudices about the safety of traditional Chinese medicine injections. Compared with western medicine,traditional Chinese medicine has its own particularity. Traditional Chinese medicine has complex components. Its research and clinical application is different from western medicine. Adverse reactions of traditional Chinese medicine injections are related to many factors,such as a large number of irrational use,blind use of traditional Chinese medicine injections and western medicine injections,counterfeit and substandard drugs,incorrect methods of intravenous infusion,toxicity of supplementary materials,drug ingredients. Developing traditional Chinese medicine injection is the need for curing sickness to save patients. The purposeful, targeted, organized and planned systematic research of traditional Chinese medicine injections should be strengthened,especially the safety of traditional Chinese medicine. Strengthen supervision and control of rational drug use.Strengthen the examination and approval,supervision and management of all aspects to ensure the safety of patients. Copyright© by the Chinese Pharmaceutical Association.

Developing Teaching Material Software Assisted for Numerical Methods

Science.gov (United States)

Handayani, A. D.; Herman, T.; Fatimah, S.

2017-09-01

The NCTM vision shows the importance of two things in school mathematics, which is knowing the mathematics of the 21st century and the need to continue to improve mathematics education to answer the challenges of a changing world. One of the competencies associated with the great challenges of the 21st century is the use of help and tools (including IT), such as: knowing the existence of various tools for mathematical activity. One of the significant challenges in mathematical learning is how to teach students about abstract concepts. In this case, technology in the form of mathematics learning software can be used more widely to embed the abstract concept in mathematics. In mathematics learning, the use of mathematical software can make high level math activity become easier accepted by student. Technology can strengthen student learning by delivering numerical, graphic, and symbolic content without spending the time to calculate complex computing problems manually. The purpose of this research is to design and develop teaching materials software assisted for numerical method. The process of developing the teaching material starts from the defining step, the process of designing the learning material developed based on information obtained from the step of early analysis, learners, materials, tasks that support then done the design step or design, then the last step is the development step. The development of teaching materials software assisted for numerical methods is valid in content. While validator assessment for teaching material in numerical methods is good and can be used with little revision.

Materials comprising polydienes and hydrophilic polymers and related methods

Science.gov (United States)

Mays, Jimmy W [Knoxville, TN; Deng, Suxiang [Knoxville, TN; Mauritz, Kenneth A [Hattiesburg, MS; Hassan, Mohammad K [Hattiesburg, MS; Gido, Samuel P [Hadley, MA

2011-11-22

Materials prepared from polydienes, such as poly(cyclohexadiene), and hydrophilic polymers, such as poly(alkylene oxide), are described. Methods of making the materials and their use in fuel cell membranes, batteries, breathable chemical-biological protective materials, and templates for sol-gel polymerization are also provided. The materials can be crosslinked and sulfonated, and can include copolymers and polymer blends.

[Ideas and methods on efficient screening of traditional medicines for anti-osteoporosis activity based on M-Act/Tox integrated evaluation using zebrafish].

Science.gov (United States)

Wang, Mo; Ling, Jie; Chen, Ying; Song, Jie; Sun, E; Shi, Zi-Qi; Feng, Liang; Jia, Xiao-Bin; Wei, Ying-Jie

2017-11-01

The increasingly apparent liver injury problems of bone strengthening Chinese medicines have brought challenges for clinical application, and it is necessary to consider both effectiveness and safety in screening anti-osteoporosis Chinese medicines. Metabolic transformation is closely related to drug efficacy and toxicity, so it is significant to comprehensively consider metabolism-action/toxicity(M-Act/Tox) for screening anti-osteoporosis Chinese medicines. The current evaluation models and the number of compounds(including metabolites) severely restrict efficient screening in vivo. By referring to previous relevant research and domestic and abroad literature, zebrafish M-Act/Tox integrative method was put forward for efficiently screening anti-osteoporosis herb medicines, which has organically integrated zebrafish metabolism model, osteoporosis model and toxicity evaluation method. This method can break through the bottleneck and blind spots that trace compositions can't achieve efficient and integrated in vivo evaluation, and realize both efficient and comprehensive screening on anti-osteoporosis traditional medicines based on in vivo process taking both safety and effectiveness into account, which is significant to accelerate discovery of effective and safe innovative traditional Chinese medicines for osteoporosis. Copyright© by the Chinese Pharmaceutical Association.

The Choice Method of Selected Material has influence single evaporation flash method

International Nuclear Information System (INIS)

Sunaryo, Geni Rina; Sumijanto; Nurul L, Siti

2000-01-01

The final objective of this research is to design the mini scale of desalination installation. It has been started from 1997/1998 and has been doing for this 3 years. Where the study on the assessment of various desalination system has been done in the first year and thermodynamic in the second year. In this third year, literatully study on material resistance from outside pressure has been done. The number of pressure for single evaporator flashing method is mainly depend on the temperature that applied in that system. In this paper, the configuration stage, the choice method of selecting material for main evaporator vessel, tube, tube plates, water boxes, pipework, and valves for multistage flash distillation will be described. The choice of selecting material for MSF is base on economical consideration, cheap, high resistance and easy to be maintained

Method of capturing or trapping zinc using zinc getter materials

Science.gov (United States)

Hunyadi Murph, Simona E.; Korinko, Paul S.

2017-07-11

A method of trapping or capturing zinc is disclosed. In particular, the method comprises a step of contacting a zinc vapor with a zinc getter material. The zinc getter material comprises nanoparticles and a metal substrate.

The lost history of American veterinary medicine: the need for preservation*†

Science.gov (United States)

Boyd, C. Trenton

2011-01-01

Objective: The objective of this study was to survey holdings of ephemeral veterinary literature. Methods: WorldCat OCLC catalog, the Library of Congress online catalog, the US National Agricultural Library online catalog, and the Dictionary Catalog of the National Agricultural Library, 1862–1965, were used to determine current library holdings of materials published by veterinary schools that are no longer in existence and veterinary associations that are defunct, veterinary supply catalogs, veterinary house organs, patent medicine publications, and veterinary advertisements. Individual library catalogs were also consulted. In addition, the practice of removing advertisements from bound volumes was examined. Results: There are many gaps in the cataloged library holdings of primary source materials relating to the history of the education of veterinarians in the United States. Conclusions: A proactive action plan needs to be designed and activated to locate, catalog, and preserve this primary source material of veterinary medicine for posterity. PMID:21243050

Macro-architectured cellular materials: Properties, characteristic modes, and prediction methods

Science.gov (United States)

Ma, Zheng-Dong

2017-12-01

Macro-architectured cellular (MAC) material is defined as a class of engineered materials having configurable cells of relatively large (i.e., visible) size that can be architecturally designed to achieve various desired material properties. Two types of novel MAC materials, negative Poisson's ratio material and biomimetic tendon reinforced material, were introduced in this study. To estimate the effective material properties for structural analyses and to optimally design such materials, a set of suitable homogenization methods was developed that provided an effective means for the multiscale modeling of MAC materials. First, a strain-based homogenization method was developed using an approach that separated the strain field into a homogenized strain field and a strain variation field in the local cellular domain superposed on the homogenized strain field. The principle of virtual displacements for the relationship between the strain variation field and the homogenized strain field was then used to condense the strain variation field onto the homogenized strain field. The new method was then extended to a stress-based homogenization process based on the principle of virtual forces and further applied to address the discrete systems represented by the beam or frame structures of the aforementioned MAC materials. The characteristic modes and the stress recovery process used to predict the stress distribution inside the cellular domain and thus determine the material strengths and failures at the local level are also discussed.

Materials characterization by resonant ultrasonic spectroscopy method

International Nuclear Information System (INIS)

Cheong, Yong Moo; Jung, H.K.; Joo, Y.S.; Sim, C.M.

2001-01-01

A high temperature resonant ultrasound spectroscopy(RUS) was developed. The dynamic elastic constant of RPV weld, which has various different microstructure was determined by RUS. It was confirmed the RUS method is very sensitive to the microstructures of the material. RUS can be used to monitor the degradation of nuclear materials including neutron irradiation embrittlement through the measurement of dynamic elastic constants, elastic anisotropy, high temperature elastic constant and Q-factor

Modeling of Landslides with the Material Point Method

DEFF Research Database (Denmark)

Andersen, Søren Mikkel; Andersen, Lars

2008-01-01

A numerical model for studying the dynamic evolution of landslides is presented. The numerical model is based on the Generalized Interpolation Material Point Method. A simplified slope with a house placed on top is analysed. An elasto-plastic material model based on the Mohr-Coulomb yield criterion...

Modelling of Landslides with the Material-point Method

DEFF Research Database (Denmark)

Andersen, Søren; Andersen, Lars

2009-01-01

A numerical model for studying the dynamic evolution of landslides is presented. The numerical model is based on the Generalized Interpolation Material Point Method. A simplified slope with a house placed on top is analysed. An elasto-plastic material model based on the Mohr-Coulomb yield criterion...

Traditional Preparations and Methanol Extracts of Medicinal Plants from Papua New Guinea Exhibit Similar Cytochrome P450 Inhibition

Directory of Open Access Journals (Sweden)

Erica C. Larson

2016-01-01

Full Text Available The hypothesis underlying this current work is that fresh juice expressed from Papua New Guinea (PNG medicinal plants (succus will inhibit human Cytochrome P450s (CYPs. The CYP inhibitory activity identified in fresh material was compared with inhibition in methanol extracts of dried material. Succus is the most common method of traditional medicine (TM preparation for consumption in PNG. There is increasing concern that TMs might antagonize or complicate drug therapy. We have previously shown that methanol extracts of commonly consumed PNG medicinal plants are able to induce and/or inhibit human CYPs in vitro. In this current work plant succus was prepared from fresh plant leaves. Inhibition of three major CYPs was determined using human liver microsomes and enzyme-selective model substrates. Of 15 species tested, succus from 6/15 was found to inhibit CYP1A2, 7/15 inhibited CYP3A4, and 4/15 inhibited CYP2D6. Chi-squared tests determined differences in inhibitory activity between succus and methanol preparations. Over 80% agreement was found. Thus, fresh juice from PNG medicinal plants does exhibit the potential to complicate drug therapy in at risk populations. Further, the general reproducibility of these findings suggests that methanol extraction of dried material is a reasonable surrogate preparation method for fresh plant samples.

[Evidence-based medicine: modern scientific methods for determining usefulness].

Science.gov (United States)

Schmidt, J G

1999-01-01

For quite some time, clinical epidemiology has introduced the art of critical appraisal of evidence as well as the methods of how to design sound clinical studies and trials. Almost unnoticed by most medical institutions a new hierarchy of evidence has emerged which puts well thought out trials, able to document unbiased treatment benefit in terms of patient suffering, above pathophysiological theory. Many controlled trials have shown, in the meantime, that the control of laboratory or other kind of pathologies and the correction of anatomical abnormalities do not necessarily mean a benefit for the patient. Concepts relating to this dissection of evidence include: Surrogate fallacy ("cosmetics" of laboratory results or ligament or cartilage "cosmetics" in surgery), confounding (spurious causal relationships), selection bias (comparison with selected groups) as well as lead-time bias (mistaking earlier diagnosis as increase of survival), length bias (overlooking differences in the aggressiveness of diseases as determinants of disease stage distributions) and overdiagnosis bias (mistaking the increasing detection of clinically silent pathologies as improvement of prognosis). Moreover, absolute instead of relative risk reduction needs to be used to measure patient benefit. The incorporation of decision-analysis and of the concepts or clinical epidemiology will improve the efficiency and quality of medicine much more effectively than the sole focus on technical medical performance. Evidence based medicine is the systematic and critical appraisal of medical interventions, based on the understanding how to avoid the fallacies and biases mentioned.

Methods of materiality

DEFF Research Database (Denmark)

Aagaard, Jesper; Matthiesen, Noomi Christine Linde

2016-01-01

that researchers should start paying attention to the material world (consisting of both human bodies and material objects) and what it means for how people live their lives. It is argued that this can be done by incorporating the concept of material presence to capture embodied and material layers of existence......This article challenges the hegemonic status of “language” as the primary substance of qualitative research in psychology, whether through interviews or recordings of naturally occurring talk. It thereby questions the overt focus on analyzing linguistic “meaning.” Instead, it is suggested...... practical guidelines for incorporating attention to materiality in qualitative research....

Further Validation of a Rapid Screening Semiquantitative Thin-Layer Chromatographic Method for Marketed Antimalarial Medicines for Adoption in Malawi

Directory of Open Access Journals (Sweden)

Dorcas Osei-Safo

2018-01-01

Full Text Available A recently developed semiquantitative thin-layer chromatographic (SQ-TLC assay has been employed in postmarketing surveillance of antimalarial medicines used in Malawi prior to HPLC assay. Both methods gave analogous results in a significant majority of the samples, with a good correlation (r = 0.9012 for the active pharmaceutical ingredients of the dosage forms assayed. Artemether-containing medicines had the highest percentage (92.67% of samples with comparable results for both assays. The lowest percentage (66.67% was observed in artesunate-containing medicines. The SQ-TLC method was validated for specificity, accuracy, precision, linearity, and stability according to the International Conference on Harmonisation guidelines, with the results falling within acceptable limits. For specificity, retention factor values of the test samples and reference standards were comparable, while accuracy and precision of 91.1 ± 5.7% were obtained for all samples. The method was linear in the range 1.0–2.0 µg/spot with a correlation coefficient of r = 0.9783. Stability tests also fell within acceptable limits. In this study, we present the validation of the SQ-TLC method and propose its adoption as a rapid screening tool for field estimation of the quality of antimalarial and other essential medicines in Malawi and other parts of the developing world prior to a more accurate HPLC assay.

Textile materials for lightweight constructions technologies, methods, materials, properties

CERN Document Server

2016-01-01

In this book, experts on textile technologies convey both general and specific informa­tion on various aspects of textile engineering, ready-made technologies, and textile chemistry. They describe the entire process chain from fiber materials to various yarn constructions, 2D and 3D textile constructions, preforms, and interface layer design. In addition, the authors introduce testing methods, shaping and simulation techniques for the characterization of and structural mechanics calculations on anisotropic, pliable high-performance textiles, including specific examples from the fields of fiber plastic composites, textile concrete, and textile membranes. Readers will also be familiarized with the potential offered by increasingly popular textile structures, for instance in the fields of composite technology, construction technology, security technology, and membrane technology. Textile materials and semi-finished products have widely varied potential characteristics, and are commonly used as essential element...

Computerized statistical analysis with bootstrap method in nuclear medicine

International Nuclear Information System (INIS)

Zoccarato, O.; Sardina, M.; Zatta, G.; De Agostini, A.; Barbesti, S.; Mana, O.; Tarolo, G.L.

1988-01-01

Statistical analysis of data samples involves some hypothesis about the features of data themselves. The accuracy of these hypotheses can influence the results of statistical inference. Among the new methods of computer-aided statistical analysis, the bootstrap method appears to be one of the most powerful, thanks to its ability to reproduce many artificial samples starting from a single original sample and because it works without hypothesis about data distribution. The authors applied the bootstrap method to two typical situation of Nuclear Medicine Department. The determination of the normal range of serum ferritin, as assessed by radioimmunoassay and defined by the mean value ±2 standard deviations, starting from an experimental sample of small dimension, shows an unacceptable lower limit (ferritin plasmatic levels below zero). On the contrary, the results obtained by elaborating 5000 bootstrap samples gives ans interval of values (10.95 ng/ml - 72.87 ng/ml) corresponding to the normal ranges commonly reported. Moreover the authors applied the bootstrap method in evaluating the possible error associated with the correlation coefficient determined between left ventricular ejection fraction (LVEF) values obtained by first pass radionuclide angiocardiography with 99m Tc and 195m Au. The results obtained indicate a high degree of statistical correlation and give the range of r 2 values to be considered acceptable for this type of studies

Computers for use in nuclear medicine

International Nuclear Information System (INIS)

Surova, H.

1991-01-01

Brief information is presented on computers for nuclear medicine that are currently available on the market. The treatment is based on print material by various manufacturers and commercial organizations and on the publication ''Nuclear Medicine Computers - A Personal Comparison Chart'' of May 1991, issued by the Reilly Publishing Company. (Z.S.)

Development of a novel sports medicine rotation for emergency medicine residents.

Science.gov (United States)

Waterbrook, Anna L; Pritchard, T Gail; Lane, Allison D; Stoneking, Lisa R; Koch, Bryna; McAtee, Robert; Grall, Kristi H; Min, Alice A; Prior, Jessica; Farrell, Isaac; McNulty, Holly G; Stolz, Uwe

2016-01-01

Musculoskeletal complaints are the most common reason for patients to visit a physician, yet competency in musculoskeletal medicine is invariably reported as a deficiency in medical education in the USA. Sports medicine clinical rotations improve both medical students' and residents' musculoskeletal knowledge. Despite the importance of this knowledge, a standardized sports medicine curriculum in emergency medicine (EM) does not exist. Hence, we developed a novel sports medicine rotation for EM residents to improve their musculoskeletal educational experience and to improve their knowledge in musculoskeletal medicine by teaching the evaluation and management of many common musculoskeletal disorders and injuries that are encountered in the emergency department. The University of Arizona has two distinct EM residency programs, South Campus (SC) and University Campus (UC). The UC curriculum includes a traditional 4-week orthopedic rotation, which consistently rated poorly on evaluations by residents. Therefore, with the initiation of a new EM residency at SC, we replaced the standard orthopedic rotation with a novel sports medicine rotation for EM interns. This rotation includes attendance at sports medicine clinics with primary care and orthopedic sports medicine physicians, involvement in sport event coverage, assigned reading materials, didactic experiences, and an on-call schedule to assist with reductions in the emergency department. We analyzed postrotation surveys completed by residents, postrotation evaluations of the residents completed by primary care sports medicine faculty and orthopedic chief residents, as well as the total number of dislocation reductions performed by each graduating resident at both programs over the last 5 years. While all residents in both programs exceeded the ten dislocation reductions required for graduation, residents on the sports medicine rotation had a statistically significant higher rate of satisfaction of their educational

Readability of patient education materials on the American Orthopaedic Society for Sports Medicine website.

Science.gov (United States)

Eltorai, Adam E M; Han, Alex; Truntzer, Jeremy; Daniels, Alan H

2014-11-01

The recommended readability of patient education materials by the American Medical Association (AMA) and National Institutes of Health (NIH) should be no greater than a sixth-grade reading level. However, online resources may be too complex for some patients to understand, and poor health literacy predicts inferior health-related quality of life outcomes. This study evaluated whether the American Orthopaedic Society for Sports Medicine (AOSSM) website's patient education materials meet recommended readability guidelines for medical information. We hypothesized that the readability of these online materials would have a Flesch-Kincaid formula grade above the sixth grade. All 65 patient education entries of the AOSSM website were analyzed for grade level readability using the Flesch-Kincaid formula, a widely used and validated tool to evaluate the text reading level. The average (standard deviation) readability of all 65 articles was grade level 10.03 (1.44); 64 articles had a readability score above the sixth-grade level, which is the maximum level recommended by the AMA and NIH. Mean readability of the articles exceeded this level by 4.03 grade levels (95% CI, 3.7-4.4; P reading level of US adults. Mean readability of the articles exceeded this level by 2.03 grade levels (95% CI, 1.7-2.4; P online AOSSM patient education materials exceeds the readability level recommended by the AMA and NIH, and is above the average reading level of the majority of US adults. This online information may be of limited utility to most patients due to a lack of comprehension. Our study provides a clear example of the need to improve the readability of specific education material in order to maximize the efficacy of multimedia sources.

Heart Palpitation From Traditional and Modern Medicine Perspectives

Science.gov (United States)

Ershadifar, Tabassom; Minaiee, Bagher; Gharooni, Manouchehr; Isfahani, Mohammad Mahdi; Nikbakht Nasrabadi, Alireza; Nazem, Esmaiel; Gousheguir, Ashraf Aldin; Kazemi Saleh, Davod

2014-01-01

Background: Palpitation is a sign of a disease and is very common in general population. For this purpose we decided to explain it in this study. Objectives: The purpose of this study was to describe the palpitation in both modern and traditional medicine aspect. It may help us to diagnose and cure better because the traditional medicine view is holistic and different from modern medicine. Materials and Methods: We addressed some descriptions to the articles of traditional medicine subjects which have published recently. Palpitation in modern medicine was extracted from medical books such as Braunwald, Harrison and Guyton physiology and some related articles obtained from authentic journals in PubMed and Ovid and Google scholar between1990 to 2013. Results: According to modern medicine, there are many causes for palpitation and in some cases it is cured symptomatically. In traditional medicine view, palpitation has been explained completely and many causes have been described. Its aspect is holistic and it cures causatively. The traditional medicine scientists evaluated the body based on Humors and temperament. Temperament can be changed to dis-temperament in diseases. Humors are divided in 4 items: sanguine, humid or phlegm, melancholy and bile. Palpitation is a disease, it is heart vibration and is caused by an abnormal substance in the heart itself or its membrane or other adjacent organs that would result in the heart suffering. Conclusions: Our data of this article suggests that causes of palpitation in the aspect of traditional medicine are completely different from modern medicine. It can help us to approach and treat this symptom better and with lower side effects than chemical drugs. According to this article we are able to detect a new approach in palpitation. PMID:24719741

An improved electrokinetic method to consolidate porous materials

DEFF Research Database (Denmark)

Feijoo, Jorge; Ottosen, Lisbeth M.; Nóvoa, X. R.

2017-01-01

the consolidation using commercial products have some limitations, such as: (1) low penetrability; (2) no chemical and mineralogical affinity with the material to treat and (3) release of toxic compounds (VOCs), during the solvent evaporation. In the last years, a new consolidation method based on electrokinetic...... the pH of the solutions in contact with the porous material, which can damage it and (2) it is difficult to determine in which area the consolidation takes place. In this study an electrokinetic consolidation method, which has two steps between which the current is reversed, is proposed to solve all...... techniques was developed. This method allows filling some pores by the precipitation of an inorganic compound. As a result the method allows increasing the penetration depth of current consolidation treatments. However, this method needs to be improved since: (1) no special care is taking in controlling...

[Current development of rapid high-throughout determination technology for total components of traditional Chinese medicines and formula and synthetic immunity chip method].

Science.gov (United States)

He, Fu-Yuan; Deng, Kai-Wen; Zeng, Jiao-Li; Dai, Ru-Wen; Dai, Ru-Wen; Xia, Zan-Shao; Liu, Weng-Long; Shi, Ji-Lian

2012-10-01

The qualitative and quantitative analysis on traditional Chinese medicine and formula components can be made by chemical and instrumental analysis methods. Of both, the instrumental analysis methods play a dominant role, including HPLC, HPLC-MS, HPLC-NMR, GC, GC-MS, biochemical and biological effect. But because traditional Chinese medicines and formula have complicated components, chemical methods are so unspecific that they shall be used less or with caution. While instrumental analysis methods are so specific that they are appropriate for analyzing complicated single component. The analysis techniques for multiple components of traditional Chinese medicines and formula focus on fingerprints, but all of these analysis techniques are limited by the pre-requisite of separation and the lack of general-purpose detectors and therefore being hard to realize the determination of all components of traditional Chinese medicines and formula. In the natural world, however, organisms identify native and alien components through specificity and non-specificity of clusters decided by antigens and antibodies. For example, components of traditional Chinese medicines are directly or indirectly synthesized into antigens and injected into animals, in order to generate specific antibodies and then collect cross reaction information of these components to specific antibodies. As for components without cross reaction, their contents shall be directly read out on the basis of the inhibition rate curve of competitive reaction for specificity of antigens and antibodies. Besides, a cross inhibition rate matrix shall be established first, and them a multiple regression linear equation between cross component concentration or concentration logarithm and inhibition rate by labeling the immunity competitive reaction between antibodies and haptens of traditional Chinese medicine and compound components, and then solved to obtain concentration of each component. The two results are combined to

A practical material decomposition method for x-ray dual spectral computed tomography.

Science.gov (United States)

Hu, Jingjing; Zhao, Xing

2016-03-17

X-ray dual spectral CT (DSCT) scans the measured object with two different x-ray spectra, and the acquired rawdata can be used to perform the material decomposition of the object. Direct calibration methods allow a faster material decomposition for DSCT and can be separated in two groups: image-based and rawdata-based. The image-based method is an approximative method, and beam hardening artifacts remain in the resulting material-selective images. The rawdata-based method generally obtains better image quality than the image-based method, but this method requires geometrically consistent rawdata. However, today's clinical dual energy CT scanners usually measure different rays for different energy spectra and acquire geometrically inconsistent rawdata sets, and thus cannot meet the requirement. This paper proposes a practical material decomposition method to perform rawdata-based material decomposition in the case of inconsistent measurement. This method first yields the desired consistent rawdata sets from the measured inconsistent rawdata sets, and then employs rawdata-based technique to perform material decomposition and reconstruct material-selective images. The proposed method was evaluated by use of simulated FORBILD thorax phantom rawdata and dental CT rawdata, and simulation results indicate that this method can produce highly quantitative DSCT images in the case of inconsistent DSCT measurements.

Artificial ligamentous joints:Methods, materials and characteristics

OpenAIRE

Hockings, Nick; Iravani, Pejman; Bowen, Chris

2014-01-01

This paper presents a novel method for making ligamentous articulations for robots. Ligamentous joints are widely found in animals, but they have been of limited appli- cation in robotics due to lack of analogous synthetic materials. The method presented combines 3D printing, tow laying and thermoplastic welding which enables manufacturing of this type of structure.

Links between nuclear medicine and radiopharmacy

International Nuclear Information System (INIS)

Pelegrin, M.; Francois-Joubert, A.; Chassel, M.L.; Desruet, M.D.; Bolot, C.; Lao, S.

2010-01-01

Radiopharmaceuticals are nowadays under the responsibility of the radio-pharmacist because of their medicinal product status. Radiopharmacy belongs to the hospital pharmacy department, nevertheless, interactions with nuclear medicine department are important: rooms are included or located near nuclear medicine departments in order to respect radiation protection rules, more over staff, a part of the material and some activities are shared between the two departments. Consequently, it seems essential to formalize links between the radiopharmacy and the nuclear medicine department, setting the goals to avoid conflicts and to ensure patients' security. Modalities chosen for this formalization will depend on the establishment's organization. (authors)

Optimization of Parameters for Manufacture Nanopowder Bioceramics at Machine Pulverisette 6 by Taguchi and ANOVA Method

Science.gov (United States)

Van Hoten, Hendri; Gunawarman; Mulyadi, Ismet Hari; Kurniawan Mainil, Afdhal; Putra, Bismantoloa dan

2018-02-01

This research is about manufacture nanopowder Bioceramics from local materials used Ball Milling for biomedical applications. Source materials for the manufacture of medicines are plants, animal tissues, microbial structures and engineering biomaterial. The form of raw material medicines is a powder before mixed. In the case of medicines, research is to find sources of biomedical materials that will be in the nanoscale powders can be used as raw material for medicine. One of the biomedical materials that can be used as raw material for medicine is of the type of bioceramics is chicken eggshells. This research will develop methods for manufacture nanopowder material from chicken eggshells with Ball Milling using the Taguchi method and ANOVA. Eggshell milled using a variation of Milling rate on 150, 200 and 250 rpm, the time variation of 1, 2 and 3 hours and variations the grinding balls to eggshell powder weight ratio (BPR) 1: 6, 1: 8, 1: 10. Before milled with Ball Milling crushed eggshells in advance and calcinate to a temperature of 900°C. After the milled material characterization of the fine powder of eggshell using SEM to see its size. The result of this research is optimum parameter of Taguchi Design analysis that is 250 rpm milling rate, 3 hours milling time and BPR is 1: 6 with the average eggshell powder size is 1.305 μm. Milling speed, milling time and ball to powder weight of ratio have contribution successively equal to 60.82%, 30.76% and 6.64% by error equal to 1.78%.

Material-Point-Method Analysis of Collapsing Slopes

DEFF Research Database (Denmark)

Andersen, Søren; Andersen, Lars

2009-01-01

To understand the dynamic evolution of landslides and predict their physical extent, a computational model is required that is capable of analysing complex material behaviour as well as large strains and deformations. Here, a model is presented based on the so-called generalised-interpolation mat......To understand the dynamic evolution of landslides and predict their physical extent, a computational model is required that is capable of analysing complex material behaviour as well as large strains and deformations. Here, a model is presented based on the so-called generalised......, a deformed material description is introduced, based on time integration of the deformation gradient and utilising Gauss quadrature over the volume associated with each material point. The method has been implemented in a Fortran code and employed for the analysis of a landslide that took place during...

MIANN models in medicinal, physical and organic chemistry.

Science.gov (United States)

González-Díaz, Humberto; Arrasate, Sonia; Sotomayor, Nuria; Lete, Esther; Munteanu, Cristian R; Pazos, Alejandro; Besada-Porto, Lina; Ruso, Juan M

2013-01-01

Reducing costs in terms of time, animal sacrifice, and material resources with computational methods has become a promising goal in Medicinal, Biological, Physical and Organic Chemistry. There are many computational techniques that can be used in this sense. In any case, almost all these methods focus on few fundamental aspects including: type (1) methods to quantify the molecular structure, type (2) methods to link the structure with the biological activity, and others. In particular, MARCH-INSIDE (MI), acronym for Markov Chain Invariants for Networks Simulation and Design, is a well-known method for QSAR analysis useful in step (1). In addition, the bio-inspired Artificial-Intelligence (AI) algorithms called Artificial Neural Networks (ANNs) are among the most powerful type (2) methods. We can combine MI with ANNs in order to seek QSAR models, a strategy which is called herein MIANN (MI & ANN models). One of the first applications of the MIANN strategy was in the development of new QSAR models for drug discovery. MIANN strategy has been expanded to the QSAR study of proteins, protein-drug interactions, and protein-protein interaction networks. In this paper, we review for the first time many interesting aspects of the MIANN strategy including theoretical basis, implementation in web servers, and examples of applications in Medicinal and Biological chemistry. We also report new applications of the MIANN strategy in Medicinal chemistry and the first examples in Physical and Organic Chemistry, as well. In so doing, we developed new MIANN models for several self-assembly physicochemical properties of surfactants and large reaction networks in organic synthesis. In some of the new examples we also present experimental results which were not published up to date.

Methods for the continuous production of plastic scintillator materials

Science.gov (United States)

Bross, Alan; Pla-Dalmau, Anna; Mellott, Kerry

1999-10-19

Methods for producing plastic scintillating material employing either two major steps (tumble-mix) or a single major step (inline-coloring or inline-doping). Using the two step method, the polymer pellets are mixed with silicone oil, and the mixture is then tumble mixed with the dopants necessary to yield the proper response from the scintillator material. The mixture is then placed in a compounder and compounded in an inert gas atmosphere. The resultant scintillator material is then extruded and pelletized or formed. When only a single step is employed, the polymer pellets and dopants are metered into an inline-coloring extruding system. The mixture is then processed under a inert gas atmosphere, usually argon or nitrogen, to form plastic scintillator material in the form of either scintillator pellets, for subsequent processing, or as material in the direct formation of the final scintillator shape or form.

Evaluation of methods to compare consequences from hazardous materials transportation accidents

International Nuclear Information System (INIS)

Rhoads, R.E.; Franklin, A.L.; Lavender, J.C.

1986-10-01

This report presents the results of a project to develop a framework for making meaningful comparisons of the consequences from transportation accidents involving hazardous materials. The project was conducted in two phases. In Phase I, methods that could potentially be used to develop the consequence comparisons for hazardous material transportation accidents were identified and reviewed. Potential improvements were identified and an evaluation of the improved methods was performed. Based on this evaluation, several methods were selected for detailed evaluation in Phase II of the project. The methods selected were location-dependent scenarios, figure of merit and risk assessment. This evaluation included application of the methods to a sample problem which compares the consequences of four representative hazardous materials - chlorine, propane, spent nuclear fuel and class A explosives. These materials were selected because they represented a broad class of hazardous material properties and consequence mechanisms. The sample case aplication relied extensively on consequence calculations performed in previous transportation risk assessment studies. A consultant was employed to assist in developing consequence models for explosives. The results of the detailed evaluation of the three consequence comparison methods indicates that methods are available to perform technically defensible comparisons of the consequences from a wide variety of hazardous materials. Location-dependent scenario and risk assessment methods are available now and the figure of merit method could be developed with additional effort. All of the methods require substantial effort to implement. Methods that would require substantially less effort were identified in the preliminary evaluation, but questions of technical accuracy preclude their application on a scale. These methods may have application to specific cases, however

Occupational exposure at the Department of Nuclear Medicine as a work environment: A 19-year follow-up

OpenAIRE

Piwowarska-Bilska, Hanna; Birkenfeld, Bożena; Gwardyś, Aleksandra; Supińska, Aleksandra; Listewnik, Maria H.; Elbl, Bogumiła; Cichoń-Bańkowska, Katarzyna

2011-01-01

Summary Background: This study assessed the radiation safety at Nuclear Medicine Department being a work environment. Ionizing radiation exposure of the employees in the last 19 years and the effects of legislative changes in radiological protection were analyzed. Material/Methods: All employees of the investigated department were regularly and individually monitored using chest badges equipped with Kodak film type 2. Overall, 629 annual doses of the employees of nuclear medicine department, ...

Research methods in complementary and alternative medicine: an integrative review.

Science.gov (United States)

de Almeida Andrade, Fabiana; Schlechta Portella, Caio Fabio

2018-01-01

The scientific literature presents a modest amount of evidence in the use of complementary and alternative medicine (CAM). On the other hand, in practice, relevant results are common. The debates among CAM practitioners about the quality and execution of scientific research are important. Therefore, the aim of this review is to gather, synthesize and describe the differentiated methodological models that encompass the complexity of therapeutic interventions. The process of bringing evidence-based medicine into clinical practice in CAM is essential for the growth and strengthening of complementary medicines worldwide. Copyright © 2017 Shanghai Changhai Hospital. Published by Elsevier B.V. All rights reserved.

Material-point Method Analysis of Bending in Elastic Beams

DEFF Research Database (Denmark)

Andersen, Søren Mikkel; Andersen, Lars

The aim of this paper is to test different types of spatial interpolation for the materialpoint method. The interpolations include quadratic elements and cubic splines. A brief introduction to the material-point method is given. Simple liner-elastic problems are tested, including the classical...... cantilevered beam problem. As shown in the paper, the use of negative shape functions is not consistent with the material-point method in its current form, necessitating other types of interpolation such as cubic splines in order to obtain smoother representations of field quantities. It is shown...

Production of teaching materials of nuclear medicine for use in career of Imagenologia Diagnostica y Terapeutica of the Escuela de Tecnologias de Salud of the Universidad de Costa Rica

International Nuclear Information System (INIS)

Aguilar Blanco, Luis Alberto; Bertarioni Alfaro, Carol; Elizondo Vargas, David; Gutierrez Villareal, Raul E.; Quesada Silva, Fernando

2008-01-01

One of the main obstacles in the career of Imagenologia Diagnostica y Terapeutica of the Escuela de Tecnologias de Salud of the Universidad de Costa Rica has been access to bibliographic material of reference in Spanish. The topics most relevant of nuclear medicine of interest to imaging specialist and other disciplines as: medicine, physics, pharmacy and nursing, have been identified for the purpose of having a bibliographic body; experts have reviewed the selection in each subject. Topics of interest were identified and grouped into five specific teaching areas: 1. Radiation protection, 2. Quality Control of Nuclear Medicine Instruments, 3. Radiopharmacy, 4. Planar Nuclear Medicine, 5. Nuclear Medicine SPECT and PET. (author) [es

Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

Science.gov (United States)

Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

2017-07-19

Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

Radiology in veterinary medicine

International Nuclear Information System (INIS)

Hrusovsky, J.; Benes, J.

1985-01-01

A textbook is presented for pregraduate and postgraduate students of veterinary medicine, offering an extensive review of all aspects of radiology as applied in veterinary sciences. Based on findings published in the literature and the authors' own research, the textbook familiarizes the reader with the problems of nuclear physics, biological effects of ionizing radiation on animals, the principles of biological cycles of radionuclides in the atmosphere, the fundamentals of radiochemistry, dosimetry, radiometry and nuclear medicine. Radiation protection of animals, raw materials, feeds, foodstuff and water, and the questions of the aplications of ionizing radiation and of radionuclides in veterinary medicine are discussed in great detail. The publication is complemented with numerous photographs, figures and graphs. (L.O.)

Hydrogen storage materials and method of making by dry homogenation

Science.gov (United States)

Jensen, Craig M.; Zidan, Ragaiy A.

2002-01-01

Dry homogenized metal hydrides, in particular aluminum hydride compounds, as a material for reversible hydrogen storage is provided. The reversible hydrogen storage material comprises a dry homogenized material having transition metal catalytic sites on a metal aluminum hydride compound, or mixtures of metal aluminum hydride compounds. A method of making such reversible hydrogen storage materials by dry doping is also provided and comprises the steps of dry homogenizing metal hydrides by mechanical mixing, such as be crushing or ball milling a powder, of a metal aluminum hydride with a transition metal catalyst. In another aspect of the invention, a method of powering a vehicle apparatus with the reversible hydrogen storage material is provided.

Solid electrolyte material manufacturable by polymer processing methods

Science.gov (United States)

Singh, Mohit; Gur, Ilan; Eitouni, Hany Basam; Balsara, Nitash Pervez

2012-09-18

The present invention relates generally to electrolyte materials. According to an embodiment, the present invention provides for a solid polymer electrolyte material that is ionically conductive, mechanically robust, and can be formed into desirable shapes using conventional polymer processing methods. An exemplary polymer electrolyte material has an elastic modulus in excess of 1.times.10.sup.6 Pa at 90 degrees C. and is characterized by an ionic conductivity of at least 1.times.10.sup.-5 Scm-1 at 90 degrees C. An exemplary material can be characterized by a two domain or three domain material system. An exemplary material can include material components made of diblock polymers or triblock polymers. Many uses are contemplated for the solid polymer electrolyte materials. For example, the present invention can be applied to improve Li-based batteries by means of enabling higher energy density, better thermal and environmental stability, lower rates of self-discharge, enhanced safety, lower manufacturing costs, and novel form factors.

Fingerprinting and validation of a LC-DAD method for the analysis of biflavanones in Garcinia kola-based antimalarial improved traditional medicines.

Science.gov (United States)

Tshibangu, P Tshisekedi; Kapepula, P Mutwale; Kapinga, M J Kabongo; Lupona, H Kabika; Ngombe, N Kabamba; Kalenda, Dibungi T; Jansen, O; Wauters, J N; Tits, M; Angenot, L; Rozet, E; Hubert, Ph; Marini, R D; Frédérich, M

2016-09-05

African populations use traditional medicines in their initial attempt to treat a range of diseases. Nevertheless, accurate knowledge of the composition of these drugs remains a challenge in terms of ensuring the health of population and in order to advance towards improved traditional medicines (ITMs). In this paper chromatographic methods were developed for qualitative and quantitative analyses of a per os antimalarial ITM containing Garcinia kola. The identified analytical markers were used to establish TLC and HPLC fingerprints. G. kola seeds were analysed by HPLC to confirm the identity of the extract used by the Congolese manufacturer in the ITM. The main compounds (GB1, GB2, GB-1a and Kolaflavanone) were isolated by preparative TLC and identified by UPLC-MS and NMR. For the quantification of the major compound GB1, a simple and rapid experimental design was applied to develop an LC method, and then its validation was demonstrated using the total error strategy with the accuracy profile as a decision tool. The accurate results were observed within 0.14-0.45mg/mL range of GB1 expressed as naringenin. The extracts used in several batches of the analysed oral solutions contained GB1 (expressed as naringenin) within 2.04-2.43%. Both the fingerprints and the validated LC-DAD were found suitable for the quality control of G. kola-based raw material and finished products, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

Conservation of indigenous knowledge of medicinal plants of Western Himalayan region Rawalakot, Azad Kashmir, Pakistan.

Science.gov (United States)

Hussain, Sajjad; Murtaza, Ghulam; Mehmood, Ansar; Qureshi, Rizwana Aleem

2017-05-01

The aim of present was to document indigenous knowledge of medicinal plants traditionally used by inhabitants of Rawalakot Azad Kashmir and to screen selected medicinal plants for their antibacterial potential. Several field surveys were conducted to document indigenous knowledge of medicinal plants through interviews from local inhabitants during 2010-2013. During the study, 58 plant species, belonging to 37 families, were identified and their medicinal uses were recorded. Ethnobotanical data indicates that inhabitants of Rawalakot use medicinal plant mainly for the treatment of stomach, liver and sexual disorders. Usually fresh plant materials were used for medicinal preparations and administrated orally. Among all the species studied, three most frequently used medicinal plants Achillea millefolium, Berberis lycium and Zanthoxylum armatum were screened for their antibacterial potential by using disc diffusion method. The crude aqueous, petroleum ether and ethanolic extracts were found to be very active against selected bacterial strains. The present study contributes significantly to the medicinal plant knowledge and shows that medicinal plant knowledge is deteriorating among younger generations. Therefore, further research is needed to document indigenous knowledge, to find conservation status of medicinal plant species and to find antimicrobial compounds for more sophisticated usage of medicinal plants in future.

An ayurvedic formulation Sankat Mochan: A potent anthelmintic medicine

Directory of Open Access Journals (Sweden)

Khomendra Kumar Sarwa

2017-01-01

Full Text Available Aim and Object: Sankat Mochan is an ayurvedic formulation used in the urban and rural area of India. This polyherbal formulation is used for general stomach problems including abdominal cramping and diarrhea. The present investigation evaluated the anthelmintic activity of an aqueous solution of an ayurvedic medicine Sankat Mochan. Materials and Method: Various concentrations (1%, 5%, and 10% of medicine were used for anthelmintic activity on Pheretima posthuma. Piperazine citrate (10 mg/ml was used as a reference standard and distilled water as a control. Result and Conclusion: The result showed that the Sankat Mochan possess anthelmintic activity more potent than that of piperazine citrate. Thus, Sankat Mochan may be used as a potent anthelmintic agent against helminthiasis.

Functional dyspepsia: A new approach from traditional Persian medicine

Science.gov (United States)

Pasalar, Mehdi; Nimrouzi, Majid; Choopani, Rasool; Mosaddegh, Mahmoud; Kamalinejad, Mohammad; Mohagheghzadeh, Abdolali; Bagheri Lankarani, Kamran

2016-01-01

Objective: One of the most common global disorders is related to gastrointestinal system. Functional dyspepsia (FD) defined as upper abdominal pain and discomfort in the absence of organic ailments is a prevalent disease without any confirmed medication. The purpose of this study was to find gastric disorders which might be coincidental to FD based on traditional Persian medicine (TPM). Materials and Methods: We searched the main textbooks of TPM including Al-Havi (by Rhazes), Canon of medicine (by Avicenna), ZakhireKhawrazmshahi (by Ismail Jorjani), Moalijat-e Aghili and Makhzan Al-adviya (by Mohammad Hosein AghiliShirazi), and ExirAzam (by Hakim Azam Khan). Also, we searched Pubmed, Scopus, Science Direct, Medline, scientific information database (SID), Iranmedex and Google Scholar from 1980 to 1 August 2014 for dyspepsia, gastrointestinal disease, traditional Persian medicine, and gastric dystemperaments. Results: There is no equivalent term for FD in traditional Persian medicine although similar signs and symptoms are visible in terms like simple cold dystemperament of stomach, indigestion, and digestion debility in TPM sources. Some treatments mentioned in TPM have shown promising results in the current experimental tests. Conclusion: Finding these similarities in complementary and alternative medicine (CAM) textbooks may lead to discovering new remedies for this widespread disease. PMID:27222829

Functional dyspepsia: A new approach from traditional Persian medicine

Directory of Open Access Journals (Sweden)

Mehdi Pasalar

2016-03-01

Full Text Available Objective: One of the most common global disorders is related to gastrointestinal system. Functional dyspepsia (FD defined as upper abdominal pain and discomfort in the absence of organic ailments is a prevalent disease without any confirmed medication. The purpose of this study was to find gastric disorders which might be coincidental to FD based on traditional Persian medicine (TPM. Materials and Methods: We searched the main textbooks of TPM including Al-Havi (by Rhazes, Canon of medicine (by Avicenna, ZakhireKhawrazmshahi (by Ismail Jorjani, Moalijat-e Aghili and Makhzan Al-adviya (by Mohammad Hosein AghiliShirazi, and ExirAzam (by Hakim Azam Khan. Also, we searched Pubmed, Scopus, Science Direct, Medline, scientific information database (SID, Iranmedex and Google Scholar from 1980 to 1 August 2014 for dyspepsia, gastrointestinal disease, traditional Persian medicine, and gastric dystemperaments. Results: There is no equivalent term for FD in traditional Persian medicine although similar signs and symptoms are visible in terms like simple cold dystemperament of stomach, indigestion, and digestion debility in TPM sources. Some treatments mentioned in TPM have shown promising results in the current experimental tests. Conclusion: Finding these similarities in complementary and alternative medicine (CAM textbooks may lead to discovering new remedies for this widespread disease.

Large deformation analysis of adhesive by Eulerian method with new material model

International Nuclear Information System (INIS)

Maeda, K; Nishiguchi, K; Iwamoto, T; Okazawa, S

2010-01-01

The material model to describe large deformation of a pressure sensitive adhesive (PSA) is presented. A relationship between stress and strain of PSA includes viscoelasticity and rubber-elasticity. Therefore, we propose the material model for describing viscoelasticity and rubber-elasticity, and extend the presented material model to the rate form for three dimensional finite element analysis. After proposing the material model for PSA, we formulate the Eulerian method to simulate large deformation behavior. In the Eulerian calculation, the Piecewise Linear Interface Calculation (PLIC) method for capturing material surface is employed. By using PLIC method, we can impose dynamic and kinematic boundary conditions on captured material surface. The representative two computational examples are calculated to check validity of the present methods.

Ion beam treatment of polymers application aspects from medicine to space

CERN Document Server

Kondyurin, Alexey; McKenzie, David

2010-01-01

Polymer materials are used in different fields of industries, from microelectronice to medicine. Ion beam implantation is method of surface modification when surface properties must be significantly changed and bulk properties of material must be saved. Ion Beam Treatment of Polymers contains results of polymer investigations and techniques development in the field of polymer modification by high energy ion beams. This book is intended for specialists in polymer science who have interest to use an ion beam treatment for improvement of polymer properties, for specialists in physics who search

Application of neutron activation analysis method in leaves of Casearia obliqua medicinal plant

International Nuclear Information System (INIS)

Yamashita, Celina I.; Saiki, Mitiko; Sertie, Jaime A.A.

2005-01-01

The pharmacological properties of medicinal plants have been related to the presence of organic compounds, however elements are also known to have an important participation in the active compounds constitution process. In this study, instrumental neutron activation analysis (INAA) was applied to determine elements in leaves of Casearia obliqua medicinal plant collected at two different locations in the Atlantic Forest, Brazil, SP. Soil samples collected from where this plant was grown were also analyzed in order to verify if there is a correlation between the elements present in soils and plant leaves. Br, Ca, Cl, Co, Cr, Cs, Fe, K, La, Mn, Na, Rb, Sb, Sc and Zn were determined in C. obliqua leaves and the elements As, Ca, Ce, Eu, Fe, Hf, La, Lu, Nd, Rb, Sc, Sm, Tb, Th, U and Zn in soils. Soil samples collected from two different locations presented similar concentrations for most elements. Likewise, C. obliqua leaves collected from the two locations presented similar elemental contents. These results suggest that analysis of extracts from these leaf samples and the evaluation of their pharmacological activities should be carried out. Certified reference materials IAEA-Soil-7, USGS W-1, NIST 1573a Tomato Leaves and NIST 1515 Apple Leaves were analyzed and the quality of the obtained results was assured. (author)

Occupational medicine specialist referral triggers: Mixed-methods analysis of teleconsult cases.

Science.gov (United States)

Eaton, J L; Mohammad, A; Mohr, D C; Brustein, D J; Kirkhorn, S R

2017-12-30

Qualitative analyses can yield critical lessons for learning organizations in healthcare. Few studies have applied these techniques in the field of occupational and environmental medicine (OEM). To describe the characteristics of complex cases referred for OEM subspecialty evaluation and variation by referring provider's training. Using a mixed methods approach, we conducted a content analysis of clinical cases submitted to a national OEM teleconsult service. Consecutive cases entered between April 2014 and July 2015 were screened, coded and analysed. 108 cases were available for analysis. Local Veterans Health Administration (VHA) non-specialist providers entered a primary medical diagnosis in 96% of cases at the time of intake. OEM speciality physicians coded significant medical conditions based on free text comments. Coder inter-rater reliability was 84%. The most frequent medical diagnosis types associated with tertiary OEM referral by non-specialists were endocrine (19%), cardiovascular (18%) and mental health (16%). Concern for usage of controlled and/or sedating medications was cited in 1% of cases. Compared to referring non-specialists, OEM physicians were more likely to attribute case complexity to musculoskeletal (OR: 2.3, 1.68-3.14) or neurological (OR: 1.69, 1.28-2.24) conditions. Medication usage (OR: 2.2, 1.49-2.26) was more likely to be a source of clinical concern among referring providers. The findings highlight the range of triggers for OEM physician subspecialty referral in clinical practice with employee patients. The results of this study can be used to inform development of provider education, standardized clinical practice pathways, and quality review activities for occupational medicine practitioners. Published by Oxford University Press on behalf of The Society of Occupational Medicine 2017.

Homicides with corpse dismemberment in the material collected by the Department of Forensic Medicine, Krakow, Poland.

Science.gov (United States)

Konopka, Tomasz; Bolechała, Filip; Strona, Marcin; Kopacz, Paweł

2016-01-01

Aim of the study: To determine the circumstances which can be useful for offenders profiling in homicide cases with victim's body dismemberment. Material and methods: Study of all homicide cases with victim's corpse dismemberment examined in Krakow Department of Forensic Medicine over the last 50 years. Results: Within the past 50 years, a total number of 30 cases of homicides with dismembered bodies were examined in Krakow. 22 cases represent defensive mutilations performed by offender, 3 cases can be classified as offensive muti-lations and 3 cases represent aggressive mutilations - decapitation as a method of committing homicide. In this period the only 1 case of necrophilic mutilations was examined, when the body was dismembered without murder. In most cases the background of homicide was the family conflict, 6 was cause of mental illness of perpetrator and in 3 was sexual motive. Only in 3 cases (from 25 when the offender was known) perpetrator kill a stranger. In the other the offender belonged to the family or friends of the victim. In all cases where the perpetrator was determined, homicide and dismemberment was performed in his place of residence. The findings of the Police investigations indicate that in most cases homicides were not planned, occurred under the influence of emotion, only two have been previously scheduled. Conclusions: Homicides with corpses dismemberment usually are committed by offenders who is in close relationship with victim (family or friend). Dismemberment is almost always performed in the same place as murder - home of perpetrator. This type of homicide usually is not planned.

Computational methods for 2D materials: discovery, property characterization, and application design.

Science.gov (United States)

Paul, J T; Singh, A K; Dong, Z; Zhuang, H; Revard, B C; Rijal, B; Ashton, M; Linscheid, A; Blonsky, M; Gluhovic, D; Guo, J; Hennig, R G

2017-11-29

The discovery of two-dimensional (2D) materials comes at a time when computational methods are mature and can predict novel 2D materials, characterize their properties, and guide the design of 2D materials for applications. This article reviews the recent progress in computational approaches for 2D materials research. We discuss the computational techniques and provide an overview of the ongoing research in the field. We begin with an overview of known 2D materials, common computational methods, and available cyber infrastructures. We then move onto the discovery of novel 2D materials, discussing the stability criteria for 2D materials, computational methods for structure prediction, and interactions of monolayers with electrochemical and gaseous environments. Next, we describe the computational characterization of the 2D materials' electronic, optical, magnetic, and superconducting properties and the response of the properties under applied mechanical strain and electrical fields. From there, we move on to discuss the structure and properties of defects in 2D materials, and describe methods for 2D materials device simulations. We conclude by providing an outlook on the needs and challenges for future developments in the field of computational research for 2D materials.

Investigating the effect of K-characteristic radiation on the performance of nuclear medicine scintillators by Monte Carlo methods

International Nuclear Information System (INIS)

Liaparinos, Panagiotis; Kandarakis, Ioannis; Cavouras, Dionisis; Delis, Harry; Panayiotakis, George

2006-01-01

The aim of this study was to evaluate the effect of K-characteristic radiation on the performance of scintillator crystals incorporated in nuclear medicine detectors (LSO, BGO, GSO). K-characteristic radiation is produced within materials of at least one high atomic number element (e.g. Lu, Gd, Bi). This radiation may either be reabsorbed or it may escape the scintillator. In both cases the light emission efficiency of the scintillator may be affected resulting in either spatial or energy resolution degradation. A computational program, based on Monte Carlo methods, was developed in order to simulate the transport of K-characteristic radiation within the most commonly used scintillator materials. Crystal thickness was allowed to vary from 0.5 up to 15 mm. A monoenergetic pencil beam, with energy varying from 0.60 to 0.511 MeV was considered to fall on the center of the crystal surface. The dominant γ-ray interactions (elastic and inelastic scattering and photoelectric absorption) were taken into account in the simulation. Results showed that, depending on crystal thickness, incident photon energy and scintillator's intrinsic properties (L or K-fluorescence yield, effective atomic number and density), the scintillator's emission efficiency may be significantly reduced and affect spatial or energy resolution

[Methods of traditional chinese medicine in the treatment of patients with interstitial cystitis/bladder pain syndrome].

Science.gov (United States)

Ignashov, A Yu; Deng, B; Kuzmin, I V; Slesarevskaya, M N

2018-03-01

In recent years, there has been an increasing interest in alternative (complementary) treatments of interstitial cystitis/bladder pain syndrome (IC/BPS). This is due both to the high incidence of IC/BPS and to a lack of effectiveness of conventional treatments. One of the directions of alternative therapies is a traditional Chinese medicine using a special diet, various animal and plant-derived medicines, breathing exercises and acupuncture. This review analyzes the accumulated experience in using traditional Chinese medicine in the treatment of patients with IC/BPS. The presented data indicate that these methods appear to be promising, since they are effective in a significant number of patients, lead to an improvement in their quality of life, are non-invasive and well tolerated. However, due to the lack of clinical studies, the efficacy of this treatment modalities needs to be confirmed.

System and Method for Monitoring Piezoelectric Material Performance

Science.gov (United States)

Moses, Robert W. (Inventor); Fox, Christopher L. (Inventor); Fox, Melanie L. (Inventor); Chattin, Richard L. (Inventor); Shams, Qamar A. (Inventor); Fox, Robert L. (Inventor)

2007-01-01

A system and method are provided for monitoring performance capacity of a piezoelectric material that may form part of an actuator or sensor device. A switch is used to selectively electrically couple an inductor to the piezoelectric material to form an inductor-capacitor circuit. Resonance is induced in the inductor-capacitor circuit when the switch is operated to create the circuit. The resonance of the inductor-capacitor circuit is monitored with the frequency of the resonance being indicative of performance capacity of the device's piezoelectric material.

Recovering method for high level radioactive material

International Nuclear Information System (INIS)

Fukui, Toshiki

1998-01-01

Offgas filters such as of nuclear fuel reprocessing facilities and waste control facilities are burnt, and the burnt ash is melted by heating, and then the molten ashes are brought into contact with a molten metal having a low boiling point to transfer the high level radioactive materials in the molten ash to the molten metal. Then, only the molten metal is evaporated and solidified by drying, and residual high level radioactive materials are recovered. According to this method, the high level radioactive materials in the molten ashes are transferred to the molten metal and separated by the difference of the distribution rate of the molten ash and the molten metal. Subsequently, the molten metal to which the high level radioactive materials are transferred is heated to a temperature higher than the boiling point so that only the molten metal is evaporated and dried to be removed, and residual high level radioactive materials are recovered easily. On the other hand, the molten ash from which the high level radioactive material is removed can be discarded as ordinary industrial wastes as they are. (T.M.)

[Study on pharmacologic action characteristics of traditional Chinese medicines distributed along liver meridian based on medicinal properties combinations].

Science.gov (United States)

Guo, Hong-Ling; Gu, Hao; Wang, Yun; Qiao, Yan-Jiang

2014-07-01

To establish a characterization system of traditional Chinese medicinal properties in line with modern scientific cognition regularity, in order to reveal properties of traditional Chinese medicines distributed along liver meridian and relations of effects of medicinal properties. By collecting data about traditional Chinese medicinal properties recorded in the Pharmacopoeia of the People's Republic of China (2005 Edition), literature and data about pharmacological effects of traditional Chinese medicines recorded in the Chinese Materia Medica, by using the method of association rules, the authors dug pharmacological effect rules corresponds to relevant medicinal property combinations, with the medicinal property combination of traditional Chinese medicines distributed along liver meridian as the target. It was found that either obvious different pharmacological effects or identical pharmacological characteristics existed in traditional Chinese medicines distributed along liver meridian. With the aim to explore the correlations between traditional Chinese medicine medicinal properties and pharmacological effects, the authors linked the traditional Chinese medicine theory with modern research achievements, in order to provide the ideas and methods for interpreting mechanisms of medicinal properties.

Method of sintering ceramic materials

Science.gov (United States)

Holcombe, Cressie E.; Dykes, Norman L.

1992-01-01

A method for sintering ceramic materials is described. A ceramic article is coated with layers of protective coatings such as boron nitride, graphite foil, and niobium. The coated ceramic article is embedded in a container containing refractory metal oxide granules and placed within a microwave oven. The ceramic article is heated by microwave energy to a temperature sufficient to sinter the ceramic article to form a densified ceramic article having a density equal to or greater than 90% of theoretical density.

46 CFR 50.20-30 - Alternative materials or methods of construction.

Science.gov (United States)

2010-10-01

... 46 Shipping 2 2010-10-01 2010-10-01 false Alternative materials or methods of construction. 50.20... ENGINEERING GENERAL PROVISIONS Plan Submittal and Approval § 50.20-30 Alternative materials or methods of construction. (a) When new or alternative procedures, designs, or methods of construction are submitted for...

ELECTROKINETIC DEVICE AND METHOD FOR CONSOLIDATING POROUS MATERIALS

DEFF Research Database (Denmark)

2017-01-01

The invention relates to a device and an associated electrokinetic method which allows the pores (superficial and deep) of a porous material to be filled, by forcing the precipitation therein of a product of low solubility in water by creating an electric field which will mobilise the cations...... and anions supplied by previously selected solutions. This method comprises two phases. In the first phase, the pores located at a specified distance from the surface of contact between the porous material and the anodic or cathodic compartment are plugged. In a second phase, the rest of the pores, mainly...... those which are on the surface level, are collapsed. As a result of the designed device and the plugging system contained therein, the porous material is not affected at any moment by chemical alteration processes caused by contact with extreme pH values. This device allows the treatment to be applied...

5. International conference on materials science and condensed matter physics and symposium 'Electrical methods of materials treatment'. Abstracts

International Nuclear Information System (INIS)

2010-09-01

This book includes abstracts of the communications presented at the 5th International Conference on Materials Science and Condensed-Matter Physics and at the Symposium dedicated to the 100th anniversary of academician Boris Lazarenko, the prominent scientist and inventor, the first director of the Institute of Applied Physics of the Academy of Sciences of Moldova. The abstracts presented in the book cover a vast range of subjects, such as: advanced materials and fabrication processes; methods of crystal growth, post-growth technological processes, doping and implantation, fabrication of solid state structures; defect engineering, engineering of molecular assembly; methods of nanostructures and nano materials fabrication and characterization; quantum wells and superlattices; nano composite, nanowires and nano dots; fullerenes and nano tubes, molecular materials, meso- and nano electronics; methods of material and structure characterization; structure and mechanical characterization; optical, electrical, magnetic and superconductor properties, transport processes, nonlinear phenomena, size and interface effects; advances in condensed matter theory; theory of low dimensional systems; modelling of materials and structure properties; development of theoretical methods of solid-state characterization; phase transition; advanced quantum physics for nano systems; device modelling and simulation, device structures and elements; micro- and optoelectronics; photonics; microsensors and micro electro-mechanical systems; microsystems; degradation and reliability, solid-state device design; theory and advanced technologies of electro-physico-chemical and combined methods of materials machining and treatment, including modification of surfaces; theory and advanced technologies of using electric fields, currents and discharges so as to intensify heat mass-transfer, to raise the efficiency of treatment of materials, of biological preparations and foodstuff; modern equipment for

Methods of using structures including catalytic materials disposed within porous zeolite materials to synthesize hydrocarbons

Science.gov (United States)

Rollins, Harry W [Idaho Falls, ID; Petkovic, Lucia M [Idaho Falls, ID; Ginosar, Daniel M [Idaho Falls, ID

2011-02-01

Catalytic structures include a catalytic material disposed within a zeolite material. The catalytic material may be capable of catalyzing a formation of methanol from carbon monoxide and/or carbon dioxide, and the zeolite material may be capable of catalyzing a formation of hydrocarbon molecules from methanol. The catalytic material may include copper and zinc oxide. The zeolite material may include a first plurality of pores substantially defined by a crystal structure of the zeolite material and a second plurality of pores dispersed throughout the zeolite material. Systems for synthesizing hydrocarbon molecules also include catalytic structures. Methods for synthesizing hydrocarbon molecules include contacting hydrogen and at least one of carbon monoxide and carbon dioxide with such catalytic structures. Catalytic structures are fabricated by forming a zeolite material at least partially around a template structure, removing the template structure, and introducing a catalytic material into the zeolite material.

Comparison of a Material Point Method and a Galerkin Meshfree Method for the Simulation of Cohesive-Frictional Materials

Directory of Open Access Journals (Sweden)

Ilaria Iaconeta

2017-09-01

Full Text Available The simulation of large deformation problems, involving complex history-dependent constitutive laws, is of paramount importance in several engineering fields. Particular attention has to be paid to the choice of a suitable numerical technique such that reliable results can be obtained. In this paper, a Material Point Method (MPM and a Galerkin Meshfree Method (GMM are presented and verified against classical benchmarks in solid mechanics. The aim is to demonstrate the good behavior of the methods in the simulation of cohesive-frictional materials, both in static and dynamic regimes and in problems dealing with large deformations. The vast majority of MPM techniques in the literatrue are based on some sort of explicit time integration. The techniques proposed in the current work, on the contrary, are based on implicit approaches, which can also be easily adapted to the simulation of static cases. The two methods are presented so as to highlight the similarities to rather than the differences from “standard” Updated Lagrangian (UL approaches commonly employed by the Finite Elements (FE community. Although both methods are able to give a good prediction, it is observed that, under very large deformation of the medium, GMM lacks robustness due to its meshfree natrue, which makes the definition of the meshless shape functions more difficult and expensive than in MPM. On the other hand, the mesh-based MPM is demonstrated to be more robust and reliable for extremely large deformation cases.

Array-based techniques for fingerprinting medicinal herbs

Directory of Open Access Journals (Sweden)

Xue Charlie

2011-05-01

Full Text Available Abstract Poor quality control of medicinal herbs has led to instances of toxicity, poisoning and even deaths. The fundamental step in quality control of herbal medicine is accurate identification of herbs. Array-based techniques have recently been adapted to authenticate or identify herbal plants. This article reviews the current array-based techniques, eg oligonucleotides microarrays, gene-based probe microarrays, Suppression Subtractive Hybridization (SSH-based arrays, Diversity Array Technology (DArT and Subtracted Diversity Array (SDA. We further compare these techniques according to important parameters such as markers, polymorphism rates, restriction enzymes and sample type. The applicability of the array-based methods for fingerprinting depends on the availability of genomics and genetics of the species to be fingerprinted. For the species with few genome sequence information but high polymorphism rates, SDA techniques are particularly recommended because they require less labour and lower material cost.

Social medicine then and now: lessons from Latin America.

Science.gov (United States)

Waitzkin, H; Iriart, C; Estrada, A; Lamadrid, S

2001-10-01

The accomplishments of Latin American social medicine remain little known in the English-speaking world. In Latin America, social medicine differs from public health in its definitions of populations and social institutions, its dialectic vision of "health-illness," and its stance on causal inference. A "golden age" occurred during the 1930s, when Salvador Allende, a pathologist and future president of Chile, played a key role. Later influences included the Cuban revolution, the failed peaceful transition to socialism in Chile, the Nicaraguan revolution, liberation theology, and empowerment strategies in education. Most of the leaders of Latin American social medicine have experienced political repression, partly because they have tried to combine theory and political practice--a combination known as "praxis." Theoretic debates in social medicine take their bearings from historical materialism and recent trends in European philosophy. Methodologically, differing historical, quantitative, and qualitative approaches aim to avoid perceived problems of positivism and reductionism in traditional public health and clinical methods. Key themes emphasize the effects of broad social policies on health and health care; the social determinants of illness and death; the relationships between work, reproduction, and the environment; and the impact of violence and trauma.

Effects and treatment methods of acupuncture and herbal medicine for premenstrual syndrome/premenstrual dysphoric disorder: systematic review

Science.gov (United States)

2014-01-01

Background During their reproductive years about 10% of women experience some kind of symptoms before menstruation (PMS) in a degree that affects their quality of life (QOL). Acupuncture and herbal medicine has been a recent favorable therapeutic approach. Thus we aimed to review the effects of acupuncture and herbal medicine in the past decade as a preceding research in order to further investigate the most effective Korean Medicine treatment for PMS/PMDD. Methods A systematic literature search was conducted using electronic databases on studies published between 2002 and 2012. Our review included randomized controlled clinical trials (RCTs) of acupuncture and herbal medicine for PMS/PMDD. Interventions include acupuncture or herbal medicine. Clinical information including statistical tests was extracted from the articles and summarized in tabular form or in the text. Study outcomes were presented as the rate of improvement (%) and/or end-of-treatment scores. Results The search yielded 19 studies. In screening the RCTs, 8 studies in acupuncture and 11 studies in herbal medicine that matched the criteria were identified. Different acupuncture techniques including traditional acupuncture, hand acupuncture and moxibustion, and traditional acupuncture technique with auricular points, have been selected for analysis. In herbal medicine, studies on Vitex Agnus castus, Hypericum perforatum, Xiao yao san, Elsholtzia splendens, Cirsium japonicum, and Gingko biloba L. were identified. Experimental groups with Acupuncture and herbal medicine treatment (all herbal medicine except Cirsium japonicum) had significantly improved results regarding PMS/PMDD. Conclusions Limited evidence supports the efficacy of alternative medicinal interventions such as acupuncture and herbal medicine in controlling premenstrual syndrome and premenstrual dysphoric disorder. Acupuncture and herbal medicine treatments for premenstrual syndrome and premenstrual dysphoric disorder showed a 50% or

Mesopotamian medicine.

Science.gov (United States)

Retief, F P; Cilliers, L

2007-01-01

Although the Mesopotamian civilisation is as old as that of Egypt and might even have predated it, we know much less about Mesopotamian medicine, mainly because the cuneiform source material is less well researched. Medical healers existed from the middle of the 3rd millennium. In line with the strong theocratic state culture, healers were closely integrated with the powerful priestly fraternity, and were essentially of three main kinds: barû (seers) who were experts in divination, âshipu (exorcists), and asû (healing priests) who tended directly to the sick. All illness was accepted as sent by gods, demons and other evil spirits, either as retribution for sins or as malevolent visitations. Treatment revolved around identification of the offending supernatural power, appeasement of the angry gods, for example by offering amulets or incantations, exorcism of evil spirits, as well as a measure of empirical therapy aimed against certain recognised symptom complexes. Medical practice was rigidly codified, starting with Hammurabi's Code in the 18th century BC and persisting to the late 1st millennium BC. Works like the so-called Diagnostic Handbook, the Assyrian Herbal and Prescription Texts describe the rationale of Mesopotamian medicine, based predominantly on supernatural concepts, although rudimentary traces of empirical medicine are discernible. There is evidence that Egyptian medicine might have been influenced by Mesopotamian practices, but Greek rational medicine as it evolved in the 5th/4th centuries BC almost certainly had no significant Mesopotamian roots.

Attributes identification of nuclear material by non-destructive radiation measurement methods

International Nuclear Information System (INIS)

Gan Lin

2002-01-01

Full text: The nuclear materials should be controlled under the regulation of National Safeguard System. The non-destructive analysis method, which is simple and quick, provide a effective process in determining the nuclear materials, nuclear scraps and wastes. The method play a very important role in the fields of nuclear material control and physical protection against the illegal removal and smuggling of nuclear material. The application of non-destructive analysis in attributes identification of nuclear material is briefly described in this paper. The attributes determined by radioactive detection technique are useful tolls to identify the characterization of special nuclear material (isotopic composition, enrichment etc.). (author)

A simplified but effective method for the quality control of medicinal plants by planar chromatography.

Science.gov (United States)

Eloff, J N; Ntloedibe, D T; van Brummelen, R

2011-01-01

Three of the factors limiting the rational use of herbal medicine are uncertainty on effectivity, uncertainty on safety and variation in quality of the product. Because many herbal medicines have been used over centuries by indigenous peoples, the safety and effectivity is frequently not such a big concern. With more people collecting and distributing herbal medicine, the offered product is however, frequently not what the label indicates either through a genuine mistake, but also through fraud especially where expensive herbal medicine is concerned. Some wrong identifications have already led to serious side effects and deaths. Planar chromatography or thin layer chromatography [TLC] is widely used to verify the identity of plant extracts by determining the chemical fingerprint of the extracts. In a leading publication 17 different extractants, 41 solvent systems and 44 spray reagents have been used to verify the identity of important herbal preparations. We investigated whether a simplified system could not be developed to aid small laboratories in identifying different herbal medicines. We compared the efficacy of different extractants, identified and developed three TLC solvent systems that would separate compounds with low, medium and high polarity and then also investigated the use of several spray reagents. With acetone as extractant and benzene:ethanol:ammonia [9:1:0.1], chloroform:ethylacetate:formic acid [5:4:1] and ethylacetate:methanol:water [10:1.35:1] as TLC solvent system and vanillin-sulphuric acid as spray reagent the identity of 81 samples of more than 50 herbal preparations could be verified on the basis of the chromatograms. The same product from different suppliers usually gave similar chromatograms. More importantly in several cases it was clear that products with the same label were so different that a mistake must have occurred in the labelling. This method has found application in the quality control of the most important African medicinal

Standard Test Method for Contamination Outgassing Characteristics of Spacecraft Materials

CERN Document Server

American Society for Testing and Materials. Philadelphia

2009-01-01

1.1 This test method covers a technique for generating data to characterize the kinetics of the release of outgassing products from materials. This technique will determine both the total mass flux evolved by a material when exposed to a vacuum environment and the deposition of this flux on surfaces held at various specified temperatures. 1.2 This test method describes the test apparatus and related operating procedures for evaluating the total mass flux that is evolved from a material being subjected to temperatures that are between 298 and 398 K. Pressures external to the sample effusion cell are less than 7 × 10−3 Pa (5 × 10−5 torr). Deposition rates are measured during material outgassing tests. A test procedure for collecting data and a test method for processing and presenting the collected data are included. 1.3 This test method can be used to produce the data necessary to support mathematical models used for the prediction of molecular contaminant generation, migration, and deposition. 1.4 Al...

Method of tissue repair using a composite material

Energy Technology Data Exchange (ETDEWEB)

Hutchens, Stacy A.; Woodward, Jonathan; Evans, Barbara R.; O' Neill, Hugh M.

2016-03-01

A composite biocompatible hydrogel material includes a porous polymer matrix, the polymer matrix including a plurality of pores and providing a Young's modulus of at least 10 GPa. A calcium comprising salt is disposed in at least some of the pores. The porous polymer matrix can comprise cellulose, including bacterial cellulose. The composite can be used as a bone graft material. A method of tissue repair within the body of animals includes the steps of providing a composite biocompatible hydrogel material including a porous polymer matrix, the polymer matrix including a plurality of pores and providing a Young's modulus of at least 10 GPa, and inserting the hydrogel material into cartilage or bone tissue of an animal, wherein the hydrogel material supports cell colonization in vitro for autologous cell seeding.

Method of tissue repair using a composite material

Science.gov (United States)

Hutchens, Stacy A; Woodward, Jonathan; Evans, Barbara R; O'Neill, Hugh M

2014-03-18

A composite biocompatible hydrogel material includes a porous polymer matrix, the polymer matrix including a plurality of pores and providing a Young's modulus of at least 10 GPa. A calcium comprising salt is disposed in at least some of the pores. The porous polymer matrix can comprise cellulose, including bacterial cellulose. The composite can be used as a bone graft material. A method of tissue repair within the body of animals includes the steps of providing a composite biocompatible hydrogel material including a porous polymer matrix, the polymer matrix including a plurality of pores and providing a Young's modulus of at least 10 GPa, and inserting the hydrogel material into cartilage or bone tissue of an animal, wherein the hydrogel material supports cell colonization in vitro for autologous cell seeding.

Investigation of the Material Basis Underlying the Correlation between Presbycusis and Kidney Deficiency in Traditional Chinese Medicine via GC/MS Metabolomics

Directory of Open Access Journals (Sweden)

Yang Dong

2013-01-01

Full Text Available Objective. To investigate the correlation between presbycusis and kidney deficiency as defined by traditional Chinese medicine (TCM and its material basis from the perspective of metabolism. Methods. Pure-tone audiometry was used to test auditory function. A kidney deficiency symptom scoring table was used to measure the kidney deficiency accumulated scores of the research subjects. Gas chromatography/mass spectrometry (GC/MS was used to measure the metabolites in the urine samples from 11 presbycusis patients and 9 elderly people with normal hearing. Results. Hearing loss in the elderly was positively correlated with kidney deficiency score in TCM. There were significant differences in urine metabolite profile between the presbycusis patients and the controls. A total of 23 differentially expressed metabolites were found. Kyoto Encyclopedia of Genes and Genomes (KEGG pathway analysis showed that these metabolites were related to glutathione metabolism, amino acid metabolism, glucose metabolism, the N-methyl-D-aspartic acid (NMDA receptor pathway, and the γ-aminobutyric acid (GABA receptor pathway. Conclusion. Glutathione metabolism, amino acid metabolism, glucose metabolism, NMDA receptors, and GABA receptors may be related to the pathogenesis of presbycusis and may be the material basis underlying the correlation between presbycusis and kidney deficiency in TCM.

Investigation of the Material Basis Underlying the Correlation between Presbycusis and Kidney Deficiency in Traditional Chinese Medicine via GC/MS Metabolomics

Science.gov (United States)

Dong, Yang; Liu, Pu-Zhao; Song, Hai-Yan; Zhao, Yu-Ping; Li, Ming; Shi, Jian-Rong

2013-01-01

Objective. To investigate the correlation between presbycusis and kidney deficiency as defined by traditional Chinese medicine (TCM) and its material basis from the perspective of metabolism. Methods. Pure-tone audiometry was used to test auditory function. A kidney deficiency symptom scoring table was used to measure the kidney deficiency accumulated scores of the research subjects. Gas chromatography/mass spectrometry (GC/MS) was used to measure the metabolites in the urine samples from 11 presbycusis patients and 9 elderly people with normal hearing. Results. Hearing loss in the elderly was positively correlated with kidney deficiency score in TCM. There were significant differences in urine metabolite profile between the presbycusis patients and the controls. A total of 23 differentially expressed metabolites were found. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis showed that these metabolites were related to glutathione metabolism, amino acid metabolism, glucose metabolism, the N-methyl-D-aspartic acid (NMDA) receptor pathway, and the γ-aminobutyric acid (GABA) receptor pathway. Conclusion. Glutathione metabolism, amino acid metabolism, glucose metabolism, NMDA receptors, and GABA receptors may be related to the pathogenesis of presbycusis and may be the material basis underlying the correlation between presbycusis and kidney deficiency in TCM. PMID:24371466

Comparison of methods for controlling dental caries in the classical medicine and alternative medical practices and future prospects

Directory of Open Access Journals (Sweden)

Rabbani Khorasgani Mohammad

2015-07-01

Full Text Available Dental caries is a multi-factorial disease and the most common human infection that annually are spent millions dollars to control and treat it. Several methods have been proposed so far to control it. The most important control methods it is now include : dental hygiene, proper nutrition , fluoride therapy , the use of non- cariogenic sweeteners . Also, the use of probiotics , nanomaterials , bacteriophages , antimicrobial peptides and anti- caries vaccines can be considered as new perspective of human in the dental caries control field. In addition, the use of complementary and alternative therapies , especially herbal drug therapy recently has been considered . Demonstrating the efficacy of complementary medicine against dental caries and its use in combination with conventional medicine or trial of new methods for decline of dental caries in the future would be hopeful.

Medicinal importance, pharmacological activities, and analytical aspects of hispidulin: A concise report

Directory of Open Access Journals (Sweden)

Kanika Patel

2017-07-01

Full Text Available Herbal medicines have been played an important role in the human civilization since very ancient time as a food, cloth, medicine and other aspects. Some of the important drugs in the modern medicine were derived from the natural sources such as aspirin, digitalis, quinine, vincristine, vinblastine etc. Hispidulin (4′, 5, 7-trihydroxy-6-methoxyflavone is a flavones derivative found in plant such as Grindelia argentina, Arrabidaea chica, Saussurea involucrate, Crossostephium chinense, Artemisia and Salvia species. Hispidulin have antioxidant, antifungal, anti-inflammatory, antimutagenic, and antineoplastic properties. So far, various analytical methods have been investigated and developed for detection of hispidulin in the plant materials. Productions of hispidulin through different tissue culture techniques have been also investigated. Present review summarized medicinal uses, pharmacological activities and analytical aspects of hispidulin. From the above mentioned aspects, we can conclude that, this review will be helpful to the researcher in the field of natural product for the development of novel molecule for the treatment of different disorders.

Physics and radiobiology of nuclear medicine

CERN Document Server

Saha, Gopal B

2010-01-01

From a distinguished author comes this new edition for technologists, practitioners, residents, and students in radiology and nuclear medicine. Encompassing major topics in nuclear medicine from the basic physics of radioactive decay to instrumentation and radiobiology, it is an ideal review for Board and Registry examinations. The material is well organized and written with clarity. The book is supplemented with tables and illustrations throughout. It provides a quick reference book that is concise but comprehensive, and offers a complete discussion of topics for the nuclear medicine and radi

[Study on meridian tropism of medicinal property theory for Chines medicines by supramolecular chemistry (I)].

Science.gov (United States)

He, Fu-yuan; Deng, Kai-wen; Yang, Yan-tao; Zhou, Yi-qun; Shi, Ji-lian; Liu, Wen-long; Tang, Yu

2015-04-01

In this paper, based on the special influence of supramolecular chemistry on the basic theory of Chinese medicines ( CM) , the authors further analyzed the history of meridian tropism and natural origins of CM organisms and explained CM ingredients and the universal regularity of the automatic action of the supramolecular "imprinting templates" hole channel structure. After entering human bodies, CMs, as the aggregation of supramolecular "imprinting templates" , automatically seek supramolecular subjects that are matched with their "imprinting templates" in human meridians and organs for the purpose of self-recognition, self-organization, self-assembly and self-replication, so as to generate specific efficacy in meridians and organs, which is reflected as the meridian tropism phenomena at macro level. This regularity can be studied by in vitro and in vivo experimental studies. In vitro methods are mostly supra molecular structure analysis and kinetic and thermodynamic parameter calculation; Whereas in vivo methods are dominated by the analysis on object component distribution, chromatopharmacodynamic parameters and network chromatopharmacodynamic parameters; Particularly, the acupoint-medicine method can simplify to study the supramolecular subject-object relations. Consequently, CM's'meridian tropism reveals the universal regularity for interactions of macromolecular and micromolecular "imprinting templates" of subjects and objects in natural organisms. As the first barrier for the material base of the CM theory and breakthrough in the modernization of the basic CM theory, meridian tropism plays an important role in studies on basic theories of the basic CM theory.

medicinal plant use of villagers in the mopani district, limpopo ...

African Journals Online (AJOL)

Alinah Chauke

These studies may guide the regulation of herbal medicine industry in South. Africa. Key words: Ethnobotanical, Medicinal plants, Mashishimale village. Introduction. Reviews of literature involving research of medicinal plants suggest that scientists follow more or less the same general strategy to investigate plant materials ...

A multi points ultrasonic detection method for material flow of belt conveyor

Science.gov (United States)

Zhang, Li; He, Rongjun

2018-03-01

For big detection error of single point ultrasonic ranging technology used in material flow detection of belt conveyor when coal distributes unevenly or is large, a material flow detection method of belt conveyor is designed based on multi points ultrasonic counter ranging technology. The method can calculate approximate sectional area of material by locating multi points on surfaces of material and belt, in order to get material flow according to running speed of belt conveyor. The test results show that the method has smaller detection error than single point ultrasonic ranging technology under the condition of big coal with uneven distribution.

Method of treatment in a system passing radioactive material

Energy Technology Data Exchange (ETDEWEB)

Kamiya, K; Kinoshita, M; Asakura, Y

1976-05-14

A method to ensure the safety of the reactor and reduce radiation exposure dose by preventing oxygen hydrogen reaction of the reactor off-gas and accumulation of the radioactive material is described. Substances which are accumulated in an off-gas duct and are likely to capture radioactive material (for instance Pd catalyst falling from a recombiner) is changed into a stable material (for instance, PdI/sub 2/) which is hot likely to capture radioactive material through reaction with a stabilizer (for instance, I/sub 2/, Cl/sub 2/, HCl, etc.). This stabilized material is washed off the atomic power plant system.

Discriminant method for the optimization of radionuclide activity in studies of nuclear medicine

International Nuclear Information System (INIS)

Perez Diaz, Marlen

2003-01-01

It is presented a method for the optimization of the radionuclidic activity to administer to mature patients in studies of Nuclear Medicine. The method is based in technical of discriminant analysis to build a function that discriminates groups with image quality differed on the base of physical parameters as they are the contrast image and the aleatory noise. The image quality is the dependent variable and it is selected by means of experts' evaluation and technical of clustering. The function is a lineal combination of a reduced group of variables physical-medical, able to discriminate the groups starting from a big group of variables measures. The method allows, also, to establish the relative weight of each discriminant variable selected . The behavior of the same ones is analyzed among studies carried out with different administered activity, with the objective of determining the minimum value of this that still allows good results in the image quality (Approach of activity optimization). It is validated the method by means of results comparison with the grateful Curved ROC in studies carried out with the Mannequins of Jaszczak (for planar studies) and of Insert Heart (for studies of SPECT). The optim activity value of the 99mTc, obtained with the application of the method, was coincident with the one obtained after the application of the method ROC to 6 expert observers as much in planar studies as in SPECT for two different cameras gamma. The method was applied later on in static, dynamic studies and of SPECT carried out with camera gamma to a mature population of 210 patient. The decisive variables of the quality of the image were obtained in the nuclear venticulography in rest, the bony gammagraphy, the nuclear renogram, the renal gammagraphy and the cerebral SPECT, as well as some activity values optimized for the equipment conditions and available radiopharmac in the country, allowing to establish a better commitment relationship between image quality

Determination of crystallinity of ceramic materials from the Ruland Method

International Nuclear Information System (INIS)

Kniess, C.T.; Prates, P.B.; Gomes Junior, J.C.; Lima, J.C. de; Riella, H.G.; Kuhnen, N.C.

2011-01-01

Some methods found in literature approach the different characteristics between crystalline and amorphous phases by X ray diffraction technique. These methods use the relation between the intensities of the crystalline peaks and background amorphous or the absolute intensity of one of these to determine the relative amount of crystalline and amorphous material. However, a crystalline substance presents shows coherent diffuse scattering and a loss in the intensity of the peaks of diffraction in function of thermal vibrations of atoms and imperfections in the crystalline structure. A correct method for the determination of the crystallinity must take in account these effects. This work has as objective to determine the crystallinity of ceramic materials obtained with the addition of mineral coal bottom ashes, using the X ray diffraction technique and the Ruland Method, that considers the diminution of the intensity of the crystalline peak because of the disorder affects. The Ruland Method shows adequate for the determination of the crystallinity of the ceramic materials. (author)

Use of Thermoanalytic Methods in the Evaluation of Combusted Materials

Directory of Open Access Journals (Sweden)

František Krepelka

2006-12-01

Full Text Available The paper describes possibilities of using thermoanalytic methods for the evaluation and comparison of materials designed for a direct combustion. Differential thermal analysis (DTA and thermogravimetric analysis (TGA were both used in the evaluation. The paper includes a description of methods of data processing from analyses for the purposes of comparison of used materials regarding their heating values. The following materials were analysed in the experiments: wooden coal of objectional grain size, fly ash from heating plant exhaust funnels, dendromass waste: spruce sawdust, micro-briquettes of spruce sawdust and fly-ash combined.

[Materials/Biomaterials in Clinical Practice - a Short Review and Current Trends].

Science.gov (United States)

Bolle, T; Meyer, F; Walcher, F; Lohmann, C; Jockenhövel, S; Gries, T; Hoffmann, W

2017-04-01

Biomaterials play a major role in interventional medicine and surgery. However, the development of biomaterials is still in its early phases in spite of the huge progress made within the last decades. On the one hand, this is because our knowledge of the molecular and cellular processes associated with biomaterials is still increasing exponentially. On the other hand, a wide variety of advanced materials with highly interesting properties is being developed currently. This review provides a short introduction into the variety of materials in use as well as their application in interventional medicine and surgery. Also the importance of biomaterials for tissue engineering in the field of regenerative medicine and the functionalisation of biomaterials, including sterilisation methods are discussed. For the future, an even broader interdisciplinary scientific collaboration is necessary in order to develop novel biomaterials and facilitate their translation into clinical practice. Georg Thieme Verlag KG Stuttgart · New York.

Nuclear medicine

International Nuclear Information System (INIS)

Reichelt, H.G.

1980-01-01

Nuclear medicine as a complex diagnostical method is used mainly to detect functional organic disorders, to locate disorders and for radioimmunologic assays (RIA) in vitro. In surgery, its indication range comprises the thyroid (in vivo and in vitro), liver and bile ducts, skeletal and joint diseases, disorders of the cerebro-spinal liquor system and the urologic disorders. In the early detection of tumors, the search for metastases and tumor after-care, scintiscanning and the tumor marcher method (CEA) can be of great practical advantage, but the value of myocardial sciritiscanning in cardiac respectively coronary disorders is restricted. The paper is also concerned with the radiation doses in nuclear medicine. (orig.) [de

[Current situations and problem analysis of influencing factors of traditional Chinese medicine tablets on forming quality].

Science.gov (United States)

Li, Yan-Nian; Wu, Zhen-Feng; Wan, Na; Li, Yuan-Hui; Li, Hui-Ting; Yang, Ming

2018-04-01

The compressibility of tablets is the essential operating unit during the preparation of traditional Chinese medicine tablets, as well as a complicated process. Therefore, it is of great significance to comprehensively study the influencing factors on the formation process. This paper aimed to review the evaluation methods for the tablet forming quality and highlight the effects of material powder properties, excipients and preparation technology on the quality of traditional Chinese medicine tablets on the basis of relevant literatures. Furthermore, the common problems in tablet forming process are also analyzed to provide useful references for the development of tablet forming quality of traditional Chinese medicines. Copyright© by the Chinese Pharmaceutical Association.

Method for evaluating leaching from LSA-III material

International Nuclear Information System (INIS)

Abe, H.; Satoh, K.; Ozaki, S.; Watabe, N.; Iida, T.; Akamatsu, H.

1989-01-01

The IAEA transport regulations are scheduled to be introduced in Japan. New regulations are supposed to be set forth for low specific activity (LSA) material and industrial packaging (IP) as solidified concentrated waste water should correspond to the LSA material. Solidified concentrated waste water should be transported in accordance with the new transport regulations which reflect the IAEA transport regulations. As one of the regulations for LSA material, the leaching test for LSA-III materials states that the radioactive loss due to leaching without the packaging should not exceed 0.1 A 2 when left in the water for 7 days. This test method is called Transport regulations hereafter. Since the test had not been conducted in Japan before now, there was no available data. Consequently, it is necessary to make an assessment on whether the current solidified concentrated waste water can satisfy the leaching amount of radioactive nuclide specified in the IAEA transport regulations. If the test is performed in accordance with the IAEA transport regulations, however, it is necessary to measure the amount of radioactive nuclide actually leached from the solidified concentrated waste water. Since the solidified concentrated waste water is put in a drum cam, it is necessary to prepare large-scale hot test equipment. In this study, therefore, the leaching test was conducted on the solidified concentrated waste water to propose the means of a leaching assessment which can be conducted with ordinary equipment to evaluate the leaching for assessment of the adaptability to IAEA transport regulations. In addition, the leaching test was performed in accordance with the IAEA method to examine the co-relation between the transport regulations and the IAEA method. Many test results have been reported for the IAEA method in Japan, which will be detailed later on

The Effect of Medicine Knowledge on the Methods Applied for Lowering Blood Pressure in Patients with Hypertension

Directory of Open Access Journals (Sweden)

Belguzar Kara

2009-06-01

Full Text Available AIM: The aim of this study was to determine the effect of medicine knowledge on the methods applied for lowering blood pressure among patients with hypertension. METHODS: This cross-sectional study was conducted between February 1 and April 30, 2006. The sample of the study was constituted by 77 patients who had admitted to Gulhane Military Medical Academy Cardiology Outpatient Clinic with the diagnosis of hypertension. The data were collected by using a questionnaire designed by the investigators. Descriptive statistics and chi-square test were used to analyze the data. RESULTS: The mean age of the patients was 54±13 years. Of the patients, 54.5% were female and %90.9 were married. The patients’ median duration of disease was 4 years and median duration of using antihypertensive drug was 4 years. Approximately 53% of the study group was educated about the antihypertensive drugs and 70.7% was educated by the physician. The methods applied for lowering blood pressure of patients were: 48.1% use of oral antihypertensive medicine; 40.2% use of traditional methods; %11.7 use of sublingual medicine. In this study, the methods used in case of blood pressure elevation was significantly associated with having been educated about the antihypertensive drugs and knowing the side effects of the drugs (χ²=16.378; p<0.001, χ²=13.467; p<0.01, respectively. CONCLUSION: The results of this study showed that the patients who had been educated about the antihypertensive drugs and their side effects were more frequently preferring to use antihypertensive drug to lower the elevated blood pressure. [TAF Prev Med Bull 2009; 8(3.000: 231-238

Methods of producing compounds from plant materials

Science.gov (United States)

Werpy, Todd A [West Richland, WA; Schmidt, Andrew J [Richland, WA; Frye, Jr., John G.; Zacher, Alan H. , Franz; James A. , Alnajjar; Mikhail S. , Neuenschwander; Gary G. , Alderson; Eric V. , Orth; Rick J. , Abbas; Charles A. , Beery; Kyle E. , Rammelsberg; Anne M. , Kim; Catherine, J [Decatur, IL

2010-01-26

The invention includes methods of processing plant material by adding water to form a mixture, heating the mixture, and separating a liquid component from a solid-comprising component. At least one of the liquid component and the solid-comprising component undergoes additional processing. Processing of the solid-comprising component produces oils, and processing of the liquid component produces one or more of glycerol, ethylene glycol, lactic acid and propylene glycol. The invention includes a process of forming glycerol, ethylene glycol, lactic acid and propylene glycol from plant matter by adding water, heating and filtering the plant matter. The filtrate containing starch, starch fragments, hemicellulose and fragments of hemicellulose is treated to form linear poly-alcohols which are then cleaved to produce one or more of glycerol, ethylene glycol, lactic acid and propylene glycol. The invention also includes a method of producing free and/or complexed sterols and stanols from plant material.

Methods of producing compounds from plant material

Energy Technology Data Exchange (ETDEWEB)

Werpy, Todd A.; Schmidt, Andrew J.; Frye, Jr., John G.; Zacher, Alan H.; Franz, James A.; Alnajjar, Mikhail S.; Neuenschwander, Gary G.; Alderson, Eric V.; Orth, Rick J.; Abbas, Charles A.; Beery, Kyle E.; Rammelsberg, Anne M.; Kim, Catherine J.

2006-01-03

The invention includes methods of processing plant material by adding water to form a mixture, heating the mixture, and separating a liquid component from a solid-comprising component. At least one of the liquid component and the solid-comprising component undergoes additional processing. Processing of the solid-comprising component produces oils, and processing of the liquid component produces one or more of glycerol, ethylene glycol, lactic acid and propylene glycol. The invention includes a process of forming glycerol, ethylene glycol, lactic acid and propylene glycol from plant matter by adding water, heating and filtering the plant matter. The filtrate containing starch, starch fragments, hemicellulose and fragments of hemicellulose is treated to form linear poly-alcohols which are then cleaved to produce one or more of glycerol, ethylene glycol, lactic acid and propylene glycol. The invention also includes a method of producing free and/or complexed sterols and stanols from plant material.

Medicine utilization review at a university teaching hospital in New Delhi

Directory of Open Access Journals (Sweden)

M Aqil

2012-01-01

Full Text Available Objective: A prospective medicine usage evaluation based on prescription monitoring was conducted in the medicine OPD of our university teaching hospital to know prescribing trends of different categories of medicines. Materials and Methods: A total of 600 patients were included in the study comprising of 339 (56.5% males and 261 (43.5% females. The data were recorded within the OPD by a registered pharmacist on a medicine usage evaluation form, approved by The University Institutional Review Board (IRB. Results: A total of 2365 medicines were prescribed to 600 patients during the 3 months study period. The mean number of medicines per prescription were found to be 3.94. Medicines were most frequently prescribed as solid dosage forms (85.62%, especially tablets (70.82%, and liquid formulations (14.12%. Oral route (96.17% was the most preferred mode of administration, followed by topical (2.11% and parenteral (1.60% routes. Combination therapy (94.33% was more prevalent than monotherapy (5.66%. An overwhelming tendency for prescribing medicines by brand names (99% was observed by the physicians. The most frequently prescribed class of medicines were antimicrobials > analgesics > cardiovascular > gastrointestinal agents. The most prescribed individual medicines among various therapeutic classes included isoniazid (antimicrobial, amlodipine (cardiovascular, metformin (hypoglycemic, cetirizine (antiallergic, rabeprazole (GI medicine, atorvastatin (hypolipidemic, dextromethorphan (respiratory medicine, alprazolam (sedative-hypnotic, paracetamol (analgesic. Conclusions: There is a considerable scope of improvement in the existing prescribing practice, especially prescribing by generic names, needs to be encouraged and a hospital formulary has to be developed for the purpose. The number of medicines to be included per prescription should be judged rationally and polypharmacy ought to be curbed. Use of antimicrobial also needs to be rationalized as over

The correlation of metal content in medicinal plants and their water extracts

Directory of Open Access Journals (Sweden)

Ranđelović Saša S.

2013-01-01

Full Text Available The quality of some medicinal plants and their water extracts from South East Serbia is determined on the basis of metal content using atomic absorption spectrometry. The two methods were used for the preparation of water extracts, to examine the impact of the preparation on the content of metals in them. Content of investigated metals in both water extracts is markedly lower then in medicinal plants, but were higher in water extract prepared by method (I, with exception of lead content. The coefficients of extraction for the observed metal can be represented in the following order: Zn > Mn > Pb > Cu > Fe. Correlation coefficients between the metal concentration in the extract and total metal content in plant material vary in the range from 0.6369 to 0.9956. This indicates need the plants to be collected and grown in the unpolluted area and to examine the metal content. The content of heavy metals in the investigated medicinal plants and their water extracts is below the maximum allowable values, so they are safe to use.

Carbon Nanotubes Filled with Ferromagnetic Materials

Directory of Open Access Journals (Sweden)

Albrecht Leonhardt

2010-08-01

Full Text Available Carbon nanotubes (CNT filled with ferromagnetic metals like iron, cobalt or nickel are new and very interesting nanostructured materials with a number of unique properties. In this paper we give an overview about different chemical vapor deposition (CVD methods for their synthesis and discuss the influence of selected growth parameters. In addition we evaluate possible growth mechanisms involved in their formation. Moreover we show their identified structural and magnetic properties. On the basis of these properties we present different application possibilities. Some selected examples reveal the high potential of these materials in the field of medicine and nanotechnology.

Carbon Nanotubes Filled with Ferromagnetic Materials

Science.gov (United States)

Weissker, Uhland; Hampel, Silke; Leonhardt, Albrecht; Büchner, Bernd

2010-01-01

Carbon nanotubes (CNT) filled with ferromagnetic metals like iron, cobalt or nickel are new and very interesting nanostructured materials with a number of unique properties. In this paper we give an overview about different chemical vapor deposition (CVD) methods for their synthesis and discuss the influence of selected growth parameters. In addition we evaluate possible growth mechanisms involved in their formation. Moreover we show their identified structural and magnetic properties. On the basis of these properties we present different application possibilities. Some selected examples reveal the high potential of these materials in the field of medicine and nanotechnology. PMID:28883334

Recent history of nuclear medicine

International Nuclear Information System (INIS)

Potchen, E.J.; Gift, D.A.

1988-01-01

Diagnostic nuclear medicine's recent history is characterized both by significant change and by growing participation in efforts to quantify the impact of nuclear medicine procedures on clinical judgment and patient management, as well as to develop methods for studying the efficacy of diagnostic procedures in general. The replacement of many nuclear medicine procedures that at one time were considered essential standards of clinical care by newer, more efficient and effective modalities has been complimented by the continued development of increasingly sophisticated applications of scintigraphic tracer methods

Method for monitoring drilling materials for gamma ray activity

International Nuclear Information System (INIS)

Smith, H.D. Jr.; Arnold, D.M.; Schultz, W.E.

1985-01-01

In the preferred and illustrated embodiment taught herein, method steps for monitoring of raw materials to be used in drilling mud are disclosed. The materials are monitored for radioactivity. Procedures for taking such measurements are disclosed, and the extent of gamma radioactivity in the raw materials used in drilling mud is, determined. This is correlated to the increased radiation attributable to mud made from these materials and the effect the mud would have on gamma ray measuring logs. An alternate procedure for testing drilling mud, typically at the well site, is also disclosed. The method detects mud radioactivity from any additives including barite, potassium chloride, well cuttings or others. Excessive background levels due to mud gamma radioactivity in a well may very well mask the data obtained by various logging procedures dependent on gamma radiation. Procedures are also described for either rejecting mud which is too radioactive or correcting the log measurements for mud effects

Multiscale Modeling using Molecular Dynamics and Dual Domain Material Point Method

Energy Technology Data Exchange (ETDEWEB)

Dhakal, Tilak Raj [Los Alamos National Lab. (LANL), Los Alamos, NM (United States). Theoretical Division. Fluid Dynamics and Solid Mechanics Group, T-3; Rice Univ., Houston, TX (United States)

2016-07-07

For problems involving large material deformation rate, the material deformation time scale can be shorter than the material takes to reach a thermodynamical equilibrium. For such problems, it is difficult to obtain a constitutive relation. History dependency become important because of thermodynamic non-equilibrium. Our goal is to build a multi-scale numerical method which can bypass the need for a constitutive relation. In conclusion, multi-scale simulation method is developed based on the dual domain material point (DDMP). Molecular dynamics (MD) simulation is performed to calculate stress. Since the communication among material points is not necessary, the computation can be done embarrassingly parallel in CPU-GPU platform.

BOOK REVIEW Handbook of Physics in Medicine and Biology Handbook of Physics in Medicine and Biology

Science.gov (United States)

Tabakov, Slavik

2010-11-01

. The imaging chapters also vary in style and quality: while those on MRI and ultrasound provide a suitable introduction to the methods, the chapters on x-ray and PET need more detail. However this section includes some methods/equipment rarely featured in medical physics/engineering books (such as OCT or HIM). From this point of view the last eight chapters in the section will be a very useful reference for various specialists. The sixth section (about 30 pages) includes three chapters on lab-on-a-chip; the biophysics of DNA microarrays; nuclear medicine. While the first two could provide an interesting reference, the chapter on nuclear medicine needs much more detail. The last (seventh) section (15 pages) has only one chapter on biophysics of regenerative medicine, which is a good introduction, emphasizing biochemical factors important for improving/replacing tissues or tissue structures. The book ends with an index covering about 1400 terms. The handbook will be useful for the preparation of teaching materials and for undergraduate students, but should be complemented with more detailed/specific reference materials such as the Encyclopedia of Medical Devices and Instrumentation, the Encyclopedia of Medical Physics Emitel, or others. Parts of the handbook would be less suitable for more demanding readers (such as trainee medical physicists or radiologists, for example). In conclusion, the Handbook of Physics in Medicine and Biology includes materials that are rarely combined together, which strengthens its interdisciplinary approach and makes it an additional reference for a departmental library.

Family medicine: Perception and attitudes among Indian medical students

Directory of Open Access Journals (Sweden)

Ilhaam Ashraf

2018-01-01

Full Text Available Context: Currently, family medicine is not taught as a part of the undergraduate medical curriculum in India. In this context, the perceptions and attitudes of Indian medical students regarding family medicine as a career choice were studied. Aims: This study aims to study the perceptions and attitudes prevalent among Indian medical students regarding family medicine as a career choice and discuss its future implications. Settings and Design: Cross-sectional survey study design. Methods and Material: We conducted a cross-sectional survey of undergraduate medical (MBBS students attending the 2016 medical student conference DEMEDCON at Sri Devaraj Urs Medical College in Kolar, Karnataka, India. Besides demographics, the survey included questions pertaining to awareness, exposure, and interest in family medicine in India. We also asked an open-ended question regarding the respondent's perception of the future of family medicine in India. Statistical Analysis: Simple statistics such as mean and frequency (% were calculated. Given the small sample size, no formal tests for statistical significance were performed. Results: Responses were collected from 45 students between the ages of 18–24 from 6 medical colleges across Karnataka and Puducherry. The majority (64% of respondents were in their 3rd or 4th year of medical college. 98% of respondents expressed a desire to learn more about family medicine as a specialty, and 82% expressed a need to introduce it as a subject in medical college. However, only 58% were aware of the Medical Council of India accredited status of family medicine in India. Conclusions: There exists a significant lack of awareness and inadequate exposure among Indian medical students toward family medicine. Nonetheless, there is widespread optimism and a desire to learn more about the subject. Increased awareness and avenues for exposure to family medicine in the formal undergraduate medical curriculum is the need of the hour.

A fully general and adaptive inverse analysis method for cementitious materials

DEFF Research Database (Denmark)

Jepsen, Michael S.; Damkilde, Lars; Lövgren, Ingemar

2016-01-01

The paper presents an adaptive method for inverse determination of the tensile σ - w relationship, direct tensile strength and Young’s modulus of cementitious materials. The method facilitates an inverse analysis with a multi-linear σ - w function. Usually, simple bi- or tri-linear functions...... are applied when modeling the fracture mechanisms in cementitious materials, but the vast development of pseudo-strain hardening, fiber reinforced cementitious materials require inverse methods, capable of treating multi-linear σ - w functions. The proposed method is fully general in the sense that it relies...... of notched specimens and simulated data from a nonlinear hinge model. The paper shows that the results obtained by means of the proposed method is independent on the initial shape of the σ - w function and the initial guess of the tensile strength. The method provides very accurate fits, and the increased...

VOLATILE CONSTITUENTS OF GINGER OIL PREPARED ACCORDING TO IRANIAN TRADITIONAL MEDICINE AND CONVENTIONAL METHOD: A COMPARATIVE STUDY.

Science.gov (United States)

Shirooye, Pantea; Mokaberinejad, Roshanak; Ara, Leila; Hamzeloo-Moghadam, Maryam

2016-01-01

Herbal medicines formulated as oils were believed to possess more powerful effects than their original plants in Iranian Traditional Medicine (ITM). One of the popular oils suggested for treatment of various indications was ginger oil. In the present study, to suggest a more convenient method of oil preparation (compared to the traditional method), ginger oil has been prepared according to both the traditional and conventional maceration methods and the volatile oil constituents have been compared. Ginger oil was obtained in sesame oil according to both the traditional way and the conventional (maceration) methods. The volatile oil of dried ginger and both oils were obtained by hydro-distillation and analyzed by gas chromatography/mass spectroscopy. Fifty five, fifty nine and fifty one components consisting 94 %, 94 % and 98 % of the total compounds were identified in the volatile oil of ginger, traditional and conventional oils, respectively. The most dominant compounds of the traditional and conventional oils were almost similar; however they were different from ginger essential oil which has also been to possess limited amounts of anti-inflammatory components. It was concluded that ginger oil could be prepared through maceration method and used for indications mentioned in ITM.

A particle method for history-dependent materials

Energy Technology Data Exchange (ETDEWEB)

Sulsky, D.; Chen, Z.; Schreyer, H.L. [New Mexico Univ., Albuquerque, NM (United States)

1993-06-01

A broad class of engineering problems including penetration, impact and large rotations of solid bodies causes severe numerical problems. For these problems, the constitutive equations are history dependent so material points must be followed; this is difficult to implement in an Eulerian scheme. On the other hand, purely Lagrangian methods typically result in severe mesh distortion and the consequence is ill conditioning of the element stiffness matrix leading to mesh lockup or entanglement. Remeshing prevents the lockup and tangling but then interpolation must be performed for history dependent variables, a process which can introduce errors. Proposed here is an extension of the particle-in-cell method in which particles are interpreted to be material points that are followed through the complete loading process. A fixed Eulerian grid provides the means for determining a spatial gradient. Because the grid can also be interpreted as an updated Lagrangian frame, the usual convection term in the acceleration associated with Eulerian formulations does not appear. With the use of maps between material points and the grid, the advantages of both Eulerian and Lagrangian schemes are utilized so that mesh tangling is avoided while material variables are tracked through the complete deformation history. Example solutions in two dimensions are given to illustrate the robustness of the proposed convection algorithm and to show that typical elastic behavior can be reproduced. Also, it is shown that impact with no slip is handled without any special algorithm for bodies governed by elasticity and strain hardening plasticity.

Attitude toward learning of community medicine: A cross-sectional study among medical school students

Directory of Open Access Journals (Sweden)

Japhereena Murugavel

2017-01-01

Full Text Available Background: Community medicine strives to protect and promote the health and well-being of the community through primary health care approach. However the preference of community medicine as career among medical school students and curriculum of community medicine is pivotal. Aim: The study intended to find the attitude towards learning of community medicine and also to assess the preference of post graduation specialty among medical school students. Materials and Methods: A cross sectional study conducted at a teaching hospital located in Tamil Nadu, South India. The study questionnaire was administered to a total of 500 study participants and the data collected were analyzed using SPSS IBM version 21.0. Results: Almost 97% were of the opinion that community medicine subject is mandatory. Eighty three percent were interested in learning the principles. Only 21.8% students wanted to pursue post graduation in community medicine. Lack of attraction in terms of scientific technical interest, workplace conditions, and research potential has been reported for being not interested. Conclusion: Majority enjoyed to learn principles of community medicine at undergraduate curriculum but only few preferred to opt community medicine as post graduate specialty. Therefore there is a room to influence the medical students positively towards learning community medicine in curriculum.

Modelling of Granular Materials Using the Discrete Element Method

DEFF Research Database (Denmark)

Ullidtz, Per

1997-01-01

With the Discrete Element Method it is possible to model materials that consists of individual particles where a particle may role or slide on other particles. This is interesting because most of the deformation in granular materials is due to rolling or sliding rather that compression of the gra...

Medicine Delivery Device with Integrated Sterilization and Detection

Science.gov (United States)

Shearn, Michael J.; Greer, Harold F.; Manohara, Harish

2013-01-01

Sterile delivery devices can be created by integrating a medicine delivery instrument with surfaces that are coated with germicidal and anti-fouling material. This requires that a large-surface-area template be developed within a constrained volume to ensure good contact between the delivered medicine and the germicidal material. Both of these can be integrated using JPL-developed silicon nanotip or cryo-etch black silicon technologies with atomic layer deposition (ALD) coating of specific germicidal layers. The application of semiconductor processing techniques and technologies to the problems of fluid manipulation and delivery has enabled the integration of chemical, electrical, and mechanical manipulation of samples all within a single microfluidic device. This approach has been successfully applied at JPL to the automated processing, detection, and analysis of minute quantities (parts per trillion level) of biomaterials to develop instruments for in situ exploration or extraterrestrial bodies. The same nanofabrication techniques that are used to produce a microfluidics device are also capable of synthesizing extremely high-surface-area templates in precise locations, and coating those surfaces with conformal films to manipulate their surface properties. This methodology has been successfully applied at JPL to produce patterned and coated silicon nanotips (also known as black silicon) to manipulate the hydrophilicity of surfaces to direct the spreading of fluids in microdevices. JPL's ALD technique is an ideal method to produce the highly conformal coatings required for this type of application. Certain materials, such as TiO2, have germicidal and anti-fouling properties when they are illuminated with UV light. The proposed delivery device contacts medicine with this high-surface-area black silicon surface coated with a thin-film germicidal deposited conformally with ALD. The coating can also be illuminated with ultraviolet light for the purpose of sterilization

Two micro fatigue test methods for irradiated materials

International Nuclear Information System (INIS)

Nunomura, Shigetomo; Noguchi, Shinji; Okamura, Yuichi; Kumai, Shinji

1993-01-01

This paper demonstrates two miniature fatigue test methods in response to the requirements of the fusion reactor wall materials development program. It is known that the fatigue strength evaluated by the axial loading test is independent of the specimen size, while that evaluated by the bend test or torsion test is dependent upon the size of specimen. The new type of gripping system for the axial, tension-tension, fatigue testing of TEM disk-size specimens that has been developed is described in this paper. An alignment tool assists in gripping the miniature specimen. The miniature tension-tension fatigue test method seems to provide reliable S-N curves for SUS304 and SUS316L stainless steels. An indentation method has also been developed to determine fatigue properties. A hard steel ball or ceramic ball was used for cyclically loading the specimen, and an S-N curve was subsequently obtained. The merit of this method is primarily simple handling. S-N curves obtained from four materials by this indentation method compared well with those obtained from the rotary bend fatigue test employing a standard-size specimen

[Costing nuclear medicine diagnostic procedures].

Science.gov (United States)

Markou, Pavlos

2005-01-01

To the Editor: Referring to a recent special report about the cost analysis of twenty-nine nuclear medicine procedures, I would like to clarify some basic aspects for determining costs of nuclear medicine procedure with various costing methodologies. Activity Based Costing (ABC) method, is a new approach in imaging services costing that can provide the most accurate cost data, but is difficult to perform in nuclear medicine diagnostic procedures. That is because ABC requires determining and analyzing all direct and indirect costs of each procedure, according all its activities. Traditional costing methods, like those for estimating incomes and expenses per procedure or fixed and variable costs per procedure, which are widely used in break-even point analysis and the method of ratio-of-costs-to-charges per procedure may be easily performed in nuclear medicine departments, to evaluate the variability and differences between costs and reimbursement - charges.

The application of Westcott Formalism k0 NAA method to estimate short and medium lived elements in some Ghanaian herbal medicines complemented by AAS

Science.gov (United States)

Ayivor, J. E.; Okine, L. K. N.; Dampare, S. B.; Nyarko, B. J. B.; Debrah, S. K.

2012-04-01

The epithermal neutron shape factor, α of the inner and outer irradiation sites of the Ghana Research Reactor-1 (GHARR-1) was determined obtaining results of 0.105 for the inner (Channel 1) Irradiation site and 0.020 for the outer (channel 6) irradiation site. The neutron temperatures for the inner and outer irradiation sites were 27 °C and 20 °C, respectively. The α values used in Westcott Formalism k0 INAA was applied to determine multi elements in 13 Ghanaian herbal medicines used by the Centre for Scientific Research into Plant Medicine (CSRPM) for the management of various diseases complemented by Atomic Absorption Spectrometry. They are namely Mist. Antiaris, Mist. Enterica, Mist. Morazia, Mist. Nibima, Mist. Modium, Mist. Ninger, Mist Sodenia, Mist. Tonica, Chardicca Powder, Fefe Powder, Olax Powder, Sirrapac powder and Lippia Tea. Concentrations of Al, As, Br, K, Cl, Cu, Mg, Mn, Na and V were determined by short and medium irradiations at a thermal neutron flux of 5×1011 ncm-2 s-1. Fe, Cr, Pb, Co, Ni, Sn, Ca, Ba, Li and Sb were determined using Atomic Absorption Spectrometry (AAS). Ba, Cu, Li and V were present at trace levels whereas Al, Cl, Na, Ca were present at major levels. K, Br, Mg, Mn, Co, Ni, Fe and Sb were also present at minor levels. Arsenic was not detected in all samples. Standard Reference material, IAEA-V-10 Hay Powder was simultaneously analysed with samples. The precision and accuracy of the method using real samples and standard reference materials were evaluated and within ±10% of the reported value. Multivariate analytical techniques, such as cluster analysis (Q-mode and R-mode CA) and principal component analysis (PCA)/factor analysis (FA), have been applied to evaluate the chemical variations in the herbal medicine dataset. All the 13 samples may be grouped into 2 statistically significant clusters (liquid based and powdered herbal medicines), reflecting the different chemical compositions. R-mode CA and PCA suggest common

A Brief Review of Therapeutic and Diagnostic Applications of Enema in Iranian Traditional Medicine and Other Complementary Medicines

Directory of Open Access Journals (Sweden)

Hamideh khorrampazouh

2018-02-01

Full Text Available Introduction: Enema or ‘hoqne’ is a therapeutic approach used for a wide range of diseases in the Iranian traditional medicine. The use of this method dates back to thousands of years to Hippocrates and Galen. The aim of this study was to review the history of enema and its methods and indices in the Iranian medicine and other complementary medicine.Methods: This review study was conducted on the Iranian medicine textbooks and articles published in the international databases, including Google Scholar, PubMed, Embase, and Scopus, as well as the Iranian databases, such as SID and Magiran. The searching process was performed using the following keywords: ‘Hoqne’, ‘Enema’, ‘Vasta’, ‘Basta’, and ‘Complementary and Alternative Medicine (CAM’. There was no limitation regarding the publication data of the included studies.Result: In the Iranian medicine, the term “hoqne” is equivalent to enema. Enema is used in various diseases of the brain, respiratory system, digestive system, urogenital system, and musculoskeletal system, as well as systemic diseases. Enema is one of the five main therapies in the Indian medicine or Ayurveda. In other types of complementary medicine, including Chinese medicine, this procedure has therapeutic applications. Although enema has been recognized as a diagnostic method in modern medicine, it has been considered as a therapeutic approach in the recent years.Conclusion: According to the findings of the reviewed studies, enema is a major therapeutic focus in complementary medicine, part of which has been confirmed in the recent studies. Given the low side effects and high success rate of this treatment, it can be used as a supplemental therapy for the management of poisoning, febrile seizures, prolonged functional constipation, and chronic kidney disease, as well as the prevention of swelling. However, this theory requires further investigation and targeted clinical trials. This method has been

An analysis of the combination frequencies of constituent medicinal herbs in prescriptions for the treatment of bone and joint disorder in Korean medicine: determination of a group of candidate prescriptions for universal use

Directory of Open Access Journals (Sweden)

Yoo Kyoung Han

2017-12-01

Full Text Available Background: This study aimed to select prescriptions (mixtures of medicinal herbs used in the treatment of bone and joint disorders in Korean medicine, and through the analysis of medicinal herb combination frequencies, select a high-frequency medicinal herb combination group for further experimental and clinical research. Methods: We systematically searched for terms related to bone and joint disorder in the “Dongeuibogam (Dong yibaojian”, a seminal Korean medicine book. We reviewed the results of published papers regarding the effects in bone and joint disorders (especially in osteoporosis, osteomalacia, osteopenia, rheumatoid arthritis, and degenerative arthritis. Results: In total, 34 candidates of a medicinal herb combination for the treatment of bone and joint disorders(CMHCTBJDs and nine candidates of a medicinal herb for the treatment of bone and joint disorders(CMHTBJDs were selected. Conclusion: : The candidates of a medicinal herb combination for the treatment of bone and joint disorders (CMHCTBJDs and candidates of a medicinal herb for the treatment of bone and joint disorders(CMHTBJDs proposed in this study can be useful material for text mining to develop natural products with the effects in BJDs and also it has the potential to reduce the experimental and developmental time period. Keywords: Dongeuibogam (Dong yi bao gian, Text mining, Bone disorder

An integrated system for identifying the hidden assassins in traditional medicines containing aristolochic acids

Science.gov (United States)

Wu, Lan; Sun, Wei; Wang, Bo; Zhao, Haiyu; Li, Yaoli; Cai, Shaoqing; Xiang, Li; Zhu, Yingjie; Yao, Hui; Song, Jingyuan; Cheng, Yung-Chi; Chen, Shilin

2015-08-01

Traditional herbal medicines adulterated and contaminated with plant materials from the Aristolochiaceae family, which contain aristolochic acids (AAs), cause aristolochic acid nephropathy. Approximately 256 traditional Chinese patent medicines, containing Aristolochiaceous materials, are still being sold in Chinese markets today. In order to protect consumers from health risks due to AAs, the hidden assassins, efficient methods to differentiate Aristolochiaceous herbs from their putative substitutes need to be established. In this study, 158 Aristolochiaceous samples representing 46 species and four genera as well as 131 non-Aristolochiaceous samples representing 33 species, 20 genera and 12 families were analyzed using DNA barcodes based on the ITS2 and psbA-trnH sequences. Aristolochiaceous materials and their non-Aristolochiaceous substitutes were successfully identified using BLAST1, the nearest distance method and the neighbor-joining (NJ) tree. In addition, based on sequence information of ITS2, we developed a Real-Time PCR assay which successfully identified herbal material from the Aristolochiaceae family. Using Ultra High Performance Liquid Chromatography-Mass Spectrometer (UHPLC-HR-MS), we demonstrated that most representatives from the Aristolochiaceae family contain toxic AAs. Therefore, integrated DNA barcodes, Real-Time PCR assays using TaqMan probes and UHPLC-HR-MS system provides an efficient and reliable authentication system to protect consumers from health risks due to the hidden assassins (AAs).

Homicides with corpse dismemberment in the material collected by the Department of Forensic Medicine, Krakow, Poland

Directory of Open Access Journals (Sweden)

Tomasz Konopka

2017-06-01

Full Text Available Aim of the study : To determine the circumstances which can be useful for offenders profiling in homicide cases with victim’s body dismemberment. Material and methods: Study of all homicide cases with victim’s corpse dismemberment examined in Krakow Department of Forensic Medicine over the last 50 years. Results : Within the past 50 years, a total number of 30 cases of homicides with dismembered bodies were examined in Krakow. 22 cases represent defensive mutilations performed by offender, 3 cases can be classified as offensive muti­lations and 3 cases represent aggressive mutilations – decapitation as a method of committing homicide. In this period the only 1 case of necrophilic mutilations was examined, when the body was dismembered without murder. In most cases the background of homicide was the family conflict, 6 was cause of mental illness of perpetrator and in 3 was sexual motive. Only in 3 cases (from 25 when the offender was known perpetrator kill a stranger. In the other the offender belonged to the family or friends of the victim. In all cases where the perpetrator was determined, homicide and dismemberment was performed in his place of residence. The findings of the Police investigations indicate that in most cases homicides were not planned, occurred under the influence of emotion, only two have been previously scheduled. Conclusions : Homicides with corpses dismemberment usually are committed by offenders who is in close relationship with victim (family or friend. Dismemberment is almost always performed in the same place as murder – home of perpetrator. This type of homicide usually is not planned.

Simultaneous determination of umbelliferone and scopoletin in Tibetan medicine Saussurea laniceps and traditional Chinese medicine Radix angelicae pubescentis using excitation-emission matrix fluorescence coupled with second-order calibration method

Science.gov (United States)

Wang, Li; Wu, Hai-Long; Yin, Xiao-Li; Hu, Yong; Gu, Hui-Wen; Yu, Ru-Qin

2017-01-01

A chemometrics-assisted excitation-emission matrix (EEM) fluorescence method is presented for simultaneous determination of umbelliferone and scopoletin in Tibetan medicine Saussurea laniceps (SL) and traditional Chinese medicine Radix angelicae pubescentis (RAP). Using the strategy of combining EEM fluorescence data with second-order calibration method based on the alternating trilinear decomposition (ATLD) algorithm, the simultaneous quantification of umbelliferone and scopoletin in the two different complex systems was achieved successfully, even in the presence of potential interferents. The pretreatment is simple due to the "second-order advantage" and the use of "mathematical separation" instead of awkward "physical or chemical separation". Satisfactory results have been achieved with the limits of detection (LODs) of umbelliferone and scopoletin being 0.06 ng mL- 1 and 0.16 ng mL- 1, respectively. The average spike recoveries of umbelliferone and scopoletin are 98.8 ± 4.3% and 102.5 ± 3.3%, respectively. Besides, HPLC-DAD method was used to further validate the presented strategy, and t-test indicates that prediction results of the two methods have no significant differences. Satisfactory experimental results imply that our method is fast, low-cost and sensitive when compared with HPLC-DAD method.

Development of a novel sports medicine rotation for emergency medicine residents

Directory of Open Access Journals (Sweden)

Waterbrook AL

2016-04-01

Full Text Available Anna L Waterbrook,1 T Gail Pritchard,2 Allison D Lane,1 Lisa R Stoneking,1 Bryna Koch,2 Robert McAtee,1 Kristi H Grall,1 Alice A Min,1 Jessica Prior,1 Isaac Farrell,1 Holly G McNulty,1 Uwe Stolz1 1Department of Emergency Medicine, 2Office of Medical Student Education, The University of Arizona, Tucson, AZ, USA Abstract: Musculoskeletal complaints are the most common reason for patients to visit a physician, yet competency in musculoskeletal medicine is invariably reported as a deficiency in medical education in the USA. Sports medicine clinical rotations improve both medical students' and residents' musculoskeletal knowledge. Despite the importance of this knowledge, a standardized sports medicine curriculum in emergency medicine (EM does not exist. Hence, we developed a novel sports medicine rotation for EM residents to improve their musculoskeletal educational experience and to improve their knowledge in musculoskeletal medicine by teaching the evaluation and management of many common musculoskeletal disorders and injuries that are encountered in the emergency department. The University of Arizona has two distinct EM residency programs, South Campus (SC and University Campus (UC. The UC curriculum includes a traditional 4-week orthopedic rotation, which consistently rated poorly on evaluations by residents. Therefore, with the initiation of a new EM residency at SC, we replaced the standard orthopedic rotation with a novel sports medicine rotation for EM interns. This rotation includes attendance at sports medicine clinics with primary care and orthopedic sports medicine physicians, involvement in sport event coverage, assigned reading materials, didactic experiences, and an on-call schedule to assist with reductions in the emergency department. We analyzed postrotation surveys completed by residents, postrotation evaluations of the residents completed by primary care sports medicine faculty and orthopedic chief residents, as well as the

An n -material thresholding method for improving integerness of solutions in topology optimization

International Nuclear Information System (INIS)

Watts, Seth; Engineering); Tortorelli, Daniel A.; Engineering)

2016-01-01

It is common in solving topology optimization problems to replace an integer-valued characteristic function design field with the material volume fraction field, a real-valued approximation of the design field that permits "fictitious" mixtures of materials during intermediate iterations in the optimization process. This is reasonable so long as one can interpolate properties for such materials and so long as the final design is integer valued. For this purpose, we present a method for smoothly thresholding the volume fractions of an arbitrary number of material phases which specify the design. This method is trivial for two-material design problems, for example, the canonical topology design problem of specifying the presence or absence of a single material within a domain, but it becomes more complex when three or more materials are used, as often occurs in material design problems. We take advantage of the similarity in properties between the volume fractions and the barycentric coordinates on a simplex to derive a thresholding, method which is applicable to an arbitrary number of materials. As we show in a sensitivity analysis, this method has smooth derivatives, allowing it to be used in gradient-based optimization algorithms. Finally, we present results, which show synergistic effects when used with Solid Isotropic Material with Penalty and Rational Approximation of Material Properties material interpolation functions, popular methods of ensuring integerness of solutions.

Supplementary data: Materials and methods RNA expression ...

Indian Academy of Sciences (India)

ritt8

Supplementary data: Materials and methods. RNA expression analysis. Freshly collected tissue was taken in TRIzol reagent for total RNA isolation according to the manufacturer's protocol. The cDNA synthesis was carried out in 1 μg total RNA using Random hexamer (Invitrogen, Carlsbad, USA) and Superscript III ...

Method for Waterproofing Ceramic Materials

Science.gov (United States)

Cagliostro, Domenick E. (Inventor); Hsu, Ming-Ta S. (Inventor)

1998-01-01

Hygroscopic ceramic materials which are difficult to waterproof with a silane, substituted silane or silazane waterproofing agent, such as an alumina containing fibrous, flexible and porous, fibrous ceramic insulation used on a reentry space vehicle, are rendered easy to waterproof if the interior porous surface of the ceramic is first coated with a thin coating of silica. The silica coating is achieved by coating the interior surface of the ceramic with a silica precursor converting the precursor to silica either in-situ or by oxidative pyrolysis and then applying the waterproofing agent to the silica coated ceramic. The silica precursor comprises almost any suitable silicon containing material such as a silane, silicone, siloxane, silazane and the like applied by solution, vapor deposition and the like. If the waterproofing is removed by e.g., burning, the silica remains and the ceramic is easily rewaterproofed. An alumina containing TABI insulation which absorbs more that five times its weight of water, absorbs less than 10 wt. % water after being waterproofed according to the method of the invention.

Methods for making lithium vanadium oxide electrode materials

Science.gov (United States)

Schutts, Scott M.; Kinney, Robert J.

2000-01-01

A method of making vanadium oxide formulations is presented. In one method of preparing lithium vanadium oxide for use as an electrode material, the method involves: admixing a particulate form of a lithium compound and a particulate form of a vanadium compound; jet milling the particulate admixture of the lithium and vanadium compounds; and heating the jet milled particulate admixture at a temperature below the melting temperature of the admixture to form lithium vanadium oxide.

Validation of an activity optimization method for nuclear medicine in planar studies

Energy Technology Data Exchange (ETDEWEB)

Perez D, M. [Central University of Las Villas, CEETI, Camajuani Road Km 5.5, Santa Clara 54830 Villa Clara (Cuba); Diaz R, O. [Institute for Sciences and Advanced Technologies (Cuba); Farias L, F. [Federal University of Pernambuco (Brazil)]. e-mail: mperez@uclv.edu.cu

2006-07-01

A method for optimizing the administered activity in Static Nuclear Medicine Studies is validated by comparison with ROC curve. Linear Discriminant analysis of image quality in gamma cameras was the applied statistical technique. The constructed linear discriminant function owns as dependent parameters, the differentiated levels of image quality obtained by observer's criterion. The independent parameters in the function were physical variables, as Signal-to Background ratios and Signal-to-Noise ratios. They were obtained from the selection of Regions of Interest in images obtained from a Jaszczak phantom, corresponding to lesion and background sites. The percentage of cases correctly classified by discriminant analysis was analyzed to grade the proposed discriminant method. The minimum value of the administered activity, which permits good image quality, (it means good results for the parameters selected by the discriminant function), can be proposed as an optimized value of activity for planar studies of Nuclear Medicine. The method was tested using images from a Jaszczak phantom, acquired under four activities (1088 MBq, 962 MBq, 740 MBq and 562 MBq) with a gamma camera equipped with a high resolution - low energy- parallel-hole collimator. The gamma camera was tested by a NEMA protocol. Image quality was graded by three expert observers who also developed a rated procedure which consist in analyzing the images for ROC analysis. Two of the six measured Background-to-Signal ratios were the parameters able to construct the linear discriminant function with high correlation respect to the observer criterion, from all the measured physical variables. The value of 740 MBq was the optimum after discriminant method application in this particular experiment. The results were coincident with the application of ROC-analysis. The optimal activity value obtained with the proposed discriminant procedure coincided with the activity value for which the area under the ROC

Underground processing method for radiation-contaminated material and transferring method for buffer molding material

International Nuclear Information System (INIS)

Akasaka, Hidenari; Shimura, Satoshi; Asano, Eiichi; Yamagata, Junji; Ninomiya, Nobuo; Kawakami, Susumu.

1995-01-01

A bottomed molding material (buffer molding material) is formed into a bottomed cylindrical shape by solidifying, under pressure, powders such as of bentonite into a highly dense state by a cold isotropic pressing or the like, having a hole for accepting and containing a vessel for radiation-contaminated materials. The bottomed cylindrical molding material is loaded on a transferring vessel, and transferred to a position near the site for underground disposal. The bottomed cylindrical molding material having a upwarded containing hole is buried in the cave for disposal. The container for radiation-contaminated material is loaded and contained in the containing hole of the bottomed cylindrical molding material. A next container for radiation-contaminated materials is juxtaposed thereover. Then, a bottomed cylindrical molding material having a downwarded containing hole is covered to the container for the radiation-contaminated material in a state being protruded upwardly. The radiation-contaminated material is thus closed by a buffer material of the same material at the circumference thereof. (I.N.)

Recent applications of nuclear medicine in diagnostics (I part

Directory of Open Access Journals (Sweden)

Giorgio Treglia

2013-04-01

Full Text Available Introduction: Aim of this review is to describe the recent applications of nuclear medicine techniques in diagnostics, particularly in oncology. Materials and methods: We reviewed scientific literature data searching for the current role of tomographic nuclear medicine techniques (SPECTand PET in oncology and summarized the main applications of these techniques. Results: Nuclear medicine techniques have a key role in oncology allowing early diagnosis of many tumours, an accurate staging of disease and evalutation of treatment response. Hybrid SPECT/CT and PET/CT imaging systems now provide metabolic and functional information from SPECTor PETcombined with the high spatial resolution and anatomic information of CT. The most frequent applications of SPECT/CT in oncology concern thyroid tumours, neuroendocrine tumours, bone metastases and lymph node mapping. Furthermore the evaluation of many tumours may benefit from PET/CT imaging. Discussion: The recent development of new radiopharmaceuticals and the growth of hybrid tomographic devices, such as SPECT/CT and PET/CT, now permits molecular imaging of biologic processes at the cellular level to improve both the diagnosis and treatment of many tumours.

A review of the cultivation and processing of cannabis (Cannabis sativa L.) for production of prescription medicines in the UK.

Science.gov (United States)

Potter, David J

2014-01-01

The quality demands of the pharmaceutical industry require prescription medicines to be consistent in their active ingredient content. Achieving this, using raw cannabis as a feedstock, is especially challenging. The plant material is extremely inhomogeneous, and the ratios of active ingredients are affected by a range of factors. These include the genetics of the plant, the growing and storage conditions, the state of maturity at harvest, and the methods used to process and formulate the material. The reasons for this variability are described, with particular emphasis on the botanical considerations. To produce the complex botanical medicine Sativex®, which contains the cannabinoids Δ(9)-tetrahydrocannabinol (THC) and cannabidiol (CBD) and a range of other ingredients, GW Pharmaceuticals had to manage these variables. This medicine, for the treatment of spasticity due to multiple sclerosis, is the first cannabis-based medicine to be approved in the UK. The company's methodology for producing this and other chemotypes is described. Copyright © 2013 John Wiley & Sons, Ltd.

Network pharmacology of medicinal attributes and functions of Chinese herbal medicines: (IV Classification and network analysis of medicinal functions of Chinese herbal medicines

Directory of Open Access Journals (Sweden)

WenJun Zhang

2017-09-01

Full Text Available In present study I used the data from CHM-DATA, the interactive database of 1127 Chinese herbal medicines with 78 medicinal functions (attributes. The relational network for medicinal functions of Chinese herbal medicines was constructed using my earlier data and methods. Results of network analysis showed that the network is a scale-free complex network at the significance level of alpha=0.01. It was demonstrated that Clear away heat, Detoxification, Remove lung-heat or nourish lung, Promote secretion of saliva or body, Relieve pain, Regulate or enhance energy flow (Qi, Nourish or warm spleen / stomach / Qi, and Dispel endogenous wind, are the most influential medicinal functions. Seven main modules, corresponding links and module functions were identified and three of them were (Clear away heat, Detoxification, Relieve pain, Regulate or enhance energy flow (Qi, (Loosen the bowels, Moisten dryness, Tonify blood, Nourish essential fluid (Yin, Inhibit or break energy flow (Qi, and (Relieve external syndrome, Induce perspiration, Relieve muscular spasm, Expose exthanthema or promote eruption. PCA of 78 medicinal functions demonstrated that the medicinal functions 1-50 accounted for 79% of the total variance. There were not absolutely significant components and medicinal functions. The 78 components from PCA were substantially 78 independent and comprehensive medicinal functions. Major medicinal functions for every component can be simply determined by their importance and contribution coefficients in the component. New medicinal definition for some the most important principal components were given. Category characteristics of medicinal functions were described. At a certain level, for example, the medicinal functions -Consolidate or warm kidney, -Whet the appetite or reinforce stomach, Cool blood, -Regulate or enhance energy flow (Qi, -Nourish or warm spleen / stomach / Qi, Clear away heat, Detoxification, and Dispel endogenous cold, are the

Screening of Chemical Dyes in Traditional Chinese Medicine by HPTLC-MS.

Science.gov (United States)

He, Fengyan; He, Yi; Zheng, Xiaowei; Wang, Ruizhong; Lu, Jing; Dai, Zhong; Ma, Shuangcheng

2018-05-01

It has been uncovered that chemical dyes are illegally used in traditional Chinese medicines to brighten color and cover up inferiority, which threaten the safety of patients. In the present study, an HPTLC-MS method was developed for the effective screening of 11 chemical dyes (Sudan I, II, III, and IV; 808 Scarlet; Sudan Red 7B; malachite green; Basic Orange 2; auramine; Orange II; and erythrosine) in traditional Chinese medicine (TCM) raw materials and Chinese patent medicines. Firstly, unwashed HPTLC plates were chosen by comparing the background signals of the TLC plates used directly and prewashed with analytical grade and HPLC grade solvents. Twice developments were conducted to isolate chemical dyes of different polarity. Possible adulterants were preliminarily identified by comparing Rf values and in situ UV-Vis spectra with those of the references. Further confirmation was conducted by tandem MS analysis via an elution head-based TLC-MS interface. Sudan I and IV, 808 Scarlet, and Orange II were successfully detected in eight batches of TCM. The proposed method could be applied as a reliable technology for the screening of chemical dyes in TCM.