Zhao, Yan; Qu, Hui-Hua; Wang, Qing-Guo
2013-09-01
Study on pharmacodynamic material basis of traditional Chinese medicines is one of the key issues for the modernization of traditional Chinese medicine. Having introduced the monoclonal antibody technology into the study on pharmacodynamic material basis of traditional Chinese medicines, the author prepared the immunoaffinity chromatography column by using monoclonal antibodies in active components of traditional Chinese medicines, so as to selectively knock out the component from herbs or traditional Chinese medicine compounds, while preserving all of the other components and keeping their amount and ratio unchanged. A comparative study on pharmacokinetics and pharmacodynamics was made to explicitly reveal the correlation between the component and the main purpose of traditional Chinese medicines and compounds. The analysis on pharmacodynamic material basis of traditional Chinese medicines by using specific knockout technology with monoclonal antibodies is a new method for study pharmacodynamic material basis in line with the characteristics of traditional Chinese medicines. Its results can not only help study material basis from a new perspective, but also help find the modern scientific significance in single herb or among compounds of traditional Chinese medicines.
An integrated web medicinal materials DNA database: MMDBD (Medicinal Materials DNA Barcode Database
Directory of Open Access Journals (Sweden)
But Paul
2010-06-01
Full Text Available Abstract Background Thousands of plants and animals possess pharmacological properties and there is an increased interest in using these materials for therapy and health maintenance. Efficacies of the application is critically dependent on the use of genuine materials. For time to time, life-threatening poisoning is found because toxic adulterant or substitute is administered. DNA barcoding provides a definitive means of authentication and for conducting molecular systematics studies. Owing to the reduced cost in DNA authentication, the volume of the DNA barcodes produced for medicinal materials is on the rise and necessitates the development of an integrated DNA database. Description We have developed an integrated DNA barcode multimedia information platform- Medicinal Materials DNA Barcode Database (MMDBD for data retrieval and similarity search. MMDBD contains over 1000 species of medicinal materials listed in the Chinese Pharmacopoeia and American Herbal Pharmacopoeia. MMDBD also contains useful information of the medicinal material, including resources, adulterant information, medical parts, photographs, primers used for obtaining the barcodes and key references. MMDBD can be accessed at http://www.cuhk.edu.hk/icm/mmdbd.htm. Conclusions This work provides a centralized medicinal materials DNA barcode database and bioinformatics tools for data storage, analysis and exchange for promoting the identification of medicinal materials. MMDBD has the largest collection of DNA barcodes of medicinal materials and is a useful resource for researchers in conservation, systematic study, forensic and herbal industry.
[Sulfur dioxide limit standard and residues in Chinese medicinal materials].
Kang, Chuan-Zhi; Yang, Wan-Zhen; Mo, Ge; Zhou, Li; Jiang, Jing-Yi; Lv, Chao-Geng; Wang, Sheng; Zhou, Tao; Yang, Ye; Guo, Lan-Ping
2018-01-01
The traditional sulfur fumigation processing method has been widely used in the initial processing and storage of traditional Chinese medicinal materials due to its economy, efficiency, convenience, high operability and effect on mold and insect prevention. However, excessive sulfur fumigation of traditional Chinese medicinal materials would lead to the changes in chemical compositions, and even endanger human health. This study showed that traditional Chinese medicinal materials were sulfur fumigated directly after being harvested for quick drying, or fumigated after being weted in the storage process for preventing mold and insects. We found that the sulfur dioxide limits for traditional Chinese medicinal materials were stricter than those for foods. Based on the existing limit standards, we obtained the data of sulfur dioxide residues for 35 types of traditional Chinese medicinal materials in a total of 862 batches. According to the limit standard in the Chinese Pharmacopoeia (150, 400 mg·kg⁻¹), the average over-standard rate of sulfur dioxide was as high as 52.43%, but it was reduced to 29.47% if calculated based on the limit for vegetable additive standard (500 mg·kg⁻¹). Sulfur fumigation issue shall be considered correctly: sulfur dioxide is a type of low toxic substance and less dangerous than aflatoxin and other highly toxic substances, and a small amount of residue would not increase the toxicity of traditional Chinese medicinal materials. However, sulfur fumigation might change the content of chemical substances and affect the quality of traditional Chinese medicinal materials. Furthermore, the exposure hazards of toxic substances are comprehensively correlated with exposure cycle, exposure frequency, and application method. In conclusion, it is suggested to strengthen the studies on the limit standard of traditional Chinese medicinal materials, formulate practical and feasible limit standard for sulfur dioxide residues in traditional Chinese
DNA based identification of medicinal materials in Chinese patent medicines
Chen, Rong; Dong, Juan; Cui, Xin; Wang, Wei; Yasmeen, Afshan; Deng, Yun; Zeng, Xiaomao; Tang, Zhuo
2012-12-01
Chinese patent medicines (CPM) are highly processed and easy to use Traditional Chinese Medicine (TCM). The market for CPM in China alone is tens of billions US dollars annually and some of the CPM are also used as dietary supplements for health augmentation in the western countries. But concerns continue to be raised about the legality, safety and efficacy of many popular CPM. Here we report a pioneer work of applying molecular biotechnology to the identification of CPM, particularly well refined oral liquids and injections. What's more, this PCR based method can also be developed to an easy to use and cost-effective visual chip by taking advantage of G-quadruplex based Hybridization Chain Reaction. This study demonstrates that DNA identification of specific Medicinal materials is an efficient and cost-effective way to audit highly processed CPM and will assist in monitoring their quality and legality.
PHARMACOPOEIA METHODS FOR ELEMENTAL ANALYSIS OF MEDICINES: A COMPARATIVE STUDY
Directory of Open Access Journals (Sweden)
Tetiana M. Derkach
2018-01-01
Full Text Available The article is devoted to the problem of quality assurance of medicinal products, namely the determination of elemental impurity concentration compared to permitted daily exposures for and the correct choice analytical methods that are adequate to the formulated tasks. The paper goal is to compare characteristics of four analytical methods recommended by the Pharmacopoeia of various countries to control the content of elemental impurities in medicines, including medicinal plant raw materials and herbal medicines. Both advantages and disadvantages were described for atomic absorption spectroscopy with various atomising techniques, as well as atomic emission spectroscopy and mass spectrometry with inductively coupled plasma. The choice of the most rational analysis method depends on a research task and is reasoned from the viewpoint of analytical objectives, possible complications, performance attributes, and economic considerations. The methods of ICP-MS and GFAAS were shown to provide the greatest potential for determining the low and ultra-low concentrations of chemical elements in medicinal plants and herbal medicinal products. The other two methods, FAAS and ICP-AES, are limited to the analysis of the main essential elements and the largest impurities. The ICP-MS is the most efficient method for determining ultra-low concentrations. However, the interference of mass peaks is typical for ICP-MS. It is formed not only by impurities but also by polyatomic ions with the participation of argon, as well as atoms of gases from the air (C, N and O or matrices (O, N, H, P, S and Cl. Therefore, a correct sample preparation, which guarantees minimisation of impurity contamination and loss of analytes becomes the most crucial stage of analytical applications of ICP-MS. The detections limits for some chemical elements, which content is regulated in modern Pharmacopoeia, were estimated for each method and analysis conditions of medicinal plant raw
[Establishment of traceability system of Chinese medicinal materials' quality].
Qi, Yao-dong; Gao, Shi-man; Liu, Hai-tao; Li, Xi-wen; Wei, Jian-he; Zhang, Ben-gang; Sun, Xiao-bo; Xiao, Pei-gen
2015-12-01
The quality of Chinese medicinal materials relates greatly to the clinical curative effect and security. In order to ensure the quality and safety of Chinese medicinal materials, a systematic and operable traceability system needs to be established. It can realize the whole process of quality and safety management of Chinese medicinal materials "from production to consumption" through recording and inquiring information and recalling defective products, which is an important direction for the future development of traditional Chinese medicine. But it is still at the exploration and trial stage. In this paper, a framework of Chinese medicinal materials' quality and safety traceability system was established on the basis of the domestic and international experience about the construction of food and agricultural products traceability systems. The relationship between traceability system of Chinese medicinal materials' quality and GAP, GMP, GSP was analyzed, and the possible problems and the corresponding solutions were discussed.
Brand, Eric; Leon, Christine; Nesbitt, Mark; Guo, Ping; Huang, Ran; Chen, Hubiao; Liang, Li; Zhao, Zhongzhen
2017-03-22
Many Chinese medicinal materials (CMMs) have changed over centuries of use, particularly in terms of their botanical identity and processing methods. In some cases, these changes have important implications for safety and efficacy in modern clinical practice. As most previous research has focused on clarifying the evolution of CMMs by analyzing traditional Chinese materia medica ("bencao") literature, assessments of historical collections are needed to validate these conclusions with material evidence. Historical collections of Chinese medicines reveal the market materials in circulation at a given moment in time, and represent an underexploited resource for analyzing the evolution of Chinese herbal medicines. This study compares specimens from a rare collection of CMMs from the 1920s with contemporary market materials; by highlighting examples of changes in botanical identity and processing that remain relevant for safe clinical practice in the modern era, this work aims to stimulate further research into previously unexplored historical collections of Chinese medicines. 620 specimens of CMMs that were collected from Chinese pharmacies in the Malay peninsula in the 1920s were examined macroscopically and compared with current pharmacopoeia specifications and authentic contemporary samples. These historical specimens, which are stored in the UK in the Economic Botany Collections (EBC) of Royal Botanic Gardens Kew, were morphologically examined, photographed, and compared to authentic CMMs stored at the Bank of China (Hong Kong) Chinese Medicines Center at Hong Kong Baptist University, as well as authentic herbarium-vouchered specimens from the Leon Collection (LC) at the Kew EBC. Case studies were selected to illustrate examples of historical changes in botanical identity, used plant parts, and processing methods. This investigation confirmed that confusion due to shared common names and regional variations in the botanical identity of certain CMMs has been a
Directory of Open Access Journals (Sweden)
Dalibor Milojko Đenadić
2013-06-01
Full Text Available The fixator is a medical device that provides support to fractured biological structures. Metal biomaterials are mainly used for replacing broken or damaged hard tissues such as bones because of their high strenght, toughness and corrosion resistance. Materials such as stainless steel, titanium and aluminium alloys (Ti-6Al-4V, cobalt and chromium alloys, composite materials and other biocompatible materials are used in orthopedy for the stabilization of connective tissue injuries or as a substitute for the bone tissues. Fixators are classified according to the place of installation to external and internal fixators. Widely used medical fixators are pins, rods plates, screws, pipes, wires, nails and external fixators. Conventional and non-conventional methods of processing are used in the production process for all types of fixators. Introduction Fixators are medical devices manufactured to support damaged biological structures. In the field of orthopedic surgery that deals with skeletal disorders such as bone, spine, joints, muscles and tendons injuries and diseases, various metals, titanium and cobalt alloys etc. are used to stabilize the supporting tissue injuries or as a substitute for bone tissues. Metallic implants are frequently used in orthopedic surgery as joint prosthesis (hip, knee and elbow fracture fixation devices (plates, screws, external fixators and devices for the fixation of the spine. In principle, fixators are devided into external and internal ones, depending on the place of installation (outside or inside the body. The most common types of medical fixators are pins, rods and plates. This paper presents some of the most common materials used for the production of fixators, their processing and possibilties of use in medicine for various purposes. Types of fixators and materials used for their production Nowadays, biocompatible materials are usually used for the production of fixators and implants. These materials show good
Directory of Open Access Journals (Sweden)
Bishnu Prasad Pandey
2017-12-01
Full Text Available Aim: The main aims of the study were to evaluate the phytochemicals, antioxidant, antibacterial and chemical constituents of storage medicinal plant materials used as a traditional medicine in Nepal. Methods: Phytochemical screening, total phenolic content, total flavonoid content, antibacterial activities, anti-oxidant assay of the crude extract (water, methanol, n-hexane and acetone were carried out to identify the biological activities and phytonutrients present in the different extract. The chemical constituents present in the crude extract were analyzed using the high performance liquid chromatography (HPLC equipped with UV detector. Results: Evaluated medicinal plant materials were found to have diverse phytonutrients. Results revealed that methanol extract of Pakhanved and Jethimadhu have highest total flavonoids and polyphenol content. Among the selected medicinal plant materials Jethimadhu extract revealed the highest antioxidant activities. Furthermore, evaluated medicinal plants extract were found to exert a range of in vitro growth inhibition activity against both gram positive and gram negative species. The highest antibacterial activities were observed in the case of methanol extract, whereas, least activity was observed with the hexane extract. HPLC analysis of the acetone extract of Jethimadhu reveals the presence of diosmetin. Conclusions: Our result revealed that among the five evaluated medicinal plant materials, Jethimadhu extract revealed biological activities and exhibits a higher amount of polyphenol and flavonoid content. [J Complement Med Res 2017; 6(4.000: 369-377
The application of nuclear-medicine methods in veterinary medicine
International Nuclear Information System (INIS)
Simpraga, M.; Kraljevic, P.; Dodig, D.
1996-01-01
X-radiography and ultrasound imaging are well established and widely used in veterinary practice, but it is not the same situation with radioisotope imaging. In veterinary practice the above mentioned methods of nuclear medicine are developed only in two countries in Europe. That is not doubt due, so bar, to the difficulties in obtaining satisfactory supply of radioisotopes and to the relatively high cost of scanning equipment. However, in collaboration with the Department of Radiation Protection and Nuclear Medicine of the Medical Faculty in Zagreb, Croatia, we have chance to develop the use of those methods in clinical veterinary practice in Zagreb. That is way in this paper an overview of the application of radioisotopes imaging in veterinary medicine is given. In small animals skeletal changes, lung perusions, brain lesions, space occupying lesions in the liver and its function and hearth function can be usefully searched by a gamma camera and its associated computer. In equine practice scintigraphy of bones, liver, hearth, pulmonary circulation and ventilation is described. The largest amount of radioactive material is used during gamma camera scanning of the skeletons of horses. In this cases the radiation dose 1-2 m from the animal is approximately 3 μSv/h. That is why the protection of personal involved in radioisotope scanning in veterinary medicine must be also regulated by low of radiation protection. Also, the animals should be confined to a controlled area for 2-3 days after scanning before being returned to their owners. After this period the area must be cleaned. (author)
Patent applications for using DNA technologies to authenticate medicinal herbal material
Directory of Open Access Journals (Sweden)
Chan Albert
2009-11-01
Full Text Available Abstract Herbal medicines are used in many countries for maintaining health and treating diseases. Their efficacy depends on the use of the correct materials, and life-threatening poisoning may occur if toxic adulterants or substitutes are administered instead. Identification of a medicinal material at the DNA level provides an objective and powerful tool for quality control. Extraction of high-quality DNA is the first crucial step in DNA authentication, followed by a battery of DNA techniques including whole genome fingerprinting, DNA sequencing and DNA microarray to establish the identity of the material. New or improved technologies have been developed and valuable data have been collected and compiled for DNA authentication. Some of these technologies and data are patentable. This article provides an overview of some recent patents that cover the extraction of DNA from medicinal materials, the amplification of DNA using improved reaction conditions, the generation of DNA sequences and fingerprints, and the development of high-throughput authentication methods. It also briefly explains why these patents have been granted.
An Emerging Complimentary Medicine-Yolk Oil Made from Heating Method
Directory of Open Access Journals (Sweden)
Tsung-Ming Hu
2012-07-01
Full Text Available Yolk oil is common in Asia. According to the Flora Sinensis, yolk oil is a multipurpose medicine, with specific dermatological and fever indications. Nowadays, it is generally used as a complimentary medicine for heart diseases. Yolk oil can be made from heating or chemical extraction method. It is generally believed that yolk oil made from heating (YOheat method is more effective as a medicine than that from extraction (YOext. The technical details of the heating method remain an issue of argument, including the degree of char and the threat of carcinogens formed during the heating process. Most yolk oil related studies used YOext as research material. Nevertheless, animal studies have showed that YOheat reduced triglycerides and total cholesterol in rodent liver. It is expected an easy-to-make complimentary medicine like YOheat may become even more common and thus evidence based studies should be conducted to verify its pharmacological effects and safety.
[Status of traditional Chinese medicine materials seed and seedling breeding bases].
Li, Ying; Huang, Lu-Qi; Zhang, Xiao-Bo; Wang, Hui; Cheng, Meng; Zhang, Tian; Yang, Guang
2017-11-01
Seeds and seedlings are the material basis of traditional Chinese medicine materials production, and the construction of traditional Chinese medicine materials seed and seedling breeding bases is beneficial to the production of high-quality traditional Chinese medicine materials. The construction of traditional Chinese medicine materials seed and seedling breeding bases is one of the major topics of Chinese medica resources census pilot. Targets, tasks of traditional Chinese medicine materials seed and seedling breeding bases based on Chinese medica resources census pilot were expounded.Construction progress including hardware construction, germplasm conservation and breeding, procedures and standardsestablishment, social servicesare presented. Development counter measures were proposed for the next step: perfect the standard and system, maintain and strengthen the breeding function, strengthen the cultivation of multi-level talents, explore market development model, joint efforts to deepen services and development. Copyright© by the Chinese Pharmaceutical Association.
[The methods of Western medicine in on ancient medicine].
Ban, Deokjin
2010-06-30
The treatise On Ancient Medicine attests that questions of method were being debated both in medicine and in philosophy and is important evidence of cross-discipline methodological controversy. The treatise On Ancient Medicine is the first attempt in the history of Greek thought to provide a detailed account of the development of a science from a starting point in observation and experience. The author of it criticizes philosophical physicians who attempt to systematized medicine by reducing it to the interaction of one or more of the opposites hot, cold, wet, and dry, factors. He regards the theory of his opponents as hypothesis(hypothesis). Medicine has long been in possession of both an archē and a hodos, a principle and a method, which have enabled it to make discoveries over a long period of time. As far as method is concerned, the traditional science of medicine attained the knowledge of the visible by starting from observation and experience, but it recommended the use of reasoning and analogies with familiar objects as a means of learning about the invisible. It also utilized inference from the visible to the visible(epilogismos) and inference from the visible to the invisible(analogismos). The use of analogy as a means of learning about the obscure was also part of the common heritage of early philosophy and medicine. But the author's use of the analogical method distinguishes it from Empedocles' well-known analogy comparisons of the eye to a lantern and the process of respiration to the operations of a clepsydra. According to the author, traditional science of medicine used functional analogy like wine example and cheese example to know the function of humors within the body and utilized structured analogy like a tube example and a cupping instrument example to acknowledge an organ or structure within the body. But the author didn't distinguish between the claim that medicine has a systematic method of making discoveries and very different claim that it
Chromý, Vratislav; Vinklárková, Bára; Šprongl, Luděk; Bittová, Miroslava
2015-01-01
We found previously that albumin-calibrated total protein in certified reference materials causes unacceptable positive bias in analysis of human sera. The simplest way to cure this defect is the use of human-based serum/plasma standards calibrated by the Kjeldahl method. Such standards, commutative with serum samples, will compensate for bias caused by lipids and bilirubin in most human sera. To find a suitable primary reference procedure for total protein in reference materials, we reviewed Kjeldahl methods adopted by laboratory medicine. We found two methods recommended for total protein in human samples: an indirect analysis based on total Kjeldahl nitrogen corrected for its nonprotein nitrogen and a direct analysis made on isolated protein precipitates. The methods found will be assessed in a subsequent article.
Analyzing readability of medicines information material in Slovenia
Kasesnik, Karin; Kline, Mihael
2011-01-01
Objective: Readability has been claimed to be an important factor for understanding texts describing health symptoms and medications. Such texts may be a factor which indirectly affects the health of the population. Despite the expertise of physicians, the readability of information sources may be important for acquiring essential treatment information. The aim of this study was to measure the readability level of medicines promotion material in Slovenia. Methods: The Flesch readability formula was modified to comply with Slovene texts. On the basis of determining the Slovene readability algorithm, the readability ease related to the readability grade level of different Slovene texts was established. In order to estimate an adjustment of the texts to the recommended readability grade level of the targeted population, readability values of English texts were set. One sample t-test and standard deviations from the arithmetic mean values were used as statistical tests. Results: The results of the research showed low readability scores of the Slovene texts. Difficult readability values were seen in different types of examined texts: in patient information leaflets, in the summaries of product characteristics, in promotional materials, while describing over-the-counter medications and in the materials for creating disease awareness. Especially low readability values were found within the texts belonging to promotional materials intended for the physicians. None of researched items, not even for the general public, were close to primary school grade readability levels and therefore could not be described as easily readable. Conclusion: This study provides an understanding of the level of readability of selected Slovene medicines information material. It was concluded that health-related texts were not compliant with general public or with healthcare professional needs. PMID:23093886
Identification of processed Chinese medicinal materials using DNA mini-barcoding.
Song, Ming; Dong, Gang-Qiang; Zhang, Ya-Qin; Liu, Xia; Sun, Wei
2017-07-01
Most of Chinese medicinal herbs are subjected to traditional processing procedures, including stir-frying, charring, steaming, boiling, and calcining before they are released into dispensaries. The marketing and identification of processed medicinal materials is a growing issue in the marketplace. However, conventional methods of identification have limitations, while DNA mini-barcoding, based on the sequencing of a short-standardized region, has received considerable attention as a new potential means to identify processed medicinal materials. In the present study, six DNA barcode loci including ITS2, psbA-trnH, rbcL, matK, trnL (UAA) intron and its P6 loop, were employed for the authentication of 45 processed samples belonging to 15 species. We evaluated the amplification efficiency of each locus. We also examined the identification accuracy of the potential mini-barcode locus, of trnL (UAA) intron P6 loop. Our results showed that the five primary barcode loci were successfully amplified in only 8.89%-20% of the processed samples, while the amplification rates of the trnL (UAA) intron P6 loop were higher, at 75.56% successful amplification. We compared the mini-barcode sequences with Genbank using the Blast program. The analysis showed that 45.23% samples could be identified to genus level, while only one sample could be identified to the species level. We conclude that trnL (UAA) p6 loop is a candidate mini-barcode that has shown its potential and may become a universal mini-barcode as complementary barcode for authenticity testing and will play an important role in medicinal materials control. Copyright © 2017 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.
The phenomenon of microscale flow and mass transfer in medicinal herb materials
Energy Technology Data Exchange (ETDEWEB)
Yang, J.H.; Di, Q.Q.; Sun, M.D. [Tianjin Univ., Tianjin (China). School of Mechanical Engineering; Zhang, T.J.; Gong, S.X. [Tianjin Inst. of Pharmaceutical Research, Tianjin (China)
2008-07-01
Microwave assisted extraction (MAE) is a combination of a microwave technique and conventional solvent extraction used in the modernization of traditional Chinese medicine. The effective component of medicinal herbs is mostly cellular material which can be released via solvent extraction. The material is diffused to solvents via the porous membrane wall. The structure of herb morphology and characteristics of the solute's molecular weight play an important role in the extraction process of target compounds. Astragalus pieces were chosen for this study in which an ultra-filtration membrane method was used to determine the molecular weight distribution characteristics of Astragalus water extraction liquid in the process of MAE. The fine structure of matrix materials was also characterized by scanning election microscopy (SEM). The phenomenon of mass flow and mass transfer in the plant porous media was discussed along with the enhancement mechanism of microwave field on medicinal plant solvent extraction. The results showed that the water-soluble components in the parenchyma cells of Astragalus pieces pass through the plasmodesma with a diameter of 10 nm to adjacent cell, then through an aperture with a diameter of 0.1 {mu}m to 1 {mu}m into a trachea with a diameter of about 10 {mu}m. The water-soluble components then come onto the surface of matrix material and the main solution via the trachea. The main mass transfer occurs by the trachea and its aperture. It was concluded that in order to promote the dissolution of effective components in medicinal herb in the extraction process, a suitable extraction technology is needed to maintain the permeability of transportation tissue and parenchyma in materials. 11 refs., 1 tab., 3 figs.
Directory of Open Access Journals (Sweden)
Elena Gabriela Oltean
2014-06-01
Full Text Available The organic or inorganic impurities in the veterinary medicinal product can derive from starting materials, manufacturing process, incomplete purification, inappropriate storage. The acceptable levels of impurities in pharmaceuticals are estimated by comparison with standard solutions, according to the appropriate monographs. Forced degradation studies determine the stability of the method of dosage for the active compounds and for the entire finished product under excessive accelerated degradation conditions. They also provide information on degradation pathways and selectivity of analytical methods applied. The information provided by the degradation studies on the active compound and finished pharmaceutical product should demonstrate the specificity of the analytical method regarding impurities. Forced degradation studies should demonstrate that the impurities and degradation products generated do not interfere with the active compound. The current forced degradation methods consist of acid hydrolysis, basic hydrolysis, oxidation, exposure of the medicinal product to temperature and light. HPLC methods are an integral analytical instrument for the analysis of the medicinal product. The HPLC method should be able to separate, detect and quantify various specific degradation products that can appear after manufacture or storage of the medicinal product, as well as new elements appearing after synthesis. FDA and ICH guidelines recommend the enclosure of the results, including the chromatograms specific to the forced degradation-subjected medicinal product, in the documentation for marketing authorization. Using HPLC methods in forced degradation studies on medicinal products provides relevant information on the method of determination for the formulation of the medicinal product, synthesis product, packaging methods and storage.
Sparse QSAR modelling methods for therapeutic and regenerative medicine
Winkler, David A.
2018-02-01
The quantitative structure-activity relationships method was popularized by Hansch and Fujita over 50 years ago. The usefulness of the method for drug design and development has been shown in the intervening years. As it was developed initially to elucidate which molecular properties modulated the relative potency of putative agrochemicals, and at a time when computing resources were scarce, there is much scope for applying modern mathematical methods to improve the QSAR method and to extending the general concept to the discovery and optimization of bioactive molecules and materials more broadly. I describe research over the past two decades where we have rebuilt the unit operations of the QSAR method using improved mathematical techniques, and have applied this valuable platform technology to new important areas of research and industry such as nanoscience, omics technologies, advanced materials, and regenerative medicine. This paper was presented as the 2017 ACS Herman Skolnik lecture.
STUDY OF ACAROID MITES POLLUTION IN STORED FRUIT-DERIVED CHINESE MEDICINAL MATERIALS.
Xu, Li-fa; Li, He-xia; Xu, Peng-fei; Xu, Hai-feng; Li, Chao-pin
2015-08-01
to investigate the species and breeding density of acaroid mites in stored fruit-derived Chinese medicinal materials in Anhui province. samples of stored fruit-derived Chinese medicinal materials were collected from 30 herb stores and storehouses in 17 Anhui cities, where the breeding acaroids mites were detected. 20 species of acaroids mites were found in 33 samples, belonging to 15 genus, 5 families of the acaridae respectively, among which T. putrescentiae, A. farinae, C. lactis, and C. berlesei are predominant species. stored fruit-derived Chinese medicinal materials in Anhui areas suffer from serious acaroid mites pollution. Therefore, proactive measures should be taken to control acaroid mites from breeding in an effort to reduce the harm on medicinal materials. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.
Search of new scintillation materials for nuclear medicine application
Korzhik, M
2001-01-01
Oxide crystals have a great potential to develop new advanced scintillation materials which are dense, fast, and bright. This combination of parameters, when combined to affordable price, gives a prospect for materials to be applied in nuclear medicine devices. Some of them have been developed for the last two decades along the line of rear-earth (RE) garnet (RE//3Al//5O//1//2) oxiorthosilicate (RE//2SiO//5) and perovskite (REAlO//3) crystals doped with Ce ions. Among recently developed oxide materials the lead tungstate scintillator (PWO) becomes the most used scintillation materials in high energy physics experiments due to its application in CMS and ALICE experiments at LHC. In this paper we discuss scintillation properties of some new heavy compounds doped with Ce as well as light yield improvement of PWO crystals to apply them in low energy physics and nuclear medicine. 18 Refs.
New applications of particle accelerators in medicine, materials science, and industry
International Nuclear Information System (INIS)
Knapp, E.A.
1981-01-01
Recently, the application of particle accelerators to medicine, materials science, and other industrial uses has increased dramatically. A random sampling of some of these new programs is discussed, primarily to give the scope of these new applications. The three areas, medicine, materials science or solid-state physics, and industrial applications, are chosen for their diversity and are representative of new accelerator applications for the future
Analysis of medicinal plant extracts by neutron activation method
International Nuclear Information System (INIS)
Vaz, Sandra Muntz
1995-01-01
This dissertation has presented the results from analysis of medicinal plant extracts using neutron activation method. Instrumental neutron activation analysis was applied to the determination of the elements Al, Br, Ca, Ce, Cl, Cr, Cs, Fe, K, La, Mg, Mn, Na, Rb, Sb, Sc and Zn in medicinal extracts obtained from Achyrolcline satureoides DC, Casearia sylvestris, Centella asiatica, Citrus aurantium L., Solano lycocarpum, Solidago microglossa, Stryphnondedron barbatiman and Zingiber officinale R. plants. The elements Hg and Se were determined using radiochemical separation by means of retention of Se in HMD inorganic exchanger and solvent extraction of Hg by bismuth diethyl-dithiocarbamate solution. Precision and accuracy of the results have been evaluated by analysing reference materials. The therapeutic action of some elements found in plant extracts analyzed was briefly discussed
Ruso, Juan M; Sartuqui, Javier; Messina, Paula V
2015-01-01
Bone is a biologically and structurally sophisticated multifunctional tissue. It dynamically responds to biochemical, mechanical and electrical clues by remodelling itself and accordingly the maximum strength and toughness are along the lines of the greatest applied stress. The challenge is to develop an orthopaedic biomaterial that imitates the micro- and nano-structural elements and compositions of bone to locally match the properties of the host tissue resulting in a biologically fixed implant. Looking for the ideal implant, the convergence of life and materials sciences occurs. Researchers in many different fields apply their expertise to improve implantable devices and regenerative medicine. Materials of all kinds, but especially hierarchical nano-materials, are being exploited. The application of nano-materials with hierarchical design to calcified tissue reconstructive medicine involve intricate systems including scaffolds with multifaceted shapes that provides temporary mechanical function; materials with nano-topography modifications that guarantee their integration to tissues and that possesses functionalized surfaces to transport biologic factors to stimulate tissue growth in a controlled, safe, and rapid manner. Furthermore materials that should degrade on a timeline coordinated to the time that takes the tissues regrow, are prepared. These implantable devices are multifunctional and for its construction they involve the use of precise strategically techniques together with specific material manufacturing processes that can be integrated to achieve in the design, the required multifunctionality. For such reasons, even though the idea of displacement from synthetic implants and tissue grafts to regenerative-medicine-based tissue reconstruction has been guaranteed for well over a decade, the reality has yet to emerge. In this paper, we examine the recent approaches to create enhanced bioactive materials. Their design and manufacturing procedures as well
Luo, Min; Song, Zhi-Qin; Yang, Ping-Fei; Liu, Hai; Yang, Zai-Gang; Wu, Ming-Kai
2017-01-01
Using four Uncariae Cum Uncis materials including Uncaria sinensis (HGT), U. hirsutea (MGT), Jianhe U. rhynchophylla (JHGT) and U. rhynchophylla(GT) as the research objects, the correlations between medicinal materials' yield and photosynthetic ecophysiology-factors in the plant exuberant growth period were studied. Results showed that the Uncaria plants net photosynthetic rate (Pn) changed by unimodal curve. There was not "midday depression" phenomenon. There was a different relationship among the photosynthetic ecophysiology-factors and between photosynthetic ecophysiology-factors and medicinal materials' yield. Pn,Tl,Gs had a significant correlation with medicinal materials' yield(M)and were the most important factors of growth. Copyright© by the Chinese Pharmaceutical Association.
Material science as basis for nuclear medicine: Holmium irradiation for radioisotopes production
Usman, Ahmed Rufai; Khandaker, Mayeen Uddin; Haba, Hiromitsu; Otuka, Naohiko
2018-05-01
Material Science, being an interdisciplinary field, plays important roles in nuclear science. These applications are seen in weaponry, armoured vehicles, accelerator structure and development, semiconductor detectors, nuclear medicine and many more. Present study presents the applications of some metals in nuclear medicine (radioisotope production). The charged-particle-induced nuclear reactions by using cyclotrons or accelerators have become a very vital feature of the modern nuclear medicine. Realising the importance of excitation functions for the efficient production of medical radionuclides, some very high purity holmium metals are generally prepared or purchased for bombardment in nuclear accelerators. In the present work, various methods to obtain pure holmium for radioisotope production have been discussed while also presenting details of our present studies. From the experimental work of the present studies, some very high purity holmium foils have been used in the work for a comprehensive study of residual radionuclides production cross-sections. The study was performed using a stacked-foil activation technique combined with γ-ray spectrometry. The stack was bombarded with 50.4 MeV alpha particle beam from AVF cyclotron of RI Beam Factory, Nishina Centre for Accelerator-Based Science, RIKEN, Japan. The work produced thulium radionuclides useful in nuclear medicine.
Ganta, Abhishek; Yi, Paul H; Hussein, Khalil; Frank, Rachel M
2014-04-01
Although studies have revealed high readability levels of orthopedic patient education materials, no study has evaluated sports medicine-related patient education materials. We conducted a study to assess the readability of sports medicine-related patient education materials from the American Academy of Orthopaedic Surgeons (AAOS) and the American Orthopaedic Society for Sports Medicine (AOSSM). All sports medicine patient education articles available online in 2012 from the AAOS and the AOSSM, including the Stop Sports Injuries Campaign (STOP), were identified, and their readability was assessed with the Flesch-Kinkaid (FK) readability test. Mean overall FK grade level of the 170 articles reviewed (104 from AAOS, 36 from AOSSM, 30 from STOP) was 10.2. Mean FK levels for the 3 sources were 9.5 (AAOS), 11.0 (AOSSM), and 11.5 (STOP) (P = .16). Fifteen (8.8%) of the 170 articles had a readability level at or below eighth grade (average reading level of US adults); only 2 (1.2%) of the 170 articles were at or below the recommended sixth-grade level. The majority of sports medicine-related patient education materials from AAOS and AOSSM had reading levels higher than recommended, indicating that the majority of the patient population may find it difficult to comprehend these articles.
Current Perspective in the International Trade of Medicinal Plants Material: An Update.
Vasisht, Karan; Sharma, Neetika; Karan, Maninder
2016-01-01
The recent years have seen an increased interest in medicinal plants together with the therapeutic use of phytochemicals. Medicinal plants are utilized by the industry for the production of extracts, phytopharmaceuticals, nutraceuticals and cosmeceuticals and their use is expected to grow faster than the conventional drugs. The enormous demand of medicinal plant material has resulted in huge trade both at domestic and international levels. The trade data of medicinal plant material with commodity code HS 1211 (SITC.4, code 292.4) and their derived/related products which are traded under different commodity codes has been acquired from COMTRADE, Trade Map, country reports, technical documents etc for the period 2001 to 2014. The data was analyzed using statistical tools to draw conclusions. The significant features of the global trade; the leading source, consumer, import and export countries; and the striking trends are presented. The trade of the ten key countries and the selected important items is also discussed in detail. The conservative figure of trade of medicinal plants materials and their derived/related products including extracts, essential oils, phytopharmaceuticals, gums, spices used in medicine, tannins for pharmaceutical use, ingredients for cosmetics etc. as calculated from the global export data for the year 2014 is estimated at USD 33 billion. The average global export in medicinal plants under HS 1211 for the fourteen year period was USD 1.92 billion for 601,357 tons per annum and for the year 2014 it stood at 702,813 tons valued at USD 3.60 billion. For the studied period, an annual average growth rate (AAGR) of 2.4% in volumes and 9.2% in values of export was observed. Nearly 30% of the global trade is made up by top two countries of the import and export. China and India from Asia; Egypt and Morocco from Africa; Poland, Bulgaria and Albania from Europe; Chile and Peru from South America are important supply sources. The USA, Japan and Europe
Integrative methods for analyzing big data in precision medicine.
Gligorijević, Vladimir; Malod-Dognin, Noël; Pržulj, Nataša
2016-03-01
We provide an overview of recent developments in big data analyses in the context of precision medicine and health informatics. With the advance in technologies capturing molecular and medical data, we entered the area of "Big Data" in biology and medicine. These data offer many opportunities to advance precision medicine. We outline key challenges in precision medicine and present recent advances in data integration-based methods to uncover personalized information from big data produced by various omics studies. We survey recent integrative methods for disease subtyping, biomarkers discovery, and drug repurposing, and list the tools that are available to domain scientists. Given the ever-growing nature of these big data, we highlight key issues that big data integration methods will face. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Alternative methods for evaluation of non-uniformity in nuclear medicine images
International Nuclear Information System (INIS)
Rasaneh, S.; Rajabi, H.; Hajizadeh, E.
2005-01-01
Non-uniformity test is the most essential in daily quality control procedures of nuclear medicine equipment's. However, the calculation of non-uniformity is hindered due to high level of noise in nuclear medicine data. Non-uniformity may be considered as a type of systematic error while noise is certainly a random error. The present methods of uniformity evaluation are not able to distinguish between systematic and random error and therefore produce incorrect results when noise is significant. In the present study, two hypothetical methods have been tested for evaluation of non-uniformity in nuclear medicine images. Materials and Methods: Using the Monte Carlo method, uniform and non-uniform flood images of different matrix sizes and different counts were generated. The uniformity of the images was calculated using the conventional method and proposed methods. The results were compared with the known non-uniformity data of simulated images. Results: It was observed that the value of integral uniformity never went below the recommended values except in small matrix size of high counts (more than 80 millions counts). The differential uniformity was quite insensitive to the degree of non-uniformity in large matrix size. Matrix size of 64*64 was only found to be suitable for the calculation of differential uniformity. It was observed that in uniform images, a small amount of non-uniformity changes the p-value of Kolmogorov-Smirnov test and noise amplitude of fast fourier transformation test significantly while the conventional methods failed to detect the nonuniformity. Conclusion: The conventional methods do not distinguish noise, which is always present in the data and occasional non-uniformity at low count density. In a uniform intact flood image, the difference between maximum and minimum pixel count (the value of integral uniformity) is much more than the recommended values for non-uniformity. After filtration of image, this difference decreases, but remains high
International Nuclear Information System (INIS)
Chavez, Miguel
1997-03-01
This manual of use and accounting of material radioactive and procedures of radiological safety tries to facilitate workings of protection of material radioactive in services of medicine nuclear, during diagnosis (examinations with x-rays, or those that are made in nuclear medicine), or during the processing of diseases, mainly of the carcinomas (x-ray)
Wei, Ying-Jie; Jing, Li-Jun; Zhan, Yang; Sun, E; Jia, Xiao-Bin
2014-05-01
To break through the restrictions of the evaluation model and the quantity of compounds by using the two-dimensional zebrafish model combined with chromatographic techniques, and establish a new method for the high-throughput screening of active anti-osteoporosis components. According to the research group-related studies and relevant foreign literatures, on the basis of the fact that the zebrafish osteoporosis model could efficiently evaluate the activity, the zebrafish metabolism model could efficiently enrich metabolites and the chromatographic techniques could efficiently separate and analyze components of traditional Chinese medicines, we proposed that the inherent combination of the three methods is expected to efficiently decode in vivo and in vitro efficacious anti-osteoporosis materials of traditional Chinese medicines. The method makes it simple and efficient in the enrichment, separation and analysis on components of traditional Chinese medicines, particularly micro-components and metabolites and the screening anti-osteoporosis activity, fully reflects that efficacious materials of traditional Chinese medicines contain original components and metabolites, with characteristic of "multi-components, multi-targets and integral effect", which provides new ideas and methods for the early and rapid discovery of active anti-osteoporosis components of traditional Chinese medicines.
Materials and methods for higher performance screen-printed flexible MRI receive coils.
Corea, Joseph R; Lechene, P Balthazar; Lustig, Michael; Arias, Ana C
2017-08-01
To develop methods for characterizing materials used in screen-printed MRI coils and improve signal-to-noise ratio (SNR) with new lower-loss materials. An experimental apparatus was created to characterize dielectric properties of plastic substrates used in receive coils. Coils were fabricated by screen printing conductive ink onto several plastic substrates. Unloaded and sample loaded quality factor (Q Unloaded /Q Loaded ) measurements and scans on a 3T scanner were used to characterize coil performance. An experimental method was developed to describe the relationship between a coil's Q Unloaded and the SNR it provides in images of a phantom. In addition, 3T scans of a phantom and the head of a volunteer were obtained with a proof-of-concept printed eight-channel array, and the results were compared with a commercial 12-channel array. Printed coils with optimized substrates exhibited up to 97% of the image SNR when compared with a traditional coil on a loading phantom. Q Unloaded and the SNR of coils were successfully correlated. The printed array resulted in images comparable to the quality given by the commercial array. Using the proposed methods and materials, the SNR of printed coils approached that of commercial coils while using a new fabrication technique that provided more flexibility and close contact with the patient's body. Magn Reson Med 78:775-783, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.
Sampling and sample preparation methods for the analysis of trace elements in biological material
International Nuclear Information System (INIS)
Sansoni, B.; Iyengar, V.
1978-05-01
The authors attempt to give a most systamtic possible treatment of the sample taking and sample preparation of biological material (particularly in human medicine) for trace analysis (e.g. neutron activation analysis, atomic absorption spectrometry). Contamination and loss problems are discussed as well as the manifold problems of the different consistency of solid and liquid biological materials, as well as the stabilization of the sample material. The process of dry and wet ashing is particularly dealt with, where new methods are also described. (RB) [de
[Sampling in quality control of medicinal materials-A case of Epimedium].
Wang, Chuanyi; Cao, Jinyi; Liang, Yun; Huang, Wenhua; Guo, Baolin
2009-04-01
To investigate the effect of the different individual number of sampling on the assay results of the medicinal materials. Epimedium pubescens and E. brevicornu were used as samples. The 6 sampling levels were formulated as 1 individual, 5, 10, 20, 30, 50 individuals mix, each level with 3 parallels and 1 individual level5 parallels. The contents of epimedin C and icariin, and the peak areas of epimedin A, epimedin B, rhamnosyl icarisid II and icarisid II in all samples were analyzed by HPLC. The variation degree varied with species and chemical constituents, but the RSD and the deviation from the true value decreased with the increase of individual number on the same chemical constituent. The sampling number should be more than 10 individuals in quality control of Epimedium, and 50 or more individuals would be better for representing the quality of medicinal materials.
Directory of Open Access Journals (Sweden)
Zhao Sandy
2009-09-01
Full Text Available Abstract This article provides an overview on the regulations of Chinese medicinal materials (CMMs in various countries and regions. Harmonization of CMM monographs would provide standards for the quality control of CMM products and play an important role in the modernization and globalization of Chinese medicine. A harmonized regulatory system would improve the quality of CMMs thereby ensuring the safety of the products and assisting Chinese medicine practitioners in their practice. The fast growing demand worldwide for traditional medicines calls for harmonized monographic standards to safeguard the safety and quality of CMM products.
Mathematical methods in medicine: neuroscience, cardiology and pathology
Amigó, José M.
2017-01-01
The application of mathematics, natural sciences and engineering to medicine is gaining momentum as the mutual benefits of this collaboration become increasingly obvious. This theme issue is intended to highlight the trend in the case of mathematics. Specifically, the scope of this theme issue is to give a general view of the current research in the application of mathematical methods to medicine, as well as to show how mathematics can help in such important aspects as understanding, prediction, treatment and data processing. To this end, three representative specialties have been selected: neuroscience, cardiology and pathology. Concerning the topics, the 12 research papers and one review included in this issue cover biofluids, cardiac and virus dynamics, computational neuroscience, functional magnetic resonance imaging data processing, neural networks, optimization of treatment strategies, time-series analysis and tumour growth. In conclusion, this theme issue contains a collection of fine contributions at the intersection of mathematics and medicine, not as an exercise in applied mathematics but as a multidisciplinary research effort that interests both communities and our society in general. This article is part of the themed issue ‘Mathematical methods in medicine: neuroscience, cardiology and pathology’. PMID:28507240
Mathematical methods in medicine: neuroscience, cardiology and pathology.
Amigó, José M; Small, Michael
2017-06-28
The application of mathematics, natural sciences and engineering to medicine is gaining momentum as the mutual benefits of this collaboration become increasingly obvious. This theme issue is intended to highlight the trend in the case of mathematics. Specifically, the scope of this theme issue is to give a general view of the current research in the application of mathematical methods to medicine, as well as to show how mathematics can help in such important aspects as understanding, prediction, treatment and data processing. To this end, three representative specialties have been selected: neuroscience, cardiology and pathology. Concerning the topics, the 12 research papers and one review included in this issue cover biofluids, cardiac and virus dynamics, computational neuroscience, functional magnetic resonance imaging data processing, neural networks, optimization of treatment strategies, time-series analysis and tumour growth. In conclusion, this theme issue contains a collection of fine contributions at the intersection of mathematics and medicine, not as an exercise in applied mathematics but as a multidisciplinary research effort that interests both communities and our society in general.This article is part of the themed issue 'Mathematical methods in medicine: neuroscience, cardiology and pathology'. © 2017 The Author(s).
Physical foundations of image quality in nuclear medicine. Methods for its evaluation
International Nuclear Information System (INIS)
Perez Diaz, Marlen; Diaz Rizo, Oscar
2007-01-01
The present paper describes the main physical factors which characterize image quality in Nuclear Medicine from the physical and mathematical point of view. A conceptual description of how image system (gamma camera) degrades the information emitted by the object is also presented. A critical review of some qualitative and quantitative methods for grading image quality, collateral to equipment quality control, follows this material. Among these methods we present the ROC analysis, Clustering Techniques and Discriminant Analysis. As a part of the two last ones, we also analyze the main factors which determine image quality and how they produce changes in the quantitative physical variables measured on the images. A comparison among the methods is also presented, remarking their utility to check image quality, as well as the main advantages and disadvantages of each one (au)
Narayanan, Roshni; Nugent, Rebecca; Nugent, Kenneth
2015-10-01
Accreditation Council for Graduate Medical Education guidelines require internal medicine residents to develop skills in the interpretation of medical literature and to understand the principles of research. A necessary component is the ability to understand the statistical methods used and their results, material that is not an in-depth focus of most medical school curricula and residency programs. Given the breadth and depth of the current medical literature and an increasing emphasis on complex, sophisticated statistical analyses, the statistical foundation and education necessary for residents are uncertain. We reviewed the statistical methods and terms used in 49 articles discussed at the journal club in the Department of Internal Medicine residency program at Texas Tech University between January 1, 2013 and June 30, 2013. We collected information on the study type and on the statistical methods used for summarizing and comparing samples, determining the relations between independent variables and dependent variables, and estimating models. We then identified the typical statistics education level at which each term or method is learned. A total of 14 articles came from the Journal of the American Medical Association Internal Medicine, 11 from the New England Journal of Medicine, 6 from the Annals of Internal Medicine, 5 from the Journal of the American Medical Association, and 13 from other journals. Twenty reported randomized controlled trials. Summary statistics included mean values (39 articles), category counts (38), and medians (28). Group comparisons were based on t tests (14 articles), χ2 tests (21), and nonparametric ranking tests (10). The relations between dependent and independent variables were analyzed with simple regression (6 articles), multivariate regression (11), and logistic regression (8). Nine studies reported odds ratios with 95% confidence intervals, and seven analyzed test performance using sensitivity and specificity calculations
International Nuclear Information System (INIS)
1998-01-01
The All-Polish Symposium Nuclear Techniques in Industry, Medicine, Agriculture and Environment Protection is cyclic (in 3 year period) conference being a broad review of state of art and development of all nuclear branches cooperated with industry and other branches of national economy and public life in Poland. The conference has been divided in one plenary session and 8 problem sessions as follow: Radiation technologies of flue gas purification; radiation technologies in food and cosmetic industry; application of nuclear techniques in environmental studies and earth science; radiometric methods in material engineering; isotope tracers in biological studies and medical diagnostics; radiometric industrial measuring systems; radiation detectors and device; nuclear methods in cultural objects examination. The poster section as well as small exhibition have been also organised
Determination of elementary composition of medicinal plants by Neutron Activation Analysis method
International Nuclear Information System (INIS)
Takamoto, Árissa; Saiki, Mitiko
2017-01-01
The analyzes of medicinal plants are of great interest for the study of the correlation between elements present in them with their therapeutic activities, as well as to identify the toxic elements harmful to health human. In the work, applying the method of analysis by activation with neutrons (NAA), the medicinal plants: Aloe vera (Babosa), Morus nigra sp. (Amoreira) and Moringa oleifera (Moringa) were analysed. The samples were collected in different locations and purchased in a natural products store. The preparation consisted in the cleaning, drying and milling of the leaves. Aliquots of the samples were irradiated with synthetic elements over a period of 16 h and under thermal neutron flux of 5 x 1012 n cm -2 s -1 of the nuclear reactor IEAR-1. The gamma-induced activities were measured on a gamma-ray spectrometer coupled to a detector high resolution. The radioisotopes formed were identified by half-life and energy of the gamma rays and the concentrations of the elements were calculated by the comparative method. The results of the certified reference materials INCT-TL-1 Tea Leaves and INCT-MPH-2 Mixed Polish Herbs showed good precision and accuracy. In the analyzed plants, toxic elements such as Cu and Cd were not detected. Already the As and Sb were detected, but at very low concentrations, on the order of ng g -1 . By NAA method it was possible to determine the concentration of elements As, Br, Ca, Co, Cr, Cs, Fe, K, La, Na, Rb, Sb, Sc and Zn. Results obtained in this work demonstrated the feasibility of applying NAA in the study of medicinal plants
DEFF Research Database (Denmark)
Gruca, Marta; Blach-Overgaard, Anne; Balslev, Henrik
2015-01-01
-medicinal data on African palms, and investigate patterns of palm uses in traditional medicine; and highlight possible under-investigated areas. Materials and methods References were found through bibliographic searches using several sources including PubMed, Embase, and Google Scholar and search engines...... in traditional medicine, with most of the uses related to fruit (and palm oil), root, seed and leaf. Palms were used in traditional medicine mostly without being mixed with other plants, and less commonly in mixtures, sometimes in mixture with products of animal origin. Future ethno-botanical surveys should...... were able to demonstrate the value of palms in traditional medicine, and provide recommendations for the areas that should be targeted in future ethno-botanical surveys....
Reliability studies of diagnostic methods in Indian traditional Ayurveda medicine
DEFF Research Database (Denmark)
Kurande, Vrinda Hitendra; Waagepetersen, Rasmus; Toft, Egon
2013-01-01
as prakriti classification), method development (pulse diagnosis), quality assurance for diagnosis and treatment and in the conduct of clinical studies. Several reliability studies are conducted in western medicine. The investigation of the reliability of traditional Chinese, Japanese and Sasang medicine...
Substance and materiality? The archaeology of Talensi medicine shrines and medicinal practices.
Insoll, Timothy
2011-08-01
Talensi materia medica is varied, encompassing plant, mineral, and animal substances. Healing, medicines, and medicinal practices and knowledge can be shrine-based and linked with ritual practices. This is explored utilising ethnographic data and from an archaeological perspective with reference to future possibilities for research both on Talensi medicine and, by implication, more generally through considering the archaeology of Talensi medicine preparation, use, storage, spread, and disposal. It is suggested that configuring the archaeology of medicine shrines and practices more broadly in terms of health would increase archaeological visibility and research potential.
Methods and quality assurance in environmental medicine. Formation of a RKI-Commission
International Nuclear Information System (INIS)
Eis, D.
2000-01-01
An almost bewildering number of widely differing methods and techniques, often not validated, are being applied often inappropriately in the field of environmental medicine to answer questions regarding exposure assessment, diagnosis, treatment, counselling and prevention. Therefore, quality control within the field of environmental medicine is quite problematic. A primary goal of the newly formed RKI-Commission 'Methods and Quality Assurance in Environmental Medicine' is to form a panel of experts in the field, who evaluate the situation and generate consensus documents containing respective recommendations. By this the commission will contribute to standardization and agreement on appropriate methods, procedures and their correct application in the practice of environmental medicine. Hopefully it will also achieve a stronger, more consistent use of evidence-based-medicine and improve the quality of the structure, processes and results of research and practice in this field. The committee will initially deal with the issue of clinical environmental medicine, because here the largest problems in quality assurance are seen. In this context the commission will look at the problem areas of environmental-medical outpatient units and environmental clinics. The work of the commission will be supported by the newly formed Documentation and Evaluation Center for Methods in Environmental Medicine (Zentrale Erfassungs- und Bewertungsstelle fuer umweltmedizinische Methoden, ZEBUM) at the Robert Koch Institute. (orig.) [de
Hansberry, David R; Agarwal, Nitin; John, Elizabeth S; John, Ann M; Agarwal, Prateek; Reynolds, James C; Baker, Stephen R
2017-06-01
The majority of Americans use the Internet daily, if not more often, and many search online for health information to better understand a diagnosis they have been given or to research treatment options. The average American reads at an eighth-grade level. The purpose of this study is to evaluate the readability of online patient education materials on the websites of 14 professional organizations representing the major internal medicine subspecialties. We used ten well-established quantitative readability scales to assess written text from patient education materials published on the websites of the major professional organizations representing the following subspecialty groups: allergy and immunology, cardiology, endocrinology, gastroenterology, geriatrics, hematology, hospice and palliative care, infectious disease, nephrology, oncology, pulmonology and critical care, rheumatology, sleep medicine, and sports medicine. Collectively the 540 articles analyzed were written at an 11th-grade level (SD 1.4 grade levels). The sleep medicine and nephrology websites had the most readable materials, written at an academic grade level of 8.5 ± 1.5 and 9.0 ± 0.2, respectively. Material at the infectious disease site was written at the most difficult level, with average readability corresponding to grades 13.9 ± 0.3. None of the patient education materials we reviewed conformed to the American Medical Association (AMA) and the National Institutes of Health (NIH) guidelines requiring that patient education articles be written at a third- to seventh-grade reading level. If these online resources were rewritten, it is likely that more patients would derive benefit from reading them.
Parratt, Kirsten; Jeong, Jenny; Qiu, Peng; Roy, Krishnendu
2017-08-08
Studying cell behavior within 3D material niches is key to understanding cell biology in health and diseases, and developing biomaterials for regenerative medicine applications. Current approaches to studying these cell-material niches have low throughput and can only analyze a few replicates per experiment resulting in reduced measurement assurance and analytical power. Here, we report 3D material cytometry (3DMaC), a novel high-throughput method based on microfabricated, shape-specific 3D cell-material niches and imaging cytometry. 3DMaC achieves rapid and highly multiplexed analyses of very high replicate numbers ("n" of 10 4 -10 6 ) of 3D biomaterial constructs. 3DMaC overcomes current limitations of low "n", low-throughput, and "noisy" assays, to provide rapid and simultaneous analyses of potentially hundreds of parameters in 3D biomaterial cultures. The method is demonstrated here for a set of 85 000 events containing twelve distinct cell-biomaterial micro-niches along with robust, customized computational methods for high-throughput analytics with potentially unprecedented statistical power.
Mixed Methods Designs for Sports Medicine Research.
Kay, Melissa C; Kucera, Kristen L
2018-07-01
Mixed methods research is a relatively new approach in the field of sports medicine, where the benefits of qualitative and quantitative research are combined while offsetting the other's flaws. Despite its known and successful use in other populations, it has been used minimally in sports medicine, including studies of the clinician perspective, concussion, and patient outcomes. Therefore, there is a need for this approach to be applied in other topic areas not easily addressed by one type of research approach in isolation, such as the retirement from sport, effects of and return from injury, and catastrophic injury. Copyright © 2018 Elsevier Inc. All rights reserved.
Adib, Adiana Mohamed; Jamaludin, Fadzureena; Kiong, Ling Sui; Hashim, Nuziah; Abdullah, Zunoliza
2014-08-05
Baeckea frutescens or locally known as Cucur atap is used as antibacterial, antidysentery, antipyretic and diuretic agent. In Malaysia and Indonesia, they are used as an ingredient of the traditional medicine given to mothers during confinement. A three-steps infra-red (IR) macro-fingerprinting method combining conventional IR spectra, and the secondary derivative spectra with two dimensional infrared correlation spectroscopy (2D-IR) have been proved to be effective methods to examine a complicated mixture such as herbal medicines. This study investigated the feasibility of employing multi-steps IR spectroscopy in order to study the main constituents of B. frutescens and its different extracts (extracted by chloroform, ethyl acetate, methanol and aqueous in turn). The findings indicated that FT-IR and 2D-IR can provide many holistic variation rules of chemical constituents. The structural information of the samples indicated that B. frutescens and its extracts contain a large amount of flavonoids, since some characteristic absorption peaks of flavonoids, such as ∼1600cm(-1), ∼1500cm(-1), ∼1450cm(-1), and ∼1270cm(-1) can be observed. The macroscopical fingerprint characters of FT-IR and 2D-IR spectra can not only provide the information of main chemical constituents in medicinal materials and their different extracts, but also compare the components differences among the similar samples. In conclusion, the multi-steps IR macro-fingerprint method is rapid, effective, visual and accurate for pharmaceutical research. Copyright © 2014 Elsevier B.V. All rights reserved.
Methods for extraction and determination of phenolic acids in medicinal plants: a review.
Arceusz, Agnieszka; Wesolowski, Marek; Konieczynski, Pawel
2013-12-01
Phenolic acids constitute a group of potentially immunostimulating compounds. They occur in all medicinal plants and are widely used in phytotherapy and foods of plant origin. In recent years, phenolic acids have attracted much interest owing to their biological functions. This paper reviews the extraction and determination methods of phenolic acids in medicinal plants over the last 10 years. Although Soxhlet extraction and ultrasonic assisted extraction (UAE) are commonly used for the extraction of phenolic acids from plant materials, alternative techniques such as supercritical fluid extraction (SFE), and accelerated solvent extraction (ASE) can also be used. After extraction, phenolic acids are determined usually by liquid chromatography (LC) owing to the recent developments in this technique, especially when it is coupled with mass spectrometry (MS). Also detection systems are discussed, including UV-Vis, diode array, electrochemical and fluorimetric. Other popular techniques for the analysis of this group of secondary metabolites are gas chromatography coupled with mass spectrometry (GC-MS) and capillary electrophoresis (CE).
Cheng, Xu-Dong; Feng, Liang; Gu, Jun-Fei; Zhang, Ming-Hua; Jia, Xiao-Bin
2014-11-01
Chinese medicine prescriptions are the wisdom outcomes of traditional Chinese medicine (TCM) clinical treatment determinations which based on differentiation of symptoms and signs. Chinese medicine prescriptions are also the basis of secondary exploitation of TCM. The study on prescription helps to understand the material basis of its efficacy, pharmacological mechanism, which is an important guarantee for the modernization of traditional Chinese medicine. Currently, there is not yet dissertation n the method and technology system of basic research on the prescription of Chinese medicine. This paper focuses on how to build an effective system of prescription research technology. Based on "component structure" theory, a technology system contained four-step method that "prescription analysis, the material basis screening, the material basis of analysis and optimization and verify" was proposed. The technology system analyzes the material basis of the three levels such as Chinese medicine pieces, constituents and the compounds which could respect the overall efficacy of Chinese medicine. Ideas of prescription optimization, remodeling are introduced into the system. The technology system is the combination of the existing research and associates with new techniques and methods, which used for explore the research thought suitable for material basis research and prescription remodeling. The system provides a reference for the secondary development of traditional Chinese medicine, and industrial upgrading.
Mai, Lan-Yin; Li, Yi-Xuan; Chen, Yong; Xie, Zhen; Li, Jie; Zhong, Ming-Yu
2014-05-01
The compatibility of traditional Chinese medicines (TCMs) formulae containing enormous information, is a complex component system. Applications of mathematical statistics methods on the compatibility researches of traditional Chinese medicines formulae have great significance for promoting the modernization of traditional Chinese medicines and improving clinical efficacies and optimizations of formulae. As a tool for quantitative analysis, data inference and exploring inherent rules of substances, the mathematical statistics method can be used to reveal the working mechanisms of the compatibility of traditional Chinese medicines formulae in qualitatively and quantitatively. By reviewing studies based on the applications of mathematical statistics methods, this paper were summarized from perspective of dosages optimization, efficacies and changes of chemical components as well as the rules of incompatibility and contraindication of formulae, will provide the references for further studying and revealing the working mechanisms and the connotations of traditional Chinese medicines.
A Model for Producing and Sharing Instructional Materials in Veterinary Medicine. Final Report.
Ward, Billy C.; Niec, Alphonsus P.
This report describes a study of factors which appear to influence the "shareability" of audiovisual materials in the field of veterinary medicine. Specific factors addressed are content quality, instructional effectiveness, technical quality, institutional support, organization, logistics, and personal attitudes toward audiovisuals. (Author/CO)
Directory of Open Access Journals (Sweden)
L. L. Davtian
2018-03-01
Full Text Available The influence of variables of pharmaceutical factors on the technological processes of drugs manufacturing is incredibly important. Thus, in the development of a new drug in the form of medicinal films, the relevance and necessity of determining the effect of the methods of active substances adding on the effectiveness of the drug was determined. The aim is rationalization of the method of the active pharmaceutical ingredients adding into the composition of the developed drug. Materials and methods. As experimental samples we used medicinal films, which were made using various methods of active ingredients adding. The quality of the samples was evaluated by the antimicrobial activity against Clostridium sporogenes and Staphylococcus aureus, which was determined by the diffusion method in agar. Results. The study of the antimicrobial activity of medicinal films with various methods of active ingredients adding showed that the adding of metronidazole as an aqueous solution increases the antimicrobial activity of the films by 21.23%, 16.89%, 28.59%, respectively, compared with films of similar composition, in which metronidazole was added as a suspension, and the remaining ingredients were added by the same way. The introduction of chlorhexidine bigluconate and glucosamine hydrochloride in the film-forming solution lastly together with the solution of metronidazole increases the antimicrobial activity by 24.67%, which is probably due to the absence of contact between thermolabile ingredients and solutions of film-forming substances having a high dissolution temperature. Conclusions. The most rational is adding of metronidazole to the medicinal films in the form of a 0.01% aqueous solution in a mixture with the chlorhexidine bigluconate and glucosamine hydrochloride solution to the final film-forming solution.
The characteristics of the medicinal plants used in the herbal medicine оf type 2 diabetes
Directory of Open Access Journals (Sweden)
Sergei Kalmykov
2016-06-01
Full Text Available Purpose: consider the rational combination of the herbs in fytocomplexes applied in the rehabilitation of the type 2 diabetes. Material & Methods: analysis of scientific and methodical literature on the use of herbal medicine in the complex rehabilitation for patients with diabetes. Results: modern views on the necessity and the features of the use of herbal remedies especially in the diabetes type 2 are presented; the main medicinal plants used in this pathology are described. The main attention is paid to the peculiarities of forming up an integrated cure that contains a mixture of several kinds of medicinal plants. The classification of herbal drugs used for diabetes is given. Conclusions: advantages of application of collection of medicinal plants over synthetic drugs in the complex treatment of the type 2 diabetes are proved.
Energy Technology Data Exchange (ETDEWEB)
Schmidt, H A.E. [Evangelisches Krankenhaus Bethesda Gemeinnuetzige G.m.b.H., Duisburg (Germany, F.R.). Nuklearmedizinische Klinik und Poliklinik; Ortiz Berrocal, J [Universidad Autonoma de Madrid (Spain). Dept. of Nuclear Medicine; eds.
1979-01-01
This proceedings volume of the 16th International Annual Meeting of the Gesellschaft fuer Nuklearmedizin, which took place in Madrid on October 24-27, 1978, contains 183 compacts on the following subjects: Metrology and data processing, cyclotron products and radiopharmaceuticals, nuclear medicine as compared with computerized tomography and sonography, radioimmunoassay, haematology, thyreology, osteology, pulmonology, cardiology, angiology, nephrology, gastroenterology and hepatology, oncology, nuclear therapy methods and some free lectures and thus give a good picture of the state of the art in nuclear medicine at the time.
The effects of packaging materials on microbe population in irradiated traditional herbal medicines
International Nuclear Information System (INIS)
Bagiawati, Sri; Hilmy, Nazly
1983-01-01
Microbial population and moisture content of traditional herbal medicines contaminated with 3 kinds of aerobic microbes, packed in 5 kinds of plastic packaging materials, followed by irradiation at minimum dose of 5 kGy and stored for 6 months were investigated. The highest reduction of microbial counts during storage was observed on samples packed in polyethylene bags. All of packaging materials used were found to be impermeable to microbes and water vapour. Radiation and packaging materials used acted synergistically to inactivate microbes durind storage. The microbial counts decreased as much as 2 to 4 log cycles during storage. (author)
Vitreous humour - routine or alternative material for analysis in forensic medicine.
Markowska, Joanna; Szopa, Monika; Zawadzki, Marcin; Piekoszewski, Wojciech
2017-01-01
Biological materials used in toxicological analyses in forensic medicine traditionally include blood, urine and vitreous humour. Forensic use of the vitreous body is mostly due to the need to assess the endogenous concentration of ethyl alcohol in the process of human body decomposition. The vitreous body is an underestimated biological material, even though its biochemical properties and anatomical location make it suitable for specific forensic toxicology tests as a reliable material for the preparation of forensic expert opinions. Based on the available literature the paper gathers information on the biochemical structure of the vitreous body, ways to secure the material after collection and its use in postmortem diagnostics. Specific applications of the vitreous humour for biochemical and toxicological tests are discussed, with a focus on its advantages and limitations in forensic medical assessment which are attributable to its biochemical properties, anatomical location and limited scientific studies on the distribution of xenobiotics in the vitreous body.
Directory of Open Access Journals (Sweden)
Spiridonov S.V.
2014-12-01
Full Text Available In the last time a significant increasing of gastrointestinal tract diseases has been observed. The poor quality and irrational feeding, environmental pollution, psychological and other factors is the causes of this. Very often the gastrointestinal tract has a multifactorial pathological effects, also affecting the hepatosphere organs and urogenital system. Also a great importance have accompanying disorders of the central nervous system. Thus we must to require a comprehensive approach to the creation of drugs for use in gastroenterology, the assortment range of which should be expanded. Advantageous position in this case takes a phytotherapy using drugs based on medicinal plant raw material, which acting on the main areas of the pathological process. For this purpose the scientists from the National University of Pharmacy (Kharkov, Ukraine was created a complex herbal drug in the form of granules under the code name "Poligerbagastrin", includes the following types of medicinal plant raw material powders: helichrysum arenarium flowers, corn stigmas, horsetail grass, knotweed grass, horse chestnut seeds, licorice roots and wheat bran. Materials and methods To determine the quantity of biologically active substances the method of spectrophotometry in the visible and UV spectral region was used. This method is well studied and available, equipped with high-precision hardware. He also described in the Ukrainian normative documents and contained in the world's leading pharmacopoeias. For determination was used the unifieds methods, which shown in pharmacopoeia monographs and other reference literature. Determination was carried out with a spectrophotometer HP 8543 UV-VIZ of «Hewlett Packard» company, USA. Results and discussion For the quantitative determination of flavonoids was used a methodology, which based on the complexation reaction of isolated by acid hydrolysis and extraction with ethylacetate hydrolysis products with aluminum chloride in
How often do patients in primary care use the methods of traditional medicine
Directory of Open Access Journals (Sweden)
Petrov-Kiurski Miloranka
2014-01-01
Full Text Available Introduction: Traditional medicine is a comprehensive system of theory and practice, implemented in the prevention, diagnostics and treatment of diseases, which utilizes preparations of vegetable, animal and mineral origin, as well as methods of spiritual therapy Objective: 1. To estimate how many patients in primary care use traditional medicine for diagnostics, treatment and prevention of diseases, and to establish possible differences regarding gender, age and urban or rural location. 2. What methods of traditional medicine are the most often used, and for which diseases and conditions? 3. Why did the subjects opted for this type of treatment, and what was the effect of the therapy? Method: Multicentric research based on interviewing patients in five outpatient health centers in Serbia. As a survey instrument was used a questionnaire with 10 questions. Results: The study included 1157 subjects, 683 women and 474 men, mean age 60.22±14.54, The traditional medicine was used by 83.66% (79.96% males and 86.245% females. Information about the methods of traditional medicine subjects usually received from their friends and acquaintances (54.9% and the media (39.3%. There is no significant difference in the way of obtaining information in relation to gender. Information on the internet was obtained more often in subjects younger than 65 (p=0.000 and in urban population (p=0.000. The same is true for information obtained from doctor or pharmacist (p=0.003. They opted for this method because in their opinion it is less harmful and have less adverse effects (72.8%. This type of treatment patients used for treatment of muscles, bone and joint diseases - 28.5%, diseases of the heart and blood vessels -21,1 %, and for the treatment of pain 19.7%. Patients from rural areas more often used traditional medicine for treatment of cardiovascular diseases (p=0.000. Outcome of treatment was good or satisfactory in 45.3%, moderate in 32%, and in 15.8% effect was
Tolle, Charles R [Idaho Falls, ID; Clark, Denis E [Idaho Falls, ID; Smartt, Herschel B [Idaho Falls, ID; Miller, Karen S [Idaho Falls, ID
2009-10-06
A material-forming tool and a method for forming a material are described including a shank portion; a shoulder portion that releasably engages the shank portion; a pin that releasably engages the shoulder portion, wherein the pin defines a passageway; and a source of a material coupled in material flowing relation relative to the pin and wherein the material-forming tool is utilized in methodology that includes providing a first material; providing a second material, and placing the second material into contact with the first material; and locally plastically deforming the first material with the material-forming tool so as mix the first material and second material together to form a resulting material having characteristics different from the respective first and second materials.
Nanophase materials produced by physical methods
International Nuclear Information System (INIS)
Noda, Shoji
1992-01-01
A nanophase material is mainly characterized by the component's size and the large interface area. Some nanophase materials are briefly described. Ion implantation and oblique vapor deposition are taken as the methods to provide nanophase materials, and their features are described. These physical methods are non-equilibrium material processes, and the unique nanophase materials are demonstrated to be provided by these methods with little thermodynamic restriction. (author)
Duan, Jin-ao; Su, Shu-lan; Guo, Sheng; Jiang, Shu; Liu, Pei; Yan, Hui; Qian, Da-wei; Zhu, Hua-xu; Tang, Yu-ping; Wu, Qi-nan
2015-09-01
The objects of research on the resources chemistry of Chinese medicinal materials (RCCMM) are promotion of efficient production, rational utilization and improving quality of CMM and natural products. The development of TCM cause depends on the efficient utilization and sustainable development of CMM, hinges on the technologies and methods for using and discovering medicinal biological resources, stand or fall on the extension of industy chains, detailed utilizaion of resource chemical components by multi-way, multi-level. All of these may help to the recycling utilization and sound development of RCMM. In this article, five respects were discussed to the RCCMM researches and resources recycling utilization ways and goals and tasks. First, based on the principle of resource scarcity, discovering or replacing CMM resources, protecting the rare or endangered species or resources. Second, based on the multifunctionality of CMM, realizing the value-added and value compensation, and promoting the utilization efficiency through systermatic and detailed exploitation and utilization. Third, based on the resource conservation and environment-friendly, reducing raw material consumption, lowering cost, promoting recycling utilization and elevating utilization efficiency. Fourth, based on the stratege of turning harm into good, using the invasive alien biological resources by multi-ways and enriching the medicial resources. Fifth, based on the method of structure modification of chemical components, exploring and enhancing the utility value of resouces chemical substances. These data should provide references and attention for improving the utilization efficiency, promoting the development of recycling economy, and changing the mode of economic growth of agriculture and industry of CMM fundamentally.
Introduction to mathematical and informatics methods in Nuclear Medicine
International Nuclear Information System (INIS)
Martin, J.; Monot, C.; Legras, B.
1975-01-01
Mathematical and statistical methods are widely used in nuclear medicine because of the abundance and precision of the data obtained during morphological and dynamic explorations, and the number and complexity of the calculations involved has led to the use of informatics. Very elaborate techniques may be employed with the help of the computer. In spite of its cost it is closely associated with exploration techniques, especially in conjunction with the scintillation camera. To keep the machine in full-time use and ensure its profitability it is employed in other capacities, for an service management in particular. Each subject is dealt with from its fundamental aspect: nuclear medicine and biomathematics, statistics, informatics; compartment models in nuclear medicine (interpretation of dynamic examinations); quantitive image processing; special computer services (connections with apparatus, service and records management problems) [fr
Methods of synthesizing thermoelectric materials
Ren, Zhifeng; Chen, Shuo; Liu, Wei-Shu; Wang, Hengzhi; Wang, Hui; Yu, Bo; Chen, Gang
2016-04-05
Methods for synthesis of thermoelectric materials are disclosed. In some embodiments, a method of fabricating a thermoelectric material includes generating a plurality of nanoparticles from a starting material comprising one or more chalcogens and one or more transition metals; and consolidating the nanoparticles under elevated pressure and temperature, wherein the nanoparticles are heated and cooled at a controlled rate.
Statistical methods for nuclear material management
International Nuclear Information System (INIS)
Bowen, W.M.; Bennett, C.A.
1988-12-01
This book is intended as a reference manual of statistical methodology for nuclear material management practitioners. It describes statistical methods currently or potentially important in nuclear material management, explains the choice of methods for specific applications, and provides examples of practical applications to nuclear material management problems. Together with the accompanying training manual, which contains fully worked out problems keyed to each chapter, this book can also be used as a textbook for courses in statistical methods for nuclear material management. It should provide increased understanding and guidance to help improve the application of statistical methods to nuclear material management problems
Statistical methods for nuclear material management
Energy Technology Data Exchange (ETDEWEB)
Bowen W.M.; Bennett, C.A. (eds.)
1988-12-01
This book is intended as a reference manual of statistical methodology for nuclear material management practitioners. It describes statistical methods currently or potentially important in nuclear material management, explains the choice of methods for specific applications, and provides examples of practical applications to nuclear material management problems. Together with the accompanying training manual, which contains fully worked out problems keyed to each chapter, this book can also be used as a textbook for courses in statistical methods for nuclear material management. It should provide increased understanding and guidance to help improve the application of statistical methods to nuclear material management problems.
Nuclear medicine methods in the assessment of acupuncture effects: a short review
International Nuclear Information System (INIS)
Souza, Deise Elisabete; Rebello, Bernardo Machado; Agostinho, Raquel Terra; Silva Filho, Reginaldo de Carvalho; Bernardo-Filho, Mario
2007-01-01
The mechanisms of acupuncture are poorly understood. In consequence, numerous investigators have conducted clinical trials to test the efficacy of acupuncture in various conditions. We have used PubMed database system to evaluate the number of publications in acupuncture and nuclear medicine procedures in the period from 1964 to 2007, using the keywords: 'nuclear medicine and acupuncture', 'SPECT and acupuncture, 'PET and acupuncture', 'scintigraphy and acupuncture, 'radionuclide and acupuncture', 'radiopharmaceutical and acupuncture', 'radioisotope and acupuncture' and 99m Tc and acupuncture'. Some papers published in English language were selected and a short review is presented The analysis of the number of publications shows that when a method is well accepted by the scientific community, as the methods used in nuclear medicine, the interest in the development of research increases. Moreover, important findings are presented when the nuclear medicine image is used to evaluate the effect of the acupuncture. (author)
Herbert, Robert; Kim, Jong-Hoon; Kim, Yun Soung; Lee, Hye Moon; Yeo, Woon-Hong
2018-01-24
Flexible hybrid electronics (FHE), designed in wearable and implantable configurations, have enormous applications in advanced healthcare, rapid disease diagnostics, and persistent human-machine interfaces. Soft, contoured geometries and time-dynamic deformation of the targeted tissues require high flexibility and stretchability of the integrated bioelectronics. Recent progress in developing and engineering soft materials has provided a unique opportunity to design various types of mechanically compliant and deformable systems. Here, we summarize the required properties of soft materials and their characteristics for configuring sensing and substrate components in wearable and implantable devices and systems. Details of functionality and sensitivity of the recently developed FHE are discussed with the application areas in medicine, healthcare, and machine interactions. This review concludes with a discussion on limitations of current materials, key requirements for next generation materials, and new application areas.
Botanical drugs in Ayurveda and Traditional Chinese Medicine.
Jaiswal, Yogini; Liang, Zhitao; Zhao, Zhongzhen
2016-12-24
China and India have a long history in the therapeutic application of botanical drugs in traditional medicine. Traditional Chinese Medicine (TCM) and Ayurveda are considered as two of the most ancient systems of medicine, with history of more than two millennia. Medicinal plants are the principal medicinal materials used in both these systems. This review discusses about the histories of Ayurveda and TCM, the common medicinal plants species, the drug processing strategies used, and the current statuses of these traditional systems of medicine (TSM). Through the views presented in this article, we aim to provide a new perspective to herbal drug researchers for expanding and improving the utilization of botanical drugs and their therapeutic applications. A bibliographic investigation of Chinese and Indian pharmacopoeias, monographs and official websites was performed. Furthermore, information was obtained from scientific databases on ethnobotany and ethno medicines. The review of Ayurveda and TCM ethno medicine indicates that both these systems have many medicinal materials in common. The studies carried out by the authors for comparison of plants from same genus from both these TSM's have been discussed to further bring focus to the utilization of "qualitatively" similar species which can be utilized and substituted for endangered or economically valued species. The overview of ancient literature and scientific findings for drugs in both these systems suggests that, the botanical drugs used in common and their processing methods can be explored further for extensive utilization in traditional medicine. This review describes the histories, common medicinal plant species, their processing methods and therapeutic applications in Ayurveda and TCM. The insights provided through this article may be used by herbal drug researchers and pharmacologists for further exploration of botanical drugs from these two traditional systems of medicine. Copyright © 2016. Published by
Nondestructive evaluation ultrasonic methods for construction materials
International Nuclear Information System (INIS)
Chilibon, I.; Zisu, T.; Raetchi, V.
2002-01-01
The paper presents some ultrasonic methods for evaluation of physical-mechanical properties of construction materials (bricks, concrete, BCA), such as: pulse method, examination methods, and direct measurement of the propagation velocity and impact-echo method. Utilizing these nondestructive evaluation ultrasonic methods it can be determined the main material parameters and material characteristics (elasticity coefficients, density, propagation velocity, ultrasound attenuation, etc.) of construction materials. These method are suitable for construction materials because the defectoscopy methods for metallic materials cannot be utilized, due to its rugged and non-homogeneous structures and grate attenuation coefficients of ultrasound propagation through materials. Also, the impact-echo method is a technique for flaw detection in concrete based on stress wave propagation. Studies have shown that the impact-echo method is effective for locating voids, honeycombing, delaminating, depth of surface opening cracks, and measuring member thickness
EFFECTIVENESS OF ACTIVE TEACHING METHODS FOR THE RESIDENTS OF PHYSICAL MEDICINE AND REHABILITATION
Directory of Open Access Journals (Sweden)
Mohan Raj Manjalavil
2017-03-01
Full Text Available BACKGROUND Lecture is the most common teaching aid not only for medical undergraduates, but also specialty residents. There are many disadvantages for this type of teaching. Active teaching methods include didactic lectures followed by interactive sessions, problem-based teaching and hands on demonstration apart from the traditional didactic lecture. The aim of this project was to compare the effectiveness of active teaching method over the didactic lecture to the first year residents of Physical Medicine and Rehabilitation. MATERIALS AND METHODS Settings- Physical Medicine and Rehabilitation Department among first year residents. Study Design- Educational intervention. Didactic lecture followed by active teaching method. Statistical Analysis- Analysed using SPSS-16 package software. Initially, the first year students were subjected to a pretest, which consists of ten single responses multiple choice questions regarding - “The Carpel Tunnel Syndrome.” This is followed by didactic lecture about the above topic. After this lecture, a post test was conducted with identical questions as the pretest. Then, an interactive session and hands on demonstration of confirming the carpel tunnel syndrome by nerve conduction studies were given. Following this, the same post test was then repeated. RESULTS The arithmetic mean value of pretest score was 3.5, which improved to 8.33 after the lecture session. After the live demonstration of nerve conduction studies, the mean value further increased to 9.8333. The ‘p’ value of the paired t-test after the lecture session was 0.000113, which is significant. The ‘p’ value after the live demonstration session was 0.008612, which is also significant. CONCLUSION The active teaching learning method is found to be more effective than the didactic lecture. Immediate and short-term gains are seen with such programmes.
IDENTIFICATION OF SOME COMPOSITE MEDICINAL DRUGS CONTAINING PARACETAMOL, WITH IR-SPECTROMETRY METHOD
Directory of Open Access Journals (Sweden)
A. S. Saushkina
2017-01-01
Full Text Available A serious threat to the health of the population is falsified medicines. In a number of cases, they are identified in the process of incoming quality control for compliancewith the requirements of regulatory documents for indicators “Description”, “Packaging”, “Marking”. However, in order to identify sophisticated counterfeits, only a visual assessment of the drug is not enough. Purpose screening evaluation of potentiallycounterfeited or poor-quality drugs using the IR spectrometry along the total spectrum.Materials and methods. The objects of research were available in freely availablecommercially available tablets produced by domestic and foreign manufacturers“Paracetamol Extratab”, “Solpadein fast”, “Citrapac”, “Citramon P”, “Ascofen-P”, corresponding to the requirements of the current regulatory documents. The studies were carried out on a Fourier-Spectrophotometer infrared “FSM 1201”. Results and discussion. On the example of the tablets “Citramon P”, “Ascophen-P”, “Citrapac”, “Paracetamol Extratab”, “Solpadein Fast” the possibility of using the total IR spectra as a primary screening index of authenticity is shown. It was established that the total IR spectra of medicines of similar composition reflect the similarity of serial samples of the products ofone manufacturer and the difference in serial samples of products of different manufacturers.
Nuclear medicine methods in the assessment of acupuncture effects: a short review
Energy Technology Data Exchange (ETDEWEB)
Souza, Deise Elisabete; Rebello, Bernardo Machado; Agostinho, Raquel Terra [Universidade do Estado do Rio de Janeiro (UERJ), RJ (Brazil). Inst. de Biologia Roberto Alcantara Gomes. Lab. de Radiofarmacia Experimental; Academia Brasileira de Arte e Ciencia Oriental, Rio de Janeiro, RJ (Brazil); E-mail: deise_desouza@yahoo.com.br; Silva Filho, Reginaldo de Carvalho [Escola Brasileira de Medicina Chinesa, Sao Paulo, SP (Brazil). Centro Avancado de Pesquisas em Ciencias Orientais; Bastos, Sohaku R.C. [Academia Brasileira de Arte e Ciencia Oriental, Rio de Janeiro, RJ (Brazil); Bernardo-Filho, Mario [Instituto Nacional de Cancer (INCa), Rio de Janeiro, RJ (Brazil). Centro de Pesquisa Basica
2007-09-15
The mechanisms of acupuncture are poorly understood. In consequence, numerous investigators have conducted clinical trials to test the efficacy of acupuncture in various conditions. We have used PubMed database system to evaluate the number of publications in acupuncture and nuclear medicine procedures in the period from 1964 to 2007, using the keywords: 'nuclear medicine and acupuncture', 'SPECT and acupuncture, 'PET and acupuncture', 'scintigraphy and acupuncture, 'radionuclide and acupuncture', 'radiopharmaceutical and acupuncture', 'radioisotope and acupuncture' and {sup 99m}Tc and acupuncture'. Some papers published in English language were selected and a short review is presented The analysis of the number of publications shows that when a method is well accepted by the scientific community, as the methods used in nuclear medicine, the interest in the development of research increases. Moreover, important findings are presented when the nuclear medicine image is used to evaluate the effect of the acupuncture. (author)
In-plane Material Filters for the Discrete Material Optimization Method
DEFF Research Database (Denmark)
Sørensen, Rene; Lund, Erik
2015-01-01
, because the projection filter is a non-linear function of the design variables, the projected variables have to be re-scaled in a final so-called normalization filter. This is done to prevent the optimizer in creating superior, but non-physical pseudo-materials. The method is demonstrated on a series......This paper presents in-plane material filters for the Discrete Material Optimization method used for optimizing laminated composite structures. The filters make it possible for engineers to specify a minimum length scale which governs the minimum size of areas with constant material continuity....... Consequently, engineers can target the available production methods, and thereby increase its manufacturability while the optimizer is free to determine which material to apply together with an optimum location, shape, and size of these areas with constant material continuity. By doing so, engineers no longer...
Computational Methods in Medicine
Directory of Open Access Journals (Sweden)
Angel Garrido
2010-01-01
Full Text Available Artificial Intelligence requires Logic. But its Classical version shows too many insufficiencies. So, it is absolutely necessary to introduce more sophisticated tools, such as Fuzzy Logic, Modal Logic, Non-Monotonic Logic, and so on [2]. Among the things that AI needs to represent are Categories, Objects, Properties, Relations between objects, Situations, States, Time, Events, Causes and effects, Knowledge about knowledge, and so on. The problems in AI can be classified in two general types
[3, 4], Search Problems and Representation Problem. There exist different ways to reach this objective. So, we have [3] Logics, Rules, Frames, Associative Nets, Scripts and so on, that are often interconnected. Also, it will be very useful, in dealing with problems of uncertainty and causality, to introduce Bayesian Networks and particularly, a principal tool as the Essential Graph. We attempt here to show the scope of application of such versatile methods, currently fundamental in Medicine.
Herbert, Robert; Kim, Jong-Hoon; Kim, Yun Soung; Lee, Hye Moon
2018-01-01
Flexible hybrid electronics (FHE), designed in wearable and implantable configurations, have enormous applications in advanced healthcare, rapid disease diagnostics, and persistent human-machine interfaces. Soft, contoured geometries and time-dynamic deformation of the targeted tissues require high flexibility and stretchability of the integrated bioelectronics. Recent progress in developing and engineering soft materials has provided a unique opportunity to design various types of mechanically compliant and deformable systems. Here, we summarize the required properties of soft materials and their characteristics for configuring sensing and substrate components in wearable and implantable devices and systems. Details of functionality and sensitivity of the recently developed FHE are discussed with the application areas in medicine, healthcare, and machine interactions. This review concludes with a discussion on limitations of current materials, key requirements for next generation materials, and new application areas. PMID:29364861
Directory of Open Access Journals (Sweden)
Robert Herbert
2018-01-01
Full Text Available Flexible hybrid electronics (FHE, designed in wearable and implantable configurations, have enormous applications in advanced healthcare, rapid disease diagnostics, and persistent human-machine interfaces. Soft, contoured geometries and time-dynamic deformation of the targeted tissues require high flexibility and stretchability of the integrated bioelectronics. Recent progress in developing and engineering soft materials has provided a unique opportunity to design various types of mechanically compliant and deformable systems. Here, we summarize the required properties of soft materials and their characteristics for configuring sensing and substrate components in wearable and implantable devices and systems. Details of functionality and sensitivity of the recently developed FHE are discussed with the application areas in medicine, healthcare, and machine interactions. This review concludes with a discussion on limitations of current materials, key requirements for next generation materials, and new application areas.
Directory of Open Access Journals (Sweden)
shahla ahmadi
2010-03-01
Full Text Available Collection and determination of medicinal plants in Lorestan province have been carried out for 6 years in the agriculture and natural resources research of center of Lorestan. The aims of this study were collection and identification the medicinal plans that grow in Loretta province, their distribution, habitat, traditional uses, utilized organ, manner of usage, botany specification, local name, Persian name and scientific name. Material and methods: Medicinal plants were collected from different regions by using field and library study for these goals we prepared a list of recorded medicinal plants from Lorestan, identified the local herbal experts. Results: Finally we collected 151 medicinal plant identified that related to 63 families and 90 genuses. The Lamiaceae, Compositae, Legominosae , Liliaceae, Umbelliferae and . Rosaceae are the greatest family in the Lorestan province. Diction: According to the literature 96 medicinal plans were recorded from Lorestan, but during this study we collected and identified 151 medicinal plants in Lorestan province. Comparing with those that recorded from Bushehr 70 sp.(9, Hormozgan 113 sp.(10, Markazi 144 sp. And Kordestan 144 sp(11. We have more diversity but comparing with Zanjan 163 sp.(13, Hamedan 315 sp.(14 And Qazvin 250 sp.(15 We have less diversity in medicinal plants.
Children's (Pediatric) Nuclear Medicine
Full Text Available ... Nuclear Medicine Children’s (pediatric) nuclear medicine imaging uses small amounts of radioactive materials called radiotracers, a special ... is a branch of medical imaging that uses small amounts of radioactive material to diagnose and determine ...
An Observational Study of 3 Different Transfusion Medicine Teaching Methods for Medical Students.
Konia, Mojca Remskar; Richtsfeld, Martina; Johnson, Andrew D; Lougee, Michael; Cohn, Claudia; Morgan, Shanna
2018-04-01
Knowledge deficits of transfusion medicine are prevalent among learners and practicing physicians. In the past, the transfusion medicine community has thoughtfully defined the content of transfusion medicine curriculums through Transfusion Medicine Academic Award Group and The Academy of Clinical Laboratory Physicians and Scientists. The manner in which the curriculum should be delivered has been less carefully examined and defined. We completed an observational study in which we analyzed 3 different teaching techniques: in-person faculty-led simulation curriculum consisting of didactic session and simulation ("Simulation group"); hybrid education with a combination of online materials and short in-person simulation ("Hybrid group"); and online-only education module, which delivered the whole curricular content through a variety of online materials and videos ("Online-only group"). Knowledge acquisition was assessed with a 10-question multiple-choice questionnaire, and satisfaction was assessed by a 9-question online student satisfaction survey. A total of 276second-year medical students participated in the study. There was statistically significant difference between pre- and posttest results and in knowledge gain favoring the Simulation group as compared with the Online-only group (P=.03, P<.0001) and favoring the Simulation group as compared with the Hybrid group (P=.004, P<.0001). The Simulation group and Hybrid group medical students were also more satisfied with the education activity as compared with the Online-only group (P<.0001, P<.001). Our study demonstrated that a faculty-run transfusion medicine simulation curriculum consisting of an in-person didactic session and simulation session for the second-year medical students produced greater immediate knowledge acquisition compared with an online only or a hybrid curriculum. Furthermore, any curriculum that contained in-person teaching by faculty was preferred over the online only education. Copyright
International Nuclear Information System (INIS)
Badilla Segura, Mirta
2013-01-01
A monitoring program of the occupational exposure by incorporation of radioactive material is proposed. Nuclear medicine services of the Caja Costarricense del Seguro Social (CCSS) are evaluated. The monitoring program is based on the provisions of the International Atomic Energy Agency and of study of nuclear medicine services of the CCSS. Radionuclides are determined for monitoring of the occupational exposure, according to the radioactive material that is worked in nuclear medicine services of the CCSS. The appropriate and alternative techniques are established for the monitoring of the occupational exposure by incorporation of radioactive material, depending on the type of radionuclide that is worked in nuclear medicine services. The worker occupationally exposed (TOE) should be subject of monitoring and how often should be realized the monitoring of the occupational exposure. The monitoring of the radiation by radioactive material must be applied to personnel working in radiopharmacies and the worker has carried out therapeutic procedures for handling of significant amounts of 13 1 I. The calculation of the committed effective dose is proposed by incorporation of radioactive material with the TOE [es
Hu, Yong; Huo, Ke-Yi; Xiang, Hua
2013-09-01
This thesis reviews the historical background of agricultural industrialization, and analyzes the major theories of agricultural industrialization. It also utilizes SWOT analysis method to discuss the industrialization of traditional Chinese medicinal materials in Jianhe county, and finally it puts forward the recommendations for its further development.
Systems and methods for treating material
Scheele, Randall D; McNamara, Bruce K
2014-10-21
Systems for treating material are provided that can include a vessel defining a volume, at least one conduit coupled to the vessel and in fluid communication with the vessel, material within the vessel, and NF.sub.3 material within the conduit. Methods for fluorinating material are provided that can include exposing the material to NF.sub.3 to fluorinate at least a portion of the material. Methods for separating components of material are also provided that can include exposing the material to NF.sub.3 to at least partially fluorinate a portion of the material, and separating at least one fluorinated component of the fluorinated portion from the material. The materials exposed to the NF.sub.3 material can include but are not limited to one or more of U, Ru, Rh, Mo, Tc, Np, Pu, Sb, Ag, Am, Sn, Zr, Cs, Th, and/or Rb.
Nuclear medicine and imaging research (instrumentation and quantitative methods of evaluation)
International Nuclear Information System (INIS)
Beck, R.N.; Cooper, M.; Chen, C.T.
1992-07-01
This document is the annual progress report for project entitled ''Instrumentation and Quantitative Methods of Evaluation.'' Progress is reported in separate sections individually abstracted and indexed for the database. Subject areas reported include theoretical studies of imaging systems and methods, hardware developments, quantitative methods of evaluation, and knowledge transfer: education in quantitative nuclear medicine imaging
[Application of Delphi method in traditional Chinese medicine clinical research].
Bi, Ying-fei; Mao, Jing-yuan
2012-03-01
In recent years, Delphi method has been widely applied in traditional Chinese medicine (TCM) clinical research. This article analyzed the present application situation of Delphi method in TCM clinical research, and discussed some problems presented in the choice of evaluation method, classification of observation indexes and selection of survey items. On the basis of present application of Delphi method, the author analyzed the method on questionnaire making, selection of experts, evaluation of observation indexes and selection of survey items. Furthermore, the author summarized the steps of application of Delphi method in TCM clinical research.
Quantitative Nuclear Medicine Imaging: Concepts, Requirements and Methods
Energy Technology Data Exchange (ETDEWEB)
NONE
2014-01-15
The absolute quantification of radionuclide distribution has been a goal since the early days of nuclear medicine. Nevertheless, the apparent complexity and sometimes limited accuracy of these methods have prevented them from being widely used in important applications such as targeted radionuclide therapy or kinetic analysis. The intricacy of the effects degrading nuclear medicine images and the lack of availability of adequate methods to compensate for these effects have frequently been seen as insurmountable obstacles in the use of quantitative nuclear medicine in clinical institutions. In the last few decades, several research groups have consistently devoted their efforts to the filling of these gaps. As a result, many efficient methods are now available that make quantification a clinical reality, provided appropriate compensation tools are used. Despite these efforts, many clinical institutions still lack the knowledge and tools to adequately measure and estimate the accumulated activities in the human body, thereby using potentially outdated protocols and procedures. The purpose of the present publication is to review the current state of the art of image quantification and to provide medical physicists and other related professionals facing quantification tasks with a solid background of tools and methods. It describes and analyses the physical effects that degrade image quality and affect the accuracy of quantification, and describes methods to compensate for them in planar, single photon emission computed tomography (SPECT) and positron emission tomography (PET) images. The fast paced development of the computational infrastructure, both hardware and software, has made drastic changes in the ways image quantification is now performed. The measuring equipment has evolved from the simple blind probes to planar and three dimensional imaging, supported by SPECT, PET and hybrid equipment. Methods of iterative reconstruction have been developed to allow for
Post-Processing in the Material-Point Method
DEFF Research Database (Denmark)
Andersen, Søren; Andersen, Lars Vabbersgaard
The material-point method (MPM) is a numerical method for dynamic or static analysis of solids using a discretization in time and space. The method has shown to be successful in modelling physical problems involving large deformations, which are difficult to model with traditional numerical tools...... such as the finite element method. In the material-point method, a set of material points is utilized to track the problem in time and space, while a computational background grid is utilized to obtain spatial derivatives relevant to the physical problem. Currently, the research within the material-point method......-point method. The first idea involves associating a volume with each material point and displaying the deformation of this volume. In the discretization process, the physical domain is divided into a number of smaller volumes each represented by a simple shape; here quadrilaterals are chosen for the presented...
Applied computing in medicine and health
Al-Jumeily, Dhiya; Mallucci, Conor; Oliver, Carol
2015-01-01
Applied Computing in Medicine and Health is a comprehensive presentation of on-going investigations into current applied computing challenges and advances, with a focus on a particular class of applications, primarily artificial intelligence methods and techniques in medicine and health. Applied computing is the use of practical computer science knowledge to enable use of the latest technology and techniques in a variety of different fields ranging from business to scientific research. One of the most important and relevant areas in applied computing is the use of artificial intelligence (AI) in health and medicine. Artificial intelligence in health and medicine (AIHM) is assuming the challenge of creating and distributing tools that can support medical doctors and specialists in new endeavors. The material included covers a wide variety of interdisciplinary perspectives concerning the theory and practice of applied computing in medicine, human biology, and health care. Particular attention is given to AI-bas...
Energy Technology Data Exchange (ETDEWEB)
Felix, R [Bonn Univ. (F.R. Germany). Radiologische Klinik; Winkler, C [Bonn Univ. (F.R. Germany). Inst. fuer Klinische und Experimentelle Nuklearmedizin; Schaede, A [Bonn Univ. (F.R. Germany). Medizinische Klinik
1976-03-01
Significance and technique of roentgenologic and nuclear medicine methods for evaluation of coronary artery disease and myocardial perfusion are presented. Some routinely used methods in nuclear medicine are briefly discussed concerning the evaluation of left ventricular function.
Adachi, H; Kawai, J
2006-01-01
Molecular-orbital calculations for materials design such as alloys, ceramics, and coordination compounds are now possible for experimentalists. Molecuar-orbital calculations for the interpretation of chemical effect of spectra are also possible for experimentalists. The most suitable molecular-orbital calculation method for these purpose is the DV-Xa method, which is robust in such a way that the calculation converges to a result even if the structure of the molecule or solid is impossible in the pressure and temperature ranges on earth. This book specially addresses the methods to design novel materials and to predict the spectralline shape of unknown materials using the DV-Xa molecular-orbital method, but is also useful for those who want to calculate electronic structures of materials using any kind of method.
Chen, Meilan; Guo, Lanping; Yang, Guang; Chen, Min; Yang, Li; Huang, Luqi
2011-11-01
Applications of arbuscular mycorrhizal fungi in research of medicinal plant cultivation are increased in recent years. Medicinal plants habitat is complicated and many inclusions are in root, however crop habitat is simple and few inclusions in root. So appraisal methods and key technologies about the symbiotic system of crop and arbuscular mycorrhizal fungi can't completely suitable for the symbiotic system of medicinal plants and arbuscular mycorrhizal fungi. This article discuss the appraisal methods and key technologies about the symbiotic system of medicinal plant and arbuscular mycorrhizal fungi from the isolation and identification of arbuscular mycorrhiza, and the appraisal of colonization intensity. This article provides guidance for application research of arbuscular mycorrhizal fungi in cultivation of medicinal plants.
Methods of fabricating cermet materials and methods of utilizing same
Kong, Peter C.
2006-04-04
Methods of fabricating cermet materials and methods of utilizing the same such as in filtering particulate and gaseous pollutants from internal combustion engines having intermetallic and ceramic phases. The cermet material may be made from a transition metal aluminide phase and an aluminia phase. The mixture may be pressed to form a green compact body and then heated in a nitrogen-containing atmosphere so as to melt aluminum particles and form the cermet. Filler materials may be added to increase the porosity or tailor the catalytic properties of the cermet material. Additionally, the cermet material may be reinforced with fibers or screens. The cermet material may also be formed so as to pass an electrical current therethrough to heat the material during use.
Methods of producing cermet materials and methods of utilizing same
Kong, Peter C [Idaho Falls, ID
2008-12-30
Methods of fabricating cermet materials and methods of utilizing the same such as in filtering particulate and gaseous pollutants from internal combustion engines having intermetallic and ceramic phases. The cermet material may be made from a transition metal aluminide phase and an alumina phase. The mixture may be pressed to form a green compact body and then heated in a nitrogen-containing atmosphere so as to melt aluminum particles and form the cermet. Filler materials may be added to increase the porosity or tailor the catalytic properties of the cermet material. Additionally, the cermet material may be reinforced with fibers or screens. The cermet material may also be formed so as to pass an electrical current therethrough to heat the material during use.
Modern nuclear medicine methods as a topic of biophysics in veterinary training at UVM in Kosice
International Nuclear Information System (INIS)
Stanicova, J.; Lohajova, L.
2004-01-01
Diagnostic and therapeutic application of ionising radiation is very important in all of branches of medicine including veterinary medicine. In veterinary training at University of Veterinary Medicine in Kosice (UVM), biophysics is a basic subject and it grants physical basis necessary for understanding subsequent subjects such as veterinary surgery, roentgenology, orthopedics. In view of this, traditional methods of radiology such as fluoroscopy, skiagraphy and tomography are explaining. The appearance and application of the theory so called reconstruction of image and also computers led to qualitatively new solutions via the development of modern methods in radiology. Explaining of physical principles, advantages or disadvantages of these new methods is also important in veterinary training although some of them do not use in veterinary practice yet. Two modern methods of nuclear medicine using in diagnostic (SPECT and PET) are discussed bellow. (authors)
Urban forest justice and the rights to wild foods, medicines, and materials in the city
Melissa R. Poe; Rebecca J. McClain; Marla Emery; Patrick. Hurley
2013-01-01
Urban forests are multifunctional socio-ecological landscapes, yet some of their social benefits remain poorly understood. This paper draws on ethnographic evidence from Seattle, Washington to demonstrate that urban forests contain nontimber forest products that contribute a variety of wild foods, medicines, and materials for the wellbeing of urban residents. We show...
Wang, Lin-Yan; Tang, Yu-Ping; Liu, Xin; Ge, Ya-Hui; Li, Shu-Jiao; Shang, Er-Xin; Duan, Jin-Ao
2014-04-01
To establish a method for studying efficacious materials of traditional Chinese medicines from an overall perspective. Carthamus tinctorius was taken the example. Its major components were depleted by preparing liquid chromatography. Afterwards, the samples with major components depleted were evaluated for their antioxidant effect, so as to compare and analyze the major efficacious materials of C. tinctorius with antioxidant activity and the contributions. Seven major components were depleted from C. tinctorius samples, and six of them were identified with MS data and control comparison. After all of the samples including depleted materials are compared and evaluated for their antioxidant effect, the findings showed that hydroxysafflor yellow A, anhydrosafflor yellow B and 6-hydroxykaempferol-3, 6-di-O-glucoside-7-O-glucuronide were the major efficacious materials. This study explored a novel and effective method for studying efficacious materials of traditional Chinese medicines. Through this method, we could explain the direct and indirect contributions of different components to the efficacy of traditional Chinese medicines, and make the efficacious material expression of traditional Chinese medicines clearer.
Zhang, Ding-kun; Wang, Jia-bo; Yang, Ming; Peng, Cheng; Xiao, Xiao-he
2015-07-01
Good medicinal herbs, good drugs. Good evaluation method and indices are the prerequisite of good medicinal herbs. However, there exist numerous indices for quality evaluation and control in Chinese medicinal materials. However, most of these indices are non-interrelated each other, as well as having little relationship with efficiency and safety. The results of different evaluatior methods may not be consistent, even contradictory. Considering the complex material properties of Chinese medicinal materials, single method and index is difficult to objectively and comprehensively reflect the quality. Therefore, it is essential to explore the integrated evaluation methods. In this paper, oriented by the integrated evaluation strategies for traditional Chinese medicine quality, a new method called integrated quality index (IQI) by the integration of empirical evaluation, chemical evaluation, and biological evaluation was proposed. In addition, a study case of hypertoxic herb Aconitum carmichaelii Debx. was provided to explain this method in detail. The results suggested that in the view of specifications, the average weight of Jiangyou aconite was the greatest, followed by Weishan aconite, Butuo aconite, Hanzhong aconite, and Anxian aconite; from the point of chemical components, Jiangyou aconite had the characteristic with strong efficacy and weak toxicity, next was Hanzhong aconite, Butuo aconite, Weishan aconite, and Anxian aconite; taking toxicity price as the index, Hanzhong aconite and Jiangyou aconite have the lower toxicity, while Butuo aconite, Weishan aconite, and Anxian aconite have the relatively higher one. After the normalization and integration of evaluation results, we calculated the IQI value of Jiangyou aconite, Hanzhong aconite, Butuo aconite, Weishan aconite, and Anxian aconite were 0.842 +/- 0.091, 0.597 +/- 0.047, 0.442 +/- 0.033, 0.454 +/- 0.038, 0.170 +/- 0.021, respectively. The quality of Jiangyou aconite is significantly better than the
Method of treating radioactive waste material
International Nuclear Information System (INIS)
Allison, W.
1980-01-01
A method of treating radioactive waste material, particularly a radioactive sludge, is described comprising separating solid material from liquid material, compressing the solid material and encapsulating the solid material in a hardenable composition such as cement, bitumen or a synthetic resin. The separation and compaction stages are conveniently effected in a tube press. (author)
Materials For Gas Capture, Methods Of Making Materials For Gas Capture, And Methods Of Capturing Gas
Polshettiwar, Vivek
2013-06-20
In accordance with the purpose(s) of the present disclosure, as embodied and broadly described herein, embodiments of the present disclosure, in one aspect, relate to materials that can be used for gas (e.g., CO.sub.2) capture, methods of making materials, methods of capturing gas (e.g., CO.sub.2), and the like, and the like.
Directory of Open Access Journals (Sweden)
Vinay Babu Koganti
2017-06-01
Full Text Available BACKGROUND Postgraduation in Community Medicine finds few takers and those who do take it up as a career option have many concerns regarding the course. To understand the issues involved, a qualitative method called VIPP was used, which is a people centered approach to identify issues from the perspectives of those involved. This study is set to identify the problems faced by postgraduate students in Community Medicine regarding their course of study. MATERIALS AND METHODS This study was conducted during a regional postgraduate CME of the NTR University of Health Sciences, Andhra Pradesh. Postgraduates and junior faculty from 5 medical colleges in the region were involved in the exercise after taking their informed consent. Visualisation in Participatory Programmes (VIPP, a qualitative method was used as a means of obtaining information followed by a discussion with visual display of all the mentioned items. RESULTS The themes that emerged are problems faced due to the student’s felt inadequacies, faculty shortcomings, issues regarding the department/college management and lacunae in the course structure and implementation. CONCLUSION In VIPP, sensitive issues are visually displayed for all to see and contemplate. Many of the student’s issues were actually brought on by poor curriculum planning and implementation. This was also undermining students’ self-esteem and causing anxiety about future career prospects.
Directory of Open Access Journals (Sweden)
Rupa Sharma
2017-06-01
Full Text Available Background: Knowledge of Community Medicine plays a pivot role in effective delivery of health care services. Effective Teaching-Learning (T-L of a class of 150-200 students is a challenge. Research is needed to identify methods suitable to the needs of the students. Students’ perspective is an important diagnostic feedback tool in this context. Aims & Objectives: To know the students’ preferences and perceptions regarding current T-L methods and their felt need for modification in the T-L approach. Material & Methods: Responses were collected from students pursuing internship regarding their preferences and perception on a pretested, validated semi structured questionnaire, most of the responses were collected on a Likert type five point scale. The data was analyzed by calculating percentage, mean and Standard Deviation (SD. Result: Majority (66.2% felt a need for modification in T-L Approach and 74% of these opined that it will improve their performance in assessments. Presentation of content was voted as most important component for effective T-L (mean 3.9± 1.39. Desirable modifications was more time allotment to integrated modular T-L (51% and field visits (26%. Conclusion: A judicious combination of Power point presentations with Modular T-L sessions and Field visits can be a more effective T-L approach in Community Medicine from the students’ perspective.
[Herbal textual research of common Mongolian medicine "Du Ge Mo Nong"].
Xi, Jie; Zhong, Hua-Rong; Wucharila-Tu; Buhe Bater; Li, Hui-Hu; Zhong, Guo-Yue
2016-11-01
This study is aimed to provide the source for clinical medication by clarifing the common base of Mongolia medicinal materials "Du Ge Mo Nong". In this paper literature research and plant taxonomy method were adopted combined with investigation of the markets and clinical use status to clarify the origin of common traditional Mongolian medicine "Du Ge Mo Nong". The results showed that the Mongolian medicine "Du Ge Mo Nong" and Tibetan medicine "Du Mu Niu" were the same crude drug and originated from the seeds of Holarrhena antidysenteriaca of family Apocynaceae in earliest time. In Mongolian medicine clinic, the seed of Cynanchum thesioides of family Asclepiadaceae and the fruit of Forsythia suspense of family Oleaceae was used respectively about 18 century and recent time, as the substitutes of H. antidysenteriaca. In present standards on Mongolian material medicine, C. thesioides is including only, and H. antidysenterica is not used almost. In Tibetan medicine clinic, H. antidysenterica is being used so far. But there are various substitutes including the seeds, fruits or grass of many species classified to family Apocynaceae, Asclepiadaceae and Onagraceae from ancient time to the present, and C. forrestii and C. komarovii may be used at present. It's necessary to strengthen the arrangement on Mongolian medicine's varieties by the multidisciplinary methods including literature research, investigation of resources and the use state, and comparison of active substances and biological activities between the different substitutes,and so on. Copyright© by the Chinese Pharmaceutical Association.
International Nuclear Information System (INIS)
Wolfe, D.M.
1997-01-01
Physicists have created remarkably sophisticated instruments for the performance of experiments. With variable phase lags many of these have become useful in technology. In the medical field NMD techniques have become commonplace under the rubric of Magnetic Resonance Imaging. Particle physics has developed sophisticated detectors for both charged and neutral particles. Many of these also have been adapted to medical uses. In both radiology and nuclear medicine, pixel detectors based on designs originating at large-scale colliders, are becoming highly useful in replacing film and NaI as the primary means of X-ray and (-ray detection. Coupled with high-speed work stations, these new techniques allow exciting new imagining modalities. Many of these are based on the handling of digital images originally developed for astronomy. Thus, once again, fundamental science is making large contributions to the development of technology. In this talk, various examples of developments in digital mammography and digital detectors for nuclear medicine will be given. The possibilities for telemedicine will be discussed. (author)
Leyens, Lada; Brand, Angela
National and international medicines agencies have developed innovative methods to expedite promising new medicines to the market and facilitate early patient access. Some of these approval pathways are the conditional approval and the adaptive pathways by the European Medicines Agency (EMA); the Promising Innovative Medicine (PIM) designation and the Early Access to Medicines Scheme (EAMS) by the Medicines and Healthcare Products Regulatory Agency (MHRA), as well as the Fast Track, Breakthrough or Accelerated Approval methods by the Food and Drug Administration (FDA). However, at least in Europe, these methods cannot achieve the goal of improving timely access for patients to new medicines on their own; the reimbursement process also has to become adaptive and flexible. In the past 2 years, the effective access (national patient access) to newly approved oncology drugs ranged from 1 to 30 months, with an extremely high variability between European countries. The goal of early patient access in Europe can only be achieved if the national health technology assessment bodies, such as NICE (ENG), HAS (FR), G-BA (DE) or AIFA (IT), provide harmonized, transparent, flexible, conditional and adaptive methods that adopt the level of evidence accepted by the medicines agencies. The efforts from medicines agencies are welcome but will be in vain if health technology assessments do not follow with similar initiatives, and the European 'postcode' lottery will continue. © 2016 S. Karger AG, Basel.
Statistical methods and materials characterisation
International Nuclear Information System (INIS)
Wallin, K.R.W.
2010-01-01
Statistics is a wide mathematical area, which covers a myriad of analysis and estimation options, some of which suit special cases better than others. A comprehensive coverage of the whole area of statistics would be an enormous effort and would also be outside the capabilities of this author. Therefore, this does not intend to be a textbook on statistical methods available for general data analysis and decision making. Instead it will highlight a certain special statistical case applicable to mechanical materials characterization. The methods presented here do not in any way rule out other statistical methods by which to analyze mechanical property material data. (orig.)
Impact of medicine-related information on medicine purchase and use by literate consumers
Thawani, Vijay R.; Gharpure, Kunda J.; Sontakke, Smita D.
2014-01-01
Aims: To measure impact of information, education, and communication intervention (IEC) on rational medicine use, purchase, and stocking behavior. Materials and Methods: This was a pre- and post-design, interventional study. Base data were collected in first visit, using pre tested questionnaire from 500 respondents, who were of either gender, English speaking, at least graduates, permanent residents, and willing to participate. IEC was framed based on problems identified from this data. ...
International Nuclear Information System (INIS)
Kand, Purushottam
2012-01-01
Nuclear medicine is a specialized area of radiology that uses very small amounts of radioactive materials to examine organ function and structure. Nuclear medicine is older than CT, ultrasound and MRI. It was first used in patients over 60-70 years ago. Today it is an established medical specialty and offers procedures that are essential in many medical specialities like nephrology, pediatrics, cardiology, psychiatry, endocrinology and oncology. Nuclear medicine refers to medicine (a pharmaceutical) that is attached to a small quantity of radioactive material (a radioisotope). This combination is called a radiopharmaceutical. There are many radiopharmaceuticals like DTPA, DMSA, HIDA, MIBI and MDP available to study different parts of the body like kidneys, heart and bones etc. Nuclear medicine uses radiation coming from inside a patient's body where as conventional radiology exposes patients to radiation from outside the body. Thus nuclear imaging study is a physiological imaging, whereas diagnostic radiology is anatomical imaging. It combines many different disciplines like chemistry, physics mathematics, computer technology, and medicine. It helps in diagnosis and to treat abnormalities very early in the progression of a disease. The information provides a quick and accurate diagnosis of wide range of conditions and diseases in a person of any age. These tests are painless and most scans expose patients to only minimal and safe amounts of radiation. The amount of radiation received from a nuclear medicine procedure is comparable to, or often many times less than, that of a diagnostic X-ray. Nuclear medicine provides an effective means of examining whether some tissues/organs are functioning properly. Therapy using nuclear medicine in an effective, safe and relatively inexpensive way of controlling and in some cases eliminating, conditions such as overactive thyroid, thyroid cancer and arthritis. Nuclear medicine imaging is unique because it provides doctors with
Method of forming aluminum oxynitride material and bodies formed by such methods
Bakas, Michael P [Ammon, ID; Lillo, Thomas M [Idaho Falls, ID; Chu, Henry S [Idaho Falls, ID
2010-11-16
Methods of forming aluminum oxynitride (AlON) materials include sintering green bodies comprising aluminum orthophosphate or another sacrificial material therein. Such green bodies may comprise aluminum, oxygen, and nitrogen in addition to the aluminum orthophosphate. For example, the green bodies may include a mixture of aluminum oxide, aluminum nitride, and aluminum orthophosphate or another sacrificial material. Additional methods of forming aluminum oxynitride (AlON) materials include sintering a green body including a sacrificial material therein, using the sacrificial material to form pores in the green body during sintering, and infiltrating the pores formed in the green body with a liquid infiltrant during sintering. Bodies are formed using such methods.
Directory of Open Access Journals (Sweden)
M. E. Kim
2017-01-01
Full Text Available The signs of growth in the prevalence of multidrug-resistant tuberculosis, low effectiveness of therapy indicate the urgent need to solve problems aimed at the improvement of the effectiveness of treatment: the reduction of toxicity and side effects of anti-tuberculosis drugs, the provision of good tolerability and continuity of chemotherapy; the removal of symptoms of intoxication associated with the action of the pathogen on the body, the improvement of the quality of life of patients during therapy and remission.The aim of the investigation is to study the data of folk medicine, scientific research data concerning the use of raw materials of natural (vegetable, animal and mineral origin in the adjuvant therapy of tuberculosis.Materials and methods. The study was carried out using information retrieval and library databases (PubMed, eLIBRARY, Cyberleninka, technical information of manufacturers of dietary supplements to food, as well as site materials dedicated to the use of vegetable, animal and mineral raw materials in folk medicine.Results and discussion. The adjuvant therapy of tuberculosis includes remedies of natural origin: vegetable, animal and mineral ones. According to the research data, the use of phytotherapy is aimed at enhancing diuresis, which ensures the elimination of toxic substances and their metabolites, as well as the decrease of the overall level of toxins; the strengthening of the body’s antioxidant defense, and liver specificity, the compensation for the increased consumption of vitamins, amino acids and microelements by the liver, which actively metabolizes xenobiotics, as well as the increase of the body’s overall resistance. A long-term benefit of using natural mineral raw materials in adjuvant therapy of tuberculosis is also observed.Conclusion. Thus, adjuvant therapy of tuberculosis includes the use of raw materials of natural (vegetable, animal and mineral origin, the effectiveness of which is confirmed by
2013-01-01
This Handbook provides comprehensive coverage of laser and coherent-domain methods as applied to biomedicine, environmental monitoring, and materials science. Worldwide leaders in these fields describe the fundamentals of light interaction with random media and present an overview of basic research. The latest results on coherent and polarization properties of light scattered by random media, including tissues and blood, speckles formation in multiple scattering media, and other non-destructive interactions of coherent light with rough surfaces and tissues, allow the reader to understand the principles and applications of coherent diagnostic techniques. The expanded second edition has been thoroughly updated with particular emphasis on novel coherent-domain techniques and their applications in medicine and environmental science. Volume 1 describes state-of-the-art methods of coherent and polarization optical imaging, tomography and spectroscopy; diffusion wave spectroscopy; elastic, quasi-elastic and inelasti...
Nuclear physics methods in materials research
International Nuclear Information System (INIS)
Bethge, K.; Baumann, H.; Jex, H.; Rauch, F.
1980-01-01
Proceedings of the seventh divisional conference of the Nuclear Physics Division held at Darmstadt, Germany, from 23rd through 26th of September, 1980. The scope of this conference was defined as follows: i) to inform solid state physicists and materials scientists about the application of nuclear physics methods; ii) to show to nuclear physicists open questions and problems in solid state physics and materials science to which their methods can be applied. According to the intentions of the conference, the various nuclear physics methods utilized in solid state physics and materials science and especially new developments were reviewed by invited speakers. Detailed aspects of the methods and typical examples extending over a wide range of applications were presented as contributions in poster sessions. The Proceedings contain all the invited papers and about 90% of the contributed papers. (orig./RW)
The new generation of packing materials
International Nuclear Information System (INIS)
Malikov, T.S.; Dzhonmurodov, A.S.; Usmanova, S.R.; Teshaev, Kh.I.; Mukhidinov, Z.K.
2016-01-01
Present article is devoted to new generation of packing materials. The methods of extraction and investigation of component composition and properties of whey protein, zein, carboxymethylcellulose, hyaluronic acid and pectins were elaborated in order to further application them in pharmaceutical industry as composite materials and for capsulation of medicines.
Selective Integration in the Material-Point Method
DEFF Research Database (Denmark)
Andersen, Lars; Andersen, Søren; Damkilde, Lars
2009-01-01
The paper deals with stress integration in the material-point method. In order to avoid parasitic shear in bending, a formulation is proposed, based on selective integration in the background grid that is used to solve the governing equations. The suggested integration scheme is compared...... to a traditional material-point-method computation in which the stresses are evaluated at the material points. The deformation of a cantilever beam is analysed, assuming elastic or elastoplastic material behaviour....
International Nuclear Information System (INIS)
2005-01-01
The All-Polish Symposium Nuclear Techniques in Industry, Medicine, Agriculture and Environment Protection is cyclic (in 3 year period) conference being a broad review of state of art and development of all nuclear branches cooperated with industry and other branches of national economy and public life in Poland. The conference has been divided in one plenary session and 6 problem sessions as follow: Environmental protection, earth sciences, protection of cultural objects; Industrial applications; applications in medicine, medical apparatus; measurement methods, simulations, experiment planning; radiation techniques; laboratories, metrology
Energy Technology Data Exchange (ETDEWEB)
Vaz, Sandra Muntz
1996-12-31
This dissertation has presented the results from analysis of medicinal plant extracts using neutron activation method. Instrumental neutron activation analysis was applied to the determination of the elements Al, Br, Ca, Ce, Cl, Cr, Cs, Fe, K, La, Mg, Mn, Na, Rb, Sb, Sc and Zn in medicinal extracts obtained from Achyrolcline satureoides DC, Casearia sylvestris, Centella asiatica, Citrus aurantium L., Solano lycocarpum, Solidago microglossa, Stryphnondedron barbatiman and Zingiber officinale R. plants. The elements Hg and Se were determined using radiochemical separation by means of retention of Se in HMD inorganic exchanger and solvent extraction of Hg by bismuth diethyl-dithiocarbamate solution. Precision and accuracy of the results have been evaluated by analysing reference materials. The therapeutic action of some elements found in plant extracts analyzed was briefly discussed 70 refs., 13 figs., 15 tabs
Energy Technology Data Exchange (ETDEWEB)
Vaz, Sandra Muntz
1995-12-31
This dissertation has presented the results from analysis of medicinal plant extracts using neutron activation method. Instrumental neutron activation analysis was applied to the determination of the elements Al, Br, Ca, Ce, Cl, Cr, Cs, Fe, K, La, Mg, Mn, Na, Rb, Sb, Sc and Zn in medicinal extracts obtained from Achyrolcline satureoides DC, Casearia sylvestris, Centella asiatica, Citrus aurantium L., Solano lycocarpum, Solidago microglossa, Stryphnondedron barbatiman and Zingiber officinale R. plants. The elements Hg and Se were determined using radiochemical separation by means of retention of Se in HMD inorganic exchanger and solvent extraction of Hg by bismuth diethyl-dithiocarbamate solution. Precision and accuracy of the results have been evaluated by analysing reference materials. The therapeutic action of some elements found in plant extracts analyzed was briefly discussed 70 refs., 13 figs., 15 tabs
Rapid Radiochemical Methods for Asphalt Paving Material ...
Technical Brief Validated rapid radiochemical methods for alpha and beta emitters in solid matrices that are commonly encountered in urban environments were previously unavailable for public use by responding laboratories. A lack of tested rapid methods would delay the quick determination of contamination levels and the assessment of acceptable site-specific exposure levels. Of special concern are matrices with rough and porous surfaces, which allow the movement of radioactive material deep into the building material making it difficult to detect. This research focuses on methods that address preparation, radiochemical separation, and analysis of asphalt paving materials and asphalt roofing shingles. These matrices, common to outdoor environments, challenge the capability and capacity of very experienced radiochemistry laboratories. Generally, routine sample preparation and dissolution techniques produce liquid samples (representative of the original sample material) that can be processed using available radiochemical methods. The asphalt materials are especially difficult because they do not readily lend themselves to these routine sample preparation and dissolution techniques. The HSRP and ORIA coordinate radiological reference laboratory priorities and activities in conjunction with HSRP’s Partner Process. As part of the collaboration, the HSRP worked with ORIA to publish rapid radioanalytical methods for selected radionuclides in building material matrice
Roediger, Rebecca; Jaka, Hyasinta; Bougaila, Amina; Smart, Luke; Langwick, Stacey
2017-01-01
Background Hypertension is increasingly common in sub-Saharan Africa where traditional medicine use is also common. We conducted a hospital-based, mixed-methods study to determine prevalence, pattern, and correlates of herbal and alternative medicine use in Tanzanian adults hospitalized with hypertension. Methods A standardized questionnaire was administered. In-depth interviews were performed on a subset of participants. Factors associated with herbal medicine use were determined by logistic regression. The association between traditional medicine uses and allopathic medication adherence was determined using ordinal logistic regression. Qualitative data were analyzed according to grounded theory. Results Of 213 adults enrolled, 52 (24.4%) reported using herbs during the previous month and 47 (22.1%) reported concurrent use of herbs and allopathic medicines. Lower educational level, nonprofessional employment, and lack of health insurance were significantly associated with herbal medicine use. Alternative medicines use was not associated with lower medication adherence. Qualitative interviews identified several important themes including reasons for herbal medicine use. Conclusion The use of traditional medicines is very common among patients with hypertension. Adults from low socioeconomic status, those with misunderstandings about hypertension, and those without health insurance were more likely to take herbs. Open, nonjudgmental communication between healthcare workers and patients regarding use of traditional medicines must be encouraged in Africa. PMID:28634545
Directory of Open Access Journals (Sweden)
Anthony Liwa
2017-01-01
Full Text Available Background. Hypertension is increasingly common in sub-Saharan Africa where traditional medicine use is also common. We conducted a hospital-based, mixed-methods study to determine prevalence, pattern, and correlates of herbal and alternative medicine use in Tanzanian adults hospitalized with hypertension. Methods. A standardized questionnaire was administered. In-depth interviews were performed on a subset of participants. Factors associated with herbal medicine use were determined by logistic regression. The association between traditional medicine uses and allopathic medication adherence was determined using ordinal logistic regression. Qualitative data were analyzed according to grounded theory. Results. Of 213 adults enrolled, 52 (24.4% reported using herbs during the previous month and 47 (22.1% reported concurrent use of herbs and allopathic medicines. Lower educational level, nonprofessional employment, and lack of health insurance were significantly associated with herbal medicine use. Alternative medicines use was not associated with lower medication adherence. Qualitative interviews identified several important themes including reasons for herbal medicine use. Conclusion. The use of traditional medicines is very common among patients with hypertension. Adults from low socioeconomic status, those with misunderstandings about hypertension, and those without health insurance were more likely to take herbs. Open, nonjudgmental communication between healthcare workers and patients regarding use of traditional medicines must be encouraged in Africa.
Price and availability survey of essential medicines in the Harare ...
African Journals Online (AJOL)
their innovator and/or generic equivalents) in both private retail and public pharmacies. Setting: Private and public sector retail pharmacies in Harare metropolitan province, Zimbabwe. Materials and Methods: Forty medicines were selected for ...
Niemi, Maria; Ståhle, Göran
2016-02-17
Ayurveda has its historical roots in India, but has also been internationalised, partly via migration and partly through an increased interest in alternative medicine in the West, where studies point toward increased use. However, there is to date scarce knowledge about the use and experiences of ayurveda in Sweden. We have conducted a case study of a center for ayurvedic healthcare in Sweden. We have collected information on client background data from the center's documentation, and compiled data from all clients who visited the centre for ayurvedic consultation during spring 2014. In total, 55 individuals were included in the study, and 18 of them were chosen for individual semi-structured interviews, to gain a deeper understanding of their motives for seeking, and experiences of ayurvedic health care. The material was analysed and compiled through a mix of qualitative and quantitative methods. Among the 55 clients, 91% were female the mean age was 47 years, and 64% gave a specific illness as a reason for seeking ayurveda. The most common illnesses were respiratory, musculoskeletal, circulatory, tumor, and cutaneous illnesses. The qualitative results showed that ayurveda was being used in combination with other methods, including various diets, other alternative medicine methods and conventional medicine. Some participants recounted having sought ayurveda as a complement to conventional medicine, or in cases when conventional medicine had been experienced as insufficient in terms of diagnosis or treatment. However, some participants experienced it as difficult to follow the ayurvedic life-style advice in the midst of their everyday life. Many participants reported positive experiences of pulse diagnostics, which was the main diagnostic method used in ayurvedic consultation. Some reported concrete, physical improvement of their symptoms. This study points towards important aspects of participant experience of ayurveda, that may be subject to further research. The
Techniques and methods in nuclear materials traceability
International Nuclear Information System (INIS)
Persiani, P.J.
1996-01-01
The nonproliferation community is currently addressing concerns that the access to special nuclear materials may increase the illicit trafficking in weapons-usable materials from civil and/or weapons material stores and/or fuel cycles systems. Illicit nuclear traffic usually involves reduced quantities of nuclear materials perhaps as samplings of a potential protracted diversionary flow from sources to users. To counter illicit nuclear transactions requires the development of techniques and methods in nuclear material traceability as an important phase of a broad forensic analysis capability. This report discusses how isotopic signatures and correlation methods were applied to determine the origins of Highly Enriched Uranium (HEU) and Plutonium samples reported as illicit trafficking in nuclear materials
Molecular methods in nuclear medicine therapy
International Nuclear Information System (INIS)
Lee, Kyung Han
2001-01-01
Nuclear medicine has traditionally contributed to molecular oncology by allowing noninvasive monitoring of tumor metabolism, growth and genetic changes, thereby providing a basis for appropriate biology-based treatment planning. However, NM techniques are now being applied as an active therapeutic tool in novel molecular approaches for cancer treatment. Such areas include research on cancer therapy with radiolabeled ligands or oligonucleotides, and utilization of synergism between NM radiotherapy and gene transfer techniques. Here we will focus on novel aspects of nuclear medicine therapy
Naughton, Bernard; Roberts, Lindsey; Dopson, Sue; Brindley, David; Chapman, Stephen
2017-05-06
This study aims to establish expert opinion and potential improvements for the Falsified Medicines Directive mandated medicines authentication technology. A two-round Delphi method study using an online questionnaire. Large National Health Service (NHS) foundation trust teaching hospital. Secondary care pharmacists and accredited checking technicians. Seven-point rating scale answers which reached a consensus of 70-80% with a standard deviation (SD) of <1.0. Likert scale questions which reached a consensus of 70-80%, a SD of <1.0 and classified as important according to study criteria. Consensus expert opinion has described database cross-checking technology as quick and user friendly and suggested the inclusion of an audio signal to further support the detection of counterfeit medicines in secondary care (70% consensus, 0.9 SD); other important consensus with a SD of <1.0 included reviewing the colour and information in warning pop up screens to ensure they were not mistaken for the 'already dispensed here' pop up, encouraging the dispenser/checker to act on the warnings and making it mandatory to complete an 'action taken' documentation process to improve the quarantine of potentially counterfeit, expired or recalled medicines. This paper informs key opinion leaders and decision makers as to the positives and negatives of medicines authentication technology from an operator's perspective and suggests the adjustments which may be required to improve operator compliance and the detection of counterfeit medicines in the secondary care sector. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
DEFF Research Database (Denmark)
Inta, A.; Shengji, P.; Balslev, Henrik
2008-01-01
Aim of the study : The survey aims to study the effect of geographic separation of ethnic groups on local knowledge of medicinal plants used by Akha people in Thailand and China, who were separated 100-120 years ago, to see how different the two geographically distinct but culturally similar groups...... were in this respect. Materials and methods : Interviewing 10 villagers in each of five Akha villages, three in Thailand and two in China, about which plants they used and how they used them. Results : A total of 95 medicinal plants registered in the five villages only 16 were shared between China......, but that when using these new species they have maintained other traditions relating to medicinal plants....
Liu, Baoyan; Zhang, Yanhong; Hu, Jingqing; He, Liyun; Zhou, Xuezhong
2011-06-01
The gradual development of Chinese medicine is based on constant accumulation and summary of experience in clinical practice, but without the benefit of undergoing the experimental medicine stage. Although Chinese medicine has formed a systematic and unique theory system through thousands of years, with the development of evidence-based medicine, the bondage of the research methods of experience medicine to Chinese medicine is appearing. The rapid transition and transformation from experience medicine to evidence-based medicine have become important content in the development of Chinese medicine. According to the features of Chinese medicine, we propose the research idea of "taking two ways simultaneously," which is the study both in the ideal condition and in the real world. Analyzing and constructing the theoretical basis and methodology of clinical research in the real world, and building the stage for research technique is key to the effective clinical research of Chinese medicine. Only by gradually maturing and completing the clinical research methods of the real world could we realize "taking two ways simultaneously" and complementing each other, continuously produce scientific and reliable evidence of Chinese medicine, as well as transform and develop Chinese medicine from experience medicine to evidence-based medicine.
Dastgheib, Ladan; Farahangiz, Saman; Adelpour, Zeinab; Salehi, Alireza
2017-10-01
The objective of this study was to assess complementary and alternative medicine use and its related factors among Iranian dermatology outpatients. In this cross-sectional study, a self-structured questionnaire was administered to 600 dermatology outpatients. Mann-Whitney U test, chi-square test, and binary logistic regression test were used. A total of 188 (31.3%) patients had used one of complementary and alternative medicine methods. The most frequent method used was herbal medicine (89.9%). The mean years of duration of the skin condition were significantly higher in complementary and alternative medicine users compared with nonusers ( P = .037). Patients with acne and alopecia significantly used more complementary and alternative medicine (odds ratio: 2.48 and 3.19, respectively). There was a significant relationship between education and using complementary and alternative medicine ( P alternative medicine use is prevalent among our patients and we should think of ways of educating general population about complementary and alternative medicine methods and their potential risks and benefits and encourage our health care workers to communicate these materials with their patients.
Directory of Open Access Journals (Sweden)
Jeong Hwan Park
2017-12-01
Full Text Available Background: Functional dyspepsia (FD is the seventh most common disease encountered in Korean medicine (KM clinics. Despite the large number of FD patients visiting KM clinics, the accumulated medical records have no utility in evidence development, due to being unstructured. This study aimed to construct a standard operating procedure (SOP with appropriate structured diagnostic methods for FD, and assess the feasibility for use in KM clinics. Methods: Two rounds of professional surveys were conducted by 10 Korean internal medicine professors to select the representative diagnostic methods. A feasibility study was conducted to evaluate compliance and time required for using the structured diagnostic methods by three specialists in two hospitals. Results: As per the results of the professional survey, five questionnaires and one basic diagnostic method were selected. An SOP was constructed based on the survey results, and a feasibility study showed that the SOP compliance score (out of 5 was 3.45 among the subjects, and 3.25 among the practitioners. The SOP was acceptable and was not deemed difficult to execute. The total execution time was 136.5 minutes, out of which the gastric emptying test time was 129 minutes. Conclusion: This feasibility study of the SOP with structured diagnostic methods for FD confirmed it was adequate for use in KM clinics. It is expected that these study findings will be helpful to clinicians who wish to conduct observational studies as well as to generate quantitative medical records to facilitate Big Data research. Keywords: Big Data, Dyspepsia, Korean medicine, Feasibility studies, Observational study
Study on color difference estimation method of medicine biochemical analysis
Wang, Chunhong; Zhou, Yue; Zhao, Hongxia; Sun, Jiashi; Zhou, Fengkun
2006-01-01
The biochemical analysis in medicine is an important inspection and diagnosis method in hospital clinic. The biochemical analysis of urine is one important item. The Urine test paper shows corresponding color with different detection project or different illness degree. The color difference between the standard threshold and the test paper color of urine can be used to judge the illness degree, so that further analysis and diagnosis to urine is gotten. The color is a three-dimensional physical variable concerning psychology, while reflectance is one-dimensional variable; therefore, the estimation method of color difference in urine test can have better precision and facility than the conventional test method with one-dimensional reflectance, it can make an accurate diagnose. The digital camera is easy to take an image of urine test paper and is used to carry out the urine biochemical analysis conveniently. On the experiment, the color image of urine test paper is taken by popular color digital camera and saved in the computer which installs a simple color space conversion (RGB -> XYZ -> L *a *b *)and the calculation software. Test sample is graded according to intelligent detection of quantitative color. The images taken every time were saved in computer, and the whole illness process will be monitored. This method can also use in other medicine biochemical analyses that have relation with color. Experiment result shows that this test method is quick and accurate; it can be used in hospital, calibrating organization and family, so its application prospect is extensive.
Method and apparatus for semi-solid material processing
Han, Qingyou [Knoxville, TN; Jian, Xiaogang [Knoxville, TN; Xu, Hanbing [Knoxville, TN; Meek, Thomas T [Knoxville, TN
2009-02-24
A method of forming a material includes the steps of: vibrating a molten material at an ultrasonic frequency while cooling the material to a semi-solid state to form non-dendritic grains therein; forming the semi-solid material into a desired shape; and cooling the material to a solid state. The method makes semi-solid castings directly from molten materials (usually a metal), produces grain size usually in the range of smaller than 50 .mu.m, and can be easily retrofitted into existing conventional forming machine.
Composite material and method of making
Fryxell, Glen E.; Samuels, William D.; Simmons, Kevin L.
2004-04-20
The composite material and methods of making the present invention rely upon a fully dense monolayer of molecules attached to an oxygenated surface at one end, and an organic terminal group at the other end, which is in turn bonded to a polymer. Thus, the composite material is a second material chemically bonded to a polymer with fully dense monolayer there between.
Liao, Su-Fen; Yan, Su-Rong; Guo, Wei-Jia; Luo, Ji; Sun, Jing; Dong, Fang; Wang, Yun; Qiao, Yan-Jiang
2014-07-01
Multi-component traditional Chinese medicines are an innovative research mode for traditional Chinese medicines. Currently, there are many design methods for developing multi-component traditional Chinese medicines, but their common feature is the lack of effective connection of the traditional Chinese medicine theory. In this paper, the authors discussed the multi-component traditional Chinese medicine design methods based on medicinal property combination modes, provided the combination methods with the characteristics of traditional Chinese medicine for the prescription combinations, and proved its feasibly with hypertension cases.
Zhao, Yufeng; Liu, Bo; He, Liyun; Bai, Wenjing; Yu, Xueyun; Cao, Xinyu; Luo, Lin; Rong, Peijing; Zhao, Yuxue; Li, Guozheng; Liu, Baoyan
2017-09-01
Traditional Chinese patent medicines are widely used to treat stroke because it has good efficacy in the clinical environment. However, because of the lack of knowledge on traditional Chinese patent medicines, many Western physicians, who are accountable for the majority of clinical prescriptions for such medicine, are confused with the use of traditional Chinese patent medicines. Therefore, the aid-decision method is critical and necessary to help Western physicians rationally use traditional Chinese patent medicines. In this paper, Manifold Ranking is employed to develop the aid-decision model of traditional Chinese patent medicines for stroke treatment. First, 115 stroke patients from three hospitals are recruited in the cross-sectional survey. Simultaneously, traditional Chinese physicians determine the traditional Chinese patent medicines appropriate for each patient. Second, particular indicators are explored to characterize the population feature of traditional Chinese patent medicines for stroke treatment. Moreover, these particular indicators can be easily obtained byWestern physicians and are feasible for widespread clinical application in the future. Third, the aid-decision model of traditional Chinese patent medicines for stroke treatment is constructed based on Manifold Ranking. Experimental results reveal that traditional Chinese patent medicines can be differentiated. Moreover, the proposed model can obtain high accuracy of aid decision.
Application of photonuclear methods of analysis in biology, medicine, ecological studies
International Nuclear Information System (INIS)
Burmistenko, Yu.N.
1986-01-01
Examples of application of photonuclear methods of analysis (PhMA) of the substance composition in biology, medicine, ecology are considered. The methods for determining the element composition of soft and bone tissues, blood, urine are developed. The results of studying the limits of determination of different elements are presented. In ecological investigations PhMA is applied for studying the composition of atmospheric aerosols, industrial sewage, canalization wastes, pollution of soil, plants, animals with toxic elements
Comparison of Leiomyoma of Modern Medicine and Traditional Persian Medicine.
Tansaz, Mojgan; Tajadini, Haleh
2016-04-01
Leiomyoma is the most common benign tumor of the pelvic that is associated with reproductive problems such as infertility, frequent abortions, and undesirable prenatal outcomes. High prevalence of leiomyoma and its relation with important gynecological complications, especially during reproductive ages, on the one hand, and high medical expenses and significant complications of common treatments, on the other, made us search traditional Persian medicine texts for a similar disease. In traditional Persian medicine, a condition has been introduced similar to leiomyoma (Oram-e-rahem). In this article, by collecting materials from traditional medicine texts on leiomyoma, we aim to provide theories for further studies on this topic, as there is an obvious difference between traditional Persian medicine and modern medicine with regard to leiomyoma. When modern medicine has not found a suitable response to treatment, reviewing of traditional Persian medicine for finding better treatment strategies is wise. © The Author(s) 2015.
Medicinal plants used as excipients in the history in Ghanaian herbal medicine
DEFF Research Database (Denmark)
Freiesleben, Sara Holm; Soelberg, Jens; Jäger, Anna
2015-01-01
Ethnopharmacological relevance The present study was carried out to investigate the traditional use, pharmacology and active compounds of four plants commonly used as excipients in herbal medicine in Ghana. Materials and methods A comprehensive literature search was conducted to gain knowledge....... melegueta could act as an antioxidant to preserve herbal preparations. None of the plant excipients had antibacterial activity against the bacteria tested in this study. Compounds with an aromatic or pungent smell had been identified in all the plant excipients. An explanation for the use of the plants...... as excipients could rely on their taste properties. Conclusion The present study suggests that there may be more than one simple explanation for the use of these four plants as excipients. Plausible explanations have been proven to be: (1) a way to increase the effect of the medicine, (2) a way to make...
Device and method for traditional chinese medicine diagnosis using radioactive tracer method
Energy Technology Data Exchange (ETDEWEB)
Wu, Shanling; Shen, Miaohe
1997-05-29
Disclosed is a device and method for traditional chinese medicine diagnosis using radioactive-tracer method. At least two nuclear radiation probes are arranged apart along the channels to detect the changing with time and on space of the intensity of radioactivity of the nuclear radioactive tracer which has been injected into the body in the channel position. The detected signals are amplified by amplifiers, and the outputs of the amplifiers are applied to data processing means which monitor the whole detecting process in real time and analyse and process the detected information about the changing of the intensity of radioactivity with time and on space indicating the operating of vital energy and blood, and obtain state parameters about operating of vital energy and blood in the body which is then output through data output means. (author) figs.
Children's (Pediatric) Nuclear Medicine
Full Text Available ... Tell your doctor about your child’s recent illnesses, medical conditions, medications and allergies. Depending on the type ... Nuclear Medicine? Nuclear medicine is a branch of medical imaging that uses small amounts of radioactive material ...
Wang, Houwei; Dou, Yanling; Tian, Jingzhen; Li, Feng; Wang, Shijun; Wang, Zhenguo
2009-02-01
To research on the substantial foundation of the medical speciality of Chinese traditional medicines from immunogenicity. Control antigen with hot nature was prepared from the mixture of the aqueous extracts of three Chinese traditional medicines with three typical hot nature of Alpinia officinarum, Cinnamomum cassia and Curculigo orchioides, while that with cold nature prepared with Rheum palmatum, Anemarrhena asphodeloides, Coptis chinensis, and polyclonal antibody was prepared by immunizing rabbit with control antigen. Dot blotting was performed between the polyclonal antibody of control antigen and the aqueous extracts of nine Chinese traditional medicines on a piece of PVDF membrane, and the blotting signals were analyzed by the software of Quantity One. Blotting signals with hot control antigen of nine Chinese traditional medicines in descending were Zingiber officinale, Aconitum carmichaeli, Eucommia ulmoides, Fraxinus rhynchophylla, Lonicera japonica, Anemarrhena asphodeloides, Coptis chinensis, Rheum palmatum and Phellodendron chinense, which degree of similarity to control antigen in peak value were 57.33%, 43.56 %, 34.16%, 30.2%, 28.81%, 26.53%, 21.68%, 17.62% and 14.85%, respectively. Blotting signals with cold control antigen were Rheum palmatum, Anemarrhena asphodeloides, Coptis chinensis, Phellodendron chinense, Zingiber officinale, Lonicera japonica, Fraxinus rhynchophylla, Eucommia ulmoides and Aconitum carmichaeli in descending, of which degree of similarity to cold control antigen in peak value were 55.22%, 54.23%, 46.72%, 34.08%, 30.3%, 24.48%, 24.33%, 20.35% and 15.17%, respectively. Results of cluster analysis with Wistar's method showed that nine medicines were classified into two groups, one group included Phellodendron chinense, Anemarrhena asphodeloides, Coptis chinensis, Rheum palmatum, another was Zingiber officinale, Aconitum carmichaeli, Eucommia ulmoides, Fraxinus rhynchophylla, Lonicera japonica. Blotting signals of nine medicines
Energy Technology Data Exchange (ETDEWEB)
Lee, Jin-Young; Park, Tae-Soon; Ho Son, Jun [Department of Cosmeceutical Science, Daegu Haany University, Kyungsan 712-715 (Korea, Republic of); Jo, Cheorun [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Woo Byun, Myung [Radiation Food Science and Biotechnology Team, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of); Jeun An, Bong [Department of Cosmeceutical Science, Daegu Haany University, Kyungsan 712-715 (Korea, Republic of)], E-mail: anbj@dhu.ac.kr
2007-11-15
Sopoongsan is an oriental medicinal prescription including 12 medicinal herbs. Sopoongsan is known to have anti-inflammatory, anti-microbial, anti-allergic, and anti-cancer effects on human skin. To use Sopoongsan extract for functional cosmetic composition, its dark color should be brighter for seeking consumer demand, clear products, without any adverse change in its function. Irradiation with doses 0, 5, 10, and 20 kGy was applied to improve color of ethanol- or water-extracted Sopoongsan and also superoxide dismutase (SOD), xanthine oxidase (XO), melanoma cell growth inhibition, and anti-microbial activity was investigated. Generally, ethanol extract was better than water extract in function and irradiation up to 20 kGy did not change any functional effect. Especially, the inhibition of melanin deposition on skin measured by inhibition of B16F10 (melanoma) cell growth was as high as arbutin, commercially available product, when the ethanol-extracted Sopoongsan was irradiated for 20 kGy. Results showed that when irradiation technology is used, the limitation of addition amount of natural materials for food or cosmetic composition caused by color problem can be decreased significantly with time saving and cost benefit compared to conventional color removal process. Therefore, irradiation would be one of the good methods to pose an additional value for related industry.
International Nuclear Information System (INIS)
Lee, Jin-Young; Park, Tae-Soon; Ho Son, Jun; Jo, Cheorun; Woo Byun, Myung; Jeun An, Bong
2007-01-01
Sopoongsan is an oriental medicinal prescription including 12 medicinal herbs. Sopoongsan is known to have anti-inflammatory, anti-microbial, anti-allergic, and anti-cancer effects on human skin. To use Sopoongsan extract for functional cosmetic composition, its dark color should be brighter for seeking consumer demand, clear products, without any adverse change in its function. Irradiation with doses 0, 5, 10, and 20 kGy was applied to improve color of ethanol- or water-extracted Sopoongsan and also superoxide dismutase (SOD), xanthine oxidase (XO), melanoma cell growth inhibition, and anti-microbial activity was investigated. Generally, ethanol extract was better than water extract in function and irradiation up to 20 kGy did not change any functional effect. Especially, the inhibition of melanin deposition on skin measured by inhibition of B16F10 (melanoma) cell growth was as high as arbutin, commercially available product, when the ethanol-extracted Sopoongsan was irradiated for 20 kGy. Results showed that when irradiation technology is used, the limitation of addition amount of natural materials for food or cosmetic composition caused by color problem can be decreased significantly with time saving and cost benefit compared to conventional color removal process. Therefore, irradiation would be one of the good methods to pose an additional value for related industry
Capturing indigenous knowledge on medicinal plants use: Case ...
African Journals Online (AJOL)
Background: Understanding the intricate link between humans and the plants use is needed to address some of to-day's socio-economic and health challenges. Materials and Methods: The study focused on plants that have high cultural and medicinal values for the host communities of Old Oyo National Park, Nigeria. Local ...
Children's (Pediatric) Nuclear Medicine
Full Text Available ... Nuclear Medicine? Nuclear medicine is a branch of medical imaging that uses small amounts of radioactive material to ... a radiologist or other physician. To locate a medical imaging or radiation oncology provider in your community, you ...
Wang, Hui; Zhang, Xiao-Bo; Huang, Lu-Qi; Guo, Lan-Ping; Wang, Ling; Zhao, Yu-Ping; Yang, Guang
2017-11-01
The supply of Chinese patent medicine is influenced by the price of raw materials (Chinese herbal medicines) and the stock of resources. On the one hand, raw material prices show cyclical volatility or even irreversible soaring, making the price of Chinese patent medicine is not stable or even the highest cost of hanging upside down. On the other hand, due to lack of resources or disable some of the proprietary Chinese medicine was forced to stop production. Based on the micro-service architecture and Redis cluster deployment Based on the micro-service architecture and Redis cluster deployment, the supply security monitoring and analysis system for Chinese patent medicines in national essential medicines has realized the dynamic monitoring and intelligence warning of herbs and Chinese patent medicine by connecting and integrating the database of Chinese medicine resources, the dynamic monitoring system of traditional Chinese medicine resources and the basic medicine database of Chinese patent medicine. Copyright© by the Chinese Pharmaceutical Association.
Directory of Open Access Journals (Sweden)
Goran Stojković
2016-03-01
Full Text Available Two simple, sensitive, selective, precise, and accurate methods for determination of trimethoprim in different sulfonamide formulations intended for use in human and veterinary medicine were optimized and validated. The methods are based on the trimethoprim reaction with bromcresol green (BCG and 2,4-dinitro-1-fluorobenzene (DNFB. As extraction solvents we used 10 % N,N-dimethylacetamide in methanol and acetone for both methods, respectively. The colored products are quantified applying visible spectrophotometry at their corresponding absorption maxima. The methods were validated for linearity, sensitivity, accuracy, and precision. We tested the method applicability on four different medicinal products in tablet and powder forms containing sulfametrole and sulfamethoxazole in combination with trimethoprim. The results revealed that both methods are equally accurate with recoveries within the range 95-105 %. The obtained between-day precision for both methods, when applied on four different medicinal products, was within in the range 1.08-3.20 %. By applying the F-statistical test (P<0.05, it was concluded that for three medicinal products tested both methods are applicable with statistically insignificant difference in precision. The optimized and validated BCG and DNFB methods could find application in routine quality control of trimethoprim in various formulation forms, at different concentration levels, and in combination with different sulfonamides.
Ledford, Christy J W; Cafferty, Lauren A; Seehusen, Dean A
2015-01-01
Uncertainty is a central theme in the practice of medicine and particularly primary care. This study explored how family medicine resident physicians react to uncertainty in their practice. This study incorporated a two-phase mixed methods approach, including semi-structured personal interviews (n=21) and longitudinal self-report surveys (n=21) with family medicine residents. Qualitative analysis showed that though residents described uncertainty as an implicit part of their identity, they still developed tactics to minimize or manage uncertainty in their practice. Residents described increasing comfort with uncertainty the longer they practiced and anticipated that growth continuing throughout their careers. Quantitative surveys showed that reactions to uncertainty were more positive over time; however, the difference was not statistically significant. Qualitative and quantitative results show that as family medicine residents practice medicine their perception of uncertainty changes. To reduce uncertainty, residents use relational information-seeking strategies. From a broader view of practice, residents describe uncertainty neutrally, asserting that uncertainty is simply part of the practice of family medicine.
African Journals Online (AJOL)
RamalivhanaJN
2014-01-22
Jan 22, 2014 ... There has been a steady rise in antibiotic resistance of bacteria and this ... against an extensive spectrum of microorganisms, it differs depending on the type of honey. ... on the antibacterial activities of medicinal plants against.
Attitude and knowledge of family medicine practitioners towards the ...
African Journals Online (AJOL)
Objectives: To assess the attitude and knowledge of family medicine practitioners (FMPs) towards the association between periodontal disease and obesity. Materials and Methods: A cross-sectional study was performed and a 13-item survey questionnaire was given to FMPs practicing in 12 different teaching hospitals in ...
Inventory of Medicinal Flora from Thal Desert, Punjab, Pakistan ...
African Journals Online (AJOL)
Materials and Methods: The whole area was surveyed for inventorying medicinal flora by using a semi-structured questionnaire. Results: The people of the study area are extremely knowledgeable, hence reported 120 plants which are being used in treating various human diseases. The detailed inventory including ...
14 CFR 35.17 - Materials and manufacturing methods.
2010-01-01
... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Materials and manufacturing methods. 35.17... AIRWORTHINESS STANDARDS: PROPELLERS Design and Construction § 35.17 Materials and manufacturing methods. (a) The... and manufacturing methods must conform to specifications acceptable to the Administrator. (c) The...
Empirical methods for systematic reviews and evidence-based medicine
van Enst, W.A.
2014-01-01
Evidence-Based Medicine is the integration of best research evidence with clinical expertise and patient values. Systematic reviews have become the cornerstone of evidence-based medicine, which is reflected in the position systematic reviews have in the pyramid of evidence-based medicine. Systematic
Proceedings of computational methods in materials science
International Nuclear Information System (INIS)
Mark, J.E. Glicksman, M.E.; Marsh, S.P.
1992-01-01
The Symposium on which this volume is based was conceived as a timely expression of some of the fast-paced developments occurring throughout materials science and engineering. It focuses particularly on those involving modern computational methods applied to model and predict the response of materials under a diverse range of physico-chemical conditions. The current easy access of many materials scientists in industry, government laboratories, and academe to high-performance computers has opened many new vistas for predicting the behavior of complex materials under realistic conditions. Some have even argued that modern computational methods in materials science and engineering are literally redefining the bounds of our knowledge from which we predict structure-property relationships, perhaps forever changing the historically descriptive character of the science and much of the engineering
New materials through a variety of sintering methods
Jaworska, L.; Cyboroń, J.; Cygan, S.; Laszkiewicz-Łukasik, J.; Podsiadło, M.; Novak, P.; Holovenko, Y.
2018-03-01
New sintering techniques make it possible to obtain materials with special properties that are impossible to obtain by conventional sintering techniques. This issue is especially important for ceramic materials for application under extreme conditions. Following the tendency to limit critical materials in manufacturing processes, the use of W, Si, B, Co, Cr should be limited, also. One of the cheapest and widely available materials is aluminum oxide, which shows differences in phase composition, grain size, hardness, strain and fracture toughness of the same type of powder, sintered via various methods. In this paper the alumina was sintered using the conventional free sintering process, microwave sintering, Spark Plasma Sintering (SPS), high pressure-high temperature method (HP-HT) and High Pressure Spark Plasma Sintering (HP SPS). Phase composition analysis, by X-ray diffraction of the alumina materials sintered using various methods, was carried out. For the conventional sintering method, compacts are composed of α-Al2O3 and θ-Al2O3. For compacts sintered using SPS, microwave and HP-HT methods, χ-Al2O3 and γ-Al2O3 phases were additionally present. Mechanical and physical properties of the obtained materials were compared between the methods of sintering. On the basis of images from scanning electron microscope quantitative analysis was performed to determine the degree of grain growth of alumina after sintering.
Methods for the measurement of micro material evidence
International Nuclear Information System (INIS)
Yang Mingtai; Wang Wen; Wu Lunqiang; Dai Changsong
2012-01-01
The micro material evidence has been used in judicature litigation successfully, that must base on impersonal authentication with the advanced and proper methods. The basic principle, main trait, applicable range, analysis minimum and sensitive limit of twelve type instruments used in micro material evidence analysis have been related. Those could supply optional proper methods for micro material evidence. (authors)
Complementary and Alternative Medicine Methods in Chronic Renal Failure
Directory of Open Access Journals (Sweden)
Zeynep Erdogan
2014-08-01
Full Text Available Despite its long history, use of complementary and alternative medicine (CAM methods has increased dramatically only after 1990s. Up to 57% of patients with chronic renal use CAM methods.These patienys use CAM methods to overcome hypertension, fatigue, constipation, leg edema, pain, cramps, anxiety, depression, sleep disorders, to cope with symptoms such as itching, to stop the progression of kidney disease and to improve their quality of life. Methods used are herbal products and food supplements, acupressure, acupuncture, homeopathy, exercise, aromatherapy, yoga and reflexology. Nephrotoxic effect of several CAM therapies used in patients with renal impairment could disturb hemodynamics by reducing the glomerular filtration rate. For this reason, health care providers should question patients about used of CAM, methods. Communication with patients should be clear and should not act judgmental. Health care personnel should learn more about CAM methods in order to avoid unwanted situations that could develop after the application of CAM methods. Patients should be informed correctly and scientifically about these methods to avoid harmful and unnecessary uses. [Archives Medical Review Journal 2014; 23(4.000: 770-786
Reliability studies of diagnostic methods in Indian traditional Ayurveda medicine: An overview
Kurande, Vrinda Hitendra; Waagepetersen, Rasmus; Toft, Egon; Prasad, Ramjee
2013-01-01
Recently, a need to develop supportive new scientific evidence for contemporary Ayurveda has emerged. One of the research objectives is an assessment of the reliability of diagnoses and treatment. Reliability is a quantitative measure of consistency. It is a crucial issue in classification (such as prakriti classification), method development (pulse diagnosis), quality assurance for diagnosis and treatment and in the conduct of clinical studies. Several reliability studies are conducted in western medicine. The investigation of the reliability of traditional Chinese, Japanese and Sasang medicine diagnoses is in the formative stage. However, reliability studies in Ayurveda are in the preliminary stage. In this paper, examples are provided to illustrate relevant concepts of reliability studies of diagnostic methods and their implication in practice, education, and training. An introduction to reliability estimates and different study designs and statistical analysis is given for future studies in Ayurveda. PMID:23930037
Constipation due to Liver Disorder in Iranian Traditional Medicine`s Viewpoint
Directory of Open Access Journals (Sweden)
R Choopani
2014-04-01
Full Text Available Introduction: Constipation is one of the most common pediatric disorders.In many cases, there is no anatomic endocrineor metabolic cause in explanation of chronic constipation.More than 85% of them called functional or idiopathic.Constipation is one of the serious disease in Iranian Traditional Medicine. Besides the problem it causes, chronic constipation can be the origin of many disease. That is why, ithas been called Mother of disease.The purpose of this study is to investigate the Constipation in children and the role of other organs such as the liver by view of Iranian Traditional Medicine Materials and Method: This study is a review through Iranian traditional medicine references. At first, all the main available traditional books were reviewed. All the data about therapies of vaginal discharge in ITM were collected then classified. Results: In traditional medicine different reasons have been mentioned for constipation especially for childrenwhich most of them are similar to etiology in Modern Medicine.Constipation due to liver disorder is one of the causes of constipation.In Iranian Traditional medicine` viewpoint, one of the mechanism for excretion is existence of secreted bile in intestine.If by any reason,measure or quality of its which secreted in intestine through bile changes or if intestinal mucous secretion becomes barrier for absorbing the food,it will caused disorder in excretion and finally will lead to constipation.Well known Iranian Traditional Medicine scientists, has mentioned all reasons for liver disorders and changing quality& quantity of secreted bile .he has mentioned the solutions as well. Conclusion: It is hoped that by paying attention to constipation and with advanced clinical research we will be able to explain idiopathic constipation and prepare new ways of treatments for constipation. New researches have approved the effectiveness of these foods and drugs for treating the constipation. Keywords
The determinants of traditional medicine use in Northern Tanzania: a mixed-methods study.
Directory of Open Access Journals (Sweden)
John W Stanifer
Full Text Available Traditional medicines are an important part of healthcare in sub-Saharan Africa, and building successful disease treatment programs that are sensitive to traditional medicine practices will require an understanding of their current use and roles, including from a biomedical perspective. Therefore, we conducted a mixed-method study in Northern Tanzania in order to characterize the extent of and reasons for the use of traditional medicines among the general population so that we can better inform public health efforts in the region.Between December 2013 and June 2014 in Kilimanjaro, Tanzania, we conducted 5 focus group discussions and 27 in-depth interviews of key informants. The data from these sessions were analyzed using an inductive framework method with cultural insider-outsider coding. From these results, we developed a structured survey designed to test different aspects of traditional medicine use and administered it to a random sample of 655 adults from the community. The results were triangulated to explore converging and diverging themes.Most structured survey participants (68% reported knowing someone who frequently used traditional medicines, and the majority (56% reported using them themselves in the previous year. The most common uses were for symptomatic ailments (42%, chronic diseases (15%, reproductive problems (11%, and malaria/febrile illnesses (11%. We identified five major determinants for traditional medicine use in Northern Tanzania: biomedical healthcare delivery, credibility of traditional practices, strong cultural identities, individual health status, and disease understanding.In order to better formulate effective local disease management programs that are sensitive to TM practices, we described the determinants of TM use. Additionally, we found TM use to be high in Northern Tanzania and that its use is not limited to lower-income areas or rural settings. After symptomatic ailments, chronic diseases were reported as
Training Methods to Improve Evidence-Based Medicine Skills
Directory of Open Access Journals (Sweden)
Filiz Ozyigit
2010-06-01
Full Text Available Evidence based medicine (EBM is the conscientious, explicit and judicious use of current best evidence in making decisions about the care of individual patients. It is estimated that only 15% of medical interventions is evidence-based. Increasing demand, new technological developments, malpractice legislations, a very speed increase in knowledge and knowledge sources push the physicians forward for EBM, but at the same time increase load of physicians by giving them the responsibility to improve their skills. Clinical maneuvers are needed more, as the number of clinical trials and observational studies increase. However, many of the physicians, who are in front row of patient care do not use this increasing evidence. There are several examples related to different training methods in order to improve skills of physicians for evidence based practice. There are many training methods to improve EBM skills and these trainings might be given during medical school, during residency or as continuous trainings to the actual practitioners in the field. It is important to discuss these different training methods in our country as well and encourage dissemination of feasible and effective methods. [TAF Prev Med Bull 2010; 9(3.000: 245-254
Analysis of Stress Updates in the Material-point Method
DEFF Research Database (Denmark)
Andersen, Søren; Andersen, Lars
2009-01-01
The material-point method (MPM) is a new numerical method for analysis of large strain engineering problems. The MPM applies a dual formulation, where the state of the problem (mass, stress, strain, velocity etc.) is tracked using a finite set of material points while the governing equations...... are solved on a background computational grid. Several references state, that one of the main advantages of the material-point method is the easy application of complicated material behaviour as the constitutive response is updated individually for each material point. However, as discussed here, the MPM way...
The Gender Lens: Development of a learning aid to introduce gender medicine
Directory of Open Access Journals (Sweden)
Weyers, Simone
2017-05-01
Full Text Available Background and aim: Gender medicine takes into account biological and social differences between men and women in terms of prevalence and course of disease, diagnosis and therapy. Medical students should be made aware of this in the early stages of medical education. However, there is hardly any teaching material currently available. This article presents the adaption and first use of the German “Gender Lens,” a tool to introduce gender medicine to medical students. Method: The original Canadian ”Gender Lens Tool” was translated into German, tested by (n=5 teachers and adapted based on current scientific concepts. The instrument was applied and evaluated using qualitative methods in a student focus group (n=4. It was then piloted in a cohort of fourth-semester students (n=247 in a seminar addressing gender medicine. These experiences were evaluated using quantitative methods.Results: The German translation of the Gender Lens offers students a framework with which to analyze sex and gender differences in terms of the “prevalence, diagnosis, course, therapy and prevention” of a specific disease. Furthermore, it enables a refined search for causes such as “biological disposition, attitudes and behaviors, family and social networks, occupational and material circumstances and experiences with the health care system.” Recommendations were received from the student groups regarding teaching methods. Male and female fourth-semester students agreed that the Gender Lens is useful as an introduction to gender medicine. Discussion: Initial experiences with the Gender Lens adapted for the German curriculum suggest that such a learning aid can contribute to raising awareness of gender medicine in medical students.
Li, Jing-Jian; Xiong, Chao; Liu, Yue; Liang, Jun-Song; Zhou, Xing-Wen
2016-01-01
Correct identification of medicinal plant ingredients is essential for their safe use and for the regulation of herbal drug supply chain. Loop-mediated isothermal amplification (LAMP) is a recently developed approach to identify herbal medicine species. This novel molecular biology technique enables timely and accurate testing, especially in settings where infrastructures to support polymerase chain reaction facilities are lacking. Studies that used this method have altered our view on the extent and complexity of herbal medicine identification. In this review, we give an introduction into LAMP analysis, covers the basic principles and important aspects in the development of LAMP analysis method. Then we presented a critical review of the application of LAMP-based methods in detecting and identifying raw medicinal plant materials and their processed products. We also provide a practical standard operating procedure (SOP) for the utilization of the LAMP protocol in herbal authentication, and consider the prospects of LAMP technology in the future developments of herbal medicine identification and the challenges associated with its application.
Energy Technology Data Exchange (ETDEWEB)
Daniels, Michael A.; Heaps, Ronald J.; Wallace, Ronald S.; Pantoya, Michelle L.; Collins, Eric S.
2016-11-01
An energetic material comprising an elemental fuel, an oxidizer or other element, and a carbon nanofiller or carbon fiber rods, where the carbon nanofiller or carbon fiber rods are substantially homogeneously dispersed in the energetic material. Methods of tailoring the electrostatic discharge sensitivity of an energetic material are also disclosed.
Ceramic luminescent radiographic materials for medicine and tool construction
International Nuclear Information System (INIS)
Winnacker, A.
1991-01-01
X-ray recording luminescent materials form the basis of a new concept for X ray imaging. Essential advantages as compared to the conventional film systems are the digitalisation of the X ray as well as the high dynamics of registration. Modern methods of image processing and video recording can be applied. Advantages also show where a very extensive video material must be filed. Compared to the films used up to now, one expects higher sensitivity, higher homogeneity and higher spatial resolution of pictures taken with ceramic films. (BaFBr:Eu, RbJ:Tl). (orig.) [de
Qualitative research methods in renal medicine: an introduction.
Bristowe, Katherine; Selman, Lucy; Murtagh, Fliss E M
2015-09-01
Qualitative methodologies are becoming increasingly widely used in health research. However, within some specialties, including renal medicine, qualitative approaches remain under-represented in the high-impact factor journals. Qualitative research can be undertaken: (i) as a stand-alone research method, addressing specific research questions; (ii) as part of a mixed methods approach alongside quantitative approaches or (iii) embedded in clinical trials, or during the development of complex interventions. The aim of this paper is to introduce qualitative research, including the rationale for choosing qualitative approaches, and guidance for ensuring quality when undertaking and reporting qualitative research. In addition, we introduce types of qualitative data (observation, interviews and focus groups) as well as some of the most commonly encountered methodological approaches (case studies, ethnography, phenomenology, grounded theory, thematic analysis, framework analysis and content analysis). © The Author 2015. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved.
Calibration and intercomparison methods of dose calibrators used in nuclear medicine facilities
International Nuclear Information System (INIS)
Costa, Alessandro Martins da
1999-01-01
Dose calibrators are used in most of the nuclear medicine facilities to determine the amount of radioactivity administered to a patient in a particular investigation or therapeutic procedure. It is therefore of vital importance that the equipment used presents good performance and is regular;y calibrated at a authorized laboratory. This occurs of adequate quality assurance procedures are carried out. Such quality control tests should be performed daily, other biannually or yearly, testing, for example, its accuracy and precision, the reproducibility and response linearity. In this work a commercial dose calibrator was calibrated with solution of radionuclides used in nuclear medicine. Simple instrument tests, such as response linearity and the response variation of the source volume increase at a constant source activity concentration, were performed. This instrument can now be used as a working standard for calibration of other dose calibrators/ An intercomparison procedure was proposed as a method of quality control of dose calibrators used in nuclear medicine facilities. (author)
Leder, Drew; Krucoff, Mitchell W
2011-09-01
Modern medicine is often accused by diverse critics of being "too materialistic" and therefore insufficiently holistic and effective. Yet, this critique can be misleading, dependent upon the ambiguous meanings of "materialism." The term can refer to the prevalence of financial concerns in driving medical practice. Alternatively, it can refer to "mechanistic materialism," the patient viewed as a body-machine. In each case, this article shows that this represents not authentic "materialism" at play, but a focus upon high-level abstractions. "Bottom-line" financial or diagnostic numbers can distract practitioners from the embodied needs of sick patients. In this sense, medical practice is not materialist enough. Through a series of clinical examples, this article explores how an authentic materialism would look in current and future practice. The article examines the use of prayer/comfort shawls at the bedside; hospitals and nursing homes redesigned as enriched healing environments; and a paradigmatic medical device--the implantable cardioverter defibrillator--as it might be presented to patients, in contrast to current practice.
Comparison of Sasang Constitutional Medicine, Traditional Chinese Medicine and Ayurveda
Kim, Jong Yeol; Pham, Duong Duc; Koh, Byung Hee
2011-01-01
Sasang constitutional medicine (SCM), traditional Chinese medicine (TCM) and Ayurveda are three different forms of Asian traditional medicine. Although these traditions share a lot in common as holistic medicines, the different philosophical foundations found in each confer distinguishing attributes and unique qualities. SCM is based on a constitution-based approach, and is in this way relatively more similar to the Ayurvedic tradition than to the TCM, although many of the basic SCM theories were originally derived from TCM, a syndrome-based medicine. SCM and TCM use the same botanical materials that are distributed mainly in the East Asian region, but the basic principles of usage and the underlying rationale are completely different from each other. Meanwhile, the principles of the Ayurvedic use of botanical resources are very similar to those seen in SCM, but the medicinal herbs used in Ayurveda generally originate from the West Asian region which displays a different spectrum of flora. PMID:21949669
Comparison of Sasang Constitutional Medicine, Traditional Chinese Medicine and Ayurveda
Directory of Open Access Journals (Sweden)
Jong Yeol Kim
2011-01-01
Full Text Available Sasang constitutional medicine (SCM, traditional Chinese medicine (TCM and Ayurveda are three different forms of Asian traditional medicine. Although these traditions share a lot in common as holistic medicines, the different philosophical foundations found in each confer distinguishing attributes and unique qualities. SCM is based on a constitution-based approach, and is in this way relatively more similar to the Ayurvedic tradition than to the TCM, although many of the basic SCM theories were originally derived from TCM, a syndrome-based medicine. SCM and TCM use the same botanical materials that are distributed mainly in the East Asian region, but the basic principles of usage and the underlying rationale are completely different from each other. Meanwhile, the principles of the Ayurvedic use of botanical resources are very similar to those seen in SCM, but the medicinal herbs used in Ayurveda generally originate from the West Asian region which displays a different spectrum of flora.
Methods for purifying carbon materials
Dailly, Anne [Pasadena, CA; Ahn, Channing [Pasadena, CA; Yazami, Rachid [Los Angeles, CA; Fultz, Brent T [Pasadena, CA
2009-05-26
Methods of purifying samples are provided that are capable of removing carbonaceous and noncarbonaceous impurities from a sample containing a carbon material having a selected structure. Purification methods are provided for removing residual metal catalyst particles enclosed in multilayer carbonaceous impurities in samples generate by catalytic synthesis methods. Purification methods are provided wherein carbonaceous impurities in a sample are at least partially exfoliated, thereby facilitating subsequent removal of carbonaceous and noncarbonaceous impurities from the sample. Methods of purifying carbon nanotube-containing samples are provided wherein an intercalant is added to the sample and subsequently reacted with an exfoliation initiator to achieve exfoliation of carbonaceous impurities.
Cevik, Arif Alper; Cakal, Elif Dilek; Abu-Zidan, Fikri M
2018-06-07
The published recommendations for international emergency medicine curricula cover the content, but exclude teaching and learning methods, assessment, and evaluation. We aim to provide an overview on available emergency medicine clerkship curricula and report the development and application experience of our own curriculum. Our curriculum is an outcome-based education, enriched by e-learning and various up-to-date pedagogic principles. Teaching and learning methods, assessment, and evaluation are described. The theory behind our practice in the light of recent literature is discussed aiming to help other colleagues from developing countries to have a clear map for developing and tailoring their own curricula depending on their needs. The details of our emergency medicine clerkship will serve as an example for developing and developed countries having immature undergraduate emergency medicine clerkship curricula. However, these recommendations will differ in various settings depending on available resources. The main concept of curriculum development is to create a curriculum having learning outcomes and content relevant to the local context, and then align the teaching and learning activities, assessments, and evaluations to be in harmony. This may assure favorable educational outcome even in resource limited settings.
Methods for treating lignocellulosic materials
Jansen, Robert; Travisano, Philip; Madsen, Lee; Matis, Neta; Lawson, James Alan; Lapidot, Noa; Eyal, Aharon M.; Bauer, Timothy Allen; Belman, Ziv-Vladimir; Hallac, Bassem; Zviely, Michael
2017-10-10
The present invention relates to methods of processing lignocellulosic material to obtain hemicellulose sugars, cellulose sugars, lignin, cellulose and other high-value products. Also provided are hemicellulose sugars, cellulose sugars, lignin, cellulose, and other high-value products.
Methods for treating lignocellulosic materials
Energy Technology Data Exchange (ETDEWEB)
Jansen, Robert; Gregoire, Claire; Travisano, Philip; Madsen, Lee; Matis, Neta; Har-Tal, Yael Miriam; Eliahu, Shay; Lawson, James Alan; Lapidot, Noa; Eyal, Aharon M.; Bauer, Timothy Allen; McWilliams, Paul; Zviely, Michael; Carden, Adam
2017-05-16
The present invention relates to methods of processing lignocellulosic material to obtain hemicellulose sugars, cellulose sugars, lignin, cellulose and other high-value products. Also provided are hemicellulose sugars, cellulose sugars, lignin, cellulose, and other high-value products.
Methods for treating lignocellulosic materials
Energy Technology Data Exchange (ETDEWEB)
Jansen, Robert; Gregoire, Claire; Travisano, Philip; Madsen, Lee; Matis, Neta; Har-Tal, Yael Miriam; Eliahu, Shay; Lawson, James Alan; Lapidot, Noa; Burke, Luke; Eyal, Aharon M.; Bauer, Timothy Allen; Sade, Hagit; McWilliams, Paul; Zviely, Michael; Carden, Adam
2017-04-25
The present invention relates to methods of processing lignocellulosic material to obtain hemicellulose sugars, cellulose sugars, lignin, cellulose and other high-value products. Also provided are hemicellulose sugars, cellulose sugars, lignin, cellulose, and other high-value products.
Between the Living and the Dead: Trauma Medicine and Forensic Medicine in the Mid-Qing.
Wu, Yi-Li
2015-03-01
This paper analyzes the influence of forensic medicine on therapeutic medicine through a case study of Qian Xiuchang and Hu Tingguang, two Chinese doctors who specialized in treating traumatic injuries. During the early nineteenth century, both men compiled medical treatises that sought to improve on a scholarly model of "rectifying bones" articulated in 1742 by the Imperially-Compiled Golden Mirror of the Medical Lineage . Both texts also incorporated information from forensic medicine, including official inquest diagrams and checklists promulgated by the Qing government. I show that they drew on these forensic materials to help address two interlinked medical issues: understanding the effects of injury on different parts of the body, and clarifying the location and form of the body's bones. Overall, I suggest that the exchange of ideas between the realm of therapeutic medicine and forensic medicine was an important epistemological strategy that doctors and officials alike employed to improve their knowledge of the material body.
Directory of Open Access Journals (Sweden)
Justyna Kucińska-Lipka
2018-02-01
Full Text Available Novel, slowly-degradable and hydrophilic materials with proper mechanical properties and surface characteristics are in great demand within the biomedical field. In this paper, the design, synthesis, and characterization of polyurethanes (PUR crosslinked with poly(vinyl alcohol (PVA as a new proposition for regenerative medicine is described. PVA-crosslinked PURs were synthesized by a two-step polymerization performed in a solvent (dimethylsulfoxide, DMSO. The raw materials used for the synthesis of PVA-crosslinked PURs were poly(ε-caprolactone (PCL, 1,6-hexamethylene diisocyanate (HDI, and PVA as a crosslinking agent. The obtained materials were studied towards their physicochemical, mechanical, and biological performance. The tests revealed contact angle of the materials surface between 38–47° and tensile strength in the range of 41–52 MPa. Mechanical characteristics of the obtained PURs was close to the characteristics of native human bone such as the cortical bone (TSb = 51–151 MPa or the cancellous bone (TSb = 10–20 MPa. The obtained PVA-crosslinked PURs did not show significant progress of degradation after 3 months of incubation in a phosphate-buffered saline (PBS. Accordingly, the obtained materials may behave similar to slowly-degradable materials, which can provide long-term physical support in, for example, tissue regeneration, as well as providing a uniform calcium deposition on the material surface, which may influence, for example, bone restoration. A performed short-term hemocompatibility study showed that obtained PVA-crosslinked PURs do not significantly influence blood components, and a cytotoxicity test performed with the use of MG 63 cell line revealed the great cytocompatibility of the obtained materials. According to the performed studies, such PVA-crosslinked PURs may be a suitable proposition for the field of tissue engineering in regenerative medicine.
Method and apparatus for modeling, visualization and analysis of materials
Aboulhassan, Amal
2016-08-25
A method, apparatus, and computer readable medium are provided for modeling of materials and visualization of properties of the materials. An example method includes receiving data describing a set of properties of a material, and computing, by a processor and based on the received data, geometric features of the material. The example method further includes extracting, by the processor, particle paths within the material based on the computed geometric features, and geometrically modeling, by the processor, the material using the geometric features and the extracted particle paths. The example method further includes generating, by the processor and based on the geometric modeling of the material, one or more visualizations regarding the material, and causing display, by a user interface, of the one or more visualizations.
International Nuclear Information System (INIS)
Martin, P.M.
1977-01-01
Numerical description of medical and biologic phenomena is proliferating. Laboratory studies on patients now yield measurements of at least a dozen indices, each with its own normal limits. Within nuclear medicine, numerical analysis as well as numerical measurement and the use of computers are becoming more common. While the digital computer has proved to be a valuable tool for measurment and analysis of imaging and radioimmunoassay data, it has created more work in that users now ask for more detailed calculations and for indices that measure the reliability of quantified observations. The following material is presented with the intention of providing a straight-forward methodology to determine values for some useful parameters and to estimate the errors involved. The process used is that of asking relevant questions and then providing answers by illustrations. It is hoped that this will help the reader avoid an error of the third kind, that is, the error of statistical misrepresentation or inadvertent deception. This occurs most frequently in cases where the right answer is found to the wrong question. The purposes of this chapter are: (1) to provide some relevant statistical theory, using a terminology suitable for the nuclear medicine field; (2) to demonstrate the application of a number of statistical methods to the kinds of data commonly encountered in nuclear medicine; (3) to provide a framework to assist the experimenter in choosing the method and the questions most suitable for the experiment at hand; and (4) to present a simple approach for a quantitative quality control program for scintillation cameras and other radiation detectors
Personalized medicine: a confluence of traditional and contemporary medicine.
Jafari, Samineh; Abdollahi, Mohammad; Saeidnia, Soodabeh
2014-01-01
Traditional systems of medicine have attained great popularity among patients in recent years. Success of this system in the treatment of disease warrants consideration, particularly in cases for which conventional medicine has been insufficient. This study investigates the similarities in principles and approaches of 3 traditional systems and explores whether conventional medicine is able to exploit the advantages of traditional systems. This study first identifies and explores the advantages of 3 well-known systems-traditional Iranian medicine (TIM), ayurveda, and traditional Chinese medicine (TCM)-that are similar in their basic principles and methods. Second, it clarifies whether and how conventional medicine could exploit the advantages of traditional systems as it modernizes, to become more personalized. Finally, this study investigates the possibility that conventional medicine could benefit from traditional typology to improve its personalization. The acknowledgment of the unity of humans and nature, applying rational methods, and personalized approaches is fundamentally similar in the 3 systems. Additionally, they all promote the holistic view that health is harmony and disease is disharmony of the body. Other similarities include their recognition of the unique nature of every person and their categorization of people into different body types. Although conventional medicine has mostly failed to incorporate the advantages of traditional medicine, its integration with traditional medicine is achievable. For instance, exploiting traditional typologies in genomic and other studies may facilitate personalization of conventional medicine. From its review, the research team concludes that prospects are bright for the integration of traditional and conventional medicines and, consequently, for a dramatic improvement in health systems.
The Significance of Ayurvedic Medicinal Plants
Kumar, Syal; Dobos, Gustav J.; Rampp, Thomas
2016-01-01
Traditional Indian medicine (ayurveda) is becoming increasingly popular, with many chronic conditions responding to it well. Most patients begin to take conventional medications as soon as their diagnoses are made, so ayurvedic treatments are usually undergone alongside and/or after conventional medical approaches. A detailed knowledge of the action of food, spices, and medicinal plants is needed in order to understand their potential influence fully. While societal use of ayurvedic plants and Indian spices is commonplace, without ill effect, the use of more concentrated products made from single plants, often in the form of teas or tablets, is of more concern. The mechanisms by which polyherbal drugs and their extracts act differ in many respects from the actions of single substances or synthetic drugs. Despite the fact that ayurvedic medicines are based on natural herbal materials, their safety depends on their method of administration, taking into account individuals’ needs and their specific disease conditions. PMID:27707902
Spectral Analysis of Chinese Medicinal Herbs Based on Delayed Luminescence
Directory of Open Access Journals (Sweden)
Jingxiang Pang
2016-01-01
Full Text Available Traditional Chinese medicine (TCM plays a critical role in healthcare; however, it lacks scientific evidence to support the multidimensional therapeutic effects. These effects are based on experience, and, to date, there is no advanced tool to evaluate these experience based effects. In the current study, Chinese herbal materials classified with different cold and heat therapeutic properties, based on Chinese medicine principles, were investigated using spectral distribution, as well as the decay probability distribution based on delayed luminescence (DL. A detection system based on ultraweak biophoton emission was developed to determine the DL decay kinetics of the cold and heat properties of Chinese herbal materials. We constructed a mathematical model to fit the experimental data and characterize the properties of Chinese medicinal herbs with different parameters. The results demonstrated that this method has good reproducibility. Moreover, there is a significant difference (p<0.05 in the spectral distribution and the decay probability distribution of Chinese herbal materials with cold and heat properties. This approach takes advantage of the comprehensive nature of DL compared with more reductionist approaches and is more consistent with TCM principles, in which the core comprises holistic views.
Choose of standard materials in the method of β-testing new materials' mass thickness
International Nuclear Information System (INIS)
Chen Zhong
2007-01-01
To make sure of the standard mass thickness in beta radials testing mass thickness, this paper calculate using M. C. method and get the result of the relations between the beta radials' transmission rate of different energies and mass thickness in different materials. This result prove that in method of beta test mass thickness choosing materials whose elements are close as standard materials are viable. (authors)
New developments in nuclear medicine technology
International Nuclear Information System (INIS)
Ziegler, S.I.; Pichler, B.J.
2000-01-01
During the past few years, there have been new impulses in the development of a number of technologies employed in Nuclear Medicine imaging. These include new scintillation materials, the way of detecting the scintillation light, and completely novel methods to detect gamma rays by means of semiconductor detectors. In addition to combined instrumentation that can be used for SPECT and PET, already in clinical use, combined scintigraphic and anatomic imaging devices are now becoming available, for example SPECT/CT or PET/CT. This review article describes the most important of the new components, part of which have already entered product development and part of which are still in the research phase. The review focus on the employment of modern semiconductor detectors in Nuclear Medicine. (orig.) [de
Directory of Open Access Journals (Sweden)
Ledile Mankga
2013-12-01
Full Text Available Medicinal plants cover a broad range of taxa, which may be phylogenetically less related but morphologically very similar. Such morphological similarity between species may lead to misidentification and inappropriate use. Also the substitution of a medicinal plant by a cheaper alternative (e.g. other non-medicinal plant species, either due to misidentification, or deliberately to cheat consumers, is an issue of growing concern. In this study, we used DNA barcoding to identify commonly used medicinal plants in South Africa. Using the core plant barcodes, matK and rbcLa, obtained from processed and poorly conserved materials sold at the muthi traditional medicine market, we tested efficacy of the barcodes in species discrimination. Based on genetic divergence, PCR amplification efficiency and BLAST algorithm, we revealed varied discriminatory potentials for the DNA barcodes. In general, the barcodes exhibited high discriminatory power, indicating their effectiveness in verifying the identity of the most common plant species traded in South African medicinal markets. BLAST algorithm successfully matched 61% of the queries against a reference database, suggesting that most of the information supplied by sellers at traditional medicinal markets in South Africa is correct. Our findings reinforce the utility of DNA barcoding technique in limiting false identification that can harm public health.
Anorexia: Highlights in Traditional Persian medicine and conventional medicine
Nimrouzi, Majid; Zarshenas, Mohammad Mehdi
2018-01-01
Objective: Anorexia and impaired appetite (Dysorexia) are common symptoms with varying causes, and often need no serious medical intervention. Anorexia nervosa (AN) is a chronic psychiatric disease with a high mortality rate. In Traditional Persian Medicine (TPM), anorexia is a condition in which anorexic patients lose appetite due to dystemperament. This review aims to discuss the common points of traditional and conventional approaches rather than introducing Persian medical recommendations suitable for nowadays use. Materials and Methods: For this purpose, Avicenna's Canon of Medicine, main TPM resources and important databases were reviewed using the related keywords. Results: Despite complex hormonal explanation, etiology of AN in conventional approach is not completely understood. In TPM approach, the etiology and recommended interventions are thoroughly defined based on humoral pathophysiology. In TPM approach, disease states are regarded as the result of imbalances in organs’ temperament and humors. In anorexia with simple dystemperament, the physician should attempt to balance the temperament using foods and medicaments which have opposite quality of temperament. Lifestyle, spiritual diseases (neuro – psychological) and gastrointestinal worms are the other causes for reducing appetite. Also, medicines and foods with warm temperaments (such as Pea soup and Mustard) are useful for these patients (cold temperament). Conclusion: Although the pathophysiology of AN in TPM is different in comparison with conventional views, TPM criteria for treatment this disorder is similar to those of current medicine. Recommending to have spiritual support and a healthy lifestyle are common in both views. Simple safe interventions recommended by TPM may be considered as alternative medical modalities after being confirmed by well-designed clinical trials. PMID:29387569
Method to assist conception of collimators in nuclear medicine
International Nuclear Information System (INIS)
Gantet, P.; Esquerre, J.P.; Danet, B.; Roux, G.; Guiraud, R.
1990-01-01
Designing a collimator should begin by an accurate computation of its performances in order to minimize the usual expensive and time consuming phase of trial and error. The authors briefly describe several methods currently used, and present a method of simulation of the percussional response of collimators. The computation takes into account the attenuation of photons by the collimator septas. An other benefit is its ability to be used whatever the geometric specifications of the collimator. The program computes spatial resolution, geometric efficiency, septal penetration, as well as slice thickness when the collimator is used with a SPECT device. The study presents the results concerning two collimators: a general purpose parallel hole commercially available and a focused parallel one dedicated to a single slice SPECT system. In conclusion, this deterministic method which takes attenuation into account for collimators performances computation should be useful tool to assist conception of new collimators in nuclear medicine [fr
Finite Element Method for Analysis of Material Properties
DEFF Research Database (Denmark)
Rauhe, Jens Christian
and the finite element method. The material microstructure of the heterogeneous material is non-destructively determined using X-ray microtomography. A software program has been generated which uses the X-ray tomographic data as an input for the mesh generation of the material microstructure. To obtain a proper...... which are used for the determination of the effective properties of the heterogeneous material. Generally, the properties determined using the finite element method coupled with X-ray microtomography are in good agreement with both experimentally determined properties and properties determined using......The use of cellular and composite materials have in recent years become more and more common in all kinds of structural components and accurate knowledge of the effective properties is therefore essential. In this wok the effective properties are determined using the real material microstructure...
Materials for Molybdenum 99 purification
International Nuclear Information System (INIS)
Wilkinson, M. Victoria; Mondino, Angel V.; Manzini, Alberto C.
2003-01-01
The National Atomic Energy Commission (CNEA) produces fission Mo 99, an isotope of wide use in nuclear medicine. In order to simplify the current Mo 99 production process, to shorten its duration and reduce impurities in the final product, alternative methods for purification steps were looked for. In this work a variety of new materials for the purification columns were designed, all of them with carbon. These materials were studied and a material which contribute with the best results for molybdenum retention, was selected. The preparation procedure and the working conditions were determined. (author)
Integrative medicine is a future medicine
International Nuclear Information System (INIS)
Samosyuk, I.Z.; Chukhraev, N.V.
2001-01-01
An analysis is given of the modern integrative medicine basis which is the synthesis of: 1. Theology, philosophy and sociology; 2. Physico-mathematical sciences, cybernetics, chemistry and astrology; 3. Medico-biological and clinical experience; 4. Traditional and scientific medicine; 5. Use of traditional and new medical technologies. Problems of 'holistic' medicine which considers Man as a unity of biological, emotional, psychological and social phenomena are exposed. Advantages in combining the drug therapy with modern physiotherapy and physioacupuncture methods seem to be obvious. All visible effects of a disease can de represented in the following forms of changes: information-energy - biochemical - ultrastructure - tissue - clinical diseases. Self-regulation of functional systems has a multilevel structure and needs application of different methods for body recovery. Short-wave irradiation (lasers, magnetotherapy) can be used for energy restoration in functional systems or meridians, and acupuncture plays the role of a 'trigger' which activises the body recovery. Integration of Western and Oriental medicines is the way for achieving the qualitative new level of health protection
Tomographic methods in nuclear medicine
International Nuclear Information System (INIS)
Ahluwalia, B.D.
1989-01-01
This book is a review of the various approaches to tomographic imaging that have been pursued in nuclear medicine. The evolution of single photon emission computed tomography (SPECT) is discussed in detail, and the major classes of instrumentation are represented. A section on positron emission tomography is also included, but is rather brief and may serve only as a general introduction
Zhang, Xiao-Bo; Ge, Xiao-Guang; Jin, Yan; Shi, Ting-Ting; Wang, Hui; Li, Meng; Jing, Zhi-Xian; Guo, Lan-Ping; Huang, Lu-Qi
2017-11-01
With the development of computer and image processing technology, image recognition technology has been applied to the national medicine resources census work at all stages.Among them: ①In the preparatory work, in order to establish a unified library of traditional Chinese medicine resources, using text recognition technology based on paper materials, be the assistant in the digitalization of various categories related to Chinese medicine resources; to determine the representative area and plots of the survey from each census team, based on the satellite remote sensing image and vegetation map and other basic data, using remote sensing image classification and other technical methods to assist in determining the key investigation area. ②In the process of field investigation, to obtain the planting area of Chinese herbal medicine was accurately, we use the decision tree model, spectral feature and object-oriented method were used to assist the regional identification and area estimation of Chinese medicinal materials.③In the process of finishing in the industry, in order to be able to relatively accurately determine the type of Chinese medicine resources in the region, based on the individual photos of the plant, the specimens and the name of the use of image recognition techniques, to assist the statistical summary of the types of traditional Chinese medicine resources. ④In the application of the results of transformation, based on the pharmaceutical resources and individual samples of medicinal herbs, the development of Chinese medicine resources to identify APP and authentic herbs 3D display system, assisted the identification of Chinese medicine resources and herbs identification characteristics. The introduction of image recognition technology in the census of Chinese medicine resources, assisting census personnel to carry out related work, not only can reduce the workload of the artificial, improve work efficiency, but also improve the census results
The stress analysis method for three-dimensional composite materials
Nagai, Kanehiro; Yokoyama, Atsushi; Maekawa, Zen'ichiro; Hamada, Hiroyuki
1994-05-01
This study proposes a stress analysis method for three-dimensionally fiber reinforced composite materials. In this method, the rule-of mixture for composites is successfully applied to 3-D space in which material properties would change 3-dimensionally. The fundamental formulas for Young's modulus, shear modulus, and Poisson's ratio are derived. Also, we discuss a strength estimation and an optimum material design technique for 3-D composite materials. The analysis is executed for a triaxial orthogonally woven fabric, and their results are compared to the experimental data in order to verify the accuracy of this method. The present methodology can be easily understood with basic material mechanics and elementary mathematics, so it enables us to write a computer program of this theory without difficulty. Furthermore, this method can be applied to various types of 3-D composites because of its general-purpose characteristics.
Method of distillation of bituminous material
Energy Technology Data Exchange (ETDEWEB)
Gustafsson, E G.T.
1919-11-12
A method is described of dry distillation of bituminous materials by leading warm combustible gases, mixed or not mixed with steam, through the distillation chamber in direct contact with the materials, during which process the distillation chamber may be heated by other means. It is characterized by the mixture of distillation products (formed by the vapors produced by heating the raw materials) and the gas (circulating gas) used for heating in the process, being led through coolers or similar contrivances, in order to separate through condensation the greater part of the content of the products or materials condensable at ordinary temperatures, and also to recover as much as possible of the highly volatile oils in the gas. Thereafter the gas is split, one part is, without further cleaning, and led through the distillation chamber, after this gas has been reheated in suitable apparatus. The other part (surplus gas), which in volume corresponds approximately to the new-formed distillation gases, is treated according to known methods for the extraction of the remaining products of the distillation, such as volatile oils, ammonia, methyl alcohol, sulfuretted hydrogen, and others. The patent contains three other claims.
Behmann, M; Bisson, S; Walter, U
2011-12-01
The 9 (th) Revision of German Medical Licensing Regulations for Physicians has come into effect on October 1 (st) 2003. Social medicine was separated into the fields "occupational health, social medicine" and the various cross-sectional modules: epidemiology, biometry, medical computer science; health economics, health-care system, public health; prevention, health promotion; rehabilitation, physical medicine, naturopathic treatment. This paper studies the realisation of teaching in the field social medicine at German medical faculties. The survey was conducted in collaboration with the German Association for Social Medicine and Prevention (DGSMP). A survey was conducted at 38 institutes of 36 German medical faculties. The written questionnaire contained mostly selection items in which chances and barriers of the field were queried with supply items. Information about time scale, general conditions and resources was aked for. On the basis of the guidelines of the DGSMP, the topics to be taught were evaluated concerning their relevance and integration into education. The response rate was 68% (n=26). Social insurance, basic principles, responsibility in the Social Security Code and the different providers were judged as the most important topics. There was a strong demand for lecturing material. 82% (n=18) of the faculties wished to have specific material, for example e-learning, examples, lesson plans, curricula and also textbooks. 91% (n=19) of the faculties requested an exchange of information between the faculties concerning educational contents, motivation of students and e-learning. The realisation of teaching is different between the faculties concerning the number of hours, teaching methods and number of students per year. The motivation of the students is one of the problems, but also the lack of acceptance within the clinic. Specific resources and exchange between the faculties are necessary concerning e-learning, which is offered at only few faculties so
Yuan, Dan; Pan, Yingni; Chen, Yan; Uno, Toshio; Zhang, Shaohui; Kano, Yoshihiro
2008-01-01
Basic hydrolysis procedure is often included in the sample preparation in order to quantify malonylglucosides or acetylglucosides of soy materials. However, it is preferable not to use NaOH as a hydrolytic reagent considering the effect of its alkalinity on the successive injection to HPLC and low acidity of soy isoflavones. This paper presents an improved method for basic hydrolysis using ammonia as a hydrolytic reagent without the additional neutralization step. Moreover, by means of HPLC and LC-MS methods, a systematic quality evaluation of natural soy materials from Chinese markets were established and discussed, inclusive of soybeans, black soybeans, defatted soy flours, as well as the distribution of isoflavones in the seed coat, hypocotyl and cotyledon. The results indicate that HPLC profiling patterns of originating various isoflavone constituents of Chinese soybeans was similar to those of Japanese ones, and those of Chinese black soybeans was similar to those of American ones. The average content level of total soy isoflavones of Chinese soybeans and black soybeans were a little lower than that of American and Japanese ones. Additionally, the thorough analysis for Semen Sojae Praeparatum, a Chinese herbal medicine made from fermented black soybeans or soybeans was done for the first time and the characteristic of its HPLC profiling patterns shows the higher content of isoflavone glucosides and aglycones than those of natural soy materials.
Fundamentals of nuclear medicine
Energy Technology Data Exchange (ETDEWEB)
Alazraki, N.P.; Mishkin, F.S.
1984-01-01
This guidebook for clinical nuclear medicine is written as a description of how nuclear medicine procedures should be used by clinicians in evaluating their patients. It is designed to assist medical students and physicians in becoming acquainted with nuclear medicine techniques for detecting and evaluating most common disorders. The material provides an introduction to, not a textbook of, nuclear medicine. Each chapter is devoted to a particular organ system or topic relevant to the risks and benefits involved in nuclear medicine studies. The emphasis is on presenting the rationales for ordering the various clinical imaging procedures performed in most nuclear medicine departments. Where appropriate, alternative imaging modalities including ultrasound, computed tomography imaging, and radiographic special procedures are discussed. Comparative data between nuclear medicine imaging and other modalities are presented to help guide the practicing clinician in the selection of the most appropriate procedure for a given problem.
Nuclear medicine methods used in diagnosing diseases of the gastrointestinal tract
International Nuclear Information System (INIS)
Kostadinova, I.
2001-01-01
Using physiologic tracer scintigraphy may give unique information on gastrointestinal (GI) motility and function, supplementing the findings of rather invasive methods. Conventional barium-contrast x-ray studies of the GI tract, computed tomography, ultrasonography and magnetic resonance imaging afford high resolution images of the GI anatomy, but have a serious shortcoming - hardly lending themselves to quantification. As shown by the results functional scintigraphy is a sensitive, quantitative and noninvasive procedure. The potential of nuclear medicine methods to diagnose successfully diseases of the salivary glands, esophagus, stomach and visualization of GI bleeding and hepatobiliary system are comprehensively discussed. The advantages and drawbacks of radionuclide techniques are outlined, and compared with other methods of visualization. (author)
Zhang, Chi; Zhang, Ge; Chen, Ke-ji; Lu, Ai-ping
2016-04-01
The development of an effective classification method for human health conditions is essential for precise diagnosis and delivery of tailored therapy to individuals. Contemporary classification of disease systems has properties that limit its information content and usability. Chinese medicine pattern classification has been incorporated with disease classification, and this integrated classification method became more precise because of the increased understanding of the molecular mechanisms. However, we are still facing the complexity of diseases and patterns in the classification of health conditions. With continuing advances in omics methodologies and instrumentation, we are proposing a new classification approach: molecular module classification, which is applying molecular modules to classifying human health status. The initiative would be precisely defining the health status, providing accurate diagnoses, optimizing the therapeutics and improving new drug discovery strategy. Therefore, there would be no current disease diagnosis, no disease pattern classification, and in the future, a new medicine based on this classification, molecular module medicine, could redefine health statuses and reshape the clinical practice.
Standard Test Methods for Constituent Content of Composite Materials
American Society for Testing and Materials. Philadelphia
2009-01-01
1.1 These test methods determine the constituent content of composite materials by one of two approaches. Method I physically removes the matrix by digestion or ignition by one of seven procedures, leaving the reinforcement essentially unaffected and thus allowing calculation of reinforcement or matrix content (by weight or volume) as well as percent void volume. Method II, applicable only to laminate materials of known fiber areal weight, calculates reinforcement or matrix content (by weight or volume), and the cured ply thickness, based on the measured thickness of the laminate. Method II is not applicable to the measurement of void volume. 1.1.1 These test methods are primarily intended for two-part composite material systems. However, special provisions can be made to extend these test methods to filled material systems with more than two constituents, though not all test results can be determined in every case. 1.1.2 The procedures contained within have been designed to be particularly effective for ce...
World Workshop on Oral Medicine VI
DEFF Research Database (Denmark)
Villa, Alessandro; Wolff, Andy; Narayana, Nagamani
2016-01-01
OBJECTIVE: To perform a systematic review of the pathogenesis of medication-induced salivary gland dysfunction (MISGD). MATERIALS AND METHODS: Review of the identified papers was based on the standards regarding the methodology for systematic reviews set forth by the World Workshop on Oral Medicine...... of the studies considered only xerostomia. Thus, further human studies are necessary to improve our understanding of the association between MISGD and the underlying pathophysiology. This article is protected by copyright. All rights reserved....
[Study on incompatibility of traditional Chinese medicines].
Fan, Xin-sheng; Duan, Jin-ao; Hua, Hao-ming; Qian, Da-wei; Shang, Er-xin; Guo, Jian-ming
2015-04-01
The incompatibility of traditional Chinese medicines is related to the clinical medication safety, so has attracted wide attentions from the public. With the deepening of studies on the incompatibility of traditional Chinese medicines represented by 18 incompatible herbs, the incompatibility of theory traditional Chinese medicines has raised to new heights. From the origin of incompatibility theory of traditional Chinese medicines, relationship of herbs, harms of incompatible herbs and principle of prevention to toxic effects of specific incompatible medicines, the innovation and development of the traditional Chinese medicine incompatibility theory was explored. Structurally, the incompatibility of traditional Chinese medicines refers to the opposition of two herbs based on seven emotions and clinical experience. The combination of incompatible herbs may lead to human harms, especially latent harm and inefficacy of intervention medicines. The avoidance of the combination of incompatible herbs and the consideration of both symptoms and drug efficacy are the basic method to prevent adverse reactions. The recent studies have revealed five characteristics of incompatible herbs. Toxicity potentiation, toxication, efficacy reduction and inefficacy are the four manifestations of the incompatible relations. The material changes can reflect the effects of toxicity potentiation and toxication of opposite herbs. The accumulation of toxicity and metabolic changes are the basis for latent harms. The antagonistic effect of main efficacies and the coexistence of positive and negative effects are the distinctive part of the incompatibility. The connotation of incompatible herbs plays an important role in the innovation of the traditional Chinese medicine incompatibility theory.
Hinderer, Svenja; Layland, Shannon Lee; Schenke-Layland, Katja
2016-02-01
Regenerative strategies such as stem cell-based therapies and tissue engineering applications are being developed with the aim to replace, remodel, regenerate or support damaged tissues and organs. In addition to careful cell type selection, the design of appropriate three-dimensional (3D) scaffolds is essential for the generation of bio-inspired replacement tissues. Such scaffolds are usually made of degradable or non-degradable biomaterials and can serve as cell or drug carriers. The development of more effective and efficient drug carrier systems is also highly relevant for novel cancer treatment strategies. In this review, we provide a summary of current approaches that employ ECM and ECM-like materials, or ECM-synthetic polymer hybrids, as biomaterials in the field of regenerative medicine. We further discuss the utilization of such materials for cell and drug delivery, and highlight strategies for their use as vehicles for cancer therapy. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Method of measurement on materials shielding effectiveness test in time domain
International Nuclear Information System (INIS)
Liu Shunkun; Han Jun; Chen Xiangyue
2009-01-01
Windows method is a measurement of slot coupling effect in nature when it is used to measure material's shielding effectiveness. The error of measurement will become serious when it is used to measure material's shielding effectiveness in low frequency band. It is difficult to measure material's shielding effectiveness of electromagnetic pulse with Windows method. Device under test method (DUT method) was presented in this paper to overcome the limitations of Windows method in material's shielding effectiveness test. The method can be used to measure any material's shielding Effectiveness effectively through the design and the test of the DUT.The method was used to measure shielding effectiveness of special cement .Compared with theoretical analysis,the measurement result prove the DUT method to be very efficient in material's shielding effectiveness test. (authors)
Method of producing catalytic material for fabricating nanostructures
Seals, Roland D.; Menchhofer, Paul A.; Howe, Jane Y.; Wang, Wei
2018-01-30
Methods of fabricating nano-catalysts are described. In some embodiments the nano-catalyst is formed from a powder-based substrate material and is some embodiments the nano-catalyst is formed from a solid-based substrate material. In some embodiments the substrate material may include metal, ceramic, or silicon or another metalloid. The nano-catalysts typically have metal nanoparticles disposed adjacent the surface of the substrate material. The methods typically include functionalizing the surface of the substrate material with a chelating agent, such as a chemical having dissociated carboxyl functional groups (--COO), that provides an enhanced affinity for metal ions. The functionalized substrate surface may then be exposed to a chemical solution that contains metal ions. The metal ions are then bound to the substrate material and may then be reduced, such as by a stream of gas that includes hydrogen, to form metal nanoparticles adjacent the surface of the substrate.
Directory of Open Access Journals (Sweden)
Marjan Piponski
2015-03-01
Full Text Available Quality control of veterinary medicine products containing two different frequently used antibiotics metronidazole and ciprofloxacin hydrochloride, was considered and performed, using modified pharmacopoeial HPLC methods. Three different HPLC systems were used: Varian ProStar, Perkin Elmer Series and UPLC Shimadzu Prominence XR. The chromatographic columns used were LiChropher RP Select B 75 mm x 4 mm with 5 μm particles and Discovery C18 100 mm x 4,6 mm with 5 μm particles. Chromatographic methods used for both analytes were compendial, with minor modifications made for experimental purposes. Minor modifications of the pharmacopoeia prescribed chromatographic conditions, in both cases, led to better chromatographic parameters, good resolution and shorter analysis times. Optimized methods can be used for: determination of metronidazole in gel formulation, for its simultaneous quantification with preservatives present in the formulation and even for identification and quantification of its specified impurity, 2-methyl-5-nitroimidazole; determination of ciprofloxacin hydrochloride in film coated tablets and eye drops and identification and quantification of its specified impurities. These slightly modified and optimized pharmacopoeial methods for quality control of metronidazole and ciprofloxacin dosage forms used in veterinary medicine can be successfully applied in laboratories for quality control of veterinary medicines.
DEFF Research Database (Denmark)
Nielsen, Merete Willemoes; Søndergaard, Birthe; Kjøller, Mette
2008-01-01
OBJECTIVE: This study compared national self-reported data on medicine use and national prescription records at the individual level. STUDY DESIGN AND SETTING: Data from the nationally representative Danish health survey conducted in 2000 (n=16,688) were linked at the individual level to national...... prescription records covering 1999-2000. Kappa statistics and 95% confidence intervals were calculated. RESULTS: Applying the legend time method to medicine groups used mainly on a chronic basis revealed good to very good agreement between the two data sources, whereas medicines used as needed showed fair...... to moderate agreement. When a fixed-time window was applied for analysis, agreement was unchanged for medicines used mainly on a chronic basis, whereas agreement increased somewhat compared to the legend time method when analyzing medicines used as needed. CONCLUSION: Agreement between national self...
Experience with Nuclear Medicine Information System
Directory of Open Access Journals (Sweden)
Bilge Volkan-Salanci
2012-12-01
Full Text Available Objective: Radiology information system (RIS is basically evolved for the need of radiologists and ignores the vital steps needed for a proper work flow of Nuclear Medicine Department. Moreover, CT/MRI oriented classical PACS systems are far from satisfying Nuclear Physicians like storing dynamic data for reprocessing and quantitative analysis of colored images. Our purpose was to develop a workflow based Nuclear Medicine Information System (NMIS that fulfills the needs of Nuclear Medicine Department and its integration to hospital PACS system. Material and Methods: Workflow in NMIS uses HL7 (health level seven and steps include, patient scheduling and retrieving information from HIS (hospital information system, radiopharmacy, acquisition, digital reporting and approval of the reports using Nuclear Medicine specific diagnostic codes. Images and dynamic data from cameras of are sent to and retrieved from PACS system (Corttex© for reprocessing and quantitative analysis. Results: NMIS has additional functions to the RIS such as radiopharmaceutical management program which includes stock recording of both radioactive and non-radioactive substances, calculation of the radiopharmaceutical dose for individual patient according to body weight and maximum permissible activity, and calculation of radioactivity left per unit volume for each radionuclide according their half lives. Patient scheduling and gamma camera patient work list settings were arranged according to specific Nuclear Medicine procedures. Nuclear Medicine images and reports can be retrieved and viewed from HIS. Conclusion: NMIS provides functionality to standard RIS and PACS system according to the needs of Nuclear Medicine. (MIRT 2012;21:97-102
Zhang, Baixia; He, Shuaibing; Lv, Chenyang; Zhang, Yanling; Wang, Yun
2018-01-01
The identification of bioactive components in traditional Chinese medicine (TCM) is an important part of the TCM material foundation research. Recently, molecular docking technology has been extensively used for the identification of TCM bioactive components. However, target proteins that are used in molecular docking may not be the actual TCM target. For this reason, the bioactive components would likely be omitted or incorrect. To address this problem, this study proposed the GEPSI method that identified the target proteins of TCM based on the similarity of gene expression profiles. The similarity of the gene expression profiles affected by TCM and small molecular drugs was calculated. The pharmacological action of TCM may be similar to that of small molecule drugs that have a high similarity score. Indeed, the target proteins of the small molecule drugs could be considered TCM targets. Thus, we identified the bioactive components of a TCM by molecular docking and verified the reliability of this method by a literature investigation. Using the target proteins that TCM actually affected as targets, the identification of the bioactive components was more accurate. This study provides a fast and effective method for the identification of TCM bioactive components.
DEFF Research Database (Denmark)
Holstein, Bjørn; Andersen, Anette; Due, Pernille
2009-01-01
INTRODUCTION: Medicine use for aches and psychological problems is common among adolescents. Medicines are toxic and may have harmful side effects. It is therefore important to study change over time and patterns of medicine use. The objective of this paper is to describe self-reported medicine use...... for headaches, stomach-aches, difficulties in falling asleep, and nervousness among 11-, 13-, and 15-year-old boys and girls from 1968 to 2006. MATERIAL AND METHODS: The data material is 6 comparable and representative cross-sectional studies of 11-, 13-, and 15-year-olds from 1988, 1991, 1994, 1998, 2002......: There was a significant increase in 11-, 13-, and 15-year-old student's use of medicine for aches and psychological problems from 1988 to 2006. In the same period, there was a decrease in the prevalence of students who reported pains monthly. Udgivelsesdato: 2009-Jan-5...
Brambilla, A.; Gorecki, A.; Potop, A.; Paulus, C.; Verger, L.
2017-08-01
Energy sensitive photon counting X-ray detectors provide energy dependent information which can be exploited for material identification. The attenuation of an X-ray beam as a function of energy depends on the effective atomic number Zeff and the density. However, the measured attenuation is degraded by the imperfections of the detector response such as charge sharing or pile-up. These imperfections lead to non-linearities that limit the benefits of energy resolved imaging. This work aims to implement a basis material decomposition method which overcomes these problems. Basis material decomposition is based on the fact that the attenuation of any material or complex object can be accurately reproduced by a combination of equivalent thicknesses of basis materials. Our method is based on a calibration phase to learn the response of the detector for different combinations of thicknesses of the basis materials. The decomposition algorithm finds the thicknesses of basis material whose spectrum is closest to the measurement, using a maximum likelihood criterion assuming a Poisson law distribution of photon counts for each energy bin. The method was used with a ME100 linear array spectrometric X-ray imager to decompose different plastic materials on a Polyethylene and Polyvinyl Chloride base. The resulting equivalent thicknesses were used to estimate the effective atomic number Zeff. The results are in good agreement with the theoretical Zeff, regardless of the plastic sample thickness. The linear behaviour of the equivalent lengths makes it possible to process overlapped materials. Moreover, the method was tested with a 3 materials base by adding gadolinium, whose K-edge is not taken into account by the other two materials. The proposed method has the advantage that it can be used with any number of energy channels, taking full advantage of the high energy resolution of the ME100 detector. Although in principle two channels are sufficient, experimental measurements show
Historical versus contemporary medicinal plant uses in the US Virgin Islands
DEFF Research Database (Denmark)
Soelberg, Jens; Davis, Olasee; Jäger, Anna K
2016-01-01
West Indies (now US Virgin Islands), we identify pre-1900 medicinal plants and their historical uses, and trace their status in the traditional medicine of St. Croix today (2014). By a combined historical and ethnobotanical approach we assess the scale of loss and preservation of traditional medicinal...... knowledge on St. Croix, and explore the drivers involved in the disappearance of knowledge in the oral tradition of medicine. MATERIALS AND METHODS: Names, uses and identities of 18th and 19th century medicinal plant uses in the Danish West Indies were derived from manuscripts and publications of Von Rohr...... (1757/58), Oldendorp (1777), West (1793), Benzon (1822), Riise (1853), Eggers (1876;1879) and Berg and Eggers (1888). The presence of the plant species in the pre-1900 Danish West Indies was confirmed by review of herbarium specimens in the University of Copenhagen Herbarium (C). The same species were...
The model of Western integrative medicine: the role of Chinese medicine.
Dobos, Gustav; Tao, Iven
2011-01-01
The basic concept of integrative medicine (IM) is that by combining mainstream (biomedicine) with complementary and alternative medicine (CAM), synergistic therapeutic effects can be attained. When the methods of mind/body medicine (MBM) are added to this combination, as in Western countries, a new concept emerges that drastically changes the approach toward illness.It is interesting to note that the joining of traditional Chinese medicine and Western medicine in the early days of the Peoples' Republic of China preceded the Western model of IM by almost 50 years. Several elements that make up the key components of IM as practiced today in the West were already present in the Chinese version of IM, and Chinese medicine has played and continues to play an important role in advancing IM. However, one of the major differences between the Chinese and the Western models of IM today, besides MBM and some other treatment options, is that Western integrative medicine (WIM) strictly requires its CAM methods to be supported by scientific evidence.The therapeutic methods of IM and their applications are many and varied. However, they are most frequently employed to treat chronic medical conditions, e.g., bronchial asthma, rheumatic disease, chronic inflammatory bowel disorder and chronic pain. Other fields in which IM may be applied are internal medicine (inflammatory bowel diseases and cardiovascular diseases), musculoskeletal disorders, oncology (chemotherapy-induced side effects), obstetrics and gynecology (dysmenorrhea, endometriosis, infertility and menopausal complaints), pediatrics, geriatrics, neurology (migraine and chronic headache), and psychiatry (anxiety and depression).The concept of WIM is discussed here in detail by reviewing its scope and implications for the practice of medicine and focusing on the role of Chinese medicine in WIM.
METHODS FOR DETECTING BACTERIA USING POLYMER MATERIALS
Van Grinsven Bart Robert, Nicolaas; Cleij, Thomas
2017-01-01
A method for characterizing bacteria includes passing a liquid containing an analyte comprising a first bacteria and a second bacteria over and in contact with a polymer material on a substrate. The polymer material is formulated to bind to the first bacteria, and the first bacteria binds to the
Use of radioactive materials in Medicine
International Nuclear Information System (INIS)
Martinez-Duncker R, C.
1999-01-01
The diagnostic studies of Molecular Nuclear Medicine allow diagnose, to confirm and characterize a large variety of illnesses avoiding at the same time the cost and or the risk or other studies for confirming or excluding the illness, providing new information which can characterize more accurately the syndrome which would be present the patient. The new information is reliable since it can be reproduced and with this to make a follow-up adequate of the person. The new and trusty information obtained allows to increase or diminish quickly the probability which the patient had a specific illness. (Author)
NREL Patents Method for Continuous Monitoring of Materials During
Manufacturing | News | NREL NREL Patents Method for Continuous Monitoring of Materials During Manufacturing News Release: NREL Patents Method for Continuous Monitoring of Materials During Manufacturing NREL's Energy Systems Integration Facility (ESIF). More information, including the published patent, can
Standard test method for galling resistance of material couples
American Society for Testing and Materials. Philadelphia
2008-01-01
1.1 This test method covers a laboratory test that ranks the galling resistance of material couples using a quantitative measure. Bare metals, alloys, nonmetallic materials, coatings, and surface modified materials may be evaluated by this test method. 1.2 This test method is not designed for evaluating the galling resistance of material couples sliding under lubricated conditions, because galling usually will not occur under lubricated sliding conditions using this test method. 1.3 The values stated in SI units are to be regarded as standard. No other units of measurement are included in this standard. 1.4 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.
International Nuclear Information System (INIS)
Zhang, Liwen; Lin, Tong; Jiang, Yingqiao; Bi, Fujun
2013-01-01
This work used a new criterion to analyze 162 varieties (222 batches) of traditional Chinese medicinal herbs based on the European Standard EN 13751 (2009. Foodstuffs—Detection of Irradiated Food Using Photostimulated Luminescence. European Committee for Standardization, Brussels, Belgium). The characteristics of PSL signals are described, and a new criterion is established. Compared to EN 13751, the new criterion uses clearer definition to evaluate instead of the ambiguous descriptions in EN Standard, such as “much greater than” and “within the same order of magnitude”. Moreover, the accuracy of the new criterion is as good as or better than EN Standard in regard to classifying irradiated and non-irradiated traditional Chinese medicinal herbs. It can help to avoid false positive result when a non-irradiated herb got a screening PSL measurement above 5000 counts/60 s. This new criterion of photostimulated luminescence method can be applied to identify the irradiation status of traditional Chinese medicinal herbs, even if the medicinal herbs were irradiated at a low dose (0.3 kGy) or stored in the dark at room temperature for 24 months after the irradiation treatment. - Highlights: • Clearer evaluation criterion instead of the ambiguous descriptions in EN 13751. • Accuracy satisfied. • Large sample size provides outstanding representativeness. • Systematical evaluation on PSL method
Material-Point Method Analysis of Bending in Elastic Beams
DEFF Research Database (Denmark)
Andersen, Søren Mikkel; Andersen, Lars
2007-01-01
The aim of this paper is to test different types of spatial interpolation for the material-point method. The interpolations include quadratic elements and cubic splines. A brief introduction to the material-point method is given. Simple liner-elastic problems are tested, including the classical...... cantilevered beam problem. As shown in the paper, the use of negative shape functions is not consistent with the material-point method in its current form, necessitating other types of interpolation such as cubic splines in order to obtain smoother representations of field quantities. It is shown...
A Review of Current Methods for Analysis of Mycotoxins in Herbal Medicines
Zhang, Lei; Dou, Xiao-Wen; Zhang, Cheng; Logrieco, Antonio F.; Yang, Mei-Hua
2018-01-01
The presence of mycotoxins in herbal medicines is an established problem throughout the entire world. The sensitive and accurate analysis of mycotoxin in complicated matrices (e.g., herbs) typically involves challenging sample pretreatment procedures and an efficient detection instrument. However, although numerous reviews have been published regarding the occurrence of mycotoxins in herbal medicines, few of them provided a detailed summary of related analytical methods for mycotoxin determination. This review focuses on analytical techniques including sampling, extraction, cleanup, and detection for mycotoxin determination in herbal medicines established within the past ten years. Dedicated sections of this article address the significant developments in sample preparation, and highlight the importance of this procedure in the analytical technology. This review also summarizes conventional chromatographic techniques for mycotoxin qualification or quantitation, as well as recent studies regarding the development and application of screening assays such as enzyme-linked immunosorbent assays, lateral flow immunoassays, aptamer-based lateral flow assays, and cytometric bead arrays. The present work provides a good insight regarding the advanced research that has been done and closes with an indication of future demand for the emerging technologies. PMID:29393905
International Nuclear Information System (INIS)
Kang, Lae-Hyong; Lee, Dae-Oen; Han, Jae-Hung
2011-01-01
We introduce a new compression test method for piezoelectric materials to investigate changes in piezoelectric properties under the compressive stress condition. Until now, compression tests of piezoelectric materials have been generally conducted using bulky piezoelectric ceramics and pressure block. The conventional method using the pressure block for thin piezoelectric patches, which are used in unimorph or bimorph actuators, is prone to unwanted bending and buckling. In addition, due to the constrained boundaries at both ends, the observed piezoelectric behavior contains boundary effects. In order to avoid these problems, the proposed method employs two guide plates with initial longitudinal tensile stress. By removing the tensile stress after bonding a piezoelectric material between the guide layers, longitudinal compressive stress is induced in the piezoelectric layer. Using the compression test specimens, two important properties, which govern the actuation performance of the piezoelectric material, the piezoelectric strain coefficients and the elastic modulus, are measured to evaluate the effects of applied electric fields and re-poling. The results show that the piezoelectric strain coefficient d 31 increases and the elastic modulus decreases when high voltage is applied to PZT5A, and the compression in the longitudinal direction decreases the piezoelectric strain coefficient d 31 but does not affect the elastic modulus. We also found that the re-poling of the piezoelectric material increases the elastic modulus, but the piezoelectric strain coefficient d 31 is not changed much (slightly increased) by re-poling
Application of radiochemical determination methods in cleanability research of building materials
International Nuclear Information System (INIS)
Maeaettae, Jenni; Kymaelaeinen, Hanna-Riitta; Sjoeberg, Anna-Maija
2011-01-01
During recent years increasing effort has been made to modify surface properties with easy-to-clean or self-cleaning characteristics, and concomitantly there is a need to be able to quantify cleanability. Methodology is a complex issue, including aspects of selection and characterization of the surface materials, the soiling materials (contaminants), soiling and cleaning methods, and the detection methods. Different biological, chemical, physical and visual methods have been included in studies of surface cleanability. One challenge has been to obtain quantitative information about soiling. The radiochemical methods, gamma spectrometry (NaI(Tl)-crystal) and liquid scintillation counting, have been shown to be suitable for evaluating cleanability of different surface materials and different soiling material types, providing quantitative information about the amount of soiling material both on and beneath the surface. Due to the different labelled soiling components, the interaction of the surface with different soiling material types can be evaluated. Radiochemical methods have unique benefits particularly for examining porous materials and surfaces. However, they are suitable only for highly controlled studies because of the hazards. Different features and details of radiochemical methods are discussed with the view to aid planning of future cleanability studies. - Highlights: → Radiochemical methods can be used for cleanability studies. → These methods give quantitative information about the amount of soiling material. → These methods are suitable particularly for examining porous materials. → These methods are suitable for highly controlled studies because of the hazards.
Nuclear Medicine and Application of Nuclear Techniques in Medicine
International Nuclear Information System (INIS)
Wiharto, Kunto
1996-01-01
The use of nuclear techniques medicine covers not only nuclear medicine and radiology in strict sense but also determination of body mineral content by neutron activation analysis and x-ray fluorescence technique either in vitro or in vivo, application of radioisotopes as tracers in pharmacology and biochemistry, etc. This paper describes the ideal tracer in nuclear medicine, functional and morphological imaging, clinical aspect and radiation protection in nuclear medicine. Nuclear technique offers facilities and chances related to research activities and services in medicine. The development of diagnostic as well as therapeutic methods using monoclonal antibodies labeled with radioisotope will undoubtedly play an important role in the disease control
The Development of Ojibway Language Materials.
Pheasant-Williams, Shirley
2003-01-01
Revitalization of the Nishinaabeg language started in 1998 with the development of language materials. A committee on Nishinaabemwin orthography advised on the development of the text and writing system. Teaching methods follow the four parts of Medicine Wheel teachings: spiritual, emotional, physical, and mental. An interactive hockey game and a…
Efficacy of DNA typing as an accurate method in forensic medicine
Directory of Open Access Journals (Sweden)
Namazi H
2000-08-01
Full Text Available DNA typing is a new method with important applications in forensic medicine. In the present study, we evaluated application of DNA typing in Iran. Loci Hum LPL, Hum Tpox, Hum F13, Hum vw 31A, Hum TH01 and Hum FES/FPS of DNA short tandem repeats were studied. To determine sensitivity of the test, 85 mother-child couples (1020 chromosomes that were referred to DNA section of legal medicine organization of Iran were included and for determination of it's specificity 42 brother-sister couples (1200 chromosomes and 58 non-relative couples were examined. The results show lack of mutations in the studied loci and acceptable sensitivity of the test. Of 12 alleles of siblings, there were 2-6 differences, in contrast with 3-9 differences in non-relatives, so the test has 100% specificity in these loci. Considering polymorphism, power of exclusion of these 6 sites was 99%.
Method of melting and decontaminating radioactive contaminated aluminum material
International Nuclear Information System (INIS)
Uda, Tatsuhiko; Miura, Noboru; Kawasaki, Katsuo; Iba, Hajime.
1986-01-01
Purpose: To improve the decontaminating efficiency upon melting decontamination of radioactive-contaminated aluminum materials. Method: This invention concerns an improvement for the method of melting decontamination by adding slug agent composed of organic compound to contaminated aluminum material and extracting the radioactive materials into the slug thereby decontaminating the aluminum material. Specifically metals effective for reducing the active amount of aluminum are added such that the content is greater than a predetermined value in the heat melting process. The metal comprises Mg, Cu or a mixture thereof and the content is more than 4 % including those previously contained in the aluminum material. (Ikeda, J.)
International Nuclear Information System (INIS)
Krivonosov, A.I.; Postrigan, M.V.
1975-01-01
The authors present the results of an investigation of the effect of gamma radiation on the properties of low-molecular moulded polymethyl methacrylates (molecular weight distribution, physicomechanical properties, resistance to the effects of aqueous media and physiological solution) in the form of copolymers of methyl methacrylate with methyl (MA) or butyl acrylate (BA) with the brand names Dacryl-4B, Dacryl-2M and Dacryl-4M (4% BA; 2 and 4% MA respectively) having a molecular weight of around 10 5 . For comparison, block polymethyl methacrylate with a molecular weight of 3 x 10 6 was used. The results of experiments on the ageing of unirradiated and irradiated specimens in a heated store-room (t = 10 - 20 0 C) and at high temperatures (90 0 C) are also given. It is shown that irradiation with doses of 2.5-20 Mrad leads to radiolysis of the above copolymers, accompanied by destructive processes. Evidence of this is an increase in the polydispersity of the materials and a reduction in their mean molecular weight. These changes impair their physicomechanical characteristics to some extent. Irradiation with a sterilizing dose of 2.5 Mrad reduces the strength indices by around 15%, which is quite acceptable for polymer products having high initial physicomechanical characteristics. Irradiation has practically no effect on the molecular and strength characteristics of Dacryl products in a heated room, and the change in physicomechanical properties resulting from storage at high temperatures is practically the same for unirradiated specimens. On the basis of these results the materials investigated can be recommended for the packaging of medicinal preparations. (author)
Curtis, Tyler E; Roeder, Ryan K
2017-10-01
magnitude by comparison. The material basis matrix calibration was more sensitive to changes in the calibration methods than the scaling factor calibration. The material basis matrix calibration significantly influenced both the quantitative and spatial accuracy of material decomposition, while the scaling factor calibration influenced quantitative but not spatial accuracy. Importantly, the median RMSE of material decomposition was as low as ~1.5 mM (~0.24 mg/mL gadolinium), which was similar in magnitude to that measured by optical spectroscopy on the same samples. The accuracy of quantitative material decomposition in photon-counting spectral CT was significantly influenced by calibration methods which must therefore be carefully considered for the intended diagnostic imaging application. © 2017 American Association of Physicists in Medicine.
Method and apparatus for vibrating a substrate during material formation
Bailey, Jeffrey A [Richland, WA; Roger, Johnson N [Richland, WA; John, Munley T [Benton City, WA; Walter, Park R [Benton City, WA
2008-10-21
A method and apparatus for affecting the properties of a material include vibrating the material during its formation (i.e., "surface sifting"). The method includes the steps of providing a material formation device and applying a plurality of vibrations to the material during formation, which vibrations are oscillations having dissimilar, non-harmonic frequencies and at least two different directions. The apparatus includes a plurality of vibration sources that impart vibrations to the material.
[Diversity and distribution of the threatened medicinal vascular plants in Lancang].
Chi, Xiu-Lian; Yuan, Yi-Kai; Fang, Bo; Zhang, Xiao-Bo; Yang, Han-Yu; Zhao, Zhi-Ping; Li, Guo; Fu, Kai-Cong; Guo, Lan-Ping; Huang, Lu-Qi
2017-11-01
The rich diversity in medicinal plants provides an important material basic for the development of Traditional Chinese medicine in China. It is important to explore the present situation of medicinal plants within special regions in order to provide scientific instructions for their sustainable protection and exploitation and utilization. In this study, we carried out the field survey according to the guideline of national survey of Chinese material medica resources and the guideline of plant species diversity survey and estimation at county level with the line transect method. With the field surveyed data, we explored the diversity and distribution of the threatened medicinal vascular plants in Lancang. We found that there were 33 species of the threatened medicinal vascular plants in this county. These species were from 23 genera and 17 families, and were composed of one critical endangered, 10 endangered and 22 vulnerable species. They were widely distributed across the whole county and were most concentrated in the town of Nuozhadu, Fazhanhe, Nuofu and Zhutang, which were located in the southeastern, southwestern and western of Lancang, respectively. We also found that the plant species richness followed a unimodal pattern along elevation. In addition, we found that the areas of Nuozhadu Nature Reserve in Lancang only covered six threatened medicinal vascular plants, while most of the regions with high species richness were not well protected. Therefore, we proposed to make more efforts to improve the protection measurements in order to better protect and utilize the medicinal plants in Lancang. Copyright© by the Chinese Pharmaceutical Association.
Method and apparatus for altering material
Stinnett, Regan W.; Greenly, John B.
2002-02-05
Methods and apparatus for thermally altering the near surface characteristics of a material are described. In particular, a repetitively pulsed ion beam system comprising a high energy pulsed power source and an ion beam generator are described which are capable of producing single species high voltage ion beams (0.25-2.5 MeV) at 1-1000 kW average power and over extended operating cycles (10.sup.8). Irradiating materials with such high energy, repetitively pulsed ion beams can yield surface treatments including localized high temperature anneals to melting, both followed by rapid thermal quenching to ambient temperatures to achieve both novel and heretofore commercially unachievable physical characteristics in a near surface layer of material.
Materials For Gas Capture, Methods Of Making Materials For Gas Capture, And Methods Of Capturing Gas
Polshettiwar, Vivek; Patil, Umesh
2013-01-01
In accordance with the purpose(s) of the present disclosure, as embodied and broadly described herein, embodiments of the present disclosure, in one aspect, relate to materials that can be used for gas (e.g., CO.sub.2) capture, methods of making
Aims and methods of nuclear materials management
International Nuclear Information System (INIS)
Leven, D.; Schier, H.
1979-05-01
Whilst international safeguarding of fissile materials against abuse has been the subject of extensive debate, little public attention has so far been devoted to the internal security of these materials. All countries using nuclear energy for peaceful purposes have laid down appropriate regulations. In the Federal Republic of Germany safeguards are required, for instance, by the Atomic Energy Act, and are therefore a prerequisite for licensing. The aims and methods of national nuclear materials management are contrasted with viewpoints on international safeguards
[Analysis of varieties and standards of Scrophulariaceae plants used in Tibetan medicine].
Cao, Lan; Mu, Ze-jing; Zhong, Wei-hong; Zhong, Wei-jin; He, Jun-wei; Du, Xiao-lang; Zhong, Guo-yue
2015-12-01
In this paper, the popular domestic varieties and quality standard of Scrophulariaceae plants used in Tibetan medicine were analyzed. The results showed that there were 11 genera and 99 species (including varieties), as well as 28 medicinal materials varieties of Scrophulariaceae plants were recorded in the relevant literatures. In relevant Tibetan standards arid literatures, there are great differences in varieties, sources, parts, and efficacies of medicinal plant. Among them, about 41.4% (including 41 species) of endemic plants, about 15.2% (including 15 species) of the original plants have medicinal standard legal records, except the medicinal materials of Scrophalaria ningpoensis, Lagotis brevituba, Picrorhiza scrophulariiflora, Veronica eriogyne general, most varieties have not completed quality standard. Consequently it is necessary to reinforce the herbal textual, resources and the use present situation investigation, the effects of the species resources material foundation and biological activity, quality standard, specification the medical terms of the plants, and promote Tibetan medicinal vareties-terminologies-sources such as the criterion and quality standard system for enriching the varieties of Tibetan medicinal materials and Chinese medicinal resources.
Methods for evaluation of mechanical stress condition of materials
Directory of Open Access Journals (Sweden)
Mirchev Yordan
2018-01-01
Full Text Available Primary attention is given to the following methods: method by drilling cylindrical holes (drill method and integrated ultrasonic method using volume (longitudinal and transverse, surface, and sub-surface waves. Drill method allows determination of residual mechanical stress in small depth of material surfaces, assessing type, size, and orientation of principal stresses. For the first time, parallel studies are carried out of mechanical stress in materials using the electroacoustic effect of volume, surface and sub-surface waves on the one hand, and effective mechanical stresses on the other. The experimental results present electroacoustic coefficients for different types of waves in the material of gas pipeline tube of 243 mm diameter and 14 mm thickness. These are used to evaluate mechanical stresses in pipelines, according to active GOST standards.
Li, Su-Yun
2014-04-01
The research methods, such as philology of medicine history and comparison between tradition and modern and so on were adopted in this article to study the acupuncture-moxibustion development after western medicine spreading to the East in Japan and its main transition under the impact of western medicine. The results showed that from Meiji to Showa period, under the influence of western medicine, the transition of Japanese acupuncture-moxibustion mainly embodied in following three aspects, incuinng acupuncture works absorbing western medicine knowledge, applying experiment measures to explore acupuncture principle and launching acupuncture teaching in accordance with Europe and America academy educational pattern. The changes on acupuncture works, teaching materials and methods of researching and teaching have triggered the transition and transformation of Japanese acupuncture-moxibustion from tradition to modern.
Methods for removing contaminant matter from a porous material
Fox, Robert V [Idaho Falls, ID; Avci, Recep [Bozeman, MT; Groenewold, Gary S [Idaho Falls, ID
2010-11-16
Methods of removing contaminant matter from porous materials include applying a polymer material to a contaminated surface, irradiating the contaminated surface to cause redistribution of contaminant matter, and removing at least a portion of the polymer material from the surface. Systems for decontaminating a contaminated structure comprising porous material include a radiation device configured to emit electromagnetic radiation toward a surface of a structure, and at least one spray device configured to apply a capture material onto the surface of the structure. Polymer materials that can be used in such methods and systems include polyphosphazine-based polymer materials having polyphosphazine backbone segments and side chain groups that include selected functional groups. The selected functional groups may include iminos, oximes, carboxylates, sulfonates, .beta.-diketones, phosphine sulfides, phosphates, phosphites, phosphonates, phosphinates, phosphine oxides, monothio phosphinic acids, and dithio phosphinic acids.
Adopting a blended learning approach to teaching evidence based medicine: a mixed methods study
Ilic, Dragan; Hart, William; Fiddes, Patrick; Misso, Marie; Villanueva, Elmer
2013-01-01
Background Evidence Based Medicine (EBM) is a core unit delivered across many medical schools. Few studies have investigated the most effective method of teaching a course in EBM to medical students. The objective of this study was to identify whether a blended-learning approach to teaching EBM is more effective a didactic-based approach at increasing medical student competency in EBM. Methods A mixed-methods study was conducted consisting of a controlled trial and focus groups with second ye...
Han, Sheng-Nan
2014-07-01
Chemometrics is a new branch of chemistry which is widely applied to various fields of analytical chemistry. Chemometrics can use theories and methods of mathematics, statistics, computer science and other related disciplines to optimize the chemical measurement process and maximize access to acquire chemical information and other information on material systems by analyzing chemical measurement data. In recent years, traditional Chinese medicine has attracted widespread attention. In the research of traditional Chinese medicine, it has been a key problem that how to interpret the relationship between various chemical components and its efficacy, which seriously restricts the modernization of Chinese medicine. As chemometrics brings the multivariate analysis methods into the chemical research, it has been applied as an effective research tool in the composition-activity relationship research of Chinese medicine. This article reviews the applications of chemometrics methods in the composition-activity relationship research in recent years. The applications of multivariate statistical analysis methods (such as regression analysis, correlation analysis, principal component analysis, etc. ) and artificial neural network (such as back propagation artificial neural network, radical basis function neural network, support vector machine, etc. ) are summarized, including the brief fundamental principles, the research contents and the advantages and disadvantages. Finally, the existing main problems and prospects of its future researches are proposed.
DNA Barcoding for the Identification and Authentication of Animal Species in Traditional Medicine
Directory of Open Access Journals (Sweden)
Fan Yang
2018-01-01
Full Text Available Animal-based traditional medicine not only plays a significant role in therapeutic practices worldwide but also provides a potential compound library for drug discovery. However, persistent hunting and illegal trade markedly threaten numerous medicinal animal species, and increasing demand further provokes the emergence of various adulterants. As the conventional methods are difficult and time-consuming to detect processed products or identify animal species with similar morphology, developing novel authentication methods for animal-based traditional medicine represents an urgent need. During the last decade, DNA barcoding offers an accurate and efficient strategy that can identify existing species and discover unknown species via analysis of sequence variation in a standardized region of DNA. Recent studies have shown that DNA barcoding as well as minibarcoding and metabarcoding is capable of identifying animal species and discriminating the authentics from the adulterants in various types of traditional medicines, including raw materials, processed products, and complex preparations. These techniques can also be used to detect the unlabelled and threatened animal species in traditional medicine. Here, we review the recent progress of DNA barcoding for the identification and authentication of animal species used in traditional medicine, which provides a reference for quality control and trade supervision of animal-based traditional medicine.
DNA Barcoding for the Identification and Authentication of Animal Species in Traditional Medicine.
Yang, Fan; Ding, Fei; Chen, Hong; He, Mingqi; Zhu, Shixin; Ma, Xin; Jiang, Li; Li, Haifeng
2018-01-01
Animal-based traditional medicine not only plays a significant role in therapeutic practices worldwide but also provides a potential compound library for drug discovery. However, persistent hunting and illegal trade markedly threaten numerous medicinal animal species, and increasing demand further provokes the emergence of various adulterants. As the conventional methods are difficult and time-consuming to detect processed products or identify animal species with similar morphology, developing novel authentication methods for animal-based traditional medicine represents an urgent need. During the last decade, DNA barcoding offers an accurate and efficient strategy that can identify existing species and discover unknown species via analysis of sequence variation in a standardized region of DNA. Recent studies have shown that DNA barcoding as well as minibarcoding and metabarcoding is capable of identifying animal species and discriminating the authentics from the adulterants in various types of traditional medicines, including raw materials, processed products, and complex preparations. These techniques can also be used to detect the unlabelled and threatened animal species in traditional medicine. Here, we review the recent progress of DNA barcoding for the identification and authentication of animal species used in traditional medicine, which provides a reference for quality control and trade supervision of animal-based traditional medicine.
Overcoming immunological barriers in regenerative medicine.
Zakrzewski, Johannes L; van den Brink, Marcel R M; Hubbell, Jeffrey A
2014-08-01
Regenerative therapies that use allogeneic cells are likely to encounter immunological barriers similar to those that occur with transplantation of solid organs and allogeneic hematopoietic stem cells (HSCs). Decades of experience in clinical transplantation hold valuable lessons for regenerative medicine, offering approaches for developing tolerance-induction treatments relevant to cell therapies. Outside the field of solid-organ and allogeneic HSC transplantation, new strategies are emerging for controlling the immune response, such as methods based on biomaterials or mimicry of antigen-specific peripheral tolerance. Novel biomaterials can alter the behavior of cells in tissue-engineered constructs and can blunt host immune responses to cells and biomaterial scaffolds. Approaches to suppress autoreactive immune cells may also be useful in regenerative medicine. The most innovative solutions will be developed through closer collaboration among stem cell biologists, transplantation immunologists and materials scientists.
Use of diagnostic radionuclides in medicine
International Nuclear Information System (INIS)
Early, R.J.
1996-01-01
The purpose of this paper is to follow the course of historical development in the use of radiopharmaceuticals as a diagnostic tool in nuclear medicine. This course has been a series of plateaus and growth spurts throughout its history. This article is designed to identify the different phases of the development of nuclear medicine, pointing out the events which most shaped its history along the way. Those events included such things as the discovery of radioactivity, the development of the cyclotron and nuclear reactor as a method of producing high specific activity radioactive material, the development of imaging equipment such as the rectilinear scanner, scintillation camera, PET and SPECT, the application of computers, and the discovery of 99 m Tc and the development of associated kits designed to image many organs and processes in human body. (author). 9 Refs., 11 Figs., 2 tabs
De Lima, Joao Jose
2011-01-01
Edited by a renowned international expert in the field, Nuclear Medicine Physics offers an up-to-date, state-of-the-art account of the physics behind the theoretical foundation and applications of nuclear medicine. It covers important physical aspects of the methods and instruments involved in modern nuclear medicine, along with related biological topics. The book first discusses the physics of and machines for producing radioisotopes suitable for use in conventional nuclear medicine and PET. After focusing on positron physics and the applications of positrons in medicine and biology, it descr
Energy Technology Data Exchange (ETDEWEB)
NONE
1998-07-01
The All-Polish Symposium Nuclear Techniques in Industry, Medicine, Agriculture and Environment Protection is cyclic (in 3 year period) conference being a broad review of state of art and development of all nuclear branches cooperated with industry and other branches of national economy and public life in Poland. The conference has been divided in one plenary session and 8 problem sessions as follow: Radiation technologies of flue gas purification; radiation technologies in food and cosmetic industry; application of nuclear techniques in environmental studies and earth science; radiometric methods in material engineering; isotope tracers in biological studies and medical diagnostics; radiometric industrial measuring systems; radiation detectors and device; nuclear methods in cultural objects examination. The poster section as well as small exhibition have been also organised.
Schaef, Herbert T.; McGrail, B. Peter
2015-07-28
Downhole fluid injection systems are provided that can include a first well extending into a geological formation, and a fluid injector assembly located within the well. The fluid injector assembly can be configured to inject a liquid CO2/H2O-emulsion into the surrounding geological formation. CO2 sequestration methods are provided that can include exposing a geological formation to a liquid CO2/H2O-emulsion to sequester at least a portion of the CO2 from the emulsion within the formation. Hydrocarbon material recovery methods are provided that can include exposing a liquid CO2/H2O-emulsion to a geological formation having the hydrocarbon material therein. The methods can include recovering at least a portion of the hydrocarbon material from the formation.
International Nuclear Information System (INIS)
Gribkov, V A; Miklaszewski, R; Paduch, M; Zielinska, E; Chernyshova, M; Pisarczyk, T; Sadowski, M J; Pimenov, V N; Demina, E V; Niemela, J; Crespo, M-L; Cicuttin, A; Tomaszewski, K; Skladnik-Sadowska, E; Pytel, K; Zawadka, A; Giannini, G; Longo, F; Talab, A; Ul'yanenko, S E
2015-01-01
The paper presents some outcomes obtained during the year of 2013 of the activity in the frame of the International Atomic Energy Agency Co-ordinated research project 'Investigations of Materials under High Repetition and Intense Fusion-Relevant Pulses'. The main results are related to the effects created at the interaction of powerful pulses of different types of radiation (soft and hard X-rays, hot plasma and fast ion streams, neutrons, etc. generated in Dense Plasma Focus (DPF) facilities) with various materials including those that are counted as perspective ones for their use in future thermonuclear reactors. Besides we discuss phenomena observed at the irradiation of biological test objects. We examine possible applications of nanosecond powerful pulses of neutrons to the aims of nuclear medicine and for disclosure of hidden illegal objects. Special attention is devoted to discussions of a possibility to create extremely large and enormously diminutive DPF devices and probabilities of their use in energetics, medicine and modern electronics. (paper)
Gribkov, V. A.; Miklaszewski, R.; Paduch, M.; Zielinska, E.; Chernyshova, M.; Pisarczyk, T.; Pimenov, V. N.; Demina, E. V.; Niemela, J.; Crespo, M.-L.; Cicuttin, A.; Tomaszewski, K.; Sadowski, M. J.; Skladnik-Sadowska, E.; Pytel, K.; Zawadka, A.; Giannini, G.; Longo, F.; Talab, A.; Ul'yanenko, S. E.
2015-03-01
The paper presents some outcomes obtained during the year of 2013 of the activity in the frame of the International Atomic Energy Agency Co-ordinated research project "Investigations of Materials under High Repetition and Intense Fusion-Relevant Pulses". The main results are related to the effects created at the interaction of powerful pulses of different types of radiation (soft and hard X-rays, hot plasma and fast ion streams, neutrons, etc. generated in Dense Plasma Focus (DPF) facilities) with various materials including those that are counted as perspective ones for their use in future thermonuclear reactors. Besides we discuss phenomena observed at the irradiation of biological test objects. We examine possible applications of nanosecond powerful pulses of neutrons to the aims of nuclear medicine and for disclosure of hidden illegal objects. Special attention is devoted to discussions of a possibility to create extremely large and enormously diminutive DPF devices and probabilities of their use in energetics, medicine and modern electronics.
Methods of humidity determination Part II: Determination of material humidity
Rübner, Katrin; Balköse, Devrim; Robens, E.
2008-01-01
Part II covers the most common methods of measuring the humidity of solid material. State of water near solid surfaces, gravimetric measurement of material humidity, measurement of water sorption isotherms, chemical methods for determination of water content, measurement of material humidity via the gas phase, standardisation, cosmonautical observations are reviewed.
Your Radiologist Explains Nuclear Medicine
Full Text Available ... can be detected with other diagnostic tests. Nuclear medicine imaging procedures use small amounts of radioactive materials – called radiotracers – that ... outweighs any risk. To learn more about nuclear medicine, visit Radiology Info dot org. Thank you for your ... of Use | Links | Site Map Copyright © 2018 Radiological Society of ...
Wang, Jinghui; Li, Yan; Yang, Yinfeng; Chen, Xuetong; Du, Jian; Zheng, Qiusheng; Liang, Zongsuo; Wang, Yonghua
2017-05-04
Traditional Chinese medicine (TCM), such as Uyghur Medicine (UM) has been used in clinical treatment for many years. TCM is featured as multiple targets and complex mechanisms of action, which is normally a combination of medicinal herbs and sometimes even contains certain rare animal medicinal ingredients. A question arises as to whether these animal materials can be removed replaced from TCM applications due to their valuable rare resources or animal ethics. Here, we select a classical UM Yimusake formula, which contains 3 animal drugs and other 8 herbs, and has got wealthy experience and remarkable achievements in treating erectile dysfunction (ED) in China. The active components, drug targets and therapeutic mechanisms have been comprehensively analyzed by systems-pharmacology methods. Additionally, to validate the inhibitory effects of all candidate compounds on their related targets, in vitro experiments, computational analysis and molecular dynamics simulations were performed. The results show that the modified, original and three animal materials display very similar mechanisms for an effective treatment of ED, indicating that it is quite possible to remove these three animal drugs from the original formula while still keep its efficiency. This work provides a new attempt for deleting animal materials from TCM, which should be important for optimization of traditional medicines.
Flexible energetic materials and related methods
Energy Technology Data Exchange (ETDEWEB)
Heaps, Ronald J.
2018-03-06
Energetic compositions and methods of forming components from the compositions are provided. In one embodiment, a composition includes aluminum, molybdenum trioxide, potassium perchlorate, and a binder. In one embodiment, the binder may include a silicone material. The materials may be mixed with a solvent, such as xylene, de-aired, shaped and cured to provide a self-supporting structure. In one embodiment, one or more reinforcement members may be added to provide additional strength to the structure. For example, a weave or mat of carbon fiber material may be added to the mixture prior to curing. In one embodiment, blade casting techniques may be used to form a structure. In another embodiment, a structure may be formed using 3-dimensional printing techniques.
What can acute medicine learn from qualitative methods?
Heasman, Brett; Reader, Tom W
2015-10-01
The contribution of qualitative methods to evidence-based medicine is growing, with qualitative studies increasingly used to examine patient experience and unsafe organizational cultures. The present review considers qualitative research recently conducted on teamwork and organizational culture in the ICU and also other acute domains. Qualitative studies have highlighted the importance of interpersonal and social aspects of healthcare on managing and responding to patient care needs. Clear/consistent communication, compassion, and trust underpin successful patient-physician interactions, with improved patient experiences linked to patient safety and clinical effectiveness across a wide range of measures and outcomes. Across multidisciplinary teams, good communication facilitates shared understanding, decision-making and coordinated action, reducing patient risk in the process. Qualitative methods highlight the complex nature of risk management in hospital wards, which is highly contextualized to the demands and resources available, and influenced by multilayered social contexts. In addition to augmenting quantitative research, qualitative investigations enable the investigation of questions on social behaviour that are beyond the scope of quantitative assessment alone. To develop improved patient-centred care, health professionals should therefore consider integrating qualitative procedures into their existing assessments of patient/staff satisfaction.
Vinklárková, Bára; Chromý, Vratislav; Šprongl, Luděk; Bittová, Miroslava; Rikanová, Milena; Ohnútková, Ivana; Žaludová, Lenka
2015-01-01
To select a Kjeldahl procedure suitable for the determination of total protein in reference materials used in laboratory medicine, we reviewed in our previous article Kjeldahl methods adopted by clinical chemistry and found an indirect two-step analysis by total Kjeldahl nitrogen corrected for its nonprotein nitrogen and a direct analysis made on isolated protein precipitates. In this article, we compare both procedures on various reference materials. An indirect Kjeldahl method gave falsely lower results than a direct analysis. Preliminary performance parameters qualify the direct Kjeldahl analysis as a suitable primary reference procedure for the certification of total protein in reference laboratories.
Lin, Annie Xianghong; Chan, Ging; Hu, Yuanjia; Ouyang, Defang; Ung, Carolina Oi Lam; Shi, Luwen; Hu, Hao
2018-01-01
Through reviewing the current international market for traditional Chinese medicine (TCM), this paper identified the internationalization challenges for TCM, including unclear therapeutic material basis and mechanism, difficulty of quality control, low preparation level, registration/policy barriers, and shortage of intellectual property. To deal with these challenges, suggestions were given including: (1) product innovation of TCM (study the TCM by using the methods and means of western medicine; innovate the basic theory of TCM; develop TCM health product); (2) standard innovation of TCM; (3) building big data platform of Chinese medicine (big data platform of TCM preparation; big data platform on the quality of TCM).
Directory of Open Access Journals (Sweden)
Sricharoen P
2015-02-01
Full Text Available Pungkava Sricharoen,1 Chaiyaporn Yuksen,1 Yuwares Sittichanbuncha,1 Kittisak Sawanyawisuth2,3 1Department of Emergency Medicine, Faculty of Medicine, Ramathibodi Hospital, Mahidol University, Bangkok, Thailand; 2Department of Medicine, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand; 3The Research Center in Back, Neck, Other Joint Pain and Human Performance (BNOJPH, Khon Kaen University, Khon Kaen, Thailand Background: There are different teaching methods; such as traditional lectures, bedside teaching, and workshops for clinical medical clerkships. Each method has advantages and disadvantages in different situations. Emergency Medicine (EM focuses on emergency medical conditions and deals with several emergency procedures. This study aimed to compare traditional teaching methods with teaching methods involving workshops in the EM setting for medical students. Methods: Fifth year medical students (academic year of 2010 at Ramathibodi Hospital, Faculty of Medicine, Mahidol University, Bangkok, Thailand participated in the study. Half of students received traditional teaching, including lectures and bedside teaching, while the other half received traditional teaching plus three workshops, namely, airway workshop, trauma workshop, and emergency medical services workshop. Student evaluations at the end of the clerkship were recorded. The evaluation form included overall satisfaction, satisfaction in overall teaching methods, and satisfaction in each teaching method. Results: During the academic year 2010, there were 189 students who attended the EM rotation. Of those, 77 students (40.74% were in the traditional EM curriculum, while 112 students were in the new EM curriculum. The average satisfaction score in teaching method of the new EM curriculum group was higher than the traditional EM curriculum group (4.54 versus 4.07, P-value <0.001. The top three highest average satisfaction scores in the new EM curriculum group were trauma
Non-Adiabatic Molecular Dynamics Methods for Materials Discovery
Energy Technology Data Exchange (ETDEWEB)
Furche, Filipp [Univ. of California, Irvine, CA (United States); Parker, Shane M. [Univ. of California, Irvine, CA (United States); Muuronen, Mikko J. [Univ. of California, Irvine, CA (United States); Roy, Saswata [Univ. of California, Irvine, CA (United States)
2017-04-04
The flow of radiative energy in light-driven materials such as photosensitizer dyes or photocatalysts is governed by non-adiabatic transitions between electronic states and cannot be described within the Born-Oppenheimer approximation commonly used in electronic structure theory. The non-adiabatic molecular dynamics (NAMD) methods based on Tully surface hopping and time-dependent density functional theory developed in this project have greatly extended the range of molecular materials that can be tackled by NAMD simulations. New algorithms to compute molecular excited state and response properties efficiently were developed. Fundamental limitations of common non-linear response methods were discovered and characterized. Methods for accurate computations of vibronic spectra of materials such as black absorbers were developed and applied. It was shown that open-shell TDDFT methods capture bond breaking in NAMD simulations, a longstanding challenge for single-reference molecular dynamics simulations. The methods developed in this project were applied to study the photodissociation of acetaldehyde and revealed that non-adiabatic effects are experimentally observable in fragment kinetic energy distributions. Finally, the project enabled the first detailed NAMD simulations of photocatalytic water oxidation by titania nanoclusters, uncovering the mechanism of this fundamentally important reaction for fuel generation and storage.
Jha, Abhinav K; Caffo, Brian; Frey, Eric C
2016-04-07
The objective optimization and evaluation of nuclear-medicine quantitative imaging methods using patient data is highly desirable but often hindered by the lack of a gold standard. Previously, a regression-without-truth (RWT) approach has been proposed for evaluating quantitative imaging methods in the absence of a gold standard, but this approach implicitly assumes that bounds on the distribution of true values are known. Several quantitative imaging methods in nuclear-medicine imaging measure parameters where these bounds are not known, such as the activity concentration in an organ or the volume of a tumor. We extended upon the RWT approach to develop a no-gold-standard (NGS) technique for objectively evaluating such quantitative nuclear-medicine imaging methods with patient data in the absence of any ground truth. Using the parameters estimated with the NGS technique, a figure of merit, the noise-to-slope ratio (NSR), can be computed, which can rank the methods on the basis of precision. An issue with NGS evaluation techniques is the requirement of a large number of patient studies. To reduce this requirement, the proposed method explored the use of multiple quantitative measurements from the same patient, such as the activity concentration values from different organs in the same patient. The proposed technique was evaluated using rigorous numerical experiments and using data from realistic simulation studies. The numerical experiments demonstrated that the NSR was estimated accurately using the proposed NGS technique when the bounds on the distribution of true values were not precisely known, thus serving as a very reliable metric for ranking the methods on the basis of precision. In the realistic simulation study, the NGS technique was used to rank reconstruction methods for quantitative single-photon emission computed tomography (SPECT) based on their performance on the task of estimating the mean activity concentration within a known volume of interest
International Nuclear Information System (INIS)
Jha, Abhinav K; Frey, Eric C; Caffo, Brian
2016-01-01
The objective optimization and evaluation of nuclear-medicine quantitative imaging methods using patient data is highly desirable but often hindered by the lack of a gold standard. Previously, a regression-without-truth (RWT) approach has been proposed for evaluating quantitative imaging methods in the absence of a gold standard, but this approach implicitly assumes that bounds on the distribution of true values are known. Several quantitative imaging methods in nuclear-medicine imaging measure parameters where these bounds are not known, such as the activity concentration in an organ or the volume of a tumor. We extended upon the RWT approach to develop a no-gold-standard (NGS) technique for objectively evaluating such quantitative nuclear-medicine imaging methods with patient data in the absence of any ground truth. Using the parameters estimated with the NGS technique, a figure of merit, the noise-to-slope ratio (NSR), can be computed, which can rank the methods on the basis of precision. An issue with NGS evaluation techniques is the requirement of a large number of patient studies. To reduce this requirement, the proposed method explored the use of multiple quantitative measurements from the same patient, such as the activity concentration values from different organs in the same patient. The proposed technique was evaluated using rigorous numerical experiments and using data from realistic simulation studies. The numerical experiments demonstrated that the NSR was estimated accurately using the proposed NGS technique when the bounds on the distribution of true values were not precisely known, thus serving as a very reliable metric for ranking the methods on the basis of precision. In the realistic simulation study, the NGS technique was used to rank reconstruction methods for quantitative single-photon emission computed tomography (SPECT) based on their performance on the task of estimating the mean activity concentration within a known volume of interest
Yu, H.; He, J.; Zhou, H.; Guan, F.; Li, L.; Ren, B.; Wang, Z.
2018-04-01
Remote sensing technology has become an important method to rapidly acquireing of planting layout and composition of regional crops.It is very important to accurately master the planting area of Chinese medicine crops in the Characteristic planting area because it relations to accurately master the cultivation of Chinese medicine crops, formulate related policies and adjustment of crop planting structure.The author puts forward a method of using remote sencing technology for momitoring Chinese medicine which has good applicability and generalization. This paper took Qiaocheng District of Bozhou as an example to Verify the feasibility of the method, providing a reference for solving the problem of interpretation and extraction of Chinese medicinal materials in the region.
Editorial Nano structures for Medicine and Pharmaceuticals
International Nuclear Information System (INIS)
Xing-Jie, L.; Kumar, A.; Donglu, S.; Daxiang, C.
2012-01-01
The rapid developments in nano structured materials and nano technology will have profound impact in many areas of biomedical applications including delivery of drugs and biomolecules, tissue engineering, detection of bio markers, cancer diagnosis, cancer therapy, and imaging. This field is expanding quickly, and a lot of work is ongoing in the design, characterization, synthesis, and application of materials, for controlling shape and size at nanometer scale to develop highly advanced materials for biomedical application and even to design better pharmaceutical products. In recent years, novel nano structure with multi functionalities has been focused on the use of nano structures toward solving problems of biology and medicine. The main scope of this special issue is to demonstrate the latest achievement of nano technology and its application in nano medicine particularly in new approaches for drug delivery such as targeted drug delivery system, nano structure for drug storage, nano materials for tissue engineering, medical diagnosis and treatment, and generation of new kinds of materials from biological sources. Therefore, many critical issues in nano structured materials, particularly their applications in biomedicine, must be addressed before clinical applications. This special issue devotes several review and research articles encompassing various aspects of nano materials for medicine and pharmaceuticals.
Method of processing radioactive materials
International Nuclear Information System (INIS)
Kondo, Susumu; Moriya, Tetsuo; Ishibashi, Tadashi; Kariya, Masahiro.
1986-01-01
Purpose: To improve contamination proofness, water proofness, close bondability and stretching performance of strippable paints coated to substrates liable to be contaminated with radioactive materials. Method: Strippable paints are previously coated on substrates which may possibly be contaminated with radioactive materials. After the contamination, the coated membranes are stripped and removed. Alternatively, the strippable paints may be coated on the already contaminated substrates and, after drying, the paints are stripped and removed. The strippable paints used herein have a composition comprising a styrene-butadiene block copolymer containing from 60 to 80 wt% of styrene as a main ingredient and from 0.3 to 5 % by weight of a higher alkyl amine compound having 12 to 18 carbon atoms blended with the copolymer. (Ikeda, J.)
Medicinal Chemistry Projects Requiring Imaginative Structure-Based Drug Design Methods.
Moitessier, Nicolas; Pottel, Joshua; Therrien, Eric; Englebienne, Pablo; Liu, Zhaomin; Tomberg, Anna; Corbeil, Christopher R
2016-09-20
Computational methods for docking small molecules to proteins are prominent in drug discovery. There are hundreds, if not thousands, of documented examples-and several pertinent cases within our research program. Fifteen years ago, our first docking-guided drug design project yielded nanomolar metalloproteinase inhibitors and illustrated the potential of structure-based drug design. Subsequent applications of docking programs to the design of integrin antagonists, BACE-1 inhibitors, and aminoglycosides binding to bacterial RNA demonstrated that available docking programs needed significant improvement. At that time, docking programs primarily considered flexible ligands and rigid proteins. We demonstrated that accounting for protein flexibility, employing displaceable water molecules, and using ligand-based pharmacophores improved the docking accuracy of existing methods-enabling the design of bioactive molecules. The success prompted the development of our own program, Fitted, implementing all of these aspects. The primary motivation has always been to respond to the needs of drug design studies; the majority of the concepts behind the evolution of Fitted are rooted in medicinal chemistry projects and collaborations. Several examples follow: (1) Searching for HDAC inhibitors led us to develop methods considering drug-zinc coordination and its effect on the pKa of surrounding residues. (2) Targeting covalent prolyl oligopeptidase (POP) inhibitors prompted an update to Fitted to identify reactive groups and form bonds with a given residue (e.g., a catalytic residue) when the geometry allows it. Fitted-the first fully automated covalent docking program-was successfully applied to the discovery of four new classes of covalent POP inhibitors. As a result, efficient stereoselective syntheses of a few screening hits were prioritized rather than synthesizing large chemical libraries-yielding nanomolar inhibitors. (3) In order to study the metabolism of POP inhibitors by
Nuclear medicine and mathematics
Energy Technology Data Exchange (ETDEWEB)
Pedroso de Lima, J.J. [Dept. de Biofisica e Proc. de Imagem, IBILI - Faculdade de Medicina, Coimbra (Portugal)
1996-06-01
The purpose of this review is not to present a comprehensive description of all the mathematical tools used in nuclear medicine, but to emphasize the importance of the mathematical method in nuclear medicine and to elucidate some of the mathematical concepts currently used. We can distinguish three different areas in which mathematical support has been offered to nuclear medicine: Physiology, methodology and data processing. Nevertheless, the boundaries between these areas can be indistinct. It is impossible in a single article to give even an idea of the extent and complexity of the procedures currently usede in nuclear medicine, such as image processing, reconstruction from projections and artificial intelligence. These disciplines do not belong to nuclear medicine: They are already branches of engineering, and my interest will reside simply in revealing a little of the elegance and the fantastic potential of these new `allies` of nuclear medicine. In this review the mathematics of physiological interpretation and methodology are considered together in the same section. General aspects of data-processing methods, including image processing and artificial intelligence, are briefly analysed. The mathematical tools that are most often used to assist the interpretation of biological phenomena in nuclear medicine are considered; these include convolution and deconvolution methods, Fourier analysis, factorial analysis and neural networking. (orig.)
Nuclear medicine and mathematics
International Nuclear Information System (INIS)
Pedroso de Lima, J.J.
1996-01-01
The purpose of this review is not to present a comprehensive description of all the mathematical tools used in nuclear medicine, but to emphasize the importance of the mathematical method in nuclear medicine and to elucidate some of the mathematical concepts currently used. We can distinguish three different areas in which mathematical support has been offered to nuclear medicine: Physiology, methodology and data processing. Nevertheless, the boundaries between these areas can be indistinct. It is impossible in a single article to give even an idea of the extent and complexity of the procedures currently usede in nuclear medicine, such as image processing, reconstruction from projections and artificial intelligence. These disciplines do not belong to nuclear medicine: They are already branches of engineering, and my interest will reside simply in revealing a little of the elegance and the fantastic potential of these new 'allies' of nuclear medicine. In this review the mathematics of physiological interpretation and methodology are considered together in the same section. General aspects of data-processing methods, including image processing and artificial intelligence, are briefly analysed. The mathematical tools that are most often used to assist the interpretation of biological phenomena in nuclear medicine are considered; these include convolution and deconvolution methods, Fourier analysis, factorial analysis and neural networking. (orig.)
Kizawa, Yoshiyuki; Tsuneto, Satoru; Tamba, Kaichiro; Takamiya, Yusuke; Morita, Tatsuya; Bito, Seiji; Otaki, Junji
2012-07-01
There is currently no consensus syllabus of palliative medicine for undergraduate medical education in Japan, although the Cancer Control Act proposed in 2007 covers the dissemination of palliative care. To develop a nationwide consensus syllabus of palliative medicine for undergraduate medical education in Japan using a modified Delphi method. We adopted the following three-step method: (1) a workshop to produce the draft syllabus; (2) a survey-based provisional syllabus; (3) Delphi rounds and a panel meeting (modified Delphi method) to produce the working syllabus. Educators in charge of palliative medicine from 63% of the medical schools in Japan collaborated to develop a survey-based provisional syllabus before the Delphi rounds. A panel of 32 people was then formed for the modified Delphi rounds comprising 28 educators and experts in palliative medicine, one cancer survivor, one bereaved family member, and two medical students. The final consensus syllabus consists of 115 learning objectives across seven sections as follows: basic principles; disease process and comprehensive assessment; symptom management; psychosocial care; cultural, religious, and spiritual issues; ethical issues; and legal frameworks. Learning objectives were categorized as essential or desirable (essential: 66; desirable: 49). A consensus syllabus of palliative medicine for undergraduate medical education was developed using a clear and innovative methodology. The final consensus syllabus will be made available for further dissemination of palliative care education throughout the country.
Lindequist, U.; Won Kim, H.; Tiralongo, E.; Griensven, van L.J.L.D.
2014-01-01
Since beginning of mankind nature is the most important source of medicines. Bioactive compounds produced by living organisms can be used directly as drugs or as lead compounds for drug development. Besides, the natural material can be used as crude drug for preparation of powder or extracts. Plants
A fuzzy logic based PROMETHEE method for material selection problems
Directory of Open Access Journals (Sweden)
Muhammet Gul
2018-03-01
Full Text Available Material selection is a complex problem in the design and development of products for diverse engineering applications. This paper presents a fuzzy PROMETHEE (Preference Ranking Organization Method for Enrichment Evaluation method based on trapezoidal fuzzy interval numbers that can be applied to the selection of materials for an automotive instrument panel. Also, it presents uniqueness in making a significant contribution to the literature in terms of the application of fuzzy decision-making approach to material selection problems. The method is illustrated, validated, and compared against three different fuzzy MCDM methods (fuzzy VIKOR, fuzzy TOPSIS, and fuzzy ELECTRE in terms of its ranking performance. Also, the relationships between the compared methods and the proposed scenarios for fuzzy PROMETHEE are evaluated via the Spearman’s correlation coefficient. Styrene Maleic Anhydride and Polypropylene are determined optionally as suitable materials for the automotive instrument panel case. We propose a generic fuzzy MCDM methodology that can be practically implemented to material selection problem. The main advantages of the methodology are consideration of the vagueness, uncertainty, and fuzziness to decision making environment.
Nuclear medicine methods in the assessment of acupuncture effects: a short review
Directory of Open Access Journals (Sweden)
Deise Elisabete Souza
2007-09-01
Full Text Available The mechanisms of acupuncture are poorly understood. In consequence, numerous investigators have conducted clinical trials to test the efficacy of acupuncture in various conditions. We have used PubMed database system to evaluate the number of publications in acupuncture and nuclear medicine procedures in the period from 1964 to 2007, using the keywords: "nuclear medicine and acupuncture", "SPECT and acupuncture", "PET and acupuncture", "scintigraphy and acupuncture", "radionuclide and acupuncture", "radiopharmaceutical and acupuncture", "radioisotope and acupuncture" and "99mTc and acupuncture". Some papers published in English language were selected and a short review is presented The analysis of the number of publications shows that when a method is well accepted by the scientific community, as the methods used in nuclear medicine, the interest in the development of research increases. Moreover, important findings are presented when the nuclear medicine image is used to evaluate the effect of the acupuncture.Os mecanismos de ação da acupuntura ainda não são completamente esclarecidos. Em conseqüência, diversos pesquisadores têm conduzido testes clínicos para verificar a eficiência da acupuntura em condições diversas. Nós utilizamos o sistema de base de dados PubMed para avaliar o número de publicações em acupuntura e procedimentos em medicina nuclear no período de 1964 até 2007, usando as palavras-chaves: "medicina nuclear e acupuntura", "SPECT e acupuntura", "PET e acupuntura", "cintilografia e acupuntura", "radionuclídeo e acupuntura", "radiofármaco e acupuntura", "radioisótopo e acupuntura" e "99mTc e acupuntura". Alguns artigos publicados em inglês foram selecionados e uma pequena revisão é apresentada. A análise do número de publicações mostra que quando um método é bem aceito pela comunidade científica, como os métodos utilizados em medicina nuclear, o interesse em desenvolver novos estudos aumenta. Al
Survey on supply and demand of medicinal plants in Lorestan province groceries
Directory of Open Access Journals (Sweden)
fatemeh Naderi
2010-03-01
Full Text Available The results of activities related to medicinal plant industry lead to maintenance and progress (improvement of society health. Attention to situation of medicinal plants in groceries, diagnosis different species, Value of consumption and supplier regions as most important factors in medicinal plants forum can be used for programming and politics in medicinal industry in our country. So via proper scientific programming we can achieve to better culture of medicinal plants consumption and we can improve health parameters in lorestan province. Materials and methods The research was accomplished with Cross-Sectional study and questionary technique was used for data collection. The questionnaire consist of 3 parts were included questions related to socioeconomic trait, number of medicinal plant and medicinal properties. All of the groceries in the lorestan province were studied as statistical society. Sampling method was availability sample and samples size was 69 groceries. Results Results showed that the numbers of medicinal plants in groceries were about 336 species, mean of sold weight Was 128.48 kg. 94.5% and 5.5% of medicinal plants were supplied from out of Lorestan and Lorestan province respectively. Conclusion Existence of special plains and mountains plentiful running water, high storage of under round water and different Climate in the lorestan province cause a considerable diversity in this province. Whereas the results of this study showed that the most important suppliers of medicinal plants were located out of this province therefore programming in the case of these valuable sources of medicinal plants will be because higher preoccupation and existence of these crops in the groceries of lorestan province, even can export these to other countries.
INFLUENCE OF AEROSPACE MEDICINE ACHIEVEMENTS ON THE DEVELOPMENT OF SPORT MEDICINE METHODOLOGY.
R Yashina, E R; Kurashvili, V A; Turzin, P S
Modern technologies of aerospace medicine develop at rapid pace pulling on its orbit all spheres of the human activity, including sport. Innovations play a major role in the progress of sport medicine areas related to the biomedical support of precontest training. Overview of the most important aerospace medicine achievements and their methodical implications for sport medicine is presented. Discussion is devoted to how the aerospace medicine technologies can raise effectiveness of the biomedical support to different sectors of sport and fitness.
Al Aqeel, Sinaa; Abanmy, Norah; Aldayel, Abeer; Al-Khalifa, Hend; Al-Yahya, Maha; Diab, Mona
2018-02-27
Written Medicine Information (WMI) is one of the sources that patients use to obtain information concerning medicine. This paper aims to assess the readability of two types of WMIs in Arabic language based on vocabulary use and sentence structure using a panel of experts and consumers. This is a descriptive study. Two different types of materials, including the online text from King Abdullah Bin Abdulaziz Arabic Health Encyclopaedia (KAAHE) and medication leaflets submitted by the manufacturers to the Saudi Food and Drug Authority (SFDA) were evaluated. We selected a group of sentences from each WMI. The readability was assessed by experts (n = 5) and consumers (n = 5). The sentence readability of each measured using a specific criteria and rated as 1 = easy, 2 = intermediate, or 3 = difficult. A total of 4476 sentences (SFDA 2231; KAHEE 2245) extracted from websites or patient information leaflets on 50 medications and evaluated. The majority of the vocabulary and sentence structure was considered easy by both expert (SFDA: 68%; KAAHE: 76%) and consumer (SFDA: 76%; KAAHE: 84%) groups. The sentences with difficult or intermediate vocabulary and sentence structure are derived primarily from the precautions and side effects sections. The SFDA and KAAHE WMIs are easy to read and understand as judged by our study sample. However; there is room for improvement, especially in sections related to the side effects and precautions.
Textbook of respiratory medicine
International Nuclear Information System (INIS)
Murray, J.F.; Nadel, J.
1987-01-01
This book presents a clinical reference of respiratory medicine. It also details basic science aspects of pulmonary physiology and describes recently developed, sophisticated diagnostic tools and therapeutic methods. It also covers anatomy, physiology, pharmacology, and pathology; microbiologic, radiologic, nuclear medicine, and biopsy methods for diagnosis
Attitude and opinion towards essential medicine formulary
Sharma, Sangeeta; Kh, Reeta; Chaudhury, R. Roy
2010-01-01
Objective: The Delhi State Drug Policy was adopted in 1994 following which the first Essential Medicines List (EML) was developed in 1996. The Delhi State Essential Medicines Formulary was brought out in 1997. A need was felt to revise the formulary to match with the EML as the EML is renewed every 2 years. Materials and Methods: A survey was undertaken to elicit the opinions of the doctors practicing in the state on the usefulness of the formulary before revising and printing the updated version. The survey covered dispensaries, 10–20 bedded hospitals, 100-bedded hospitals and two tertiary care hospitals. Discussions were focused on questionnaires on attitudes toward adopting Essential Medicines Formulary using a 10-point scale. Results: Of the 200 doctors approached, only 90 doctors completed the questionnaire. Sixty-nine respondents (76.6%) had received the copy of the formulary. Most practitioners welcomed the formulary and were satisfied with the coverage and selection of the medicines. Most respondents (76.9%) agreed that a well-developed formulary would improve the quality of the public health care system, although they had reservations about the authority, relevance and effect on professional autonomy. Conclusion: About 74% of the respondents used the formulary in clinical practice as a source of medicine information, which makes its regular revision necessary. PMID:20871765
Studies on compatibility of energetic materials by thermal methods
Directory of Open Access Journals (Sweden)
Maria Alice Carvalho Mazzeu
2010-04-01
Full Text Available The chemical compatibility of explosives, pyrotechnics and propellants with those materials is studied to evaluate potential hazards when in contact with other materials during production, storage and handling. Compatibility can be studied by several thermal methods as DSC (differential scanning calorimetry, TG (Thermogravimetry, VST (Vacuum stability test and others. The test methods and well defined criteria are the most important elements when a compatibility study is being accomplished. In this paper, the compatibility of two very important high explosives used in ammunition, RDX (Cyclo-1,3,5-trimethylene-2,4,6-trinitramine and HMX (Cyclotetramethylene tetranitramine was studied with the materials: fluoroelastomer (Viton and powdered aluminum (Al, using DSC and VST methods. The criteria to judge the compatibility between materials is based on a standardization agreement (STANAG 4147, 2001, and the final conclusion is that explosives and this materials are compatible, but in DSC it was observed that the peak of decomposition temperature of the admixture of RDX with Al decreased in 3º C and another peak appeared after the decomposition peak.
He, Ping; Li, Feng-Jie; Li, Lian-da; Li, Yi-Kui
2017-03-01
Safety issues of traditional Chinese medicine injections has been heated debate. There are two diametrically opposed views: it should be used reasonable and developed healthily or be forbidden to use. Some people have many misunderstandings and prejudices about the safety of traditional Chinese medicine injections. Compared with western medicine,traditional Chinese medicine has its own particularity. Traditional Chinese medicine has complex components. Its research and clinical application is different from western medicine. Adverse reactions of traditional Chinese medicine injections are related to many factors,such as a large number of irrational use,blind use of traditional Chinese medicine injections and western medicine injections,counterfeit and substandard drugs,incorrect methods of intravenous infusion,toxicity of supplementary materials,drug ingredients. Developing traditional Chinese medicine injection is the need for curing sickness to save patients. The purposeful, targeted, organized and planned systematic research of traditional Chinese medicine injections should be strengthened,especially the safety of traditional Chinese medicine. Strengthen supervision and control of rational drug use.Strengthen the examination and approval,supervision and management of all aspects to ensure the safety of patients. Copyright© by the Chinese Pharmaceutical Association.
Developing Teaching Material Software Assisted for Numerical Methods
Handayani, A. D.; Herman, T.; Fatimah, S.
2017-09-01
The NCTM vision shows the importance of two things in school mathematics, which is knowing the mathematics of the 21st century and the need to continue to improve mathematics education to answer the challenges of a changing world. One of the competencies associated with the great challenges of the 21st century is the use of help and tools (including IT), such as: knowing the existence of various tools for mathematical activity. One of the significant challenges in mathematical learning is how to teach students about abstract concepts. In this case, technology in the form of mathematics learning software can be used more widely to embed the abstract concept in mathematics. In mathematics learning, the use of mathematical software can make high level math activity become easier accepted by student. Technology can strengthen student learning by delivering numerical, graphic, and symbolic content without spending the time to calculate complex computing problems manually. The purpose of this research is to design and develop teaching materials software assisted for numerical method. The process of developing the teaching material starts from the defining step, the process of designing the learning material developed based on information obtained from the step of early analysis, learners, materials, tasks that support then done the design step or design, then the last step is the development step. The development of teaching materials software assisted for numerical methods is valid in content. While validator assessment for teaching material in numerical methods is good and can be used with little revision.
Materials comprising polydienes and hydrophilic polymers and related methods
Mays, Jimmy W [Knoxville, TN; Deng, Suxiang [Knoxville, TN; Mauritz, Kenneth A [Hattiesburg, MS; Hassan, Mohammad K [Hattiesburg, MS; Gido, Samuel P [Hadley, MA
2011-11-22
Materials prepared from polydienes, such as poly(cyclohexadiene), and hydrophilic polymers, such as poly(alkylene oxide), are described. Methods of making the materials and their use in fuel cell membranes, batteries, breathable chemical-biological protective materials, and templates for sol-gel polymerization are also provided. The materials can be crosslinked and sulfonated, and can include copolymers and polymer blends.
Wang, Mo; Ling, Jie; Chen, Ying; Song, Jie; Sun, E; Shi, Zi-Qi; Feng, Liang; Jia, Xiao-Bin; Wei, Ying-Jie
2017-11-01
The increasingly apparent liver injury problems of bone strengthening Chinese medicines have brought challenges for clinical application, and it is necessary to consider both effectiveness and safety in screening anti-osteoporosis Chinese medicines. Metabolic transformation is closely related to drug efficacy and toxicity, so it is significant to comprehensively consider metabolism-action/toxicity(M-Act/Tox) for screening anti-osteoporosis Chinese medicines. The current evaluation models and the number of compounds(including metabolites) severely restrict efficient screening in vivo. By referring to previous relevant research and domestic and abroad literature, zebrafish M-Act/Tox integrative method was put forward for efficiently screening anti-osteoporosis herb medicines, which has organically integrated zebrafish metabolism model, osteoporosis model and toxicity evaluation method. This method can break through the bottleneck and blind spots that trace compositions can't achieve efficient and integrated in vivo evaluation, and realize both efficient and comprehensive screening on anti-osteoporosis traditional medicines based on in vivo process taking both safety and effectiveness into account, which is significant to accelerate discovery of effective and safe innovative traditional Chinese medicines for osteoporosis. Copyright© by the Chinese Pharmaceutical Association.
The Choice Method of Selected Material has influence single evaporation flash method
International Nuclear Information System (INIS)
Sunaryo, Geni Rina; Sumijanto; Nurul L, Siti
2000-01-01
The final objective of this research is to design the mini scale of desalination installation. It has been started from 1997/1998 and has been doing for this 3 years. Where the study on the assessment of various desalination system has been done in the first year and thermodynamic in the second year. In this third year, literatully study on material resistance from outside pressure has been done. The number of pressure for single evaporator flashing method is mainly depend on the temperature that applied in that system. In this paper, the configuration stage, the choice method of selecting material for main evaporator vessel, tube, tube plates, water boxes, pipework, and valves for multistage flash distillation will be described. The choice of selecting material for MSF is base on economical consideration, cheap, high resistance and easy to be maintained
Method of capturing or trapping zinc using zinc getter materials
Hunyadi Murph, Simona E.; Korinko, Paul S.
2017-07-11
A method of trapping or capturing zinc is disclosed. In particular, the method comprises a step of contacting a zinc vapor with a zinc getter material. The zinc getter material comprises nanoparticles and a metal substrate.
The lost history of American veterinary medicine: the need for preservation*†
Boyd, C. Trenton
2011-01-01
Objective: The objective of this study was to survey holdings of ephemeral veterinary literature. Methods: WorldCat OCLC catalog, the Library of Congress online catalog, the US National Agricultural Library online catalog, and the Dictionary Catalog of the National Agricultural Library, 1862–1965, were used to determine current library holdings of materials published by veterinary schools that are no longer in existence and veterinary associations that are defunct, veterinary supply catalogs, veterinary house organs, patent medicine publications, and veterinary advertisements. Individual library catalogs were also consulted. In addition, the practice of removing advertisements from bound volumes was examined. Results: There are many gaps in the cataloged library holdings of primary source materials relating to the history of the education of veterinarians in the United States. Conclusions: A proactive action plan needs to be designed and activated to locate, catalog, and preserve this primary source material of veterinary medicine for posterity. PMID:21243050
Macro-architectured cellular materials: Properties, characteristic modes, and prediction methods
Ma, Zheng-Dong
2017-12-01
Macro-architectured cellular (MAC) material is defined as a class of engineered materials having configurable cells of relatively large (i.e., visible) size that can be architecturally designed to achieve various desired material properties. Two types of novel MAC materials, negative Poisson's ratio material and biomimetic tendon reinforced material, were introduced in this study. To estimate the effective material properties for structural analyses and to optimally design such materials, a set of suitable homogenization methods was developed that provided an effective means for the multiscale modeling of MAC materials. First, a strain-based homogenization method was developed using an approach that separated the strain field into a homogenized strain field and a strain variation field in the local cellular domain superposed on the homogenized strain field. The principle of virtual displacements for the relationship between the strain variation field and the homogenized strain field was then used to condense the strain variation field onto the homogenized strain field. The new method was then extended to a stress-based homogenization process based on the principle of virtual forces and further applied to address the discrete systems represented by the beam or frame structures of the aforementioned MAC materials. The characteristic modes and the stress recovery process used to predict the stress distribution inside the cellular domain and thus determine the material strengths and failures at the local level are also discussed.
Materials characterization by resonant ultrasonic spectroscopy method
International Nuclear Information System (INIS)
Cheong, Yong Moo; Jung, H.K.; Joo, Y.S.; Sim, C.M.
2001-01-01
A high temperature resonant ultrasound spectroscopy(RUS) was developed. The dynamic elastic constant of RPV weld, which has various different microstructure was determined by RUS. It was confirmed the RUS method is very sensitive to the microstructures of the material. RUS can be used to monitor the degradation of nuclear materials including neutron irradiation embrittlement through the measurement of dynamic elastic constants, elastic anisotropy, high temperature elastic constant and Q-factor
Modeling of Landslides with the Material Point Method
DEFF Research Database (Denmark)
Andersen, Søren Mikkel; Andersen, Lars
2008-01-01
A numerical model for studying the dynamic evolution of landslides is presented. The numerical model is based on the Generalized Interpolation Material Point Method. A simplified slope with a house placed on top is analysed. An elasto-plastic material model based on the Mohr-Coulomb yield criterion...
Modelling of Landslides with the Material-point Method
DEFF Research Database (Denmark)
Andersen, Søren; Andersen, Lars
2009-01-01
A numerical model for studying the dynamic evolution of landslides is presented. The numerical model is based on the Generalized Interpolation Material Point Method. A simplified slope with a house placed on top is analysed. An elasto-plastic material model based on the Mohr-Coulomb yield criterion...
Directory of Open Access Journals (Sweden)
Erica C. Larson
2016-01-01
Full Text Available The hypothesis underlying this current work is that fresh juice expressed from Papua New Guinea (PNG medicinal plants (succus will inhibit human Cytochrome P450s (CYPs. The CYP inhibitory activity identified in fresh material was compared with inhibition in methanol extracts of dried material. Succus is the most common method of traditional medicine (TM preparation for consumption in PNG. There is increasing concern that TMs might antagonize or complicate drug therapy. We have previously shown that methanol extracts of commonly consumed PNG medicinal plants are able to induce and/or inhibit human CYPs in vitro. In this current work plant succus was prepared from fresh plant leaves. Inhibition of three major CYPs was determined using human liver microsomes and enzyme-selective model substrates. Of 15 species tested, succus from 6/15 was found to inhibit CYP1A2, 7/15 inhibited CYP3A4, and 4/15 inhibited CYP2D6. Chi-squared tests determined differences in inhibitory activity between succus and methanol preparations. Over 80% agreement was found. Thus, fresh juice from PNG medicinal plants does exhibit the potential to complicate drug therapy in at risk populations. Further, the general reproducibility of these findings suggests that methanol extraction of dried material is a reasonable surrogate preparation method for fresh plant samples.
[Evidence-based medicine: modern scientific methods for determining usefulness].
Schmidt, J G
1999-01-01
For quite some time, clinical epidemiology has introduced the art of critical appraisal of evidence as well as the methods of how to design sound clinical studies and trials. Almost unnoticed by most medical institutions a new hierarchy of evidence has emerged which puts well thought out trials, able to document unbiased treatment benefit in terms of patient suffering, above pathophysiological theory. Many controlled trials have shown, in the meantime, that the control of laboratory or other kind of pathologies and the correction of anatomical abnormalities do not necessarily mean a benefit for the patient. Concepts relating to this dissection of evidence include: Surrogate fallacy ("cosmetics" of laboratory results or ligament or cartilage "cosmetics" in surgery), confounding (spurious causal relationships), selection bias (comparison with selected groups) as well as lead-time bias (mistaking earlier diagnosis as increase of survival), length bias (overlooking differences in the aggressiveness of diseases as determinants of disease stage distributions) and overdiagnosis bias (mistaking the increasing detection of clinically silent pathologies as improvement of prognosis). Moreover, absolute instead of relative risk reduction needs to be used to measure patient benefit. The incorporation of decision-analysis and of the concepts or clinical epidemiology will improve the efficiency and quality of medicine much more effectively than the sole focus on technical medical performance. Evidence based medicine is the systematic and critical appraisal of medical interventions, based on the understanding how to avoid the fallacies and biases mentioned.
DEFF Research Database (Denmark)
Aagaard, Jesper; Matthiesen, Noomi Christine Linde
2016-01-01
that researchers should start paying attention to the material world (consisting of both human bodies and material objects) and what it means for how people live their lives. It is argued that this can be done by incorporating the concept of material presence to capture embodied and material layers of existence......This article challenges the hegemonic status of “language” as the primary substance of qualitative research in psychology, whether through interviews or recordings of naturally occurring talk. It thereby questions the overt focus on analyzing linguistic “meaning.” Instead, it is suggested...... practical guidelines for incorporating attention to materiality in qualitative research....
Directory of Open Access Journals (Sweden)
Dorcas Osei-Safo
2018-01-01
Full Text Available A recently developed semiquantitative thin-layer chromatographic (SQ-TLC assay has been employed in postmarketing surveillance of antimalarial medicines used in Malawi prior to HPLC assay. Both methods gave analogous results in a significant majority of the samples, with a good correlation (r = 0.9012 for the active pharmaceutical ingredients of the dosage forms assayed. Artemether-containing medicines had the highest percentage (92.67% of samples with comparable results for both assays. The lowest percentage (66.67% was observed in artesunate-containing medicines. The SQ-TLC method was validated for specificity, accuracy, precision, linearity, and stability according to the International Conference on Harmonisation guidelines, with the results falling within acceptable limits. For specificity, retention factor values of the test samples and reference standards were comparable, while accuracy and precision of 91.1 ± 5.7% were obtained for all samples. The method was linear in the range 1.0–2.0 µg/spot with a correlation coefficient of r = 0.9783. Stability tests also fell within acceptable limits. In this study, we present the validation of the SQ-TLC method and propose its adoption as a rapid screening tool for field estimation of the quality of antimalarial and other essential medicines in Malawi and other parts of the developing world prior to a more accurate HPLC assay.
Textile materials for lightweight constructions technologies, methods, materials, properties
2016-01-01
In this book, experts on textile technologies convey both general and specific information on various aspects of textile engineering, ready-made technologies, and textile chemistry. They describe the entire process chain from fiber materials to various yarn constructions, 2D and 3D textile constructions, preforms, and interface layer design. In addition, the authors introduce testing methods, shaping and simulation techniques for the characterization of and structural mechanics calculations on anisotropic, pliable high-performance textiles, including specific examples from the fields of fiber plastic composites, textile concrete, and textile membranes. Readers will also be familiarized with the potential offered by increasingly popular textile structures, for instance in the fields of composite technology, construction technology, security technology, and membrane technology. Textile materials and semi-finished products have widely varied potential characteristics, and are commonly used as essential element...
Computerized statistical analysis with bootstrap method in nuclear medicine
International Nuclear Information System (INIS)
Zoccarato, O.; Sardina, M.; Zatta, G.; De Agostini, A.; Barbesti, S.; Mana, O.; Tarolo, G.L.
1988-01-01
Statistical analysis of data samples involves some hypothesis about the features of data themselves. The accuracy of these hypotheses can influence the results of statistical inference. Among the new methods of computer-aided statistical analysis, the bootstrap method appears to be one of the most powerful, thanks to its ability to reproduce many artificial samples starting from a single original sample and because it works without hypothesis about data distribution. The authors applied the bootstrap method to two typical situation of Nuclear Medicine Department. The determination of the normal range of serum ferritin, as assessed by radioimmunoassay and defined by the mean value ±2 standard deviations, starting from an experimental sample of small dimension, shows an unacceptable lower limit (ferritin plasmatic levels below zero). On the contrary, the results obtained by elaborating 5000 bootstrap samples gives ans interval of values (10.95 ng/ml - 72.87 ng/ml) corresponding to the normal ranges commonly reported. Moreover the authors applied the bootstrap method in evaluating the possible error associated with the correlation coefficient determined between left ventricular ejection fraction (LVEF) values obtained by first pass radionuclide angiocardiography with 99m Tc and 195m Au. The results obtained indicate a high degree of statistical correlation and give the range of r 2 values to be considered acceptable for this type of studies
Computers for use in nuclear medicine
International Nuclear Information System (INIS)
Surova, H.
1991-01-01
Brief information is presented on computers for nuclear medicine that are currently available on the market. The treatment is based on print material by various manufacturers and commercial organizations and on the publication ''Nuclear Medicine Computers - A Personal Comparison Chart'' of May 1991, issued by the Reilly Publishing Company. (Z.S.)
Development of a novel sports medicine rotation for emergency medicine residents.
Waterbrook, Anna L; Pritchard, T Gail; Lane, Allison D; Stoneking, Lisa R; Koch, Bryna; McAtee, Robert; Grall, Kristi H; Min, Alice A; Prior, Jessica; Farrell, Isaac; McNulty, Holly G; Stolz, Uwe
2016-01-01
Musculoskeletal complaints are the most common reason for patients to visit a physician, yet competency in musculoskeletal medicine is invariably reported as a deficiency in medical education in the USA. Sports medicine clinical rotations improve both medical students' and residents' musculoskeletal knowledge. Despite the importance of this knowledge, a standardized sports medicine curriculum in emergency medicine (EM) does not exist. Hence, we developed a novel sports medicine rotation for EM residents to improve their musculoskeletal educational experience and to improve their knowledge in musculoskeletal medicine by teaching the evaluation and management of many common musculoskeletal disorders and injuries that are encountered in the emergency department. The University of Arizona has two distinct EM residency programs, South Campus (SC) and University Campus (UC). The UC curriculum includes a traditional 4-week orthopedic rotation, which consistently rated poorly on evaluations by residents. Therefore, with the initiation of a new EM residency at SC, we replaced the standard orthopedic rotation with a novel sports medicine rotation for EM interns. This rotation includes attendance at sports medicine clinics with primary care and orthopedic sports medicine physicians, involvement in sport event coverage, assigned reading materials, didactic experiences, and an on-call schedule to assist with reductions in the emergency department. We analyzed postrotation surveys completed by residents, postrotation evaluations of the residents completed by primary care sports medicine faculty and orthopedic chief residents, as well as the total number of dislocation reductions performed by each graduating resident at both programs over the last 5 years. While all residents in both programs exceeded the ten dislocation reductions required for graduation, residents on the sports medicine rotation had a statistically significant higher rate of satisfaction of their educational
Eltorai, Adam E M; Han, Alex; Truntzer, Jeremy; Daniels, Alan H
2014-11-01
The recommended readability of patient education materials by the American Medical Association (AMA) and National Institutes of Health (NIH) should be no greater than a sixth-grade reading level. However, online resources may be too complex for some patients to understand, and poor health literacy predicts inferior health-related quality of life outcomes. This study evaluated whether the American Orthopaedic Society for Sports Medicine (AOSSM) website's patient education materials meet recommended readability guidelines for medical information. We hypothesized that the readability of these online materials would have a Flesch-Kincaid formula grade above the sixth grade. All 65 patient education entries of the AOSSM website were analyzed for grade level readability using the Flesch-Kincaid formula, a widely used and validated tool to evaluate the text reading level. The average (standard deviation) readability of all 65 articles was grade level 10.03 (1.44); 64 articles had a readability score above the sixth-grade level, which is the maximum level recommended by the AMA and NIH. Mean readability of the articles exceeded this level by 4.03 grade levels (95% CI, 3.7-4.4; P reading level of US adults. Mean readability of the articles exceeded this level by 2.03 grade levels (95% CI, 1.7-2.4; P online AOSSM patient education materials exceeds the readability level recommended by the AMA and NIH, and is above the average reading level of the majority of US adults. This online information may be of limited utility to most patients due to a lack of comprehension. Our study provides a clear example of the need to improve the readability of specific education material in order to maximize the efficacy of multimedia sources.
Heart Palpitation From Traditional and Modern Medicine Perspectives
Ershadifar, Tabassom; Minaiee, Bagher; Gharooni, Manouchehr; Isfahani, Mohammad Mahdi; Nikbakht Nasrabadi, Alireza; Nazem, Esmaiel; Gousheguir, Ashraf Aldin; Kazemi Saleh, Davod
2014-01-01
Background: Palpitation is a sign of a disease and is very common in general population. For this purpose we decided to explain it in this study. Objectives: The purpose of this study was to describe the palpitation in both modern and traditional medicine aspect. It may help us to diagnose and cure better because the traditional medicine view is holistic and different from modern medicine. Materials and Methods: We addressed some descriptions to the articles of traditional medicine subjects which have published recently. Palpitation in modern medicine was extracted from medical books such as Braunwald, Harrison and Guyton physiology and some related articles obtained from authentic journals in PubMed and Ovid and Google scholar between1990 to 2013. Results: According to modern medicine, there are many causes for palpitation and in some cases it is cured symptomatically. In traditional medicine view, palpitation has been explained completely and many causes have been described. Its aspect is holistic and it cures causatively. The traditional medicine scientists evaluated the body based on Humors and temperament. Temperament can be changed to dis-temperament in diseases. Humors are divided in 4 items: sanguine, humid or phlegm, melancholy and bile. Palpitation is a disease, it is heart vibration and is caused by an abnormal substance in the heart itself or its membrane or other adjacent organs that would result in the heart suffering. Conclusions: Our data of this article suggests that causes of palpitation in the aspect of traditional medicine are completely different from modern medicine. It can help us to approach and treat this symptom better and with lower side effects than chemical drugs. According to this article we are able to detect a new approach in palpitation. PMID:24719741
An improved electrokinetic method to consolidate porous materials
DEFF Research Database (Denmark)
Feijoo, Jorge; Ottosen, Lisbeth M.; Nóvoa, X. R.
2017-01-01
the consolidation using commercial products have some limitations, such as: (1) low penetrability; (2) no chemical and mineralogical affinity with the material to treat and (3) release of toxic compounds (VOCs), during the solvent evaporation. In the last years, a new consolidation method based on electrokinetic...... the pH of the solutions in contact with the porous material, which can damage it and (2) it is difficult to determine in which area the consolidation takes place. In this study an electrokinetic consolidation method, which has two steps between which the current is reversed, is proposed to solve all...... techniques was developed. This method allows filling some pores by the precipitation of an inorganic compound. As a result the method allows increasing the penetration depth of current consolidation treatments. However, this method needs to be improved since: (1) no special care is taking in controlling...
He, Fu-Yuan; Deng, Kai-Wen; Zeng, Jiao-Li; Dai, Ru-Wen; Dai, Ru-Wen; Xia, Zan-Shao; Liu, Weng-Long; Shi, Ji-Lian
2012-10-01
The qualitative and quantitative analysis on traditional Chinese medicine and formula components can be made by chemical and instrumental analysis methods. Of both, the instrumental analysis methods play a dominant role, including HPLC, HPLC-MS, HPLC-NMR, GC, GC-MS, biochemical and biological effect. But because traditional Chinese medicines and formula have complicated components, chemical methods are so unspecific that they shall be used less or with caution. While instrumental analysis methods are so specific that they are appropriate for analyzing complicated single component. The analysis techniques for multiple components of traditional Chinese medicines and formula focus on fingerprints, but all of these analysis techniques are limited by the pre-requisite of separation and the lack of general-purpose detectors and therefore being hard to realize the determination of all components of traditional Chinese medicines and formula. In the natural world, however, organisms identify native and alien components through specificity and non-specificity of clusters decided by antigens and antibodies. For example, components of traditional Chinese medicines are directly or indirectly synthesized into antigens and injected into animals, in order to generate specific antibodies and then collect cross reaction information of these components to specific antibodies. As for components without cross reaction, their contents shall be directly read out on the basis of the inhibition rate curve of competitive reaction for specificity of antigens and antibodies. Besides, a cross inhibition rate matrix shall be established first, and them a multiple regression linear equation between cross component concentration or concentration logarithm and inhibition rate by labeling the immunity competitive reaction between antibodies and haptens of traditional Chinese medicine and compound components, and then solved to obtain concentration of each component. The two results are combined to
A practical material decomposition method for x-ray dual spectral computed tomography.
Hu, Jingjing; Zhao, Xing
2016-03-17
X-ray dual spectral CT (DSCT) scans the measured object with two different x-ray spectra, and the acquired rawdata can be used to perform the material decomposition of the object. Direct calibration methods allow a faster material decomposition for DSCT and can be separated in two groups: image-based and rawdata-based. The image-based method is an approximative method, and beam hardening artifacts remain in the resulting material-selective images. The rawdata-based method generally obtains better image quality than the image-based method, but this method requires geometrically consistent rawdata. However, today's clinical dual energy CT scanners usually measure different rays for different energy spectra and acquire geometrically inconsistent rawdata sets, and thus cannot meet the requirement. This paper proposes a practical material decomposition method to perform rawdata-based material decomposition in the case of inconsistent measurement. This method first yields the desired consistent rawdata sets from the measured inconsistent rawdata sets, and then employs rawdata-based technique to perform material decomposition and reconstruct material-selective images. The proposed method was evaluated by use of simulated FORBILD thorax phantom rawdata and dental CT rawdata, and simulation results indicate that this method can produce highly quantitative DSCT images in the case of inconsistent DSCT measurements.
Artificial ligamentous joints:Methods, materials and characteristics
Hockings, Nick; Iravani, Pejman; Bowen, Chris
2014-01-01
This paper presents a novel method for making ligamentous articulations for robots. Ligamentous joints are widely found in animals, but they have been of limited appli- cation in robotics due to lack of analogous synthetic materials. The method presented combines 3D printing, tow laying and thermoplastic welding which enables manufacturing of this type of structure.
Links between nuclear medicine and radiopharmacy
International Nuclear Information System (INIS)
Pelegrin, M.; Francois-Joubert, A.; Chassel, M.L.; Desruet, M.D.; Bolot, C.; Lao, S.
2010-01-01
Radiopharmaceuticals are nowadays under the responsibility of the radio-pharmacist because of their medicinal product status. Radiopharmacy belongs to the hospital pharmacy department, nevertheless, interactions with nuclear medicine department are important: rooms are included or located near nuclear medicine departments in order to respect radiation protection rules, more over staff, a part of the material and some activities are shared between the two departments. Consequently, it seems essential to formalize links between the radiopharmacy and the nuclear medicine department, setting the goals to avoid conflicts and to ensure patients' security. Modalities chosen for this formalization will depend on the establishment's organization. (authors)
Van Hoten, Hendri; Gunawarman; Mulyadi, Ismet Hari; Kurniawan Mainil, Afdhal; Putra, Bismantoloa dan
2018-02-01
This research is about manufacture nanopowder Bioceramics from local materials used Ball Milling for biomedical applications. Source materials for the manufacture of medicines are plants, animal tissues, microbial structures and engineering biomaterial. The form of raw material medicines is a powder before mixed. In the case of medicines, research is to find sources of biomedical materials that will be in the nanoscale powders can be used as raw material for medicine. One of the biomedical materials that can be used as raw material for medicine is of the type of bioceramics is chicken eggshells. This research will develop methods for manufacture nanopowder material from chicken eggshells with Ball Milling using the Taguchi method and ANOVA. Eggshell milled using a variation of Milling rate on 150, 200 and 250 rpm, the time variation of 1, 2 and 3 hours and variations the grinding balls to eggshell powder weight ratio (BPR) 1: 6, 1: 8, 1: 10. Before milled with Ball Milling crushed eggshells in advance and calcinate to a temperature of 900°C. After the milled material characterization of the fine powder of eggshell using SEM to see its size. The result of this research is optimum parameter of Taguchi Design analysis that is 250 rpm milling rate, 3 hours milling time and BPR is 1: 6 with the average eggshell powder size is 1.305 μm. Milling speed, milling time and ball to powder weight of ratio have contribution successively equal to 60.82%, 30.76% and 6.64% by error equal to 1.78%.
Material-Point-Method Analysis of Collapsing Slopes
DEFF Research Database (Denmark)
Andersen, Søren; Andersen, Lars
2009-01-01
To understand the dynamic evolution of landslides and predict their physical extent, a computational model is required that is capable of analysing complex material behaviour as well as large strains and deformations. Here, a model is presented based on the so-called generalised-interpolation mat......To understand the dynamic evolution of landslides and predict their physical extent, a computational model is required that is capable of analysing complex material behaviour as well as large strains and deformations. Here, a model is presented based on the so-called generalised......, a deformed material description is introduced, based on time integration of the deformation gradient and utilising Gauss quadrature over the volume associated with each material point. The method has been implemented in a Fortran code and employed for the analysis of a landslide that took place during...
MIANN models in medicinal, physical and organic chemistry.
González-Díaz, Humberto; Arrasate, Sonia; Sotomayor, Nuria; Lete, Esther; Munteanu, Cristian R; Pazos, Alejandro; Besada-Porto, Lina; Ruso, Juan M
2013-01-01
Reducing costs in terms of time, animal sacrifice, and material resources with computational methods has become a promising goal in Medicinal, Biological, Physical and Organic Chemistry. There are many computational techniques that can be used in this sense. In any case, almost all these methods focus on few fundamental aspects including: type (1) methods to quantify the molecular structure, type (2) methods to link the structure with the biological activity, and others. In particular, MARCH-INSIDE (MI), acronym for Markov Chain Invariants for Networks Simulation and Design, is a well-known method for QSAR analysis useful in step (1). In addition, the bio-inspired Artificial-Intelligence (AI) algorithms called Artificial Neural Networks (ANNs) are among the most powerful type (2) methods. We can combine MI with ANNs in order to seek QSAR models, a strategy which is called herein MIANN (MI & ANN models). One of the first applications of the MIANN strategy was in the development of new QSAR models for drug discovery. MIANN strategy has been expanded to the QSAR study of proteins, protein-drug interactions, and protein-protein interaction networks. In this paper, we review for the first time many interesting aspects of the MIANN strategy including theoretical basis, implementation in web servers, and examples of applications in Medicinal and Biological chemistry. We also report new applications of the MIANN strategy in Medicinal chemistry and the first examples in Physical and Organic Chemistry, as well. In so doing, we developed new MIANN models for several self-assembly physicochemical properties of surfactants and large reaction networks in organic synthesis. In some of the new examples we also present experimental results which were not published up to date.
Methods for the continuous production of plastic scintillator materials
Bross, Alan; Pla-Dalmau, Anna; Mellott, Kerry
1999-10-19
Methods for producing plastic scintillating material employing either two major steps (tumble-mix) or a single major step (inline-coloring or inline-doping). Using the two step method, the polymer pellets are mixed with silicone oil, and the mixture is then tumble mixed with the dopants necessary to yield the proper response from the scintillator material. The mixture is then placed in a compounder and compounded in an inert gas atmosphere. The resultant scintillator material is then extruded and pelletized or formed. When only a single step is employed, the polymer pellets and dopants are metered into an inline-coloring extruding system. The mixture is then processed under a inert gas atmosphere, usually argon or nitrogen, to form plastic scintillator material in the form of either scintillator pellets, for subsequent processing, or as material in the direct formation of the final scintillator shape or form.
Evaluation of methods to compare consequences from hazardous materials transportation accidents
International Nuclear Information System (INIS)
Rhoads, R.E.; Franklin, A.L.; Lavender, J.C.
1986-10-01
This report presents the results of a project to develop a framework for making meaningful comparisons of the consequences from transportation accidents involving hazardous materials. The project was conducted in two phases. In Phase I, methods that could potentially be used to develop the consequence comparisons for hazardous material transportation accidents were identified and reviewed. Potential improvements were identified and an evaluation of the improved methods was performed. Based on this evaluation, several methods were selected for detailed evaluation in Phase II of the project. The methods selected were location-dependent scenarios, figure of merit and risk assessment. This evaluation included application of the methods to a sample problem which compares the consequences of four representative hazardous materials - chlorine, propane, spent nuclear fuel and class A explosives. These materials were selected because they represented a broad class of hazardous material properties and consequence mechanisms. The sample case aplication relied extensively on consequence calculations performed in previous transportation risk assessment studies. A consultant was employed to assist in developing consequence models for explosives. The results of the detailed evaluation of the three consequence comparison methods indicates that methods are available to perform technically defensible comparisons of the consequences from a wide variety of hazardous materials. Location-dependent scenario and risk assessment methods are available now and the figure of merit method could be developed with additional effort. All of the methods require substantial effort to implement. Methods that would require substantially less effort were identified in the preliminary evaluation, but questions of technical accuracy preclude their application on a scale. These methods may have application to specific cases, however
Piwowarska-Bilska, Hanna; Birkenfeld, Bożena; Gwardyś, Aleksandra; Supińska, Aleksandra; Listewnik, Maria H.; Elbl, Bogumiła; Cichoń-Bańkowska, Katarzyna
2011-01-01
Summary Background: This study assessed the radiation safety at Nuclear Medicine Department being a work environment. Ionizing radiation exposure of the employees in the last 19 years and the effects of legislative changes in radiological protection were analyzed. Material/Methods: All employees of the investigated department were regularly and individually monitored using chest badges equipped with Kodak film type 2. Overall, 629 annual doses of the employees of nuclear medicine department, ...
Research methods in complementary and alternative medicine: an integrative review.
de Almeida Andrade, Fabiana; Schlechta Portella, Caio Fabio
2018-01-01
The scientific literature presents a modest amount of evidence in the use of complementary and alternative medicine (CAM). On the other hand, in practice, relevant results are common. The debates among CAM practitioners about the quality and execution of scientific research are important. Therefore, the aim of this review is to gather, synthesize and describe the differentiated methodological models that encompass the complexity of therapeutic interventions. The process of bringing evidence-based medicine into clinical practice in CAM is essential for the growth and strengthening of complementary medicines worldwide. Copyright © 2017 Shanghai Changhai Hospital. Published by Elsevier B.V. All rights reserved.
Material-point Method Analysis of Bending in Elastic Beams
DEFF Research Database (Denmark)
Andersen, Søren Mikkel; Andersen, Lars
The aim of this paper is to test different types of spatial interpolation for the materialpoint method. The interpolations include quadratic elements and cubic splines. A brief introduction to the material-point method is given. Simple liner-elastic problems are tested, including the classical...... cantilevered beam problem. As shown in the paper, the use of negative shape functions is not consistent with the material-point method in its current form, necessitating other types of interpolation such as cubic splines in order to obtain smoother representations of field quantities. It is shown...
International Nuclear Information System (INIS)
Aguilar Blanco, Luis Alberto; Bertarioni Alfaro, Carol; Elizondo Vargas, David; Gutierrez Villareal, Raul E.; Quesada Silva, Fernando
2008-01-01
One of the main obstacles in the career of Imagenologia Diagnostica y Terapeutica of the Escuela de Tecnologias de Salud of the Universidad de Costa Rica has been access to bibliographic material of reference in Spanish. The topics most relevant of nuclear medicine of interest to imaging specialist and other disciplines as: medicine, physics, pharmacy and nursing, have been identified for the purpose of having a bibliographic body; experts have reviewed the selection in each subject. Topics of interest were identified and grouped into five specific teaching areas: 1. Radiation protection, 2. Quality Control of Nuclear Medicine Instruments, 3. Radiopharmacy, 4. Planar Nuclear Medicine, 5. Nuclear Medicine SPECT and PET. (author) [es
Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G
2017-07-19
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.
Radiology in veterinary medicine
International Nuclear Information System (INIS)
Hrusovsky, J.; Benes, J.
1985-01-01
A textbook is presented for pregraduate and postgraduate students of veterinary medicine, offering an extensive review of all aspects of radiology as applied in veterinary sciences. Based on findings published in the literature and the authors' own research, the textbook familiarizes the reader with the problems of nuclear physics, biological effects of ionizing radiation on animals, the principles of biological cycles of radionuclides in the atmosphere, the fundamentals of radiochemistry, dosimetry, radiometry and nuclear medicine. Radiation protection of animals, raw materials, feeds, foodstuff and water, and the questions of the aplications of ionizing radiation and of radionuclides in veterinary medicine are discussed in great detail. The publication is complemented with numerous photographs, figures and graphs. (L.O.)
Hydrogen storage materials and method of making by dry homogenation
Jensen, Craig M.; Zidan, Ragaiy A.
2002-01-01
Dry homogenized metal hydrides, in particular aluminum hydride compounds, as a material for reversible hydrogen storage is provided. The reversible hydrogen storage material comprises a dry homogenized material having transition metal catalytic sites on a metal aluminum hydride compound, or mixtures of metal aluminum hydride compounds. A method of making such reversible hydrogen storage materials by dry doping is also provided and comprises the steps of dry homogenizing metal hydrides by mechanical mixing, such as be crushing or ball milling a powder, of a metal aluminum hydride with a transition metal catalyst. In another aspect of the invention, a method of powering a vehicle apparatus with the reversible hydrogen storage material is provided.
Solid electrolyte material manufacturable by polymer processing methods
Singh, Mohit; Gur, Ilan; Eitouni, Hany Basam; Balsara, Nitash Pervez
2012-09-18
The present invention relates generally to electrolyte materials. According to an embodiment, the present invention provides for a solid polymer electrolyte material that is ionically conductive, mechanically robust, and can be formed into desirable shapes using conventional polymer processing methods. An exemplary polymer electrolyte material has an elastic modulus in excess of 1.times.10.sup.6 Pa at 90 degrees C. and is characterized by an ionic conductivity of at least 1.times.10.sup.-5 Scm-1 at 90 degrees C. An exemplary material can be characterized by a two domain or three domain material system. An exemplary material can include material components made of diblock polymers or triblock polymers. Many uses are contemplated for the solid polymer electrolyte materials. For example, the present invention can be applied to improve Li-based batteries by means of enabling higher energy density, better thermal and environmental stability, lower rates of self-discharge, enhanced safety, lower manufacturing costs, and novel form factors.
Tshibangu, P Tshisekedi; Kapepula, P Mutwale; Kapinga, M J Kabongo; Lupona, H Kabika; Ngombe, N Kabamba; Kalenda, Dibungi T; Jansen, O; Wauters, J N; Tits, M; Angenot, L; Rozet, E; Hubert, Ph; Marini, R D; Frédérich, M
2016-09-05
African populations use traditional medicines in their initial attempt to treat a range of diseases. Nevertheless, accurate knowledge of the composition of these drugs remains a challenge in terms of ensuring the health of population and in order to advance towards improved traditional medicines (ITMs). In this paper chromatographic methods were developed for qualitative and quantitative analyses of a per os antimalarial ITM containing Garcinia kola. The identified analytical markers were used to establish TLC and HPLC fingerprints. G. kola seeds were analysed by HPLC to confirm the identity of the extract used by the Congolese manufacturer in the ITM. The main compounds (GB1, GB2, GB-1a and Kolaflavanone) were isolated by preparative TLC and identified by UPLC-MS and NMR. For the quantification of the major compound GB1, a simple and rapid experimental design was applied to develop an LC method, and then its validation was demonstrated using the total error strategy with the accuracy profile as a decision tool. The accurate results were observed within 0.14-0.45mg/mL range of GB1 expressed as naringenin. The extracts used in several batches of the analysed oral solutions contained GB1 (expressed as naringenin) within 2.04-2.43%. Both the fingerprints and the validated LC-DAD were found suitable for the quality control of G. kola-based raw material and finished products, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.
Hussain, Sajjad; Murtaza, Ghulam; Mehmood, Ansar; Qureshi, Rizwana Aleem
2017-05-01
The aim of present was to document indigenous knowledge of medicinal plants traditionally used by inhabitants of Rawalakot Azad Kashmir and to screen selected medicinal plants for their antibacterial potential. Several field surveys were conducted to document indigenous knowledge of medicinal plants through interviews from local inhabitants during 2010-2013. During the study, 58 plant species, belonging to 37 families, were identified and their medicinal uses were recorded. Ethnobotanical data indicates that inhabitants of Rawalakot use medicinal plant mainly for the treatment of stomach, liver and sexual disorders. Usually fresh plant materials were used for medicinal preparations and administrated orally. Among all the species studied, three most frequently used medicinal plants Achillea millefolium, Berberis lycium and Zanthoxylum armatum were screened for their antibacterial potential by using disc diffusion method. The crude aqueous, petroleum ether and ethanolic extracts were found to be very active against selected bacterial strains. The present study contributes significantly to the medicinal plant knowledge and shows that medicinal plant knowledge is deteriorating among younger generations. Therefore, further research is needed to document indigenous knowledge, to find conservation status of medicinal plant species and to find antimicrobial compounds for more sophisticated usage of medicinal plants in future.
An ayurvedic formulation Sankat Mochan: A potent anthelmintic medicine
Directory of Open Access Journals (Sweden)
Khomendra Kumar Sarwa
2017-01-01
Full Text Available Aim and Object: Sankat Mochan is an ayurvedic formulation used in the urban and rural area of India. This polyherbal formulation is used for general stomach problems including abdominal cramping and diarrhea. The present investigation evaluated the anthelmintic activity of an aqueous solution of an ayurvedic medicine Sankat Mochan. Materials and Method: Various concentrations (1%, 5%, and 10% of medicine were used for anthelmintic activity on Pheretima posthuma. Piperazine citrate (10 mg/ml was used as a reference standard and distilled water as a control. Result and Conclusion: The result showed that the Sankat Mochan possess anthelmintic activity more potent than that of piperazine citrate. Thus, Sankat Mochan may be used as a potent anthelmintic agent against helminthiasis.
Functional dyspepsia: A new approach from traditional Persian medicine
Pasalar, Mehdi; Nimrouzi, Majid; Choopani, Rasool; Mosaddegh, Mahmoud; Kamalinejad, Mohammad; Mohagheghzadeh, Abdolali; Bagheri Lankarani, Kamran
2016-01-01
Objective: One of the most common global disorders is related to gastrointestinal system. Functional dyspepsia (FD) defined as upper abdominal pain and discomfort in the absence of organic ailments is a prevalent disease without any confirmed medication. The purpose of this study was to find gastric disorders which might be coincidental to FD based on traditional Persian medicine (TPM). Materials and Methods: We searched the main textbooks of TPM including Al-Havi (by Rhazes), Canon of medicine (by Avicenna), ZakhireKhawrazmshahi (by Ismail Jorjani), Moalijat-e Aghili and Makhzan Al-adviya (by Mohammad Hosein AghiliShirazi), and ExirAzam (by Hakim Azam Khan). Also, we searched Pubmed, Scopus, Science Direct, Medline, scientific information database (SID), Iranmedex and Google Scholar from 1980 to 1 August 2014 for dyspepsia, gastrointestinal disease, traditional Persian medicine, and gastric dystemperaments. Results: There is no equivalent term for FD in traditional Persian medicine although similar signs and symptoms are visible in terms like simple cold dystemperament of stomach, indigestion, and digestion debility in TPM sources. Some treatments mentioned in TPM have shown promising results in the current experimental tests. Conclusion: Finding these similarities in complementary and alternative medicine (CAM) textbooks may lead to discovering new remedies for this widespread disease. PMID:27222829
Functional dyspepsia: A new approach from traditional Persian medicine
Directory of Open Access Journals (Sweden)
Mehdi Pasalar
2016-03-01
Full Text Available Objective: One of the most common global disorders is related to gastrointestinal system. Functional dyspepsia (FD defined as upper abdominal pain and discomfort in the absence of organic ailments is a prevalent disease without any confirmed medication. The purpose of this study was to find gastric disorders which might be coincidental to FD based on traditional Persian medicine (TPM. Materials and Methods: We searched the main textbooks of TPM including Al-Havi (by Rhazes, Canon of medicine (by Avicenna, ZakhireKhawrazmshahi (by Ismail Jorjani, Moalijat-e Aghili and Makhzan Al-adviya (by Mohammad Hosein AghiliShirazi, and ExirAzam (by Hakim Azam Khan. Also, we searched Pubmed, Scopus, Science Direct, Medline, scientific information database (SID, Iranmedex and Google Scholar from 1980 to 1 August 2014 for dyspepsia, gastrointestinal disease, traditional Persian medicine, and gastric dystemperaments. Results: There is no equivalent term for FD in traditional Persian medicine although similar signs and symptoms are visible in terms like simple cold dystemperament of stomach, indigestion, and digestion debility in TPM sources. Some treatments mentioned in TPM have shown promising results in the current experimental tests. Conclusion: Finding these similarities in complementary and alternative medicine (CAM textbooks may lead to discovering new remedies for this widespread disease.
Large deformation analysis of adhesive by Eulerian method with new material model
International Nuclear Information System (INIS)
Maeda, K; Nishiguchi, K; Iwamoto, T; Okazawa, S
2010-01-01
The material model to describe large deformation of a pressure sensitive adhesive (PSA) is presented. A relationship between stress and strain of PSA includes viscoelasticity and rubber-elasticity. Therefore, we propose the material model for describing viscoelasticity and rubber-elasticity, and extend the presented material model to the rate form for three dimensional finite element analysis. After proposing the material model for PSA, we formulate the Eulerian method to simulate large deformation behavior. In the Eulerian calculation, the Piecewise Linear Interface Calculation (PLIC) method for capturing material surface is employed. By using PLIC method, we can impose dynamic and kinematic boundary conditions on captured material surface. The representative two computational examples are calculated to check validity of the present methods.
Ion beam treatment of polymers application aspects from medicine to space
Kondyurin, Alexey; McKenzie, David
2010-01-01
Polymer materials are used in different fields of industries, from microelectronice to medicine. Ion beam implantation is method of surface modification when surface properties must be significantly changed and bulk properties of material must be saved. Ion Beam Treatment of Polymers contains results of polymer investigations and techniques development in the field of polymer modification by high energy ion beams. This book is intended for specialists in polymer science who have interest to use an ion beam treatment for improvement of polymer properties, for specialists in physics who search
Application of neutron activation analysis method in leaves of Casearia obliqua medicinal plant
International Nuclear Information System (INIS)
Yamashita, Celina I.; Saiki, Mitiko; Sertie, Jaime A.A.
2005-01-01
The pharmacological properties of medicinal plants have been related to the presence of organic compounds, however elements are also known to have an important participation in the active compounds constitution process. In this study, instrumental neutron activation analysis (INAA) was applied to determine elements in leaves of Casearia obliqua medicinal plant collected at two different locations in the Atlantic Forest, Brazil, SP. Soil samples collected from where this plant was grown were also analyzed in order to verify if there is a correlation between the elements present in soils and plant leaves. Br, Ca, Cl, Co, Cr, Cs, Fe, K, La, Mn, Na, Rb, Sb, Sc and Zn were determined in C. obliqua leaves and the elements As, Ca, Ce, Eu, Fe, Hf, La, Lu, Nd, Rb, Sc, Sm, Tb, Th, U and Zn in soils. Soil samples collected from two different locations presented similar concentrations for most elements. Likewise, C. obliqua leaves collected from the two locations presented similar elemental contents. These results suggest that analysis of extracts from these leaf samples and the evaluation of their pharmacological activities should be carried out. Certified reference materials IAEA-Soil-7, USGS W-1, NIST 1573a Tomato Leaves and NIST 1515 Apple Leaves were analyzed and the quality of the obtained results was assured. (author)
Occupational medicine specialist referral triggers: Mixed-methods analysis of teleconsult cases.
Eaton, J L; Mohammad, A; Mohr, D C; Brustein, D J; Kirkhorn, S R
2017-12-30
Qualitative analyses can yield critical lessons for learning organizations in healthcare. Few studies have applied these techniques in the field of occupational and environmental medicine (OEM). To describe the characteristics of complex cases referred for OEM subspecialty evaluation and variation by referring provider's training. Using a mixed methods approach, we conducted a content analysis of clinical cases submitted to a national OEM teleconsult service. Consecutive cases entered between April 2014 and July 2015 were screened, coded and analysed. 108 cases were available for analysis. Local Veterans Health Administration (VHA) non-specialist providers entered a primary medical diagnosis in 96% of cases at the time of intake. OEM speciality physicians coded significant medical conditions based on free text comments. Coder inter-rater reliability was 84%. The most frequent medical diagnosis types associated with tertiary OEM referral by non-specialists were endocrine (19%), cardiovascular (18%) and mental health (16%). Concern for usage of controlled and/or sedating medications was cited in 1% of cases. Compared to referring non-specialists, OEM physicians were more likely to attribute case complexity to musculoskeletal (OR: 2.3, 1.68-3.14) or neurological (OR: 1.69, 1.28-2.24) conditions. Medication usage (OR: 2.2, 1.49-2.26) was more likely to be a source of clinical concern among referring providers. The findings highlight the range of triggers for OEM physician subspecialty referral in clinical practice with employee patients. The results of this study can be used to inform development of provider education, standardized clinical practice pathways, and quality review activities for occupational medicine practitioners. Published by Oxford University Press on behalf of The Society of Occupational Medicine 2017.
Konopka, Tomasz; Bolechała, Filip; Strona, Marcin; Kopacz, Paweł
2016-01-01
Aim of the study: To determine the circumstances which can be useful for offenders profiling in homicide cases with victim's body dismemberment. Material and methods: Study of all homicide cases with victim's corpse dismemberment examined in Krakow Department of Forensic Medicine over the last 50 years. Results: Within the past 50 years, a total number of 30 cases of homicides with dismembered bodies were examined in Krakow. 22 cases represent defensive mutilations performed by offender, 3 cases can be classified as offensive muti-lations and 3 cases represent aggressive mutilations - decapitation as a method of committing homicide. In this period the only 1 case of necrophilic mutilations was examined, when the body was dismembered without murder. In most cases the background of homicide was the family conflict, 6 was cause of mental illness of perpetrator and in 3 was sexual motive. Only in 3 cases (from 25 when the offender was known) perpetrator kill a stranger. In the other the offender belonged to the family or friends of the victim. In all cases where the perpetrator was determined, homicide and dismemberment was performed in his place of residence. The findings of the Police investigations indicate that in most cases homicides were not planned, occurred under the influence of emotion, only two have been previously scheduled. Conclusions: Homicides with corpses dismemberment usually are committed by offenders who is in close relationship with victim (family or friend). Dismemberment is almost always performed in the same place as murder - home of perpetrator. This type of homicide usually is not planned.
Paul, J T; Singh, A K; Dong, Z; Zhuang, H; Revard, B C; Rijal, B; Ashton, M; Linscheid, A; Blonsky, M; Gluhovic, D; Guo, J; Hennig, R G
2017-11-29
The discovery of two-dimensional (2D) materials comes at a time when computational methods are mature and can predict novel 2D materials, characterize their properties, and guide the design of 2D materials for applications. This article reviews the recent progress in computational approaches for 2D materials research. We discuss the computational techniques and provide an overview of the ongoing research in the field. We begin with an overview of known 2D materials, common computational methods, and available cyber infrastructures. We then move onto the discovery of novel 2D materials, discussing the stability criteria for 2D materials, computational methods for structure prediction, and interactions of monolayers with electrochemical and gaseous environments. Next, we describe the computational characterization of the 2D materials' electronic, optical, magnetic, and superconducting properties and the response of the properties under applied mechanical strain and electrical fields. From there, we move on to discuss the structure and properties of defects in 2D materials, and describe methods for 2D materials device simulations. We conclude by providing an outlook on the needs and challenges for future developments in the field of computational research for 2D materials.
International Nuclear Information System (INIS)
Liaparinos, Panagiotis; Kandarakis, Ioannis; Cavouras, Dionisis; Delis, Harry; Panayiotakis, George
2006-01-01
The aim of this study was to evaluate the effect of K-characteristic radiation on the performance of scintillator crystals incorporated in nuclear medicine detectors (LSO, BGO, GSO). K-characteristic radiation is produced within materials of at least one high atomic number element (e.g. Lu, Gd, Bi). This radiation may either be reabsorbed or it may escape the scintillator. In both cases the light emission efficiency of the scintillator may be affected resulting in either spatial or energy resolution degradation. A computational program, based on Monte Carlo methods, was developed in order to simulate the transport of K-characteristic radiation within the most commonly used scintillator materials. Crystal thickness was allowed to vary from 0.5 up to 15 mm. A monoenergetic pencil beam, with energy varying from 0.60 to 0.511 MeV was considered to fall on the center of the crystal surface. The dominant γ-ray interactions (elastic and inelastic scattering and photoelectric absorption) were taken into account in the simulation. Results showed that, depending on crystal thickness, incident photon energy and scintillator's intrinsic properties (L or K-fluorescence yield, effective atomic number and density), the scintillator's emission efficiency may be significantly reduced and affect spatial or energy resolution
Ignashov, A Yu; Deng, B; Kuzmin, I V; Slesarevskaya, M N
2018-03-01
In recent years, there has been an increasing interest in alternative (complementary) treatments of interstitial cystitis/bladder pain syndrome (IC/BPS). This is due both to the high incidence of IC/BPS and to a lack of effectiveness of conventional treatments. One of the directions of alternative therapies is a traditional Chinese medicine using a special diet, various animal and plant-derived medicines, breathing exercises and acupuncture. This review analyzes the accumulated experience in using traditional Chinese medicine in the treatment of patients with IC/BPS. The presented data indicate that these methods appear to be promising, since they are effective in a significant number of patients, lead to an improvement in their quality of life, are non-invasive and well tolerated. However, due to the lack of clinical studies, the efficacy of this treatment modalities needs to be confirmed.
System and Method for Monitoring Piezoelectric Material Performance
Moses, Robert W. (Inventor); Fox, Christopher L. (Inventor); Fox, Melanie L. (Inventor); Chattin, Richard L. (Inventor); Shams, Qamar A. (Inventor); Fox, Robert L. (Inventor)
2007-01-01
A system and method are provided for monitoring performance capacity of a piezoelectric material that may form part of an actuator or sensor device. A switch is used to selectively electrically couple an inductor to the piezoelectric material to form an inductor-capacitor circuit. Resonance is induced in the inductor-capacitor circuit when the switch is operated to create the circuit. The resonance of the inductor-capacitor circuit is monitored with the frequency of the resonance being indicative of performance capacity of the device's piezoelectric material.
Recovering method for high level radioactive material
International Nuclear Information System (INIS)
Fukui, Toshiki
1998-01-01
Offgas filters such as of nuclear fuel reprocessing facilities and waste control facilities are burnt, and the burnt ash is melted by heating, and then the molten ashes are brought into contact with a molten metal having a low boiling point to transfer the high level radioactive materials in the molten ash to the molten metal. Then, only the molten metal is evaporated and solidified by drying, and residual high level radioactive materials are recovered. According to this method, the high level radioactive materials in the molten ashes are transferred to the molten metal and separated by the difference of the distribution rate of the molten ash and the molten metal. Subsequently, the molten metal to which the high level radioactive materials are transferred is heated to a temperature higher than the boiling point so that only the molten metal is evaporated and dried to be removed, and residual high level radioactive materials are recovered easily. On the other hand, the molten ash from which the high level radioactive material is removed can be discarded as ordinary industrial wastes as they are. (T.M.)
Guo, Hong-Ling; Gu, Hao; Wang, Yun; Qiao, Yan-Jiang
2014-07-01
To establish a characterization system of traditional Chinese medicinal properties in line with modern scientific cognition regularity, in order to reveal properties of traditional Chinese medicines distributed along liver meridian and relations of effects of medicinal properties. By collecting data about traditional Chinese medicinal properties recorded in the Pharmacopoeia of the People's Republic of China (2005 Edition), literature and data about pharmacological effects of traditional Chinese medicines recorded in the Chinese Materia Medica, by using the method of association rules, the authors dug pharmacological effect rules corresponds to relevant medicinal property combinations, with the medicinal property combination of traditional Chinese medicines distributed along liver meridian as the target. It was found that either obvious different pharmacological effects or identical pharmacological characteristics existed in traditional Chinese medicines distributed along liver meridian. With the aim to explore the correlations between traditional Chinese medicine medicinal properties and pharmacological effects, the authors linked the traditional Chinese medicine theory with modern research achievements, in order to provide the ideas and methods for interpreting mechanisms of medicinal properties.
Method of sintering ceramic materials
Holcombe, Cressie E.; Dykes, Norman L.
1992-01-01
A method for sintering ceramic materials is described. A ceramic article is coated with layers of protective coatings such as boron nitride, graphite foil, and niobium. The coated ceramic article is embedded in a container containing refractory metal oxide granules and placed within a microwave oven. The ceramic article is heated by microwave energy to a temperature sufficient to sinter the ceramic article to form a densified ceramic article having a density equal to or greater than 90% of theoretical density.
46 CFR 50.20-30 - Alternative materials or methods of construction.
2010-10-01
... 46 Shipping 2 2010-10-01 2010-10-01 false Alternative materials or methods of construction. 50.20... ENGINEERING GENERAL PROVISIONS Plan Submittal and Approval § 50.20-30 Alternative materials or methods of construction. (a) When new or alternative procedures, designs, or methods of construction are submitted for...
ELECTROKINETIC DEVICE AND METHOD FOR CONSOLIDATING POROUS MATERIALS
DEFF Research Database (Denmark)
2017-01-01
The invention relates to a device and an associated electrokinetic method which allows the pores (superficial and deep) of a porous material to be filled, by forcing the precipitation therein of a product of low solubility in water by creating an electric field which will mobilise the cations...... and anions supplied by previously selected solutions. This method comprises two phases. In the first phase, the pores located at a specified distance from the surface of contact between the porous material and the anodic or cathodic compartment are plugged. In a second phase, the rest of the pores, mainly...... those which are on the surface level, are collapsed. As a result of the designed device and the plugging system contained therein, the porous material is not affected at any moment by chemical alteration processes caused by contact with extreme pH values. This device allows the treatment to be applied...
International Nuclear Information System (INIS)
2010-09-01
This book includes abstracts of the communications presented at the 5th International Conference on Materials Science and Condensed-Matter Physics and at the Symposium dedicated to the 100th anniversary of academician Boris Lazarenko, the prominent scientist and inventor, the first director of the Institute of Applied Physics of the Academy of Sciences of Moldova. The abstracts presented in the book cover a vast range of subjects, such as: advanced materials and fabrication processes; methods of crystal growth, post-growth technological processes, doping and implantation, fabrication of solid state structures; defect engineering, engineering of molecular assembly; methods of nanostructures and nano materials fabrication and characterization; quantum wells and superlattices; nano composite, nanowires and nano dots; fullerenes and nano tubes, molecular materials, meso- and nano electronics; methods of material and structure characterization; structure and mechanical characterization; optical, electrical, magnetic and superconductor properties, transport processes, nonlinear phenomena, size and interface effects; advances in condensed matter theory; theory of low dimensional systems; modelling of materials and structure properties; development of theoretical methods of solid-state characterization; phase transition; advanced quantum physics for nano systems; device modelling and simulation, device structures and elements; micro- and optoelectronics; photonics; microsensors and micro electro-mechanical systems; microsystems; degradation and reliability, solid-state device design; theory and advanced technologies of electro-physico-chemical and combined methods of materials machining and treatment, including modification of surfaces; theory and advanced technologies of using electric fields, currents and discharges so as to intensify heat mass-transfer, to raise the efficiency of treatment of materials, of biological preparations and foodstuff; modern equipment for
Rollins, Harry W [Idaho Falls, ID; Petkovic, Lucia M [Idaho Falls, ID; Ginosar, Daniel M [Idaho Falls, ID
2011-02-01
Catalytic structures include a catalytic material disposed within a zeolite material. The catalytic material may be capable of catalyzing a formation of methanol from carbon monoxide and/or carbon dioxide, and the zeolite material may be capable of catalyzing a formation of hydrocarbon molecules from methanol. The catalytic material may include copper and zinc oxide. The zeolite material may include a first plurality of pores substantially defined by a crystal structure of the zeolite material and a second plurality of pores dispersed throughout the zeolite material. Systems for synthesizing hydrocarbon molecules also include catalytic structures. Methods for synthesizing hydrocarbon molecules include contacting hydrogen and at least one of carbon monoxide and carbon dioxide with such catalytic structures. Catalytic structures are fabricated by forming a zeolite material at least partially around a template structure, removing the template structure, and introducing a catalytic material into the zeolite material.
Directory of Open Access Journals (Sweden)
Ilaria Iaconeta
2017-09-01
Full Text Available The simulation of large deformation problems, involving complex history-dependent constitutive laws, is of paramount importance in several engineering fields. Particular attention has to be paid to the choice of a suitable numerical technique such that reliable results can be obtained. In this paper, a Material Point Method (MPM and a Galerkin Meshfree Method (GMM are presented and verified against classical benchmarks in solid mechanics. The aim is to demonstrate the good behavior of the methods in the simulation of cohesive-frictional materials, both in static and dynamic regimes and in problems dealing with large deformations. The vast majority of MPM techniques in the literatrue are based on some sort of explicit time integration. The techniques proposed in the current work, on the contrary, are based on implicit approaches, which can also be easily adapted to the simulation of static cases. The two methods are presented so as to highlight the similarities to rather than the differences from “standard” Updated Lagrangian (UL approaches commonly employed by the Finite Elements (FE community. Although both methods are able to give a good prediction, it is observed that, under very large deformation of the medium, GMM lacks robustness due to its meshfree natrue, which makes the definition of the meshless shape functions more difficult and expensive than in MPM. On the other hand, the mesh-based MPM is demonstrated to be more robust and reliable for extremely large deformation cases.
Array-based techniques for fingerprinting medicinal herbs
Directory of Open Access Journals (Sweden)
Xue Charlie
2011-05-01
Full Text Available Abstract Poor quality control of medicinal herbs has led to instances of toxicity, poisoning and even deaths. The fundamental step in quality control of herbal medicine is accurate identification of herbs. Array-based techniques have recently been adapted to authenticate or identify herbal plants. This article reviews the current array-based techniques, eg oligonucleotides microarrays, gene-based probe microarrays, Suppression Subtractive Hybridization (SSH-based arrays, Diversity Array Technology (DArT and Subtracted Diversity Array (SDA. We further compare these techniques according to important parameters such as markers, polymorphism rates, restriction enzymes and sample type. The applicability of the array-based methods for fingerprinting depends on the availability of genomics and genetics of the species to be fingerprinted. For the species with few genome sequence information but high polymorphism rates, SDA techniques are particularly recommended because they require less labour and lower material cost.
Social medicine then and now: lessons from Latin America.
Waitzkin, H; Iriart, C; Estrada, A; Lamadrid, S
2001-10-01
The accomplishments of Latin American social medicine remain little known in the English-speaking world. In Latin America, social medicine differs from public health in its definitions of populations and social institutions, its dialectic vision of "health-illness," and its stance on causal inference. A "golden age" occurred during the 1930s, when Salvador Allende, a pathologist and future president of Chile, played a key role. Later influences included the Cuban revolution, the failed peaceful transition to socialism in Chile, the Nicaraguan revolution, liberation theology, and empowerment strategies in education. Most of the leaders of Latin American social medicine have experienced political repression, partly because they have tried to combine theory and political practice--a combination known as "praxis." Theoretic debates in social medicine take their bearings from historical materialism and recent trends in European philosophy. Methodologically, differing historical, quantitative, and qualitative approaches aim to avoid perceived problems of positivism and reductionism in traditional public health and clinical methods. Key themes emphasize the effects of broad social policies on health and health care; the social determinants of illness and death; the relationships between work, reproduction, and the environment; and the impact of violence and trauma.
2014-01-01
Background During their reproductive years about 10% of women experience some kind of symptoms before menstruation (PMS) in a degree that affects their quality of life (QOL). Acupuncture and herbal medicine has been a recent favorable therapeutic approach. Thus we aimed to review the effects of acupuncture and herbal medicine in the past decade as a preceding research in order to further investigate the most effective Korean Medicine treatment for PMS/PMDD. Methods A systematic literature search was conducted using electronic databases on studies published between 2002 and 2012. Our review included randomized controlled clinical trials (RCTs) of acupuncture and herbal medicine for PMS/PMDD. Interventions include acupuncture or herbal medicine. Clinical information including statistical tests was extracted from the articles and summarized in tabular form or in the text. Study outcomes were presented as the rate of improvement (%) and/or end-of-treatment scores. Results The search yielded 19 studies. In screening the RCTs, 8 studies in acupuncture and 11 studies in herbal medicine that matched the criteria were identified. Different acupuncture techniques including traditional acupuncture, hand acupuncture and moxibustion, and traditional acupuncture technique with auricular points, have been selected for analysis. In herbal medicine, studies on Vitex Agnus castus, Hypericum perforatum, Xiao yao san, Elsholtzia splendens, Cirsium japonicum, and Gingko biloba L. were identified. Experimental groups with Acupuncture and herbal medicine treatment (all herbal medicine except Cirsium japonicum) had significantly improved results regarding PMS/PMDD. Conclusions Limited evidence supports the efficacy of alternative medicinal interventions such as acupuncture and herbal medicine in controlling premenstrual syndrome and premenstrual dysphoric disorder. Acupuncture and herbal medicine treatments for premenstrual syndrome and premenstrual dysphoric disorder showed a 50% or
Retief, F P; Cilliers, L
2007-01-01
Although the Mesopotamian civilisation is as old as that of Egypt and might even have predated it, we know much less about Mesopotamian medicine, mainly because the cuneiform source material is less well researched. Medical healers existed from the middle of the 3rd millennium. In line with the strong theocratic state culture, healers were closely integrated with the powerful priestly fraternity, and were essentially of three main kinds: barû (seers) who were experts in divination, âshipu (exorcists), and asû (healing priests) who tended directly to the sick. All illness was accepted as sent by gods, demons and other evil spirits, either as retribution for sins or as malevolent visitations. Treatment revolved around identification of the offending supernatural power, appeasement of the angry gods, for example by offering amulets or incantations, exorcism of evil spirits, as well as a measure of empirical therapy aimed against certain recognised symptom complexes. Medical practice was rigidly codified, starting with Hammurabi's Code in the 18th century BC and persisting to the late 1st millennium BC. Works like the so-called Diagnostic Handbook, the Assyrian Herbal and Prescription Texts describe the rationale of Mesopotamian medicine, based predominantly on supernatural concepts, although rudimentary traces of empirical medicine are discernible. There is evidence that Egyptian medicine might have been influenced by Mesopotamian practices, but Greek rational medicine as it evolved in the 5th/4th centuries BC almost certainly had no significant Mesopotamian roots.
Attributes identification of nuclear material by non-destructive radiation measurement methods
International Nuclear Information System (INIS)
Gan Lin
2002-01-01
Full text: The nuclear materials should be controlled under the regulation of National Safeguard System. The non-destructive analysis method, which is simple and quick, provide a effective process in determining the nuclear materials, nuclear scraps and wastes. The method play a very important role in the fields of nuclear material control and physical protection against the illegal removal and smuggling of nuclear material. The application of non-destructive analysis in attributes identification of nuclear material is briefly described in this paper. The attributes determined by radioactive detection technique are useful tolls to identify the characterization of special nuclear material (isotopic composition, enrichment etc.). (author)
Eloff, J N; Ntloedibe, D T; van Brummelen, R
2011-01-01
Three of the factors limiting the rational use of herbal medicine are uncertainty on effectivity, uncertainty on safety and variation in quality of the product. Because many herbal medicines have been used over centuries by indigenous peoples, the safety and effectivity is frequently not such a big concern. With more people collecting and distributing herbal medicine, the offered product is however, frequently not what the label indicates either through a genuine mistake, but also through fraud especially where expensive herbal medicine is concerned. Some wrong identifications have already led to serious side effects and deaths. Planar chromatography or thin layer chromatography [TLC] is widely used to verify the identity of plant extracts by determining the chemical fingerprint of the extracts. In a leading publication 17 different extractants, 41 solvent systems and 44 spray reagents have been used to verify the identity of important herbal preparations. We investigated whether a simplified system could not be developed to aid small laboratories in identifying different herbal medicines. We compared the efficacy of different extractants, identified and developed three TLC solvent systems that would separate compounds with low, medium and high polarity and then also investigated the use of several spray reagents. With acetone as extractant and benzene:ethanol:ammonia [9:1:0.1], chloroform:ethylacetate:formic acid [5:4:1] and ethylacetate:methanol:water [10:1.35:1] as TLC solvent system and vanillin-sulphuric acid as spray reagent the identity of 81 samples of more than 50 herbal preparations could be verified on the basis of the chromatograms. The same product from different suppliers usually gave similar chromatograms. More importantly in several cases it was clear that products with the same label were so different that a mistake must have occurred in the labelling. This method has found application in the quality control of the most important African medicinal
Standard Test Method for Contamination Outgassing Characteristics of Spacecraft Materials
American Society for Testing and Materials. Philadelphia
2009-01-01
1.1 This test method covers a technique for generating data to characterize the kinetics of the release of outgassing products from materials. This technique will determine both the total mass flux evolved by a material when exposed to a vacuum environment and the deposition of this flux on surfaces held at various specified temperatures. 1.2 This test method describes the test apparatus and related operating procedures for evaluating the total mass flux that is evolved from a material being subjected to temperatures that are between 298 and 398 K. Pressures external to the sample effusion cell are less than 7 × 10−3 Pa (5 × 10−5 torr). Deposition rates are measured during material outgassing tests. A test procedure for collecting data and a test method for processing and presenting the collected data are included. 1.3 This test method can be used to produce the data necessary to support mathematical models used for the prediction of molecular contaminant generation, migration, and deposition. 1.4 Al...
Method of tissue repair using a composite material
Energy Technology Data Exchange (ETDEWEB)
Hutchens, Stacy A.; Woodward, Jonathan; Evans, Barbara R.; O' Neill, Hugh M.
2016-03-01
A composite biocompatible hydrogel material includes a porous polymer matrix, the polymer matrix including a plurality of pores and providing a Young's modulus of at least 10 GPa. A calcium comprising salt is disposed in at least some of the pores. The porous polymer matrix can comprise cellulose, including bacterial cellulose. The composite can be used as a bone graft material. A method of tissue repair within the body of animals includes the steps of providing a composite biocompatible hydrogel material including a porous polymer matrix, the polymer matrix including a plurality of pores and providing a Young's modulus of at least 10 GPa, and inserting the hydrogel material into cartilage or bone tissue of an animal, wherein the hydrogel material supports cell colonization in vitro for autologous cell seeding.
Method of tissue repair using a composite material
Hutchens, Stacy A; Woodward, Jonathan; Evans, Barbara R; O'Neill, Hugh M
2014-03-18
A composite biocompatible hydrogel material includes a porous polymer matrix, the polymer matrix including a plurality of pores and providing a Young's modulus of at least 10 GPa. A calcium comprising salt is disposed in at least some of the pores. The porous polymer matrix can comprise cellulose, including bacterial cellulose. The composite can be used as a bone graft material. A method of tissue repair within the body of animals includes the steps of providing a composite biocompatible hydrogel material including a porous polymer matrix, the polymer matrix including a plurality of pores and providing a Young's modulus of at least 10 GPa, and inserting the hydrogel material into cartilage or bone tissue of an animal, wherein the hydrogel material supports cell colonization in vitro for autologous cell seeding.
Directory of Open Access Journals (Sweden)
Yang Dong
2013-01-01
Full Text Available Objective. To investigate the correlation between presbycusis and kidney deficiency as defined by traditional Chinese medicine (TCM and its material basis from the perspective of metabolism. Methods. Pure-tone audiometry was used to test auditory function. A kidney deficiency symptom scoring table was used to measure the kidney deficiency accumulated scores of the research subjects. Gas chromatography/mass spectrometry (GC/MS was used to measure the metabolites in the urine samples from 11 presbycusis patients and 9 elderly people with normal hearing. Results. Hearing loss in the elderly was positively correlated with kidney deficiency score in TCM. There were significant differences in urine metabolite profile between the presbycusis patients and the controls. A total of 23 differentially expressed metabolites were found. Kyoto Encyclopedia of Genes and Genomes (KEGG pathway analysis showed that these metabolites were related to glutathione metabolism, amino acid metabolism, glucose metabolism, the N-methyl-D-aspartic acid (NMDA receptor pathway, and the γ-aminobutyric acid (GABA receptor pathway. Conclusion. Glutathione metabolism, amino acid metabolism, glucose metabolism, NMDA receptors, and GABA receptors may be related to the pathogenesis of presbycusis and may be the material basis underlying the correlation between presbycusis and kidney deficiency in TCM.
Dong, Yang; Liu, Pu-Zhao; Song, Hai-Yan; Zhao, Yu-Ping; Li, Ming; Shi, Jian-Rong
2013-01-01
Objective. To investigate the correlation between presbycusis and kidney deficiency as defined by traditional Chinese medicine (TCM) and its material basis from the perspective of metabolism. Methods. Pure-tone audiometry was used to test auditory function. A kidney deficiency symptom scoring table was used to measure the kidney deficiency accumulated scores of the research subjects. Gas chromatography/mass spectrometry (GC/MS) was used to measure the metabolites in the urine samples from 11 presbycusis patients and 9 elderly people with normal hearing. Results. Hearing loss in the elderly was positively correlated with kidney deficiency score in TCM. There were significant differences in urine metabolite profile between the presbycusis patients and the controls. A total of 23 differentially expressed metabolites were found. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis showed that these metabolites were related to glutathione metabolism, amino acid metabolism, glucose metabolism, the N-methyl-D-aspartic acid (NMDA) receptor pathway, and the γ-aminobutyric acid (GABA) receptor pathway. Conclusion. Glutathione metabolism, amino acid metabolism, glucose metabolism, NMDA receptors, and GABA receptors may be related to the pathogenesis of presbycusis and may be the material basis underlying the correlation between presbycusis and kidney deficiency in TCM. PMID:24371466
Directory of Open Access Journals (Sweden)
Rabbani Khorasgani Mohammad
2015-07-01
Full Text Available Dental caries is a multi-factorial disease and the most common human infection that annually are spent millions dollars to control and treat it. Several methods have been proposed so far to control it. The most important control methods it is now include : dental hygiene, proper nutrition , fluoride therapy , the use of non- cariogenic sweeteners . Also, the use of probiotics , nanomaterials , bacteriophages , antimicrobial peptides and anti- caries vaccines can be considered as new perspective of human in the dental caries control field. In addition, the use of complementary and alternative therapies , especially herbal drug therapy recently has been considered . Demonstrating the efficacy of complementary medicine against dental caries and its use in combination with conventional medicine or trial of new methods for decline of dental caries in the future would be hopeful.
Directory of Open Access Journals (Sweden)
Kanika Patel
2017-07-01
Full Text Available Herbal medicines have been played an important role in the human civilization since very ancient time as a food, cloth, medicine and other aspects. Some of the important drugs in the modern medicine were derived from the natural sources such as aspirin, digitalis, quinine, vincristine, vinblastine etc. Hispidulin (4′, 5, 7-trihydroxy-6-methoxyflavone is a flavones derivative found in plant such as Grindelia argentina, Arrabidaea chica, Saussurea involucrate, Crossostephium chinense, Artemisia and Salvia species. Hispidulin have antioxidant, antifungal, anti-inflammatory, antimutagenic, and antineoplastic properties. So far, various analytical methods have been investigated and developed for detection of hispidulin in the plant materials. Productions of hispidulin through different tissue culture techniques have been also investigated. Present review summarized medicinal uses, pharmacological activities and analytical aspects of hispidulin. From the above mentioned aspects, we can conclude that, this review will be helpful to the researcher in the field of natural product for the development of novel molecule for the treatment of different disorders.
Physics and radiobiology of nuclear medicine
Saha, Gopal B
2010-01-01
From a distinguished author comes this new edition for technologists, practitioners, residents, and students in radiology and nuclear medicine. Encompassing major topics in nuclear medicine from the basic physics of radioactive decay to instrumentation and radiobiology, it is an ideal review for Board and Registry examinations. The material is well organized and written with clarity. The book is supplemented with tables and illustrations throughout. It provides a quick reference book that is concise but comprehensive, and offers a complete discussion of topics for the nuclear medicine and radi
He, Fu-yuan; Deng, Kai-wen; Yang, Yan-tao; Zhou, Yi-qun; Shi, Ji-lian; Liu, Wen-long; Tang, Yu
2015-04-01
In this paper, based on the special influence of supramolecular chemistry on the basic theory of Chinese medicines ( CM) , the authors further analyzed the history of meridian tropism and natural origins of CM organisms and explained CM ingredients and the universal regularity of the automatic action of the supramolecular "imprinting templates" hole channel structure. After entering human bodies, CMs, as the aggregation of supramolecular "imprinting templates" , automatically seek supramolecular subjects that are matched with their "imprinting templates" in human meridians and organs for the purpose of self-recognition, self-organization, self-assembly and self-replication, so as to generate specific efficacy in meridians and organs, which is reflected as the meridian tropism phenomena at macro level. This regularity can be studied by in vitro and in vivo experimental studies. In vitro methods are mostly supra molecular structure analysis and kinetic and thermodynamic parameter calculation; Whereas in vivo methods are dominated by the analysis on object component distribution, chromatopharmacodynamic parameters and network chromatopharmacodynamic parameters; Particularly, the acupoint-medicine method can simplify to study the supramolecular subject-object relations. Consequently, CM's'meridian tropism reveals the universal regularity for interactions of macromolecular and micromolecular "imprinting templates" of subjects and objects in natural organisms. As the first barrier for the material base of the CM theory and breakthrough in the modernization of the basic CM theory, meridian tropism plays an important role in studies on basic theories of the basic CM theory.
medicinal plant use of villagers in the mopani district, limpopo ...
African Journals Online (AJOL)
Alinah Chauke
These studies may guide the regulation of herbal medicine industry in South. Africa. Key words: Ethnobotanical, Medicinal plants, Mashishimale village. Introduction. Reviews of literature involving research of medicinal plants suggest that scientists follow more or less the same general strategy to investigate plant materials ...
A multi points ultrasonic detection method for material flow of belt conveyor
Zhang, Li; He, Rongjun
2018-03-01
For big detection error of single point ultrasonic ranging technology used in material flow detection of belt conveyor when coal distributes unevenly or is large, a material flow detection method of belt conveyor is designed based on multi points ultrasonic counter ranging technology. The method can calculate approximate sectional area of material by locating multi points on surfaces of material and belt, in order to get material flow according to running speed of belt conveyor. The test results show that the method has smaller detection error than single point ultrasonic ranging technology under the condition of big coal with uneven distribution.
Method of treatment in a system passing radioactive material
Energy Technology Data Exchange (ETDEWEB)
Kamiya, K; Kinoshita, M; Asakura, Y
1976-05-14
A method to ensure the safety of the reactor and reduce radiation exposure dose by preventing oxygen hydrogen reaction of the reactor off-gas and accumulation of the radioactive material is described. Substances which are accumulated in an off-gas duct and are likely to capture radioactive material (for instance Pd catalyst falling from a recombiner) is changed into a stable material (for instance, PdI/sub 2/) which is hot likely to capture radioactive material through reaction with a stabilizer (for instance, I/sub 2/, Cl/sub 2/, HCl, etc.). This stabilized material is washed off the atomic power plant system.
Discriminant method for the optimization of radionuclide activity in studies of nuclear medicine
International Nuclear Information System (INIS)
Perez Diaz, Marlen
2003-01-01
It is presented a method for the optimization of the radionuclidic activity to administer to mature patients in studies of Nuclear Medicine. The method is based in technical of discriminant analysis to build a function that discriminates groups with image quality differed on the base of physical parameters as they are the contrast image and the aleatory noise. The image quality is the dependent variable and it is selected by means of experts' evaluation and technical of clustering. The function is a lineal combination of a reduced group of variables physical-medical, able to discriminate the groups starting from a big group of variables measures. The method allows, also, to establish the relative weight of each discriminant variable selected . The behavior of the same ones is analyzed among studies carried out with different administered activity, with the objective of determining the minimum value of this that still allows good results in the image quality (Approach of activity optimization). It is validated the method by means of results comparison with the grateful Curved ROC in studies carried out with the Mannequins of Jaszczak (for planar studies) and of Insert Heart (for studies of SPECT). The optim activity value of the 99mTc, obtained with the application of the method, was coincident with the one obtained after the application of the method ROC to 6 expert observers as much in planar studies as in SPECT for two different cameras gamma. The method was applied later on in static, dynamic studies and of SPECT carried out with camera gamma to a mature population of 210 patient. The decisive variables of the quality of the image were obtained in the nuclear venticulography in rest, the bony gammagraphy, the nuclear renogram, the renal gammagraphy and the cerebral SPECT, as well as some activity values optimized for the equipment conditions and available radiopharmac in the country, allowing to establish a better commitment relationship between image quality
Determination of crystallinity of ceramic materials from the Ruland Method
International Nuclear Information System (INIS)
Kniess, C.T.; Prates, P.B.; Gomes Junior, J.C.; Lima, J.C. de; Riella, H.G.; Kuhnen, N.C.
2011-01-01
Some methods found in literature approach the different characteristics between crystalline and amorphous phases by X ray diffraction technique. These methods use the relation between the intensities of the crystalline peaks and background amorphous or the absolute intensity of one of these to determine the relative amount of crystalline and amorphous material. However, a crystalline substance presents shows coherent diffuse scattering and a loss in the intensity of the peaks of diffraction in function of thermal vibrations of atoms and imperfections in the crystalline structure. A correct method for the determination of the crystallinity must take in account these effects. This work has as objective to determine the crystallinity of ceramic materials obtained with the addition of mineral coal bottom ashes, using the X ray diffraction technique and the Ruland Method, that considers the diminution of the intensity of the crystalline peak because of the disorder affects. The Ruland Method shows adequate for the determination of the crystallinity of the ceramic materials. (author)
Use of Thermoanalytic Methods in the Evaluation of Combusted Materials
Directory of Open Access Journals (Sweden)
František Krepelka
2006-12-01
Full Text Available The paper describes possibilities of using thermoanalytic methods for the evaluation and comparison of materials designed for a direct combustion. Differential thermal analysis (DTA and thermogravimetric analysis (TGA were both used in the evaluation. The paper includes a description of methods of data processing from analyses for the purposes of comparison of used materials regarding their heating values. The following materials were analysed in the experiments: wooden coal of objectional grain size, fly ash from heating plant exhaust funnels, dendromass waste: spruce sawdust, micro-briquettes of spruce sawdust and fly-ash combined.
[Materials/Biomaterials in Clinical Practice - a Short Review and Current Trends].
Bolle, T; Meyer, F; Walcher, F; Lohmann, C; Jockenhövel, S; Gries, T; Hoffmann, W
2017-04-01
Biomaterials play a major role in interventional medicine and surgery. However, the development of biomaterials is still in its early phases in spite of the huge progress made within the last decades. On the one hand, this is because our knowledge of the molecular and cellular processes associated with biomaterials is still increasing exponentially. On the other hand, a wide variety of advanced materials with highly interesting properties is being developed currently. This review provides a short introduction into the variety of materials in use as well as their application in interventional medicine and surgery. Also the importance of biomaterials for tissue engineering in the field of regenerative medicine and the functionalisation of biomaterials, including sterilisation methods are discussed. For the future, an even broader interdisciplinary scientific collaboration is necessary in order to develop novel biomaterials and facilitate their translation into clinical practice. Georg Thieme Verlag KG Stuttgart · New York.
International Nuclear Information System (INIS)
Reichelt, H.G.
1980-01-01
Nuclear medicine as a complex diagnostical method is used mainly to detect functional organic disorders, to locate disorders and for radioimmunologic assays (RIA) in vitro. In surgery, its indication range comprises the thyroid (in vivo and in vitro), liver and bile ducts, skeletal and joint diseases, disorders of the cerebro-spinal liquor system and the urologic disorders. In the early detection of tumors, the search for metastases and tumor after-care, scintiscanning and the tumor marcher method (CEA) can be of great practical advantage, but the value of myocardial sciritiscanning in cardiac respectively coronary disorders is restricted. The paper is also concerned with the radiation doses in nuclear medicine. (orig.) [de
Li, Yan-Nian; Wu, Zhen-Feng; Wan, Na; Li, Yuan-Hui; Li, Hui-Ting; Yang, Ming
2018-04-01
The compressibility of tablets is the essential operating unit during the preparation of traditional Chinese medicine tablets, as well as a complicated process. Therefore, it is of great significance to comprehensively study the influencing factors on the formation process. This paper aimed to review the evaluation methods for the tablet forming quality and highlight the effects of material powder properties, excipients and preparation technology on the quality of traditional Chinese medicine tablets on the basis of relevant literatures. Furthermore, the common problems in tablet forming process are also analyzed to provide useful references for the development of tablet forming quality of traditional Chinese medicines. Copyright© by the Chinese Pharmaceutical Association.
Method for evaluating leaching from LSA-III material
International Nuclear Information System (INIS)
Abe, H.; Satoh, K.; Ozaki, S.; Watabe, N.; Iida, T.; Akamatsu, H.
1989-01-01
The IAEA transport regulations are scheduled to be introduced in Japan. New regulations are supposed to be set forth for low specific activity (LSA) material and industrial packaging (IP) as solidified concentrated waste water should correspond to the LSA material. Solidified concentrated waste water should be transported in accordance with the new transport regulations which reflect the IAEA transport regulations. As one of the regulations for LSA material, the leaching test for LSA-III materials states that the radioactive loss due to leaching without the packaging should not exceed 0.1 A 2 when left in the water for 7 days. This test method is called Transport regulations hereafter. Since the test had not been conducted in Japan before now, there was no available data. Consequently, it is necessary to make an assessment on whether the current solidified concentrated waste water can satisfy the leaching amount of radioactive nuclide specified in the IAEA transport regulations. If the test is performed in accordance with the IAEA transport regulations, however, it is necessary to measure the amount of radioactive nuclide actually leached from the solidified concentrated waste water. Since the solidified concentrated waste water is put in a drum cam, it is necessary to prepare large-scale hot test equipment. In this study, therefore, the leaching test was conducted on the solidified concentrated waste water to propose the means of a leaching assessment which can be conducted with ordinary equipment to evaluate the leaching for assessment of the adaptability to IAEA transport regulations. In addition, the leaching test was performed in accordance with the IAEA method to examine the co-relation between the transport regulations and the IAEA method. Many test results have been reported for the IAEA method in Japan, which will be detailed later on
Directory of Open Access Journals (Sweden)
Belguzar Kara
2009-06-01
Full Text Available AIM: The aim of this study was to determine the effect of medicine knowledge on the methods applied for lowering blood pressure among patients with hypertension. METHODS: This cross-sectional study was conducted between February 1 and April 30, 2006. The sample of the study was constituted by 77 patients who had admitted to Gulhane Military Medical Academy Cardiology Outpatient Clinic with the diagnosis of hypertension. The data were collected by using a questionnaire designed by the investigators. Descriptive statistics and chi-square test were used to analyze the data. RESULTS: The mean age of the patients was 54±13 years. Of the patients, 54.5% were female and %90.9 were married. The patients median duration of disease was 4 years and median duration of using antihypertensive drug was 4 years. Approximately 53% of the study group was educated about the antihypertensive drugs and 70.7% was educated by the physician. The methods applied for lowering blood pressure of patients were: 48.1% use of oral antihypertensive medicine; 40.2% use of traditional methods; %11.7 use of sublingual medicine. In this study, the methods used in case of blood pressure elevation was significantly associated with having been educated about the antihypertensive drugs and knowing the side effects of the drugs (χ²=16.378; p<0.001, χ²=13.467; p<0.01, respectively. CONCLUSION: The results of this study showed that the patients who had been educated about the antihypertensive drugs and their side effects were more frequently preferring to use antihypertensive drug to lower the elevated blood pressure. [TAF Prev Med Bull 2009; 8(3.000: 231-238
Methods of producing compounds from plant materials
Werpy, Todd A [West Richland, WA; Schmidt, Andrew J [Richland, WA; Frye, Jr., John G.; Zacher, Alan H. , Franz; James A. , Alnajjar; Mikhail S. , Neuenschwander; Gary G. , Alderson; Eric V. , Orth; Rick J. , Abbas; Charles A. , Beery; Kyle E. , Rammelsberg; Anne M. , Kim; Catherine, J [Decatur, IL
2010-01-26
The invention includes methods of processing plant material by adding water to form a mixture, heating the mixture, and separating a liquid component from a solid-comprising component. At least one of the liquid component and the solid-comprising component undergoes additional processing. Processing of the solid-comprising component produces oils, and processing of the liquid component produces one or more of glycerol, ethylene glycol, lactic acid and propylene glycol. The invention includes a process of forming glycerol, ethylene glycol, lactic acid and propylene glycol from plant matter by adding water, heating and filtering the plant matter. The filtrate containing starch, starch fragments, hemicellulose and fragments of hemicellulose is treated to form linear poly-alcohols which are then cleaved to produce one or more of glycerol, ethylene glycol, lactic acid and propylene glycol. The invention also includes a method of producing free and/or complexed sterols and stanols from plant material.
Methods of producing compounds from plant material
Energy Technology Data Exchange (ETDEWEB)
Werpy, Todd A.; Schmidt, Andrew J.; Frye, Jr., John G.; Zacher, Alan H.; Franz, James A.; Alnajjar, Mikhail S.; Neuenschwander, Gary G.; Alderson, Eric V.; Orth, Rick J.; Abbas, Charles A.; Beery, Kyle E.; Rammelsberg, Anne M.; Kim, Catherine J.
2006-01-03
The invention includes methods of processing plant material by adding water to form a mixture, heating the mixture, and separating a liquid component from a solid-comprising component. At least one of the liquid component and the solid-comprising component undergoes additional processing. Processing of the solid-comprising component produces oils, and processing of the liquid component produces one or more of glycerol, ethylene glycol, lactic acid and propylene glycol. The invention includes a process of forming glycerol, ethylene glycol, lactic acid and propylene glycol from plant matter by adding water, heating and filtering the plant matter. The filtrate containing starch, starch fragments, hemicellulose and fragments of hemicellulose is treated to form linear poly-alcohols which are then cleaved to produce one or more of glycerol, ethylene glycol, lactic acid and propylene glycol. The invention also includes a method of producing free and/or complexed sterols and stanols from plant material.
Medicine utilization review at a university teaching hospital in New Delhi
Directory of Open Access Journals (Sweden)
M Aqil
2012-01-01
Full Text Available Objective: A prospective medicine usage evaluation based on prescription monitoring was conducted in the medicine OPD of our university teaching hospital to know prescribing trends of different categories of medicines. Materials and Methods: A total of 600 patients were included in the study comprising of 339 (56.5% males and 261 (43.5% females. The data were recorded within the OPD by a registered pharmacist on a medicine usage evaluation form, approved by The University Institutional Review Board (IRB. Results: A total of 2365 medicines were prescribed to 600 patients during the 3 months study period. The mean number of medicines per prescription were found to be 3.94. Medicines were most frequently prescribed as solid dosage forms (85.62%, especially tablets (70.82%, and liquid formulations (14.12%. Oral route (96.17% was the most preferred mode of administration, followed by topical (2.11% and parenteral (1.60% routes. Combination therapy (94.33% was more prevalent than monotherapy (5.66%. An overwhelming tendency for prescribing medicines by brand names (99% was observed by the physicians. The most frequently prescribed class of medicines were antimicrobials > analgesics > cardiovascular > gastrointestinal agents. The most prescribed individual medicines among various therapeutic classes included isoniazid (antimicrobial, amlodipine (cardiovascular, metformin (hypoglycemic, cetirizine (antiallergic, rabeprazole (GI medicine, atorvastatin (hypolipidemic, dextromethorphan (respiratory medicine, alprazolam (sedative-hypnotic, paracetamol (analgesic. Conclusions: There is a considerable scope of improvement in the existing prescribing practice, especially prescribing by generic names, needs to be encouraged and a hospital formulary has to be developed for the purpose. The number of medicines to be included per prescription should be judged rationally and polypharmacy ought to be curbed. Use of antimicrobial also needs to be rationalized as over
The correlation of metal content in medicinal plants and their water extracts
Directory of Open Access Journals (Sweden)
Ranđelović Saša S.
2013-01-01
Full Text Available The quality of some medicinal plants and their water extracts from South East Serbia is determined on the basis of metal content using atomic absorption spectrometry. The two methods were used for the preparation of water extracts, to examine the impact of the preparation on the content of metals in them. Content of investigated metals in both water extracts is markedly lower then in medicinal plants, but were higher in water extract prepared by method (I, with exception of lead content. The coefficients of extraction for the observed metal can be represented in the following order: Zn > Mn > Pb > Cu > Fe. Correlation coefficients between the metal concentration in the extract and total metal content in plant material vary in the range from 0.6369 to 0.9956. This indicates need the plants to be collected and grown in the unpolluted area and to examine the metal content. The content of heavy metals in the investigated medicinal plants and their water extracts is below the maximum allowable values, so they are safe to use.
Carbon Nanotubes Filled with Ferromagnetic Materials
Directory of Open Access Journals (Sweden)
Albrecht Leonhardt
2010-08-01
Full Text Available Carbon nanotubes (CNT filled with ferromagnetic metals like iron, cobalt or nickel are new and very interesting nanostructured materials with a number of unique properties. In this paper we give an overview about different chemical vapor deposition (CVD methods for their synthesis and discuss the influence of selected growth parameters. In addition we evaluate possible growth mechanisms involved in their formation. Moreover we show their identified structural and magnetic properties. On the basis of these properties we present different application possibilities. Some selected examples reveal the high potential of these materials in the field of medicine and nanotechnology.
Carbon Nanotubes Filled with Ferromagnetic Materials
Weissker, Uhland; Hampel, Silke; Leonhardt, Albrecht; Büchner, Bernd
2010-01-01
Carbon nanotubes (CNT) filled with ferromagnetic metals like iron, cobalt or nickel are new and very interesting nanostructured materials with a number of unique properties. In this paper we give an overview about different chemical vapor deposition (CVD) methods for their synthesis and discuss the influence of selected growth parameters. In addition we evaluate possible growth mechanisms involved in their formation. Moreover we show their identified structural and magnetic properties. On the basis of these properties we present different application possibilities. Some selected examples reveal the high potential of these materials in the field of medicine and nanotechnology. PMID:28883334
Recent history of nuclear medicine
International Nuclear Information System (INIS)
Potchen, E.J.; Gift, D.A.
1988-01-01
Diagnostic nuclear medicine's recent history is characterized both by significant change and by growing participation in efforts to quantify the impact of nuclear medicine procedures on clinical judgment and patient management, as well as to develop methods for studying the efficacy of diagnostic procedures in general. The replacement of many nuclear medicine procedures that at one time were considered essential standards of clinical care by newer, more efficient and effective modalities has been complimented by the continued development of increasingly sophisticated applications of scintigraphic tracer methods
Method for monitoring drilling materials for gamma ray activity
International Nuclear Information System (INIS)
Smith, H.D. Jr.; Arnold, D.M.; Schultz, W.E.
1985-01-01
In the preferred and illustrated embodiment taught herein, method steps for monitoring of raw materials to be used in drilling mud are disclosed. The materials are monitored for radioactivity. Procedures for taking such measurements are disclosed, and the extent of gamma radioactivity in the raw materials used in drilling mud is, determined. This is correlated to the increased radiation attributable to mud made from these materials and the effect the mud would have on gamma ray measuring logs. An alternate procedure for testing drilling mud, typically at the well site, is also disclosed. The method detects mud radioactivity from any additives including barite, potassium chloride, well cuttings or others. Excessive background levels due to mud gamma radioactivity in a well may very well mask the data obtained by various logging procedures dependent on gamma radiation. Procedures are also described for either rejecting mud which is too radioactive or correcting the log measurements for mud effects
Multiscale Modeling using Molecular Dynamics and Dual Domain Material Point Method
Energy Technology Data Exchange (ETDEWEB)
Dhakal, Tilak Raj [Los Alamos National Lab. (LANL), Los Alamos, NM (United States). Theoretical Division. Fluid Dynamics and Solid Mechanics Group, T-3; Rice Univ., Houston, TX (United States)
2016-07-07
For problems involving large material deformation rate, the material deformation time scale can be shorter than the material takes to reach a thermodynamical equilibrium. For such problems, it is difficult to obtain a constitutive relation. History dependency become important because of thermodynamic non-equilibrium. Our goal is to build a multi-scale numerical method which can bypass the need for a constitutive relation. In conclusion, multi-scale simulation method is developed based on the dual domain material point (DDMP). Molecular dynamics (MD) simulation is performed to calculate stress. Since the communication among material points is not necessary, the computation can be done embarrassingly parallel in CPU-GPU platform.
BOOK REVIEW Handbook of Physics in Medicine and Biology Handbook of Physics in Medicine and Biology
Tabakov, Slavik
2010-11-01
. The imaging chapters also vary in style and quality: while those on MRI and ultrasound provide a suitable introduction to the methods, the chapters on x-ray and PET need more detail. However this section includes some methods/equipment rarely featured in medical physics/engineering books (such as OCT or HIM). From this point of view the last eight chapters in the section will be a very useful reference for various specialists. The sixth section (about 30 pages) includes three chapters on lab-on-a-chip; the biophysics of DNA microarrays; nuclear medicine. While the first two could provide an interesting reference, the chapter on nuclear medicine needs much more detail. The last (seventh) section (15 pages) has only one chapter on biophysics of regenerative medicine, which is a good introduction, emphasizing biochemical factors important for improving/replacing tissues or tissue structures. The book ends with an index covering about 1400 terms. The handbook will be useful for the preparation of teaching materials and for undergraduate students, but should be complemented with more detailed/specific reference materials such as the Encyclopedia of Medical Devices and Instrumentation, the Encyclopedia of Medical Physics Emitel, or others. Parts of the handbook would be less suitable for more demanding readers (such as trainee medical physicists or radiologists, for example). In conclusion, the Handbook of Physics in Medicine and Biology includes materials that are rarely combined together, which strengthens its interdisciplinary approach and makes it an additional reference for a departmental library.
Family medicine: Perception and attitudes among Indian medical students
Directory of Open Access Journals (Sweden)
Ilhaam Ashraf
2018-01-01
Full Text Available Context: Currently, family medicine is not taught as a part of the undergraduate medical curriculum in India. In this context, the perceptions and attitudes of Indian medical students regarding family medicine as a career choice were studied. Aims: This study aims to study the perceptions and attitudes prevalent among Indian medical students regarding family medicine as a career choice and discuss its future implications. Settings and Design: Cross-sectional survey study design. Methods and Material: We conducted a cross-sectional survey of undergraduate medical (MBBS students attending the 2016 medical student conference DEMEDCON at Sri Devaraj Urs Medical College in Kolar, Karnataka, India. Besides demographics, the survey included questions pertaining to awareness, exposure, and interest in family medicine in India. We also asked an open-ended question regarding the respondent's perception of the future of family medicine in India. Statistical Analysis: Simple statistics such as mean and frequency (% were calculated. Given the small sample size, no formal tests for statistical significance were performed. Results: Responses were collected from 45 students between the ages of 18–24 from 6 medical colleges across Karnataka and Puducherry. The majority (64% of respondents were in their 3rd or 4th year of medical college. 98% of respondents expressed a desire to learn more about family medicine as a specialty, and 82% expressed a need to introduce it as a subject in medical college. However, only 58% were aware of the Medical Council of India accredited status of family medicine in India. Conclusions: There exists a significant lack of awareness and inadequate exposure among Indian medical students toward family medicine. Nonetheless, there is widespread optimism and a desire to learn more about the subject. Increased awareness and avenues for exposure to family medicine in the formal undergraduate medical curriculum is the need of the hour.
A fully general and adaptive inverse analysis method for cementitious materials
DEFF Research Database (Denmark)
Jepsen, Michael S.; Damkilde, Lars; Lövgren, Ingemar
2016-01-01
The paper presents an adaptive method for inverse determination of the tensile σ - w relationship, direct tensile strength and Young’s modulus of cementitious materials. The method facilitates an inverse analysis with a multi-linear σ - w function. Usually, simple bi- or tri-linear functions...... are applied when modeling the fracture mechanisms in cementitious materials, but the vast development of pseudo-strain hardening, fiber reinforced cementitious materials require inverse methods, capable of treating multi-linear σ - w functions. The proposed method is fully general in the sense that it relies...... of notched specimens and simulated data from a nonlinear hinge model. The paper shows that the results obtained by means of the proposed method is independent on the initial shape of the σ - w function and the initial guess of the tensile strength. The method provides very accurate fits, and the increased...
Shirooye, Pantea; Mokaberinejad, Roshanak; Ara, Leila; Hamzeloo-Moghadam, Maryam
2016-01-01
Herbal medicines formulated as oils were believed to possess more powerful effects than their original plants in Iranian Traditional Medicine (ITM). One of the popular oils suggested for treatment of various indications was ginger oil. In the present study, to suggest a more convenient method of oil preparation (compared to the traditional method), ginger oil has been prepared according to both the traditional and conventional maceration methods and the volatile oil constituents have been compared. Ginger oil was obtained in sesame oil according to both the traditional way and the conventional (maceration) methods. The volatile oil of dried ginger and both oils were obtained by hydro-distillation and analyzed by gas chromatography/mass spectroscopy. Fifty five, fifty nine and fifty one components consisting 94 %, 94 % and 98 % of the total compounds were identified in the volatile oil of ginger, traditional and conventional oils, respectively. The most dominant compounds of the traditional and conventional oils were almost similar; however they were different from ginger essential oil which has also been to possess limited amounts of anti-inflammatory components. It was concluded that ginger oil could be prepared through maceration method and used for indications mentioned in ITM.
A particle method for history-dependent materials
Energy Technology Data Exchange (ETDEWEB)
Sulsky, D.; Chen, Z.; Schreyer, H.L. [New Mexico Univ., Albuquerque, NM (United States)
1993-06-01
A broad class of engineering problems including penetration, impact and large rotations of solid bodies causes severe numerical problems. For these problems, the constitutive equations are history dependent so material points must be followed; this is difficult to implement in an Eulerian scheme. On the other hand, purely Lagrangian methods typically result in severe mesh distortion and the consequence is ill conditioning of the element stiffness matrix leading to mesh lockup or entanglement. Remeshing prevents the lockup and tangling but then interpolation must be performed for history dependent variables, a process which can introduce errors. Proposed here is an extension of the particle-in-cell method in which particles are interpreted to be material points that are followed through the complete loading process. A fixed Eulerian grid provides the means for determining a spatial gradient. Because the grid can also be interpreted as an updated Lagrangian frame, the usual convection term in the acceleration associated with Eulerian formulations does not appear. With the use of maps between material points and the grid, the advantages of both Eulerian and Lagrangian schemes are utilized so that mesh tangling is avoided while material variables are tracked through the complete deformation history. Example solutions in two dimensions are given to illustrate the robustness of the proposed convection algorithm and to show that typical elastic behavior can be reproduced. Also, it is shown that impact with no slip is handled without any special algorithm for bodies governed by elasticity and strain hardening plasticity.
Directory of Open Access Journals (Sweden)
Japhereena Murugavel
2017-01-01
Full Text Available Background: Community medicine strives to protect and promote the health and well-being of the community through primary health care approach. However the preference of community medicine as career among medical school students and curriculum of community medicine is pivotal. Aim: The study intended to find the attitude towards learning of community medicine and also to assess the preference of post graduation specialty among medical school students. Materials and Methods: A cross sectional study conducted at a teaching hospital located in Tamil Nadu, South India. The study questionnaire was administered to a total of 500 study participants and the data collected were analyzed using SPSS IBM version 21.0. Results: Almost 97% were of the opinion that community medicine subject is mandatory. Eighty three percent were interested in learning the principles. Only 21.8% students wanted to pursue post graduation in community medicine. Lack of attraction in terms of scientific technical interest, workplace conditions, and research potential has been reported for being not interested. Conclusion: Majority enjoyed to learn principles of community medicine at undergraduate curriculum but only few preferred to opt community medicine as post graduate specialty. Therefore there is a room to influence the medical students positively towards learning community medicine in curriculum.
Modelling of Granular Materials Using the Discrete Element Method
DEFF Research Database (Denmark)
Ullidtz, Per
1997-01-01
With the Discrete Element Method it is possible to model materials that consists of individual particles where a particle may role or slide on other particles. This is interesting because most of the deformation in granular materials is due to rolling or sliding rather that compression of the gra...
Medicine Delivery Device with Integrated Sterilization and Detection
Shearn, Michael J.; Greer, Harold F.; Manohara, Harish
2013-01-01
Sterile delivery devices can be created by integrating a medicine delivery instrument with surfaces that are coated with germicidal and anti-fouling material. This requires that a large-surface-area template be developed within a constrained volume to ensure good contact between the delivered medicine and the germicidal material. Both of these can be integrated using JPL-developed silicon nanotip or cryo-etch black silicon technologies with atomic layer deposition (ALD) coating of specific germicidal layers. The application of semiconductor processing techniques and technologies to the problems of fluid manipulation and delivery has enabled the integration of chemical, electrical, and mechanical manipulation of samples all within a single microfluidic device. This approach has been successfully applied at JPL to the automated processing, detection, and analysis of minute quantities (parts per trillion level) of biomaterials to develop instruments for in situ exploration or extraterrestrial bodies. The same nanofabrication techniques that are used to produce a microfluidics device are also capable of synthesizing extremely high-surface-area templates in precise locations, and coating those surfaces with conformal films to manipulate their surface properties. This methodology has been successfully applied at JPL to produce patterned and coated silicon nanotips (also known as black silicon) to manipulate the hydrophilicity of surfaces to direct the spreading of fluids in microdevices. JPL's ALD technique is an ideal method to produce the highly conformal coatings required for this type of application. Certain materials, such as TiO2, have germicidal and anti-fouling properties when they are illuminated with UV light. The proposed delivery device contacts medicine with this high-surface-area black silicon surface coated with a thin-film germicidal deposited conformally with ALD. The coating can also be illuminated with ultraviolet light for the purpose of sterilization
Two micro fatigue test methods for irradiated materials
International Nuclear Information System (INIS)
Nunomura, Shigetomo; Noguchi, Shinji; Okamura, Yuichi; Kumai, Shinji
1993-01-01
This paper demonstrates two miniature fatigue test methods in response to the requirements of the fusion reactor wall materials development program. It is known that the fatigue strength evaluated by the axial loading test is independent of the specimen size, while that evaluated by the bend test or torsion test is dependent upon the size of specimen. The new type of gripping system for the axial, tension-tension, fatigue testing of TEM disk-size specimens that has been developed is described in this paper. An alignment tool assists in gripping the miniature specimen. The miniature tension-tension fatigue test method seems to provide reliable S-N curves for SUS304 and SUS316L stainless steels. An indentation method has also been developed to determine fatigue properties. A hard steel ball or ceramic ball was used for cyclically loading the specimen, and an S-N curve was subsequently obtained. The merit of this method is primarily simple handling. S-N curves obtained from four materials by this indentation method compared well with those obtained from the rotary bend fatigue test employing a standard-size specimen
[Costing nuclear medicine diagnostic procedures].
Markou, Pavlos
2005-01-01
To the Editor: Referring to a recent special report about the cost analysis of twenty-nine nuclear medicine procedures, I would like to clarify some basic aspects for determining costs of nuclear medicine procedure with various costing methodologies. Activity Based Costing (ABC) method, is a new approach in imaging services costing that can provide the most accurate cost data, but is difficult to perform in nuclear medicine diagnostic procedures. That is because ABC requires determining and analyzing all direct and indirect costs of each procedure, according all its activities. Traditional costing methods, like those for estimating incomes and expenses per procedure or fixed and variable costs per procedure, which are widely used in break-even point analysis and the method of ratio-of-costs-to-charges per procedure may be easily performed in nuclear medicine departments, to evaluate the variability and differences between costs and reimbursement - charges.
Ayivor, J. E.; Okine, L. K. N.; Dampare, S. B.; Nyarko, B. J. B.; Debrah, S. K.
2012-04-01
The epithermal neutron shape factor, α of the inner and outer irradiation sites of the Ghana Research Reactor-1 (GHARR-1) was determined obtaining results of 0.105 for the inner (Channel 1) Irradiation site and 0.020 for the outer (channel 6) irradiation site. The neutron temperatures for the inner and outer irradiation sites were 27 °C and 20 °C, respectively. The α values used in Westcott Formalism k0 INAA was applied to determine multi elements in 13 Ghanaian herbal medicines used by the Centre for Scientific Research into Plant Medicine (CSRPM) for the management of various diseases complemented by Atomic Absorption Spectrometry. They are namely Mist. Antiaris, Mist. Enterica, Mist. Morazia, Mist. Nibima, Mist. Modium, Mist. Ninger, Mist Sodenia, Mist. Tonica, Chardicca Powder, Fefe Powder, Olax Powder, Sirrapac powder and Lippia Tea. Concentrations of Al, As, Br, K, Cl, Cu, Mg, Mn, Na and V were determined by short and medium irradiations at a thermal neutron flux of 5×1011 ncm-2 s-1. Fe, Cr, Pb, Co, Ni, Sn, Ca, Ba, Li and Sb were determined using Atomic Absorption Spectrometry (AAS). Ba, Cu, Li and V were present at trace levels whereas Al, Cl, Na, Ca were present at major levels. K, Br, Mg, Mn, Co, Ni, Fe and Sb were also present at minor levels. Arsenic was not detected in all samples. Standard Reference material, IAEA-V-10 Hay Powder was simultaneously analysed with samples. The precision and accuracy of the method using real samples and standard reference materials were evaluated and within ±10% of the reported value. Multivariate analytical techniques, such as cluster analysis (Q-mode and R-mode CA) and principal component analysis (PCA)/factor analysis (FA), have been applied to evaluate the chemical variations in the herbal medicine dataset. All the 13 samples may be grouped into 2 statistically significant clusters (liquid based and powdered herbal medicines), reflecting the different chemical compositions. R-mode CA and PCA suggest common
Directory of Open Access Journals (Sweden)
Hamideh khorrampazouh
2018-02-01
Full Text Available Introduction: Enema or ‘hoqne’ is a therapeutic approach used for a wide range of diseases in the Iranian traditional medicine. The use of this method dates back to thousands of years to Hippocrates and Galen. The aim of this study was to review the history of enema and its methods and indices in the Iranian medicine and other complementary medicine.Methods: This review study was conducted on the Iranian medicine textbooks and articles published in the international databases, including Google Scholar, PubMed, Embase, and Scopus, as well as the Iranian databases, such as SID and Magiran. The searching process was performed using the following keywords: ‘Hoqne’, ‘Enema’, ‘Vasta’, ‘Basta’, and ‘Complementary and Alternative Medicine (CAM’. There was no limitation regarding the publication data of the included studies.Result: In the Iranian medicine, the term “hoqne” is equivalent to enema. Enema is used in various diseases of the brain, respiratory system, digestive system, urogenital system, and musculoskeletal system, as well as systemic diseases. Enema is one of the five main therapies in the Indian medicine or Ayurveda. In other types of complementary medicine, including Chinese medicine, this procedure has therapeutic applications. Although enema has been recognized as a diagnostic method in modern medicine, it has been considered as a therapeutic approach in the recent years.Conclusion: According to the findings of the reviewed studies, enema is a major therapeutic focus in complementary medicine, part of which has been confirmed in the recent studies. Given the low side effects and high success rate of this treatment, it can be used as a supplemental therapy for the management of poisoning, febrile seizures, prolonged functional constipation, and chronic kidney disease, as well as the prevention of swelling. However, this theory requires further investigation and targeted clinical trials. This method has been
Directory of Open Access Journals (Sweden)
Yoo Kyoung Han
2017-12-01
Full Text Available Background: This study aimed to select prescriptions (mixtures of medicinal herbs used in the treatment of bone and joint disorders in Korean medicine, and through the analysis of medicinal herb combination frequencies, select a high-frequency medicinal herb combination group for further experimental and clinical research. Methods: We systematically searched for terms related to bone and joint disorder in the âDongeuibogam (Dong yibaojianâ, a seminal Korean medicine book. We reviewed the results of published papers regarding the effects in bone and joint disorders (especially in osteoporosis, osteomalacia, osteopenia, rheumatoid arthritis, and degenerative arthritis. Results: In total, 34 candidates of a medicinal herb combination for the treatment of bone and joint disorders(CMHCTBJDs and nine candidates of a medicinal herb for the treatment of bone and joint disorders(CMHTBJDs were selected. Conclusion: : The candidates of a medicinal herb combination for the treatment of bone and joint disorders (CMHCTBJDs and candidates of a medicinal herb for the treatment of bone and joint disorders(CMHTBJDs proposed in this study can be useful material for text mining to develop natural products with the effects in BJDs and also it has the potential to reduce the experimental and developmental time period. Keywords: Dongeuibogam (Dong yi bao gian, Text mining, Bone disorder
Wu, Lan; Sun, Wei; Wang, Bo; Zhao, Haiyu; Li, Yaoli; Cai, Shaoqing; Xiang, Li; Zhu, Yingjie; Yao, Hui; Song, Jingyuan; Cheng, Yung-Chi; Chen, Shilin
2015-08-01
Traditional herbal medicines adulterated and contaminated with plant materials from the Aristolochiaceae family, which contain aristolochic acids (AAs), cause aristolochic acid nephropathy. Approximately 256 traditional Chinese patent medicines, containing Aristolochiaceous materials, are still being sold in Chinese markets today. In order to protect consumers from health risks due to AAs, the hidden assassins, efficient methods to differentiate Aristolochiaceous herbs from their putative substitutes need to be established. In this study, 158 Aristolochiaceous samples representing 46 species and four genera as well as 131 non-Aristolochiaceous samples representing 33 species, 20 genera and 12 families were analyzed using DNA barcodes based on the ITS2 and psbA-trnH sequences. Aristolochiaceous materials and their non-Aristolochiaceous substitutes were successfully identified using BLAST1, the nearest distance method and the neighbor-joining (NJ) tree. In addition, based on sequence information of ITS2, we developed a Real-Time PCR assay which successfully identified herbal material from the Aristolochiaceae family. Using Ultra High Performance Liquid Chromatography-Mass Spectrometer (UHPLC-HR-MS), we demonstrated that most representatives from the Aristolochiaceae family contain toxic AAs. Therefore, integrated DNA barcodes, Real-Time PCR assays using TaqMan probes and UHPLC-HR-MS system provides an efficient and reliable authentication system to protect consumers from health risks due to the hidden assassins (AAs).
Directory of Open Access Journals (Sweden)
Tomasz Konopka
2017-06-01
Full Text Available Aim of the study : To determine the circumstances which can be useful for offenders profiling in homicide cases with victim’s body dismemberment. Material and methods: Study of all homicide cases with victim’s corpse dismemberment examined in Krakow Department of Forensic Medicine over the last 50 years. Results : Within the past 50 years, a total number of 30 cases of homicides with dismembered bodies were examined in Krakow. 22 cases represent defensive mutilations performed by offender, 3 cases can be classified as offensive mutilations and 3 cases represent aggressive mutilations – decapitation as a method of committing homicide. In this period the only 1 case of necrophilic mutilations was examined, when the body was dismembered without murder. In most cases the background of homicide was the family conflict, 6 was cause of mental illness of perpetrator and in 3 was sexual motive. Only in 3 cases (from 25 when the offender was known perpetrator kill a stranger. In the other the offender belonged to the family or friends of the victim. In all cases where the perpetrator was determined, homicide and dismemberment was performed in his place of residence. The findings of the Police investigations indicate that in most cases homicides were not planned, occurred under the influence of emotion, only two have been previously scheduled. Conclusions : Homicides with corpses dismemberment usually are committed by offenders who is in close relationship with victim (family or friend. Dismemberment is almost always performed in the same place as murder – home of perpetrator. This type of homicide usually is not planned.
Wang, Li; Wu, Hai-Long; Yin, Xiao-Li; Hu, Yong; Gu, Hui-Wen; Yu, Ru-Qin
2017-01-01
A chemometrics-assisted excitation-emission matrix (EEM) fluorescence method is presented for simultaneous determination of umbelliferone and scopoletin in Tibetan medicine Saussurea laniceps (SL) and traditional Chinese medicine Radix angelicae pubescentis (RAP). Using the strategy of combining EEM fluorescence data with second-order calibration method based on the alternating trilinear decomposition (ATLD) algorithm, the simultaneous quantification of umbelliferone and scopoletin in the two different complex systems was achieved successfully, even in the presence of potential interferents. The pretreatment is simple due to the "second-order advantage" and the use of "mathematical separation" instead of awkward "physical or chemical separation". Satisfactory results have been achieved with the limits of detection (LODs) of umbelliferone and scopoletin being 0.06 ng mL- 1 and 0.16 ng mL- 1, respectively. The average spike recoveries of umbelliferone and scopoletin are 98.8 ± 4.3% and 102.5 ± 3.3%, respectively. Besides, HPLC-DAD method was used to further validate the presented strategy, and t-test indicates that prediction results of the two methods have no significant differences. Satisfactory experimental results imply that our method is fast, low-cost and sensitive when compared with HPLC-DAD method.
Development of a novel sports medicine rotation for emergency medicine residents
Directory of Open Access Journals (Sweden)
Waterbrook AL
2016-04-01
Full Text Available Anna L Waterbrook,1 T Gail Pritchard,2 Allison D Lane,1 Lisa R Stoneking,1 Bryna Koch,2 Robert McAtee,1 Kristi H Grall,1 Alice A Min,1 Jessica Prior,1 Isaac Farrell,1 Holly G McNulty,1 Uwe Stolz1 1Department of Emergency Medicine, 2Office of Medical Student Education, The University of Arizona, Tucson, AZ, USA Abstract: Musculoskeletal complaints are the most common reason for patients to visit a physician, yet competency in musculoskeletal medicine is invariably reported as a deficiency in medical education in the USA. Sports medicine clinical rotations improve both medical students' and residents' musculoskeletal knowledge. Despite the importance of this knowledge, a standardized sports medicine curriculum in emergency medicine (EM does not exist. Hence, we developed a novel sports medicine rotation for EM residents to improve their musculoskeletal educational experience and to improve their knowledge in musculoskeletal medicine by teaching the evaluation and management of many common musculoskeletal disorders and injuries that are encountered in the emergency department. The University of Arizona has two distinct EM residency programs, South Campus (SC and University Campus (UC. The UC curriculum includes a traditional 4-week orthopedic rotation, which consistently rated poorly on evaluations by residents. Therefore, with the initiation of a new EM residency at SC, we replaced the standard orthopedic rotation with a novel sports medicine rotation for EM interns. This rotation includes attendance at sports medicine clinics with primary care and orthopedic sports medicine physicians, involvement in sport event coverage, assigned reading materials, didactic experiences, and an on-call schedule to assist with reductions in the emergency department. We analyzed postrotation surveys completed by residents, postrotation evaluations of the residents completed by primary care sports medicine faculty and orthopedic chief residents, as well as the
An n -material thresholding method for improving integerness of solutions in topology optimization
International Nuclear Information System (INIS)
Watts, Seth; Engineering); Tortorelli, Daniel A.; Engineering)
2016-01-01
It is common in solving topology optimization problems to replace an integer-valued characteristic function design field with the material volume fraction field, a real-valued approximation of the design field that permits "fictitious" mixtures of materials during intermediate iterations in the optimization process. This is reasonable so long as one can interpolate properties for such materials and so long as the final design is integer valued. For this purpose, we present a method for smoothly thresholding the volume fractions of an arbitrary number of material phases which specify the design. This method is trivial for two-material design problems, for example, the canonical topology design problem of specifying the presence or absence of a single material within a domain, but it becomes more complex when three or more materials are used, as often occurs in material design problems. We take advantage of the similarity in properties between the volume fractions and the barycentric coordinates on a simplex to derive a thresholding, method which is applicable to an arbitrary number of materials. As we show in a sensitivity analysis, this method has smooth derivatives, allowing it to be used in gradient-based optimization algorithms. Finally, we present results, which show synergistic effects when used with Solid Isotropic Material with Penalty and Rational Approximation of Material Properties material interpolation functions, popular methods of ensuring integerness of solutions.
Supplementary data: Materials and methods RNA expression ...
Indian Academy of Sciences (India)
ritt8
Supplementary data: Materials and methods. RNA expression analysis. Freshly collected tissue was taken in TRIzol reagent for total RNA isolation according to the manufacturer's protocol. The cDNA synthesis was carried out in 1 μg total RNA using Random hexamer (Invitrogen, Carlsbad, USA) and Superscript III ...
Method for Waterproofing Ceramic Materials
Cagliostro, Domenick E. (Inventor); Hsu, Ming-Ta S. (Inventor)
1998-01-01
Hygroscopic ceramic materials which are difficult to waterproof with a silane, substituted silane or silazane waterproofing agent, such as an alumina containing fibrous, flexible and porous, fibrous ceramic insulation used on a reentry space vehicle, are rendered easy to waterproof if the interior porous surface of the ceramic is first coated with a thin coating of silica. The silica coating is achieved by coating the interior surface of the ceramic with a silica precursor converting the precursor to silica either in-situ or by oxidative pyrolysis and then applying the waterproofing agent to the silica coated ceramic. The silica precursor comprises almost any suitable silicon containing material such as a silane, silicone, siloxane, silazane and the like applied by solution, vapor deposition and the like. If the waterproofing is removed by e.g., burning, the silica remains and the ceramic is easily rewaterproofed. An alumina containing TABI insulation which absorbs more that five times its weight of water, absorbs less than 10 wt. % water after being waterproofed according to the method of the invention.
Methods for making lithium vanadium oxide electrode materials
Schutts, Scott M.; Kinney, Robert J.
2000-01-01
A method of making vanadium oxide formulations is presented. In one method of preparing lithium vanadium oxide for use as an electrode material, the method involves: admixing a particulate form of a lithium compound and a particulate form of a vanadium compound; jet milling the particulate admixture of the lithium and vanadium compounds; and heating the jet milled particulate admixture at a temperature below the melting temperature of the admixture to form lithium vanadium oxide.
Validation of an activity optimization method for nuclear medicine in planar studies
Energy Technology Data Exchange (ETDEWEB)
Perez D, M. [Central University of Las Villas, CEETI, Camajuani Road Km 5.5, Santa Clara 54830 Villa Clara (Cuba); Diaz R, O. [Institute for Sciences and Advanced Technologies (Cuba); Farias L, F. [Federal University of Pernambuco (Brazil)]. e-mail: mperez@uclv.edu.cu
2006-07-01
A method for optimizing the administered activity in Static Nuclear Medicine Studies is validated by comparison with ROC curve. Linear Discriminant analysis of image quality in gamma cameras was the applied statistical technique. The constructed linear discriminant function owns as dependent parameters, the differentiated levels of image quality obtained by observer's criterion. The independent parameters in the function were physical variables, as Signal-to Background ratios and Signal-to-Noise ratios. They were obtained from the selection of Regions of Interest in images obtained from a Jaszczak phantom, corresponding to lesion and background sites. The percentage of cases correctly classified by discriminant analysis was analyzed to grade the proposed discriminant method. The minimum value of the administered activity, which permits good image quality, (it means good results for the parameters selected by the discriminant function), can be proposed as an optimized value of activity for planar studies of Nuclear Medicine. The method was tested using images from a Jaszczak phantom, acquired under four activities (1088 MBq, 962 MBq, 740 MBq and 562 MBq) with a gamma camera equipped with a high resolution - low energy- parallel-hole collimator. The gamma camera was tested by a NEMA protocol. Image quality was graded by three expert observers who also developed a rated procedure which consist in analyzing the images for ROC analysis. Two of the six measured Background-to-Signal ratios were the parameters able to construct the linear discriminant function with high correlation respect to the observer criterion, from all the measured physical variables. The value of 740 MBq was the optimum after discriminant method application in this particular experiment. The results were coincident with the application of ROC-analysis. The optimal activity value obtained with the proposed discriminant procedure coincided with the activity value for which the area under the ROC
International Nuclear Information System (INIS)
Akasaka, Hidenari; Shimura, Satoshi; Asano, Eiichi; Yamagata, Junji; Ninomiya, Nobuo; Kawakami, Susumu.
1995-01-01
A bottomed molding material (buffer molding material) is formed into a bottomed cylindrical shape by solidifying, under pressure, powders such as of bentonite into a highly dense state by a cold isotropic pressing or the like, having a hole for accepting and containing a vessel for radiation-contaminated materials. The bottomed cylindrical molding material is loaded on a transferring vessel, and transferred to a position near the site for underground disposal. The bottomed cylindrical molding material having a upwarded containing hole is buried in the cave for disposal. The container for radiation-contaminated material is loaded and contained in the containing hole of the bottomed cylindrical molding material. A next container for radiation-contaminated materials is juxtaposed thereover. Then, a bottomed cylindrical molding material having a downwarded containing hole is covered to the container for the radiation-contaminated material in a state being protruded upwardly. The radiation-contaminated material is thus closed by a buffer material of the same material at the circumference thereof. (I.N.)
Recent applications of nuclear medicine in diagnostics (I part
Directory of Open Access Journals (Sweden)
Giorgio Treglia
2013-04-01
Full Text Available Introduction: Aim of this review is to describe the recent applications of nuclear medicine techniques in diagnostics, particularly in oncology. Materials and methods: We reviewed scientific literature data searching for the current role of tomographic nuclear medicine techniques (SPECTand PET in oncology and summarized the main applications of these techniques. Results: Nuclear medicine techniques have a key role in oncology allowing early diagnosis of many tumours, an accurate staging of disease and evalutation of treatment response. Hybrid SPECT/CT and PET/CT imaging systems now provide metabolic and functional information from SPECTor PETcombined with the high spatial resolution and anatomic information of CT. The most frequent applications of SPECT/CT in oncology concern thyroid tumours, neuroendocrine tumours, bone metastases and lymph node mapping. Furthermore the evaluation of many tumours may benefit from PET/CT imaging. Discussion: The recent development of new radiopharmaceuticals and the growth of hybrid tomographic devices, such as SPECT/CT and PET/CT, now permits molecular imaging of biologic processes at the cellular level to improve both the diagnosis and treatment of many tumours.
Potter, David J
2014-01-01
The quality demands of the pharmaceutical industry require prescription medicines to be consistent in their active ingredient content. Achieving this, using raw cannabis as a feedstock, is especially challenging. The plant material is extremely inhomogeneous, and the ratios of active ingredients are affected by a range of factors. These include the genetics of the plant, the growing and storage conditions, the state of maturity at harvest, and the methods used to process and formulate the material. The reasons for this variability are described, with particular emphasis on the botanical considerations. To produce the complex botanical medicine Sativex®, which contains the cannabinoids Δ(9)-tetrahydrocannabinol (THC) and cannabidiol (CBD) and a range of other ingredients, GW Pharmaceuticals had to manage these variables. This medicine, for the treatment of spasticity due to multiple sclerosis, is the first cannabis-based medicine to be approved in the UK. The company's methodology for producing this and other chemotypes is described. Copyright © 2013 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
WenJun Zhang
2017-09-01
Full Text Available In present study I used the data from CHM-DATA, the interactive database of 1127 Chinese herbal medicines with 78 medicinal functions (attributes. The relational network for medicinal functions of Chinese herbal medicines was constructed using my earlier data and methods. Results of network analysis showed that the network is a scale-free complex network at the significance level of alpha=0.01. It was demonstrated that Clear away heat, Detoxification, Remove lung-heat or nourish lung, Promote secretion of saliva or body, Relieve pain, Regulate or enhance energy flow (Qi, Nourish or warm spleen / stomach / Qi, and Dispel endogenous wind, are the most influential medicinal functions. Seven main modules, corresponding links and module functions were identified and three of them were (Clear away heat, Detoxification, Relieve pain, Regulate or enhance energy flow (Qi, (Loosen the bowels, Moisten dryness, Tonify blood, Nourish essential fluid (Yin, Inhibit or break energy flow (Qi, and (Relieve external syndrome, Induce perspiration, Relieve muscular spasm, Expose exthanthema or promote eruption. PCA of 78 medicinal functions demonstrated that the medicinal functions 1-50 accounted for 79% of the total variance. There were not absolutely significant components and medicinal functions. The 78 components from PCA were substantially 78 independent and comprehensive medicinal functions. Major medicinal functions for every component can be simply determined by their importance and contribution coefficients in the component. New medicinal definition for some the most important principal components were given. Category characteristics of medicinal functions were described. At a certain level, for example, the medicinal functions -Consolidate or warm kidney, -Whet the appetite or reinforce stomach, Cool blood, -Regulate or enhance energy flow (Qi, -Nourish or warm spleen / stomach / Qi, Clear away heat, Detoxification, and Dispel endogenous cold, are the
Screening of Chemical Dyes in Traditional Chinese Medicine by HPTLC-MS.
He, Fengyan; He, Yi; Zheng, Xiaowei; Wang, Ruizhong; Lu, Jing; Dai, Zhong; Ma, Shuangcheng
2018-05-01
It has been uncovered that chemical dyes are illegally used in traditional Chinese medicines to brighten color and cover up inferiority, which threaten the safety of patients. In the present study, an HPTLC-MS method was developed for the effective screening of 11 chemical dyes (Sudan I, II, III, and IV; 808 Scarlet; Sudan Red 7B; malachite green; Basic Orange 2; auramine; Orange II; and erythrosine) in traditional Chinese medicine (TCM) raw materials and Chinese patent medicines. Firstly, unwashed HPTLC plates were chosen by comparing the background signals of the TLC plates used directly and prewashed with analytical grade and HPLC grade solvents. Twice developments were conducted to isolate chemical dyes of different polarity. Possible adulterants were preliminarily identified by comparing Rf values and in situ UV-Vis spectra with those of the references. Further confirmation was conducted by tandem MS analysis via an elution head-based TLC-MS interface. Sudan I and IV, 808 Scarlet, and Orange II were successfully detected in eight batches of TCM. The proposed method could be applied as a reliable technology for the screening of chemical dyes in TCM.
Application of pulse spectro- zonal luminescent method for the rapid method of material analysis
International Nuclear Information System (INIS)
Lisitsin, V.M.; Oleshko, V.I.; Yakovlev, A.N.
2004-01-01
Full text: The scope of luminescent methods of the analysis covers enough a big around of substances as the luminescence can be excited in overwhelming majority of nonmetals. Analytical opportunities of luminescent methods can be essentially expanded by use of pulse excitation and registration of spectra of a luminescence with the time resolved methods. The most perspective method is to use pulses of high-current electron beams with the nanosecond duration for excitation from the following reasons: excitation is carried out ionizing, deeply enough by a penetrating radiation; the pulse of radiation has high capacity, up to 10 8 W, but energy no more than 1 J; the pulse of radiation has the nanosecond duration. Electrons with energy in 300-400 keV will penetrate on depth into some tenth shares of mm, i.e. they create volumetric excitation of a sample. Therefore the luminescence raised by an electronic beam has the information about volumetric properties of substance. High density of excitation allow to find out and study the centers (defects) having a small yield of a luminescence, to analyze the weakly luminescent objects. Occurrence of the new effects is possible useful to analyze of materials. There is an opportunity of reception of the information from change of spectral structure of a luminescence during the time after the ending of a pulse of excitation and kinetic characteristics of attenuation of luminescence. The matter is the energy of radiation is absorbed mainly by a matrix, then electronic excitations one is transferred the centers of a luminescence (defects) of a lattice. Therefore during the time after creation electronic excitations the spectrum of a luminescence can repeatedly change, transferring the information on the centers (defects) which are the most effective radiators at present time. Hence, the study of change of spectra of radiation during the time allows providing an additional way of discrimination of the information on the centers of a
System to detect nuclear materials by active neutron method
International Nuclear Information System (INIS)
Koroev, M.; Korolev, Yu.; Lopatin, Yu.; Filonov, V.
1999-01-01
The report presents the results of the development of the system to detect nuclear materials by active neutron method measuring delayed neutrons. As the neutron source the neutron generator was used. The neutron generator was controlled by the system. The detectors were developed on the base of the helium-3 counters. Each detector consist of 6 counters. Using a number of such detectors it is possible to verify materials stored in different geometry. There is an spectrometric scintillator detector in the system which gives an additional functional ability to the system. The system could be used to estimate the nuclear materials in waste, to detect the unauthorized transfer of the nuclear materials, to estimate the material in tubes [ru
Paule, Lynde; Murray, Stephen L.
As a precursor to making recommendations for more effective assessment methods for teacher certification, an examination is made of the professions of law and medicine. Specifically, the examination covers the relationship between training programs and the methods employed for evaluating prospective lawyers and doctors to ensure that they have the…
Brown, David; Cuccurullo, Sara; Lee, Joseph; Petagna, Ann; Strax, Thomas
2008-08-01
This project sought to create an educational module including evaluation methodology to instruct physical medicine and rehabilitation (PM&R) residents in electrodiagnostic evaluation of patients with neuromuscular problems, and to verify acquired competencies in those electrodiagnostic skills through objective evaluation methodology. Sixteen residents were trained by board-certified neuromuscular and electrodiagnostic medicine physicians through technical training, lectures, and review of self-assessment examination (SAE) concepts from the American Academy of Physical Medicine & Rehabilitation syllabus provided in the Archives of Physical Medicine and Rehabilitation. After delivery of the educational module, knowledge acquisition and skill attainment were measured in (1) clinical skill in diagnostic procedures via a procedure checklist, (2) diagnosis and ability to design a patient-care management plan via chart simulated recall (CSR) exams, (3) physician/patient interaction via patient surveys, (4) physician/staff interaction via 360-degree global ratings, and (5) ability to write a comprehensive patient-care report and to document a patient-care management plan in accordance with Medicare guidelines via written patient reports. Assessment tools developed for this program address the basic competencies outlined by the Accreditation Council for Graduate Medical Education (ACGME). To test the success of the standardized educational module, data were collected on an ongoing basis. Objective measures compared resident SAE scores in electrodiagnostics (EDX) before and after institution of the comprehensive EDX competency module in a PM&R residency program. Fifteen of 16 residents (94%) successfully demonstrated proficiency in every segment of the evaluation element of the educational module by the end of their PGY-4 electrodiagnostic rotation. The resident who did not initially pass underwent remedial coursework and passed on the second attempt. Furthermore, the
Multilayer composite material and method for evaporative cooling
Buckley, Theresa M. (Inventor)
2002-01-01
A multilayer composite material and method for evaporative cooling of a person employs an evaporative cooling liquid that changes phase from a liquid to a gaseous state to absorb thermal energy. The evaporative cooling liquid is absorbed into a superabsorbent material enclosed within the multilayer composite material. The multilayer composite material has a high percentage of the evaporative cooling liquid in the matrix. The cooling effect can be sustained for an extended period of time because of the high percentage of phase change liquid that can be absorbed into the superabsorbent. Such a composite can be used for cooling febrile patients by evaporative cooling as the evaporative cooling liquid in the matrix changes from a liquid to a gaseous state to absorb thermal energy. The composite can be made with a perforated barrier material around the outside to regulate the evaporation rate of the phase change liquid. Alternatively, the composite can be made with an imperveous barrier material or semipermeable membrane on one side to prevent the liquid from contacting the person's skin. The evaporative cooling liquid in the matrix can be recharged by soaking the material in the liquid. The multilayer composite material can be fashioned into blankets, garments and other articles.
Method and apparatus for modeling, visualization and analysis of materials
Aboulhassan, Amal; Hadwiger, Markus
2016-01-01
processor and based on the received data, geometric features of the material. The example method further includes extracting, by the processor, particle paths within the material based on the computed geometric features, and geometrically modeling
The radiological protection in the nuclear medicine practice
International Nuclear Information System (INIS)
Maldonado M, H.
2010-09-01
The nuclear medicine practice dates of the 1950 years, in this work the achievements reached as regards radiological protection are shown, although even lack a lot to make, the doses for the occupationally exposed personnel have decreased with lapsing of the years, thanks to the perception of the nuclear physicians to improve the administration techniques of the radioactive material, the decrease of administered activity and the unit doses use among the most remarkable advances. The changes in the equipment s technology to quantify the activity to administer, detection systems and image formation have demanded the development of the new professionals of the nuclear medicine that allows give protection to the patient. This improvement needs to consolidate with the appropriate normative development, the involved personnel qualification and the methods and procedures actualization to improve the protection of the occupationally exposed personnel, the public, the environment and the patient. (Author)
Personalized medicine in psychiatry
DEFF Research Database (Denmark)
Wium-Andersen, Ida Kim; Vinberg, Maj; Kessing, Lars Vedel
2017-01-01
Background: Personalized medicine is a model in which a patient’s unique clinical, genetic, and environmental characteristics are the basis for treatment and prevention. Aim, method, and results: This review aims to describe the current tools, phenomenological features, clinical risk factors......, and biomarkers used to provide personalized medicine. Furthermore, this study describes the target areas in which they can be applied including diagnostics, treatment selection and response, assessment of risk of side-effects, and prevention. Discussion and conclusion: Personalized medicine in psychiatry....... The discussion proposes possible solutions to narrow this gap and to move psychiatric research forward towards personalized medicine....
Xiang, Li; Tang, Huan; Cheng, Jin-le; Chen, Yi-long; Deng, Wen; Zheng, Xia-sheng; Lai, Zhi-tian; Chen, Shi-lin
2015-12-01
Ultrafine powder and cell wall-broken powder of herbal medicine lack of the morphological characters and microscopic identification features. This makes it hard to identify herb's authenticity with traditional methods. We tested ITS2 sequence as DNA barcode in identification of herbal medicine in ultrafine powder and cell wall-broken powder in this study. We extracted genomic DNAs of 93 samples of 31 representative herbal medicines (28 species), which include whole plant, roots and bulbs, stems, leaves, flowers, fruits and seeds. The ITS2 sequences were amplified and sequenced bidirectionally. The ITS2 sequences were identified using Basic Local Alignment Search Tool (BLAST) method in the GenBank database and DNA barcoding system to identify the herbal medicine. The genetic distance was analyzed using the Kimura 2-parameter (K2P) model and the Neighbor-joining (NJ) phylogenetic tree was constructed using MEGA 6.0. The results showed that DNA can be extracted successfully from 93 samples and high quality ITS2 sequences can be amplified. All 31 herbal medicines can get correct identification via BLAST method. The ITS2 sequences of raw material medicines, ultrafine powder and cell wall-broken powder have same sequence in 26 herbal medicines, while the ITS2 sequences in other 5 herbal medicines exhibited variation. The maximum intraspecific genetic-distances of each species were all less than the minimum interspecific genetic distances. ITS2 sequences of each species are all converged to their standard DNA barcodes using NJ method. Therefore, using ITS2 barcode can accurately and effectively distinguish ultrafine powder and cell wall-broken powder of herbal medicine. It provides a new molecular method to identify ultrafine powder and cell wall-broken powder of herbal medicine in the quality control and market supervision.
Alternative methods for determination of composition and porosity in abradable materials
International Nuclear Information System (INIS)
Matejicek, Jiri; Kolman, Blahoslav; Dubsky, Jiri; Neufuss, Karel; Hopkins, Noel; Zwick, Jochen
2006-01-01
Materials properties and performance are governed by their composition and structure. These are commonly characterized using materialography and image analysis. However, in abradable materials, obtaining a reliable and representative sample (polished section) for this widespread technique is complicated by their abradable nature and heterogeneity. Therefore, alternative methods are also considered in this paper. They are namely X-ray diffraction and electron probe microanalysis to determine the composition, and mercury intrusion porosimetry, Archimedean porosimetry and helium pycnometry to determine the porosity. These methods, including materialography, were applied on representative abradable materials produced by plasma spraying; their results are compared and the advantages and drawbacks of each method are discussed
Social Medicine Then and Now: Lessons From Latin America
Waitzkin, Howard; Iriart, Celia; Estrada, Alfredo; Lamadrid, Silvia
2001-01-01
The accomplishments of Latin American social medicine remain little known in the English-speaking world. In Latin America, social medicine differs from public health in its definitions of populations and social institutions, its dialectic vision of “health–illness,” and its stance on causal inference. A “golden age” occurred during the 1930s, when Salvador Allende, a pathologist and future president of Chile, played a key role. Later influences included the Cuban revolution, the failed peaceful transition to socialism in Chile, the Nicaraguan revolution, liberation theology, and empowerment strategies in education. Most of the leaders of Latin American social medicine have experienced political repression, partly because they have tried to combine theory and political practice—a combination known as “praxis.” Theoretic debates in social medicine take their bearings from historical materialism and recent trends in European philosophy. Methodologically, differing historical, quantitative, and qualitative approaches aim to avoid perceived problems of positivism and reductionism in traditional public health and clinical methods. Key themes emphasize the effects of broad social policies on health and health care; the social determinants of illness and death; the relationships between work, reproduction, and the environment; and the impact of violence and trauma. PMID:11574316
Directory of Open Access Journals (Sweden)
FAHIM GOHARAWAN
2017-04-01
Full Text Available Techniques for the cavity measurement of the electrical characteristics of the materials are well established using the approximate method due to its simplicity in material insertion and fabrication. However, the exact method which requires more comprehensive mathematical analysis as well, owing to the practical difficulties for the material insertion, is not mostly used while performing the measurements as compared to approximate method in most of the works. In this work the comparative analysis of both the approximate as well as Exact method is performed and accuracy of the Exact method is established by performing the measurements of non-magnetic material Teflon within the cavity.
International Nuclear Information System (INIS)
Awan, F.G.; Sheikh, N.A.; Qureshi, S.A.; Sheikh, N.M.
2017-01-01
Techniques for the cavity measurement of the electrical characteristics of the materials are well established using the approximate method due to its simplicity in material insertion and fabrication. However, the exact method which requires more comprehensive mathematical analysis as well, owing to the practical difficulties for the material insertion, is not mostly used while performing the measurements as compared to approximate method in most of the works. In this work the comparative analysis of both the approximate as well as Exact method is performed and accuracy of the Exact method is established by performing the measurements of non-magnetic material Teflon within the cavity. (author)
[Prudent use price controls in Chinese medicines market: based on statistical data analysis].
Yang, Guang; Wang, Nuo; Huang, Lu-Qi; Qiu, Hong-Yan; Guo, Lan-Ping
2014-01-01
A dispute about the decreasing-price problem of traditional Chinese medicine (TCM) has recently arisen. This article analyzes the statistical data of 1995-2011 in China, the results showed that the main responsibility of expensive health care has no direct relationship with the drug price. The price index of TCM rose significantly slower than the medicine prices, the production margins of TCM affected by the material prices has been diminishing since 1995, continuous price reduction will further depress profits of the TCM industry. Considering the pros and cons of raw materials vary greatly in price, decreasing medicine price behavior will force enterprises to use inferior materials in order to maintain corporate profits. The results have the guiding meaning to medicine price management.
Pasechnyk, Olena V; Hendel, Nataliia V
2018-01-01
Introduction: The development of international legal cooperation in the field of health has largely been driven by the trade interests of states. The aim: The article analyzes the legal regulation of the circulation of medicines through the prism of the law of the World Trade Organization. Materials and methods: Using the historical legal method has allowed to analyze the genesis of legal regulation of the circulation of medicines through the prism of the law of the World Trade Organization. The dialectical method is widely used, in particular, when it comes to the issue of the ratio of market regulation of medicines circulation and public health protection, the formal logic method, in particular, in formulating the general principles, principles and methods of legal regulation in the field of medicines, as well as the systemic method, in particular, in defining the institutional component of legal regulation in the field of medicines. Review: The activities of the WTO include several areas related to health protection: international control over infectious diseases, international legal regulation of food safety (food security), tobacco control, environmental protection, international legal aspects of access and treatment of medicinal and pharmaceutical products, international legal regulation of medical services provision. Conclusions: It is proved that the right to health is a right to access to medicines. However, for many developing countries, it is problematic to obtain patents for the production of necessary medicines or to pay a license fee, which creates a barrier to the realization of the right to health.
Directory of Open Access Journals (Sweden)
О. С. Дем’янюк
2016-12-01
Full Text Available Historical review was done concerning the formation and development of scientific research of the Experimental Station of Medicinal Plants over the period 1916–2016. The main stages of experimenting in the direction of “medicinal plant cultivation’’ in Ukraine were covered. Role and importance of the Experimental Station of Medicinal Plants in the scientific and methodological support of such scientific directions as breeding, seed production, cultivation technologies, pharmacognosy in medicinal plant cultivation were shown. For the needs of the branch, over 100 species of introduced medicinal plants were studied at the Station and agricultural techniques of their growing were developed, in addition, more than 50 varieties of medicinal plants were created, a number of machines and devices for growing, harvesting and initial treatment of raw materials and seeds of the most important medicinal plants was designed. Other scientific achievements of the Station were mentioned and promising areas of medicinal plant research in Ukraine were outlined.
Mapping of medicine data with k-means and apriori combinations based on patient diagnosis
Dharshinni, N. P.; Mawengkang, H.; Nasution, M. K. M.
2018-03-01
Medicine is one of the items needed by sick society, the high influence of medicine on service and the economy in hospitals, requires mapping and planning the optimal need for medicines according to the conditions, because 50% -60% of hospital income is sourced from medicine sales. The purpose of this study was to find patterns of doctor’s prescription medicine association with sales data using an apriori algorithm based on data grouping using a k-means algorithm. The results of the experiments show that medicine prescription data with medicine sales have significant differences so that the data can not be used as materials for medicine planning, this is due to some indication of one of the unavailability of medicine caused by mapping inaccuracy so that the planning of medicine requirements is not optimal. The results of this analysis can be used as input materials in decision making, so the planning needs of medicines can be in accordance with the development of patient disease patterns.
Monographs for medicines on WHO’s Model List of Essential Medicines
Adler, Melissa; Jain, Tanvi; Bempong, Daniel
2018-01-01
Abstract Objective To raise awareness about the importance of public pharmaceutical standards, identify if and, if so, where current pharmacopeias are falling short in the development of new and complete monographs and foster collaboration among the various pharmacopeias, to prioritize, develop and make available standards for those key medicines for which no complete monographs exist. Methods In August 2017, we mined eight pharmacopeias to identify which of the 669 medicines in the 20th edition of the World Health Organization’s Model List of Essential Medicines were covered by complete or incomplete monographs. The pharmacopeias we included were the Brazilian Pharmacopoeia, the British Pharmacopoeia, the Indian Pharmacopeia Commission, the International Pharmacopoeia, the Japanese Pharmacopoeia, the Mexican Pharmacopoeia, the Pharmacopeia of the People’s Republic of China and the United States Pharmacopeia. Findings For 99 (15%) of the medicines on the Model List, no monographs were available in any of the eight pharmacopeias investigated. Only 3% (1/30) of the cardiovascular medicines listed, but 28% (9/32) of the antiretroviral medicines and 23% (6/26) of the antimalarial medicines lacked monographs. Conclusion There appear to be no public standards for many so-called essential medicines. To address this shortfall, a greater collaboration in the global health community is needed.
Patent Medicine VendorsAND#8217; Clients: Medicine Use Behaviour
Directory of Open Access Journals (Sweden)
Asa Auta
2012-12-01
Full Text Available AIM: To investigate some medicine use behaviour of Patent Medicine Vendors’ (PMVs clients including self medication practice and medication sharing behaviour. METHOD: A descriptive, cross-sectional survey was conducted in July 2011, on 361 undergraduate students of the University of Jos, Nigeria who visited PMVs within a month preceding the study. A pretested questionnaire was administered to participating students. Participants responded to questions on demography, and medicine use behaviour. Data were entered into the Statistical Package for Social Sciences (SPSS version 16 to generate descriptive statistics which were represented in percentages. RESULTS: The results showed that majority of the respondents (91.7% visited the PMVs for self-medication with the common classes of medicines procured by PMVs clients including analgesics (38.4%, antimalarials (22.2% and nutrition/blood preparations (14.1%. About 78.5% of the medicines sold to PMVs clients were in their original package and only 45.9% of clients reported checking the expiry date of their procured medicine prior to use. Medication sharing behaviour was common (60.2% among respondents. Although most respondents (70.2% said they had read a medicine information leaflet in the past, majority of them depended on unreliable sources such as friends/relatives (23.2%, media (10.8% and the internet (9.9% for medicine information. CONCLUSION: The study therefore demonstrated that PMV clients are those on self-medication practices and medication sharing behaviour is high among them. [TAF Prev Med Bull 2012; 11(6.000: 681-686
International Nuclear Information System (INIS)
Affram, R.K.; Kyere, K.; Amuasi, J.
1991-01-01
The background to the introduction and application of radioisotopes in medicine culminating in the establishment of the nuclear Medicine Unit at the Korle Bu Teaching Hospital, Ghana, has been examined. The Unit has been involved in important clinical researches since early 1970s but routine application in patient management has not always been possible because of cost per test and lack of continuous availability of convertible currency for the purchase of radioisotopes which are not presently produced by the National Nuclear Research Institute at Kwabenya. The capabilities and potentials of the Unit are highlighted and a comparison of Nuclear Medicine techniques to other medical diagnostic and imaging methods have been made. There is no organised instruction in the principles of medical imaging and diagnostic methods at both undergraduate and postgraduate levels in Korle Bu Teaching Hospital which has not promoted the use of Nuclear Medicine techniques. The development of a comprehensive medical diagnostic and imaging services is urgently needed. (author). 18 refs., 3 tabs
Complementary and alternative medicine use in children with thalassaemia.
Efe, Emine; Işler, Ayşegül; Sarvan, Süreyya; Başer, Hayriye; Yeşilipek, Akif
2013-03-01
The aims of this study were to: (1) determine the types of complementary and alternative medicine use among children with thalassaemia as reported by parents and (2) describe sociodemographic and medical factors associated with the use of such treatments in families residing in southern Turkey. Thalassaemia is one of the most common human genetic diseases. Despite the therapeutic efforts, patients will encounter a variety of physical and psychological problems. Therefore, the use of complementary and alternative medicines among children thalassaemia is becoming increasingly popular. This is a descriptive study of complementary and alternative medicine. This study was conducted in the Hematology Outpatient Clinic at Akdeniz University Hospital and in the Thalassemia Centre at Ministry of Health Antalya Education and Research Hospital, Antalya, Turkey, between January 2010-December 2010. Parents of 97 paediatric patients, among 125 parents who applied to the haematology outpatient clinic and thalassaemia centre between these dates, agreed to take part in the study with whom contact could be made were included. Data were collected by using a questionnaire. The proportion of parents who reported using one or more of the complementary and alternative medicine methods was 82·5%. Of these parents, 61·8% were using prayer/spiritual practice, 47·4% were using nutritional supplements and 35·1% were using animal materials. It was determined that a significant portion of the parents using complementary and alternative medicine use it to treat their children's health problems, they were informed about complementary and alternative medicine by their paediatricians and family elders, and they have discussed the use of complementary and alternative medicine with healthcare professionals. To sustain medical treatment and prognosis of thalassaemia, it is important for nurses to consult with their patients and parents regarding the use and potential risks of some complementary
Assessment of knowledge of general practitioners about nuclear medicine
International Nuclear Information System (INIS)
Zakavi, R.; Derakhshan, A.; Pourzadeh, Z.
2002-01-01
Nuclear medicine is an important department in most of scientific hospitals in the world. Rapid improvement in the filed of nuclear medicine needs continuing education of medical students. We tried to evaluate the knowledge of general practitioners in the flied of nuclear medicine, hoping that this study help mangers in accurate planning of teaching programs. Methods and materials: We prepared a questionnaire with 14 questions regarding applications of nuclear medicine techniques in different specialities of medicine. We selected questions as simple as possible with considering the most common techniques and best imaging modality in some disease. One question in nuclear cardiology, one in lung disease, two questions in thyroid therapy, another two in gastrointestinal system, two in genitourinary system and the last two in nuclear oncology. Also 4 questions were about general aspects of nuclear medicine. We have another 4 questions regarding the necessity of having a nuclear medicine subject during medical study, the best method of teaching of nuclear medicine and the preferred method of continuing education. Also age, sex, graduation date and university of education of all subjects were recorded. Results: One hundred (General practitioners) were studied. including, 58 male and 42 female with age range of 27-45 years did . About 60% of cases were 27-30 years old and 40 cases were older than 40. Seventy two cases were graduated in the last 5 years. Mashad University was the main university of education 52 cases with Tehran University (16 cases) and Tabriz University (6 cases) in the next ranks. Also 26 cases were graduated from other universities. From four questions in the field of general nuclear nedione 27% were correctly answered to all questions, 37% correctly answered two questions and 10% had correct answered only one question. No correct answer was noted in 26% . correct answer was noted in 80% the held of nuclear cardiology and in 72% in the field of lung
WEST AFRICAN JOURNAL OF MEDICINE
African Journals Online (AJOL)
user1
the Unified Parkinson Disease Rating Scale (UPDRS) motor ... †Neurology Unit, Department of Medicine, ‡Department of Chemical Pathology, College of Medicine, University of Lagos & Lagos ... Study Site and Recruitment Method. The study ...
The mechanical spectra of deposited materials by a composite reed vibration method
International Nuclear Information System (INIS)
Ying, X.N.; Zhang, L.; Yuan, Y.H.
2010-01-01
Recently a composite reed vibration method has been designed to measure the mechanical spectra (complex Young's modulus) of materials from liquid to solid state. The mechanical spectra of materials can be obtained from a composite system consisting of a substrate reed and of materials deposited on it. In this report, two sets of formulas to calculate the mechanical spectra of deposited materials are further analyzed. The proof is given for the previous named 'approximate formulas' (labeled as Formula II). Then the composite reed vibration method can be safely used as an extension of the mechanical spectrum method of the thin solid film. At the same time, some comments are made on previous analytical formulas (labeled as Formula I). At last, more experiments with a small amount of deposited materials are performed. It is found that smaller quantity is more favorable to achieve the intrinsic mechanical spectra of deposited materials.
A concise guide to nuclear medicine
Elgazzar, Abdelhamid H
2011-01-01
Nuclear medicine is an important component of modern medicine. This easy-to-use book is designed to acquaint readers with the basic principles of nuclear medicine, the instrumentation used, the gamut of procedures available, and the basis for selecting specific diagnostic or therapeutic procedures and interpreting results. After an introductory chapter on the history, technical basis, and scope of nuclear medicine, a series of chapters are devoted to the application of nuclear medicine techniques in the different body systems. In addition, the use of nuclear medicine methods within oncology is
Medicinal plants: production and biochemical characterization
International Nuclear Information System (INIS)
Chunzhao Liu; Zobayed, S.M.A; Murch, S.J.; Saxena, P.K.
2002-01-01
Recent advances in the area of biotechnology offer some possibility for the development of new technologies for the conservation, characterization and mass production of medicinal plant species, (i.e. in vitro cell culture techniques for the mass production of sterile, consistent, standardized medicinal plant materials). This paper discussed the following subjects - plant tissue culture, de novo shoot organogenesis, de novo root organogenesis, somatic embryogenesis, large scale propagation in bioreactors and discovery of unique biomolecules
Herbal Medicines: from Traditional Medicine to Modern Experimental Approaches
Directory of Open Access Journals (Sweden)
Bahram Rasoulian
2017-03-01
Full Text Available Academic writings indicate that the medicinal use of plants dates back to 4000 - 5000 B.C. (1. Utilization of medicinal herbs has indeed a long history not only in human's life, but also in animals and there are some interesting evidences about the animals' self-medication, in both the prevention and treatment of diseases (2-5. The World Health Organization (WHO has recognized the importance of traditional medicines and created strategies, guidelines and standards for botanical medicines (6, 7. A significant part of those traditional text dealing with medicine, which were appreciated by ancient scientific communities worldwide, such as The Canon of Medicine by Persian physician–philosopher Ibn Sina (or Avicenna, 980 to 1032 AD, is allocated to herbal medicines. The Canon explores nearly 500 medicinal plants and herbal drugs. It should be noted that this book was used as a medical textbook in Europe until the 17th century AD (8, 9. Although there are important evidences about using some kinds of experimental approaches in traditional medicine (8, the efficacy of such approaches is in doubt because it is generally agreed that they might have been part of physicians' personal experiences. Not only the demand for herbal drugs is growing in developing countries, but also there are some evidences that consumers in developed countries are becoming disillusioned with modern healthcare; hence, the demand for traditional alternatives including herbal medicines is increasing in developing countries (10. On the one hand, the increased interest in herbal medicines throughout the world (10, 11, on the other hand, the need for direct empirical evidence about the effectiveness of herbal medicines in the proper statistical society with the appropriate number and method, denote the significance of new studies about medicinal plants and publishing their results. Herbal Medicines Journal (eISSN: 2538-2144 reports valuable research results for researchers all
Study of Herbal Medicine in Zirrah (Touz /Dashtestan/Bushehr province
Directory of Open Access Journals (Sweden)
Mohammad ali Ziraee
2015-09-01
Full Text Available Background: Ethnopharmacology has been seen as a multidisciplinary approach for novel drug discovery by providing valuable data about medicinal plants in different cultures. The aim of this ethnopharmacological study was to identify medicinal plants of the Zirrah (Touz/Dashtestan/Bushehr province in the North of Persian Gulf. Material and Methods: The medical uses of medicinal plants were gathered from 23 local informants by face to face interviews. The relative frequency of citation (FRC and cultural importance (CI indices were calculated. Results: A total of 131 medicinal plants belonging to 62 families were identified. Malva sylvestris, Zataria multiflora, Terminalia chebula, Cuminum cyminum, Foenicum vulgare, Olivera decumbens, Echium amoenum, Teucriuma polium, Cannabis sativa and Papaver somniferum had the highest cultural importance indices. Ducrosia anethifolia Bioss, Nigella sativa, Capparis spinosa and Urtica dioica had the highest FRC indices. The highest medical uses were for gastrointestinal diseases, gynecological diseases and dermatological uses, infectious diseases, nature of cool and metabolic disorders, respectively. Conclusion: There is a vast variety of medicinal plants in Zirrah (Touz/Dashtestan/Bushehr province. Although most of therapeutic applications of these plants in the Zirrah (Touz/Dashtestan/Bushehr province are the same as Iran’s traditional medicine, but the people of this region use some of these plants for some diseases which are unique for this area. Thus, investigation about these plants should be initiated to discover novel drugs for clinical applications.
Medicinal plants from Mali: Chemistry and biology.
Wangensteen, Helle; Diallo, Drissa; Paulsen, Berit Smestad
2015-12-24
Mali is one of the countries in West Africa where the health system rely the most on traditional medicine. The healers are mainly using medicinal plants for their treatments. The studies performed being the basis for this review is of importance as they will contribute to sustaining the traditional knowledge. They contribute to evaluate and improve locally produced herbal remedies, and the review gives also an overview of the plant preparations that will have the most potential to be evaluated for new Improved Traditional Medicines. The aim of this review is to give an overview of the studies performed related to medicinal plants from Mali in the period 1995-2015. These studies include ethnopharmacology, chemistry and biological studies of the plants that were chosen based on our interviews with the healers in different regions of Mali, and contribute to sustainable knowledge on the medicinal plants. The Department of Traditional Medicine, Bamako, Mali, is responsible for registering the knowledge of the traditional healers on their use of medicinal plants and also identifying compounds in the plants responsible for the bioactivities claimed. The studies reported aimed at getting information from the healers on the use of medicinal plants, and study the biology and chemistry of selected plants for the purpose of verifying the traditional use of the plants. These studies should form the basis for necessary knowledge for the development of registered Improved Traditional Medicines in Mali. The healers were the ethnopharmacological informants. Questions asked initially were related to wound healing. This was because the immune system is involved when wounds are healed, and additionally the immune system is involved in the majority of the illnesses common in Mali. Based on the results of the interviews the plant material for studies was selected. Studies were performed on the plant parts the healers were using when treating their patients. Conventional chromatographic
Acceptability of a future phantoms bank for quality control in nuclear medicine
International Nuclear Information System (INIS)
Ferreira, Fernanda Carla Lima; Souza, Divanizia do Nascimento
2011-01-01
Objective: The present study was aimed at determining the acceptability of a national or regional phantoms bank to be deployed in Brazil for shared use in quality control activities by nuclear medicine centers. Materials and Methods: The authors analyzed the answers to a questionnaire applied to medical physicists and radioprotection supervisors in Brazilian nuclear medicine centers. Initially, the questionnaire was validated by professionals in the city of Aracaju, SE, which is located in the Northeast region. The present study sample was geographically distributed as follows: the Northeast region, with answers from 13 professionals of nuclear medicine centers; the North region, with 2 professionals; the South region, with 7 professionals; the Southeast region, with 43 professionals; and the Midwest region, with 2 professionals. Results: According to the data analyzed, 82% of the respondents consider that the implementation of a phantoms bank would be a suitable alternative for improving nuclear medicine quality control. The interest in sharing the bank was reported by 87% of the respondents. Conclusion: The present study demonstrated the motivation for a shared use of a future phantoms bank. (author)
Acceptability of a future phantoms bank for quality control in nuclear medicine
Energy Technology Data Exchange (ETDEWEB)
Ferreira, Fernanda Carla Lima; Souza, Divanizia do Nascimento, E-mail: fernacarlaluan@gmail.co [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Program of Post-Graduation in Physics
2011-03-15
Objective: The present study was aimed at determining the acceptability of a national or regional phantoms bank to be deployed in Brazil for shared use in quality control activities by nuclear medicine centers. Materials and Methods: The authors analyzed the answers to a questionnaire applied to medical physicists and radioprotection supervisors in Brazilian nuclear medicine centers. Initially, the questionnaire was validated by professionals in the city of Aracaju, SE, which is located in the Northeast region. The present study sample was geographically distributed as follows: the Northeast region, with answers from 13 professionals of nuclear medicine centers; the North region, with 2 professionals; the South region, with 7 professionals; the Southeast region, with 43 professionals; and the Midwest region, with 2 professionals. Results: According to the data analyzed, 82% of the respondents consider that the implementation of a phantoms bank would be a suitable alternative for improving nuclear medicine quality control. The interest in sharing the bank was reported by 87% of the respondents. Conclusion: The present study demonstrated the motivation for a shared use of a future phantoms bank. (author)
Ethnopharmacology of Medicinal Plants in Genaveh Port
Directory of Open Access Journals (Sweden)
Leila Moradi
2014-11-01
Full Text Available Background: Ethnopharmacology has been seen as a multidisciplinatary approach for novel drug discovery by providing valuable data about medicinal plants in different cultures. The aim of this ethnopharmacological study was to identify medicinal plants of the Genaveh port in the North of Persian Gulf. Material and Methods: The medical uses of medicinal plants were gathered from 30 local informants by face to face interview. The relative frequency of citation (FRC and cultural importance (CI indices were calculated. Results: A total of 93 medicinal plants belonging to 55 families were identified. Plantago psyllium, Teucrium polium, Peganum harmala, Descuraninia sophia, Cichorium intybus, Achillea erophora DC, Matricarria charmomilla and Citrolus colocynthis had the highest cultural importance indices. Plantago psyllium, Descuraninia sophia and Zataria multiflora had the highest FRC indices. The highest medical uses were for gastrointestinal diseases, gynocological diseases, respiratory disorders, infectious diseases, nature of cool and metabolic disorders, respectively. In addition to the use of these plants to treat diseases as in Iran’s traditional medicine, people in the Genaveh port particularly use Plantago psyllium for drainage of infective boils and abscesses, cough, skin diseases, Teucrium polium for diabetes mellitus, wound washing and sterilizing, Peganum harmala for uterus infections and abdominal cramps, Descuraninia sophia for heart diseases and heatstroke, Cichorium intybus for heatstroke and liver diseases, Achillea eriophora DC for reflex, diabetes mellitus and wound healing, Matricarria charmomilla for seizure and dysmenorrhea, Citrolus colocynthis for hemorrhoid, diabetes mellitus and rheumatism and Zataria multiflora for sedation, abdominal pain and respiratory diseases. Conclusion: There is a vast variety of medicinal plants in Genaveh port. Although most of therapeutic applications of these plants in the Genaveh port are the
Nanotechnology in medicine: concepts and concerns
International Nuclear Information System (INIS)
Cancino, Juliana; Marangoni, Valeria S.; Zucolotto, Valtencir
2014-01-01
The recent advances in the development of nanomaterials have opened new and exciting opportunities for their applications in medicine. These applications include molecular imaging, drug-delivery, and photothermal therapy. Despite the progress in medicinal applications of nanomaterials, several key problems remain unaddressed. Recent advances in this area include the enhancement of sensitivity in early diagnosis and therapy, in addition to investigations into the possible toxicity of nanomaterials. However, since little is known about the toxicity of nanomaterials, the regulation of these materials is a slow and complex process. This paper reviews the current scenario in the applications of nanomaterials in medicine as well as the main concerns and regulatory questions. (author)
Methods of evaluation of procurement of material resources
Directory of Open Access Journals (Sweden)
Dupina L.F.
2017-04-01
Full Text Available the researchers of this article analyze some questions concerning the choice of methods of material resources evaluation, types and elements of the evaluation, organization of effective accounting and analytical support of material and production resources of enterprises.
2016-03-01
Medicinal plants provide indigenous and peasant communities worldwide with means to meet their healthcare needs. Homegardens often act as medicine cabinets, providing easily accessible medicinal plants for household needs. Social structure and social exchanges have been proposed as factors influencing the species diversity that people maintain in their homegardens. Here, we assess the association between the exchange of medicinal knowledge and plant material and medicinal plant richness in homegardens. Using Tsimane' Amazonian homegardens as a case study, we explore whether social organization shapes exchanges of medicinal plant knowledge and medicinal plant material. We also use network centrality measures to evaluate people's location and performance in medicinal plant knowledge and plant material exchange networks. Our results suggest that social organization, specifically kinship and gender relations, influences medicinal plant exchange patterns significantly. Homegardens total and medicinal plant species richness are related to gardeners' centrality in the networks, whereby people with greater centrality maintain greater plant richness. Thus, together with agroecological conditions, social relations among gardeners and the culturally specific social structure seem to be important determinants of plant richness in homegardens. Understanding which factors pattern general species diversity in tropical homegardens, and medicinal plant diversity in particular, can help policy makers, health providers, and local communities to understand better how to promote and preserve medicinal plants in situ. Biocultural approaches that are also gender sensitive offer a culturally appropriate means to reduce the global and local loss of both biological and cultural diversity.
Neutron activation analysis of heavy metal elements in Chinese medicines and medical herbs
International Nuclear Information System (INIS)
Furuta, Etsuko; Ishihara, Sachiko; Okumura, Ryou; Iinuma, Yuuto
2014-01-01
'Kanpo (Chinese method)' is a kind of traditional Chinese medical science, and 'Kanpo-yaku (Chinese medicines)' is the drugs on the basis of this medical science. The raw materials for Chinese medicines mainly use ingredients derived from nature, such as herbs, parts of living animal body, and ores, and these are collectively referred to as crude drugs. Using instrumental neutron activation analysis, this study performed the qualitative and quantitative analysis of metal elements contained in the Chinese medicines and crude drugs that were obtained from five routes of four countries. It divided totally 119 samples to each purchase root, and summarized the quantitative analytical results with a focus on Cr, Co, As, Sb, and Hg, and found variations in the contents between the natures of the samples. A large amount of As was detected in two samples of 'Oriental bezoar' and 'Liushen pill,' which were purchased from China under doctors' prescriptions. As a result of the analysis of 47 plant samples purchased from Vietnam as the raw materials for Chinese medicines, a higher percentage of Hg was found compared with other samples. This fact suggests that Chinese medicines using medical herbs derived from plants are liable to contains not a little Hg. Large variations in the content of each sample suggest that the contents are dependent on the country of origin, as well as types and parts of plants. As for the samples purchased in Japan, the detected percentages of five target elements were the smallest. (A.O.)
A rapid identification of four medicinal chrysanthemum varieties with near infrared spectroscopy.
Han, Bangxing; Yan, Hui; Chen, Cunwu; Yao, Houjun; Dai, Jun; Chen, Naifu
2014-07-01
For genuine medicinal material in Chinese herbs; the efficient, rapid, and precise identification is the focus and difficulty in the filed studying Chinese herbal medicines. Chrysanthemum morifolium as herbs has a long planting history in China, culturing high quality ones and different varieties. Different chrysanthemum varieties differ in quality, chemical composition, functions, and application. Therefore, chrysanthemum varieties in the market demands precise identification to provide reference for reasonable and correct application as genuine medicinal material. A total of 244 batches of chrysanthemum samples were randomly divided into calibration set (160 batches) and prediction set (84 batches). The near infrared diffuses reflectance spectra of chrysanthemum varieties were preprocessed by first order derivative (D1) and autoscaling and was built model with partial least squares (PLS). In this study of four chrysanthemum varieties identification, the accuracy rates in calibration sets of Boju, Chuju, Hangju, and Gongju are respectively 100, 100, 98.65, and 96.67%; while the accuracy rates in prediction sets are 100% except for 99.1% of Hangju. The research results demonstrate that the qualitative analysis can be conducted by machine learning combined with near infrared spectroscopy (NIR), which provides a new method for rapid and noninvasive identification of chrysanthemum varieties.
Qualification Methods of Al2O3 Injection Molding Raw Materials
International Nuclear Information System (INIS)
Egész, Á; Gömze, L A
2015-01-01
For producing ceramic arc tube parts (plugs), there are used two different major components for producing injection molding raw material (feedstock): high purity alumina powder as the main component, and an organic paraffin wax as a binder material. It is expressly important to know the material, physical and chemical properties of these components, since mainly these have effect on the homogenity of feedstock, and therefore on the quality of end product. In this research, both of the main components and the moldable raw material was investigated by visual, physical, and thermal methods. As most important and main statement, the researchers found that the dynamic viscosity of raw material depends more on the applied temperature, than on the deformation speed gradient.Applied analitycal methods were laser granulometry, sieve analysis, differential thermal analysis and rheology analysis. (paper)
Application of isotopes in traditional Chinese medicine
International Nuclear Information System (INIS)
Ye Ling; Liu Ning; Yang Yuanyou; Mo Shangwu
2006-01-01
Modernization of traditional Chinese medicine necessitates many new or advanced methods. Among these methods, isotopes are considered to be a convenient, fast and feasible method. The recent advance of isotope's application to traditional Chinese medicine is reviewed. In addition, their present status, problems and prospect are discussed. (authors)
Your Radiologist Explains Nuclear Medicine
Full Text Available ... other diagnostic tests. Nuclear medicine imaging procedures use small amounts of radioactive materials – called radiotracers – that are ... However, because the amount of radiotracer used is small, the level of radiation exposure is relatively low ...
Medicinal Herbs in Iranian Traditional Medicine for Learning and Memory
Shojaii, Asie; Ghods, Roshanak; Fard, Mehri Abdollahi
2016-01-01
Background: A few factors such as age, stress, and emotions may lead to impaired learning, memory loss, amnesia, and dementia or threats like schizophrenia and Alzheimer?s disease (AD). Iranian traditional medicine (ITM) recommends some herbs and herbal preparations for the treatment or prevention of CNS problems. Methods: In this study, scientific evidence related to the effectiveness of ITM herbal medicine on memory, learning and AD is reviewed. The scientific evidence of plant efficacy was...
International Nuclear Information System (INIS)
Durak, H.
2001-01-01
recently installed in 2000, one in Istanbul and one in Izmir with 2 private PET centers. PET centers in Ankara are on the way. Turkish Atomic Energy Agency provides license for nuclear medicine departments and therapy wards according to the written regulations. The import and nationwide transport of radioactive substances and disposal of wastes are under the control of this agency. All nuclear medicine clinics need to be licensed by this agency in order to purchase radioactive materials
Method of distilling solid materials, such as shale
Energy Technology Data Exchange (ETDEWEB)
Ramen, A
1917-09-04
A method of distilling compact materials, such as shales, containing volatile matter, is characterized by heating the material in an oven or other apparatus or in a section or zone of same in the presence of some condensable gas (such as steam) which is indifferent to the vapors distillated during the heating of the material. The gas together with these products is conducted through a condensation apparatus, containing water or some other liquid, where the volatile matters are condensed. The steam which is produced in the gas regenerator is, after preheating, forced through the hot remaining residue from the distillation either in the same retort or in another retort in order to heat further this residue for the purpose of making it possible for the steam, by being forced through freshly charged material in the first oven or apparatus to bring about its distillation. The patent contains ten additional claims.
Multi-scale calculation based on dual domain material point method combined with molecular dynamics
Energy Technology Data Exchange (ETDEWEB)
Dhakal, Tilak Raj [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2017-02-27
This dissertation combines the dual domain material point method (DDMP) with molecular dynamics (MD) in an attempt to create a multi-scale numerical method to simulate materials undergoing large deformations with high strain rates. In these types of problems, the material is often in a thermodynamically non-equilibrium state, and conventional constitutive relations are often not available. In this method, the closure quantities, such as stress, at each material point are calculated from a MD simulation of a group of atoms surrounding the material point. Rather than restricting the multi-scale simulation in a small spatial region, such as phase interfaces, or crack tips, this multi-scale method can be used to consider non-equilibrium thermodynamic e ects in a macroscopic domain. This method takes advantage that the material points only communicate with mesh nodes, not among themselves; therefore MD simulations for material points can be performed independently in parallel. First, using a one-dimensional shock problem as an example, the numerical properties of the original material point method (MPM), the generalized interpolation material point (GIMP) method, the convected particle domain interpolation (CPDI) method, and the DDMP method are investigated. Among these methods, only the DDMP method converges as the number of particles increases, but the large number of particles needed for convergence makes the method very expensive especially in our multi-scale method where we calculate stress in each material point using MD simulation. To improve DDMP, the sub-point method is introduced in this dissertation, which provides high quality numerical solutions with a very small number of particles. The multi-scale method based on DDMP with sub-points is successfully implemented for a one dimensional problem of shock wave propagation in a cerium crystal. The MD simulation to calculate stress in each material point is performed in GPU using CUDA to accelerate the
Visualization of DNA in highly processed botanical materials.
Lu, Zhengfei; Rubinsky, Maria; Babajanian, Silva; Zhang, Yanjun; Chang, Peter; Swanson, Gary
2018-04-15
DNA-based methods have been gaining recognition as a tool for botanical authentication in herbal medicine; however, their application in processed botanical materials is challenging due to the low quality and quantity of DNA left after extensive manufacturing processes. The low amount of DNA recovered from processed materials, especially extracts, is "invisible" by current technology, which has casted doubt on the presence of amplifiable botanical DNA. A method using adapter-ligation and PCR amplification was successfully applied to visualize the "invisible" DNA in botanical extracts. The size of the "invisible" DNA fragments in botanical extracts was around 20-220 bp compared to fragments of around 600 bp for the more easily visualized DNA in botanical powders. This technique is the first to allow characterization and visualization of small fragments of DNA in processed botanical materials and will provide key information to guide the development of appropriate DNA-based botanical authentication methods in the future. Copyright © 2017 Elsevier Ltd. All rights reserved.
von Woedtke, Th.; Reuter, S.; Masur, K.; Weltmann, K.-D.
2013-09-01
Plasma medicine is an innovative and emerging field combining plasma physics, life science and clinical medicine. In a more general perspective, medical application of physical plasma can be subdivided into two principal approaches. (i) “Indirect” use of plasma-based or plasma-supplemented techniques to treat surfaces, materials or devices to realize specific qualities for subsequent special medical applications, and (ii) application of physical plasma on or in the human (or animal) body to realize therapeutic effects based on direct interaction of plasma with living tissue. The field of plasma applications for the treatment of medical materials or devices is intensively researched and partially well established for several years. However, plasma medicine in the sense of its actual definition as a new field of research focuses on the use of plasma technology in the treatment of living cells, tissues, and organs. Therefore, the aim of the new research field of plasma medicine is the exploitation of a much more differentiated interaction of specific plasma components with specific structural as well as functional elements or functionalities of living cells. This interaction can possibly lead either to stimulation or inhibition of cellular function and be finally used for therapeutic purposes. During recent years a broad spectrum of different plasma sources with various names dedicated for biomedical applications has been reported. So far, research activities were mainly focused on barrier discharges and plasma jets working at atmospheric pressure. Most efforts to realize plasma application directly on or in the human (or animal) body for medical purposes is concentrated on the broad field of dermatology including wound healing, but also includes cancer treatment, endoscopy, or dentistry. Despite the fact that the field of plasma medicine is very young and until now mostly in an empirical stage of development yet, there are first indicators of its enormous
Application of case analysis teaching method in nursing teaching in Department of Internal Medicine
Directory of Open Access Journals (Sweden)
Zhang-xiu SHENG
2014-04-01
Full Text Available Objective:In order to adapt to the modern occupation education teaching idea, to stimulate students’ interest in learning, training students' comprehensive quality, improve the students' active participation, understanding, analysis and problem solving skills. Methods: I In the course of different stages using teaching methods of case analysis: case introduction before class teaching method, case analysis during and after class teaching method, and case analysis of the whole chapter after class teaching method. Results and Conclusion: Through the course of different stages of using case analysis teaching method, we can launch the students’ active learning, stimulate the students' interest in learning, activate classroom atmosphere, train students' independent thinking, strengthen the problems solving ability, improve the self-learning ability of students, activate their participation and awareness, analysis, judgment, introduction, and strengthen students' exam ability, improve the test scores of students and the teaching effect of nursing in Department of internal medicine.
A method for prevention of radioactive material release
International Nuclear Information System (INIS)
Uchida, Shunsuke; Sato, Chikara; Kitamura, Masao.
1975-01-01
Object: To provide a method for preventing an underwater radioactive material from being released in a simple and highly reliable manner, which can decrease an amount of radioactive materials discharged into open air from reactor water containing a large amount of radioactive materials such as a reactor core pool. Structure: Pure warm water higher in temperature than that of reactor water is poured from the top of a water surface of a water tank which stores reactor water containing radioactive materials such as radioactive iodine, and water is drawn through an outlet located downwardly of the pure warm water inlet to form a layer of pure warm water at the upper part of the water tank while preventing diffusion of the reactor water into the pure warm water by the difference in density between the reactor water and the pure warm water and downward movement of the pure warm water, thereby preventing contact of the reactor water with the atmosphere and diffusion of the radioactive material into the atmosphere. (Kamimura, M.)
International Nuclear Information System (INIS)
Virgilio, Alex; Nóbrega, Joaquim A.; Rêgo, Jardes F.; Neto, José A. Gomes
2012-01-01
A method for Cr determination in medicinal plants using direct solid sampling graphite furnace high-resolution continuum source atomic absorption spectrometry was developed. Modifiers were dispensable. Pyrolysis and atomization temperatures were 1500 °C and 2400 °C, respectively. Slopes of calibration curves (50–750 pg Cr, R 2 > 0.999) using aqueous and solid standards coincides in 96%, indicated feasibility of aqueous calibration for solid sampling of medicinal plants. Accuracy was checked by analysis of four plant certified reference materials. Results were in agreement at 95% confidence level with certified and non-certified values. Ten samples of medicinal plants were analyzed and Cr contents were in the 1.3–17.7 μg g −1 Cr range. The highest RSD (n = 5) was 15.4% for the sample Melissa officinalis containing 13.9 ± 2.1 μg g −1 Cr. The limit of detection was 3.3 ng g −1 Cr. - Highlights: ► Direct solid sampling is first time employed for Cr in plant materials. ► Calibration curves with liquids and solids are coincident. ► Microanalysis of plants for Cr is validated by reference materials. ► The proposed HR-CS GF AAS method is environmental friendly.
Energy Technology Data Exchange (ETDEWEB)
Virgilio, Alex; Nobrega, Joaquim A. [Department of Chemistry, Federal University of Sao Carlos, Post Office Box 676, 13560-970, Sao Carlos-SP (Brazil); Rego, Jardes F. [Department of Analytical Chemistry, Institute of Chemistry, Sao Paulo State University-UNESP, Post Office Box 355, 14801-970, Araraquara-SP (Brazil); Neto, Jose A. Gomes, E-mail: anchieta@iq.unesp.br [Department of Analytical Chemistry, Institute of Chemistry, Sao Paulo State University-UNESP, Post Office Box 355, 14801-970, Araraquara-SP (Brazil)
2012-12-01
A method for Cr determination in medicinal plants using direct solid sampling graphite furnace high-resolution continuum source atomic absorption spectrometry was developed. Modifiers were dispensable. Pyrolysis and atomization temperatures were 1500 Degree-Sign C and 2400 Degree-Sign C, respectively. Slopes of calibration curves (50-750 pg Cr, R{sup 2} > 0.999) using aqueous and solid standards coincides in 96%, indicated feasibility of aqueous calibration for solid sampling of medicinal plants. Accuracy was checked by analysis of four plant certified reference materials. Results were in agreement at 95% confidence level with certified and non-certified values. Ten samples of medicinal plants were analyzed and Cr contents were in the 1.3-17.7 {mu}g g{sup -1} Cr range. The highest RSD (n = 5) was 15.4% for the sample Melissa officinalis containing 13.9 {+-} 2.1 {mu}g g{sup -1} Cr. The limit of detection was 3.3 ng g{sup -1} Cr. - Highlights: Black-Right-Pointing-Pointer Direct solid sampling is first time employed for Cr in plant materials. Black-Right-Pointing-Pointer Calibration curves with liquids and solids are coincident. Black-Right-Pointing-Pointer Microanalysis of plants for Cr is validated by reference materials. Black-Right-Pointing-Pointer The proposed HR-CS GF AAS method is environmental friendly.
The applications of nanomaterials in nuclear medicine
International Nuclear Information System (INIS)
Liu Jinjian; Liu Jianfeng
2010-01-01
Over the last decade, nanotechnology and nanomaterials have gained rapid development in medical application, especially in targeted drug delivery and gene transfer vector domain, and nano-materials are also beginning to applied in nuclear medicine. This paper is to make a view of the application research of several types of nanomaterials in nuclear medicine, and discuss some problems and the main direction of future development. (authors)
Do we need a ''green medicine''?; Brauchen wir ''Gruene Medizin?''
Energy Technology Data Exchange (ETDEWEB)
Bauer, M.; Daschner, F.; Scherrer, M. [Universitaetsklinikum Freiburg (Germany)
2006-07-01
Spontaneously, we do associate ''green medicine'' with terms like naturopathy, natural healing substances, herbal active agents, homeopathy, healthy food, preventive medicine and similar things, and finally we think of ecology. This is the focus of the following article. First of all, the following question arises: Are there any environment-friendly and cost-saving alternatives to the present medicine? There is an increasing number of environment-caused diseases. Therefore, a medicine not coping with the environment is not credible. In today's medicine, for example, there are too many persistent detergents, water-polluting disinfectants, and many disposable materials. Too much water ist consumed, whereas the use of renewable energies is only limited. And too little natural healing methods are applied in diagnostics and therapy. Presently, in Germany, 16,7 million in-patients are treated in Germany, 1,16 million out-patients have surgeries in 2166 hospitals by ca. 1,1 million medical staff. All this work needs energy and materials which bring various risks to environment and the patients. During the last two decades, however, many efforts were made in the field of environment protection in medicine. There is hardly a hospital left which has not taken measures of protecting the environment. In the branch-specific quality management system KTQ (=cooperation for transparency and quality in the health system). environment protection measures are interrogated and systematically assessed.
Trends in study design and the statistical methods employed in a leading general medicine journal.
Gosho, M; Sato, Y; Nagashima, K; Takahashi, S
2018-02-01
Study design and statistical methods have become core components of medical research, and the methodology has become more multifaceted and complicated over time. The study of the comprehensive details and current trends of study design and statistical methods is required to support the future implementation of well-planned clinical studies providing information about evidence-based medicine. Our purpose was to illustrate study design and statistical methods employed in recent medical literature. This was an extension study of Sato et al. (N Engl J Med 2017; 376: 1086-1087), which reviewed 238 articles published in 2015 in the New England Journal of Medicine (NEJM) and briefly summarized the statistical methods employed in NEJM. Using the same database, we performed a new investigation of the detailed trends in study design and individual statistical methods that were not reported in the Sato study. Due to the CONSORT statement, prespecification and justification of sample size are obligatory in planning intervention studies. Although standard survival methods (eg Kaplan-Meier estimator and Cox regression model) were most frequently applied, the Gray test and Fine-Gray proportional hazard model for considering competing risks were sometimes used for a more valid statistical inference. With respect to handling missing data, model-based methods, which are valid for missing-at-random data, were more frequently used than single imputation methods. These methods are not recommended as a primary analysis, but they have been applied in many clinical trials. Group sequential design with interim analyses was one of the standard designs, and novel design, such as adaptive dose selection and sample size re-estimation, was sometimes employed in NEJM. Model-based approaches for handling missing data should replace single imputation methods for primary analysis in the light of the information found in some publications. Use of adaptive design with interim analyses is increasing
Method of manufacturing a niobium-aluminum-germanium superconductive material
Wang, J.L.F.; Pickus, M.R.; Douglas, K.E.
A method for manufacturing flexible Nb/sub 3/ (Al,Ge) multifilamentary superconductive material in which a sintered porous Nb compact is infiltrated with an Al-Ge alloy. It is deformed and heat treated in a series of steps at successively higher temperatures preferably below 1000/sup 0/C during the heat treatment, cladding material such as copper can be applied to facilitate a deformation step preceding the heat treatment and can remain in place through the heat treatment to serve as a temperature stabilizer for the superconductive material produced. These lower heat treatment temperatures favor formation of filaments with reduced grain size and with more grain boundaries which in turn increase the current-carrying capacity of the superconductive material.
Nawaz, Haq; Petraro, Paul V.; Via, Christina; Ullah, Saif; Lim, Lionel; Wild, Dorothea; Kennedy, Mary; Phillips, Edward M.
2016-01-01
Background The vast majority of the healthcare problems burdening our society today are caused by disease-promoting lifestyles (e.g., physical inactivity and unhealthy eating). Physicians report poor training and lack of confidence in counseling patients on lifestyle changes. Objective To evaluate a new curriculum and rotation in lifestyle medicine for preventive medicine residents. Methods Training included didactics (six sessions/year), distance learning, educational conferences, and newly developed lifestyle medicine rotations at the Institute of Lifestyle Medicine, the Yale-Griffin Prevention Research Center, and the Integrative Medicine Center. We used a number of tools to assess residents’ progress including Objective Structured Clinical Examinations (OSCEs), self-assessments, and logs of personal health habits. Results A total of 20 residents participated in the lifestyle medicine training between 2010 and 2013. There was a 15% increase in residents’ discussions of lifestyle issues with their patients based on their baseline and follow-up surveys. The performance of preventive medicine residents on OSCEs increased each year they were in the program (average OSCE score: PGY1 73%, PGY2 83%, PGY3 87%, and PGY4 91%, p=0.01). Our internal medicine and preliminary residents served as a control, since they did participate in didactics but not in lifestyle medicine rotations. Internal medicine and preliminary residents who completed the same OSCEs had a slightly lower average score (76%) compared with plural for resident, preventive medicine residents (80%). However, this difference did not reach statistical significance (p=0.11). Conclusion Incorporating the lifestyle medicine curriculum is feasible for preventive medicine training allowing residents to improve their health behavior change discussions with patients as well as their own personal health habits. PMID:27507540
Directory of Open Access Journals (Sweden)
Haq Nawaz
2016-08-01
Full Text Available Background: The vast majority of the healthcare problems burdening our society today are caused by disease-promoting lifestyles (e.g., physical inactivity and unhealthy eating. Physicians report poor training and lack of confidence in counseling patients on lifestyle changes. Objective: To evaluate a new curriculum and rotation in lifestyle medicine for preventive medicine residents. Methods: Training included didactics (six sessions/year, distance learning, educational conferences, and newly developed lifestyle medicine rotations at the Institute of Lifestyle Medicine, the Yale-Griffin Prevention Research Center, and the Integrative Medicine Center. We used a number of tools to assess residents’ progress including Objective Structured Clinical Examinations (OSCEs, self-assessments, and logs of personal health habits. Results: A total of 20 residents participated in the lifestyle medicine training between 2010 and 2013. There was a 15% increase in residents’ discussions of lifestyle issues with their patients based on their baseline and follow-up surveys. The performance of preventive medicine residents on OSCEs increased each year they were in the program (average OSCE score: PGY1 73%, PGY2 83%, PGY3 87%, and PGY4 91%, p=0.01. Our internal medicine and preliminary residents served as a control, since they did participate in didactics but not in lifestyle medicine rotations. Internal medicine and preliminary residents who completed the same OSCEs had a slightly lower average score (76% compared with plural for resident, preventive medicine residents (80%. However, this difference did not reach statistical significance (p=0.11. Conclusion: Incorporating the lifestyle medicine curriculum is feasible for preventive medicine training allowing residents to improve their health behavior change discussions with patients as well as their own personal health habits.
Directory of Open Access Journals (Sweden)
D. Van der Merwe
2001-07-01
Full Text Available Rapid Rural Appraisal (RRA methods were employed to document the use of ethnoveterinary medicinal plants in cattle by Setswana-speaking people in the Madikwe area of the North West Province of South Africa. The study indicated that Setswana-speaking people in the North West Province have a rich heritage of ethnoveterinary knowledge, which includes all aspects of ethnoveterinary medicinal plant use. Information was gathered from informants through individual interviews, group interviews, guided field walks and observations. Ethnoveterinary uses in cattle of 45 plant species representing 24 families were recorded. Plants were used in 84 % of the total number of recorded ethnoveterinary remedies. These plants were used alone (64 % or in mixtures (36 % for 29 indications. The most important indications were retained placenta, diarrhoea, gallsickness, fractures, eye inflammation, general ailments, fertility enhancement, general gastrointestinal problems, heartwater, internal parasites, coughing, redwater and reduction of tick burden. Plant materials were prepared in various ways including infusion, decoction, ground fresh material, sap expressed from fresh material, charred and dried. The most common dosage formwas a liquid for oral dosing. Other dosage forms included drops, licks, ointments, lotions and powders. Liquid remedies for oral dosing were always administered using a bottle. Medicinal plant material was preferably stored in a dried form in a cool place out of direct sunlight and wind. Lack of transfer of ethnoveterinary knowledge to younger generations puts this knowledge at risk. RRA was found to be a successful method of investigation for the study of ethnoveterinary medicine.
Application of RNB for high sensitive wear diagnostics in medicine technique and industry
International Nuclear Information System (INIS)
Fehsenfeld, P.; Eifrig, C.; Kubat, R.
2002-01-01
The RTM--Radionuclide Technique in Mechanical engineering--is now extended to the solution of world wide problems in medicine technique (prosthetics), and in development of modern materials (synthetic materials, ceramics, hard coatings, etc.) and their industrial application. RNB--Radioactive Nuclear Beams of 7 Be or 22 Na--may enable the required extreme thin radioactive surface labeling (several micrometers) of synthetic materials for wear measurements without producing radiation damages of influence to the wear properties of the material. The function principle and special properties of the RTM on-line wear diagnostics and its components, the measurement methods, the radioactive surface labeling, and the measurement instruments are explained. The quality features of a 7 Be and 22 Na-beam for RTM application are specified
[Verruca planae Chinese medicine treatment].
Chen, Hai-Ming
2008-08-01
Flat wart on the effectiveness of TCM treatment. Outpatients will be by the "People's Republic of China Chinese medicine industry standards, TCM diagnosis of dermatological diseases efficacy standards, Chen Hou State Administration of Traditional Chinese Medicine 1994-06-28 approved, 1995-01-01 implementation". Randomly divided into two groups. Treatment and control groups. Treatment groups treated with Chinese herbs. The control group were treated with WM. Since the preparation of the unification formula ointment, cuboiling method. Chinese herbal medicine preparation by my hospital room Producer. 5 g pre pack, after treatment for 30 days, clinical observation. The group of Chinese medicine is better than western medicine (86.7% vs 71.7% , P < 0.05). Chinese medicine has some effect flat wart.
Goff, Ben M; Murphy, Patrick T; Moore, Kenneth J
2012-03-15
A variety of methods have been developed for estimating lignin concentration within plant materials. The objective of this study was to compare the lignin concentrations produced by six methods on a diverse population of forage and biomass materials and to examine the relationship between these concentrations and the portions of these materials that are available for utilisation by livestock or for ethanol conversion. Several methods produced lignin concentrations that were highly correlated with the digestibility of the forages, but there were few relationships between these methods and the available carbohydrate of the biomass materials. The use of Na₂SO₃ during preparation of residues for hydrolysis resulted in reduced lignin concentrations and decreased correlation with digestibility of forage materials, particularly the warm-season grasses. There were several methods that were well suited for predicting the digestible portion of forage materials, with the acid detergent lignin and Klason lignin method giving the highest correlation across the three types of forage. The continued use of Na₂SO₃ during preparation of Van Soest fibres needs to be evaluated owing to its ability to reduce lignin concentrations and effectiveness in predicting the utilisation of feedstuffs and feedstocks. Because there was little correlation between the lignin concentration and the biomass materials, there is a need to examine alternative or develop new methods to estimate lignin concentrations that may be used to predict the availability of carbohydrates for ethanol conversion. Copyright © 2011 Society of Chemical Industry.
Radiation protection in nuclear medicine
International Nuclear Information System (INIS)
Chougule, Arun
2014-01-01
The branch of medical science that utilizes the nuclear properties of the radioactivity and stable nuclides to make diagnostic evaluation of anatomical and/or physiological conditions of the body and provide therapy with unsealed radioactive sources is called Nuclear Medicine (NM). The use of unsealed radionuclides in medicine is increasing throughout the world for diagnosis and treatment. As per UNSCEAR report more than 6 million nuclear medicine procedures are conducted in a year. However we know that radiation is double edged sword and if not used carefully will be harmful to patient as well as staff and therefore a nuclear medicine procedure should be undertaken only after proper justification and optimization. Nuclear medicine procedures are different than the X-ray diagnostic procedures as in NM, radioisotope is administered to patient and patient becomes radioactive. The NM staff is involved in unpacking radioactive material, activity measurements, storage of sources, internal transports of sources, preparation of radiopharmaceuticals, administration of radiopharmaceutical, examination of the patient, care of the radioactive patient, handling of radioactive waste and therefore receives radiation dose. This talk will discuss the various steps for radiation safety of patient, staff and public during Nuclear Medicine procedures so as to implementing the ALARA concept. (author)
Origin and concept of medicine food homology and its application in modern functional foods.
Hou, Yan; Jiang, Jian-Guo
2013-12-01
The viewpoints of "medicine food homology" (MFH) conform to today's food requirements of returning to a natural and green healthy life. This paper aims to introduce the concept of MFH and its origin and evolution, and analyze the relationship between food and Chinese medicine. In this review, more than 80 MFH materials approved by China's Ministry of Health are listed and their effective ingredients are summarized in detail. Their treatment mechanism in TCM and western medicine are summarized too. Moreover, some new MFH resources that have been gradually developed are also introduced. MFH materials are a treasure house of functional factors for current functional foods. Innovative ideas for the development of MFH resources in current functional foods are prospected and discussed, such as taking advantage of Chinese diet theory, building a database for MFH varieties and developing new methods and technologies. At present, modern research for the development of MFH functional foods is still in its primary stage, there is still much work required in the popularization of the MFH concept and the development of new products. Knowledge and technological innovations in this area should be accelerated in the future to promote the modernization of MFH.
Health monitoring method for composite materials
Watkins, Jr., Kenneth S.; Morris, Shelby J [Hampton, VA
2011-04-12
An in-situ method for monitoring the health of a composite component utilizes a condition sensor made of electrically conductive particles dispersed in a polymeric matrix. The sensor is bonded or otherwise formed on the matrix surface of the composite material. Age-related shrinkage of the sensor matrix results in a decrease in the resistivity of the condition sensor. Correlation of measured sensor resistivity with data from aged specimens allows indirect determination of mechanical damage and remaining age of the composite component.
DATA MINING METHODS FOR OMICS AND KNOWLEDGE OF CRUDE MEDICINAL PLANTS TOWARD BIG DATA BIOLOGY
Directory of Open Access Journals (Sweden)
Farit M. Afendi
2013-01-01
Full Text Available Molecular biological data has rapidly increased with the recent progress of the Omics fields, e.g., genomics, transcriptomics, proteomics and metabolomics that necessitates the development of databases and methods for efficient storage, retrieval, integration and analysis of massive data. The present study reviews the usage of KNApSAcK Family DB in metabolomics and related area, discusses several statistical methods for handling multivariate data and shows their application on Indonesian blended herbal medicines (Jamu as a case study. Exploration using Biplot reveals many plants are rarely utilized while some plants are highly utilized toward specific efficacy. Furthermore, the ingredients of Jamu formulas are modeled using Partial Least Squares Discriminant Analysis (PLS-DA in order to predict their efficacy. The plants used in each Jamu medicine served as the predictors, whereas the efficacy of each Jamu provided the responses. This model produces 71.6% correct classification in predicting efficacy. Permutation test then is used to determine plants that serve as main ingredients in Jamu formula by evaluating the significance of the PLS-DA coefficients. Next, in order to explain the role of plants that serve as main ingredients in Jamu medicines, information of pharmacological activity of the plants is added to the predictor block. Then N-PLS-DA model, multiway version of PLS-DA, is utilized to handle the three-dimensional array of the predictor block. The resulting N-PLS-DA model reveals that the effects of some pharmacological activities are specific for certain efficacy and the other activities are diverse toward many efficacies. Mathematical modeling introduced in the present study can be utilized in global analysis of big data targeting to reveal the underlying biology.
Assessment of suspected infection of hip or knee endoprosthesis by nuclear medicine techniques
International Nuclear Information System (INIS)
Schmidt, M.; Dietlein, M.; Schicha, H.; Delank, K.S.
2007-01-01
Complications after hip endoprosthesis operation occur with a frequency of 1-2 % after primary operation and with 3-5 % after revision arthroplasty and are even more frequent after knee arthroplasty. The differentiation between aseptic loosening and bacterial infection is very important. In aseptic loosening a one-step revision is usually possible. In case of bacterial infection, all foreign material has to be removed first to allow cure from the infection. After healing and absence of bacteria a follow-up operation is possible with insertion of a new prosthesis. Diagnosis and therapy of a painful hip or knee endoprosthesis are difficult, because patient history, clinical examination, laboratory results including microbiological investigation of puncture material and results of radiological examinations may all be inconclusive. Quite a number of nuclear medicine procedures have been published in the past to help in the differentiation between aseptic loosening and bacterial infection of a painful hip or knee endoprosthesis. No single method can be regarded as excellent and without disadvantages. In the international literature the combined leucocyte-marrow imaging has been propageted as superior technique. In Germany, combined leucocyte-marrow imaging is not available in the published form. Moreover, this technique is time consuming, cost intensive and requires direct work with blood. Therefore, infection imaging with labelled antibodies or labelled fragments of antibodies may be regarded as the method of choice for most nuclear medicine physicians. With semiquantitative evaluation a comparative diagnostic accuracy may be achieved. 18 F-FDG-PET is not able to differentiate reliably between abacterial polyethylene abrasion and septic inflammation. However, with pattern recognition of the distribution of 18 F-FDG around a hip prosthesis an approach with clinically acceptable results has been published. A normal 18 F-FDG-PET can reliably exclude an infection
Monte Carlo simulation in nuclear medicine
International Nuclear Information System (INIS)
Morel, Ch.
2007-01-01
The Monte Carlo method allows for simulating random processes by using series of pseudo-random numbers. It became an important tool in nuclear medicine to assist in the design of new medical imaging devices, optimise their use and analyse their data. Presently, the sophistication of the simulation tools allows the introduction of Monte Carlo predictions in data correction and image reconstruction processes. The availability to simulate time dependent processes opens up new horizons for Monte Carlo simulation in nuclear medicine. In a near future, these developments will allow to tackle simultaneously imaging and dosimetry issues and soon, case system Monte Carlo simulations may become part of the nuclear medicine diagnostic process. This paper describes some Monte Carlo method basics and the sampling methods that were developed for it. It gives a referenced list of different simulation software used in nuclear medicine and enumerates some of their present and prospective applications. (author)
TREATMENT OF PSORIASIS WITH HOMEOPATHIC MEDICINES
Directory of Open Access Journals (Sweden)
V. A. Molochkov
2014-01-01
Full Text Available Background: Psoriasis is a disease with growing incidence predominantly affecting young and middle-aged patients. It is characterized by frequent exacerbations, insufficient efficacy of the routine therapy and common adverse effects. Thus, use of alternative therapies is of great importance. Aim: To assess efficacy and safety of homeopathic medicine Loma Lux Psoriasis in patients with different forms of psoriasis. Materials and methods: 45 patients with progressive (n=17 and stable (n=28 psoriasis and mean PASI (Psoriasis Area and Severity Index value 17.3 (5–30 were treated with homeopathic medicine Loma Lux Psoriasis in combination with topical medicines: salicylic Vaseline 2%, tar and naphthalane preparations, ointments with fluocinolone acetonide and mometasone, betametasone/salicylic acid combinations. Diet was also recommended. Results: After 12 weeks, significant improvement (PASI decrease 75–100% was demonstrated in 40% of the patients including completely absent skin desquamation, resorption of psoriatic papules and patches with residual hyper- or depigmentation. 57.8% of the patient had moderate improvement (PASI decrease 25–75%. In one patient with only slight improvement (PASI decrease less than 25% treatment was prolonged for 4 weeks and significant improvement was achieved. Therapy was well tolerated in all patients. No side effects or treatment-related complications were reported. Clinical recover was associated with marked tendency to improvement of blood biochemistry and immunology: elevation of immunoregulatory index up to 1.6 and T-helpers content up to 44.3%. Conclusion: Homeopathic medicine Loma Lux Psoriasis is characterized by good efficacy and safety profile and may be recommended as addon to comprehensive treatment of stable and progressing psoriasis.
Combinatorial methods for advanced materials research and development
Energy Technology Data Exchange (ETDEWEB)
Cremer, R.; Dondorf, S.; Hauck, M.; Horbach, D.; Kaiser, M.; Krysta, S.; Kyrylov, O.; Muenstermann, E.; Philipps, M.; Reichert, K.; Strauch, G. [Rheinisch-Westfaelische Technische Hochschule Aachen (Germany). Lehrstuhl fuer Theoretische Huettenkunde
2001-10-01
The applicability of combinatorial methods in developing advanced materials is illustrated presenting four examples for the deposition and characterization of one- and two-dimensionally laterally graded coatings, which were deposited by means of (reactive) magnetron sputtering and plasma-enhanced chemical vapor deposition. To emphasize the advantages of combinatorial approaches, metastable hard coatings like (Ti,Al)N and (Ti,Al,Hf)N respectively, as well as Ge-Sb-Te based films for rewritable optical data storage were investigated with respect to the relations between structure, composition, and the desired materials properties. (orig.)
Lee, Tsung-Han
Strongly correlated materials are a class of materials that cannot be properly described by the Density Functional Theory (DFT), which is a single-particle approximation to the original many-body electronic Hamiltonian. These systems contain d or f orbital electrons, i.e., transition metals, actinides, and lanthanides compounds, for which the electron-electron interaction (correlation) effects are too strong to be described by the single-particle approximation of DFT. Therefore, complementary many-body methods have been developed, at the model Hamiltonians level, to describe these strong correlation effects. Dynamical Mean Field Theory (DMFT) and Rotationally Invariant Slave-Boson (RISB) approaches are two successful methods that can capture the correlation effects for a broad interaction strength. However, these many-body methods, as applied to model Hamiltonians, treat the electronic structure of realistic materials in a phenomenological fashion, which only allow to describe their properties qualitatively. Consequently, the combination of DFT and many body methods, e.g., Local Density Approximation augmented by RISB and DMFT (LDA+RISB and LDA+DMFT), have been recently proposed to combine the advantages of both methods into a quantitative tool to analyze strongly correlated systems. In this dissertation, we studied the possible improvements of these approaches, and tested their accuracy on realistic materials. This dissertation is separated into two parts. In the first part, we studied the extension of DMFT and RISB in three directions. First, we extended DMFT framework to investigate the behavior of the domain wall structure in metal-Mott insulator coexistence regime by studying the unstable solution describing the domain wall. We found that this solution, differing qualitatively from both the metallic and the insulating solutions, displays an insulating-like behavior in resistivity while carrying a weak metallic character in its electronic structure. Second, we
Van der Meersch, H; Verschuere, A P; Bottriaux, F
2006-01-01
Pharmaceutical grade cannabis is available to Dutch patients from public pharmacies in the Netherlands. The first part of this paper reviews the pharmaceutical and pharmacological properties of medicinal cannabis. Detailed information about its composition and quality, potential applications, methods of administration, adverse reactions, drug interactions and safety during pregnancy or breastfeeding are given. The second part deals with the legal aspects of dispensing medicinal cannabis through pharmacies in view of the Belgian and Dutch legislation. The last part discusses the present Belgian regulation about the possession of cannabis.
Wardle, Jonathan Lee; Sarris, Jerome
2014-06-01
Complementary medicine is forming an increasingly large part of health care in developed countries and is increasingly being formally taught in tertiary academic settings. An exploratory study of naturopathic student perceptions of, use of and attitudes towards teaching resources in naturopathic clinical training and education. Focus groups were conducted with current and recent students of 4-year naturopathic degree programmes in Brisbane and Sydney to ascertain how they interact with clinical teaching materials, and their perceptions and attitudes towards teaching materials in naturopathic education. Naturopathic students have a complex and critical relationship with their learning materials. Although naturopathic practice is often defined by traditional evidence, students want information that both supports and is critical of traditional naturopathic practices, and focuses heavily on evidence-based medicine. Students remain largely ambivalent about new teaching technologies and would prefer that these develop organically as an evolution from printed materials, rather than depart from dramatically and radically from these previously established materials. Findings from this study will assist publishers, librarians and academics develop clinical information sources that appropriately meet student expectations and support their learning requirements. © 2014 The authors. Health Information and Libraries Journal © 2014 Health Libraries Group.
Measurement of complex permittivity of composite materials using waveguide method
Tereshchenko, O.V.; Buesink, Frederik Johannes Karel; Leferink, Frank Bernardus Johannes
2011-01-01
Complex dielectric permittivity of 4 different composite materials has been measured using the transmissionline method. A waveguide fixture in L, S, C and X band was used for the measurements. Measurement accuracy is influenced by air gaps between test fixtures and the materials tested. One of the
Nuclear medicine. 1 part. Manual
International Nuclear Information System (INIS)
Shlygina, O.E.; Borisenko, A.R.
2006-01-01
Current manual is urged to give wide-scale readers a submission on a key principles and methods of nuclear medicine, and it opportunities and restrictions in diagnostics and treatment of different diseases. Nuclear medicine is differing first of all by combination of diverse knowledge fields: special knowledge of a doctor, knowledge of physical processes bases, related with radiation, grounds of radiopharmaceutics, dosimetry. In the base of the book the 5th edition of 'Nuclear medicine' manual in 2 parts of German authors - Schicha, G.; Schober, O. is applied. In the book publishing the stuff of the Institute of Nuclear Physics of the National Nuclear Center of Republic of Kazakhstan has been worked. Modifications undergo practically all chapters: especially the second one, forth and sixth was enlarged. The 1 part of the book was published due to support of IAEA within the Technical cooperation project 'Implementation of Nuclear Medicine and Biophysics Center' (KAZ/6/007). The manual second part - devoted to applications of nuclear medicine methods for diagnostics and treatment - will be published in 2007
How to write a materials and methods section of a scientific article?
Erdemir, Fikret
2013-09-01
In contrast to past centuries, scientific researchers have been currently conducted systematically in all countries as part of an education strategy. As a consequence, scientists have published thousands of reports. Writing an effective article is generally a significant problem for researchers. All parts of an article, specifically the abstract, material and methods, results, discussion and references sections should contain certain features that should always be considered before sending a manuscript to a journal for publication. It is generally known that the material and methods section is a relatively easy section of an article to write. Therefore, it is often a good idea to begin by writing the materials and methods section, which is also a crucial part of an article. Because "reproducible results" are very important in science, a detailed account of the study should be given in this section. If the authors provide sufficient detail, other scientists can repeat their experiments to verify their findings. It is generally recommended that the materials and methods should be written in the past tense, either in active or passive voice. In this section, ethical approval, study dates, number of subjects, groups, evaluation criteria, exclusion criteria and statistical methods should be described sequentially. It should be noted that a well-written materials and methods section markedly enhances the chances of an article being published.
Prospects and Challenges for Harnessing Opportunities in Medicinal Plants Sector in India
Directory of Open Access Journals (Sweden)
Harbir Singh
2006-09-01
Full Text Available The importance of the medicinal plants sector can be gauged from the fact that herbal medicines serve the healthcare needs of about 80 per cent of the world's population. India, with approximately eight percent of world's biodiversity including plant genetic diversity with medicinal properties, has the potential of becoming a major global player in market for medicinal plants-based herbal formulations and products. However, prior to establishment of Medicinal Plants Board, there was no nodal agency to look into medicinal plants as an economic 'sector' and different organisations dealt with different aspects of medicinal plants without any clear cut focus and coordination. This lack of co-ordination led to critical research gaps relating to socio-economic and policy aspects of medicinal plants. At the same time, absence of formal marketing linkages and effective buy-back arrangements hindered the development of medicinal plants sector. Developing appropriate varieties for cultivation which could ensure uniform quality and continuous supply of raw material for processing industry would not only meet the industry demand but also halt the degradation of natural resource base. To capitalize on expanding opportunities in the international market, we need to focus on scientific methods of cultivation, harvesting, processing, grading, transport, storage, labeling and marketing practices involved in the entire supply chain for medicinal plants. Policy and institutional issues particularly related to co-ordination among various stake holders are one of the major constraints faced by this sector. Species- specific and socio-economic environment specific research would be helpful for identification of an optimal institutional framework to take care of needs of various stakeholders and also cater to social needs without adverse implications for equity and environment.
Methods of pretreating comminuted cellulosic material with carbonate-containing solutions
Energy Technology Data Exchange (ETDEWEB)
Francis, Raymond
2012-11-06
Methods of pretreating comminuted cellulosic material with an acidic solution and then a carbonate-containing solution to produce a pretreated cellulosic material are provided. The pretreated material may then be further treated in a pulping process, for example, a soda-anthraquinone pulping process, to produce a cellulose pulp. The pretreatment solutions may be extracted from the pretreated cellulose material and selectively re-used, for example, with acid or alkali addition, for the pretreatment solutions. The resulting cellulose pulp is characterized by having reduced lignin content and increased yield compared to prior art treatment processes.
Eisenberg, David M; Harris, Eric S J; Littlefield, Bruce A; Cao, Shugeng; Craycroft, Jane A; Scholten, Robert; Bayliss, Peter; Fu, Yanling; Wang, Wenquan; Qiao, Yanjiang; Zhao, Zhongzhen; Chen, Hubiao; Liu, Yong; Kaptchuk, Ted; Hahn, William C; Wang, Xiaoxing; Roberts, Thomas; Shamu, Caroline E; Clardy, Jon
2011-01-01
While the popularity of and expenditures for herbal therapies (aka "ethnomedicines") have increased globally in recent years, their efficacy, safety, mechanisms of action, potential as novel therapeutic agents, cost-effectiveness, or lack thereof, remain poorly defined and controversial. Moreover, published clinical trials evaluating the efficacy of herbal therapies have rightfully been criticized, post hoc, for their lack of quality assurance and reproducibility of study materials, as well as a lack of demonstration of plausible mechanisms and dosing effects. In short, clinical botanical investigations have suffered from the lack of a cohesive research strategy which draws on the expertise of all relevant specialties. With this as background, US and Chinese co-investigators with expertise in Traditional Chinese Medicine (TCM), botany, chemistry and drug discovery, have jointly established a prototype library consisting of 202 authenticated medicinal plant and fungal species that collectively represent the therapeutic content of the majority of all commonly prescribed TCM herbal prescriptions. Currently housed at Harvard University, the library consists of duplicate or triplicate kilogram quantities of each authenticated and processed species, as well as "detanninized" extracts and sub-fractions of each mother extract. Each species has been collected at 2-3 sites, each separated geographically by hundreds of miles, with precise GPS documentation, and authenticated visually and chemically prior to testing for heavy metals and/or pesticides contamination. An explicit decision process has been developed whereby samples with the least contamination were selected to undergo ethanol extraction and HPLC sub-fractionation in preparation for high throughput screening across a broad array of biological targets including cancer biology targets. As envisioned, the subfractions in this artisan collection of authenticated medicinal plants will be tested for biological activity
Radioprotection in nuclear medicine department of 'Porto Alegre Clinical Hospital'
International Nuclear Information System (INIS)
Dias, T.M.; Pinto, A.L.; Bacelar, A.L.; Dytz, A.S.; Bernasiuk, M.E.; Baptista, I.S.
1996-01-01
The use of ionizing radiation in medicine allows great benefits. Nuclear Medicine uses ionizing radiation for medical diagnostic, such as: tumor, cancer, and dysfunctions location. However the use of ionizing radiation must be controlled in order to avoid likely biological effects in human beings. In order to extremely minimize that these effects appear, the Medical Physics Department of the Porto Alegre Clinical Hospital has implemented some procedures to assure that handling and use of radioactive material are in a safe way. This preoccupation is considered in all the places of nuclear medicine sector since the moment when the radioactive material is brought into including its manipulation and retirement, the exam process being accompanied. (authors). 4 refs
Gyroidal mesoporous carbon materials and methods thereof
Energy Technology Data Exchange (ETDEWEB)
Wiesner, Ulrich B.; Werner, Joerg G.
2017-07-25
The present invention relates to, inter alia, gyroidal mesoporous carbon materials and methods of use and manufacture thereof. In one embodiment, the present invention relates to a mesoporous carbon composition comprising a gyroidal mesoporous carbon having an ordered gyroidal structure and mesopores having a pore size of greater than 2 nanometers (nm) in diameter, and more particularly greater than 11 nm in diameter.
Systems and methods for neutron detection using scintillator nano-materials
Letant, Sonia Edith; Wang, Tzu-Fang
2016-03-08
In one embodiment, a neutron detector includes a three dimensional matrix, having nanocomposite materials and a substantially transparent film material for suspending the nanocomposite materials, a detector coupled to the three dimensional matrix adapted for detecting a change in the nanocomposite materials, and an analyzer coupled to the detector adapted for analyzing the change detected by the detector. In another embodiment, a method for detecting neutrons includes receiving radiation from a source, converting neutrons in the radiation into alpha particles using converter material, converting the alpha particles into photons using quantum dot emitters, detecting the photons, and analyzing the photons to determine neutrons in the radiation.
[The apprentice education system of Chinese medicinal industry in modern Kunming].
Yang, Zhuqing
2015-07-01
In the late Qing Dynasty, following the appearance of the Chinese medicinal materials industry trade association of Kunming, the "master agreement" as a professional regulation, also implemented, marking the beginning of the contractualization and institutionalization of apprentice education in Yunnan. The contents and implementation of the "master agreement" was organized by the Chinese medicinal materials industry trade association of Kunming and its craft union. The apprentice education in Kunming traditional Chinese medicinal industry has the following characteristics: expanding the source of talent; adepting at agricultural production of the accorded apprentice; conforming to the conditions of human manipulation of Chinese traditional medicine; being in line with the characteristics and rules of Chinese medicine skills taught by oral narration and tacit understanding; unity of the medical and pharmaceutical professionals; and non-governmental organization. Apprentice training had trained a number of medical talents, and promoted the transformation of manual workshop to industrialization in Kunming. Apprentice education had catalyzed the establishment of specialized shops selling patent medicines exclusively to separated from those running both crude drugs and patent medicines, to form a set of effective teaching system, thus exerting profound influence on later generations.
Selection and authentication of botanical materials for the development of analytical methods.
Applequist, Wendy L; Miller, James S
2013-05-01
Herbal products, for example botanical dietary supplements, are widely used. Analytical methods are needed to ensure that botanical ingredients used in commercial products are correctly identified and that research materials are of adequate quality and are sufficiently characterized to enable research to be interpreted and replicated. Adulteration of botanical material in commerce is common for some species. The development of analytical methods for specific botanicals, and accurate reporting of research results, depend critically on correct identification of test materials. Conscious efforts must therefore be made to ensure that the botanical identity of test materials is rigorously confirmed and documented through preservation of vouchers, and that their geographic origin and handling are appropriate. Use of material with an associated herbarium voucher that can be botanically identified is always ideal. Indirect methods of authenticating bulk material in commerce, for example use of organoleptic, anatomical, chemical, or molecular characteristics, are not always acceptable for the chemist's purposes. Familiarity with botanical and pharmacognostic literature is necessary to determine what potential adulterants exist and how they may be distinguished.
Directory of Open Access Journals (Sweden)
Jaka Ogorevc
2015-12-01
Full Text Available AbstractIntroduction: Body temperature monitoring is one of the oldest and still one of the most basic diagnostic methods in medicine. In recent years thermal imaging has been increasingly used in measurements of body temperature for diagnostic purposes. Thermal imaging is non-invasive, non-contact method for measuring surface body temperature. Method is quick, painless and patient is not exposed to ionizing radiation or any other body burden.Application of thermal imaging in medicine: Pathological conditions can be indicated as hyper- or hypothermic patterns in many cases. Thermal imaging is presented as a diagnostic method, which can detect such thermal anomalies. This article provides an overview of the thermal imaging applications in various fields of medicine. Thermal imaging has proven to be a suitable method for human febrile temperature screening, for the detection of sites of fractures and infections, a reliable diagnostic tool in the detection of breast cancer and determining the type of skin cancer tumour. It is useful in monitoring the course of a therapy after spinal cord injury, in the detection of food allergies and detecting complications at hemodialysis and is also very effective at the course of treatment of breast reconstruction after mastectomy. With thermal imaging is possible to determine the degrees of burns and early detection of osteomyelitis in diabetic foot phenomenon. The most common and the oldest application of thermal imaging in medicine is the field of rheumatology.Recommendations for use and standards: Essential performance of a thermal imaging camera, measurement method, preparation of a patient and environmental conditions are very important for proper interpretation of measurement results in medical applications of thermal imaging. Standard for screening thermographs was formed for the human febrile temperature screening application.Conclusion: Based on presented examples it is shown that thermal imaging can
Folk Medicine and Its Second Life
Directory of Open Access Journals (Sweden)
Rosari Kingston
2017-10-01
Full Text Available Irish folk medicine is perceived to be dying, if not dead already. It lies as a parallel system to modern biomedicine and is known only through word of mouth. However, no matter what modality is practised, be it bone-setting, plant medicine, charms or rituals, there are traditional characteristics common to all as a whole. An examination of these traditional elements allows us to see how Irish folk medicine is currently practised and to ascertain whether it has reached the second life that Lauri Honko suggested. If this were the case, “the recycling of material in an environment that differs from its original context” (Honko, “The Folklore” 42 should be evident.
Estimation of individual sennosides in plant materials and marketed formulations by an HPTLC method.
Shah, S A; Ravishankara, M N; Nirmal, A; Shishoo, C J; Rathod, I S; Suhagia, B N
2000-04-01
Senna is a well-known drug, used in the Ayurvedic and Allopathic systems of medicine, and is a treatment for constipation. The purgative action of senna and its formulations is due to the presence of sennosides A and B. An HPTLC method has been developed for the determination of individual sennosides (A, B, C, D) without any derivatization in marketed formulations (three tablet formulations, two granule formulations and one liquid formulation) and plant materials (senna leaf and pod). The methanolic solution of a sample was applied on a pre-coated silica gel G60 F254 TLC plate (E. Merck.) and was developed using n-propanol : ethyl acetate : water : glacial acetic acid (3 : 3 : 2 : 0.1 v/v) as the mobile phase. The relative band speeds (Rf values) obtained were 0.35, 0.25, 0.61, 0.46 for sennosides A, B, C and D, respectively. The densitometric response was monitored at 366nm. Calibration curves were found to be linear in the concentration ranges 193-1356, 402-2817, 71-497 and 132-927 ng per spot for sennosides A, B, C, and D, respectively. The correlation coefficients were found to be 0.9978, 0.9987, 0.9939 and 0.9983 respectively for sennosides A, B, C and D. The result obtained with the HPTLC method for total sennoside content was compared with the results using the pharmacopoeial methods (spectrophotometric (British Pharmacopoeia) and spectrofluorimetric (United States Pharmacopeia) using the 'F' test). The results revealed no significant difference in the three different methods for estimation of total sennoside. The proposed HPTLC method was found to be simple, specific, precise, accurate and rapid. It can be used for routine quality control of sennosides or senna-containing formulations for individual sennosides.
Materials and methods for hard-facing of power engineering valves
International Nuclear Information System (INIS)
Frumin, I.I.; Gladkii, P.V.; Eremeev, V.B.; Perepliotchikov, E.F.
1980-01-01
In the Soviet Union a large experience in hard-facing for the water and steam valves has been accumulated. A workability of valves largely depends upon materials used and a technology of their deposition. Mechanized methods have been recently successfully developed, new hard-facing materials created are considered
Method of Poisson's ratio imaging within a material part
Roth, Don J. (Inventor)
1996-01-01
The present invention is directed to a method of displaying the Poisson's ratio image of a material part. In the present invention longitudinal data is produced using a longitudinal wave transducer and shear wave data is produced using a shear wave transducer. The respective data is then used to calculate the Poisson's ratio for the entire material part. The Poisson's ratio approximations are then used to displayed the image.
Camels Milk: Nutrition and Health Perspectives Iranian Traditional Medicine
Directory of Open Access Journals (Sweden)
Seyyd Musa al-Reza Hosseini
2015-09-01
Full Text Available Background: Camel milk is the closest to human mother’s milk. In the references on Iranian traditional medicine, camel’s milk has been represented as the one having numerous nutritious and medical properties.Objectives: In this article, the nutritive and therapeutic effects of camel’s milk have been examined from the view point of Iranian traditional medicine.Materials and Methods: The present study is a qualitative one, which was carried out, based on certain criteria, through purposeful search of certain keywords in the written references of Iranian traditional medicine.Results: Numerous pharmacological functions and therapeutic effects of camel’s milk on patients suffering from liver, kidney, bladder, spleen, stomach and intestines, uterus, skin, lungs, and brain diseases have been mentioned. Camel’s milk seems to be an appropriate alternative/supplement to nourish infants and children.Conclusions: Animal resources, such as camel’s milk and its various products, have comprehensively been dealt with regarding their nutritive and therapeutic effects. Its compatibility with and similarity to mother’s milk have led to its application in pediatrics; thus, offering valid information to pediatricians on camel’s milk can further enhance the consumption of this natural product.
The Hair Follicle: An Underutilized Source of Cells and Materials for Regenerative Medicine.
Kiani, Mehrdad T; Higgins, Claire A; Almquist, Benjamin D
2018-04-09
The hair follicle is one of only two structures within the adult body that selectively degenerates and regenerates, making it an intriguing organ to study and use for regenerative medicine. Hair follicles have been shown to influence wound healing, angiogenesis, neurogenesis, and harbor distinct populations of stem cells; this has led to cells from the follicle being used in clinical trials for tendinosis and chronic ulcers. In addition, keratin produced by the follicle in the form of a hair fiber provides an abundant source of biomaterials for regenerative medicine. In this review, we provide an overview of the structure of a hair follicle, explain the role of the follicle in regulating the microenvironment of skin and the impact on wound healing, explore individual cell types of interest for regenerative medicine, and cover several applications of keratin-based biomaterials.
Requirements for occupational medicine training in Europe postulated by Polish professionals.
Indulski, J A; Boczkowski, A; Mikulski, M
1998-01-01
In order to determine common key competences required for occupational medicine specialists across Europe, a questionnaire has been developed and disseminated in several European countries. The questionnaire contained 115 subjects relating to eight fields of activity of an occupational medicine physician (occupational hazards to health, assessment of disability and fitness for work, communications, research methods, management, environmental medicine, occupational health law and ethics, and health promotion). Items in each part were classified into three categories: knowledge, experience and skills. For each of the subjects respondents were asked to allocate a score from 0 to 5, where 0 = not necessary, 1 = of minimal importance and 5 = most important or essential. In Poland the questionnaire was distributed between two groups of specialists: group I--chief administrators of occupational health services, and group II--relatively younger occupational medicine physicians participating in a specialist training. A comprehensive analysis of the completed questionnaires had three dimensions: (a) substantive (classification of the importance of particular key competences, as perceived by Polish specialists in occupational medicine), (b) personal (differences in opinions among occupational medicine physicians and an attempt to explain these differences in sociological terms), (c) comparative (evaluation and interpretation of similarities and differences between two groups). A hierarchy of requirements for occupational medicine training in Poland was constructed, with one set of competences recognized by the respondents as needless and others as useful with different grade of importance. Surprisingly, a wide diversity of opinions among respondents has given rise to the explanation hypotheses, some of them being verified using the material gathered.
Interlaboratory study of a method for determining nonvolatile organic carbon in aquifer materials
Caughey, M.E.; Barcelona, M.J.; Powell, R.M.; Cahill, R.A.; Gron, C.; Lawrenz, D.; Meschi, P.L.
1995-01-01
The organic carbon fraction in aquifer materials exerts a major influence on the subsurface mobilities of organic and organic-associated contaminants. The spatial distribution of total organic carbon (TOC) in aquifer materials must be determined before the transport of hydrophobic organic pollutants in aquifers can be modeled accurately. Previous interlaboratory studies showed that it is difficult to measure TOC concentrations 1%. We have tested a new analytical method designed to improve the accuracy and precision of nonvolatile TOC quantitation in geologic materials that also contain carbonate minerals. Four authentic aquifer materials and one NIST standard reference material were selected as test materials for a blind collaborative study. Nonvolatile TOC in these materials ranged from 0.05 to 1.4%, while TIC ranged from 0.46 to 12.6%. Sample replicates were digested with sulfurous acid, dried at 40??C, and then combusted at 950??C using LECO or UIC instruments. For the three test materials that contained >2% TIC, incomplete acidification resulted in a systematic positive bias of TOC values reported by five of the six laboratories that used the test method. Participants did not have enough time to become proficient with the new method before they analyzed the test materials. A seventh laboratory successfully used an alternative method that analyzed separate liquid and solid fractions of the acidified sample residues. ?? 1995 Springer-Verlag.
A Proposal on the Quantitative Homogeneity Analysis Method of SEM Images for Material Inspections
Energy Technology Data Exchange (ETDEWEB)
Kim, Song Hyun; Kim, Jong Woo; Shin, Chang Ho [Hanyang University, Seoul (Korea, Republic of); Choi, Jung-Hoon; Cho, In-Hak; Park, Hwan Seo [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)
2015-05-15
A scanning electron microscope (SEM) is a method to inspect the surface microstructure of materials. The SEM uses electron beams for imaging high magnifications of material surfaces; therefore, various chemical analyses can be performed from the SEM images. Therefore, it is widely used for the material inspection, chemical characteristic analysis, and biological analysis. For the nuclear criticality analysis field, it is an important parameter to check the homogeneity of the compound material for using it in the nuclear system. In our previous study, the SEM was tried to use for the homogeneity analysis of the materials. In this study, a quantitative homogeneity analysis method of SEM images is proposed for the material inspections. The method is based on the stochastic analysis method with the information of the grayscales of the SEM images.
A Proposal on the Quantitative Homogeneity Analysis Method of SEM Images for Material Inspections
International Nuclear Information System (INIS)
Kim, Song Hyun; Kim, Jong Woo; Shin, Chang Ho; Choi, Jung-Hoon; Cho, In-Hak; Park, Hwan Seo
2015-01-01
A scanning electron microscope (SEM) is a method to inspect the surface microstructure of materials. The SEM uses electron beams for imaging high magnifications of material surfaces; therefore, various chemical analyses can be performed from the SEM images. Therefore, it is widely used for the material inspection, chemical characteristic analysis, and biological analysis. For the nuclear criticality analysis field, it is an important parameter to check the homogeneity of the compound material for using it in the nuclear system. In our previous study, the SEM was tried to use for the homogeneity analysis of the materials. In this study, a quantitative homogeneity analysis method of SEM images is proposed for the material inspections. The method is based on the stochastic analysis method with the information of the grayscales of the SEM images
American Society for Testing and Materials. Philadelphia
2007-01-01
1.1 This test method describes gamma-ray methods used to nondestructively measure the quantity of 235U, or 239Pu remaining as holdup in nuclear facilities. Holdup occurs in all facilities where nuclear material is processed, in process equipment, in exhaust ventilation systems and in building walls and floors. 1.2 This test method includes information useful for management, planning, selection of equipment, consideration of interferences, measurement program definition, and the utilization of resources (1, 2, 3, 4). 1.3 The measurement of nuclear material hold up in process equipment requires a scientific knowledge of radiation sources and detectors, transmission of radiation, calibration, facility operations and error analysis. It is subject to the constraints of the facility, management, budget, and schedule; plus health and safety requirements; as well as the laws of physics. The measurement process includes defining measurement uncertainties and is sensitive to the form and distribution of the material...
International Nuclear Information System (INIS)
Beretta, M.; Pilon, R.; Mut, F.
2002-01-01
Aim: To develop a procedure for the creation of nuclear medicine reports containing static and dynamic images. The reason for implementing this technique is the lack of adequate solutions for an electronic format of nuclear medicine results allowing for rapid transmission via e-mail, specially in the case of dynamic and gated SPECT studies, since functional data is best presented in dynamic mode. Material and Methods: Clinical images were acquired in static, whole body, dynamic and gated mode, corresponding to bone studies, diuretic renogram, radionuclide cystography and gated perfusion SPECT, as well as respective time-activity curves. Image files were imported from a dedicated nuclear medicine computer system (Elscint XPert) to a Windows-based PC through a standard ethernet network with TCP-IP communications protocol, using a software developed by us which permits the conversion from the manufacturer's original format into a bitmap format (.bmp) compatible with commercially available PC software. For cardiac perfusion studies, background was subtracted prior to transferring to reduce the amount of information in the file; this was not done for other type of studies because useful data could be eliminated. Dynamic images were then processed using commercial software to create animated files and stored in .gif format. Static images were re-sized and stored in .jpg format. Original color or gray scale was always preserved. All the graphic material was then merged with a previously prepared report text using HTML format. The report also contained reference diagrams to facilitate interpretation. The whole report was then compressed into a self-extractable file, ready to be sent by electronic mail. Reception of the material was visually checked for data integrity including image quality by two experienced nuclear medicine physicians. Results: The report presented allows for simultaneous visualization of the text, diagrams and images either static, dynamic, gated or
Your Radiologist Explains Nuclear Medicine
Full Text Available ... other diagnostic tests. Nuclear medicine imaging procedures use small amounts of radioactive materials – called radiotracers – that are typically injected into the bloodstream, inhaled or swallowed. The radiotracer travels through the area being examined and gives off energy in the ...
Deffenbacher, Brandy; Langner, Shannon; Khodaee, Morteza
2017-11-01
A family medicine residency is a unique training environment where residents are exposed to care in multiple settings, across all ages. Procedures are an integral part of family medicine practice. Family medicine residency (FMR) programs are tasked with the job of teaching these skills at a level of intensity and frequency that allows a resident to achieve competency of such skills. In an environment that is limited by work hour restrictions, self-study teaching methods are one way to ensure all residents receive the fundamental knowledge of how to perform procedures. We developed and evaluated the efficacy of a self-study procedure teaching method and procedure evaluation checklist. A self-study procedure teaching intervention was created, consisting of instructional articles and videos on three procedures. To assess the efficacy of the intervention, and the competency of the residents, pre- and postintervention procedure performance sessions were completed. These sessions were reviewed and scored using a standardized procedure performance checklist. All 24 residents participated in the study. Overall, the resident procedure knowledge increased on two of the three procedures studied, and ability to perform procedure according to expert-validated checklist improved significantly on all procedures. A self-study intervention is a simple but effective way to increase and improve procedure training in a way that fits the complex scheduling needs of a residency training program. In addition, this study demonstrates that the procedure performance checklists are a simple and reliable way to increase assessment of resident procedure performance skills in a residency setting.
A primal-dual interior point method for large-scale free material optimization
DEFF Research Database (Denmark)
Weldeyesus, Alemseged Gebrehiwot; Stolpe, Mathias
2015-01-01
Free Material Optimization (FMO) is a branch of structural optimization in which the design variable is the elastic material tensor that is allowed to vary over the design domain. The requirements are that the material tensor is symmetric positive semidefinite with bounded trace. The resulting...... optimization problem is a nonlinear semidefinite program with many small matrix inequalities for which a special-purpose optimization method should be developed. The objective of this article is to propose an efficient primal-dual interior point method for FMO that can robustly and accurately solve large...... of iterations the interior point method requires is modest and increases only marginally with problem size. The computed optimal solutions obtain a higher precision than other available special-purpose methods for FMO. The efficiency and robustness of the method is demonstrated by numerical experiments on a set...
Development of an Assessment Method for Building Materials Under Euratom Scope.
de With, Govert
2017-11-01
In 2013, the European Commission published its basic safety standards for protection against the dangers arising from exposure to ionizing radiation (Council Directive 2013/59/Euratom)-also known as EU-BSS. As a result, the use of raw materials with potentially elevated activity concentrations such as fly ash, phosphogypsum, and slags will now fall under EU-BSS scope when applied in building materials. In light of this new policy, a variety of tools are available to assess compliance with the 1-mSv y reference level for building materials. At the heart of these tools is a gamma-spectrometric determination of the naturally occurring radionuclides Ra, Th, and K in the material of concern. As a large number of construction products contain a certain amount of the raw material that falls under the scope of the EU regulation, this policy will lead to substantial measurement of building materials that pose little radiation risk. For this reason, a method is developed to enable assessment against the 1-mSv value not on the basis of gamma-spectrometric analysis but rather based on the product's material composition. The proposed method prescribes a maximum permitted content of raw materials with potentially elevated activity concentrations in terms of a weight percentage of the end product, where the raw materials of concern are defined as those listed in Annex XIII of the EU-BSS. The permitted content is a function of the product's surface density. Therefore, a product with a low surface density of up to 25 kg m can consist of nearly 100% raw materials with potentially elevated activity concentrations, and this percentage drops to around 15% for products with a surface density of around 500 kg m. Building materials that comply with these requirements on product composition are exempt from testing, while products that do not comply must perform regular gamma-spectrometric analysis. A full validation and testing of the method is provided. In addition, the paper discusses
Applications of electrochemistry in medicine
Schlesinger, Mordechay
2013-01-01
Medical Applications of Electrochemistry, a volume of the series Modern Aspects of Electrochemistry, illustrates the interdisciplinary nature of modern science by indicating the many current issues in medicine that are susceptible to solution by electrochemical methods. This book also suggests how personalized medicine can develop.