WorldWideScience

Sample records for methods leaf size

  1. Leaf size indices and structure of the peat swamp forest

    Directory of Open Access Journals (Sweden)

    L.G. Aribal

    2017-12-01

    Full Text Available Leaf size indices of the tree species in the peatland of Agusan del Sur in Mindanao in Philippines was examined to deduce the variation of forest structure and observed forest zonation.  Using raunkiaer and webb’s leaf size classification, the leaf morphometrics of seven tree species consistently found on the established sampling plots were determined.  The species includes Ternstroemia philippinensis Merr., Polyscias aherniana Merr. Lowry and G.M. Plunkett, Calophyllum sclerophyllum Vesque, Fagraea racemosa Jack, Ilex cymosa Blume, Syzygium tenuirame (Miq. Merr. and Tristaniopsis micrantha Merr. Peter G.Wilson and J.T.Waterh.The LSI were correlated against the variables of the peat physico-chemical properties (such as bulk density, acrotelm thickness, peat depth, total organic carbon, nitrogen, phosphorus, and potassium, pH; water (pH, ammonium, nitrate, phosphate; and leaf tissue elements (nitrogen, phosphorus and potassium.  Result showed a decreasing leaf size indices and a three leaf size category consisting of mesophyllous, mesophyllous-notophyllous and microphyllous were observed which corresponds to the structure of vegetation i.e., from the tall-pole forest having the biggest average leaf area of 6,142.29 mm2 to the pygmy forest with average leaf area of 1,670.10 mm2.  Such decreased leaf size indices were strongly correlated to soil nitrogen, acrotelm thickness, peat depth, phosphate in water, nitrogen and phosphorus in the plant tissue.

  2. Correlations Between Degree of Petal Fusion, Leaf Size and Fruit Size: A Case in Syzygium (Myrtaceae

    Directory of Open Access Journals (Sweden)

    PUDJI WIDODO

    2009-07-01

    Full Text Available Syzygium is one of large genera of the flowering plants. In order to simplify the identification, a classification is required, e.g. based on degree of petal fusion, leaf size and fruit size. Due to variations of vegetative and generative characters, a correlation analysis was carried out. The aim of this research is to know the correlation between degree of petal fusion, leaf length and fruit diameter. The result of this research showed that there is positive correlation between those three variables. The increase of leaf size will increase fruit size and petal lobe depth.

  3. Spatial trends in leaf size of Amazonian rainforest trees

    Science.gov (United States)

    Malhado, A. C. M.; Malhi, Y.; Whittaker, R. J.; Ladle, R. J.; Ter Steege, H.; Phillips, O. L.; Butt, N.; Aragão, L. E. O. C.; Quesada, C. A.; Araujo-Murakami, A.; Arroyo, L.; Peacock, J.; Lopez-Gonzalez, G.; Baker, T. R.; Anderson, L. O.; Almeida, S.; Higuchi, N.; Killeen, T. J.; Monteagudo, A.; Neill, D.; Pitman, N.; Prieto, A.; Salomão, R. P.; Vásquez-Martínez, R.; Laurance, W. F.

    2009-08-01

    Leaf size influences many aspects of tree function such as rates of transpiration and photosynthesis and, consequently, often varies in a predictable way in response to environmental gradients. The recent development of pan-Amazonian databases based on permanent botanical plots has now made it possible to assess trends in leaf size across environmental gradients in Amazonia. Previous plot-based studies have shown that the community structure of Amazonian trees breaks down into at least two major ecological gradients corresponding with variations in soil fertility (decreasing from southwest to northeast) and length of the dry season (increasing from northwest to south and east). Here we describe the geographic distribution of leaf size categories based on 121 plots distributed across eight South American countries. We find that the Amazon forest is predominantly populated by tree species and individuals in the mesophyll size class (20.25-182.25 cm2). The geographic distribution of species and individuals with large leaves (>20.25 cm2) is complex but is generally characterized by a higher proportion of such trees in the northwest of the region. Spatially corrected regressions reveal weak correlations between the proportion of large-leaved species and metrics of water availability. We also find a significant negative relationship between leaf size and wood density.

  4. Accumulation of three different sizes of particulate matter on plant leaf surfaces: Effect on leaf traits

    Directory of Open Access Journals (Sweden)

    Chen Xiaoping

    2015-01-01

    Full Text Available Plants not only improve air quality by adsorbing particulate matter (PM on leaf surfaces but can also be affected by their accumulation. In this study, a field investigation was performed in Wuhan, China, into the relationship between seven leaf traits and the accumulation of three different sizes of PM (PM11, PM2.5 and PM0.2 on leaves. The retention abilities of plant leaves with respect to the three sizes of PM differed significantly at different sites and species. The average PM retention capabilities of plant leaves and specific leaf area (SLA were significantly greater in a seriously polluted area, whereas the average values of chlorophyll a (Chl a, chlorophyll b (Chl b, total chlorophyll, carotenoid, pH and relative water content (RWC were greater at the control site. SLA significantly positively correlated with the size of PM, but Chl a, Chl b, total chlorophyll, RWC significantly negatively correlated with the size of PM, whereas the pH did not correlate significantly with the the PM fractions. Additionally, SLA was found to be affected by large particles (PM11, p<0.01; PM2.5 had a more obvious effect on plant leaf traits than the other PM (p<0.05. Overall, the findings from this study provide useful information regarding the selection of plants to reduce atmospheric pollution.

  5. The leaf size-twig size spectrum in evergreen broad- leaved forest of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-06-07

    Jun 7, 2010 ... al., 1998; Brouat and McKey, 2001; Preston and Ackerly,. 2003; Westoby and Wright, 2003), few studies have examined the scaling relationship in relation to environ- mental gradients. In order to examine the response of the leaf size-twig size relationship to environmental variations, we investi-.

  6. Photoperiod-H1 (Ppd-H1) Controls Leaf Size1[OPEN

    Science.gov (United States)

    Digel, Benedikt; Tavakol, Elahe; Verderio, Gabriele; Xu, Xin

    2016-01-01

    Leaf size is a major determinant of plant photosynthetic activity and biomass; however, it is poorly understood how leaf size is genetically controlled in cereal crop plants like barley (Hordeum vulgare). We conducted a genome-wide association scan for flowering time, leaf width, and leaf length in a diverse panel of European winter cultivars grown in the field and genotyped with a single-nucleotide polymorphism array. The genome-wide association scan identified PHOTOPERIOD-H1 (Ppd-H1) as a candidate gene underlying the major quantitative trait loci for flowering time and leaf size in the barley population. Microscopic phenotyping of three independent introgression lines confirmed the effect of Ppd-H1 on leaf size. Differences in the duration of leaf growth and consequent variation in leaf cell number were responsible for the leaf size differences between the Ppd-H1 variants. The Ppd-H1-dependent induction of the BARLEY MADS BOX genes BM3 and BM8 in the leaf correlated with reductions in leaf size and leaf number. Our results indicate that leaf size is controlled by the Ppd-H1- and photoperiod-dependent progression of plant development. The coordination of leaf growth with flowering may be part of a reproductive strategy to optimize resource allocation to the developing inflorescences and seeds. PMID:27457126

  7. Photoperiod-H1 (Ppd-H1) Controls Leaf Size.

    Science.gov (United States)

    Digel, Benedikt; Tavakol, Elahe; Verderio, Gabriele; Tondelli, Alessandro; Xu, Xin; Cattivelli, Luigi; Rossini, Laura; von Korff, Maria

    2016-09-01

    Leaf size is a major determinant of plant photosynthetic activity and biomass; however, it is poorly understood how leaf size is genetically controlled in cereal crop plants like barley (Hordeum vulgare). We conducted a genome-wide association scan for flowering time, leaf width, and leaf length in a diverse panel of European winter cultivars grown in the field and genotyped with a single-nucleotide polymorphism array. The genome-wide association scan identified PHOTOPERIOD-H1 (Ppd-H1) as a candidate gene underlying the major quantitative trait loci for flowering time and leaf size in the barley population. Microscopic phenotyping of three independent introgression lines confirmed the effect of Ppd-H1 on leaf size. Differences in the duration of leaf growth and consequent variation in leaf cell number were responsible for the leaf size differences between the Ppd-H1 variants. The Ppd-H1-dependent induction of the BARLEY MADS BOX genes BM3 and BM8 in the leaf correlated with reductions in leaf size and leaf number. Our results indicate that leaf size is controlled by the Ppd-H1- and photoperiod-dependent progression of plant development. The coordination of leaf growth with flowering may be part of a reproductive strategy to optimize resource allocation to the developing inflorescences and seeds. © 2016 American Society of Plant Biologists. All rights reserved.

  8. Frost and leaf-size gradients in forests: global patterns and experimental evidence.

    Science.gov (United States)

    Lusk, Christopher H; Clearwater, Michael J; Laughlin, Daniel C; Harrison, Sandy P; Prentice, Iain Colin; Nordenstahl, Marisa; Smith, Benjamin

    2018-05-16

    Explanations of leaf size variation commonly focus on water availability, yet leaf size also varies with latitude and elevation in environments where water is not strongly limiting. We provide the first conclusive test of a prediction of leaf energy balance theory that may explain this pattern: large leaves are more vulnerable to night-time chilling, because their thick boundary layers impede convective exchange with the surrounding air. Seedlings of 15 New Zealand evergreens spanning 12-fold variation in leaf width were exposed to clear night skies, and leaf temperatures were measured with thermocouples. We then used a global dataset to assess several climate variables as predictors of leaf size in forest assemblages. Leaf minus air temperature was strongly correlated with leaf width, ranging from -0.9 to -3.2°C in the smallest- and largest-leaved species, respectively. Mean annual temperature and frost-free period were good predictors of evergreen angiosperm leaf size in forest assemblages, but no climate variable predicted deciduous leaf size. Although winter deciduousness makes large leaves possible in strongly seasonal climates, large-leaved evergreens are largely confined to frost-free climates because of their susceptibility to radiative cooling. Evergreen leaf size data can therefore be used to enhance vegetation models, and to infer palaeotemperatures from fossil leaf assemblages. © 2018 The Authors New Phytologist © 2018 New Phytologist Trust.

  9. Leaf size and leaf display of thirty-eight tropical tree species

    NARCIS (Netherlands)

    Poorter, L.; Rozendaal, D.M.A.

    2008-01-01

    Trees forage for light through optimal leaf display. Effective leaf display is determined by metamer traits (i.e., the internode, petiole, and corresponding leaf), and thus these traits strongly co-determine carbon gain and as a result competitive advantage in a light-limited environment. We

  10. Disc size regulation in the brood cell building behavior of leaf-cutter bee, Megachile tsurugensis.

    Science.gov (United States)

    Kim, Jong-yoon

    2007-12-01

    The leaf-cutter bee, Megachile tsurugensis, builds a brood cell in a preexisting tunnel with leaf discs that she cuts in decreasing sizes and assembles them like a Russian matryoshka doll. By experimentally manipulating the brood cell, it was investigated how she regulates the size of leaf discs that fit in the brood cell's internal volume. When the internal volume was artificially increased by removing a bulk of leaf discs, she decreased the leaf disc size, although increasing it would have made the leaf disc more fitting in the increased internal volume. As a reverse manipulation, when the internal volume was decreased by inserting a group of inner layers of preassembled leaf discs to a brood cell, she decreased the leaf disc size, so that the leaf disc could fit in the decreased internal volume. These results suggest that she uses at least two different mechanisms to regulate the disc size: the use of some internal memory about the degree of building work accomplished in the first and of sensory feedback of dimensional information at the construction site in the second manipulation, respectively. It was concluded that a stigmergic mechanism, an immediate sensory feedback from the brood cell changed by the building work, alone cannot explain the details of the bee's behavior particularly with respect to her initial response to the first manipulation. For a more complete explanation of the behavior exhibited by the solitary bee, two additional behavioral elements, reinforcement of building activity and processing of dimensional information, were discussed along with stigmergy.

  11. Tracking maize pollen development by the Leaf Collar Method.

    Science.gov (United States)

    Begcy, Kevin; Dresselhaus, Thomas

    2017-12-01

    An easy and highly reproducible nondestructive method named the Leaf Collar Method is described to identify and characterize the different stages of pollen development in maize. In plants, many cellular events such as meiosis, asymmetric cell division, cell cycle regulation, cell fate determination, nucleus movement, vacuole formation, chromatin condensation and epigenetic modifications take place during pollen development. In maize, pollen development occurs in tassels that are confined within the internal stalk of the plant. Hence, identification of the different pollen developmental stages as a tool to investigate above biological processes is impossible without dissecting the entire plant. Therefore, an efficient and reproducible method is necessary to isolate homogeneous cell populations at individual stages throughout pollen development without destroying the plant. Here, we describe a method to identify the various stages of pollen development in maize. Using the Leaf Collar Method in the maize inbreed line B73, we have determined the duration of each stage from pollen mother cells before meiosis to mature tricellular pollen. Anther and tassel size as well as percentage of pollen stages were correlated with vegetative stages, which are easily recognized. The identification of stage-specific genes indicates the reproducibility of the method. In summary, we present an easy and highly reproducible nondestructive method to identify and characterize the different stages of pollen development in maize. This method now opens the way for many subsequent physiological, morphological and molecular analyses to study, for instance, transcriptomics, metabolomics, DNA methylation and chromatin patterns during normal and stressful conditions throughout pollen development in one of the economically most important grass species.

  12. A non-destructive method for estimating onion leaf area

    Directory of Open Access Journals (Sweden)

    Córcoles J.I.

    2015-06-01

    Full Text Available Leaf area is one of the most important parameters for characterizing crop growth and development, and its measurement is useful for examining the effects of agronomic management on crop production. It is related to interception of radiation, photosynthesis, biomass accumulation, transpiration and gas exchange in crop canopies. Several direct and indirect methods have been developed for determining leaf area. The aim of this study is to develop an indirect method, based on the use of a mathematical model, to compute leaf area in an onion crop using non-destructive measurements with the condition that the model must be practical and useful as a Decision Support System tool to improve crop management. A field experiment was conducted in a 4.75 ha commercial onion plot irrigated with a centre pivot system in Aguas Nuevas (Albacete, Spain, during the 2010 irrigation season. To determine onion crop leaf area in the laboratory, the crop was sampled on four occasions between 15 June and 15 September. At each sampling event, eight experimental plots of 1 m2 were used and the leaf area for individual leaves was computed using two indirect methods, one based on the use of an automated infrared imaging system, LI-COR-3100C, and the other using a digital scanner EPSON GT-8000, obtaining several images that were processed using Image J v 1.43 software. A total of 1146 leaves were used. Before measuring the leaf area, 25 parameters related to leaf length and width were determined for each leaf. The combined application of principal components analysis and cluster analysis for grouping leaf parameters was used to reduce the number of variables from 25 to 12. The parameter derived from the product of the total leaf length (L and the leaf diameter at a distance of 25% of the total leaf length (A25 gave the best results for estimating leaf area using a simple linear regression model. The model obtained was useful for computing leaf area using a non

  13. Phenotypic characterization and inheritance of two foliar mutants in pea (Pisum Sativum L.): 'Reduced leaf size' and 'Orange leaf'

    International Nuclear Information System (INIS)

    Naidenova, N.; Vassilevska-Ivanova, R.; Tcekova, Z.

    2003-01-01

    Two foliar pea (Pisum sativum L.) mutants characterized by reduced leaf size (2/978) and orange leaf (2/1409 M) were established. Both mutants were described morphologically and their productivity potential , pollen viability and inheritance of the mutant traits were evaluated. The mutant 2/978 was identified after irradiation of dry seeds from cv Borek with 15 Gy fast neutrons and was related to the leaf mutation 'rogue'. Reciprocal crosses between mutant 2/978 and cv Borel were executed, and F 1 and F 2 generations were analyzed. The altered leaf trait was presented in all F 1 plants suggesting a dominant character. F 2 segregation data indicated that the trait was controlled by a single dominant gene. The mutant 2/1409M originated from the mutant 2/978 after irradiation with 50 Gy γ-rays. The main mutant's phenotypic characteristic was the orange-yellow coloration of leaves and plants. After of series of crosses it was established that induced chlorophyll mutation is monogenic, recessive and both mutant traits are independently inherited. Two mutants could be used as appropriate plant material for genetic and biological investigations

  14. Linkage between canopy water storage and drop size distributions of leaf drips

    Science.gov (United States)

    Nanko, Kazuki; Watanabe, Ai; Hotta, Norifumi; Suzuki, Masakazu

    2013-04-01

    Differences in drop size distribution (DSD) of leaf drips among tree species have been estimated and physically interpreted to clarify the leaf drip generation process. Leaf drip generation experiments for nine species were conducted in an indoor location without foliage vibration using an automatic mist spray. Broad-leaved species produced a similar DSD among species whose leaves had a matte surface and a second similar DSD among species whose leaves had a coated surface. The matte broad leaves produced a larger and wider range of DSDs than the coated broad leaves. Coated coniferous needles had a wider range of DSDs than the coated broad leaves and different DSDs were observed for different species. The species with shorter dense needles generated a larger DSD. The leaf drip diameter was calculated through the estimation of a state of equilibrium of a hanging drop on the leaves based on physical theory. The calculations indicated that the maximum diameter of leaf drips was determined by the contact angle, and the range of DSDs was determined by the variation in contact length and the contact diameter at the hanging points. The results revealed that leaf drip DSD changed due to variations in leaf hydrophobicity, leaf roughness, leaf geometry and leaf inclination among the different tree species. This study allows the modelization of throughfall DSD. Furthermore, it indicates the possibility of interpreting canopy water processes from canopy water storage to drainage through the contact angle and leaf drip DSD. The part of this study is published in Nanko et al. (2013, Agric. Forest. Meteorol. 169, 74-84).

  15. The leaf size-twig size spectrum in evergreen broadleaved forest of ...

    African Journals Online (AJOL)

    Compared to deciduous broad-leaved species, the evergreen broad-leaved species were smaller in total leaf area for a given cross-sectional area or stem mass. This suggests that the species would support less leaf area at a given twig cross-sectional area with increasing environmental stress. And the life form can modify ...

  16. Using the volumetric effect of a finite-sized detector for routine quality assurance of multileaf collimator leaf positioning

    International Nuclear Information System (INIS)

    Yang Yong; Xing Lei

    2003-01-01

    Intensity modulated radiation therapy (IMRT) is an advanced form of radiation therapy and promises to improve dose conformation while reducing the irradiation to the sensitive structures. The modality is, however, more complicated than conventional treatment and requires much more stringent quality assurance (QA) to ensure what has been planned can be achieved accurately. One of the main QA tasks is the assurance of positioning accuracy of multileaf collimator (MLC) leaves during IMRT delivery. Currently, the routine quality assurance of MLC in most clinics is being done using radiographic films with specially designed MLC leaf sequences. Besides being time consuming, the results of film measurements are difficult to quantify and interpret. In this work, we propose a new and effective technique for routine MLC leaf positioning QA. The technique utilizes the fact that, when a finite-sized detector is placed under a leaf, the relative output of the detector will depend on the relative fractional volume irradiated. A small error in leaf positioning would change the fractional volume irradiated and lead to a deviation of the relative output from the normal reading. For a given MLC and detector system, the relation between the relative output and the leaf displacement can be easily established through experimental measurements and used subsequently as a quantitative means for detecting possible leaf positional errors. The method was tested using a linear accelerator with an 80-leaf MLC. Three different locations, including two locations on central plane (X1=X2=0) and one point on an off-central plane location (X1=-7.5, X=7.5), were studied. Our results indicated that the method could accurately detect a leaf positional change of ∼0.1 mm. The method was also used to monitor the stability of MLC leaf positioning for five consecutive weeks. In this test, we intentionally introduced two positional errors in the testing MLC leaf sequences: -0.2 mm and 1.2 mm. The technique

  17. Intensity modulated radiosurgery for the spine: Dosimetric impact of beamlet size variation in the leaf travel direction

    International Nuclear Information System (INIS)

    Kim, Joo Young; Shin, Hyun Soo; Kim, Ja Young; Park, Hyeli; Kim, Sung Joon

    2011-01-01

    Background and purpose: To investigate the dosimetric impact of beamlet size in the leaf travel direction for the spinal treatment using intensity-modulated radiosurgery (IMRS). Materials and methods: The IMRS plans of ten patients (11 lesions - 6 thoracic, 2 cervical, 3 lumbar) were re-planned using four different beamlet sizes (1, 2, 5, and 10 mm) - in the leaf travel direction, while keeping the Y-dimension by multi-leaf collimator (MLC) width fixed, and compared to the reference plan with beamlet size of 3 mm. To evaluate the beamlet size effect, target volumes (coverage, conformity, and size effect), organ at risks (OARS) (doses to the spinal cord, lung and kidneys), and integral dose, and monitor units (MUs) were calculated. Results: Target coverage and dose conformity for planning target volume (PTV) were not correlated with beamlet size. Maximum (p = 0.000) and mean (p = 0.000) spinal cord doses decreased by 4.0% and 3.4% from 23.4% and 28.6% as beamlet size decreased from 10 to 1 mm. The integral doses, MUs and doses to other organs increased at smaller beamlet sizes. MUs for a beamlet size of 10 mm decreased by 31.4%, as compared with that at the reference beamlet size. Conclusions: Despite no dosimetric benefits with respect to target volume and an MU increase, a definite dose reduction was observed at the spinal cord for smaller beamlet sizes. Treatment with IMRS planning for the spine will benefit from the use of a beamlet size between 2 and 4 mm.

  18. Trade-offs between seed and leaf size (seed-phytomer-leaf theory): functional glue linking regenerative with life history strategies … and taxonomy with ecology?

    Science.gov (United States)

    Hodgson, John G; Santini, Bianca A; Montserrat Marti, Gabriel; Royo Pla, Ferran; Jones, Glynis; Bogaard, Amy; Charles, Mike; Font, Xavier; Ater, Mohammed; Taleb, Abdelkader; Poschlod, Peter; Hmimsa, Younes; Palmer, Carol; Wilson, Peter J; Band, Stuart R; Styring, Amy; Diffey, Charlotte; Green, Laura; Nitsch, Erika; Stroud, Elizabeth; Romo-Díez, Angel; de Torres Espuny, Lluis; Warham, Gemma

    2017-11-10

    While the 'worldwide leaf economics spectrum' (Wright IJ, Reich PB, Westoby M, et al. 2004. The worldwide leaf economics spectrum. Nature : 821-827) defines mineral nutrient relationships in plants, no unifying functional consensus links size attributes. Here, the focus is upon leaf size, a much-studied plant trait that scales positively with habitat quality and components of plant size. The objective is to show that this wide range of relationships is explicable in terms of a seed-phytomer-leaf (SPL) theoretical model defining leaf size in terms of trade-offs involving the size, growth rate and number of the building blocks (phytomers) of which the young shoot is constructed. Functional data for 2400+ species and English and Spanish vegetation surveys were used to explore interrelationships between leaf area, leaf width, canopy height, seed mass and leaf dry matter content (LDMC). Leaf area was a consistent function of canopy height, LDMC and seed mass. Additionally, size traits are partially uncoupled. First, broad laminas help confer competitive exclusion while morphologically large leaves can, through dissection, be functionally small. Secondly, leaf size scales positively with plant size but many of the largest-leaved species are of medium height with basally supported leaves. Thirdly, photosynthetic stems may represent a functionally viable alternative to 'small seeds + large leaves' in disturbed, fertile habitats and 'large seeds + small leaves' in infertile ones. Although key elements defining the juvenile growth phase remain unmeasured, our results broadly support SPL theory in that phytometer and leaf size are a product of the size of the initial shoot meristem (≅ seed mass) and the duration and quality of juvenile growth. These allometrically constrained traits combine to confer ecological specialization on individual species. Equally, they appear conservatively expressed within major taxa. Thus, 'evolutionary canalization' sensu Stebbins (Stebbins GL

  19. Sensitivity of leaf size and shape to climate: Global patterns and paleoclimatic applications

    Science.gov (United States)

    Peppe, D.J.; Royer, D.L.; Cariglino, B.; Oliver, S.Y.; Newman, S.; Leight, E.; Enikolopov, G.; Fernandez-Burgos, M.; Herrera, F.; Adams, J.M.; Correa, E.; Currano, E.D.; Erickson, J.M.; Hinojosa, L.F.; Hoganson, J.W.; Iglesias, A.; Jaramillo, C.A.; Johnson, K.R.; Jordan, G.J.; Kraft, N.J.B.; Lovelock, E.C.; Lusk, C.H.; Niinemets, U.; Penuelas, J.; Rapson, G.; Wing, S.L.; Wright, I.J.

    2011-01-01

    Paleobotanists have long used models based on leaf size and shape to reconstruct paleoclimate. However, most models incorporate a single variable or use traits that are not physiologically or functionally linked to climate, limiting their predictive power. Further, they often underestimate paleotemperature relative to other proxies. Here we quantify leaf-climate correlations from 92 globally distributed, climatically diverse sites, and explore potential confounding factors. Multiple linear regression models for mean annual temperature (MAT) and mean annual precipitation (MAP) are developed and applied to nine well-studied fossil floras. We find that leaves in cold climates typically have larger, more numerous teeth, and are more highly dissected. Leaf habit (deciduous vs evergreen), local water availability, and phylogenetic history all affect these relationships. Leaves in wet climates are larger and have fewer, smaller teeth. Our multivariate MAT and MAP models offer moderate improvements in precision over univariate approaches (??4.0 vs 4.8??C for MAT) and strong improvements in accuracy. For example, our provisional MAT estimates for most North American fossil floras are considerably warmer and in better agreement with independent paleoclimate evidence. Our study demonstrates that the inclusion of additional leaf traits that are functionally linked to climate improves paleoclimate reconstructions. This work also illustrates the need for better understanding of the impact of phylogeny and leaf habit on leaf-climate relationships. ?? 2011 The Authors. New Phytologist ?? 2011 New Phytologist Trust.

  20. Interlaboratory Validation of the Leaching Environmental Assessment Framework (LEAF) Method 1313 and Method 1316

    Science.gov (United States)

    This document summarizes the results of an interlaboratory study conducted to generate precision estimates for two parallel batch leaching methods which are part of the Leaching Environmental Assessment Framework (LEAF). These methods are: (1) Method 1313: Liquid-Solid Partition...

  1. Mycorrhizal Stimulation of Leaf Gas Exchange in Relation to Root Colonization, Shoot Size, Leaf Phosphorus and Nitrogen: A Quantitative Analysis of the Literature Using Meta-Regression.

    Science.gov (United States)

    Augé, Robert M; Toler, Heather D; Saxton, Arnold M

    2016-01-01

    Arbuscular mycorrhizal (AM) symbiosis often stimulates gas exchange rates of the host plant. This may relate to mycorrhizal effects on host nutrition and growth rate, or the influence may occur independently of these. Using meta-regression, we tested the strength of the relationship between AM-induced increases in gas exchange, and AM size and leaf mineral effects across the literature. With only a few exceptions, AM stimulation of carbon exchange rate (CER), stomatal conductance (g s), and transpiration rate (E) has been significantly associated with mycorrhizal stimulation of shoot dry weight, leaf phosphorus, leaf nitrogen:phosphorus ratio, and percent root colonization. The sizeable mycorrhizal stimulation of CER, by 49% over all studies, has been about twice as large as the mycorrhizal stimulation of g s and E (28 and 26%, respectively). CER has been over twice as sensitive as g s and four times as sensitive as E to mycorrhizal colonization rates. The AM-induced stimulation of CER increased by 19% with each AM-induced doubling of shoot size; the AM effect was about half as large for g s and E. The ratio of leaf N to leaf P has been more closely associated with mycorrhizal influence on leaf gas exchange than leaf P alone. The mycorrhizal influence on CER has declined markedly over the 35 years of published investigations.

  2. Mycorrhizal stimulation of leaf gas exchange in relation to root colonization, shoot size, leaf phosphorus and nitrogen: a quantitative analysis of the literature using meta-regression

    Directory of Open Access Journals (Sweden)

    Robert M. Augé

    2016-07-01

    Full Text Available Arbuscular mycorrhizal (AM symbiosis often stimulates gas exchange rates of the host plant. This may relate to mycorrhizal effects on host nutrition and growth rate, or the influence may occur independently of these. Using meta-regression, we tested the strength of the relationship between AM-induced increases in gas exchange, and AM size and leaf mineral effects across the literature. With only a few exceptions, AM stimulation of carbon exchange rate (CER, stomatal conductance (gs and transpiration rate (E has been significantly associated with mycorrhizal stimulation of shoot dry weight, leaf phosphorus, leaf nitrogen: phosphorus ratio and percent root colonization. The sizeable mycorrhizal stimulation of CER, by 49% over all studies, has been about twice as large as the mycorrhizal stimulation of gs and E (28% and 26%, respectively. Carbon exchange rate has been over twice as sensitive as gs and four times as sensitive as E to mycorrhizal colonization rates. The AM-induced stimulation of CER increased by 19% with each AM-induced doubling of shoot size; the AM effect was about half as large for gs and E. The ratio of leaf N to leaf P has been more closely associated with mycorrhizal influence on leaf gas exchange than leaf P alone. The mycorrhizal influence on CER has declined markedly over the 35 years of published investigations.

  3. Effects of host-plant population size and plant sex on a specialist leaf-miner

    DEFF Research Database (Denmark)

    Bañuelos, María-José; Kollmann, Johannes Christian

    2011-01-01

    of the host-plant, and density-dependent relationships. Leaf-miners are specialised herbivores that leave distinct traces on infested leaves in the form of egg scars, mines, signs of predation and emergence holes. This allows the life cycle of the insect to be reconstructed and the success at the different...... punctures left by adults were marginally more frequent on male plants, whereas egg scars and mines were more common on females. Overall survival rate from egg stage to adult emergence was higher on female plants. Egg density was negatively correlated with hatching, while mine density was positively...... stages to be estimated. The main stages of the leaf-miner Phytomyza ilicis were recorded in eleven populations of the evergreen host Ilex aquifolium in Denmark. Survival rates were calculated and related to population size, sex of the host plant, and egg and mine densities. Host population size...

  4. Facile synthesis of size-tunable gold nanoparticles by pomegranate (Punica granatum) leaf extract: Applications in arsenate sensing

    Energy Technology Data Exchange (ETDEWEB)

    Rao, Ashit; Mahajan, Ketakee; Bankar, Ashok [Institute of Bioinformatics and Biotechnology, University of Pune, Pune 411007 (India); Srikanth, Rapole [Proteomics Laboratory, National Centre for Cell Science, Pune 411007 (India); Kumar, Ameeta Ravi [Institute of Bioinformatics and Biotechnology, University of Pune, Pune 411007 (India); Gosavi, Suresh, E-mail: swg@physics.unipune.ac.in [Department of Physics, University of Pune, Pune 411007 (India); Centre for Sensor Studies, University of Pune, Pune 411007 (India); Zinjarde, Smita, E-mail: smita@unipune.ac.in [Institute of Bioinformatics and Biotechnology, University of Pune, Pune 411007 (India); Centre for Sensor Studies, University of Pune, Pune 411007 (India)

    2013-03-15

    Highlights: ► Pomegranate leaf extracts mediated rapid gold nanoparticle (AuNP) synthesis. ► The phyto-inspired AuNPs were size-tuned and characterized. ► The reducing and capping agents in the extract were identified. ► The nanoparticles reacted specifically with arsenate (V) ions. - Abstract: When pomegranate leaf extracts were incubated with chloroauric acid (HAuCl{sub 4}), gold nanoparticles (AuNPs) were synthesized. These were characterized by a variety of techniques. With an increasing content of the leaf extract, a gradual decrease in size and an increase in monodispersity were observed. Transmission electron microscope (TEM) images showed that the phyto-fabricated AuNPs were surrounded by an amorphous layer. Gallic acid in the extract mediated the reduction and a natural decapeptide capped the nanostructures. Blocking of thiol groups in the decapeptide cysteine residues caused the nanoparticles to aggregate. On interaction with arsenate (V) ions, the UV–vis spectra of the nanoparticles showed a decrease in intensity and a red-shift. Energy dispersive spectra confirmed the presence of arsenate associated with the AuNPs. Thus, by using these AuNPs, a method for sensing the toxic arsenate ions could be developed.

  5. Facile synthesis of size-tunable gold nanoparticles by pomegranate (Punica granatum) leaf extract: Applications in arsenate sensing

    International Nuclear Information System (INIS)

    Rao, Ashit; Mahajan, Ketakee; Bankar, Ashok; Srikanth, Rapole; Kumar, Ameeta Ravi; Gosavi, Suresh; Zinjarde, Smita

    2013-01-01

    Highlights: ► Pomegranate leaf extracts mediated rapid gold nanoparticle (AuNP) synthesis. ► The phyto-inspired AuNPs were size-tuned and characterized. ► The reducing and capping agents in the extract were identified. ► The nanoparticles reacted specifically with arsenate (V) ions. - Abstract: When pomegranate leaf extracts were incubated with chloroauric acid (HAuCl 4 ), gold nanoparticles (AuNPs) were synthesized. These were characterized by a variety of techniques. With an increasing content of the leaf extract, a gradual decrease in size and an increase in monodispersity were observed. Transmission electron microscope (TEM) images showed that the phyto-fabricated AuNPs were surrounded by an amorphous layer. Gallic acid in the extract mediated the reduction and a natural decapeptide capped the nanostructures. Blocking of thiol groups in the decapeptide cysteine residues caused the nanoparticles to aggregate. On interaction with arsenate (V) ions, the UV–vis spectra of the nanoparticles showed a decrease in intensity and a red-shift. Energy dispersive spectra confirmed the presence of arsenate associated with the AuNPs. Thus, by using these AuNPs, a method for sensing the toxic arsenate ions could be developed

  6. How Does Temperature Impact Leaf Size and Shape in Four Woody Dicot Species? Testing the Assumptions of Leaf Physiognomy-Climate Models

    Science.gov (United States)

    McKee, M.; Royer, D. L.

    2017-12-01

    The physiognomy (size and shape) of fossilized leaves has been used to reconstruct the mean annual temperature of ancient environments. Colder temperatures often select for larger and more abundant leaf teeth—serrated edges on leaf margins—as well as a greater degree of leaf dissection. However, to be able to accurately predict paleotemperature from the morphology of fossilized leaves, leaves must be able to react quickly and in a predictable manner to changes in temperature. We examined the extent to which temperature affects leaf morphology in four tree species: Carpinus caroliniana, Acer negundo, Ilex opaca, and Ostrya virginiana. Saplings of these species were grown in two growth cabinets under contrasting temperatures (17 and 25 °C). Compared to the cool treatment, in the warm treatment Carpinus caroliniana leaves had significantly fewer leaf teeth and a lower ratio of total number of leaf teeth to internal perimeter; and Acer negundo leaves had a significantly lower feret diameter ratio (a measure of leaf dissection). In addition, a two-way ANOVA tested the influence of temperature and species on leaf physiognomy. This analysis revealed that all plants, regardless of species, tended to develop more highly dissected leaves with more leaf teeth in the cool treatment. Because the cabinets maintained equivalent moisture, humidity, and CO2 concentration between the two treatments, these results demonstrate that these species could rapidly adapt to changes in temperature. However, not all of the species reacted identically to temperature changes. For example, Acer negundo, Carpinus caroliniana, and Ostrya virginiana all had a higher number of total teeth in the cool treatment compared to the warm treatment, but the opposite was true for Ilex opaca. Our work questions a fundamental assumption common to all models predicting paleotemperature from the physiognomy of fossilized leaves: a given climate will inevitably select for the same leaf physiognomy

  7. Effects of host-plant population size and plant sex on a specialist leaf-miner

    Science.gov (United States)

    Bañuelos, María-José; Kollmann, Johannes

    2011-03-01

    Animal population density has been related to resource patch size through various hypotheses such as those derived from island biogeography and resource concentration theory. This theoretical framework can be also applied to plant-herbivore interactions, and it can be modified by the sex of the host-plant, and density-dependent relationships. Leaf-miners are specialised herbivores that leave distinct traces on infested leaves in the form of egg scars, mines, signs of predation and emergence holes. This allows the life cycle of the insect to be reconstructed and the success at the different stages to be estimated. The main stages of the leaf-miner Phytomyza ilicis were recorded in eleven populations of the evergreen host Ilex aquifolium in Denmark. Survival rates were calculated and related to population size, sex of the host plant, and egg and mine densities. Host population size was negatively related to leaf-miner prevalence, with larger egg and mine densities in small populations. Percentage of eggs hatching and developing into mines, and percentage of adult flies emerging from mines also differed among host populations, but were not related to population size or host cover. Feeding punctures left by adults were marginally more frequent on male plants, whereas egg scars and mines were more common on females. Overall survival rate from egg stage to adult emergence was higher on female plants. Egg density was negatively correlated with hatching, while mine density was positively correlated with emergence of the larvae. The inverse effects of host population size were not in line with predictions based on island biogeography and resource concentration theory. We discuss how a thorough knowledge of the immigration behaviour of this fly might help to understand the patterns found.

  8. Combined use of leaf size and economics traits allows direct comparison of hydrophyte and terrestrial herbaceous adaptive strategies.

    Science.gov (United States)

    Pierce, Simon; Brusa, Guido; Sartori, Matteo; Cerabolini, Bruno E L

    2012-04-01

    Hydrophytes generally exhibit highly acquisitive leaf economics. However, a range of growth forms is evident, from small, free-floating and rapidly growing Lemniden to large, broad-leaved Nymphaeiden, denoting variability in adaptive strategies. Traits used to classify adaptive strategies in terrestrial species, such as canopy height, are not applicable to hydrophytes. We hypothesize that hydrophyte leaf size traits and economics exhibit sufficient overlap with terrestrial species to allow a common classification of plant functional types, sensu Grime's CSR theory. Leaf morpho-functional traits were measured for 61 species from 47 water bodies in lowland continental, sub-alpine and alpine bioclimatic zones in southern Europe and compared against the full leaf economics spectrum and leaf size range of terrestrial herbs, and between hydrophyte growth forms. Hydrophytes differed in the ranges and mean values of traits compared with herbs, but principal components analysis (PCA) demonstrated that both groups shared axes of trait variability: PCA1 encompassed size variation (area and mass), and PCA2 ranged from relatively dense, carbon-rich leaves to nitrogen-rich leaves of high specific leaf area (SLA). Most growth forms exhibited trait syndromes directly equivalent to herbs classified as R adapted, although Nymphaeiden ranged between C and SR adaptation. Our findings support the hypothesis that hydrophyte adaptive strategy variation reflects fundamental trade-offs in economics and size that govern all plants, and that hydrophyte adaptive strategies can be directly compared with terrestrial species by combining leaf economics and size traits.

  9. Influence of pore size distributions on decomposition of maize leaf residue: evidence from X-ray computed micro-tomography

    Science.gov (United States)

    Negassa, Wakene; Guber, Andrey; Kravchenko, Alexandra; Rivers, Mark

    2014-05-01

    the incubation. The µ-CT image showed that approximately 80% of the leaves in the intact samples of large aggregate fractions (0.5-1.0 and 1.0-2.0 mm) was decomposed during the incubation, while only 50-60% of the leaves were decomposed in the intact samples of smaller sized fractions. Even lower percent of leaves (40-50%) was decomposed in the ground samples, with very similar leaf decomposition observed in all ground samples regardless of the aggregate fraction size. Consistent with µ-CT results, the proportion of decomposed leaf estimated with the conventional mass loss method was 48% and 60% for the <0.05 mm and 1.0-2.0 mm soil size fractions of intact aggregates, and 40-50% in ground samples, respectively. The results of the incubation experiment demonstrated that, while greater C mineralization was observed in samples of all size fractions amended with leaf, the effect of leaf presence was most pronounced in the smaller aggregate fractions (0.05-0.1 mm and 0.05 mm) of intact aggregates. The results of the present study unequivocally demonstrate that differences in pore size distributions have a major effect on the decomposition of plant residues added to soil. Moreover, in presence of plant residues, differences in pore size distributions appear to also influence the rates of decomposition of the intrinsic soil organic material.

  10. Method for sizing hollow microspheres

    Science.gov (United States)

    Farnum, E.H.; Fries, R.J.

    1975-10-29

    Hollow Microspheres may be effectively sized by placing them beneath a screen stack completely immersed in an ultrasonic bath containing a liquid having a density at which the microspheres float and ultrasonically agitating the bath.

  11. Evaluation of two methods of predicting MLC leaf positions using EPID measurements

    International Nuclear Information System (INIS)

    Parent, Laure; Seco, Joao; Evans, Phil M.; Dance, David R.; Fielding, Andrew

    2006-01-01

    In intensity modulated radiation treatments (IMRT), the position of the field edges and the modulation within the beam are often achieved with a multileaf collimator (MLC). During the MLC calibration process, due to the finite accuracy of leaf position measurements, a systematic error may be introduced to leaf positions. Thereafter leaf positions of the MLC depend on the systematic error introduced on each leaf during MLC calibration and on the accuracy of the leaf position control system (random errors). This study presents and evaluates two methods to predict the systematic errors on the leaf positions introduced during the MLC calibration. The two presented methods are based on a series of electronic portal imaging device (EPID) measurements. A comparison with film measurements showed that the EPID could be used to measure leaf positions without introducing any bias. The first method, referred to as the 'central leaf method', is based on the method currently used at this center for MLC leaf calibration. It mimics the manner in which leaf calibration parameters are specified in the MLC control system and consequently is also used by other centers. The second method, a new method proposed by the authors and referred to as the ''individual leaf method,'' involves the measurement of two positions for each leaf (-5 and +15 cm) and the interpolation and extrapolation from these two points to any other given position. The central leaf method and the individual leaf method predicted leaf positions at prescribed positions of -11, 0, 5, and 10 cm within 2.3 and 1.0 mm, respectively, with a standard deviation (SD) of 0.3 and 0.2 mm, respectively. The individual leaf method provided a better prediction of the leaf positions than the central leaf method. Reproducibility tests for leaf positions of -5 and +15 cm were performed. The reproducibility was within 0.4 mm on the same day and 0.4 mm six weeks later (1 SD). Measurements at gantry angles of 0 deg., 90 deg., and 270 deg

  12. Effect of Manufacturing Method to Tensile Properties of Hybrid Composite Reinforced by Natural (Agel Leaf Fiber) and Glass Fibers

    Science.gov (United States)

    Nugroho, A.; Abdurohman, K.; Kusmono; Hestiawan, H.; Jamasri

    2018-04-01

    This paper described the effect of different type of manufacturing method to tensile properties of hybrid composite woven agel leaf fiber and glass fiber as an alternative of LSU structure material. The research was done by using 3 ply of woven agel leaf fiber (ALF) and 3 ply of glass fiber (wr200) while the matrix was using unsaturated polyester. Composite manufacturing method used hand lay-up and vacuum bagging. Tensile test conducted with Tensilon universal testing machine, specimen shape and size according to standard size ASTM D 638. Based on tensile test result showed that the tensile strength of agel leaf fiber composite with unsaturated polyester matrix is 54.5 MPa by hand lay-up and 84.6 MPa with vacuum bagging method. From result of tensile test, hybrid fiber agel composite and glass fiber with unsaturated polyester matrix have potential as LSU structure.

  13. Nest Digging by Leaf-Cutting Ants: Effect of Group Size and Functional Structures

    Directory of Open Access Journals (Sweden)

    Roberto da Silva Camargo

    2012-01-01

    Full Text Available Leaf-cutting ant workers dig underground chambers, for housing their symbiotic fungus, interconnected by a vast quantity of tunnels whose function is to permit the entrance of food (leaves, gaseous exchanges, and movement of workers, offspring, and the queen. Digging is a task executed by a group of workers, but little is known about the group effect and group-constructed functional structures. Thus, we analyzed the structures formed by worker groups (5, 10, 20, and 40 individuals of the leaf-cutting ant, Atta sexdens rubropilosa, for 2 days of excavation. The digging arena was the same for the 4 groups, with each group corresponding to a different density. Our results verified a pattern of tunneling by the workers, but no chamber was constructed. The group effect is well known, since the 40-worker group dug significantly more than the groups of 5, 10, and 20. These groups did not differ statistically from each other. Analysis of load/worker verified that workers of the smallest group carried the greatest load. Our paper demonstrates the group effect on the digging of nests, namely, that excavation is proportional to group size, but without emergence of a functional structure such as a chamber.

  14. Method for continuous measurement of export from a leaf

    International Nuclear Information System (INIS)

    Geiger, D.R.; Fondy, B.R.

    1979-01-01

    Export of labeled material derived by continuous photosynthesis in 14 CO 2 was monitored with a Geiger-Mueller detector positioned next to an exporting leaf blade. Rate of export of labeled material was calculated from the difference between rates of retention and net photosynthesis of labeled carbon for the observed leaf. Given certain conditions, including nearly constant distribution of labeled material among minor veins and various types of cells, count rate data for the source leaf can be coverted to rate of export of carbon. Changes in counting efficiency resulting from changes in leaf water status can be corrected for with data from a transducer which measures leaf thickness. Export data agreed with data obtained by monitoring the arrival of 14 C in the sink region; isolated leaves gave values near zero for export of labeled carbon from a given leaf on an intact plant. The technique detects changes in export with a resolution of 10 to 20 minutes

  15. Effect of starch sizes particle as binder on short pineapple leaf fiber composite mechanical properties

    Directory of Open Access Journals (Sweden)

    Selamat Mohd Zulkefli

    2018-01-01

    Full Text Available Pineapple leaf fiber (PLF is one of the natural fibers that abundantly can be found in Malaysia, but the usage of the pineapple plant is limited only on their fruit and the other parts to be a waste. In this study, PLF is used as the reinforcement material and starch (SH used as the matrix or binder. Both materials were combined with several compositions ratio (weight percentage of PLF/SH composites which are 50PLF/50SH, 60PLF/40SH and 70PLF/30SH. Before undergo the fabrication process, the fiber has gone through an alkaline treatment to increase the strength of the fiber and chopped with an approximate size range from 0.5 mm to 5 mm. Besides that, SH powder is sieved to gain several particulate sizes which are 75 μm, 100 μm and 250 μm. The related tests such as flexural, hardness, density tests and macrostructure analysis have been done to determine their mechanical properties of composite. Based on the results, the sample with composition of 70PL/30SH with 75 μm has shown the highest result for flexural stress which is 14.49 MPa. While, the composite with the same composition of 70PLF/30SH with particulate size SH of 250 μm has shown the highest result in the hardness of 67 Shore-D and density of 1.36 g/cm3 respectively.

  16. Evaluation of four methods for estimating leaf area of isolated trees

    Science.gov (United States)

    P.J. Peper; E.G. McPherson

    2003-01-01

    The accurate modeling of the physiological and functional processes of urban forests requires information on the leaf area of urban tree species. Several non-destructive, indirect leaf area sampling methods have shown good performance for homogenous canopies. These methods have not been evaluated for use in urban settings where trees are typically isolated and...

  17. Adaptation of European beech (Fagus silvatica L.) to different ecological conditions: leaf size variation

    International Nuclear Information System (INIS)

    Barna, M.

    2004-01-01

    In beech trees, both leaf morphology and leaf area show considerable adaptation capabilities to the local radiation climate. The plants adapting to shade conditions create large leaf area with high chlorophyll concentration and high water content in the living tissues. On the other hand, the leaves of plants exposed to radiation of higher intensity have smaller area, several layers of mesophyll, thick epidermis and cuticle, higher dry weight, higher energy potential of the dry mass and several other characteristic properties

  18. Novel method for equivalent stiffness and Coulomb's damping ratio analyses of leaf spring

    International Nuclear Information System (INIS)

    Wen Jun, Wu; Yu, Xiang; Le Mei, Zhu; Li Jun, He

    2012-01-01

    The leaf spring is a representative type of laminated structure. Based on the linear theories of curve beams, the first derivatives of the leave's status vector of the leaf spring are provided. The first derivatives of the combination status-vector are obtained by properly dealing with the nonlinear interacted forces between adjacent leaves. Moreover, the precise integration technology and the transform matrix method are introduced to solve the equations. The force displacement curve of a leaf spring is then calculated separately by using the present method and the finite element software ANSYS. From the results, the precision and advantages of the present methods for analyzing the leaf spring are revealed. The Coulomb's damping ratio of the leaf spring is studied by using the present method

  19. A facile and rapid method for the black pepper leaf mediated green synthesis of silver nanoparticles and the antimicrobial study

    Science.gov (United States)

    Augustine, Robin; Kalarikkal, Nandakumar; Thomas, Sabu

    2014-10-01

    Green synthesis of nanoparticles is widely accepted due to the less toxicity in comparison with chemical methods. But there are certain drawbacks like slow formation of nanoparticles, difficulty to control particle size and shape make them less convenient. Here we report a novel cost-effective and eco-friendly method for the rapid green synthesis of silver nanoparticles using leaf extracts of Piper nigrum. Our results suggest that this method can be used for obtaining silver nanoparticles with controllable size within a few minutes. The fabricated nanoparticles possessed excellent antibacterial property against both Gram-positive and Gram-negative bacteria.

  20. Maximum leaf conductance driven by CO2 effects on stomatal size and density over geologic time.

    Science.gov (United States)

    Franks, Peter J; Beerling, David J

    2009-06-23

    Stomatal pores are microscopic structures on the epidermis of leaves formed by 2 specialized guard cells that control the exchange of water vapor and CO(2) between plants and the atmosphere. Stomatal size (S) and density (D) determine maximum leaf diffusive (stomatal) conductance of CO(2) (g(c(max))) to sites of assimilation. Although large variations in D observed in the fossil record have been correlated with atmospheric CO(2), the crucial significance of similarly large variations in S has been overlooked. Here, we use physical diffusion theory to explain why large changes in S necessarily accompanied the changes in D and atmospheric CO(2) over the last 400 million years. In particular, we show that high densities of small stomata are the only way to attain the highest g(cmax) values required to counter CO(2)"starvation" at low atmospheric CO(2) concentrations. This explains cycles of increasing D and decreasing S evident in the fossil history of stomata under the CO(2) impoverished atmospheres of the Permo-Carboniferous and Cenozoic glaciations. The pattern was reversed under rising atmospheric CO(2) regimes. Selection for small S was crucial for attaining high g(cmax) under falling atmospheric CO(2) and, therefore, may represent a mechanism linking CO(2) and the increasing gas-exchange capacity of land plants over geologic time.

  1. Caste-specific expression of genetic variation in the size of antibiotic-producing glands of leaf-cutting ants

    DEFF Research Database (Denmark)

    Hughes, W O H; Bot, A N M; Boomsma, J J

    2010-01-01

    are substantially larger than those of any workers, for their body size. The gland size of large workers varies significantly between patrilines in both Acromyrmex echinatior and Acromyrmex octospinosus. We also examined small workers and gynes in A. echinatior, again finding genetic variation in gland size...... in these castes. There were significant positive relationships between the gland sizes of patrilines in the different castes, indicating that the genetic mechanism underpinning the patriline variation has remained similar across phenotypes. The level of expressed genetic variation decreased from small workers......Social insect castes represent some of the most spectacular examples of phenotypic plasticity, with each caste being associated with different environmental conditions during their life. Here we examine the level of genetic variation in different castes of two polyandrous species of Acromyrmex leaf...

  2. Seasonal resource value and male size influence male aggressive interactions in the leaf footed cactus bug, Narnia femorata.

    Science.gov (United States)

    Nolen, Zachary J; Allen, Pablo E; Miller, Christine W

    2017-05-01

    In animal contests, resource value (the quality of a given resource) and resource holding potential (a male's absolute fighting ability) are two important factors determining the level of engagement and outcome of contests. Few studies have tested these factors simultaneously. Here, we investigated whether natural, seasonal differences in cactus phenology (fruit quality) influence interactions between males in the leaf-footed cactus bug, Narnia femorata (Hemiptera: Coreidae). We also considered whether males were more likely to interact when they were similar in size, as predicted by theory. Finally, we examined if male size relative to the size of an opponent predicted competitive success. We found that males have more interactions on cactus with high value ripe fruit, as we predicted. Further, we found that males that were closer in size were more likely to interact, and larger males were more likely to become dominant. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Methods for size classification of wood chips

    Energy Technology Data Exchange (ETDEWEB)

    Hartmann, Hans; Boehm, Thorsten [Technologie- und Foerderzentrum im Kompetenzzentrum fuer Nachwachsende Rohstoffe (TFZ), Schulgasse 18, D-94315 Straubing (Germany); Daugbjerg Jensen, Peter [Forest and Landscape FLD, The Royal Veterinary and Agricultural University, Rolighedsvej 23, DK-1958 Frederiksberg C (Denmark); Temmerman, Michaeel; Rabier, Fabienne [Centre wallon de Recherches agronomiques CRA-W Departement Genie rural, 146, Chaussee de Namur, B-5030 Gembloux (Belgium); Golser, Michael [Holzforschung Austria HFA Franz Grill-Stra beta e 7, A-1031 Wien (Austria)

    2006-11-15

    Methods for size classification of wood chips were analysed in an international round robin using 13 conventional wood chip samples and two specially prepared standard samples, one from wood chips and one from hog fuel. The true size distribution of these two samples (according to length, width and height) had been determined stereometrically (reference method) using a digital calliper gauge and by weighing each of the about 7000 wood particles per sample. Five different horizontal and three rotary screening devices were tested using five different screen hole diameters (3.15, 8, 16, 45, 63mm, round holes). These systems are compared to a commercially available continuously measuring image analysis equipment. The results show that among the devices of a measuring principle-horizontal and rotary screening-the results are quite comparable, while there is a severe incompatibility when distributions are determined by different measuring principles. Highest conformity with the reference values is given for measurements with an image analysis system, whereas for all machines with horizontal screens the median value of the size distribution only reached between one-third to half of the reference median value for the particle length distribution. These deviations can be attributed to a higher particle misplacement, which is particularly found in the larger fractions. Such differences decrease when the particle's shape is more roundish (i.e. sphericity closer to one). The median values of length distributions from screenings with a rotary classifier are between the measurements from an image analysis and horizontal screening devices. (author)

  4. Method to acquire regions of fruit, branch and leaf from image of red apple in orchard

    Science.gov (United States)

    Lv, Jidong; Xu, Liming

    2017-07-01

    This work proposed a method to acquire regions of fruit, branch and leaf from red apple image in orchard. To acquire fruit image, R-G image was extracted from the RGB image for corrosive working, hole filling, subregion removal, expansive working and opening operation in order. Finally, fruit image was acquired by threshold segmentation. To acquire leaf image, fruit image was subtracted from RGB image before extracting 2G-R-B image. Then, leaf image was acquired by subregion removal and threshold segmentation. To acquire branch image, dynamic threshold segmentation was conducted in the R-G image. Then, the segmented image was added to fruit image to acquire adding fruit image which was subtracted from RGB image with leaf image. Finally, branch image was acquired by opening operation, subregion removal and threshold segmentation after extracting the R-G image from the subtracting image. Compared with previous methods, more complete image of fruit, leaf and branch can be acquired from red apple image with this method.

  5. Topological data analysis as a morphometric method: using persistent homology to demarcate a leaf morphospace

    Science.gov (United States)

    Current morphometric methods that comprehensively measure shape cannot compare the disparate leaf shapes found in flowering plants and are sensitive to processing artifacts. Here we describe a persistent homology approach to measuring shape. Persistent homology is a topological method (concerned wit...

  6. Synthesis of different-sized silver nanoparticles by simply varying reaction conditions with leaf extracts of Bauhinia variegata L.

    Science.gov (United States)

    Kumar, V; Yadav, S K

    2012-03-01

    Green synthesis of nanoparticles is one of the crucial requirements in today's climate change scenario all over the world. In view of this, leaf extract (LE) of Bauhinia variegata L. possessing strong antidiabetic and antibacterial properties has been used to synthesise silver nanoparticles (SNP) in a controlled manner. Various-sized SNP (20-120 nm) were synthesised by varying incubation temperature, silver nitrate and LE concentrations. The rate of SNP synthesis and their size increased with increase in AgNO(3) concentration up to 4 mM. With increase in LE concentration, size and aggregation of SNP was increased. The size and aggregation of SNP were also increased at temperatures above and below 40°C. This has suggested that size and dispersion of SNP can be controlled by varying reaction components and conditions. Polarity-based fractionation of B. variegata LE has suggested that only water-soluble fraction is responsible for SNP synthesis. Fourier transform infrared spectroscopy analysis revealed the attachment of polyphenolic and carbohydrate moieties to SNP. The synthesised SNPs were found stable in double distilled water, BSA and phosphate buffer (pH 7.4). On the contrary, incubation of SNP with NaCl induced aggregation. This suggests the safe use of SNP for various in vivo applications.

  7. Feasibility of Machine Learning Methods for Separating Wood and Leaf Points from Terrestrial Laser Scanning Data

    Science.gov (United States)

    Wang, D.; Hollaus, M.; Pfeifer, N.

    2017-09-01

    Classification of wood and leaf components of trees is an essential prerequisite for deriving vital tree attributes, such as wood mass, leaf area index (LAI) and woody-to-total area. Laser scanning emerges to be a promising solution for such a request. Intensity based approaches are widely proposed, as different components of a tree can feature discriminatory optical properties at the operating wavelengths of a sensor system. For geometry based methods, machine learning algorithms are often used to separate wood and leaf points, by providing proper training samples. However, it remains unclear how the chosen machine learning classifier and features used would influence classification results. To this purpose, we compare four popular machine learning classifiers, namely Support Vector Machine (SVM), Na¨ıve Bayes (NB), Random Forest (RF), and Gaussian Mixture Model (GMM), for separating wood and leaf points from terrestrial laser scanning (TLS) data. Two trees, an Erytrophleum fordii and a Betula pendula (silver birch) are used to test the impacts from classifier, feature set, and training samples. Our results showed that RF is the best model in terms of accuracy, and local density related features are important. Experimental results confirmed the feasibility of machine learning algorithms for the reliable classification of wood and leaf points. It is also noted that our studies are based on isolated trees. Further tests should be performed on more tree species and data from more complex environments.

  8. FEASIBILITY OF MACHINE LEARNING METHODS FOR SEPARATING WOOD AND LEAF POINTS FROM TERRESTRIAL LASER SCANNING DATA

    Directory of Open Access Journals (Sweden)

    D. Wang

    2017-09-01

    Full Text Available Classification of wood and leaf components of trees is an essential prerequisite for deriving vital tree attributes, such as wood mass, leaf area index (LAI and woody-to-total area. Laser scanning emerges to be a promising solution for such a request. Intensity based approaches are widely proposed, as different components of a tree can feature discriminatory optical properties at the operating wavelengths of a sensor system. For geometry based methods, machine learning algorithms are often used to separate wood and leaf points, by providing proper training samples. However, it remains unclear how the chosen machine learning classifier and features used would influence classification results. To this purpose, we compare four popular machine learning classifiers, namely Support Vector Machine (SVM, Na¨ıve Bayes (NB, Random Forest (RF, and Gaussian Mixture Model (GMM, for separating wood and leaf points from terrestrial laser scanning (TLS data. Two trees, an Erytrophleum fordii and a Betula pendula (silver birch are used to test the impacts from classifier, feature set, and training samples. Our results showed that RF is the best model in terms of accuracy, and local density related features are important. Experimental results confirmed the feasibility of machine learning algorithms for the reliable classification of wood and leaf points. It is also noted that our studies are based on isolated trees. Further tests should be performed on more tree species and data from more complex environments.

  9. Inoculation method, temperature and relative humidity affects leaf and neck anthracnose, a new onion disease.

    Science.gov (United States)

    Leaf and neck anthracnose caused by Colletotrichum coccodes is a new disease of onion in Michigan. To test the effect of inoculation method, ‘Prince’ onion seedlings were grown in the greenhouse and inoculated with either a conidial suspension of C. coccodes (alone or with an abrasive agent) or infe...

  10. Size-density metrics, leaf area, and productivity in eastern white pine

    Science.gov (United States)

    J. C. Innes; M. J. Ducey; J. H. Gove; W. B. Leak; J. P. Barrett

    2005-01-01

    Size-density metrics are used extensively for silvicultural planning; however, they operate on biological assumptions that remain relatively untested. Using data from 12 even-aged stands of eastern white pine (Pinus strobus L.) growing in southern New Hampshire, we compared size-density metrics with stand productivity and its biological components,...

  11. A New Method to Quantify the Isotopic Signature of Leaf Transpiration: Implications for Landscape-Scale Evapotranspiration Partitioning Studies

    Science.gov (United States)

    Wang, L.; Good, S. P.; Caylor, K. K.

    2010-12-01

    Characterizing the constituent components of evapotranspiration is crucial to better understand ecosystem-level water budgets and water use dynamics. Isotope based evapotranspiration partitioning methods are promising but their utility lies in the accurate estimation of the isotopic composition of underlying transpiration and evaporation. Here we report a new method to quantify the isotopic signature of leaf transpiration under field conditions. This method utilizes a commercially available laser-based isotope analyzer and a transparent leaf chamber, modified from Licor conifer leaf chamber. The method is based on the water mass balance in ambient air and leaf transpired air. We verified the method using “artificial leaves” and glassline extracted samples. The method provides a new and direct way to estimate leaf transpiration isotopic signatures and it has wide applications in ecology, hydrology and plant physiology.

  12. Comparison of Single and Multi-Scale Method for Leaf and Wood Points Classification from Terrestrial Laser Scanning Data

    Science.gov (United States)

    Wei, Hongqiang; Zhou, Guiyun; Zhou, Junjie

    2018-04-01

    The classification of leaf and wood points is an essential preprocessing step for extracting inventory measurements and canopy characterization of trees from the terrestrial laser scanning (TLS) data. The geometry-based approach is one of the widely used classification method. In the geometry-based method, it is common practice to extract salient features at one single scale before the features are used for classification. It remains unclear how different scale(s) used affect the classification accuracy and efficiency. To assess the scale effect on the classification accuracy and efficiency, we extracted the single-scale and multi-scale salient features from the point clouds of two oak trees of different sizes and conducted the classification on leaf and wood. Our experimental results show that the balanced accuracy of the multi-scale method is higher than the average balanced accuracy of the single-scale method by about 10 % for both trees. The average speed-up ratio of single scale classifiers over multi-scale classifier for each tree is higher than 30.

  13. Restoration thinning and influence of tree size and leaf area to sapwood area ratio on water relations of Pinus ponderosa.

    Science.gov (United States)

    Simonin, K; Kolb, T E; Montes-Helu, M; Koch, G W

    2006-04-01

    Ponderosa pine (Pinus ponderosa Dougl. ex P. Laws) forest stand density has increased significantly over the last century (Covington et al. 1997). To understand the effect of increased intraspecific competition, tree size (height and diameter at breast height (DBH)) and leaf area to sapwood area ratio (A(L):A(S)) on water relations, we compared hydraulic conductance from soil to leaf (kl) and transpiration per unit leaf area (Q(L)) of ponderosa pine trees in an unthinned plot to trees in a thinned plot in the first and second years after thinning in a dense Arizona forest. We calculated kl and Q(L) based on whole- tree sap flux measured with heat dissipation sensors. Thinning increased tree predawn water potential within two weeks of treatment. Effects of thinning on kl and Q(L) depended on DBH, A(L):A(S) and drought severity. During severe drought in the first growing season after thinning, kl and Q(L) of trees with low A(L):A(S) (160-250 mm DBH; 9-11 m height) were lower in the thinned plot than the unthinned plot, suggesting a reduction in stomatal conductance (g(s)) or reduced sapwood specific conductivity (K(S)), or both, in response to thinning. In contrast kl and Q(L) were similar in the thinned plot and unthinned plot for trees with high A(L):A(S) (260-360 mm DBH; 13-16 m height). During non-drought periods, kl and Q(L) were greater in the thinned plot than in the unthinned plot for all but the largest trees. Contrary to previous studies of ponderosa pine, A(L):A(S) was positively correlated with tree height and DBH. Furthermore, kl and Q(L) showed a weak negative correlation with tree height and a strong negative correlation with A(S) and thus A(L):A(S) in both the thinned and unthinned plots, suggesting that trees with high A(L):A(S) had lower g(s). Our results highlight the important influence of stand competitive environment on tree-size-related variation in A(L):A(S) and the roles of A(L):A(S) and drought on whole-tree water relations in response to

  14. Topological Data Analysis as a Morphometric Method: Using Persistent Homology to Demarcate a Leaf Morphospace

    Directory of Open Access Journals (Sweden)

    Mao Li

    2018-04-01

    Full Text Available Current morphometric methods that comprehensively measure shape cannot compare the disparate leaf shapes found in seed plants and are sensitive to processing artifacts. We explore the use of persistent homology, a topological method applied as a filtration across simplicial complexes (or more simply, a method to measure topological features of spaces across different spatial resolutions, to overcome these limitations. The described method isolates subsets of shape features and measures the spatial relationship of neighboring pixel densities in a shape. We apply the method to the analysis of 182,707 leaves, both published and unpublished, representing 141 plant families collected from 75 sites throughout the world. By measuring leaves from throughout the seed plants using persistent homology, a defined morphospace comparing all leaves is demarcated. Clear differences in shape between major phylogenetic groups are detected and estimates of leaf shape diversity within plant families are made. The approach predicts plant family above chance. The application of a persistent homology method, using topological features, to measure leaf shape allows for a unified morphometric framework to measure plant form, including shapes, textures, patterns, and branching architectures.

  15. Improvement of sizing methods using focussed probes

    International Nuclear Information System (INIS)

    Birac, A.M.; Saglio, R.; Frappier, J.C.

    1983-05-01

    Three methods are described; these three methods, using the advantages of focussed probes allow, used simultaneously according to the nature of the detected defects, to evaluate with a good accuracy the dimensions and the orientation of the real or artificial defects [fr

  16. Efficient Method for Calculating the Composite Stiffness of Parabolic Leaf Springs with Variable Stiffness for Vehicle Rear Suspension

    Directory of Open Access Journals (Sweden)

    Wen-ku Shi

    2016-01-01

    Full Text Available The composite stiffness of parabolic leaf springs with variable stiffness is difficult to calculate using traditional integral equations. Numerical integration or FEA may be used but will require computer-aided software and long calculation times. An efficient method for calculating the composite stiffness of parabolic leaf springs with variable stiffness is developed and evaluated to reduce the complexity of calculation and shorten the calculation time. A simplified model for double-leaf springs with variable stiffness is built, and a composite stiffness calculation method for the model is derived using displacement superposition and material deformation continuity. The proposed method can be applied on triple-leaf and multileaf springs. The accuracy of the calculation method is verified by the rig test and FEA analysis. Finally, several parameters that should be considered during the design process of springs are discussed. The rig test and FEA analytical results indicate that the calculated results are acceptable. The proposed method can provide guidance for the design and production of parabolic leaf springs with variable stiffness. The composite stiffness of the leaf spring can be calculated quickly and accurately when the basic parameters of the leaf spring are known.

  17. Design of a size-efficient tunable metamaterial absorber based on leaf-shaped cell at near-infrared regions

    Science.gov (United States)

    Huang, Hailong; Xia, Hui; Xie, Wenke; Guo, Zhibo; Li, Hongjian

    2018-06-01

    A size-efficient tunable metamaterial absorber (MA) composed of metallic leaf-shaped cell, graphene layer, silicon substrate, and bottom metal film is investigated theoretically and numerically at near-infrared (NIR) regions. Simulation results reveal that the single-band high absorption of 91.9% is obtained at 1268.7 nm. Further results show that the single-band can be simply changed into dual-band high absorption by varying the geometric parameters of top metallic layer at same wavelength regions, yielding two high absorption coefficients of 96.6% and 95.3% at the wavelengths of 1158.7 nm and 1323.6 nm, respectively. And the effect of related geometric parameter on dual-band absorption intensities is also investigated to obtain the optimized one. The peak wavelength can be tuned via modifying the Fermi energy of the graphene layer through controlling the external gate voltage. The work shows that the proposed strategy can be applied to other design of the dual-band structure at infrared regions.

  18. The evaluation of winter wheat roots and leaf sheath diseases diagnostic methods

    Directory of Open Access Journals (Sweden)

    Ewa Solarska

    2012-12-01

    Full Text Available The maltose and mineral media for isolation of Gaeumannomyces graminis from roots were assessed. The differences in numbers of obtained isolates were found depending on the medium used and sampling date. Easier identification of pathogen was possible employing maltose medium. The fungi from genus Fusarium occurring on winter wheat leaf sheaths were identified by mycological analysis and PCR, while the fungus Pseudocercosporella herpotrichoides was detected by PCR and ELISA methods. PCR and ELISA methods enabled to detect pathogens also in periods before the disease symptoms on plants occurred.

  19. Performance Evaluation of Machine Learning Methods for Leaf Area Index Retrieval from Time-Series MODIS Reflectance Data

    Science.gov (United States)

    Wang, Tongtong; Xiao, Zhiqiang; Liu, Zhigang

    2017-01-01

    Leaf area index (LAI) is an important biophysical parameter and the retrieval of LAI from remote sensing data is the only feasible method for generating LAI products at regional and global scales. However, most LAI retrieval methods use satellite observations at a specific time to retrieve LAI. Because of the impacts of clouds and aerosols, the LAI products generated by these methods are spatially incomplete and temporally discontinuous, and thus they cannot meet the needs of practical applications. To generate high-quality LAI products, four machine learning algorithms, including back-propagation neutral network (BPNN), radial basis function networks (RBFNs), general regression neutral networks (GRNNs), and multi-output support vector regression (MSVR) are proposed to retrieve LAI from time-series Moderate Resolution Imaging Spectroradiometer (MODIS) reflectance data in this study and performance of these machine learning algorithms is evaluated. The results demonstrated that GRNNs, RBFNs, and MSVR exhibited low sensitivity to training sample size, whereas BPNN had high sensitivity. The four algorithms performed slightly better with red, near infrared (NIR), and short wave infrared (SWIR) bands than red and NIR bands, and the results were significantly better than those obtained using single band reflectance data (red or NIR). Regardless of band composition, GRNNs performed better than the other three methods. Among the four algorithms, BPNN required the least training time, whereas MSVR needed the most for any sample size. PMID:28045443

  20. DETERMINATION OF LEAF AREA AND PLANT COVER BY USING DIGITAL IMAGE PROCESSING

    OpenAIRE

    LŐKE, ZS.; SOÓS, G.

    2002-01-01

    The development of different crop models, and crop simulation models in particular, pointed out the importance of quantifying the exact value of the leaf area. To measure the leaf size of plants of pinnatifid form, automatic, portable leaf area meters are necessary. In most places these instruments are not available to measure the assimilatory surface size of crops with special leaf shapes. Any cheap and effective method, that could replace the application of expensive portable area meters co...

  1. Preparation of Samples for Leaf Architecture Studies, A Method for Mounting Cleared Leaves

    Directory of Open Access Journals (Sweden)

    Alejandra Vasco

    2014-09-01

    Full Text Available Premise of the study: Several recent waves of interest in leaf architecture have shown an expanding range of approaches and applications across a number of disciplines. Despite this increased interest, examination of existing archives of cleared and mounted leaves shows that current methods for mounting, in particular, yield unsatisfactory results and deterioration of samples over relatively short periods. Although techniques for clearing and staining leaves are numerous, published techniques for mounting leaves are scarce. Methods and Results: Here we present a complete protocol and recommendations for clearing, staining, and imaging leaves, and, most importantly, a method to permanently mount cleared leaves. Conclusions: The mounting protocol is faster than other methods, inexpensive, and straightforward; moreover, it yields clear and permanent samples that can easily be imaged, scanned, and stored. Specimens mounted with this method preserve well, with leaves that were mounted more than 35 years ago showing no signs of bubbling or discoloration.

  2. Preparation of samples for leaf architecture studies, a method for mounting cleared leaves1

    Science.gov (United States)

    Vasco, Alejandra; Thadeo, Marcela; Conover, Margaret; Daly, Douglas C.

    2014-01-01

    • Premise of the study: Several recent waves of interest in leaf architecture have shown an expanding range of approaches and applications across a number of disciplines. Despite this increased interest, examination of existing archives of cleared and mounted leaves shows that current methods for mounting, in particular, yield unsatisfactory results and deterioration of samples over relatively short periods. Although techniques for clearing and staining leaves are numerous, published techniques for mounting leaves are scarce. • Methods and Results: Here we present a complete protocol and recommendations for clearing, staining, and imaging leaves, and, most importantly, a method to permanently mount cleared leaves. • Conclusions: The mounting protocol is faster than other methods, inexpensive, and straightforward; moreover, it yields clear and permanent samples that can easily be imaged, scanned, and stored. Specimens mounted with this method preserve well, with leaves that were mounted more than 35 years ago showing no signs of bubbling or discoloration. PMID:25225627

  3. Preparation of samples for leaf architecture studies, a method for mounting cleared leaves.

    Science.gov (United States)

    Vasco, Alejandra; Thadeo, Marcela; Conover, Margaret; Daly, Douglas C

    2014-09-01

    Several recent waves of interest in leaf architecture have shown an expanding range of approaches and applications across a number of disciplines. Despite this increased interest, examination of existing archives of cleared and mounted leaves shows that current methods for mounting, in particular, yield unsatisfactory results and deterioration of samples over relatively short periods. Although techniques for clearing and staining leaves are numerous, published techniques for mounting leaves are scarce. • Here we present a complete protocol and recommendations for clearing, staining, and imaging leaves, and, most importantly, a method to permanently mount cleared leaves. • The mounting protocol is faster than other methods, inexpensive, and straightforward; moreover, it yields clear and permanent samples that can easily be imaged, scanned, and stored. Specimens mounted with this method preserve well, with leaves that were mounted more than 35 years ago showing no signs of bubbling or discoloration.

  4. Multimodal Dispersion of Nanoparticles: A Comprehensive Evaluation of Size Distribution with 9 Size Measurement Methods.

    Science.gov (United States)

    Varenne, Fanny; Makky, Ali; Gaucher-Delmas, Mireille; Violleau, Frédéric; Vauthier, Christine

    2016-05-01

    Evaluation of particle size distribution (PSD) of multimodal dispersion of nanoparticles is a difficult task due to inherent limitations of size measurement methods. The present work reports the evaluation of PSD of a dispersion of poly(isobutylcyanoacrylate) nanoparticles decorated with dextran known as multimodal and developed as nanomedecine. The nine methods used were classified as batch particle i.e. Static Light Scattering (SLS) and Dynamic Light Scattering (DLS), single particle i.e. Electron Microscopy (EM), Atomic Force Microscopy (AFM), Tunable Resistive Pulse Sensing (TRPS) and Nanoparticle Tracking Analysis (NTA) and separative particle i.e. Asymmetrical Flow Field-Flow Fractionation coupled with DLS (AsFlFFF) size measurement methods. The multimodal dispersion was identified using AFM, TRPS and NTA and results were consistent with those provided with the method based on a separation step prior to on-line size measurements. None of the light scattering batch methods could reveal the complexity of the PSD of the dispersion. Difference between PSD obtained from all size measurement methods tested suggested that study of the PSD of multimodal dispersion required to analyze samples by at least one of the single size particle measurement method or a method that uses a separation step prior PSD measurement.

  5. Size Controlled Synthesis of Starch Nanoparticles by a Microemulsion Method

    Directory of Open Access Journals (Sweden)

    Suk Fun Chin

    2014-01-01

    Full Text Available Controllable particles sizes of starch nanoparticles were synthesized via a precipitation in water-in-oil microemulsion approach. Microemulsion method offers the advantages of ultralow interfacial tension, large interfacial area, and being thermodynamically stable and affords monodispersed nanoparticles. The synthesis parameters such as stirring rates, ratios of oil/cosurfactant, oil phases, cosurfactants, and ratios of water/oil were found to affect the mean particle size of starch nanoparticles. Starch nanoparticles with mean particles sizes of 109 nm were synthesized by direct nanoprecipitation method, whereas by using precipitation in microemulsion approach, starch nanoparticles with smaller mean particles sizes of 83 nm were obtained.

  6. Multileaf collimator leaf position verification and analysis for adaptive radiation therapy using a video-optical method

    Science.gov (United States)

    Sethna, Sohrab B.

    External beam radiation therapy is commonly used to eliminate and control cancerous tumors. High-energy beams are shaped to match the patient's specific tumor volume, whereby maximizing radiation dose to malignant cells and limiting dose to normal tissue. A multileaf collimator (MLC) consisting of multiple pairs of tungsten leaves is used to conform the radiation beam to the desired treatment field. Advanced treatment methods utilize dynamic MLC settings to conform to multiple treatment fields and provide intensity modulated radiation therapy (IMRT). Future methods would further increase conformity by actively tracking tumor motion caused by patient cardiac and respiratory motion. Leaf position quality assurance for a dynamic MLC is critical as variation between the planned and actual leaf positions could induce significant errors in radiation dose. The goal of this research project is to prototype a video-optical quality assurance system for MLC leaf positions. The system captures light-field images of MLC leaf sequences during dynamic therapy. Image acquisition and analysis software was developed to determine leaf edge positions. The mean absolute difference between QA prototype predicted and caliper measured leaf positions was found to be 0.6 mm with an uncertainty of +/- 0.3 mm. Maximum errors in predicted positions were below 1.0 mm for static fields. The prototype served as a proof of concept for quality assurance of future tumor tracking methods. Specifically, a lung tumor phantom was created to mimic a lung tumor's motion from respiration. The lung tumor video images were superimposed on MLC field video images for visualization and analysis. The toolbox is capable of displaying leaf position, leaf velocity, tumor position, and determining errors between planned and actual treatment fields for dynamic radiation therapy.

  7. Retrieving Leaf Area Index (LAI) Using Remote Sensing: Theories, Methods and Sensors.

    Science.gov (United States)

    Zheng, Guang; Moskal, L Monika

    2009-01-01

    The ability to accurately and rapidly acquire leaf area index (LAI) is an indispensable component of process-based ecological research facilitating the understanding of gas-vegetation exchange phenomenon at an array of spatial scales from the leaf to the landscape. However, LAI is difficult to directly acquire for large spatial extents due to its time consuming and work intensive nature. Such efforts have been significantly improved by the emergence of optical and active remote sensing techniques. This paper reviews the definitions and theories of LAI measurement with respect to direct and indirect methods. Then, the methodologies for LAI retrieval with regard to the characteristics of a range of remotely sensed datasets are discussed. Remote sensing indirect methods are subdivided into two categories of passive and active remote sensing, which are further categorized as terrestrial, aerial and satellite-born platforms. Due to a wide variety in spatial resolution of remotely sensed data and the requirements of ecological modeling, the scaling issue of LAI is discussed and special consideration is given to extrapolation of measurement to landscape and regional levels.

  8. The qTSN positive effect on panicle and flag leaf size of rice is associated with an early down-regulation of tillering

    Directory of Open Access Journals (Sweden)

    Dewi Erika eAdriani

    2016-01-01

    Full Text Available The qTSN4 was identified as rice QTL (Quantitative Traits Locus increasing total spikelet number per panicle and flag leaf area but potentially reducing panicle number depending on the environment. So far, this trade-off was mainly observed at grain maturity and not specifically studied in details, limiting the apprehension of the agronomic interest of qTSN4. This study aimed to understand the effect of qTSN4 and of the environment on panicle sizing, its trade-off with panicle number and finally plant grain production. It compared two high yielding genotypes to their Near Isogenic Lines (NIL carrying either QTL qTSN4 or qTSN12, two distinct QTLs contributing to the enlarged panicle size, thereafter designated as qTSN. Traits describing C sink (organ appearance rate, size, biomass and source (leaf area, photosynthesis, sugar availability were dynamically characterized along plant and/or panicle development within two trials (greenhouse, field, each comparing two treatments contrasting for plant access to light (with or without shading, high or low planting densities. The positive effect of qTSN on panicle size and flag leaf area of the main tiller was confirmed. More precisely, it could be shown that qTSN increased leaf area and internode cross-section, and in some cases of the photosynthetic rate and starch reserves, of the top 3-4 phytomers of the main tiller. This was accompanied by an earlier tillering cessation, that coincided with the initiation of these phytomers, and an enhanced of panicle size on the main tiller. Plant leaf area at flowering was not affected by qTSN but fertile tiller number was reduced to an extent that depended on the environment. Accordingly, plant grain production was enhanced by qTSN only under shading in the greenhouse experiment, where panicle number was not affected and photosynthesis and starch storage in internodes was enhanced. The effect of qTSN on rice phenotype was thus expressed before panicle initiation

  9. A flexible method for multi-level sample size determination

    International Nuclear Information System (INIS)

    Lu, Ming-Shih; Sanborn, J.B.; Teichmann, T.

    1997-01-01

    This paper gives a flexible method to determine sample sizes for both systematic and random error models (this pertains to sampling problems in nuclear safeguard questions). In addition, the method allows different attribute rejection limits. The new method could assist achieving a higher detection probability and enhance inspection effectiveness

  10. Determining wood chip size: image analysis and clustering methods

    Directory of Open Access Journals (Sweden)

    Paolo Febbi

    2013-09-01

    Full Text Available One of the standard methods for the determination of the size distribution of wood chips is the oscillating screen method (EN 15149- 1:2010. Recent literature demonstrated how image analysis could return highly accurate measure of the dimensions defined for each individual particle, and could promote a new method depending on the geometrical shape to determine the chip size in a more accurate way. A sample of wood chips (8 litres was sieved through horizontally oscillating sieves, using five different screen hole diameters (3.15, 8, 16, 45, 63 mm; the wood chips were sorted in decreasing size classes and the mass of all fractions was used to determine the size distribution of the particles. Since the chip shape and size influence the sieving results, Wang’s theory, which concerns the geometric forms, was considered. A cluster analysis on the shape descriptors (Fourier descriptors and size descriptors (area, perimeter, Feret diameters, eccentricity was applied to observe the chips distribution. The UPGMA algorithm was applied on Euclidean distance. The obtained dendrogram shows a group separation according with the original three sieving fractions. A comparison has been made between the traditional sieve and clustering results. This preliminary result shows how the image analysis-based method has a high potential for the characterization of wood chip size distribution and could be further investigated. Moreover, this method could be implemented in an online detection machine for chips size characterization. An improvement of the results is expected by using supervised multivariate methods that utilize known class memberships. The main objective of the future activities will be to shift the analysis from a 2-dimensional method to a 3- dimensional acquisition process.

  11. Reliably detectable flaw size for NDE methods that use calibration

    Science.gov (United States)

    Koshti, Ajay M.

    2017-04-01

    Probability of detection (POD) analysis is used in assessing reliably detectable flaw size in nondestructive evaluation (NDE). MIL-HDBK-1823 and associated mh18232 POD software gives most common methods of POD analysis. In this paper, POD analysis is applied to an NDE method, such as eddy current testing, where calibration is used. NDE calibration standards have known size artificial flaws such as electro-discharge machined (EDM) notches and flat bottom hole (FBH) reflectors which are used to set instrument sensitivity for detection of real flaws. Real flaws such as cracks and crack-like flaws are desired to be detected using these NDE methods. A reliably detectable crack size is required for safe life analysis of fracture critical parts. Therefore, it is important to correlate signal responses from real flaws with signal responses form artificial flaws used in calibration process to determine reliably detectable flaw size.

  12. Estimating Apparent Nutrient Digestibility of Diets Containing or Leaf Meals for Growing Rabbits by Two Methods

    Directory of Open Access Journals (Sweden)

    A. M. Safwat

    2015-08-01

    Full Text Available This study aimed to evaluate the nutrient digestibility of growing rabbits fed diets with different levels of either Leucaena leucocephala (LLM or Moringa oleifera (MOLM leaf meals and also to compare total collection and TiO2 marker methods for estimating digestibility. A total of 30 California growing rabbits (1.81±0.19 kg live weight on average were randomly distributed into five experimental groups of six rabbits each and were housed in individual cages. The groups were control, 30% LLM, 40% LLM, 30% MOLM, and 40% MOLM. All groups received pelleted diets for two weeks; diets also contained 4 g/kg titanium dioxide as dietary marker. Daily feed intake was recorded during the whole experimental period and total feces were collected daily and weighed individually during four days. The results showed that there were no difference (p>0.05 in feed, dry matter (DM, organic matter (OM, crude protein (CP, digestible energy, and crude fiber (CF intake between the control group and the other experimental groups. The apparent digestibility values of DM, OM, CP, CF, acid detergent fiber, and gross energy were the highest for control group (p = 0.001, meanwhile MOLM diets had generally higher nutrient digestibility coefficients than LLM diets. Increasing the inclusion level of leaf meal in the diet from 30% to 40% improved the digestibility of CF from 45.02% to 51.69% for LLM and from 48.11% to 55.89% for MOLM. Similar results for apparent nutrient digestibility coefficients were obtained when either total collection or indigestible marker method was used. In conclusion, the digestibility of MOLM containing diets were better than LLM diets, furthermore TiO2 as an external marker could be used as a simple, practical and reliable method to estimate nutrients digestibility in rabbit diets.

  13. Two-level method with coarse space size independent convergence

    Energy Technology Data Exchange (ETDEWEB)

    Vanek, P.; Brezina, M. [Univ. of Colorado, Denver, CO (United States); Tezaur, R.; Krizkova, J. [UWB, Plzen (Czech Republic)

    1996-12-31

    The basic disadvantage of the standard two-level method is the strong dependence of its convergence rate on the size of the coarse-level problem. In order to obtain the optimal convergence result, one is limited to using a coarse space which is only a few times smaller than the size of the fine-level one. Consequently, the asymptotic cost of the resulting method is the same as in the case of using a coarse-level solver for the original problem. Today`s two-level domain decomposition methods typically offer an improvement by yielding a rate of convergence which depends on the ratio of fine and coarse level only polylogarithmically. However, these methods require the use of local subdomain solvers for which straightforward application of iterative methods is problematic, while the usual application of direct solvers is expensive. We suggest a method diminishing significantly these difficulties.

  14. Measurements methods and variability assesment of the Norway spruce total leaf area. Implications for remote sensing

    Czech Academy of Sciences Publication Activity Database

    Homolová, L.; Lukeš, Petr; Malenovský, Z.; Lhotáková, Z.; Kaplan, Věroslav; Hanuš, Jan

    2013-01-01

    Roč. 27, č. 1 (2013), s. 111-121 ISSN 0931-1890 R&D Projects: GA ČR GA205/09/ 1989 Institutional support: RVO:67179843 Keywords : chlorophyll content * conversion factor * Picea abies * projected leaf area * remote sensing * total leaf area Subject RIV: EH - Ecology, Behaviour Impact factor: 1.869, year: 2013

  15. Survival analysis and classification methods for forest fire size.

    Science.gov (United States)

    Tremblay, Pier-Olivier; Duchesne, Thierry; Cumming, Steven G

    2018-01-01

    Factors affecting wildland-fire size distribution include weather, fuels, and fire suppression activities. We present a novel application of survival analysis to quantify the effects of these factors on a sample of sizes of lightning-caused fires from Alberta, Canada. Two events were observed for each fire: the size at initial assessment (by the first fire fighters to arrive at the scene) and the size at "being held" (a state when no further increase in size is expected). We developed a statistical classifier to try to predict cases where there will be a growth in fire size (i.e., the size at "being held" exceeds the size at initial assessment). Logistic regression was preferred over two alternative classifiers, with covariates consistent with similar past analyses. We conducted survival analysis on the group of fires exhibiting a size increase. A screening process selected three covariates: an index of fire weather at the day the fire started, the fuel type burning at initial assessment, and a factor for the type and capabilities of the method of initial attack. The Cox proportional hazards model performed better than three accelerated failure time alternatives. Both fire weather and fuel type were highly significant, with effects consistent with known fire behaviour. The effects of initial attack method were not statistically significant, but did suggest a reverse causality that could arise if fire management agencies were to dispatch resources based on a-priori assessment of fire growth potentials. We discuss how a more sophisticated analysis of larger data sets could produce unbiased estimates of fire suppression effect under such circumstances.

  16. Survival analysis and classification methods for forest fire size

    Science.gov (United States)

    2018-01-01

    Factors affecting wildland-fire size distribution include weather, fuels, and fire suppression activities. We present a novel application of survival analysis to quantify the effects of these factors on a sample of sizes of lightning-caused fires from Alberta, Canada. Two events were observed for each fire: the size at initial assessment (by the first fire fighters to arrive at the scene) and the size at “being held” (a state when no further increase in size is expected). We developed a statistical classifier to try to predict cases where there will be a growth in fire size (i.e., the size at “being held” exceeds the size at initial assessment). Logistic regression was preferred over two alternative classifiers, with covariates consistent with similar past analyses. We conducted survival analysis on the group of fires exhibiting a size increase. A screening process selected three covariates: an index of fire weather at the day the fire started, the fuel type burning at initial assessment, and a factor for the type and capabilities of the method of initial attack. The Cox proportional hazards model performed better than three accelerated failure time alternatives. Both fire weather and fuel type were highly significant, with effects consistent with known fire behaviour. The effects of initial attack method were not statistically significant, but did suggest a reverse causality that could arise if fire management agencies were to dispatch resources based on a-priori assessment of fire growth potentials. We discuss how a more sophisticated analysis of larger data sets could produce unbiased estimates of fire suppression effect under such circumstances. PMID:29320497

  17. Rock sampling. [method for controlling particle size distribution

    Science.gov (United States)

    Blum, P. (Inventor)

    1971-01-01

    A method for sampling rock and other brittle materials and for controlling resultant particle sizes is described. The method involves cutting grooves in the rock surface to provide a grouping of parallel ridges and subsequently machining the ridges to provide a powder specimen. The machining step may comprise milling, drilling, lathe cutting or the like; but a planing step is advantageous. Control of the particle size distribution is effected primarily by changing the height and width of these ridges. This control exceeds that obtainable by conventional grinding.

  18. A pretreatment method for grain size analysis of red mudstones

    Science.gov (United States)

    Jiang, Zaixing; Liu, Li'an

    2011-11-01

    Traditional sediment disaggregation methods work well for loose mud sediments, but not for tightly cemented mudstones by ferric oxide minerals. In this paper, a new pretreatment method for analyzing the grain size of red mudstones is presented. The experimental samples are Eocene red mudstones from the Dongying Depression, Bohai Bay Basin. The red mudstones are composed mainly of clay minerals, clastic sediments and ferric oxides that make the mudstones red and tightly compacted. The procedure of the method is as follows. Firstly, samples of the red mudstones were crushed into fragments with a diameter of 0.6-0.8 mm in size; secondly, the CBD (citrate-bicarbonate-dithionite) treatment was used to remove ferric oxides so that the cementation of intra-aggregates and inter-aggregates became weakened, and then 5% dilute hydrochloric acid was added to further remove the cements; thirdly, the fragments were further ground with a rubber pestle; lastly, an ultrasonicator was used to disaggregate the samples. After the treatment, the samples could then be used for grain size analysis or for other geological analyses of sedimentary grains. Compared with other pretreatment methods for size analysis of mudstones, this proposed method is more effective and has higher repeatability.

  19. Expanding Clinical Laboratory Tobacco Product Evaluation Methods to Loose-leaf Tobacco Vaporizers

    Science.gov (United States)

    Lopez, Alexa A.; Hiler, Marzena; Maloney, Sarah; Eissenberg, Thomas; Breland, Alison

    2016-01-01

    Background Novel tobacco products entering the US market include electronic cigarettes (ECIGs) and products advertised to “heat, not burn” tobacco. There is a growing literature regarding the acute effects of ECIGs. Less is known about “heat, not burn” products. This study’s purpose was to expand existing clinical laboratory methods to examine, in cigarette smokers, the acute effects of a “heat, not burn” “loose-leaf tobacco vaporizer” (LLTV). Methods Plasma nicotine and breath carbon monoxide (CO) concentration and tobacco abstinence symptom severity were measured before and after two 10-puff (30-sec interpuff interval) product use bouts separated by 60 minutes. LLTV effects were compared to participants’ own brand (OB) cigarettes and an ECIG (3.3 V; 1.5 Ohm; 18 mg/ml nicotine). Results Relative to OB, LLTV increased plasma nicotine concentration to a lesser degree, did not increase CO, and appeared to not reduce abstinence symptoms as effectively. Relative to ECIG, LLTV nicotine and CO delivery and abstinence symptom suppression did not differ. Participants reported that both the LLTV and ECIG were significantly less satisfying than OB. Conclusions Results demonstrate that LLTVs are capable of delivering nicotine and suppressing tobacco abstinence symptoms partially; acute effects of these products can be evaluated using existing clinical laboratory methods. Results can inform tobacco product regulation and may be predictive of the extent that these products have the potential to benefit or harm overall public health. PMID:27768968

  20. Standard test methods for characterizing duplex grain sizes

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2002-01-01

    1.1 These test methods provide simple guidelines for deciding whether a duplex grain size exists. The test methods separate duplex grain sizes into one of two distinct classes, then into specific types within those classes, and provide systems for grain size characterization of each type. 1.2 Units—The values stated in SI units are to be regarded as standard. No other units of measurement are included in this standard. 1.3 This standard may involve hazardous materials, operations, and equipment. This standard does not purport to address all of the safety concerns associated with its use. It is the responsibility of the user of this standard to consult appropriate safety and health practices and determine the applicability of regulatory limitations prior to its use.

  1. Interlaboratory Validation of the Leaching Environmental Assessment Framework (LEAF) Method 1314 and Method 1315

    Science.gov (United States)

    This report summarizes the results of an interlaboratory study conducted to generate precision estimates for two leaching methods under review by the U.S. EPA’s OSWER for inclusion into the EPA’s SW-846: Method 1314: Liquid-Solid Partitioning as a Function of Liquid...

  2. Comparison of RNA Extraction Methods for the Identification of Grapevine fan leaf virus

    Directory of Open Access Journals (Sweden)

    Z. Gholampour

    2016-06-01

    Full Text Available Introduction: To now, more than 70 viral diseases have been reported from grapevine. Serological methods are regular diagnostic tools of grapevine viruses, however, their sensitivity has affected by seasonal fluctuations of the virus. Reverse transcription polymerase chain reaction provides significant improvement in detection of grapevine viruses. Extraction of high-quality RNA is essential for the successful application of many molecular techniques, such as RT-PCR. Extraction of high-quality RNA from the leaves of woody plants, such as grapevine, is particularly challenging because of high concentrations of polysaccharides, polyphenols, and other secondary metabolites. Some RNA extraction methods yield pellets that are poorly soluble, indicating the presence of unknown contaminants, whereas others are gelatinous, indicating the presence of polysaccharides. RNA can make complexes with polysaccharides and phenolic compounds render the RNA unusable for applications such as reverse transcription. Grapevine fanleaf virus is a member of the genus Nepovirus in the family Secoviridae. The GFLV genome consists of two positive-sense single stranded RNAs. The genome has a poly (A tail at the 3´ terminus and a covalently linked VPG protein at the 5´ terminus. Several extraction methods had been reported to be used for identification of GFLV in grapevine. Some of them require harmful chemical material; disadvantages of other are high costs. Immunocapture-RT-PCR requires preparation of specific antibody and direct binding RT-PCR (DB-RT-PCR has a high contamination risk. In this study, four RNA extraction protocols were compared with a commercial isolation kit to explore the most efficient RNA isolation method for grapevines. Material and Methods: 40 leaf samples were randomly collected during the growing season of 2011-2012. GFLV was detected in leaf samples by enzyme linked immunosorbent assay (ELISA Using specific antibodies raised against Iranian

  3. Leaf habit and woodiness regulate different leaf economy traits at a given nutrient supply.

    Science.gov (United States)

    Ordoñez, Jenny C; van Bodegom, Peter M; Witte, Jan-Philip M; Bartholomeus, Ruud P; van Dobben, Han F; Aerts, Rien

    2010-11-01

    The large variation in the relationships between environmental factors and plant traits observed in natural communities exemplifies the alternative solutions that plants have developed in response to the same environmental limitations. Qualitative attributes, such as growth form, woodiness, and leaf habit can be used to approximate these alternative solutions. Here, we quantified the extent to which these attributes affect leaf trait values at a given resource supply level, using measured plant traits from 105 different species (254 observations) distributed across 50 sites in mesic to wet plant communities in The Netherlands. For each site, soil total N, soil total P, and water supply estimates were obtained by field measurements and modeling. Effects of growth forms, woodiness, and leaf habit on relations between leaf traits (SLA, specific leaf area; LNC, leaf nitrogen concentration; and LPC, leaf phosphorus concentration) vs. nutrient and water supply were quantified using maximum-likelihood methods and Bonferroni post hoc tests. The qualitative attributes explained 8-23% of the variance within sites in leaf traits vs. soil fertility relationships, and therefore they can potentially be used to make better predictions of global patterns of leaf traits in relation to nutrient supply. However, at a given soil fertility, the strength of the effect of each qualitative attribute was not the same for all leaf traits. These differences may imply a differential regulation of the leaf economy traits at a given nutrient supply, in which SLA and LPC seem to be regulated in accordance to changes in plant size and architecture while LNC seems to be primarily regulated at the leaf level by factors related to leaf longevity.

  4. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  5. The measurement of the transmission loss of single leaf walls and panels by an impulse method

    Science.gov (United States)

    Balilah, Y. A.; Gibbs, B. M.

    1988-06-01

    The standard methods of measurement and rating of sound insulation of panels and walls are generally time-consuming and require expensive and often bulky equipment. In addition, the methods establish only that there has been failure to comply with insulation requirements without indicating the mode of failure. An impulse technique is proposed for the measurement of walls and partitions in situ. The method requires the digital capture of a short duration signal generated by a loudspeaker, and the isolation of the direct component from other reflected and scattered components by time-of-flight methods and windowing. The signal, when transferred from the time to frequency domain by means of fast Fourier transforms, can yield the sound insulation of a partition expressed as a transfer function. Experimental problems in the use of this technique, including those resulting from sphericity of the incident wave front and concentric bending excitation of the partition, are identified and methods proposed for their elimination. Most of the results presented are of single leaf panels subjected to sound at normal incidence, although some measurements were undertaken at oblique incidence. The range of surface densities considered was 7-500 kg/m 2, the highest value corresponding to a brick and plaster wall of thickness 285 mm. Measurement is compared with theoretical prediction, at one-third octave intervals in a frequency range of 100-5000 Hz, or as a continuous function of frequency with a typical resolution of 12·5 Hz. The dynamic range of the measurement equipment sets an upper limit to the measurable transmission loss. For the equipment eventually employed this was represented by a random incidence value of 50 dB.

  6. Methods of assessing grain-size distribution during grain growth

    DEFF Research Database (Denmark)

    Tweed, Cherry J.; Hansen, Niels; Ralph, Brian

    1985-01-01

    This paper considers methods of obtaining grain-size distributions and ways of describing them. In order to collect statistically useful amounts of data, an automatic image analyzer is used, and the resulting data are subjected to a series of tests that evaluate the differences between two related...... distributions (before and after grain growth). The distributions are measured from two-dimensional sections, and both the data and the corresponding true three-dimensional grain-size distributions (obtained by stereological analysis) are collected. The techniques described here are illustrated by reference...

  7. Webometrics: Some Critical Issues of WWW Size Estimation Methods

    Directory of Open Access Journals (Sweden)

    Srinivasan Mohana Arunachalam

    2018-04-01

    Full Text Available The number of webpages in the Internet has increased tremendously over the last two decades however only a part of it is indexed by various search engines. This small portion is the indexable web of the Internet and can be usually reachable from a Search Engine. Search engines play a big role in making the World Wide Web accessible to the end user, and how much of the World Wide Web is accessible on the size of the search engine’s index. Researchers have proposed several ways to estimate this size of the indexable web using search engines with and without privileged access to the search engine’s database. Our report provides a summary of methods used in the last two decades to estimate the size of the World Wide Web, as well as describe how this knowledge can be used in other aspects/tasks concerning the World Wide Web.

  8. Leaf Area Prediction Using Three Alternative Sampling Methods for Seven Sierra Nevada Conifer Species

    Directory of Open Access Journals (Sweden)

    Dryw A. Jones

    2015-07-01

    Full Text Available Prediction of projected tree leaf area using allometric relationships with sapwood cross-sectional area is common in tree- and stand-level production studies. Measuring sapwood is difficult and often requires destructive sampling. This study tested multiple leaf area prediction models across seven diverse conifer species in the Sierra Nevada of California. The best-fit whole tree leaf area prediction model for overall simplicity, accuracy, and utility for all seven species was a nonlinear model with basal area as the primary covariate. A new non-destructive procedure was introduced to extend the branch summation approach to leaf area data collection on trees that cannot be destructively sampled. There were no significant differences between fixed effects assigned to sampling procedures, indicating that data from the tested sampling procedures can be combined for whole tree leaf area modeling purposes. These results indicate that, for the species sampled, accurate leaf area estimates can be obtained through partially-destructive sampling and using common forest inventory data.

  9. An effective method for smoothing the staggered dose distribution of multi-leaf collimator field edge

    International Nuclear Information System (INIS)

    Hwang, I.-M.; Lin, S.-Y.; Lee, M.-S.; Wang, C.-J.; Chuang, K.-S.; Ding, H.-J.

    2002-01-01

    Purpose: To smooth the staggered dose distribution that occurs in stepped leaves defined by a multi-leaf collimator (MLC). Materials and methods: The MLC Shaper program controlled the stepped leaves, which were shifted in a traveling range, the pattern of shift was from the position of out-bound to in-bound with a one-segment (cross-bound), three-segment, and five-segment shifts. Film was placed at a depth of 1.5 cm and irradiated with the same irradiation dose used for the cerrobend block experiment. Four field edges with the MLC defining at 15 deg., 30 deg., 45 deg., 60 deg. angels relative to the jaw edge were performed, respectively, in this study. For the field edge defined by the multi-segment technique, the amplitude of the isodose lines for 50% isodose line and both the 80% and 20% isodose lines were measured. The effective penumbra widths with 90-10% and 80-20% distances for different irradiations were determined at four field edges with the MLC defining at 15 deg., 30 deg., 45 deg., 60 deg. angels relative to the jaw edge. Results: Use of the five-segment technique for multi-leaf collimation at the 60 deg. angle field edge smoothes each isodose line into an effectively straight line, similar to the pattern achieved using a cerrobend block. The separation of these lines is also important. The 80-20% effective penumbra width with five-segment techniques (8.23 mm) at 60 deg. angle relative to the jaw edge is little wider (1.9 times) than the penumbra of cerrobend block field edge (4.23 mm). We also found that the 90-10% effective penumbra width with five-segment techniques (12.68 mm) at 60 deg. angle relative to the jaw edge is little wider (1.28 times) than the penumbra of cerrobend block field edge (9.89 mm). Conclusion: The multi-segment technique is effective in smoothing the MLC staggered field edge. The effective penumbra width with more segment techniques at larger degree angles relative to the field edge is little wider than the penumbra for a

  10. Comparison of dwarf bamboos (Indocalamus sp.) leaf parameters to determine relationship between spatial density of plants and total leaf area per plant.

    Science.gov (United States)

    Shi, Pei-Jian; Xu, Qiang; Sandhu, Hardev S; Gielis, Johan; Ding, Yu-Long; Li, Hua-Rong; Dong, Xiao-Bo

    2015-10-01

    The relationship between spatial density and size of plants is an important topic in plant ecology. The self-thinning rule suggests a -3/2 power between average biomass and density or a -1/2 power between stand yield and density. However, the self-thinning rule based on total leaf area per plant and density of plants has been neglected presumably because of the lack of a method that can accurately estimate the total leaf area per plant. We aimed to find the relationship between spatial density of plants and total leaf area per plant. We also attempted to provide a novel model for accurately describing the leaf shape of bamboos. We proposed a simplified Gielis equation with only two parameters to describe the leaf shape of bamboos one model parameter represented the overall ratio of leaf width to leaf length. Using this method, we compared some leaf parameters (leaf shape, number of leaves per plant, ratio of total leaf weight to aboveground weight per plant, and total leaf area per plant) of four bamboo species of genus Indocalamus Nakai (I. pedalis (Keng) P.C. Keng, I. pumilus Q.H. Dai and C.F. Keng, I. barbatus McClure, and I. victorialis P.C. Keng). We also explored the possible correlation between spatial density and total leaf area per plant using log-linear regression. We found that the simplified Gielis equation fit the leaf shape of four bamboo species very well. Although all these four species belonged to the same genus, there were still significant differences in leaf shape. Significant differences also existed in leaf area per plant, ratio of leaf weight to aboveground weight per plant, and leaf length. In addition, we found that the total leaf area per plant decreased with increased spatial density. Therefore, we directly demonstrated the self-thinning rule to improve light interception.

  11. Method and apparatus for physical separation of different sized nanostructures

    Science.gov (United States)

    Roberts, Christopher B.; Saunders, Steven R.

    2012-07-10

    The present application provides apparatuses and methods for the size-selective fractionation of ligand-capped nanoparticles that utilizes the tunable thermophysical properties of gas-expanded liquids. The nanoparticle size separation processes are based on the controlled reduction of the solvent strength of an organic phase nanoparticle dispersion through increases in concentration of the antisolvent gas, such as CO.sub.2, via pressurization. The method of nanomaterial separation contains preparing a vessel having a solvent and dispersed nanoparticles, pressurizing the chamber with a gaseous antisolvent, and causing a first amount of the nanoparticles to precipitate, transporting the solution to a second vessel, pressurizing the second vessel with the gaseous antisolvent and causing further nanoparticles to separate from the solution.

  12. Measurement of leaf hydraulic conductance and stomatal conductance and their responses to irradiance and dehydration using the Evaporative Flux Method (EFM).

    Science.gov (United States)

    Sack, Lawren; Scoffoni, Christine

    2012-12-31

    -10). Because K(leaf) can constrain gs and photosynthetic rate across species in well watered conditions and during drought, and thus limit whole-plant performance they may possibly determine species distributions especially as droughts increase in frequency and severity(11-14). We present a simple method for simultaneous determination of K(leaf) and gs on excised leaves. A transpiring leaf is connected by its petiole to tubing running to a water source on a balance. The loss of water from the balance is recorded to calculate the flow rate through the leaf. When steady state transpiration (E, mmol • m(-2) • s(-1)) is reached, gs is determined by dividing by vapor pressure deficit, and K(leaf) by dividing by the water potential driving force determined using a pressure chamber (K(leaf)= E /- Δψ(leaf), MPa)(15). This method can be used to assess K(leaf) responses to different irradiances and the vulnerability of K(leaf) to dehydration(14,16,17).

  13. Laser triangulation method for measuring the size of parking claw

    Science.gov (United States)

    Liu, Bo; Zhang, Ming; Pang, Ying

    2017-10-01

    With the development of science and technology and the maturity of measurement technology, the 3D profile measurement technology has been developed rapidly. Three dimensional measurement technology is widely used in mold manufacturing, industrial inspection, automatic processing and manufacturing, etc. There are many kinds of situations in scientific research and industrial production. It is necessary to transform the original mechanical parts into the 3D data model on the computer quickly and accurately. At present, many methods have been developed to measure the contour size, laser triangulation is one of the most widely used methods.

  14. Ultrasonic defect sizing using decibel drop methods. III

    International Nuclear Information System (INIS)

    Mills, C.; Goszczynski, J.; Mitchell, A.B.

    1988-03-01

    An earlier study on the use of ultrasonic decibel drop sizing methods for determining the length and vertical extent of flaws in welded steel sections was based on the scanning of machined flaws and fabrication flaws. The present study utilized the techniques developed to perform a similar study of the type of flaws expected to develop during service (e.g. fatigue cracks). The general findings are that: a) the use of decibel drops of less than 14 dB generally undersize the length of fatigue cracks; and b) the use of decibel drop methods to determine vertical extent is questionable

  15. Ultrasonic defect-sizing using decibel drop methods. I

    International Nuclear Information System (INIS)

    Murphy, R.V.

    1987-03-01

    Results are reported of a study performed to investigate the accuracy and repeatability of various ultrasonic decibel (dB) drop sizing methods in determining the length, vertical extent and orientation of artificial and real weld flaws in thin steel sections. Seven artificial flaws and nine real weld flaws were examined; over 200 data plots were produced. The general findings are: a) length and vertical extent are assessed most accurately when using a 14 dB drop from the maximum indication amplitude; b) decibel drops less that 14 dB generally undersize flaws while decibel drops greater than 14 dB generally oversize flaws; c) flaws which are smaller than the width of the sound beam cannot be assessed accurately using dB drop methods; d) large flaws are assessed most accurately when the sound beam strikes the flaws at near normal incidence; e) the vertical extent and orientation of large flaws are plotted most accurately using the beam centre line method as opposed to the beam profile method; and, f) the limitations of dB-drop-sizing methods have considerable ramifications for CAN3-N285.4-M83 and ASME XI evaluation criteria

  16. Method of manufacturing leaf spring for PWR type reactor fuel assembly

    International Nuclear Information System (INIS)

    Yokoyama, Takashi; Mori, Kazuma.

    1991-01-01

    A leaf spring is manufactured by precision casting using corrosion resistant and heat resistant high strength steel material and, subsequently, the surface is treated with slight surface grinding or pickling. Further, for increasing resistance to stress corrosion cracks (SCC), shot blasting is applied to the surface. This reduces the surface roughness (Rmax) of the leaf spring to less than 0.005 mm, and the dimensional tolerance can be set to +0.005 mm, -0.0 mm. In this way, since the surface roughness is so small as not causing fabrication injury to the surface, the material has sufficient resistance to SCC. Further, since the accuracy for the plate thickness is high, stress distribution as designed can be attained to prevent stress concentration. Then, if a casting die is once prepared, the casting mass production is enabled to reduce the manufacturing cost for the leaf spring. (T.M.)

  17. An alternative method for determining particle-size distribution of forest road aggregate and soil with large-sized particles

    Science.gov (United States)

    Hakjun Rhee; Randy B. Foltz; James L. Fridley; Finn Krogstad; Deborah S. Page-Dumroese

    2014-01-01

    Measurement of particle-size distribution (PSD) of soil with large-sized particles (e.g., 25.4 mm diameter) requires a large sample and numerous particle-size analyses (PSAs). A new method is needed that would reduce time, effort, and cost for PSAs of the soil and aggregate material with large-sized particles. We evaluated a nested method for sampling and PSA by...

  18. Measurement methods and variability assessment of the Norway spruce total leaf area: Implications for remote sensing

    NARCIS (Netherlands)

    Homolova, L.; Lukes, P.; Malenovsky, Z.; Lhotakova, Z.; Kaplan, V.; Hanus, J.

    2013-01-01

    Estimation of total leaf area (LAT) is important to express biochemical properties in plant ecology and remote sensing studies. A measurement of LAT is easy in broadleaf species, but it remains challenging in coniferous canopies. We proposed a new geometrical model to estimate Norway spruce LAT and

  19. Resource quality affects weapon and testis size and the ability of these traits to respond to selection in the leaf-footed cactus bug, Narnia femorata.

    Science.gov (United States)

    Sasson, Daniel A; Munoz, Patricio R; Gezan, Salvador A; Miller, Christine W

    2016-04-01

    The size of weapons and testes can be central to male reproductive success. Yet, the expression of these traits is often extremely variable. Studies are needed that take a more complete organism perspective, investigating the sources of variation in both traits simultaneously and using developmental conditions that mimic those in nature. In this study, we investigated the components of variation in weapon and testis sizes using the leaf-footed cactus bug, Narnia femorata (Hemiptera: Coreidae) on three natural developmental diets. We show that the developmental diet has profound effects on both weapon and testis expression and scaling. Intriguingly, males in the medium-quality diet express large weapons but have relatively tiny testes, suggesting complex allocation decisions. We also find that heritability, evolvability, and additive genetic variation are highest in the high-quality diet for testis and body mass. This result suggests that these traits may have an enhanced ability to respond to selection during a small window of time each year when this diet is available. Taken together, these results illustrate that normal, seasonal fluctuations in the nutritional environment may play a large role in the expression of sexually selected traits and the ability of these traits to respond to selection.

  20. Forced sound transmission through a finite-sized single leaf panel subject to a point source excitation.

    Science.gov (United States)

    Wang, Chong

    2018-03-01

    In the case of a point source in front of a panel, the wavefront of the incident wave is spherical. This paper discusses spherical sound waves transmitting through a finite sized panel. The forced sound transmission performance that predominates in the frequency range below the coincidence frequency is the focus. Given the point source located along the centerline of the panel, forced sound transmission coefficient is derived through introducing the sound radiation impedance for spherical incident waves. It is found that in addition to the panel mass, forced sound transmission loss also depends on the distance from the source to the panel as determined by the radiation impedance. Unlike the case of plane incident waves, sound transmission performance of a finite sized panel does not necessarily converge to that of an infinite panel, especially when the source is away from the panel. For practical applications, the normal incidence sound transmission loss expression of plane incident waves can be used if the distance between the source and panel d and the panel surface area S satisfy d/S>0.5. When d/S ≈0.1, the diffuse field sound transmission loss expression may be a good approximation. An empirical expression for d/S=0  is also given.

  1. A novel method for efficient and abundant production of Phytophthora brassicae zoospores on Brussels sprout leaf discs

    Directory of Open Access Journals (Sweden)

    Govers Francine

    2009-08-01

    Full Text Available Abstract Background Phytophthora species are notorious oomycete pathogens that cause diseases on a wide range of plants. Our understanding how these pathogens are able to infect their host plants will benefit greatly from information obtained from model systems representative for plant-Phytophthora interactions. One attractive model system is the interaction between Arabidopsis and Phytophthora brassicae. Under laboratory conditions, Arabidopsis can be easily infected with mycelial plugs as inoculum. In the disease cycle, however, sporangia or zoospores are the infectious propagules. Since the current P. brassicae zoospore isolation methods are generally regarded as inefficient, we aimed at developing an alternative method for obtaining high concentrations of P. brassicae zoospores. Results P. brassicae isolates were tested for pathogenicity on Brussels sprout plants (Brassica oleracea var. gemmifera. Microscopic examination of leaves, stems and roots infected with a GFP-tagged transformant of P. brassicae clearly demonstrated the susceptibility of the various tissues. Leaf discs were cut from infected Brussels sprout leaves, transferred to microwell plates and submerged in small amounts of water. In the leaf discs the hyphae proliferated and abundant formation of zoosporangia was observed. Upon maturation the zoosporangia released zoospores in high amounts and zoospore production continued during a period of at least four weeks. The zoospores were shown to be infectious on Brussels sprouts and Arabidopsis. Conclusion The in vitro leaf disc method established from P. brassicae infected Brussels sprout leaves facilitates convenient and high-throughput production of infectious zoospores and is thus suitable to drive small and large scale inoculation experiments. The system has the advantage that zoospores are produced continuously over a period of at least one month.

  2. Optimal sizing method for stand-alone photovoltaic power systems

    Energy Technology Data Exchange (ETDEWEB)

    Groumpos, P P; Papageorgiou, G

    1987-01-01

    The total life-cycle cost of stand-alone photovoltaic (SAPV) power systems is mathematically formulated. A new optimal sizing algorithm for the solar array and battery capacity is developed. The optimum value of a balancing parameter, M, for the optimal sizing of SAPV system components is derived. The proposed optimal sizing algorithm is used in an illustrative example, where a more economical life-cycle cost has bene obtained. The question of cost versus reliability is briefly discussed.

  3. Variation of the Pseudomonas community structure on oak leaf lettuce during storage detected by culture-dependent and -independent methods.

    Science.gov (United States)

    Nübling, Simone; Schmidt, Herbert; Weiss, Agnes

    2016-01-04

    The genus Pseudomonas plays an important role in the lettuce leaf microbiota and certain species can induce spoilage. The aim of this study was to investigate the occurrence and diversity of Pseudomonas spp. on oak leaf lettuce and to follow their community shift during a six day cold storage with culture-dependent and culture-independent methods. In total, 21 analysed partial Pseudomonas 16S rRNA gene sequences matched closely (> 98.3%) to the different reference strain sequences, which were distributed among 13 different phylogenetic groups or subgroups within the genus Pseudomonas. It could be shown that all detected Pseudomonas species belonged to the P. fluorescens lineage. In the culture-dependent analysis, 73% of the isolates at day 0 and 79% of the isolates at day 6 belonged to the P. fluorescens subgroup. The second most frequent group, with 12% of the isolates, was the P. koreensis subgroup. This subgroup was only detected at day 0. In the culture-independent analysis the P. fluorescens subgroup and P. extremaustralis could not be differentiated by RFLP. Both groups were most abundant and amounted to approximately 46% at day 0 and 79% at day 6. The phytopathogenic species P. salmonii, P. viridiflava and P. marginalis increased during storage. Both approaches identified the P. fluorescens group as the main phylogenetic group. The results of the present study suggest that pseudomonads found by plating methods indeed represent the most abundant part of the Pseudomonas community on oak leaf lettuce. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. A method of size inspection for fruit with machine vision

    Science.gov (United States)

    Rao, Xiuqin; Ying, Yibin

    2005-11-01

    A real time machine vision system for fruit quality inspection was developed, which consists of rollers, an encoder, a lighting chamber, a TMS-7DSP CCD camera (PULNIX Inc.), a computer (P4 1.8G, 128M) and a set of grading controller. An image was binary, and the edge was detected with line-scanned based digit image description, and the MER was applied to detected size of the fruit, but failed. The reason for the result was that the test point with MER was different from which was done with vernier caliper. An improved method was developed, which was called as software vernier caliper. A line between weight O of the fruit and a point A on the edge was drawn, and then the crossed point between line OA and the edge was calculated, which was noted as B, a point C between AB was selected, and the point D on the other side was searched by a way to make CD was vertical to AB, by move the point C between point A and B, A new point D was searched. The maximum length of CD was recorded as an extremum value. By move point A from start to the half point on the edge, a serial of CD was gotten. 80 navel oranges were tested, the maximum error of the diameter was less than 1mm.

  5. Sample Size Calculations for Population Size Estimation Studies Using Multiplier Methods With Respondent-Driven Sampling Surveys.

    Science.gov (United States)

    Fearon, Elizabeth; Chabata, Sungai T; Thompson, Jennifer A; Cowan, Frances M; Hargreaves, James R

    2017-09-14

    While guidance exists for obtaining population size estimates using multiplier methods with respondent-driven sampling surveys, we lack specific guidance for making sample size decisions. To guide the design of multiplier method population size estimation studies using respondent-driven sampling surveys to reduce the random error around the estimate obtained. The population size estimate is obtained by dividing the number of individuals receiving a service or the number of unique objects distributed (M) by the proportion of individuals in a representative survey who report receipt of the service or object (P). We have developed an approach to sample size calculation, interpreting methods to estimate the variance around estimates obtained using multiplier methods in conjunction with research into design effects and respondent-driven sampling. We describe an application to estimate the number of female sex workers in Harare, Zimbabwe. There is high variance in estimates. Random error around the size estimate reflects uncertainty from M and P, particularly when the estimate of P in the respondent-driven sampling survey is low. As expected, sample size requirements are higher when the design effect of the survey is assumed to be greater. We suggest a method for investigating the effects of sample size on the precision of a population size estimate obtained using multipler methods and respondent-driven sampling. Uncertainty in the size estimate is high, particularly when P is small, so balancing against other potential sources of bias, we advise researchers to consider longer service attendance reference periods and to distribute more unique objects, which is likely to result in a higher estimate of P in the respondent-driven sampling survey. ©Elizabeth Fearon, Sungai T Chabata, Jennifer A Thompson, Frances M Cowan, James R Hargreaves. Originally published in JMIR Public Health and Surveillance (http://publichealth.jmir.org), 14.09.2017.

  6. Effect of weed control treatments on total leaf area of plantation black walnut (Juglans nigra)

    Science.gov (United States)

    Jason Cook; Michael R. Saunders

    2013-01-01

    Determining total tree leaf area is necessary for describing tree carbon balance, growth efficiency, and other measures used in tree-level and stand-level physiological growth models. We examined the effects of vegetation control methods on the total leaf area of sapling-size plantation black walnut trees using allometric approaches. We found significant differences in...

  7. Method and apparatus for sizing nuclear fuel rod cladding tubes

    International Nuclear Information System (INIS)

    Koehler, L.

    1976-01-01

    Nuclear fuel rod cladding tubes are sized internally to diameters precisely fitting nuclear fuel pellets with which the tubes are charged by externally applying hydraulic pressure to short lengths of each tube. The pressure is applied while the tube is stationary. The tube is then moved to bring a new length within the hydraulic pressure zone. The volume of the hydraulic liquid used and the pressure applied to this liquid is such that the liquid is compressed slightly so that the length being sized yields, the expansion of the liquid then completing the sizing. The lengths being sized step-by-step are internally supported by either the fuel pellets or a mandrel having the same diameter as the pellets

  8. Evaluating a new method to estimate the rate of leaf respiration in the light by analysis of combined gas exchange and chlorophyll fluorescence measurements

    NARCIS (Netherlands)

    Yin, X.; Sun, Z.; Struik, P.C.; Gu, J.

    2011-01-01

    Day respiration (R(d)) is an important parameter in leaf ecophysiology. It is difficult to measure directly and is indirectly estimated from gas exchange (GE) measurements of the net photosynthetic rate (A), commonly using the Laisk method or the Kok method. Recently a new method was proposed to

  9. Estimação da área foliar do algodoeiro por meio de dimensões e massa das folhas Cotton leaf area estimates based on leaf dimensions and dry mass methods

    Directory of Open Access Journals (Sweden)

    José Eduardo B. A. Monteiro

    2005-01-01

    Full Text Available O objetivo deste trabalho foi avaliar dois métodos de estimação da área foliar do algodoeiro, por meio de suas dimensões e massa seca das folhas. Foram utilizadas as cultivares IAC 23 e Coodetec 401. No método que utilizou dimensões, as folhas do algodoeiro foram agrupadas em novas, cordiformes e maduras. Para cada tipo de folha, de cada cultivar, foi determinado um fator de forma (FF por meio de análise de regressão entre o produto do comprimento (C pela largura (L e a área das folhas. Avaliou-se a correlação entre a área foliar estimada pelo fator FF e sua medida direta, utilizando-se dados independentes. Testou-se, ainda, um fator único para cada cultivar, independente do estádio da cultura e, também, um fator geral para as duas cultivares. No método que utilizou a massa seca, as folhas foram agrupadas em novas e maduras. Determinou-se o fator de massa seca (FM por meio da análise de regressão entre a massa seca de folhas e respectivas áreas foliares. Em seguida, avaliou-se a correlação entre dados estimados por FM e dados medidos de forma direta, em nova amostra. O método das dimensões é viável para a estimação de área foliar do algodoeiro, por apresentar boa precisão e exatidão, com r² entre 0,71 e 0,98 e com coeficiente angular da regressão entre 0,87 e 0,95. No entanto, pelo método da massa seca, observaram-se precisão e exatidão maiores, com r² entre 0,94 e 0,98, e coeficiente angular da regressão entre 0,97 e 1,00, com a vantagem de ser menos trabalhoso.The objective of this study was to evaluate two different methods to estimate cotton leaf area (LA, based on leaf dimensions (length - L and width - W and leaf dry mass (DM. Two cultivars, IAC 23 and Coodetec 401, were used. For leaf dimensions method, leaves were classified by age: young, heart-shape, and mature. For each age class, a leaf shape factor (LSF was obtained by simple linear regression between L*W and LA. For leaf dry mass method, leaves

  10. The determination of hyperoside in the flower and leaf of hawthorn (Crataegus oxycantha and Crataegus monogyna by the spectrophotometric method

    Directory of Open Access Journals (Sweden)

    Mihajlović Dušanka

    2006-01-01

    Full Text Available The flower and leaf of hawthorn contains many active components, used in the production of pharmaceutical preparations for cardiotonic, anti-hypertonic anti-hypotonic, artherosclerotic, anti-arithmic and anti-anemic groups. According to the ROTTE list (1996, 159 of 1800 pharmaceutical preparations contain components from hawthorn. Due to the remedial action of hyperoside and other flavonoids from hawthorn, their determination is important for the standardization of extract and preparation quality. The extraction of the flavonoids from a mixture of hawthorn (C. oxycantha and C. monogyna flower and leaf was carried out by percolation with 40% and 70% (v/v ethanol. In order to determine the content of total flavonoids calculated as hyperoside spectrophotometric method with aluminium(lll chloride as a colour reagent at 425 nm was applied. The total flavonoid content in the herbal material mixture was 0.483%, in 40% and 70% (v/v ethanolic liquid extract it was 138 mg/100 cm3 and 157 mg/100 cm, respectively. The extraction degree of total flavonoids with 40% and 70% (v/v ethanolic solutions was 57.14% and 65.01% respectively. The yield of total flavonoids in the dry extract was 63% in regard to the herbal mixure content.

  11. Phytochemical screening and antioxidant activity of ethanolic extract and ethyl acetate fraction from basil leaf (Ocimum basilicum L.) by DPPH radical scavenging method

    Science.gov (United States)

    Warsi; Sholichah, A. R.

    2017-11-01

    Basil leaf (Ocimum basilicum L.) contains various compounds such as flavonoid, alkaloid, phenol and essential oil, so it needs to be fractionated to find out the flavonoid compound with the greatest potential as an antioxidant. This research was aimed to know the chemical compound, antioxidant potential of ethanolic extract and ethyl acetate fraction from basil leaf. The basil leaf was extracted by maceration using ethanol 70 %. The crude extract was fractionated with ethyl acetate. The ethanolic extract and ethyl acetate fraction were screened of phytochemical content including identification of flavonoids, alkaloids and polyphenolics. The antioxidant activity of the ethanolic extract and ethyl acetate fraction were tested qualitatively with 2,2-diphenyl-1-picrylhydrazyl (DPPH) and phosphomolybdate. Its antioxidant activity was determined quantitatively using DPPH radical scavenging method. Phytochemical screening test showed that ethanolic extract and ethyl acetate fraction from basil leaf contain flavonoids, polyphenolics, and alkaloids. The qualitative analysis of antioxidant activity of ethanolic extract and ethyl acetate fraction from basil leaf showed an antioxidant activity. The IC50 value of ethanolic extract, ethyl acetate fraction and quercetin were 1,374.00±6.20 389.00±1.00 2.10±0.01μg/mL, respectively. The research showed that antioxidant activity of the ethyl acetate fraction more potential than the ethanol extract of the basil leaf, but less than quercetin.

  12. Magnetic agglomeration method for size control in the synthesis of magnetic nanoparticles

    Science.gov (United States)

    Huber, Dale L [Albuquerque, NM

    2011-07-05

    A method for controlling the size of chemically synthesized magnetic nanoparticles that employs magnetic interaction between particles to control particle size and does not rely on conventional kinetic control of the reaction to control particle size. The particles are caused to reversibly agglomerate and precipitate from solution; the size at which this occurs can be well controlled to provide a very narrow particle size distribution. The size of particles is controllable by the size of the surfactant employed in the process; controlling the size of the surfactant allows magnetic control of the agglomeration and precipitation processes. Agglomeration is used to effectively stop particle growth to provide a very narrow range of particle sizes.

  13. Ampere hour method of sizing a stand alone photovoltaic system ...

    African Journals Online (AJOL)

    Stand-alone photovoltaic power systems are natural options for application in electrification of remote areas which are not served by the grid electricity supply system. An ampere-hour ... Sizing of the balance-of-system were carefully handled to avoid undersizing or oversizing and subsequent variation in supply reliability.

  14. Validation of leaf ozone symptoms in natural vegetation using microscopical methods

    International Nuclear Information System (INIS)

    Vollenweider, P.; Ottiger, M.; Guenthardt-Goerg, M.S

    2003-01-01

    Integration of markers of oxidative stress, from the subcellular to the leaf and needle level, proved to be a useful tool for the differential diagnosis and validation of ozone injury. - Ozone injury to natural vegetation is being increasingly surveyed throughout the northern hemisphere. There exists a growing list of species showing visible 'ozone-like' symptoms which needs to be validated. This study presents the results from a test survey of ozone injury to forest vegetation in the light exposed sites of five Swiss level II plots, for the new ICP-Forests protocol. With AOT40 from 14 to 28 ppm·h in 2000, ten out of 49 woody plant species displayed typical symptoms, and four showed untypical symptoms. Symptom origin was investigated in nine and validated in seven species, using morphological, histological and cellular markers of oxidative stress and ozone-induced plant response. Independent of taxonomic position, ozone effects were characterized by the induction of oxidative stress in the mesophyll resulting in discrete and light-dependent hypersensitive-like responses and in accelerated cell senescence. The presented combination of cellular and morphological markers allows differential diagnosis of visible ozone injury

  15. Estimating Apparent Nutrient Digestibility of Diets Containing Leucaena leucocephala or Moringa oleifera Leaf Meals for Growing Rabbits by Two Methods.

    Science.gov (United States)

    Safwat, A M; Sarmiento-Franco, L; Santos-Ricalde, R H; Nieves, D; Sandoval-Castro, C A

    2015-08-01

    This study aimed to evaluate the nutrient digestibility of growing rabbits fed diets with different levels of either Leucaena leucocephala (LLM) or Moringa oleifera (MOLM) leaf meals and also to compare total collection and TiO2 marker methods for estimating digestibility. A total of 30 California growing rabbits (1.81±0.19 kg live weight on average) were randomly distributed into five experimental groups of six rabbits each and were housed in individual cages. The groups were control, 30% LLM, 40% LLM, 30% MOLM, and 40% MOLM. All groups received pelleted diets for two weeks; diets also contained 4 g/kg titanium dioxide as dietary marker. Daily feed intake was recorded during the whole experimental period and total feces were collected daily and weighed individually during four days. The results showed that there were no difference (p>0.05) in feed, dry matter (DM), organic matter (OM), crude protein (CP), digestible energy, and crude fiber (CF) intake between the control group and the other experimental groups. The apparent digestibility values of DM, OM, CP, CF, acid detergent fiber, and gross energy were the highest for control group (p = 0.001), meanwhile MOLM diets had generally higher nutrient digestibility coefficients than LLM diets. Increasing the inclusion level of leaf meal in the diet from 30% to 40% improved the digestibility of CF from 45.02% to 51.69% for LLM and from 48.11% to 55.89% for MOLM. Similar results for apparent nutrient digestibility coefficients were obtained when either total collection or indigestible marker method was used. In conclusion, the digestibility of MOLM containing diets were better than LLM diets, furthermore TiO2 as an external marker could be used as a simple, practical and reliable method to estimate nutrients digestibility in rabbit diets.

  16. Simple extraction methods that prevent the artifactual conversion of chlorophyll to chlorophyllide during pigment isolation from leaf samples.

    Science.gov (United States)

    Hu, Xueyun; Tanaka, Ayumi; Tanaka, Ryouichi

    2013-06-19

    When conducting plant research, the measurement of photosynthetic pigments can provide basic information on the physiological status of a plant. High-pressure liquid chromatography (HPLC) is becoming widely used for this purpose because it provides an accurate determination of a variety of photosynthetic pigments simultaneously. This technique has a drawback compared with conventional spectroscopic techniques, however, in that it is more prone to structural modification of pigments during extraction, thus potentially generating erroneous results. During pigment extraction procedures with acetone or alcohol, the phytol side chain of chlorophyll is sometimes removed, forming chlorophyllide, which affects chlorophyll measurement using HPLC. We evaluated the artifactual chlorophyllide production during chlorophyll extraction by comparing different extraction methods with wild-type and mutant Arabidopsis leaves that lack the major isoform of chlorophyllase. Several extraction methods were compared to provide alternatives to researchers who utilize HPLC for the analysis of chlorophyll levels. As a result, the following three methods are recommended. In the first method, leaves are briefly boiled prior to extraction. In the second method, grinding and homogenization of leaves are performed at sub-zero temperatures. In the third method, N, N'-dimethylformamide (DMF) is used for the extraction of pigments. When compared, the first two methods eliminated almost all chlorophyllide-forming activity in Arabidopsis thaliana, Glebionis coronaria, Pisum sativum L. and Prunus sargentii Rehd. However, DMF effectively suppressed the activity of chlorophyllase only in Arabidopsis leaves. Chlorophyllide production in leaf extracts is predominantly an artifact. All three methods evaluated in this study reduce the artifactual production of chlorophyllide and are thus suitable for pigment extraction for HPLC analysis. The boiling method would be a practical choice when leaves are not too

  17. Development of an iterative reconstruction method to overcome 2D detector low resolution limitations in MLC leaf position error detection for 3D dose verification in IMRT

    NARCIS (Netherlands)

    Visser, Ruurd; J., Godart; Wauben, D.J.L.; Langendijk, J.; van 't Veld, A.A.; Korevaar, E.W.

    2016-01-01

    The objective of this study was to introduce a new iterative method to reconstruct multi leaf collimator (MLC) positions based on low resolution ionization detector array measurements and to evaluate its error detection performance. The iterative reconstruction method consists of a fluence model, a

  18. An economical non-destructive method for estimating eelgrass, Zostera marina (Potamogetonaceae leaf growth rates: formal development and use in northwestern Baja California

    Directory of Open Access Journals (Sweden)

    Elena Solana-Arellano

    2008-09-01

    Full Text Available Seagrass beds provide much of the primary production in estuaries; host many fishes and fish larvae, and abate erosion. The present study presents original analytical methods for estimating mean leaf-growth rates of eelgrass (Zostera marina. The method was calibrated by using data collected in a Z. marina meadow at Punta Banda estuary in Baja California, Mexico. The analytical assessments were based on measurements of leaf length and standard regression procedures. We present a detailed explanation of the formal procedures involved in the derivation of these analytical methods. The measured daily leaf-growth rate was 10.9 mm d-1 leaf-1. The corresponding value projected by our method was 10.2 mm d-1 leaf-1. The associated standard errors were of 0.53 and 0.56 mm d-1 leaf-1 respectively. The method was validated by projecting leaf-growth rates from an independent data set, which gave consistent results. The use of the method to obtain the mean leaf growth rate of a transplanted plot is also illustrated. Comparison of our leaf-growth data with previously reported assessments show the significant forcing of sea-surface temperature on eelgrass leaf dynamics. The formal constructs provided here are of general scope and can be applied to equivalent eelgrass data sets in a straightforward manner. Rev. Biol. Trop. 56 (3: 1003-1013. Epub 2008 September 30.Las praderas de pastos marinos abaten la erosión y aportan gran parte de la productividad primaria de los esteros y son refugio de muchos peces y sus larvas. El presente trabajo introduce métodos analíticos para estimar las tasas medias de crecimiento foliar de Zostera marina L. y sus varianzas. La calibración del método se llevó a cabo utilizando datos de una pradera de esta fanerógama en el Estero de Punta Banda Baja California, México. Las referidas estimaciones analíticas, se basan en medias de longitud foliar y en procedimientos estandarizados de regresión. Dichas determinaciones son por

  19. Method for measuring the size distribution of airborne rhinovirus

    International Nuclear Information System (INIS)

    Russell, M.L.; Goth-Goldstein, R.; Apte, M.G.; Fisk, W.J.

    2002-01-01

    About 50% of viral-induced respiratory illnesses are caused by the human rhinovirus (HRV). Measurements of the concentrations and sizes of bioaerosols are critical for research on building characteristics, aerosol transport, and mitigation measures. We developed a quantitative reverse transcription-coupled polymerase chain reaction (RT-PCR) assay for HRV and verified that this assay detects HRV in nasal lavage samples. A quantitation standard was used to determine a detection limit of 5 fg of HRV RNA with a linear range over 1000-fold. To measure the size distribution of HRV aerosols, volunteers with a head cold spent two hours in a ventilated research chamber. Airborne particles from the chamber were collected using an Andersen Six-Stage Cascade Impactor. Each stage of the impactor was analyzed by quantitative RT-PCR for HRV. For the first two volunteers with confirmed HRV infection, but with mild symptoms, we were unable to detect HRV on any stage of the impactor

  20. Method for measuring the size distribution of airborne rhinovirus

    Energy Technology Data Exchange (ETDEWEB)

    Russell, M.L.; Goth-Goldstein, R.; Apte, M.G.; Fisk, W.J.

    2002-01-01

    About 50% of viral-induced respiratory illnesses are caused by the human rhinovirus (HRV). Measurements of the concentrations and sizes of bioaerosols are critical for research on building characteristics, aerosol transport, and mitigation measures. We developed a quantitative reverse transcription-coupled polymerase chain reaction (RT-PCR) assay for HRV and verified that this assay detects HRV in nasal lavage samples. A quantitation standard was used to determine a detection limit of 5 fg of HRV RNA with a linear range over 1000-fold. To measure the size distribution of HRV aerosols, volunteers with a head cold spent two hours in a ventilated research chamber. Airborne particles from the chamber were collected using an Andersen Six-Stage Cascade Impactor. Each stage of the impactor was analyzed by quantitative RT-PCR for HRV. For the first two volunteers with confirmed HRV infection, but with mild symptoms, we were unable to detect HRV on any stage of the impactor.

  1. Strong Stability Preserving Explicit Linear Multistep Methods with Variable Step Size

    KAUST Repository

    Hadjimichael, Yiannis

    2016-09-08

    Strong stability preserving (SSP) methods are designed primarily for time integration of nonlinear hyperbolic PDEs, for which the permissible SSP step size varies from one step to the next. We develop the first SSP linear multistep methods (of order two and three) with variable step size, and prove their optimality, stability, and convergence. The choice of step size for multistep SSP methods is an interesting problem because the allowable step size depends on the SSP coefficient, which in turn depends on the chosen step sizes. The description of the methods includes an optimal step-size strategy. We prove sharp upper bounds on the allowable step size for explicit SSP linear multistep methods and show the existence of methods with arbitrarily high order of accuracy. The effectiveness of the methods is demonstrated through numerical examples.

  2. Appropriate Separator Sizing: A Modified Stewart and Arnold Method

    Directory of Open Access Journals (Sweden)

    F. Boukadi

    2012-01-01

    Full Text Available Oil and gas separators were one of the first pieces of production equipment to be used in the petroleum industry. The different stages of separation are completed using the following three principles: gravity, centrifugal force, and impingement. The sizes of the oil droplets, in the production water, are based mainly on the choke valve pressure drop. The choke valve pressure drop creates a shearing effect; this reduces the ability of the droplets to combine. One of the goals of oil separation is to reduce the shearing effect of the choke. Separators are conventionally designed based on initial flow rates; as a result, the separator is no longer able to accommodate totality of produced fluids. Changing fluid flow rates as well as emulsion viscosity effect separator design. The reduction in vessel performance results in recorded measurements that do not match actual production levels inducing doubt into any history matching process and distorting reservoir management programs. In this paper, the new model takes into account flow rates and emulsion viscosity. The generated vessel length, vessel diameter, and slenderness ratio monographs are used to select appropriate separator size based on required retention time. Model results are compared to API 12J standards.

  3. Leaf-IT: An Android application for measuring leaf area.

    Science.gov (United States)

    Schrader, Julian; Pillar, Giso; Kreft, Holger

    2017-11-01

    The use of plant functional traits has become increasingly popular in ecological studies because plant functional traits help to understand key ecological processes in plant species and communities. This also includes changes in diversity, inter- and intraspecific interactions, and relationships of species at different spatiotemporal scales. Leaf traits are among the most important traits as they describe key dimensions of a plant's life history strategy. Further, leaf area is a key parameter with relevance for other traits such as specific leaf area, which in turn correlates with leaf chemical composition, photosynthetic rate, leaf longevity, and carbon investment. Measuring leaf area usually involves the use of scanners and commercial software and can be difficult under field conditions. We present Leaf-IT, a new smartphone application for measuring leaf area and other trait-related areas. Leaf-IT is free, designed for scientific purposes, and runs on Android 4 or higher. We tested the precision and accuracy using objects with standardized area and compared the area measurements of real leaves with the well-established, commercial software WinFOLIA using the Altman-Bland method. Area measurements of standardized objects show that Leaf-IT measures area with high accuracy and precision. Area measurements with Leaf-IT of real leaves are comparable to those of WinFOLIA. Leaf-IT is an easy-to-use application running on a wide range of smartphones. That increases the portability and use of Leaf-IT and makes it possible to measure leaf area under field conditions typical for remote locations. Its high accuracy and precision are similar to WinFOLIA. Currently, its main limitation is margin detection of damaged leaves or complex leaf morphologies.

  4. Why liquid displacement methods are sometimes wrong in estimating the pore-size distribution

    NARCIS (Netherlands)

    Gijsbertsen-Abrahamse, A.J.; Boom, R.M.; Padt, van der A.

    2004-01-01

    The liquid displacement method is a commonly used method to determine the pore size distribution of micro- and ultrafiltration membranes. One of the assumptions for the calculation of the pore sizes is that the pores are parallel and thus are not interconnected. To show that the estimated pore size

  5. The full size validation of remanent life assessment methods

    International Nuclear Information System (INIS)

    Hepworth, J.K.; Williams, J.A.

    1988-03-01

    A range of possible life assessment techniques for the remanent life appraisal of creeping structures is available in the published literature. However, due to the safety implications, the true conservatism of such methods cannot be assessed on operating plant. Consequently, the CEGB set up a four vessel programme in the Pressure Vessel Test Facility at the Marchwood Engineering Laboratories of the CEGB to underwrite and quantify the accuracy of these methods. The application of two non-destructive methods, namely strain monitoring and hardness measurement, to the data generated during about 12,000 hours of testing is examined. The current state of development of these methods is reviewed. Finally, the future CEGB programme relating to these vessels is discussed. (author)

  6. Effect of nitrogen supply on leaf appearance, leaf growth, leaf nitrogen economy and photosynthetic capacity in maize (Zea mays L.)

    NARCIS (Netherlands)

    Vos, J.; Putten, van der P.E.L.; Birch, C.J.

    2005-01-01

    Leaf area growth and nitrogen concentration per unit leaf area, Na (g m-2 N) are two options plants can use to adapt to nitrogen limitation. Previous work indicated that potato (Solanum tuberosum L.) adapts the size of leaves to maintain Na and photosynthetic capacity per unit leaf area. This paper

  7. Molecular Structure-Affinity Relationship of Flavonoids in Lotus Leaf (Nelumbo nucifera Gaertn.) on Binding to Human Serum Albumin and Bovine Serum Albumin by Spectroscopic Method.

    Science.gov (United States)

    Tang, Xiaosheng; Tang, Ping; Liu, Liangliang

    2017-06-23

    Lotus leaf has gained growing popularity as an ingredient in herbal formulations due to its various activities. As main functional components of lotus leaf, the difference in structure of flavonoids affected their binding properties and activities. In this paper, the existence of 11 flavonoids in lotus leaf extract was confirmed by High Performance Liquid Chromatography (HPLC) analysis and 11 flavonoids showed various contents in lotus leaf. The interactions between lotus leaf extract and two kinds of serum albumins (human serum albumin (HSA) and bovine serum albumin (BSA)) were investigated by spectroscopic methods. Based on the fluorescence quenching, the interactions between these flavonoids and serum albumins were further checked in detail. The relationship between the molecular properties of flavonoids and their affinities for serum albumins were analyzed and compared. The hydroxylation on 3 and 3' position increased the affinities for serum albumins. Moreover, both of the methylation on 3' position of quercetin and the C₂=C₃ double bond of apigenin and quercetin decreased the affinities for HSA and BSA. The glycosylation lowered the affinities for HSA and BSA depending on the type of sugar moiety. It revealed that the hydrogen bond force played an important role in binding flavonoids to HSA and BSA.

  8. Increasing Leaf Vein Density via Mutagenesis in Rice Results in an Enhanced Rate of Photosynthesis, Smaller Cell Sizes and Can Reduce Interveinal Mesophyll Cell Number

    Directory of Open Access Journals (Sweden)

    Aryo B. Feldman

    2017-11-01

    Full Text Available Improvements to leaf photosynthetic rates of crops can be achieved by targeted manipulation of individual component processes, such as the activity and properties of RuBisCO or photoprotection. This study shows that simple forward genetic screens of mutant populations can also be used to rapidly generate photosynthesis variants that are useful for breeding. Increasing leaf vein density (concentration of vascular tissue per unit leaf area has important implications for plant hydraulic properties and assimilate transport. It was an important step to improving photosynthetic rates in the evolution of both C3 and C4 species and is a foundation or prerequisite trait for C4 engineering in crops like rice (Oryza sativa. A previous high throughput screen identified five mutant rice lines (cv. IR64 with increased vein densities and associated narrower leaf widths (Feldman et al., 2014. Here, these high vein density rice variants were analyzed for properties related to photosynthesis. Two lines were identified as having significantly reduced mesophyll to bundle sheath cell number ratios. All five lines had 20% higher light saturated photosynthetic capacity per unit leaf area, higher maximum carboxylation rates, dark respiration rates and electron transport capacities. This was associated with no significant differences in leaf thickness, stomatal conductance or CO2 compensation point between mutants and the wild-type. The enhanced photosynthetic rate in these lines may be a result of increased RuBisCO and electron transport component amount and/or activity and/or enhanced transport of photoassimilates. We conclude that high vein density (associated with altered mesophyll cell length and number is a trait that may confer increased photosynthetic efficiency without increased transpiration.

  9. Leaf area estimation of medium size plants using optical metrology Estimativa da área foliar de plantas de médio porte com metrologia óptica

    Directory of Open Access Journals (Sweden)

    Kleber M. Ribeiro

    2013-06-01

    Full Text Available The total leaf area (TLA estimation is an important feature of the crops and their assessment a challenge, since the direct methods of obtaining it are destructive and time consuming. Non-destructive methods have been explored to obtain the TLA by indirect approaches, in turn creating other features, as the leaf area index. The development of non-destructive technology to access the TLA of a plant has been the subject of much research, and the optical metrology is an promising approach. In this work, some indirect methods associated with optical approaches were evaluated as an alternative to obtain the TLA of the coffee plant. Commercial equipment were used, such as a camera with a fish eye lens and lux meters, associated to the sizes of the canopies were tested and compared to another non-destructive method and with methods proposed in the literature. The association between production and the TLA estimated was also evaluated. The results showed that the commercial equipment, generally used in forestry, was not the best approach in coffee plants, and that the methods related to the size and lux values of the plants were the best alternatives to estimate the TLA of the coffee plant.A estimativa da área foliar total (AFT é uma importante característica das culturas cuja avaliação é um desafio visto que métodos diretos de obtê-la são destrutivos e consome tempo. Métodos não destrutivos têm sido explorados com vista a se obter a AFT por meio de abordagens indiretas e, por sua vez, a criação de outros recursos, como o índice de área foliar. O desenvolvimento de tecnologia não destrutiva para acessar a AFT de uma planta tem sido objeto de muitas pesquisas e a metrologia óptica é uma abordagem promissora. Neste trabalho alguns métodos indiretos associados com as abordagens ópticas foram avaliados como alternativa para obtenção da AFT do cafeeiro. Equipamentos comerciais foram usados, como uma câmera com lente olho de peixe e

  10. Comparing a novel automatic 3D method for LGE-CMR quantification of scar size with established methods.

    Science.gov (United States)

    Woie, Leik; Måløy, Frode; Eftestøl, Trygve; Engan, Kjersti; Edvardsen, Thor; Kvaløy, Jan Terje; Ørn, Stein

    2014-02-01

    Current methods for the estimation of infarct size by late-enhanced cardiac magnetic imaging are based upon 2D analysis that first determines the size of the infarction in each slice, and thereafter adds the infarct sizes from each slice to generate a volume. We present a novel, automatic 3D method that estimates infarct size by a simultaneous analysis of all pixels from all slices. In a population of 54 patients with ischemic scars, the infarct size estimated by the automatic 3D method was compared with four established 2D methods. The new 3D method defined scar as the sum of all pixels with signal intensity (SI) ≥35 % of max SI from the complete myocardium, border zone: SI 35-50 % of max SI and core as SI ≥50 % of max SI. The 3D method yielded smaller infarct size (-2.8 ± 2.3 %) and core size (-3.0 ± 1.7 %) than the 2D method most similar to ours. There was no difference in the size of the border zone (0.2 ± 1.4 %). The 3D method demonstrated stronger correlations between scar size and left ventricular (LV) remodelling parameters (LV ejection fraction: r = -0.71, p 3D automatic method is without the need for manual demarcation of the scar; it is less time-consuming and has a stronger correlation with remodelling parameters compared with existing methods.

  11. The higher order flux mapping method in large size PHWRs

    International Nuclear Information System (INIS)

    Kulkarni, A.K.; Balaraman, V.; Purandare, H.D.

    1997-01-01

    A new higher order method is proposed for obtaining flux map using single set of expansion mode. In this procedure, one can make use of the difference between predicted value of detector reading and their actual values for determining the strength of local fluxes around detector site. The local fluxes are arising due to constant perturbation changes (both extrinsic and intrinsic) taking place in the reactor. (author)

  12. A method for genotyping elite breeding stocks of leaf chicory (Cichorium intybus L.) by assaying mapped microsatellite marker loci.

    Science.gov (United States)

    Ghedina, Andrea; Galla, Giulio; Cadalen, Thierry; Hilbert, Jean-Louis; Caenazzo, Silvano Tiozzo; Barcaccia, Gianni

    2015-12-30

    Leaf chicory (Cichorium intybus subsp. intybus var. foliosum L.) is a diploid plant species (2n = 18) of the Asteraceae family. The term "chicory" specifies at least two types of cultivated plants: a leafy vegetable, which is highly differentiated with respect to several cultural types, and a root crop, whose current industrial utilization primarily addresses the extraction of inulin or the production of a coffee substitute. The populations grown are generally represented by local varieties (i.e., landraces) with high variation and adaptation to the natural and anthropological environment where they originated, and have been yearly selected and multiplied by farmers. Currently, molecular genetics and biotechnology are widely utilized in marker-assisted breeding programs in this species. In particular, molecular markers are becoming essential tools for developing parental lines with traits of interest and for assessing the specific combining ability of these lines to breed F1 hybrids. The present research deals with the implementation of an efficient method for genotyping elite breeding stocks developed from old landraces of leaf chicory, Radicchio of Chioggia, which are locally dominant in the Veneto region, using 27 microsatellite (SSR) marker loci scattered throughout the linkage groups. Information on the genetic diversity across molecular markers and plant accessions was successfully assessed along with descriptive statistics over all marker loci and inbred lines. Our overall data support an efficient method for assessing a multi-locus genotype of plant individuals and lineages that is useful for the selection of new varieties and the certification of local products derived from Radicchio of Chioggia. This method proved to be useful for assessing the observed degree of homozygosity of the inbred lines as a measure of their genetic stability; plus it allowed an estimate of the specific combining ability (SCA) between maternal and paternal inbred lines on the

  13. Reliability of different mark-recapture methods for population size estimation tested against reference population sizes constructed from field data.

    Directory of Open Access Journals (Sweden)

    Annegret Grimm

    Full Text Available Reliable estimates of population size are fundamental in many ecological studies and biodiversity conservation. Selecting appropriate methods to estimate abundance is often very difficult, especially if data are scarce. Most studies concerning the reliability of different estimators used simulation data based on assumptions about capture variability that do not necessarily reflect conditions in natural populations. Here, we used data from an intensively studied closed population of the arboreal gecko Gehyra variegata to construct reference population sizes for assessing twelve different population size estimators in terms of bias, precision, accuracy, and their 95%-confidence intervals. Two of the reference populations reflect natural biological entities, whereas the other reference populations reflect artificial subsets of the population. Since individual heterogeneity was assumed, we tested modifications of the Lincoln-Petersen estimator, a set of models in programs MARK and CARE-2, and a truncated geometric distribution. Ranking of methods was similar across criteria. Models accounting for individual heterogeneity performed best in all assessment criteria. For populations from heterogeneous habitats without obvious covariates explaining individual heterogeneity, we recommend using the moment estimator or the interpolated jackknife estimator (both implemented in CAPTURE/MARK. If data for capture frequencies are substantial, we recommend the sample coverage or the estimating equation (both models implemented in CARE-2. Depending on the distribution of catchabilities, our proposed multiple Lincoln-Petersen and a truncated geometric distribution obtained comparably good results. The former usually resulted in a minimum population size and the latter can be recommended when there is a long tail of low capture probabilities. Models with covariates and mixture models performed poorly. Our approach identified suitable methods and extended options to

  14. Measurement of particle size distribution of soil and selected aggregate sizes using the hydrometer method and laser diffractometry

    Science.gov (United States)

    Guzmán, G.; Gómez, J. A.; Giráldez, J. V.

    2010-05-01

    Soil particle size distribution has been traditionally determined by the hydrometer or the sieve-pipette methods, both of them time consuming and requiring a relatively large soil sample. This might be a limitation in situations, such as for instance analysis of suspended sediment, when the sample is small. A possible alternative to these methods are the optical techniques such as laser diffractometry. However the literature indicates that the use of this technique as an alternative to traditional methods is still limited, because the difficulty in replicating the results obtained with the standard methods. In this study we present the percentages of soil grain size determined using laser diffractometry within ranges set between 0.04 - 2000 μm. A Beckman-Coulter ® LS-230 with a 750 nm laser beam and software version 3.2 in five soils, representative of southern Spain: Alameda, Benacazón, Conchuela, Lanjarón and Pedrera. In three of the studied soils (Alameda, Benacazón and Conchuela) the particle size distribution of each aggregate size class was also determined. Aggregate size classes were obtained by dry sieve analysis using a Retsch AS 200 basic ®. Two hundred grams of air dried soil were sieved during 150 s, at amplitude 2 mm, getting nine different sizes between 2000 μm and 10 μm. Analyses were performed by triplicate. The soil sample preparation was also adapted to our conditions. A small amount each soil sample (less than 1 g) was transferred to the fluid module full of running water and disaggregated by ultrasonication at energy level 4 and 80 ml of sodium hexametaphosphate solution during 580 seconds. Two replicates of each sample were performed. Each measurement was made for a 90 second reading at a pump speed of 62. After the laser diffractometry analysis, each soil and its aggregate classes were processed calibrating its own optical model fitting the optical parameters that mainly depends on the color and the shape of the analyzed particle. As a

  15. Electronic structure and size of TiO sub 2 nanoparticles of controlled size prepared by aerosol methods

    CERN Document Server

    Soriano, L; Sanchez-Agudo, M; Sanz, J M; Ahonen, P P; Kauppinen, E I; Palomares, F J; Bressler, P R

    2002-01-01

    A complete characterization of nanostructures has to deal both with electronic structure and dimensions. Here we present the characterization of TiO sub 2 nanoparticles of controlled size prepared by aerosol methods. The electronic structure of these nanoparticles was probed by x-ray absorption spectroscopy (XAS), the particle size by atomic force microscopy (AFM). XAS spectra show that the particles crystallize in the anatase phase upon heating at 500 sup o C, whereas further annealing at 700 sup o C give crystallites of 70 % anatase and 30 % rutile phases. Raising the temperature to 900 sup o C results in a complete transformation of the particles to rutile. AFM images reveal that the mean size of the anatase particles formed upon heating at 500 sup o C is 30 nm, whereas for the rutile particles formed upon annealing at 900 sup o C 90 nm were found. The results obtained by these techniques agree with XRD data. (author)

  16. Systems and methods of varying charged particle beam spot size

    Science.gov (United States)

    Chen, Yu-Jiuan

    2014-09-02

    Methods and devices enable shaping of a charged particle beam. A modified dielectric wall accelerator includes a high gradient lens section and a main section. The high gradient lens section can be dynamically adjusted to establish the desired electric fields to minimize undesirable transverse defocusing fields at the entrance to the dielectric wall accelerator. Once a baseline setting with desirable output beam characteristic is established, the output beam can be dynamically modified to vary the output beam characteristics. The output beam can be modified by slightly adjusting the electric fields established across different sections of the modified dielectric wall accelerator. Additional control over the shape of the output beam can be excreted by introducing intentional timing de-synchronization offsets and producing an injected beam that is not fully matched to the entrance of the modified dielectric accelerator.

  17. PlantSize Offers an Affordable, Non-destructive Method to Measure Plant Size and Color in Vitro

    Directory of Open Access Journals (Sweden)

    Dóra Faragó

    2018-02-01

    Full Text Available Plant size, shape and color are important parameters of plants, which have traditionally been measured by destructive and time-consuming methods. Non-destructive image analysis is an increasingly popular technology to characterize plant development in time. High throughput automatic phenotyping platforms can simultaneously analyze multiple morphological and physiological parameters of hundreds or thousands of plants. Such platforms are, however, expensive and are not affordable for many laboratories. Moreover, determination of basic parameters is sufficient for most studies. Here we describe a non-invasive method, which simultaneously measures basic morphological and physiological parameters of in vitro cultured plants. Changes of plant size, shape and color is monitored by repeated photography with a commercial digital camera using neutral white background. Images are analyzed with the MatLab-based computer application PlantSize, which simultaneously calculates several parameters including rosette size, convex area, convex ratio, chlorophyll and anthocyanin contents of all plants identified on the image. Numerical data are exported in MS Excel-compatible format. Subsequent data processing provides information on growth rates, chlorophyll and anthocyanin contents. Proof-of-concept validation of the imaging technology was demonstrated by revealing small but significant differences between wild type and transgenic Arabidopsis plants overexpressing the HSFA4A transcription factor or the hsfa4a knockout mutant, subjected to different stress conditions. While HSFA4A overexpression was associated with better growth, higher chlorophyll and lower anthocyanin content in saline conditions, the knockout hsfa4a mutant showed hypersensitivity to various stresses. Morphological differences were revealed by comparing rosette size, shape and color of wild type plants with phytochrome B (phyB-9 mutant. While the technology was developed with Arabidopsis plants

  18. Background information for the Leaching environmental Assessment Framework (LEAF) test methods

    Science.gov (United States)

    The U.S. Environmental Protection Agency Office of Resource Conservation and Recovery has initiated the review and validation process for four leaching tests under consideration for inclusion into SW-846: Method 1313 "Liquid-Solid Partitioning as a Function of Extract pH for Co...

  19. Validation of an efficient visual method for estimating leaf area index ...

    African Journals Online (AJOL)

    This study aimed to evaluate the accuracy and applicability of a visual method for estimating LAI in clonal Eucalyptus grandis × E. urophylla plantations and to compare it with hemispherical photography, ceptometer and LAI-2000® estimates. Destructive sampling for direct determination of the actual LAI was performed in ...

  20. Fast and nondestructive method for leaf level chlorophyll estimation using hyperspectral LiDAR

    NARCIS (Netherlands)

    Nevalainen, O.; Hakala, T.; Suomalainen, J.M.; Mäkipää, R.; Peltoniemi, M.; Krooks, A.; Kaasalainen, S.

    2014-01-01

    We propose an empirical method for nondestructive estimation of chlorophyll in tree canopies. The first prototype of a full waveform hyperspectral LiDAR instrument has been developed by the Finnish Geodetic Institute (FGI). The instrument efficiently combines the benefits of passive and active

  1. Solving point reactor kinetic equations by time step-size adaptable numerical methods

    International Nuclear Information System (INIS)

    Liao Chaqing

    2007-01-01

    Based on the analysis of effects of time step-size on numerical solutions, this paper showed the necessity of step-size adaptation. Based on the relationship between error and step-size, two-step adaptation methods for solving initial value problems (IVPs) were introduced. They are Two-Step Method and Embedded Runge-Kutta Method. PRKEs were solved by implicit Euler method with step-sizes optimized by using Two-Step Method. It was observed that the control error has important influence on the step-size and the accuracy of solutions. With suitable control errors, the solutions of PRKEs computed by the above mentioned method are accurate reasonably. The accuracy and usage of MATLAB built-in ODE solvers ode23 and ode45, both of which adopt Runge-Kutta-Fehlberg method, were also studied and discussed. (authors)

  2. Importance of the method of leaf area measurement to the interpretation of gas exchange of complex shoots

    Science.gov (United States)

    W. K. Smith; A. W. Schoettle; M. Cui

    1991-01-01

    Net CO(2) uptake in full sunlight, total leaf area (TLA), projected leaf area of detached leaves (PLA), and the silhouette area of attached leaves in their natural orientation to the sun at midday on June 1 (SLA) were measured for sun shoots of six conifer species. Among species, TLA/SLA ranged between 5.2 and 10.0 (x bar = 7.3), TLA/PLA ranged between 2.5 and 2.9 (x...

  3. Size effect in barium titanate powders synthesized by different hydrothermal methods

    International Nuclear Information System (INIS)

    Sun Weian

    2006-01-01

    The size effect in barium titanate (BaTiO 3 ) was investigated both experimentally and theoretically. Tetragonal BaTiO 3 powders with average sizes from 80 to 420 nm were directly prepared by different hydrothermal methods. The tetragonality of the hydrothermal BaTiO 3 decreased with decreasing particle size, which exhibited a dependence on the synthesis method. A phenomenological model for the size effect was proposed to interpret the experimental observations. The influence of the defects, mainly the lattice hydroxyl, on the size effect was investigated to understand the correlation between the size effect and synthesis condition. The permittivities of BaTiO 3 powder at different particle sizes were calculated, which predicted a maximum permittivity of over 16 000 around the room-temperature critical size of ∼70 nm. The prediction was in good accordance with the experimental data reported recently

  4. Identification and Severity Determination of Wheat Stripe Rust and Wheat Leaf Rust Based on Hyperspectral Data Acquired Using a Black-Paper-Based Measuring Method

    Science.gov (United States)

    Ruan, Liu; Wang, Rui; Liu, Qi; Ma, Zhanhong; Li, Xiaolong; Cheng, Pei; Wang, Haiguang

    2016-01-01

    It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS) and support vector machine (SVM), and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS) and support vector regression (SVR). All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2) of more than 0.90 and the root mean square errors (RMSE) of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies. PMID:27128464

  5. Identification and Severity Determination of Wheat Stripe Rust and Wheat Leaf Rust Based on Hyperspectral Data Acquired Using a Black-Paper-Based Measuring Method.

    Science.gov (United States)

    Wang, Hui; Qin, Feng; Ruan, Liu; Wang, Rui; Liu, Qi; Ma, Zhanhong; Li, Xiaolong; Cheng, Pei; Wang, Haiguang

    2016-01-01

    It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS) and support vector machine (SVM), and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS) and support vector regression (SVR). All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2) of more than 0.90 and the root mean square errors (RMSE) of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies.

  6. Methods for obtaining true particle size distributions from cross section measurements

    Energy Technology Data Exchange (ETDEWEB)

    Lord, Kristina Alyse [Iowa State Univ., Ames, IA (United States)

    2013-01-01

    Sectioning methods are frequently used to measure grain sizes in materials. These methods do not provide accurate grain sizes for two reasons. First, the sizes of features observed on random sections are always smaller than the true sizes of solid spherical shaped objects, as noted by Wicksell [1]. This is the case because the section very rarely passes through the center of solid spherical shaped objects randomly dispersed throughout a material. The sizes of features observed on random sections are inversely related to the distance of the center of the solid object from the section [1]. Second, on a plane section through the solid material, larger sized features are more frequently observed than smaller ones due to the larger probability for a section to come into contact with the larger sized portion of the spheres than the smaller sized portion. As a result, it is necessary to find a method that takes into account these reasons for inaccurate particle size measurements, while providing a correction factor for accurately determining true particle size measurements. I present a method for deducing true grain size distributions from those determined from specimen cross sections, either by measurement of equivalent grain diameters or linear intercepts.

  7. Relationship between fresh-packaged spinach leaves exposed to continuous light or dark and bioactive contents: effects of cultivar, leaf size, and storage duration.

    Science.gov (United States)

    Lester, Gene E; Makus, Donald J; Hodges, D Mark

    2010-03-10

    Current retail marketing conditions allow produce to receive artificial light 24 h per day during its displayed shelf life. Essential human-health vitamins [ascorbic acid (vit C), folate (vit B(9)), phylloquinone (vit K(1)), alpha-tocopherol (vit E), and the carotenoids lutein, violaxanthin, zeaxanthin, and beta-carotene (provit A)] also are essential for photosynthesis and are biosynthesized in plants by light conditions even under chilling temperatures. Spinach leaves, notably abundant in the aforementioned human-health compounds, were harvested from flat-leaf 'Lazio' and crinkle-leafed 'Samish' cultivars at peak whole-plant maturity as baby (top- and midcanopy) and larger (lower-canopy) leaves. Leaves were placed as a single layer in commercial, clear-polymer retail boxes and stored at 4 degrees C for up to 9 days under continuous light (26.9 micromol.m(2 ).s) or dark. Top-canopy, baby-leaf spinach generally had higher concentrations of all bioactive compounds, on a dry weight basis, with the exception of carotenoids, than bottom-canopy leaves. All leaves stored under continuous light generally had higher levels of all bioactive compounds, except beta-carotene and violaxanthin, and were more prone to wilting, especially the flat-leafed cultivar. All leaves stored under continuous darkness had declining or unchanged levels of the aforementioned bioactive compounds. Findings from this study revealed that spinach leaves exposed to simulated retail continuous light at 4 degrees C, in clear plastic containers, were overall more nutritionally dense (enriched) than leaves exposed to continuous darkness.

  8. Strong Stability Preserving Explicit Linear Multistep Methods with Variable Step Size

    KAUST Repository

    Hadjimichael, Yiannis; Ketcheson, David I.; Loczi, Lajos; Né meth, Adriá n

    2016-01-01

    Strong stability preserving (SSP) methods are designed primarily for time integration of nonlinear hyperbolic PDEs, for which the permissible SSP step size varies from one step to the next. We develop the first SSP linear multistep methods (of order

  9. Estimation of the size of the female sex worker population in Rwanda using three different methods.

    Science.gov (United States)

    Mutagoma, Mwumvaneza; Kayitesi, Catherine; Gwiza, Aimé; Ruton, Hinda; Koleros, Andrew; Gupta, Neil; Balisanga, Helene; Riedel, David J; Nsanzimana, Sabin

    2015-10-01

    HIV prevalence is disproportionately high among female sex workers compared to the general population. Many African countries lack useful data on the size of female sex worker populations to inform national HIV programmes. A female sex worker size estimation exercise using three different venue-based methodologies was conducted among female sex workers in all provinces of Rwanda in August 2010. The female sex worker national population size was estimated using capture-recapture and enumeration methods, and the multiplier method was used to estimate the size of the female sex worker population in Kigali. A structured questionnaire was also used to supplement the data. The estimated number of female sex workers by the capture-recapture method was 3205 (95% confidence interval: 2998-3412). The female sex worker size was estimated at 3348 using the enumeration method. In Kigali, the female sex worker size was estimated at 2253 (95% confidence interval: 1916-2524) using the multiplier method. Nearly 80% of all female sex workers in Rwanda were found to be based in the capital, Kigali. This study provided a first-time estimate of the female sex worker population size in Rwanda using capture-recapture, enumeration, and multiplier methods. The capture-recapture and enumeration methods provided similar estimates of female sex worker in Rwanda. Combination of such size estimation methods is feasible and productive in low-resource settings and should be considered vital to inform national HIV programmes. © The Author(s) 2015.

  10. Effects of some growth regulating applications on leaf yield, raw ...

    African Journals Online (AJOL)

    This study investigated the effects of repetitive applications of herbagreen (HG), humic acid (HA), combined foliar fertilizer (CFF) and HG+CFF performed in the Müsküle grape variety grafted on 5 BB rootstock on fresh or pickled leaf size and leaf raw cellulose content. HA application increased leaf area and leaf water ...

  11. Fractal analysis of mandibular trabecular bone: optimal tile sizes for the tile counting method.

    Science.gov (United States)

    Huh, Kyung-Hoe; Baik, Jee-Seon; Yi, Won-Jin; Heo, Min-Suk; Lee, Sam-Sun; Choi, Soon-Chul; Lee, Sun-Bok; Lee, Seung-Pyo

    2011-06-01

    This study was performed to determine the optimal tile size for the fractal dimension of the mandibular trabecular bone using a tile counting method. Digital intraoral radiographic images were obtained at the mandibular angle, molar, premolar, and incisor regions of 29 human dry mandibles. After preprocessing, the parameters representing morphometric characteristics of the trabecular bone were calculated. The fractal dimensions of the processed images were analyzed in various tile sizes by the tile counting method. The optimal range of tile size was 0.132 mm to 0.396 mm for the fractal dimension using the tile counting method. The sizes were closely related to the morphometric parameters. The fractal dimension of mandibular trabecular bone, as calculated with the tile counting method, can be best characterized with a range of tile sizes from 0.132 to 0.396 mm.

  12. Optimizing CT radiation dose based on patient size and image quality: the size-specific dose estimate method

    Energy Technology Data Exchange (ETDEWEB)

    Larson, David B. [Stanford University School of Medicine, Department of Radiology, Stanford, CA (United States)

    2014-10-15

    The principle of ALARA (dose as low as reasonably achievable) calls for dose optimization rather than dose reduction, per se. Optimization of CT radiation dose is accomplished by producing images of acceptable diagnostic image quality using the lowest dose method available. Because it is image quality that constrains the dose, CT dose optimization is primarily a problem of image quality rather than radiation dose. Therefore, the primary focus in CT radiation dose optimization should be on image quality. However, no reliable direct measure of image quality has been developed for routine clinical practice. Until such measures become available, size-specific dose estimates (SSDE) can be used as a reasonable image-quality estimate. The SSDE method of radiation dose optimization for CT abdomen and pelvis consists of plotting SSDE for a sample of examinations as a function of patient size, establishing an SSDE threshold curve based on radiologists' assessment of image quality, and modifying protocols to consistently produce doses that are slightly above the threshold SSDE curve. Challenges in operationalizing CT radiation dose optimization include data gathering and monitoring, managing the complexities of the numerous protocols, scanners and operators, and understanding the relationship of the automated tube current modulation (ATCM) parameters to image quality. Because CT manufacturers currently maintain their ATCM algorithms as secret for proprietary reasons, prospective modeling of SSDE for patient populations is not possible without reverse engineering the ATCM algorithm and, hence, optimization by this method requires a trial-and-error approach. (orig.)

  13. Test of methods for retrospective activity size distribution determination from filter samples

    International Nuclear Information System (INIS)

    Meisenberg, Oliver; Tschiersch, Jochen

    2015-01-01

    Determining the activity size distribution of radioactive aerosol particles requires sophisticated and heavy equipment, which makes measurements at large number of sites difficult and expensive. Therefore three methods for a retrospective determination of size distributions from aerosol filter samples in the laboratory were tested for their applicability. Extraction into a carrier liquid with subsequent nebulisation showed size distributions with a slight but correctable bias towards larger diameters compared with the original size distribution. Yields in the order of magnitude of 1% could be achieved. Sonication-assisted extraction into a carrier liquid caused a coagulation mode to appear in the size distribution. Sonication-assisted extraction into the air did not show acceptable results due to small yields. The method of extraction into a carrier liquid without sonication was applied to aerosol samples from Chernobyl in order to calculate inhalation dose coefficients for 137 Cs based on the individual size distribution. The effective dose coefficient is about half of that calculated with a default reference size distribution. - Highlights: • Activity size distributions can be recovered after aerosol sampling on filters. • Extraction into a carrier liquid and subsequent nebulisation is appropriate. • This facilitates the determination of activity size distributions for individuals. • Size distributions from this method can be used for individual dose coefficients. • Dose coefficients were calculated for the workers at the new Chernobyl shelter

  14. Preparation of gold nanoparticles and determination of their particles size via different methods

    Energy Technology Data Exchange (ETDEWEB)

    Iqbal, Muhammad; Usanase, Gisele [University of Lyon, University Lyon-1, CNRS, UMR-5007, LAGEP, F-69622 Villeurbanne (France); Oulmi, Kafia; Aberkane, Fairouz; Bendaikha, Tahar [Laboratory of Chemistry and Environmental Chemistry(LCCE), Faculty of Science, Material Science Department, University of Batna, 05000 (Algeria); Fessi, Hatem [University of Lyon, University Lyon-1, CNRS, UMR-5007, LAGEP, F-69622 Villeurbanne (France); Zine, Nadia [Institut des Sciences Analytiques (ISA), Université Lyon, Université Claude Bernard Lyon-1, UMR-5180, 5 rue de la Doua, F-69100 Villeurbanne (France); Agusti, Géraldine [University of Lyon, University Lyon-1, CNRS, UMR-5007, LAGEP, F-69622 Villeurbanne (France); Errachid, El-Salhi [Institut des Sciences Analytiques (ISA), Université Lyon, Université Claude Bernard Lyon-1, UMR-5180, 5 rue de la Doua, F-69100 Villeurbanne (France); Elaissari, Abdelhamid, E-mail: elaissari@lagep.univ-lyon1.fr [University of Lyon, University Lyon-1, CNRS, UMR-5007, LAGEP, F-69622 Villeurbanne (France)

    2016-07-15

    Graphical abstract: Preparation of gold nanoparticles via NaBH{sub 4} reduction method, and determination of their particle size, size distribution and morphology by using different techniques. - Highlights: • Gold nanoparticles were synthesized by NaBH{sub 4} reduction method. • Excess of reducing agent leads to tendency of aggregation. • The particle size, size distribution and morphology were investigated. • Particle size was determined both experimentally as well as theoretically. - Abstract: Gold nanoparticles have been used in various applications covering both electronics, biosensors, in vivo biomedical imaging and in vitro biomedical diagnosis. As a general requirement, gold nanoparticles should be prepared in large scale, easy to be functionalized by chemical compound of by specific ligands or biomolecules. In this study, gold nanoparticles were prepared by using different concentrations of reducing agent (NaBH{sub 4}) in various formulations and their effect on the particle size, size distribution and morphology was investigated. Moreover, special attention has been dedicated to comparison of particles size measured by various techniques, such as, light scattering, transmission electron microscopy, UV spectrum using standard curve and particles size calculated by using Mie theory and UV spectrum of gold nanoparticles dispersion. Particle size determined by various techniques can be correlated for monodispersed particles and excess of reducing agent leads to increase in the particle size.

  15. Preparation of gold nanoparticles and determination of their particles size via different methods

    International Nuclear Information System (INIS)

    Iqbal, Muhammad; Usanase, Gisele; Oulmi, Kafia; Aberkane, Fairouz; Bendaikha, Tahar; Fessi, Hatem; Zine, Nadia; Agusti, Géraldine; Errachid, El-Salhi; Elaissari, Abdelhamid

    2016-01-01

    Graphical abstract: Preparation of gold nanoparticles via NaBH_4 reduction method, and determination of their particle size, size distribution and morphology by using different techniques. - Highlights: • Gold nanoparticles were synthesized by NaBH_4 reduction method. • Excess of reducing agent leads to tendency of aggregation. • The particle size, size distribution and morphology were investigated. • Particle size was determined both experimentally as well as theoretically. - Abstract: Gold nanoparticles have been used in various applications covering both electronics, biosensors, in vivo biomedical imaging and in vitro biomedical diagnosis. As a general requirement, gold nanoparticles should be prepared in large scale, easy to be functionalized by chemical compound of by specific ligands or biomolecules. In this study, gold nanoparticles were prepared by using different concentrations of reducing agent (NaBH_4) in various formulations and their effect on the particle size, size distribution and morphology was investigated. Moreover, special attention has been dedicated to comparison of particles size measured by various techniques, such as, light scattering, transmission electron microscopy, UV spectrum using standard curve and particles size calculated by using Mie theory and UV spectrum of gold nanoparticles dispersion. Particle size determined by various techniques can be correlated for monodispersed particles and excess of reducing agent leads to increase in the particle size.

  16. Novel joint selection methods can reduce sample size for rheumatoid arthritis clinical trials with ultrasound endpoints.

    Science.gov (United States)

    Allen, John C; Thumboo, Julian; Lye, Weng Kit; Conaghan, Philip G; Chew, Li-Ching; Tan, York Kiat

    2018-03-01

    To determine whether novel methods of selecting joints through (i) ultrasonography (individualized-ultrasound [IUS] method), or (ii) ultrasonography and clinical examination (individualized-composite-ultrasound [ICUS] method) translate into smaller rheumatoid arthritis (RA) clinical trial sample sizes when compared to existing methods utilizing predetermined joint sites for ultrasonography. Cohen's effect size (ES) was estimated (ES^) and a 95% CI (ES^L, ES^U) calculated on a mean change in 3-month total inflammatory score for each method. Corresponding 95% CIs [nL(ES^U), nU(ES^L)] were obtained on a post hoc sample size reflecting the uncertainty in ES^. Sample size calculations were based on a one-sample t-test as the patient numbers needed to provide 80% power at α = 0.05 to reject a null hypothesis H 0 : ES = 0 versus alternative hypotheses H 1 : ES = ES^, ES = ES^L and ES = ES^U. We aimed to provide point and interval estimates on projected sample sizes for future studies reflecting the uncertainty in our study ES^S. Twenty-four treated RA patients were followed up for 3 months. Utilizing the 12-joint approach and existing methods, the post hoc sample size (95% CI) was 22 (10-245). Corresponding sample sizes using ICUS and IUS were 11 (7-40) and 11 (6-38), respectively. Utilizing a seven-joint approach, the corresponding sample sizes using ICUS and IUS methods were nine (6-24) and 11 (6-35), respectively. Our pilot study suggests that sample size for RA clinical trials with ultrasound endpoints may be reduced using the novel methods, providing justification for larger studies to confirm these observations. © 2017 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  17. Sensitivity of Particle Size in Discrete Element Method to Particle Gas Method (DEM_PGM) Coupling in Underbody Blast Simulations

    Science.gov (United States)

    2016-06-12

    Particle Size in Discrete Element Method to Particle Gas Method (DEM_PGM) Coupling in Underbody Blast Simulations Venkatesh Babu, Kumar Kulkarni, Sanjay...buried in soil viz., (1) coupled discrete element & particle gas methods (DEM-PGM) and (2) Arbitrary Lagrangian-Eulerian (ALE), are investigated. The...DEM_PGM and identify the limitations/strengths compared to the ALE method. Discrete Element Method (DEM) can model individual particle directly, and

  18. A quantitative method to the analysis of MLC leaf position and speed based on EPID and EBT3 film for dynamic IMRT treatment with different types of MLC.

    Science.gov (United States)

    Li, Yinghui; Chen, Lixin; Zhu, Jinhan; Wang, Bin; Liu, Xiaowei

    2017-07-01

    A quantitative method based on the electronic portal imaging system (EPID) and film was developed for MLC position and speed testing; this method was used for three MLC types (Millennium, MLCi, and Agility MLC). To determine the leaf position, a picket fence designed by the dynamic (DMLC) model was used. The full-width half-maximum (FWHM) values of each gap measured by EPID and EBT3 were converted to the gap width using the FWHM versus nominal gap width relationship. The algorithm developed for the picket fence analysis was able to quantify the gap width, the distance between gaps, and each individual leaf position. To determine the leaf speed, a 0.5 × 20 cm 2 MLC-defined sliding gap was applied across a 14 × 20 cm 2 symmetry field. The linacs ran at a fixed-dose rate. The use of different monitor units (MUs) for this test led to different leaf speeds. The effect of leaf transmission was considered in a speed accuracy analysis. The difference between the EPID and film results for the MLC position is less than 0.1 mm. For the three MLC types, twice the standard deviation (2 SD) is provided; 0.2, 0.4, and 0.4 mm for gap widths of three MLC types, and 0.1, 0.2, and 0.2 mm for distances between gaps. The individual leaf positions deviate from the preset positions within 0.1 mm. The variations in the speed profiles for the EPID and EBT3 results are consistent, but the EPID results are slightly better than the film results. Different speeds were measured for each MLC type. For all three MLC types, speed errors increase with increasing speed. The analysis speeds deviate from the preset speeds within approximately 0.01 cm s -1 . This quantitative analysis of MLC position and speed provides an intuitive evaluation for MLC quality assurance (QA). © 2017 The Authors. Journal of Applied Clinical Medical Physics published by Wiley Periodicals, Inc. on behalf of American Association of Physicists in Medicine.

  19. Evaluation of assembling methods on determination of whole genome sequence of Xylella fastidiosa blueberry bacterial leaf scorch strain

    Science.gov (United States)

    Blueberry bacterial leaf scorch (BBLS) disease, a threat to blueberry production in the Southern USA and potentially elsewhere, is caused by Xylella fastidiosa. Efficient control of BBLS requires knowledge of the pathogen. However, this is challenging because Xylella fastidiosa is difficult to cultu...

  20. A liposome-based size calibration method for measuring microvesicles by flow cytometry

    DEFF Research Database (Denmark)

    Simonsen, Jens Bæk

    2016-01-01

    BACKGROUND: Over the last years the need for a gold standard to determine the sizes of extracellular vesicles including microvesicles by flow cytometry has been emphasized. METHODS: This work suggests to use artificial vesicles as calibrators to ascertain the size of microvesicles from the side...

  1. Size distributions of micro-bubbles generated by a pressurized dissolution method

    Science.gov (United States)

    Taya, C.; Maeda, Y.; Hosokawa, S.; Tomiyama, A.; Ito, Y.

    2012-03-01

    Size of micro-bubbles is widely distributed in the range of one to several hundreds micrometers and depends on generation methods, flow conditions and elapsed times after the bubble generation. Although a size distribution of micro-bubbles should be taken into account to improve accuracy in numerical simulations of flows with micro-bubbles, a variety of the size distribution makes it difficult to introduce the size distribution in the simulations. On the other hand, several models such as the Rosin-Rammler equation and the Nukiyama-Tanazawa equation have been proposed to represent the size distribution of particles or droplets. Applicability of these models to the size distribution of micro-bubbles has not been examined yet. In this study, we therefore measure size distribution of micro-bubbles generated by a pressurized dissolution method by using a phase Doppler anemometry (PDA), and investigate the applicability of the available models to the size distributions of micro-bubbles. Experimental apparatus consists of a pressurized tank in which air is dissolved in liquid under high pressure condition, a decompression nozzle in which micro-bubbles are generated due to pressure reduction, a rectangular duct and an upper tank. Experiments are conducted for several liquid volumetric fluxes in the decompression nozzle. Measurements are carried out at the downstream region of the decompression nozzle and in the upper tank. The experimental results indicate that (1) the Nukiyama-Tanasawa equation well represents the size distribution of micro-bubbles generated by the pressurized dissolution method, whereas the Rosin-Rammler equation fails in the representation, (2) the bubble size distribution of micro-bubbles can be evaluated by using the Nukiyama-Tanasawa equation without individual bubble diameters, when mean bubble diameter and skewness of the bubble distribution are given, and (3) an evaluation method of visibility based on the bubble size distribution and bubble

  2. Near surface illumination method to detect particle size information by optical calibration free remission measurements

    Science.gov (United States)

    Stocker, Sabrina; Foschum, Florian; Kienle, Alwin

    2017-07-01

    A calibration free method to detect particle size information is presented. A possible application for such measurements is the investigation of raw milk since there not only the fat and protein content varies but also the fat droplet size. The newly developed method is sensitive to the scattering phase function, which makes it applicable to many other applications, too. By simulating the light propagation by use of Monte Carlo simulations, a calibration free device can be developed from this principle.

  3. Optimal plot size in the evaluation of papaya scions: proposal and comparison of methods

    Directory of Open Access Journals (Sweden)

    Humberto Felipe Celanti

    Full Text Available ABSTRACT Evaluating the quality of scions is extremely important and it can be done by characteristics of shoots and roots. This experiment evaluated height of the aerial part, stem diameter, number of leaves, petiole length and length of roots of papaya seedlings. Analyses were performed from a blank trial with 240 seedlings of "Golden Pecíolo Curto". The determination of the optimum plot size was done by applying the methods of maximum curvature, maximum curvature of coefficient of variation and a new proposed method, which incorporates the bootstrap resampling simulation to the maximum curvature method. According to the results obtained, five is the optimal number of seedlings of papaya "Golden Pecíolo Curto" per plot. The proposed method of bootstrap simulation with replacement provides optimal plot sizes equal or higher than the maximum curvature method and provides same plot size than maximum curvature method of the coefficient of variation.

  4. ON ESTIMATION AND HYPOTHESIS TESTING OF THE GRAIN SIZE DISTRIBUTION BY THE SALTYKOV METHOD

    Directory of Open Access Journals (Sweden)

    Yuri Gulbin

    2011-05-01

    Full Text Available The paper considers the problem of validity of unfolding the grain size distribution with the back-substitution method. Due to the ill-conditioned nature of unfolding matrices, it is necessary to evaluate the accuracy and precision of parameter estimation and to verify the possibility of expected grain size distribution testing on the basis of intersection size histogram data. In order to review these questions, the computer modeling was used to compare size distributions obtained stereologically with those possessed by three-dimensional model aggregates of grains with a specified shape and random size. Results of simulations are reported and ways of improving the conventional stereological techniques are suggested. It is shown that new improvements in estimating and testing procedures enable grain size distributions to be unfolded more efficiently.

  5. Production of various sizes and some properties of beryllium pebbles by the rotating electrode method

    Energy Technology Data Exchange (ETDEWEB)

    Iwadachi, T.; Sakamoto, N.; Nishida, K. [NGK Insulators Ltd., Nagoya (Japan); Kawamura, H.

    1998-01-01

    The particle size distribution of beryllium pebbles produced by the rotating electrode method was investigated. Particle size depends on some physical properties and process parameters, which can practicaly be controlled by varying electrode angular velocities. The average particle sizes produced were expressed by the hyperbolic function with electrode angular velocity. Particles within the range of 0.3 and 2.0 mm in diameter are readily produced by the rotating electrode method while those of 0.2 mm in diameter are also fabricable. Sphericity and surface roughness were good in each size of pebble. Grain sizes of the pebbles are 17 {mu} m in 0.25 mm diameter pebbles and 260 {mu} m in 1.8 mm diameter pebbles. (author)

  6. RNA sequencing supports distinct reactive oxygen species-mediated pathways of apoptosis by high and low size mass fractions of Bay leaf (Lauris nobilis) in HT-29 cells.

    Science.gov (United States)

    Rodd, Annabelle L; Ververis, Katherine; Sayakkarage, Dheeshana; Khan, Abdul W; Rafehi, Haloom; Ziemann, Mark; Loveridge, Shanon J; Lazarus, Ross; Kerr, Caroline; Lockett, Trevor; El-Osta, Assam; Karagiannis, Tom C; Bennett, Louise E

    2015-08-01

    Anti-proliferative and pro-apoptotic effects of Bay leaf (Laurus nobilis) in mammalian cancer and HT-29 adenocarcinoma cells have been previously attributed to effects of polyphenolic and essential oil chemical species. Recently, we demonstrated differentiated growth-regulating effects of high (HFBL) versus low molecular mass (LFBL) aqueous fractions of bay leaf and now confirm by comparative effects on gene expression, that HFBL and LFBL suppress HT-29 growth by distinct mechanisms. Induction of intra-cellular lesions including DNA strand breakage by extra-cellular HFBL, invoked the hypothesis that iron-mediated reactive oxygen species with capacity to penetrate cell membrane, were responsible for HFBL-mediated effects, supported by equivalent effects of HFBL in combination with γ radiation. Activities of HFBL and LFBL were interpreted to reflect differentiated responses to iron-mediated reactive oxygen species (ROS), occurring either outside or inside cells. In the presence of LFBL, apoptotic death was relatively delayed compared with HFBL. ROS production by LFBL mediated p53-dependent apoptosis and recovery was suppressed by promoting G1/S phase arrest and failure of cellular tight junctions. In comparison, intra-cellular anti-oxidant protection exerted by LFBL was absent for extra-cellular HFBL (likely polysaccharide-rich), which potentiated more rapid apoptosis by producing DNA double strand breaks. Differentiated effects on expression of genes regulating ROS defense and chromatic condensation by LFBL versus HFBL, were observed. The results support ferrous iron in cell culture systems and potentially in vivo, can invoke different extra-cellular versus intra-cellular ROS-mediated chemistries, that may be regulated by exogenous, including dietary species.

  7. A method for crack sizing using Bayesian inference arising in eddy current testing

    International Nuclear Information System (INIS)

    Kojima, Fumio; Kikuchi, Mitsuhiro

    2008-01-01

    This paper is concerned with a sizing methodology of crack using Bayesian inference arising in eddy current testing. There is often uncertainty about data through quantitative measurements of nondestructive testing and this can yield misleading inference of crack sizing at on-site monitoring. In this paper, we propose optimal strategies of measurements in eddy current testing using Bayesian prior-to-posteriori analysis. First our likelihood functional is given by Gaussian distribution with the measurement model based on the hybrid use of finite and boundary element methods. Secondly, given a priori distributions of crack sizing, we propose a method for estimating the region of interest for sizing cracks. Finally an optimal sensing method is demonstrated using our idea. (author)

  8. Approaches for developing a sizing method for stand-alone PV systems with variable demand

    Energy Technology Data Exchange (ETDEWEB)

    Posadillo, R. [Grupo de Investigacion en Energias y Recursos Renovables, Dpto. de Fisica Aplicada, E.P.S., Universidad de Cordoba, Avda. Menendez Pidal s/n, 14004 Cordoba (Spain); Lopez Luque, R. [Grupo de Investigacion de Fisica para las Energias y Recursos Renovables, Dpto. de Fisica Aplicada. Edificio C2 Campus de Rabanales, 14071 Cordoba (Spain)

    2008-05-15

    Accurate sizing is one of the most important aspects to take into consideration when designing a stand-alone photovoltaic system (SAPV). Various methods, which differ in terms of their simplicity or reliability, have been developed for this purpose. Analytical methods, which seek functional relationships between variables of interest to the sizing problem, are one of these approaches. A series of rational considerations are presented in this paper with the aim of shedding light upon the basic principles and results of various sizing methods proposed by different authors. These considerations set the basis for a new analytical method that has been designed for systems with variable monthly energy demands. Following previous approaches, the method proposed is based on the concept of loss of load probability (LLP) - a parameter that is used to characterize system design. The method includes information on the standard deviation of loss of load probability ({sigma}{sub LLP}) and on two new parameters: annual number of system failures (f) and standard deviation of annual number of failures ({sigma}{sub f}). The method proves useful for sizing a PV system in a reliable manner and serves to explain the discrepancies found in the research on systems with LLP<10{sup -2}. We demonstrate that reliability depends not only on the sizing variables and on the distribution function of solar radiation, but on the minimum value as well, which in a given location and with a monthly average clearness index, achieves total solar radiation on the receiver surface. (author)

  9. Leaf shape responds to temperature but not CO2 in Acer rubrum.

    Science.gov (United States)

    Royer, Dana L

    2012-01-01

    The degree of leaf dissection and the presence of leaf teeth, along with tooth size and abundance, inversely correlate with mean annual temperature (MAT) across many plant communities. These relationships form the core of several methods for reconstructing MAT from fossils, yet the direct selection of temperature on tooth morphology has not been demonstrated experimentally. It is also not known if atmospheric CO(2) concentration affects leaf shape, limiting confidence in ancient climate reconstructions because CO(2) has varied widely on geologic timescales. Here I report the results of growing Acer rubrum (red maple) in growth cabinets at contrasting temperature and CO(2) conditions. The CO(2) treatment imparted no significant differences in leaf size and shape, while plants grown at cooler temperatures tended to have more teeth and more highly dissected leaves. These results provide direct evidence for the selection of temperature on leaf shape in one species, and support a key link in many leaf-climate methods. More broadly, these results increase confidence for using leaf shape in fossils to reconstruct paleoclimate.

  10. A sizing method for stand-alone PV installations with variable demand

    Energy Technology Data Exchange (ETDEWEB)

    Posadillo, R. [Grupo de Investigacion en Energias y Recursos Renovables, Dpto. de Fisica Aplicada, E.P.S., Universidad de Cordoba, Avda. Menendez Pidal s/n, 14004 Cordoba (Spain); Lopez Luque, R. [Grupo de Investigacion de Fisica Para las Energias y Recursos Renovables, Dpto. de Fisica Aplicada, Edificio C2 Campus de Rabanales, 14071 Cordoba (Spain)

    2008-05-15

    The practical applicability of the considerations made in a previous paper to characterize energy balances in stand-alone photovoltaic systems (SAPV) is presented. Given that energy balances were characterized based on monthly estimations, the method is appropriate for sizing installations with variable monthly demands and variable monthly panel tilt (for seasonal estimations). The method presented is original in that it is the only method proposed for this type of demand. The method is based on the rational utilization of daily solar radiation distribution functions. When exact mathematical expressions are not available, approximate empirical expressions can be used. The more precise the statistical characterization of the solar radiation on the receiver module, the more precise the sizing method given that the characterization will solely depend on the distribution function of the daily global irradiation on the tilted surface H{sub g{beta}}{sub i}. This method, like previous ones, uses the concept of loss of load probability (LLP) as a parameter to characterize system design and includes information on the standard deviation of this parameter ({sigma}{sub LLP}) as well as two new parameters: annual number of system failures (f) and the standard deviation of annual number of system failures ({sigma}{sub f}). This paper therefore provides an analytical method for evaluating and sizing stand-alone PV systems with variable monthly demand and panel inclination. The sizing method has also been applied in a practical manner. (author)

  11. Estimating sample size for a small-quadrat method of botanical ...

    African Journals Online (AJOL)

    Reports the results of a study conducted to determine an appropriate sample size for a small-quadrat method of botanical survey for application in the Mixed Bushveld of South Africa. Species density and grass density were measured using a small-quadrat method in eight plant communities in the Nylsvley Nature Reserve.

  12. Prognosis method to predict small-sized breast cancer affected by fibrocystic disease

    Directory of Open Access Journals (Sweden)

    S. A. Velichko

    2017-01-01

    Full Text Available The purpose of the study is to develop an effective radiological symptom-complex of small-sized breast cancer affected by fibrocystic breast disease by using multivariate statistical methods.Materials and methods. Radiological findings of small-sized breast cancer affected by fibrocystic mastopathy were analyzed in 100 patients with histologically verified diagnosis.Results. It was revealed that the conventional approach to the analysis of mammograms based on the detection of the primary, secondary and indirect mammographic signs of small-sized breast cancer is not effective enough - the sensitivity of mammography is only 62%. Fibrocystic disease and moderate-to-severe sclerosing adenosis make small-sized breast cancer hard to visualize by mammography. The detailed analysis of mammograms allowed us to identify the additional manifestations of small-sized breast cancer affected by mastopathy. The computer program allowing us to evaluate the risk of small-size breast cancer and the diagnostic algorithm for detecting small size breast cancer with sensitivity of 92% were developed. 

  13. Iron oxide nanoparticles: the Influence of synthesis method and size on composition and magnetic properties

    International Nuclear Information System (INIS)

    Carvalho, M.D.; Henriques, F.; Ferreira, L.P.; Godinho, M.; Cruz, M.M.

    2013-01-01

    Iron oxide nanoparticles with mean diameter ranging from 7 to 20 nm were synthesized using two routes: the precipitation method in controlled atmosphere and a reduction–precipitation method under air, in some cases followed by a hydrothermal treatment. The smallest nanoparticles were obtained by the reduction–precipitation method. In order to establish the composition of the iron oxide nanoparticles and its relation with size, the morphological, structural and magnetic properties of the prepared samples were investigated using X-ray diffraction, transmission electron microscopy, Mössbauer spectroscopy and SQUID magnetometry. The results allow to conclude that the nanoparticles can be essentially described as Fe 3−x O 4 , x decreasing with the particle size increase. The composition and magnetic behavior of the synthesized iron oxide nanoparticles are directly related with their size. The overall results are compatible with a core@shell structure model, where a magnetite core is surrounded by an oxidized magnetite layer (labeled as maghemite), the magnetite core dimension depending on the average particle size. - Graphical abstract: TEM images and Mössbauer spectroscopy spectra of Fe 3−x O 4 samples with different sizes. Highlights: ► Fe 3−x O 4 nanoparticles with a mean size between 7 and 20 nm were synthesized. ► The smallest nanoparticles were obtained by a reduction precipitation method, under air. ► The increase of particles size was succeeded using a hydrothermal treatment at 150 °C. ► The magnetic properties of the nanoparticles are directly related with their size

  14. Preliminary study of determination of UO2 grain size using X-ray diffraction method

    International Nuclear Information System (INIS)

    Mulyana, T.; Sambodo, G. D.; Juanda, D.; Fatchatul, B.

    1998-01-01

    The determination of UO 2 grain size has accomplished using x-ray diffraction method. The UO 2 powder is obtained from sol-gel process. A copper target as radiation source in the x-ray diffractometer was used in this experiment with CμKα characteristic wavelength 1.54433 Angstrom. The result indicate that the UO 2 mean grain size on presintered (temperature 800 o C) has the value 456.8500 Angstrom and the UO 2 mean grain size on sintered (temperature 1700 o C) has value 651.4934 Angstrom

  15. Comparison of three methods of measuring vertebral heart size in German Shepherd dogs

    International Nuclear Information System (INIS)

    Spasojevic-Kosic, Lj.; Krstic, N.; Trailovic, R.D.

    2007-01-01

    The method of measuring the heart size in thoracic radiography by comparing it to the length of thoracic vertebrae is marked as vertebral heart size (VHS). Besides of the original VHS measurement suggested by Buchanan and Buecheler, there are modifications of these measurements in literature. With the aim to evaluate differences between different methods of VHS measurement, we compared radiographs of six clinically healthy dogs of the same breed and age (German Shepherd dogs, 3 years of age), whose heart size was measured according to three different methods of VHS measurement. There were not significant differences between the values obtained by different methods of VHS measurement. In our study, we also compared findings of radiographs subjective assessment and VHS measurements. The second and third method of measurement were much more consistent to subjective assessment than the first method. Diagnosis of cardiac abnormalities in dgs should not be based solely on the measuremet of vertebral heart size. However, VHS measurement is very suitable for clinical practice. According to the study reported here, the second method of VHS measurement described in this paper, was recommended

  16. A simple method for estimating the size of nuclei on fractal surfaces

    Science.gov (United States)

    Zeng, Qiang

    2017-10-01

    Determining the size of nuclei on complex surfaces remains a big challenge in aspects of biological, material and chemical engineering. Here the author reported a simple method to estimate the size of the nuclei in contact with complex (fractal) surfaces. The established approach was based on the assumptions of contact area proportionality for determining nucleation density and the scaling congruence between nuclei and surfaces for identifying contact regimes. It showed three different regimes governing the equations for estimating the nucleation site density. Nuclei in the size large enough could eliminate the effect of fractal structure. Nuclei in the size small enough could lead to the independence of nucleation site density on fractal parameters. Only when nuclei match the fractal scales, the nucleation site density is associated with the fractal parameters and the size of the nuclei in a coupling pattern. The method was validated by the experimental data reported in the literature. The method may provide an effective way to estimate the size of nuclei on fractal surfaces, through which a number of promising applications in relative fields can be envisioned.

  17. Automatic calibration method of voxel size for cone-beam 3D-CT scanning system

    International Nuclear Information System (INIS)

    Yang Min; Wang Xiaolong; Wei Dongbo; Liu Yipeng; Meng Fanyong; Li Xingdong; Liu Wenli

    2014-01-01

    For a cone-beam three-dimensional computed tomography (3D-CT) scanning system, voxel size is an important indicator to guarantee the accuracy of data analysis and feature measurement based on 3D-CT images. Meanwhile, the voxel size changes with the movement of the rotary stage along X-ray direction. In order to realize the automatic calibration of the voxel size, a new and easily-implemented method is proposed. According to this method, several projections of a spherical phantom are captured at different imaging positions and the corresponding voxel size values are calculated by non-linear least-square fitting. Through these interpolation values, a linear equation is obtained that reflects the relationship between the voxel size and the rotary stage translation distance from its nominal zero position. Finally, the linear equation is imported into the calibration module of the 3D-CT scanning system. When the rotary stage is moving along X-ray direction, the accurate value of the voxel size is dynamically exported. The experimental results prove that this method meets the requirements of the actual CT scanning system, and has virtues of easy implementation and high accuracy. (authors)

  18. Rounded leaf end effect of multileaf collimator on penumbra width and radiation field offset: an analytical and numerical study

    International Nuclear Information System (INIS)

    Zhou, Dong; Zhang, Hui; Ye, Peiqing

    2015-01-01

    Penumbra characteristics play a significant role in dose delivery accuracy for radiation therapy. For treatment planning, penumbra width and radiation field offset strongly influence target dose conformity and organ at risk sparing. In this study, we present an analytical and numerical approach for evaluation of the rounded leaf end effect on penumbra characteristics. Based on the rule of half-value layer, algorithms for leaf position calculation and radiation field offset correction were developed, which were advantageous particularly in dealing with large radius leaf end. Computer simulation was performed based on the Monte Carlo codes of EGSnrc/BEAMnrc, with groups of leaf end radii and source sizes. Data processing technique of curve fitting was employed for deriving penumbra width and radiation field offset. Results showed that penumbra width increased with source size. Penumbra width curves for large radius leaf end were U-shaped. This observation was probably related to the fact that radiation beams penetrated through the proximal and distal leaf sides. In contrast, source size had negligible impact on radiation field offset. Radiation field offsets were found to be constant both for analytical method and numerical simulation. However, the overall resulting values of radiation field offset obtained by analytical method were slightly smaller compared with Monte Carlo simulation. The method we proposed could provide insight into the investigation of rounded leaf end effects on penumbra characteristics. Penumbra width and radiation field offset calibration should be carefully performed to commission multileaf collimator for intensity modulated radiotherapy

  19. Soil Particle Size Analysis by Laser Diffractometry: Result Comparison with Pipette Method

    Science.gov (United States)

    Šinkovičová, Miroslava; Igaz, Dušan; Kondrlová, Elena; Jarošová, Miriam

    2017-10-01

    Soil texture as the basic soil physical property provides a basic information on the soil grain size distribution as well as grain size fraction representation. Currently, there are several methods of particle dimension measurement available that are based on different physical principles. Pipette method based on the different sedimentation velocity of particles with different diameter is considered to be one of the standard methods of individual grain size fraction distribution determination. Following the technical advancement, optical methods such as laser diffraction can be also used nowadays for grain size distribution determination in the soil. According to the literature review of domestic as well as international sources related to this topic, it is obvious that the results obtained by laser diffractometry do not correspond with the results obtained by pipette method. The main aim of this paper was to analyse 132 samples of medium fine soil, taken from the Nitra River catchment in Slovakia, from depths of 15-20 cm and 40-45 cm, respectively, using laser analysers: ANALYSETTE 22 MicroTec plus (Fritsch GmbH) and Mastersizer 2000 (Malvern Instruments Ltd). The results obtained by laser diffractometry were compared with pipette method and the regression relationships using linear, exponential, power and polynomial trend were derived. Regressions with the three highest regression coefficients (R2) were further investigated. The fit with the highest tightness was observed for the polynomial regression. In view of the results obtained, we recommend using the estimate of the representation of the clay fraction (analysis is done according to laser diffractometry. The advantages of laser diffraction method comprise the short analysis time, usage of small sample amount, application for the various grain size fraction and soil type classification systems, and a wide range of determined fractions. Therefore, it is necessary to focus on this issue further to address the

  20. Effects of sample drying and storage, and choice of extraction solvent and analysis method on the yield of birch leaf hydrolyzable tannins.

    Science.gov (United States)

    Salminen, Juha-Pekka

    2003-06-01

    In this study, I investigated the effects of different methods of sample drying and storage, and the choice of extraction solvent and analysis method on the concentrations of 14 individual hydrolyzable tannins (HTs), and insoluble ellagitannins in birch (Betula pubescens) leaves. Freeze- and vacuum-drying of birch leaves were found to provide more reliable results than air- or oven-drying. Storage of leaves at -20 degrees C for 3 months before freeze-drying did not cause major changes in tannin content, although levels of 1,2,3,4,6-penta-O-galloylglucose and isostrictinin were altered. Storage of dried leaf material at -20 degrees C is preferred because 1 year storage of freeze-dried leaves at 4 degrees C and at room temperature decreased the concentration of the pedunculagin derivative, one of the main ellagitannins of birch. Furthermore, storage at room temperature increased the levels of isostrictinin and 2,3-(S)-HHDP-glucose, indicating possible HT catabolism. Of the extraction solvents tested, aqueous acetone was superior to pure acetone, or aqueous or pure methanol. The addition of 0.1% ascorbic acid into 70% acetone significantly increased the yield of ellagitannins. presumably by preventing their oxidation. By comparing the conventional rhodanine assay and the HPLC-ESI-MS assay for quantification of leaf galloylglucoses, the former tends to underestimate total concentrations of galloylglucoses in birch leaf extract. On the basis of the outcomes of all the method and solvent comparisons, their suitability for qualitative and quantitative analysis of plant HTs is discussed, emphasizing that each plant species, with its presumably unique HT composition, is likely to have a unique combination of ideal conditions for tissue preservation and extraction.

  1. Method validation for determination of metals in Vitis labrusca L. grapevine leaf extracts by inductively coupled plasma mass spectrometry (ICP-MS

    Directory of Open Access Journals (Sweden)

    LIANE V.V. BOKOWSKI

    Full Text Available ABSTRACT Vitis labrusca L. is the main species used for wine and juice production in Brazil. The grapevine leaves can be used both as functional foods and as cheapest sources for the extraction of phenolic compounds. Besides the antioxidant activity, grapevine leaves exhibited significant anti-inflammatory activity. Therefore, the aim of this study was to develop and validate an analytical methodology to determine the metals selenium (96Se, chromium (53Cr, nickel (62Ni, cadmium (111Cd and lead (206Pb in 30 samples of grapevine leaf extracts (Vitis labrusca, Bordo cultivar using inductively coupled plasma mass spectrometry (ICP-MS. To obtain the grapevine leaf extracts the samples were milled, weighed and digested in microwave oven with nitric acid. The method showed linearity, precision, accuracy and limits of quantification and detection acceptable for INMETRO protocol validation of analytical methods. Therefore, the method using ICP-MS was developed and validated to determine metals concentrations in grapevine leaves of Vitis labrusca L. and the proposed method could be applied in routine analytical laboratory.

  2. Method for rapid particle size analysis by hydrosizing and nuclear sensing

    International Nuclear Information System (INIS)

    Daellenbach, C.B.; Mahan, W.M.

    1977-01-01

    A method and apparatus to practice the method for rapidly determining the size and mass distribution of a sample of randomly sized particles of a known total mass are described. A series of substantially identical hydrocyclones are connected by conduits to each other and to a temperature controlled water feed. By restricting the cross-sectional areas of these conduits to progressively smaller values, the slurry containing the sample particles is caused to increase its velocity as it moves from hydrocyclone to hydrocyclone. As described by the Stokesian theory which relates particle diameter and settling velocity, the largest sized particles are suspended in the closed apex of the first hydrocyclone with smaller sized particles, in given size ranges, being suspended in the next succeeding hydrocyclone's apexes. In this manner, the particles are separated into discrete fractional sizes with a residual slurry of the very smallest particles being discharged. Before the discrete fractions of particles are suspended in their hydrocyclone apexes, a combined photon source, like a gamma ray source, and detector are calibrated with the water temperature kept constant. When the suspension of particles takes place, an attenuation of the radiation from the source is observed at the detector. This attenuation can be related to the mass or weight of the discrete fractions of suspended particles. Electronic circuitry is used to indicate what this fractional mass or weight is as it relates to the total weight of the sample. 6 claims, 4 figs

  3. Women's Preferences for Penis Size: A New Research Method Using Selection among 3D Models.

    Directory of Open Access Journals (Sweden)

    Nicole Prause

    Full Text Available Women's preferences for penis size may affect men's comfort with their own bodies and may have implications for sexual health. Studies of women's penis size preferences typically have relied on their abstract ratings or selecting amongst 2D, flaccid images. This study used haptic stimuli to allow assessment of women's size recall accuracy for the first time, as well as examine their preferences for erect penis sizes in different relationship contexts. Women (N = 75 selected amongst 33, 3D models. Women recalled model size accurately using this method, although they made more errors with respect to penis length than circumference. Women preferred a penis of slightly larger circumference and length for one-time (length = 6.4 inches/16.3 cm, circumference = 5.0 inches/12.7 cm versus long-term (length = 6.3 inches/16.0 cm, circumference = 4.8 inches/12.2 cm sexual partners. These first estimates of erect penis size preferences using 3D models suggest women accurately recall size and prefer penises only slightly larger than average.

  4. Women's Preferences for Penis Size: A New Research Method Using Selection among 3D Models.

    Science.gov (United States)

    Prause, Nicole; Park, Jaymie; Leung, Shannon; Miller, Geoffrey

    2015-01-01

    Women's preferences for penis size may affect men's comfort with their own bodies and may have implications for sexual health. Studies of women's penis size preferences typically have relied on their abstract ratings or selecting amongst 2D, flaccid images. This study used haptic stimuli to allow assessment of women's size recall accuracy for the first time, as well as examine their preferences for erect penis sizes in different relationship contexts. Women (N = 75) selected amongst 33, 3D models. Women recalled model size accurately using this method, although they made more errors with respect to penis length than circumference. Women preferred a penis of slightly larger circumference and length for one-time (length = 6.4 inches/16.3 cm, circumference = 5.0 inches/12.7 cm) versus long-term (length = 6.3 inches/16.0 cm, circumference = 4.8 inches/12.2 cm) sexual partners. These first estimates of erect penis size preferences using 3D models suggest women accurately recall size and prefer penises only slightly larger than average.

  5. Effect of supercritical fluid density on nanoencapsulated drug particle size using the supercritical antisolvent method.

    Science.gov (United States)

    Kalani, Mahshid; Yunus, Robiah

    2012-01-01

    The reported work demonstrates and discusses the effect of supercritical fluid density (pressure and temperature of supercritical fluid carbon dioxide) on particle size and distribution using the supercritical antisolvent (SAS) method in the purpose of drug encapsulation. In this study, paracetamol was encapsulated inside L-polylactic acid, a semicrystalline polymer, with different process parameters, including pressure and temperature, using the SAS process. The morphology and particle size of the prepared nanoparticles were determined by scanning electron microscopy and transmission electron microscopy. The results revealed that increasing temperature enhanced mean particle size due to the plasticizing effect. Furthermore, increasing pressure enhanced molecular interaction and solubility; thus, particle size was reduced. Transmission electron microscopy images defined the internal structure of nanoparticles. Thermal characteristics of nanoparticles were also investigated via differential scanning calorimetry. Furthermore, X-ray diffraction pattern revealed the changes in crystallinity structure during the SAS process. In vitro drug release analysis determined the sustained release of paracetamol in over 4 weeks.

  6. ASSESSMENT OF KNOWLEDGE REGARDING FAMILY PLANNING METHODS AND INTENDED FAMILY SIZE AMONG MEN OF URBAN SLUM

    Directory of Open Access Journals (Sweden)

    Anand Mohan Dixit

    2013-12-01

    Full Text Available Objective: To assess the knowledge of contraceptive methods and intended family size among the men of urban slum.Material and Method: Present study conducted in urban slum area of Jaipur. Information from 400 married men of age group 18-49 years collected on semi structured schedule during June to October 2012.House to house survey conducted to achieve defined sample size. Data were analyzed by using SPSS 12 soft ware. Chi square, t test and ANOVA were used for interpretation.Result and Conclusion: Most commonly known methods of family planning were female sterilization (95.2%, condom (94.7% and Male sterilization (93.5%.  IUCD (57% was still not popularly known method of contraception. Emergency contraceptive pills (12.2% and Injectables (25.7% were least known methods among men. Knowledge of different contraceptive differs according to educational status and caste of men.  TV and radio were main source of information. Only 16% men said that they got information from health personnel. On analysis present family size was 3.125 while desired family size was 2.63, it shows that two child norm is not ideal to all. Men who had already two children 53 % of them still want to expand their family. Approximately half of the men feel that they have larger family size and the main reasons were inappropriate knowledge (37% and ignorance (21%. Those men who want to expand their family size, son preference was the major reason. Only 3% men show the intention of one child as ideal in family, which indicate that one child norm is too far to reach.

  7. ASSESSMENT OF KNOWLEDGE REGARDING FAMILY PLANNING METHODS AND INTENDED FAMILY SIZE AMONG MEN OF URBAN SLUM

    Directory of Open Access Journals (Sweden)

    Anand Mohan Dixit

    2013-09-01

    Full Text Available Objective: To assess the knowledge of contraceptive methods and intended family size among the men of urban slum.Material and Method: Present study conducted in urban slum area of Jaipur. Information from 400 married men of age group 18-49 years collected on semi structured schedule during June to October 2012.House to house survey conducted to achieve defined sample size. Data were analyzed by using SPSS 12 soft ware. Chi square, t test and ANOVA were used for interpretation.Result and Conclusion: Most commonly known methods of family planning were female sterilization (95.2%, condom (94.7% and Male sterilization (93.5%.  IUCD (57% was still not popularly known method of contraception. Emergency contraceptive pills (12.2% and Injectables (25.7% were least known methods among men. Knowledge of different contraceptive differs according to educational status and caste of men.  TV and radio were main source of information. Only 16% men said that they got information from health personnel. On analysis present family size was 3.125 while desired family size was 2.63, it shows that two child norm is not ideal to all. Men who had already two children 53 % of them still want to expand their family. Approximately half of the men feel that they have larger family size and the main reasons were inappropriate knowledge (37% and ignorance (21%. Those men who want to expand their family size, son preference was the major reason. Only 3% men show the intention of one child as ideal in family, which indicate that one child norm is too far to reach.

  8. Fabrication and Application of Mono-sized Spherical Micro Particles by Pulsated Orifice Ejection Method

    Directory of Open Access Journals (Sweden)

    DONG Wei

    2018-02-01

    Full Text Available A novel technology called pulsated orifice ejection method(POEM and used for preparing mono-sized and high-precision spherical micro particles was introduced in this article. The working principle of the technique was illustrated and it was in two modes:low-melting point diaphragm mode and high-melting point rod mode, depending on the different melting points of materials. The particles prepared by POEM have the advantages of mono-sized, uniform and controllable particle size, high sphericity, and consistent thermal history. By introducing the application of particles prepared by this method, showing the huge application prospects of this technology in electronic packaging, bioengineering, micro-fabrication, rapid solidification analysis of metal droplets, additive manufacturing and so on.With the development of POEM, this technology is predicted to have wider prospects due to its unique characteristics.

  9. An Improved Method for Sizing Standalone Photovoltaic Systems Using Generalized Regression Neural Network

    Directory of Open Access Journals (Sweden)

    Tamer Khatib

    2014-01-01

    Full Text Available In this research an improved approach for sizing standalone PV system (SAPV is presented. This work is an improved work developed previously by the authors. The previous work is based on the analytical method which faced some concerns regarding the difficulty of finding the model’s coefficients. Therefore, the proposed approach in this research is based on a combination of an analytical method and a machine learning approach for a generalized artificial neural network (GRNN. The GRNN assists to predict the optimal size of a PV system using the geographical coordinates of the targeted site instead of using mathematical formulas. Employing the GRNN facilitates the use of a previously developed method by the authors and avoids some of its drawbacks. The approach has been tested using data from five Malaysian sites. According to the results, the proposed method can be efficiently used for SAPV sizing whereas the proposed GRNN based model predicts the sizing curves of the PV system accurately with a prediction error of 0.6%. Moreover, hourly meteorological and load demand data are used in this research in order to consider the uncertainty of the solar energy and the load demand.

  10. CLSM as quantitative method to determine the size of drug crystals in a solid dispersion

    NARCIS (Netherlands)

    de Waard, Hans; Hessels, Martin J T; Boon, Maarten; Sjollema, Klaas A; Hinrichs, Wouter L J; Eissens, Anko C; Frijlink, Henderik W

    2011-01-01

    PURPOSE: To test whether confocal laser scanning microscopy (CLSM) can be used as an analytical tool to determine the drug crystal size in a powder mixture or a crystalline solid dispersion. METHODS: Crystals of the autofluorescent drug dipyridamole were incorporated in a matrix of crystalline

  11. Validation of the Gatortail method for accurate sizing of pulmonary vessels from 3D medical images.

    Science.gov (United States)

    O'Dell, Walter G; Gormaley, Anne K; Prida, David A

    2017-12-01

    Detailed characterization of changes in vessel size is crucial for the diagnosis and management of a variety of vascular diseases. Because clinical measurement of vessel size is typically dependent on the radiologist's subjective interpretation of the vessel borders, it is often prone to high inter- and intra-user variability. Automatic methods of vessel sizing have been developed for two-dimensional images but a fully three-dimensional (3D) method suitable for vessel sizing from volumetric X-ray computed tomography (CT) or magnetic resonance imaging has heretofore not been demonstrated and validated robustly. In this paper, we refined and objectively validated Gatortail, a method that creates a mathematical geometric 3D model of each branch in a vascular tree, simulates the appearance of the virtual vascular tree in a 3D CT image, and uses the similarity of the simulated image to a patient's CT scan to drive the optimization of the model parameters, including vessel size, to match that of the patient. The method was validated with a 2-dimensional virtual tree structure under deformation, and with a realistic 3D-printed vascular phantom in which the diameter of 64 branches were manually measured 3 times each. The phantom was then scanned on a conventional clinical CT imaging system and the images processed with the in-house software to automatically segment and mathematically model the vascular tree, label each branch, and perform the Gatortail optimization of branch size and trajectory. Previously proposed methods of vessel sizing using matched Gaussian filters and tubularity metrics were also tested. The Gatortail method was then demonstrated on the pulmonary arterial tree segmented from a human volunteer's CT scan. The standard deviation of the difference between the manually measured and Gatortail-based radii in the 3D physical phantom was 0.074 mm (0.087 in-plane pixel units for image voxels of dimension 0.85 × 0.85 × 1.0 mm) over the 64 branches

  12. A comparison study of size-specific dose estimate calculation methods

    Energy Technology Data Exchange (ETDEWEB)

    Parikh, Roshni A. [Rainbow Babies and Children' s Hospital, University Hospitals Cleveland Medical Center, Case Western Reserve University School of Medicine, Department of Radiology, Cleveland, OH (United States); University of Michigan Health System, Department of Radiology, Ann Arbor, MI (United States); Wien, Michael A.; Jordan, David W.; Ciancibello, Leslie; Berlin, Sheila C. [Rainbow Babies and Children' s Hospital, University Hospitals Cleveland Medical Center, Case Western Reserve University School of Medicine, Department of Radiology, Cleveland, OH (United States); Novak, Ronald D. [Rainbow Babies and Children' s Hospital, University Hospitals Cleveland Medical Center, Case Western Reserve University School of Medicine, Department of Radiology, Cleveland, OH (United States); Rebecca D. Considine Research Institute, Children' s Hospital Medical Center of Akron, Center for Mitochondrial Medicine Research, Akron, OH (United States); Klahr, Paul [CT Clinical Science, Philips Healthcare, Highland Heights, OH (United States); Soriano, Stephanie [Rainbow Babies and Children' s Hospital, University Hospitals Cleveland Medical Center, Case Western Reserve University School of Medicine, Department of Radiology, Cleveland, OH (United States); University of Washington, Department of Radiology, Seattle, WA (United States)

    2018-01-15

    The size-specific dose estimate (SSDE) has emerged as an improved metric for use by medical physicists and radiologists for estimating individual patient dose. Several methods of calculating SSDE have been described, ranging from patient thickness or attenuation-based (automated and manual) measurements to weight-based techniques. To compare the accuracy of thickness vs. weight measurement of body size to allow for the calculation of the size-specific dose estimate (SSDE) in pediatric body CT. We retrospectively identified 109 pediatric body CT examinations for SSDE calculation. We examined two automated methods measuring a series of level-specific diameters of the patient's body: method A used the effective diameter and method B used the water-equivalent diameter. Two manual methods measured patient diameter at two predetermined levels: the superior endplate of L2, where body width is typically most thin, and the superior femoral head or iliac crest (for scans that did not include the pelvis), where body width is typically most thick; method C averaged lateral measurements at these two levels from the CT projection scan, and method D averaged lateral and anteroposterior measurements at the same two levels from the axial CT images. Finally, we used body weight to characterize patient size, method E, and compared this with the various other measurement methods. Methods were compared across the entire population as well as by subgroup based on body width. Concordance correlation (ρ{sub c}) between each of the SSDE calculation methods (methods A-E) was greater than 0.92 across the entire population, although the range was wider when analyzed by subgroup (0.42-0.99). When we compared each SSDE measurement method with CTDI{sub vol,} there was poor correlation, ρ{sub c}<0.77, with percentage differences between 20.8% and 51.0%. Automated computer algorithms are accurate and efficient in the calculation of SSDE. Manual methods based on patient thickness provide

  13. Size-controlled fluorescent nanodiamonds: A facile method of fabrication and color-center counting

    KAUST Repository

    Mahfouz, Remi

    2013-01-01

    We present a facile method for the production of fluorescent diamond nanocrystals (DNCs) of different sizes and efficiently quantify the concentration of emitting defect color centers (DCCs) of each DNC size. We prepared the DNCs by ball-milling commercially available micrometer-sized synthetic (high pressure, high temperature (HPHT)) diamonds and then separated the as-produced DNCs by density gradient ultracentrifugation (DGU) into size-controlled fractions. A protocol to enhance the uniformity of the nitrogen-vacancy (NV) centers in the diamonds was devised by depositing the DNCs as a dense monolayer on amino-silanized silicon substrates and then subjecting the monolayer to He+ beam irradiation. Using a standard confocal setup, we analyzed the average number of NV centers per crystal, and obtained a quantitative relationship between the DNC particle size and the NV number per crystal. This relationship was in good agreement with results from previous studies that used more elaborate setups. Our findings suggest that nanocrystal size separation by DGU may be used to control the number of defects per nanocrystal. The efficient approaches described herein to control and quantify DCCs are valuable to researchers as they explore applications for color centers and new strategies to create them. © 2013 The Royal Society of Chemistry.

  14. Evaluating unsupervised methods to size and classify suspended particles using digital in-line holography

    Science.gov (United States)

    Davies, Emlyn J.; Buscombe, Daniel D.; Graham, George W.; Nimmo-Smith, W. Alex M.

    2015-01-01

    Substantial information can be gained from digital in-line holography of marine particles, eliminating depth-of-field and focusing errors associated with standard lens-based imaging methods. However, for the technique to reach its full potential in oceanographic research, fully unsupervised (automated) methods are required for focusing, segmentation, sizing and classification of particles. These computational challenges are the subject of this paper, in which we draw upon data collected using a variety of holographic systems developed at Plymouth University, UK, from a significant range of particle types, sizes and shapes. A new method for noise reduction in reconstructed planes is found to be successful in aiding particle segmentation and sizing. The performance of an automated routine for deriving particle characteristics (and subsequent size distributions) is evaluated against equivalent size metrics obtained by a trained operative measuring grain axes on screen. The unsupervised method is found to be reliable, despite some errors resulting from over-segmentation of particles. A simple unsupervised particle classification system is developed, and is capable of successfully differentiating sand grains, bubbles and diatoms from within the surf-zone. Avoiding miscounting bubbles and biological particles as sand grains enables more accurate estimates of sand concentrations, and is especially important in deployments of particle monitoring instrumentation in aerated water. Perhaps the greatest potential for further development in the computational aspects of particle holography is in the area of unsupervised particle classification. The simple method proposed here provides a foundation upon which further development could lead to reliable identification of more complex particle populations, such as those containing phytoplankton, zooplankton, flocculated cohesive sediments and oil droplets.

  15. Sizing of Compression Coil Springs Gas Regulators Using Modern Methods CAD and CAE

    Directory of Open Access Journals (Sweden)

    Adelin Ionel Tuţă

    2010-10-01

    Full Text Available This paper presents a method for compression coil springs sizing by gas regulators composition, using CAD techniques (Computer Aided Design and CAE (Computer Aided Engineering. Sizing is to optimize the functioning of the regulators under dynamic industrial and house-hold. Gas regulator is a device that automatically and continuously adjusted to maintain pre-set limits on output gas pressure at varying flow and input pressure. The performances of the pressure regulators like automatic systems depend on their behaviour under dynamic opera-tion. Time constant optimization of pneumatic actuators, which drives gas regulators, leads to a better functioning under their dynamic.

  16. Standalone Photovoltaic System Sizing using Peak Sun Hour Method and Evaluation by TRNSYS Simulation

    OpenAIRE

    Riza, Dimas Firmanda Al; Gilani, Syed Ihtshamul-Haq

    2016-01-01

    This paper presents sizing and evaluation of a standalone photovoltaic system for residential load. Peak Sun Hour method is used to determine photovoltaic panel and battery capacity, then the sizing results is tested and evaluated using hourly time-step transient simulation model by using TRNSYS 16.0. The results shows for typical Malaysian terraced house that have about 6 kWh daily electricity load, the photovoltaic system requirement consist of 1.9 kWp photovoltaic panel and 2200 Ah battery...

  17. Leveraging multiple datasets for deep leaf counting

    OpenAIRE

    Dobrescu, Andrei; Giuffrida, Mario Valerio; Tsaftaris, Sotirios A

    2017-01-01

    The number of leaves a plant has is one of the key traits (phenotypes) describing its development and growth. Here, we propose an automated, deep learning based approach for counting leaves in model rosette plants. While state-of-the-art results on leaf counting with deep learning methods have recently been reported, they obtain the count as a result of leaf segmentation and thus require per-leaf (instance) segmentation to train the models (a rather strong annotation). Instead, our method tre...

  18. A Method of MPPT Control Based on Power Variable Step-size in Photovoltaic Converter System

    Directory of Open Access Journals (Sweden)

    Xu Hui-xiang

    2016-01-01

    Full Text Available Since the disadvantage of traditional MPPT algorithms of variable step-size, proposed power tracking based on variable step-size with the advantage method of the constant-voltage and the perturb-observe (P&O[1-3]. The control strategy modify the problem of voltage fluctuation caused by perturb-observe method, at the same time, introducing the advantage of constant-voltage method and simplify the circuit topology. With the theoretical derivation, control the output power of photovoltaic modules to change the duty cycle of main switch. Achieve the maximum power stabilization output, reduce the volatility of energy loss effectively, and improve the inversion efficiency[3,4]. Given the result of experimental test based theoretical derivation and the curve of MPPT when the prototype work.

  19. a New Method for Calculating Fractal Dimensions of Porous Media Based on Pore Size Distribution

    Science.gov (United States)

    Xia, Yuxuan; Cai, Jianchao; Wei, Wei; Hu, Xiangyun; Wang, Xin; Ge, Xinmin

    Fractal theory has been widely used in petrophysical properties of porous rocks over several decades and determination of fractal dimensions is always the focus of researches and applications by means of fractal-based methods. In this work, a new method for calculating pore space fractal dimension and tortuosity fractal dimension of porous media is derived based on fractal capillary model assumption. The presented work establishes relationship between fractal dimensions and pore size distribution, which can be directly used to calculate the fractal dimensions. The published pore size distribution data for eight sandstone samples are used to calculate the fractal dimensions and simultaneously compared with prediction results from analytical expression. In addition, the proposed fractal dimension method is also tested through Micro-CT images of three sandstone cores, and are compared with fractal dimensions by box-counting algorithm. The test results also prove a self-similar fractal range in sandstone when excluding smaller pores.

  20. Tooth-size discrepancy: A comparison between manual and digital methods

    Directory of Open Access Journals (Sweden)

    Gabriele Dória Cabral Correia

    2014-08-01

    Full Text Available INTRODUCTION: Technological advances in Dentistry have emerged primarily in the area of diagnostic tools. One example is the 3D scanner, which can transform plaster models into three-dimensional digital models. OBJECTIVE: This study aimed to assess the reliability of tooth size-arch length discrepancy analysis measurements performed on three-dimensional digital models, and compare these measurements with those obtained from plaster models. MATERIAL AND METHODS: To this end, plaster models of lower dental arches and their corresponding three-dimensional digital models acquired with a 3Shape R700T scanner were used. All of them had lower permanent dentition. Four different tooth size-arch length discrepancy calculations were performed on each model, two of which by manual methods using calipers and brass wire, and two by digital methods using linear measurements and parabolas. RESULTS: Data were statistically assessed using Friedman test and no statistically significant differences were found between the two methods (P > 0.05, except for values found by the linear digital method which revealed a slight, non-significant statistical difference. CONCLUSIONS: Based on the results, it is reasonable to assert that any of these resources used by orthodontists to clinically assess tooth size-arch length discrepancy can be considered reliable.

  1. Facile method for liquid-exfoliated graphene size prediction by UV-visible spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Ismail, Zulhelmi, E-mail: helmie83@hotmail.com [Faculty of Manufacturing Engineering, Universiti Malaysia Pahang, 26600 Pekan, Pahang (Malaysia); Yusoh, Kamal, E-mail: kamal@ump.edu.my [Faculty of Chemical Engineering and Natural Resources, Universiti Malaysia Pahang, Lebuhraya Tun Razak, 26300 Kuantan, Pahang (Malaysia)

    2016-07-19

    In this work, an application of UV spectroscopy for facile prediction of liquid –exfoliated graphene size is discussed. Dynamic light scattering method was used to estimate the graphene flake size ( whilst UV spectroscopy measurement was carried out for extinction coefficient value (ε) determination. It was found that the value of (ε) decreased gradually as the graphene size was further reduced after intense sonication time (7h). This observation showed the influence of sonication time on electronic structure of graphene. A mathematical equation was derived from log-log graph for correlation between () and (ε) value. Both values can be expressed in a single equation as ( = (3.4 × 10{sup −2}) ε{sup 1.2}).

  2. Easy Leaf Area: Automated Digital Image Analysis for Rapid and Accurate Measurement of Leaf Area

    Directory of Open Access Journals (Sweden)

    Hsien Ming Easlon

    2014-07-01

    Full Text Available Premise of the study: Measurement of leaf areas from digital photographs has traditionally required significant user input unless backgrounds are carefully masked. Easy Leaf Area was developed to batch process hundreds of Arabidopsis rosette images in minutes, removing background artifacts and saving results to a spreadsheet-ready CSV file. Methods and Results: Easy Leaf Area uses the color ratios of each pixel to distinguish leaves and calibration areas from their background and compares leaf pixel counts to a red calibration area to eliminate the need for camera distance calculations or manual ruler scale measurement that other software methods typically require. Leaf areas estimated by this software from images taken with a camera phone were more accurate than ImageJ estimates from flatbed scanner images. Conclusions: Easy Leaf Area provides an easy-to-use method for rapid measurement of leaf area and nondestructive estimation of canopy area from digital images.

  3. Accuracy of various impression materials and methods for two implant systems: An effect size study.

    Science.gov (United States)

    Schmidt, Alexander; Häussling, Teresa; Rehmann, Peter; Schaaf, Heidrun; Wöstmann, Bernd

    2018-04-01

    An accurate impression is required for implant treatment. The aim of this in-vitro study was to determine the effect size of the impression material/method, implant system and implant angulation on impression transfer precision. An upper jaw model with three BEGO and three Straumann implants (angulations 0°, 15°, 20°) in the left and right maxilla was used as a reference model. One polyether (Impregum Penta) and two polyvinyl siloxanes (Flexitime Monophase/Aquasil Ultra Monophase) were examined with two impression techniques (open and closed tray). A total of 60 impressions were made. A coordinate measurement machine was used to measure the target variables for 3D-shift, implant axis inclination and implant axis rotation. All the data were subjected to a four-way ANOVA. The effect size (partial eta-squared [η 2 P ]) was reported. The impression material had a significant influence on the 3D shift and the implant axis inclination deviation (p-values=.000), and both factors had very large effect sizes (3D-shift [η 2 P ]=.599; implant axis inclination [η 2 P ]=.298). Impressions made with polyvinyl siloxane exhibited the highest transfer precision. When the angulation of the implants was larger, more deviations occurred for the implant axis rotational deviation. The implant systems and impression methods showed partially significant variations (p-values=.001-.639) but only very small effect sizes (η 2 P =.001-.031). The impression material had the greatest effect size on accuracy in terms of the 3D shift and the implant axis inclination. For multiunit restorations with disparallel implants, polyvinyl siloxane materials should be considered. In addition, the effect size of a multivariate investigation should be reported. Copyright © 2017 Japan Prosthodontic Society. Published by Elsevier Ltd. All rights reserved.

  4. Leaf blade and petiole nutritional diagnosis for Vitis vinifera L. cv. 'Tempranillo' by deviation from optimum percentage method

    Energy Technology Data Exchange (ETDEWEB)

    Romero, I.; Benito, A.; Dominguez, N.; Garcia-Escudero, E.

    2014-06-01

    Deviation from optimum percentage (DOP) is a diagnosis methodology for leaf analyses which expresses the deviation for each element with respect to its optimal concentration. This deviation is an individual index for each nutrient and allows the sorting of all the analyzed nutrients according to their limitations. A nutritional survey was undertaken over eleven years in La Rioja (Spain), to establish reference concentrations for the nutritional diagnosis of Vitis vinifera L., cv. 'Tempranillo' grafted on Richter-110. Reference concentrations for DOP methodology are proposed, and sensibility for the nutritional diagnosis was evaluated for blade and petiole analysis of N, P, K, Ca, Mg, Fe, Mn, Zn, Cu, and B at flowering and veraison phenological stages by comparison between DOP and sufficiency ranges (SR) methods. Results suggest that petiole has lower sensibility than blade to detect deficiencies or excesses of N, P, K, Ca, Mg, Zn, and Mn at veraison. In addition, petiole is a better tissue than blade to detect Fe and B deficiencies or excesses. Therefore, our results make possible the right choice between tissues, leaf blade or petiole, for a general nutritional diagnosis of 'Tempranillo' grapevines. On the other hand, it is possible to evaluate the status of each nutrient in each phonological stage analyzing both tissues and comparing the nutrient status to its references, DOP or SR, in the most adequate tissue. (Author)

  5. Processing surface sizing starch using oxidation, enzymatic hydrolysis and ultrasonic treatment methods--Preparation and application.

    Science.gov (United States)

    Brenner, Tobias; Kiessler, Birgit; Radosta, Sylvia; Arndt, Tiemo

    2016-03-15

    The surface application of starch is a well-established method for increasing paper strength. In surface sizing, a solution of degraded starch is applied to the paper. Two procedures have proved valuable for starch degradation in the paper mill: enzymatic and thermo-oxidative degradation. The objective of this study was to determine achievable efficiencies of cavitation in preparing degraded starch for surface application on paper. It was found that ultrasonic-assisted starch degradation can provide a starch solution that is suitable for surface sizing. The molecular composition of starch solutions prepared by ultrasonic treatment differed from that of starch solutions degraded by enzymes or by thermo-oxidation. Compared to commercial degradation processes, this resulted in intensified film formation and in greater penetration during surface sizing and ultimately in a higher starch content of the paper. Paper sized with ultrasonically treated starch solutions show the same strength properties compared to commercially sized paper. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Influence of Sample Size on Automatic Positional Accuracy Assessment Methods for Urban Areas

    Directory of Open Access Journals (Sweden)

    Francisco J. Ariza-López

    2018-05-01

    Full Text Available In recent years, new approaches aimed to increase the automation level of positional accuracy assessment processes for spatial data have been developed. However, in such cases, an aspect as significant as sample size has not yet been addressed. In this paper, we study the influence of sample size when estimating the planimetric positional accuracy of urban databases by means of an automatic assessment using polygon-based methodology. Our study is based on a simulation process, which extracts pairs of homologous polygons from the assessed and reference data sources and applies two buffer-based methods. The parameter used for determining the different sizes (which range from 5 km up to 100 km has been the length of the polygons’ perimeter, and for each sample size 1000 simulations were run. After completing the simulation process, the comparisons between the estimated distribution functions for each sample and population distribution function were carried out by means of the Kolmogorov–Smirnov test. Results show a significant reduction in the variability of estimations when sample size increased from 5 km to 100 km.

  7. Sample size methods for estimating HIV incidence from cross-sectional surveys.

    Science.gov (United States)

    Konikoff, Jacob; Brookmeyer, Ron

    2015-12-01

    Understanding HIV incidence, the rate at which new infections occur in populations, is critical for tracking and surveillance of the epidemic. In this article, we derive methods for determining sample sizes for cross-sectional surveys to estimate incidence with sufficient precision. We further show how to specify sample sizes for two successive cross-sectional surveys to detect changes in incidence with adequate power. In these surveys biomarkers such as CD4 cell count, viral load, and recently developed serological assays are used to determine which individuals are in an early disease stage of infection. The total number of individuals in this stage, divided by the number of people who are uninfected, is used to approximate the incidence rate. Our methods account for uncertainty in the durations of time spent in the biomarker defined early disease stage. We find that failure to account for this uncertainty when designing surveys can lead to imprecise estimates of incidence and underpowered studies. We evaluated our sample size methods in simulations and found that they performed well in a variety of underlying epidemics. Code for implementing our methods in R is available with this article at the Biometrics website on Wiley Online Library. © 2015, The International Biometric Society.

  8. Size matters: insights from an allometric approach to evaluate control methods for invasive Australian Rhinella marina.

    Science.gov (United States)

    Beaty, Lynne E; Salice, Christopher J

    2013-10-01

    Invasive species are costly and difficult to control. In order to gain a mechanistic understanding of potential control measures, individual-based models uniquely parameterized to reflect the salient life-history characteristics of invasive species are useful. Using invasive Australian Rhinella marina as a case study, we constructed a cohort- and individual-based population simulation that incorporates growth and body size of terrestrial stages. We used this allometric approach to examine the efficacy of nontraditional control methods (i.e., tadpole alarm chemicals and native meat ants) that may have indirect effects on population dynamics mediated by effects on body size. We compared population estimates resulting from these control methods with traditional hand removal. We also conducted a sensitivity analysis to investigate the effect that model parameters, specifically those associated with growth and body size, had on adult population estimates. Incremental increases in hand removal of adults and juveniles caused nonlinear decreases in adult population estimates, suggesting less return with increased investment in hand-removal efforts. Applying tadpole alarm chemicals or meat ants decreased adult population estimates on the same level as removing 15-25% of adults and juveniles by hand. The combined application of tadpole alarm chemicals and meat ants resulted in approximately 80% decrease in adult abundance, the largest of any applied control method. In further support of the nontraditional control methods, which greatly affected the metamorph stage, our model was most sensitive to changes in metamorph survival, juvenile survival, metamorph growth rate, and adult survival. Our results highlight the use and insights that can be gained from individual-based models that incorporate growth and body size and the potential success that nontraditional control methods could have in controlling established, invasive Rhinella marina populations.

  9. Why do leaf-tying caterpillars abandon their leaf ties?

    Directory of Open Access Journals (Sweden)

    Michelle Sliwinski

    2013-09-01

    Full Text Available Leaf-tying caterpillars act as ecosystem engineers by building shelters between overlapping leaves, which are inhabited by other arthropods. Leaf-tiers have been observed to leave their ties and create new shelters (and thus additional microhabitats, but the ecological factors affecting shelter fidelity are poorly known. For this study, we explored the effects of resource limitation and occupant density on shelter fidelity and assessed the consequences of shelter abandonment. We first quantified the area of leaf material required for a caterpillar to fully develop for two of the most common leaf-tiers that feed on white oak, Quercus alba. On average, Psilocorsis spp. caterpillars consumed 21.65 ± 0.67 cm2 leaf material to complete development. We also measured the area of natural leaf ties found in a Maryland forest, to determine the distribution of resources available to caterpillars in situ. Of 158 natural leaf ties examined, 47% were too small to sustain an average Psilocorsis spp. caterpillar for the entirety of its development. We also manipulated caterpillar densities within experimental ties on potted trees to determine the effects of cohabitants on the likelihood of a caterpillar to leave its tie. We placed 1, 2, or 4 caterpillars in ties of a standard size and monitored the caterpillars twice daily to track their movement. In ties with more than one occupant, caterpillars showed a significantly greater propensity to leave their tie, and left sooner and at a faster rate than those in ties as single occupants. To understand the consequences of leaf tie abandonment, we observed caterpillars searching a tree for a site to build a shelter in the field. This is a risky behavior, as 17% of the caterpillars observed died while searching for a shelter site. Caterpillars that successfully built a shelter traveled 110 ± 20 cm and took 28 ± 7 min to find a suitable site to build a shelter. In conclusion, leaf-tying caterpillars must frequently

  10. Features of digital photogrammetry methods application and image processing in small and medium-sized enterprises

    Directory of Open Access Journals (Sweden)

    Samsonova N. V.

    2018-05-01

    Full Text Available the paper discusses the methods of survey enterprises employees effective training to use modern measurement systems and the need for further photogrammetric processing of the results obtained. Attention is also paid to integrated learning, based primarily on web content, the introduction of a social component in the development and familiarization with new photogrammetric equipment and technologies in order to increase the competitiveness of engineering and research small and medium-sized enterprises.

  11. Study of crystallite size of yttria-stabilized zirconia powders by Rietveld method

    International Nuclear Information System (INIS)

    Leite, Wellington Claiton; Brinatti, Andre Mauricio; Ribeiro, Mauricio Aparecido; Andrade, Andre Vitor Chaves de; Chinelatto, Adriana Scoton Antonio; Chinelatto, Adilson Luiz

    2009-01-01

    The yttria-stabilized zirconia (YSZ) is used in a great variety of applications, for example, electrolytes of solid oxide fuel cells and oxygen sensors. In the study of YSZ, the particle size powders and sintering processes are important to define the final properties of the zirconia products. The objectives of this work were to determine the phases and the crystalline size using X-Ray Diffraction (XRD) data and the Rietveld Method (RM) of the YSZ powders obtained by chemical synthesis based on the Pechini method. It was used ZrOCl 2.8 H 2 O and Y(NO 3 ) 3.5 H 2 O as precursors reagents. After calcination at 550 deg C during 24 hours, the powder was analyzed by XRD and scanning electronic microscopy (SEM). From XRD and using Rietveld method were verified that there is only cubic phase with lattice parameter a = 5.1307(1) Å and the space group Fm3m. Due to substitution of the Zr atoms in the Y atoms sites, there were vacancies in 17.72 % of O atoms sites. However, the percentage of substitution of Zr atoms in Y atoms sites in the structure not was determinate because the curves of atomic scattering of them are very similar. Using Scherrer equation and considering anisotropy effect, the average crystalline size was determinate: 10,43 nm (c axis) and 10,39 (b axis). This spherical symmetry also observed for SEM. (author)

  12. Numerical sedimentation particle-size analysis using the Discrete Element Method

    Science.gov (United States)

    Bravo, R.; Pérez-Aparicio, J. L.; Gómez-Hernández, J. J.

    2015-12-01

    Sedimentation tests are widely used to determine the particle size distribution of a granular sample. In this work, the Discrete Element Method interacts with the simulation of flow using the well known one-way-coupling method, a computationally affordable approach for the time-consuming numerical simulation of the hydrometer, buoyancy and pipette sedimentation tests. These tests are used in the laboratory to determine the particle-size distribution of fine-grained aggregates. Five samples with different particle-size distributions are modeled by about six million rigid spheres projected on two-dimensions, with diameters ranging from 2.5 ×10-6 m to 70 ×10-6 m, forming a water suspension in a sedimentation cylinder. DEM simulates the particle's movement considering laminar flow interactions of buoyant, drag and lubrication forces. The simulation provides the temporal/spatial distributions of densities and concentrations of the suspension. The numerical simulations cannot replace the laboratory tests since they need the final granulometry as initial data, but, as the results show, these simulations can identify the strong and weak points of each method and eventually recommend useful variations and draw conclusions on their validity, aspects very difficult to achieve in the laboratory.

  13. A New, Simple Method for Estimating Pleural Effusion Size on CT Scans

    Science.gov (United States)

    Moy, Matthew P.; Berko, Netanel S.; Godelman, Alla; Jain, Vineet R.; Haramati, Linda B.

    2013-01-01

    Background: There is no standardized system to grade pleural effusion size on CT scans. A validated, systematic grading system would improve communication of findings and may help determine the need for imaging guidance for thoracentesis. Methods: CT scans of 34 patients demonstrating a wide range of pleural effusion sizes were measured with a volume segmentation tool and reviewed for qualitative and simple quantitative features related to size. A classification rule was developed using the features that best predicted size and distinguished among small, moderate, and large effusions. Inter-reader agreement for effusion size was assessed on the CT scans for three groups of physicians (radiology residents, pulmonologists, and cardiothoracic radiologists) before and after implementation of the classification rule. Results: The CT imaging features found to best classify effusions as small, moderate, or large were anteroposterior (AP) quartile and maximum AP depth measured at the midclavicular line. According to the decision rule, first AP-quartile effusions are small, second AP-quartile effusions are moderate, and third or fourth AP-quartile effusions are large. In borderline cases, AP depth is measured with 3-cm and 10-cm thresholds for the upper limit of small and moderate, respectively. Use of the rule improved interobserver agreement from κ = 0.56 to 0.79 for all physicians, 0.59 to 0.73 for radiology residents, 0.54 to 0.76 for pulmonologists, and 0.74 to 0.85 for cardiothoracic radiologists. Conclusions: A simple, two-step decision rule for sizing pleural effusions on CT scans improves interobserver agreement from moderate to substantial levels. PMID:23632863

  14. Easy Leaf Area: Automated digital image analysis for rapid and accurate measurement of leaf area.

    Science.gov (United States)

    Easlon, Hsien Ming; Bloom, Arnold J

    2014-07-01

    Measurement of leaf areas from digital photographs has traditionally required significant user input unless backgrounds are carefully masked. Easy Leaf Area was developed to batch process hundreds of Arabidopsis rosette images in minutes, removing background artifacts and saving results to a spreadsheet-ready CSV file. • Easy Leaf Area uses the color ratios of each pixel to distinguish leaves and calibration areas from their background and compares leaf pixel counts to a red calibration area to eliminate the need for camera distance calculations or manual ruler scale measurement that other software methods typically require. Leaf areas estimated by this software from images taken with a camera phone were more accurate than ImageJ estimates from flatbed scanner images. • Easy Leaf Area provides an easy-to-use method for rapid measurement of leaf area and nondestructive estimation of canopy area from digital images.

  15. Relation between Silver Nanoparticle Formation Rate and Antioxidant Capacity of Aqueous Plant Leaf Extracts

    Directory of Open Access Journals (Sweden)

    Azat Akbal

    2016-01-01

    Full Text Available Correlation between the antioxidant capacity and silver nanoparticle formation rates of pomegranate (Punica granatum, quince (Cydonia oblonga, chestnut (Castanea sativa, fig (Ficus carica, walnut (Juglans cinerea, black mulberry (Morus nigra, and white mulberry (Morus alba leaf extracts is investigated at a fixed illumination. Silver nanoparticles formed in all plant leaf extracts possess round shapes with average particle size of 15 to 25 nm, whereas corresponding surface plasmon resonance peak wavelengths vary between 422 nm and 451 nm. Cupric reducing antioxidant capacity technique is used as a reference method to determine total antioxidant capacity of the plant leaf extracts. Integrated absorbance over the plasmon resonance peaks exhibits better linear relation with antioxidant capacities of various plant leaf extracts compared to peak absorbance values, with correlation coefficient values of 0.9333 and 0.7221, respectively.

  16. Comparative analysis of non-destructive methods to control fissile materials in large-size containers

    Directory of Open Access Journals (Sweden)

    Batyaev V.F.

    2017-01-01

    Full Text Available The analysis of various non-destructive methods to control fissile materials (FM in large-size containers filled with radioactive waste (RAW has been carried out. The difficulty of applying passive gamma-neutron monitoring FM in large containers filled with concreted RAW is shown. Selection of an active non-destructive assay technique depends on the container contents; and in case of a concrete or iron matrix with very low activity and low activity RAW the neutron radiation method appears to be more preferable as compared with the photonuclear one.

  17. Comparative analysis of non-destructive methods to control fissile materials in large-size containers

    Science.gov (United States)

    Batyaev, V. F.; Sklyarov, S. V.

    2017-09-01

    The analysis of various non-destructive methods to control fissile materials (FM) in large-size containers filled with radioactive waste (RAW) has been carried out. The difficulty of applying passive gamma-neutron monitoring FM in large containers filled with concreted RAW is shown. Selection of an active non-destructive assay technique depends on the container contents; and in case of a concrete or iron matrix with very low activity and low activity RAW the neutron radiation method appears to be more preferable as compared with the photonuclear one. Note to the reader: the pdf file has been changed on September 22, 2017.

  18. Leaf absorbance and photosynthesis

    Science.gov (United States)

    Schurer, Kees

    1994-01-01

    The absorption spectrum of a leaf is often thought to contain some clues to the photosynthetic action spectrum of chlorophyll. Of course, absorption of photons is needed for photosynthesis, but the reverse, photosynthesis when there is absorption, is not necessarily true. As a check on the existence of absorption limits we measured spectra for a few different leaves. Two techniques for measuring absorption have been used, viz. the separate determination of the diffuse reflectance and the diffuse transmittance with the leaf at a port of an integrating sphere and the direct determination of the non-absorbed fraction with the leaf in the sphere. In a cross-check both methods yielded the same results for the absorption spectrum. The spectrum of a Fuchsia leaf, covering the short-wave region from 350 to 2500 nm, shows a high absorption in UV, blue and red, the well known dip in the green and a steep fall-off at 700 nm. Absorption drops to virtually zero in the near infrared, with subsequent absorptions, corresponding to the water absorption bands. In more detailed spectra, taken at 5 nm intervals with a 5 nm bandwidth, differences in chlorophyll content show in the different depths of the dip around 550 nm and in a small shift of the absorption edge at 700 nm. Spectra for Geranium (Pelargonium zonale) and Hibiscus (with a higher chlorophyll content) show that the upper limit for photosynthesis can not be much above 700 nm. No evidence, however, is to be seen of a lower limit for photosynthesis and, in fact, some experiments down to 300 nm still did not show a decrease of the absorption although it is well recognized that no photosynthesis results with 300 nm wavelengths.

  19. Leaf area compounds height-related hydraulic costs of water transport in Oregon White Oak trees.

    Science.gov (United States)

    N. Phillips; B. J. Bond; N. G. McDowell; Michael G. Ryan; A. Schauer

    2003-01-01

    The ratio of leaf to sapwood area generally decreases with tree size, presumably to moderate hydraulic costs of tree height. This study assessed consequences of tree size and leaf area on water flux in Quercus garryana Dougl. ex. Hook (Oregon White Oak), a species in which leaf to sapwood area ratio increases with tree size. We tested hypotheses that...

  20. Biophysical control of leaf temperature

    Science.gov (United States)

    Dong, N.; Prentice, I. C.; Wright, I. J.

    2014-12-01

    In principle sunlit leaves can maintain their temperatures within a narrower range than ambient temperatures. This is an important and long-known (but now overlooked) prediction of energy balance theory. Net radiation at leaf surface in steady state (which is reached rapidly) must be equal to the combination of sensible and latent heat exchanges with surrounding air, the former being proportional to leaf-to-air temperature difference (ΔT), the latter to the transpiration rate. We present field measurements of ΔT which confirm the existence of a 'crossover temperature' in the 25-30˚C range for species in a tropical savanna and a tropical rainforest environment. This finding is consistent with a simple representation of transpiration as a function of net radiation and temperature (Priestley-Taylor relationship) assuming an entrainment factor (ω) somewhat greater than the canonical value of 0.26. The fact that leaves in tropical forests are typically cooler than surrounding air, often already by solar noon, is consistent with a recently published comparison of MODIS day-time land-surface temperatures with air temperatures. Theory further predicts a strong dependence of leaf size (which is inversely related to leaf boundary-layer conductance, and therefore to absolute magnitude of ΔT) on moisture availability. Theoretically, leaf size should be determined by either night-time constraints (risk of frost damage to active leaves) or day-time constraints (risk of heat stress damage),with the former likely to predominate - thereby restricting the occurrence of large leaves - at high latitudes. In low latitudes, daytime maximum leaf size is predicted to increase with temperature, provided that water is plentiful. If water is restricted, however, transpiration cannot proceed at the Priestley-Taylor rate, and it quickly becomes advantageous for plants to have small leaves, which do not heat up much above the temperature of their surroundings. The difference between leaf

  1. From nanoparticles to large aerosols: Ultrafast measurement methods for size and concentration

    International Nuclear Information System (INIS)

    Keck, Lothar; Spielvogel, Juergen; Grimm, Hans

    2009-01-01

    A major challenge in aerosol technology is the fast measurement of number size distributions with good accuracy and size resolution. The dedicated instruments are frequently based on particle charging and electric detection. Established fast systems, however, still feature a number of shortcomings. We have developed a new instrument that constitutes of a high flow Differential Mobility Analyser (high flow DMA) and a high sensitivity Faraday Cup Electrometer (FCE). The system enables variable flow rates of up to 150 lpm, and the scan time for size distribution can be shortened considerably due to the short residence time of the particles in the DMA. Three different electrodes can be employed in order to cover a large size range. First test results demonstrate that the scan time can be reduced to less than 1 s for small particles, and that the results from the fast scans feature no significant difference to the results from established slow method. The fields of application for the new instrument comprise the precise monitoring of fast processes with nanoparticles, including monitoring of engine exhaust in automotive research.

  2. From nanoparticles to large aerosols: Ultrafast measurement methods for size and concentration

    Science.gov (United States)

    Keck, Lothar; Spielvogel, Jürgen; Grimm, Hans

    2009-05-01

    A major challenge in aerosol technology is the fast measurement of number size distributions with good accuracy and size resolution. The dedicated instruments are frequently based on particle charging and electric detection. Established fast systems, however, still feature a number of shortcomings. We have developed a new instrument that constitutes of a high flow Differential Mobility Analyser (high flow DMA) and a high sensitivity Faraday Cup Electrometer (FCE). The system enables variable flow rates of up to 150 lpm, and the scan time for size distribution can be shortened considerably due to the short residence time of the particles in the DMA. Three different electrodes can be employed in order to cover a large size range. First test results demonstrate that the scan time can be reduced to less than 1 s for small particles, and that the results from the fast scans feature no significant difference to the results from established slow method. The fields of application for the new instrument comprise the precise monitoring of fast processes with nanoparticles, including monitoring of engine exhaust in automotive research.

  3. Replicon sizes in mammalian cells as estimated by an x-ray plus bromodeoxyuridine photolysis method

    International Nuclear Information System (INIS)

    Kapp, L.N.; Painter, R.B.

    1978-01-01

    A new method is described for estimating replicon sizes in mammalian cells. Cultures were pulse labeled with [ 3 H]thymidine ([ 3 H]TdR) and bromodeoxyuridine (BrDUrd) for up to 1 h. The lengths of the resulting labeled regions of DNA, L/sub obs/, were estimated by a technique wherein the change in molecular weight of nascent DNA strands, induced by 313 nm light, is measured by velocity sedimentation in alkaline sucrose gradients. If cells are exposed to 1,000 rads of x rays immediately before pulse labeling, initiation of replicon operation is blocked, although chain elongation proceeds almost normally. Under these conditions L/sub obs/ continues to increase only until operating replicons have completed their replication. This value for L/sub obs/ then remains constant as long as the block to initiation remains and represents an estimate for the average size of replicons operating in the cells before x irradiation. For human diploid fibroblasts and human HeLa cells this estimated average size is approximately 17 μM, whereas for Chinese hamster ovary cells, the average replicon size is about 42 μM

  4. Effect of nitrogen supply on leaf growth, leaf nitrogen economy and photosynthetic capacity in potato

    NARCIS (Netherlands)

    Vos, J.; Putten, van der P.E.L.

    1998-01-01

    Literature reports show little effect of nitrogen supply on radiation use efficiency in potato and in other dicotyledonous C3 species. This paper tests the hypothesis that potato reduces leaf size rather than leaf nitrogen concentration and photosynthetic capacity when nitrogen is in short supply.

  5. Grain size control method for the nozzles of AP1000 primary coolant pipes

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Shenglong [State Key Laboratory for Advanced Metals and Materials, University of Science & Technology Beijing, Beijing 100083 (China); Sun, Yanhui [Collaborative Innovation Center of Steel Technology, University of Science & Technology Beijing, Beijing 100083 (China); Yang, Bin, E-mail: byang@ustb.edu.cn [State Key Laboratory for Advanced Metals and Materials, University of Science & Technology Beijing, Beijing 100083 (China); Collaborative Innovation Center of Steel Technology, University of Science & Technology Beijing, Beijing 100083 (China); Zhang, Mingxian [State Key Laboratory for Advanced Metals and Materials, University of Science & Technology Beijing, Beijing 100083 (China)

    2017-04-01

    Highlights: • Design a new forging technology for AP1000 primary coolant pipe. • Method combining FEM and scale-down experiments is adopted. • The grain size and distribution in simulation and experiment are consistent. • Get optimal forging parameters for production guiding. - Abstract: AP1000 primary coolant pipe is made of 316LN austenitic stainless steel. It is a large special-shaped pipe manufactured by integral forging technology. Owing to non-uniform temperature and deformation during forging, coarse grains often occur in the boss sections of the pipe especially in the nozzles’ parts. In the present study, a new forging technology was proposed to control the grain size. The finite element method was used to optimize the forging speed and friction coefficient, then the scale-down experiments were performed for comparison. The forging speed is suggested to be less than 20 mm/s, and effective lubricants should be used to decrease the friction coefficient. The errors of the grain size between the experiment and simulation are less than 20%.

  6. Grain size control method for the nozzles of AP1000 primary coolant pipes

    International Nuclear Information System (INIS)

    Wang, Shenglong; Sun, Yanhui; Yang, Bin; Zhang, Mingxian

    2017-01-01

    Highlights: • Design a new forging technology for AP1000 primary coolant pipe. • Method combining FEM and scale-down experiments is adopted. • The grain size and distribution in simulation and experiment are consistent. • Get optimal forging parameters for production guiding. - Abstract: AP1000 primary coolant pipe is made of 316LN austenitic stainless steel. It is a large special-shaped pipe manufactured by integral forging technology. Owing to non-uniform temperature and deformation during forging, coarse grains often occur in the boss sections of the pipe especially in the nozzles’ parts. In the present study, a new forging technology was proposed to control the grain size. The finite element method was used to optimize the forging speed and friction coefficient, then the scale-down experiments were performed for comparison. The forging speed is suggested to be less than 20 mm/s, and effective lubricants should be used to decrease the friction coefficient. The errors of the grain size between the experiment and simulation are less than 20%.

  7. A Review of Discrete Element Method (DEM) Particle Shapes and Size Distributions for Lunar Soil

    Science.gov (United States)

    Lane, John E.; Metzger, Philip T.; Wilkinson, R. Allen

    2010-01-01

    As part of ongoing efforts to develop models of lunar soil mechanics, this report reviews two topics that are important to discrete element method (DEM) modeling the behavior of soils (such as lunar soils): (1) methods of modeling particle shapes and (2) analytical representations of particle size distribution. The choice of particle shape complexity is driven primarily by opposing tradeoffs with total number of particles, computer memory, and total simulation computer processing time. The choice is also dependent on available DEM software capabilities. For example, PFC2D/PFC3D and EDEM support clustering of spheres; MIMES incorporates superquadric particle shapes; and BLOKS3D provides polyhedra shapes. Most commercial and custom DEM software supports some type of complex particle shape beyond the standard sphere. Convex polyhedra, clusters of spheres and single parametric particle shapes such as the ellipsoid, polyellipsoid, and superquadric, are all motivated by the desire to introduce asymmetry into the particle shape, as well as edges and corners, in order to better simulate actual granular particle shapes and behavior. An empirical particle size distribution (PSD) formula is shown to fit desert sand data from Bagnold. Particle size data of JSC-1a obtained from a fine particle analyzer at the NASA Kennedy Space Center is also fitted to a similar empirical PSD function.

  8. A method for detecting the presence of organic fraction in nucleation mode sized particles

    Directory of Open Access Journals (Sweden)

    P. Vaattovaara

    2005-01-01

    Full Text Available New particle formation and growth has a very important role in many climate processes. However, the overall knowlegde of the chemical composition of atmospheric nucleation mode (particle diameter, d<20 nm and the lower end of Aitken mode particles (d≤50 nm is still insufficient. In this work, we have applied the UFO-TDMA (ultrafine organic tandem differential mobility analyzer method to shed light on the presence of an organic fraction in the nucleation mode size class in different atmospheric environments. The basic principle of the organic fraction detection is based on our laboratory UFO-TDMA measurements with organic and inorganic compounds. Our laboratory measurements indicate that the usefulness of the UFO-TDMA in the field experiments would arise especially from the fact that atmospherically the most relevant inorganic compounds do not grow in subsaturated ethanol vapor, when particle size is 10 nm in diameter and saturation ratio is about 86% or below it. Furthermore, internally mixed particles composed of ammonium bisulfate and sulfuric acid with sulfuric acid mass fraction ≤33% show no growth at 85% saturation ratio. In contrast, 10 nm particles composed of various oxidized organic compounds of atmospheric relevance are able to grow in those conditions. These discoveries indicate that it is possible to detect the presence of organics in atmospheric nucleation mode sized particles using the UFO-TDMA method. In the future, the UFO-TDMA is expected to be an important aid to describe the composition of atmospheric newly-formed particles.

  9. On the limitations of fixed-step-size adaptive methods with response confidence.

    Science.gov (United States)

    Hsu, Yung-Fong; Chin, Ching-Lan

    2014-05-01

    The family of (non-parametric, fixed-step-size) adaptive methods, also known as 'up-down' or 'staircase' methods, has been used extensively in psychophysical studies for threshold estimation. Extensions of adaptive methods to non-binary responses have also been proposed. An example is the three-category weighted up-down (WUD) method (Kaernbach, 2001) and its four-category extension (Klein, 2001). Such an extension, however, is somewhat restricted, and in this paper we discuss its limitations. To facilitate the discussion, we characterize the extension of WUD by an algorithm that incorporates response confidence into a family of adaptive methods. This algorithm can also be applied to two other adaptive methods, namely Derman's up-down method and the biased-coin design, which are suitable for estimating any threshold quantiles. We then discuss via simulations of the above three methods the limitations of the algorithm. To illustrate, we conduct a small scale of experiment using the extended WUD under different response confidence formats to evaluate the consistency of threshold estimation. © 2013 The British Psychological Society.

  10. Validation of a particle tracking analysis method for the size determination of nano- and microparticles

    Science.gov (United States)

    Kestens, Vikram; Bozatzidis, Vassili; De Temmerman, Pieter-Jan; Ramaye, Yannic; Roebben, Gert

    2017-08-01

    Particle tracking analysis (PTA) is an emerging technique suitable for size analysis of particles with external dimensions in the nano- and sub-micrometre scale range. Only limited attempts have so far been made to investigate and quantify the performance of the PTA method for particle size analysis. This article presents the results of a validation study during which selected colloidal silica and polystyrene latex reference materials with particle sizes in the range of 20 nm to 200 nm were analysed with NS500 and LM10-HSBF NanoSight instruments and video analysis software NTA 2.3 and NTA 3.0. Key performance characteristics such as working range, linearity, limit of detection, limit of quantification, sensitivity, robustness, precision and trueness were examined according to recommendations proposed by EURACHEM. A model for measurement uncertainty estimation following the principles described in ISO/IEC Guide 98-3 was used for quantifying random and systematic variations. For nominal 50 nm and 100 nm polystyrene and a nominal 80 nm silica reference materials, the relative expanded measurement uncertainties for the three measurands of interest, being the mode, median and arithmetic mean of the number-weighted particle size distribution, varied from about 10% to 12%. For the nominal 50 nm polystyrene material, the relative expanded uncertainty of the arithmetic mean of the particle size distributions increased up to 18% which was due to the presence of agglomerates. Data analysis was performed with software NTA 2.3 and NTA 3.0. The latter showed to be superior in terms of sensitivity and resolution.

  11. Validation of a food quantification picture book and portion sizes estimation applying perception and memory methods.

    Science.gov (United States)

    Szenczi-Cseh, J; Horváth, Zs; Ambrus, Á

    2017-12-01

    We tested the applicability of EPIC-SOFT food picture series used in the context of a Hungarian food consumption survey gathering data for exposure assessment, and investigated errors in food portion estimation resulted from the visual perception and conceptualisation-memory. Sixty-two participants in three age groups (10 to foods. The results were considered acceptable if the relative difference between average estimated and actual weight obtained through the perception method was ≤25%, and the relative standard deviation of the individual weight estimates was food items were rated acceptable. Small portion sizes were tended to be overestimated, large ones were tended to be underestimated. Portions of boiled potato and creamed spinach were all over- and underestimated, respectively. Recalling the portion sizes resulted in overestimation with larger differences (up to 60.7%).

  12. An engineering method for estimating notch-size effect in fatigue tests on steel

    Science.gov (United States)

    Kuhn, Paul; Hardrath, Herbert F

    1952-01-01

    Neuber's proposed method of calculating a practical factor of stress concentration for parts containing notches of arbitrary size depends on the knowledge of a "new material constant" which can be established only indirectly. In this paper, the new constant has been evaluated for a large variety of steels from fatigue tests reported in the literature, attention being confined to stresses near the endurance limit. Reasonably satisfactory results were obtained with the assumption that the constant depends only on the tensile strength of the steel. Even in cases where the notches were cracks of which only the depth was known, reasonably satisfactory agreement was found between calculated and experimental factors. It is also shown that the material constant can be used in an empirical formula to estimate the size effect on unnotched specimens tested in bending fatigue.

  13. Size-controlled Synthesis and Characterization of Fe3O4 Nanoparticles by Chemical Coprecipitation Method

    International Nuclear Information System (INIS)

    Chia Chin Hua; Sarani Zakaria; Farahiyan, R.; Liew Tze Khong; Mustaffa Abdullah; Sahrim Ahmad; Nguyen, K.L.

    2008-01-01

    Magnetite (Fe 3 O 4 ) nanoparticles have been synthesized using the chemical coprecipitation method. The Fe 3 O 4 nanoparticles were likely formed via dissolution-recrystallization process. During the precipitation process, ferrihydrite and Fe(OH) 2 particles formed aggregates and followed by the formation of spherical Fe 3 O 4 particles. The synthesized Fe 3 O 4 nanoparticles exhibited superparamagnetic behavior and in single crystal form. The synthesis temperature and the degree of agitation during the precipitation were found to be decisive in controlling the crystallite and particle size of the produced Fe 3 O 4 nanoparticles. Lower temperature and higher degree of agitation were the favorable conditions for producing smaller particle. The magnetic properties (saturation magnetization and coercivity) of the Fe 3 O 4 nanoparticles increased with the particle size. (author)

  14. Designs and Methods for Association Studies and Population Size Inference in Statistical Genetics

    DEFF Research Database (Denmark)

    Waltoft, Berit Lindum

    method provides a simple goodness of t test by comparing the observed SFS with the expected SFS under a given model of population size changes. By the use of Monte Carlo estimation the expected time between coalescent events can be estimated and the expected SFS can thereby be evaluated. Using......). The OR is interpreted as the eect of an exposure on the probability of being diseased at the end of follow-up, while the interpretation of the IRR is the eect of an exposure on the probability of becoming diseased. Through a simulation study, the OR from a classical case-control study is shown to be an inconsistent...... the classical chi-square statistics we are able to infer single parameter models. Multiple parameter models, e.g. multiple epochs, are harder to identify. By introducing the inference of population size back in time as an inverse problem, the second procedure applies the theory of smoothing splines to infer...

  15. Analysis of small sample size studies using nonparametric bootstrap test with pooled resampling method.

    Science.gov (United States)

    Dwivedi, Alok Kumar; Mallawaarachchi, Indika; Alvarado, Luis A

    2017-06-30

    Experimental studies in biomedical research frequently pose analytical problems related to small sample size. In such studies, there are conflicting findings regarding the choice of parametric and nonparametric analysis, especially with non-normal data. In such instances, some methodologists questioned the validity of parametric tests and suggested nonparametric tests. In contrast, other methodologists found nonparametric tests to be too conservative and less powerful and thus preferred using parametric tests. Some researchers have recommended using a bootstrap test; however, this method also has small sample size limitation. We used a pooled method in nonparametric bootstrap test that may overcome the problem related with small samples in hypothesis testing. The present study compared nonparametric bootstrap test with pooled resampling method corresponding to parametric, nonparametric, and permutation tests through extensive simulations under various conditions and using real data examples. The nonparametric pooled bootstrap t-test provided equal or greater power for comparing two means as compared with unpaired t-test, Welch t-test, Wilcoxon rank sum test, and permutation test while maintaining type I error probability for any conditions except for Cauchy and extreme variable lognormal distributions. In such cases, we suggest using an exact Wilcoxon rank sum test. Nonparametric bootstrap paired t-test also provided better performance than other alternatives. Nonparametric bootstrap test provided benefit over exact Kruskal-Wallis test. We suggest using nonparametric bootstrap test with pooled resampling method for comparing paired or unpaired means and for validating the one way analysis of variance test results for non-normal data in small sample size studies. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  16. New phase method of measuring particle size with laser Doppler radar

    Science.gov (United States)

    Zemlianskii, Vladimir M.

    1996-06-01

    A vast field of non-contact metrology, vibrometry, dynamics and microdynamics problems solved on the basis of laser Doppler method resulted in the development of great variety of laser Doppler radar (LDR). In coherent LDR few beams with various polarization are generally adopted, that are directed at the zone of measurement, through which the probing air stream moves. Studies of various coherent LDR demonstrated that polarization-phase effects of scattering can in some cases considerably effect on the signal-to-noise ratio of the Doppler signal. On the other side using phase effects can simultaneous measurement of size and velocity of spherical particles. New possibilities for improving the accuracy of measuring spherical particles' sizes come to light when application is made in coherent LDR of two waves- probing and one out of the types of symmetrical reception of scattered radiation, during which phase-conjugate signals are formed. The theoretical analysis on the basis of the scattering theory showed, that in symmetrical reception of scattered radiation with respect to the planes OXZ and OYZ output signal of the photoreceiver contains two high- frequency signal components, which in relation to parameters of the probing and size, can either be in phase or antiphase. Results of numerical modeling are presented: amplitude of high frequency signal, coefficient of phase and polarization matching of mixed waves, the depths of photocurrent modulation and also signal's phase in relation to the angle between the probing beams. Phase method of determining particle's sizes based on the use of two wavelengths probing and symmetrical reception of scattered radiation in which conditions for the formation of phase conjugated high-frequency signals are satisfied is presented.

  17. A Geometrical Method for Sound-Hole Size and Location Enhancement in Lute Family Musical Instruments: The Golden Method

    Directory of Open Access Journals (Sweden)

    Soheil Jafari

    2017-11-01

    Full Text Available This paper presents a new analytical approach, the Golden Method, to enhance sound-hole size and location in musical instruments of the lute family in order to obtain better sound damping characteristics based on the concept of the golden ratio and the instrument geometry. The main objective of the paper is to increase the capability of lute family musical instruments in keeping a note for a certain time at a certain level to enhance the instruments’ orchestral characteristics. For this purpose, a geometry-based analytical method, the Golden Method is first described in detail in an itemized feature. A new musical instrument is then developed and tested to confirm the ability of the Golden Method in optimizing the acoustical characteristics of musical instruments from a damping point of view by designing the modified sound-hole. Finally, the new-developed instrument is tested, and the obtained results are compared with those of two well-known instruments to confirm the effectiveness of the proposed method. The experimental results show that the suggested method is able to increase the sound damping time by at least 2.4% without affecting the frequency response function and other acoustic characteristics of the instrument. This methodology could be used as the first step in future studies on design, optimization and evaluation of musical instruments of the lute family (e.g., lute, oud, barbat, mandolin, setar, and etc..

  18. Tangential flow ultrafiltration: a "green" method for the size selection and concentration of colloidal silver nanoparticles.

    Science.gov (United States)

    Anders, Catherine B; Baker, Joshua D; Stahler, Adam C; Williams, Austin J; Sisco, Jackie N; Trefry, John C; Wooley, Dawn P; Pavel Sizemore, Ioana E

    2012-10-04

    Nowadays, AgNPs are extensively used in the manufacture of consumer products,(1) water disinfectants,(2) therapeutics,(1, 3) and biomedical devices(4) due to their powerful antimicrobial properties.(3-6) These nanoparticle applications are strongly influenced by the AgNP size and aggregation state. Many challenges exist in the controlled fabrication(7) and size-based isolation(4,8) of unfunctionalized, homogenous AgNPs that are free from chemically aggressive capping/stabilizing agents or organic solvents.(7-13) Limitations emerge from the toxicity of reagents, high costs or reduced efficiency of the AgNP synthesis or isolation methods (e.g., centrifugation, size-dependent solubility, size-exclusion chromatography, etc.).(10,14-18) To overcome this, we recently showed that TFU permits greater control over the size, concentration and aggregation state of Creighton AgNPs (300 ml of 15.3 μg ml(-1) down to 10 ml of 198.7 μg ml(-1)) than conventional methods of isolation such as ultracentrifugation.(19) TFU is a recirculation method commonly used for the weight-based isolation of proteins, viruses and cells.(20,21) Briefly, the liquid sample is passed through a series of hollow fiber membranes with pore size ranging from 1,000 kD to 10 kD. Smaller suspended or dissolved constituents in the sample will pass through the porous barrier together with the solvent (filtrate), while the larger constituents are retained (retentate). TFU may be considered a "green" method as it neither damages the sample nor requires additional solvent to eliminate toxic excess reagents and byproducts. Furthermore, TFU may be applied to a large variety of nanoparticles as both hydrophobic and hydrophilic filters are available. The two main objectives of this study were: 1) to illustrate the experimental aspects of the TFU approach through an invited video experience and 2) to demonstrate the feasibility of the TFU method for larger volumes of colloidal nanoparticles and smaller volumes of

  19. Compound Method to Disperse CaCO3 Nanoparticles to Nano-Size in Water.

    Science.gov (United States)

    Gu, Sui; Cai, Jihua; Wang, Jijun; Yuan, Ye; Chang, Dewu; Chikhotkin, Viktor F

    2015-12-01

    The invalidation of CaCO3 nanoparticles (nCaCO3) is often caused by the fact of agglomeration and inhomogeneous dispersion which limits its application into water-based drilling muds for low permeability reservoirs such as coalbed methane reservoir and shale gas/oil reservoir. Effective methods to disperse nCaCO3 to nano-size (≤ 100 nm) in water have seldom been reported. Here we developed a compound method containing mechanical stirring, ultrasonic treatment, the use of surfactant and stabilizer to disperse nCaCO3 in water. It comprises the steps adding 2% nCaCO3, 1% sodium dodecyl sulfonate (SDS), 2% cetyltrimethyl ammonium bromide (CTAB), 2% OP-10, 3% to 4% biopolymer (XC) in water successively, stirring it at a shear rate of 6000 to 8000 r/min for 15 minutes and treating it with ultrasonic at a frequency of 28 KHz for 30 to 40 minutes. The dispersed nCaCO3 was characterized with scanning electron microscope (SEM), transmission electron microscope (TEM) and particle size distribution (PSD) tests. We found that nCaCO3 could be dispersed to below 100 nm in water and the medium value of nCaCO3 was below 50 nm. This method paved the way for the utilization of nCaCO3 in drilling fluid and completion fluid for low permeability reservoirs such as coal seams and shale gas/oil formations.

  20. Mathematical programming models for solving in equal-sized facilities layout problems. A genetic search method

    International Nuclear Information System (INIS)

    Tavakkoli-Moghaddam, R.

    1999-01-01

    This paper present unequal-sized facilities layout solutions generated by a genetic search program. named Layout Design using a Genetic Algorithm) 9. The generalized quadratic assignment problem requiring pre-determined distance and material flow matrices as the input data and the continuous plane model employing a dynamic distance measure and a material flow matrix are discussed. Computational results on test problems are reported as compared with layout solutions generated by the branch - and bound algorithm a hybrid method merging simulated annealing and local search techniques, and an optimization process of an enveloped block

  1. Dissolution and particle size characterization of radioactive contaminants in Hanford facilities: Criteria for methods of measurement

    International Nuclear Information System (INIS)

    Briant, J.K.; James, A.C.

    1990-08-01

    The purpose of this document is to discuss experimental methods that can be applied to evaluate the rate at which an actinide material is likely to dissolve in biological fluids. Criteria are recommended for the design and conduct of meaningful experimental procedures to sample a representative size fraction of the source material, to measure the rate of radionuclide dissolution, and to apply the results to assign the material to an appropriate ICRP Publication-30 lung retention class (or mixture of classes). 26 refs., 3 figs., 3 tabs

  2. Comparing radio-tracking and visual detection methods to quantify group size measures

    Directory of Open Access Journals (Sweden)

    Reiczigel Jenő

    2015-12-01

    Full Text Available 1. Average values of animal group sizes are prone to be overestimated in traditional field studies because small groups and singletons are easier to overlook than large ones. This kind of bias also applies for the method of locating groups by tracking previously radio-collared individuals in the wild. If the researcher randomly chooses a collared animal to locate a group to visit, a large group has higher probability to be selected than a small one, simply because it has more members.

  3. Nano sized La2Co2O6 double perovskite synthesized by sol gel method

    Science.gov (United States)

    Solanki, Neha; Lodhi, Pavitra Devi; Choudhary, K. K.; Kaurav, Netram

    2018-05-01

    We report here the synthesis of double perovskite La2Co2O6 (LCO) compound by a sol gel route method. The double perovskite structure of LCO system was confirmed via X-ray diffraction (XRD) analysis. Further, the lattice parameter, unit cell volume and bond length were refined by means of rietveld analysis using the full proof software. Debye Scherer formula was used to determine the particle size. The compound crystallized in triclinic structure with space group P-1 in ambient condition. We also obtained Raman modes from XRD spectra of poly-crystalline LCO sample. These results were interpreted for the observation of phonon excitations in this compound.

  4. Computing physical properties with quantum Monte Carlo methods with statistical fluctuations independent of system size.

    Science.gov (United States)

    Assaraf, Roland

    2014-12-01

    We show that the recently proposed correlated sampling without reweighting procedure extends the locality (asymptotic independence of the system size) of a physical property to the statistical fluctuations of its estimator. This makes the approach potentially vastly more efficient for computing space-localized properties in large systems compared with standard correlated methods. A proof is given for a large collection of noninteracting fragments. Calculations on hydrogen chains suggest that this behavior holds not only for systems displaying short-range correlations, but also for systems with long-range correlations.

  5. The synthesis and characterization of platinum nanoparticles: a method of controlling the size and morphology

    International Nuclear Information System (INIS)

    Long, Nguyen Viet; Hayakawa, Tomokatsu; Lakshminarayana, Gandham; Nogami, Masayuki; Chien, Nguyen Duc; Hirata, Hirohito

    2010-01-01

    In this paper, Pt nanoparticles with good shapes of nanocubes and nano-octahedra and well-controlled sizes in the range 5-7 and 8-12 nm, respectively, have been successfully synthesized. The modified polyol method by adding silver nitrate and varying the molar ratio of the solutions of silver nitrate and H 2 PtCl 6 has been used to produce Pt nanoparticles of the size and shape to be controlled. The size and morphology of Pt nanoparticles have been studied by transmission electron microscopy (TEM) and high resolution TEM (HRTEM). The results have shown that their very sharp and good shapes exist in the main forms of cubic, cuboctahedral, octahedral and tetrahedral shapes directly related to the crystal nucleation along various directions of the {100} cubic, {111} octahedral and {111} tetrahedral facets during synthesis. In particular, various irregular and new shapes of Pt nanoparticles have been found. Here, it is concluded that the role of silver ions has to be considered as an important factor for promoting and controlling the development of Pt nanoparticles of {100} cubic, {111} octahedral and {111} tetrahedral facets, and also directly orienting the growth and formation of Pt nanoparticles.

  6. A simple, rapid and inexpensive method for localization of Tomato yellow leaf curl virus and Potato leafroll virus in plant and insect vectors.

    Science.gov (United States)

    Ghanim, Murad; Brumin, Marina; Popovski, Smadar

    2009-08-01

    A simple, rapid, inexpensive method for the localization of virus transcripts in plant and insect vector tissues is reported here. The method based on fluorescent in situ hybridization using short DNA oligonucleotides complementary to an RNA segment representing a virus transcript in the infected plant or insect vector. The DNA probe harbors a fluorescent molecule at its 5' or 3' ends. The protocol: simple fixation, hybridization, minimal washing and confocal microscopy, provides a highly specific signal. The reliability of the protocol was tested by localizing two phloem-limited plant virus transcripts in infected plants and insect tissues: Tomato yellow leaf curl virus (TYLCV) (Begomovirus: Geminiviridae), exclusively transmitted by the whitefly Bemisia tabaci (Gennadius) in a circulative non-propagative manner, and Potato leafroll virus (Polerovirus: Luteoviridae), similarly transmitted by the aphid Myzus persicae (Sulzer). Transcripts for both viruses were localized specifically to the phloem sieve elements of infected plants, while negative controls showed no signal. TYLCV transcripts were also localized to the digestive tract of B. tabaci, confirming TYLCV route of transmission. Compared to previous methods for localizing virus transcripts in plant and insect tissues that include complex steps for in-vitro probe preparation or antibody raising, tissue fixation, block preparation, sectioning and hybridization, the method described below provides very reliable, convincing, background-free results with much less time, effort and cost.

  7. Comparison of different methods for determining the size of a focal spot of microfocus X-ray tubes

    International Nuclear Information System (INIS)

    Salamon, M.; Hanke, R.; Krueger, P.; Sukowski, F.; Uhlmann, N.; Voland, V.

    2008-01-01

    The EN 12543-5 describes a method for determining the focal spot size of microfocus X-ray tubes up to a minimum spot size of 5 μm. The wide application of X-ray tubes with even smaller focal spot sizes in computed tomography and radioscopy applications requires the evaluation of existing methods for focal spot sizes below 5 μm. In addition, new methods and conditions for determining submicron focal spot sizes have to be developed. For the evaluation and extension of the present methods to smaller focal spot sizes, different procedures in comparison with the existing EN 12543-5 were analyzed and applied, and the results are presented

  8. Does leaf chemistry differentially affect breakdown in tropical versus temperate streams? Importance of standardized analytical techniques to measure leaf chemistry

    Science.gov (United States)

    Marcelo Ardon; Catherine M. Pringle; Susan L. Eggert

    2009-01-01

    Comparisons of the effects of leaf litter chemistry on leaf breakdown rates in tropical vs temperate streams are hindered by incompatibility among studies and across sites of analytical methods used to...

  9. Finite-size scaling method for the Berezinskii–Kosterlitz–Thouless transition

    International Nuclear Information System (INIS)

    Hsieh, Yun-Da; Kao, Ying-Jer; Sandvik, Anders W

    2013-01-01

    We test an improved finite-size scaling method for reliably extracting the critical temperature T BKT of a Berezinskii–Kosterlitz–Thouless (BKT) transition. Using known single-parameter logarithmic corrections to the spin stiffness ρ s at T BKT in combination with the Kosterlitz–Nelson relation between the transition temperature and the stiffness, ρ s (T BKT ) = 2T BKT /π, we define a size-dependent transition temperature T BKT (L 1 ,L 2 ) based on a pair of system sizes L 1 ,L 2 , e.g., L 2 = 2L 1 . We use Monte Carlo data for the standard two-dimensional classical XY model to demonstrate that this quantity is well behaved and can be reliably extrapolated to the thermodynamic limit using the next expected logarithmic correction beyond the ones included in defining T BKT (L 1 ,L 2 ). For the Monte Carlo calculations we use GPU (graphical processing unit) computing to obtain high-precision data for L up to 512. We find that the sub-leading logarithmic corrections have significant effects on the extrapolation. Our result T BKT = 0.8935(1) is several error bars above the previously best estimates of the transition temperature, T BKT ≈ 0.8929. If only the leading log-correction is used, the result is, however, consistent with the lower value, suggesting that previous works have underestimated T BKT because of the neglect of sub-leading logarithms. Our method is easy to implement in practice and should be applicable to generic BKT transitions. (paper)

  10. COCHLEATA controls leaf size and secondary inflorescence ...

    Indian Academy of Sciences (India)

    2012-10-18

    Oct 18, 2012 ... sion promotes production of secondary branches from the axils of cauline leaves ... ASYMMETRIC LEAVES 2 transcription factor, which in turn represses the ...... Blixt S 1967 Linkage studies in Pisum VII. The manifestation of ...

  11. Development of stress relaxation measurement by a small size C-ring specimen method

    International Nuclear Information System (INIS)

    Shimanuki, Shizuka; Nakata, Kiyotomo; Kasahara, Shigeki; Kuniya, Jiro

    2002-01-01

    A stress relaxation measurement method has been developed by using C-ring specimens, and a specimen size effect has been evaluated taking radiation-induced stress relaxation into consideration. C-ring specimens were stressed by forcing a wedge in the gap. Giving an appropriate eccentric configuration in the half of the ring opposite the gap, the stress gradient along the circumference was eliminated in the section and the stress level could be varied by changing the gap spacing. The validity of the C-ring test method was confirmed by thermally stress relaxation experiments at annealing temperatures from 300 to 600degC for 1 min to 200 h in carbon steel: considerable stress relaxation could be measured for all levels of applied stress even at relatively low annealing temperatures. The relaxation results obtained from the C-ring test were in good agreement with those from a uniaxial tensile stress relaxation test. The smaller C-ring specimen with about 40 mm diameter, which is required for radiation-induced stress relaxation test, also showed adequate accuracy on stress relaxation at 600 to 830degC in stainless steel, compared with the large size C-ring specimen test. (author)

  12. Gastropod shell size and architecture influence the applicability of methods used to estimate internal volume.

    Science.gov (United States)

    Ragagnin, Marilia Nagata; Gorman, Daniel; McCarthy, Ian Donald; Sant'Anna, Bruno Sampaio; de Castro, Cláudio Campi; Turra, Alexander

    2018-01-11

    Obtaining accurate and reproducible estimates of internal shell volume is a vital requirement for studies into the ecology of a range of shell-occupying organisms, including hermit crabs. Shell internal volume is usually estimated by filling the shell cavity with water or sand, however, there has been no systematic assessment of the reliability of these methods and moreover no comparison with modern alternatives, e.g., computed tomography (CT). This study undertakes the first assessment of the measurement reproducibility of three contrasting approaches across a spectrum of shell architectures and sizes. While our results suggested a certain level of variability inherent for all methods, we conclude that a single measure using sand/water is likely to be sufficient for the majority of studies. However, care must be taken as precision may decline with increasing shell size and structural complexity. CT provided less variation between repeat measures but volume estimates were consistently lower compared to sand/water and will need methodological improvements before it can be used as an alternative. CT indicated volume may be also underestimated using sand/water due to the presence of air spaces visible in filled shells scanned by CT. Lastly, we encourage authors to clearly describe how volume estimates were obtained.

  13. An Efficient Adaptive Window Size Selection Method for Improving Spectrogram Visualization

    Directory of Open Access Journals (Sweden)

    Shibli Nisar

    2016-01-01

    Full Text Available Short Time Fourier Transform (STFT is an important technique for the time-frequency analysis of a time varying signal. The basic approach behind it involves the application of a Fast Fourier Transform (FFT to a signal multiplied with an appropriate window function with fixed resolution. The selection of an appropriate window size is difficult when no background information about the input signal is known. In this paper, a novel empirical model is proposed that adaptively adjusts the window size for a narrow band-signal using spectrum sensing technique. For wide-band signals, where a fixed time-frequency resolution is undesirable, the approach adapts the constant Q transform (CQT. Unlike the STFT, the CQT provides a varying time-frequency resolution. This results in a high spectral resolution at low frequencies and high temporal resolution at high frequencies. In this paper, a simple but effective switching framework is provided between both STFT and CQT. The proposed method also allows for the dynamic construction of a filter bank according to user-defined parameters. This helps in reducing redundant entries in the filter bank. Results obtained from the proposed method not only improve the spectrogram visualization but also reduce the computation cost and achieves 87.71% of the appropriate window length selection.

  14. Definition of datum of materials lump size on conveyors by means of reflected gamma-radiation method

    International Nuclear Information System (INIS)

    Gal'yanov, A.V.; Antonov, V.A.; Laptev, Yu.V.

    2001-01-01

    A method of technological control of large-size lumps in conveyor-transported crushed material based on intensity measurement of X-ray and gamma radiation reflected from the material surface was suggested. The method was substantiated theoretically and as a result it was shown that dispersion of radiation intensity, multiply measured for short periods of time, can be analytic parameter of large-size lumps yield. Principled methodical and design recommendations on the method practical applications are given [ru

  15. Simultaneous determination of glucose, fructose, sucrose and sorbitol in the leaf and fruit peel of different apple cultivars by the HPLC-RI optimized method.

    Science.gov (United States)

    Filip, Miuţa; Vlassa, Mihaela; Coman, Virginia; Halmagyi, Adela

    2016-05-15

    A high performance liquid chromatography method with refractive index detection (HPLC-RI), for simultaneous determination of glucose, fructose, sucrose and sorbitol in leaf and/or apple peel samples from nine apple (Malus domestica Borkh.) cultivars and rootstocks, originating from a germplasm collection, has been developed and validated. Box-Behnken design of response surface methodology was applied for the method optimization. The Carbosep Coregel 87H3 column was used under the optimum conditions predicted: mobile phase of H2SO4 0.005 mol L(-1) solution, flow rate of 0.3 mL min(-1) and column temperature of 35°C. The method was validated for linearity (R(2)>0.99), limits of detection (2.67-4.83 μg mL(-1)) and quantification (8.9-16.1 μg mL(-1)), precision (%RSD<5.05) and recovery (93.94-103.06%) and satisfactory results obtained. The sugars content varied across micropropagated plants in vitro, plants regenerated after cryostorage, growing trees in vivo, and fruit peel. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Betel leaf in stoma care.

    Science.gov (United States)

    Banu, Tahmina; Talukder, Rupom; Chowdhury, Tanvir Kabir; Hoque, Mozammel

    2007-07-01

    Construction of a stoma is a common procedure in pediatric surgical practice. For care of these stomas, commercially available devices such as ostomy bag, either disposable or of longer duration are usually used. These are expensive, particularly in countries like Bangladesh, and proper-sized ones are not always available. We have found an alternative for stoma care, betel leaf, which is suitable for Bangladeshis. We report the outcome of its use. After construction of stoma, at first zinc oxide paste was applied on the peristomal skin. A betel leaf with shiny, smooth surface outwards and rough surface inwards was put over the stoma with a hole made in the center according to the size of stoma. Another intact leaf covers the stomal opening. When bowel movement occurs, the overlying intact leaf was removed and the fecal matter was washed away from both. The leaves were reused after cleaning. Leaves were changed every 2 to 3 days. From June 1998 to December 2005, in the department of pediatric surgery, Chittagong Medical College and Hospital, Chittagong, Bangladesh, a total of 623 patients had exteriorization of bowel. Of this total, 495 stomas were cared for with betel leaves and 128 with ostomy bags. Of 623 children, 287 had sigmoid colostomy, 211 had transverse colostomy, 105 had ileostomy, and 20 had jejunostomy. Of the 495 children under betel leaf stoma care, 13 patients (2.6%) developed skin excoriation. There were no allergic reactions. Of the 128 patients using ostomy bag, 52 (40.65%) had skin excoriation. Twenty-four (18.75%) children developed some allergic reactions to adhesive. Monthly costs for betel leaves were 15 cents (10 BDT), whereas ostomy bags cost about US$24. In the care of stoma, betel leaves are cheap, easy to handle, nonirritant, and nonallergic.

  17. SCOPING STUDIES TO DEVELOP A METHOD TO DETERMINE PARTICLE SIZE IN SIMULANT SLUDGE SLURRIES BY SIEVING

    International Nuclear Information System (INIS)

    DAMON, CLICK

    2005-01-01

    A physical separation method (i.e. sieving) was investigated to determine particle size distribution in non-radioactive sludge slurry simulants with the goal of implementation into the SRNL (Savannah River National Laboratory) shielded cells for use with radioactive sludge slurries. The investigation included obtaining the necessary experimental equipment, developing accessory equipment for use with the sieve shaker (to be able to sieve simulant slurries with aqueous solutions), sieving three different simulant slurries through a number of sieves and determining the particle size distribution gravimetrically, and developing a sufficient cleaning protocol of the sieves for re-use. The experimental protocol involved successive sieving of a NIST standard (to check the particle size retention of the sieves) and three non-radioactive slurry simulants (Batch 3 Tank 40 Test 3, Tank 40 Drum 3 and CETL Sludge Batch 2, which had been previously characterized by Microtrac analysis) through smaller and smaller sieves (150 microns x 5 microns) via use of the wet sieving system or by hand. For each of the three slurries, duplicate experiments were carried out using filtered supernate and DI water (to check the accuracy of the method versus Microtrac data) to sieve the slurry. Particle size determinations using the wet sieving system with DI water agree well with Microtrac data on a volume basis and in some cases the sieving data may be more accurate particularly if the material sieved had large particles. A correction factor had to be applied to data obtained from experiments done with supernate due to the dissolved solids which dried upon the sieves in the drying stage of the experiments. Upon subtraction of the correction factors, the experimental results were very similar to those obtained with DI water. It should be noted that approximately 250 mL of each of three simulant slurries was necessary to have enough filtered supernate available to carry out the experiments. The

  18. A Fatigue Crack Size Evaluation Method Based on Lamb Wave Simulation and Limited Experimental Data

    Directory of Open Access Journals (Sweden)

    Jingjing He

    2017-09-01

    Full Text Available This paper presents a systematic and general method for Lamb wave-based crack size quantification using finite element simulations and Bayesian updating. The method consists of construction of a baseline quantification model using finite element simulation data and Bayesian updating with limited Lamb wave data from target structure. The baseline model correlates two proposed damage sensitive features, namely the normalized amplitude and phase change, with the crack length through a response surface model. The two damage sensitive features are extracted from the first received S0 mode wave package. The model parameters of the baseline model are estimated using finite element simulation data. To account for uncertainties from numerical modeling, geometry, material and manufacturing between the baseline model and the target model, Bayesian method is employed to update the baseline model with a few measurements acquired from the actual target structure. A rigorous validation is made using in-situ fatigue testing and Lamb wave data from coupon specimens and realistic lap-joint components. The effectiveness and accuracy of the proposed method is demonstrated under different loading and damage conditions.

  19. Turbofan engine diagnostics neuron network size optimization method which takes into account overlaerning effect

    Directory of Open Access Journals (Sweden)

    О.С. Якушенко

    2010-01-01

    Full Text Available  The article is devoted to the problem of gas turbine engine (GTE technical state class automatic recognition with operation parameters by neuron networks. The one of main problems for creation the neuron networks is determination of their optimal structures size (amount of layers in network and count of neurons in each layer.The method of neuron network size optimization intended for classification of GTE technical state is considered in the article. Optimization is cared out with taking into account of overlearning effect possibility when a learning network loses property of generalization and begins strictly describing educational data set. To determinate a moment when overlearning effect is appeared in learning neuron network the method  of three data sets is used. The method is based on the comparison of recognition quality parameters changes which were calculated during recognition of educational and control data sets. As the moment when network overlearning effect is appeared the moment when control data set recognition quality begins deteriorating but educational data set recognition quality continues still improving is used. To determinate this moment learning process periodically is terminated and simulation of network with education and control data sets is fulfilled. The optimization of two-, three- and four-layer networks is conducted and some results of optimization are shown. Also the extended educational set is created and shown. The set describes 16 GTE technical state classes and each class is represented with 200 points (200 possible technical state class realizations instead of 20 points using in the former articles. It was done to increase representativeness of data set.In the article the algorithm of optimization is considered and some results which were obtained with it are shown. The results of experiments were analyzed to determinate most optimal neuron network structure. This structure provides most high-quality GTE

  20. Inferring the photometric and size evolution of galaxies from image simulations. I. Method

    Science.gov (United States)

    Carassou, Sébastien; de Lapparent, Valérie; Bertin, Emmanuel; Le Borgne, Damien

    2017-09-01

    Context. Current constraints on models of galaxy evolution rely on morphometric catalogs extracted from multi-band photometric surveys. However, these catalogs are altered by selection effects that are difficult to model, that correlate in non trivial ways, and that can lead to contradictory predictions if not taken into account carefully. Aims: To address this issue, we have developed a new approach combining parametric Bayesian indirect likelihood (pBIL) techniques and empirical modeling with realistic image simulations that reproduce a large fraction of these selection effects. This allows us to perform a direct comparison between observed and simulated images and to infer robust constraints on model parameters. Methods: We use a semi-empirical forward model to generate a distribution of mock galaxies from a set of physical parameters. These galaxies are passed through an image simulator reproducing the instrumental characteristics of any survey and are then extracted in the same way as the observed data. The discrepancy between the simulated and observed data is quantified, and minimized with a custom sampling process based on adaptive Markov chain Monte Carlo methods. Results: Using synthetic data matching most of the properties of a Canada-France-Hawaii Telescope Legacy Survey Deep field, we demonstrate the robustness and internal consistency of our approach by inferring the parameters governing the size and luminosity functions and their evolutions for different realistic populations of galaxies. We also compare the results of our approach with those obtained from the classical spectral energy distribution fitting and photometric redshift approach. Conclusions: Our pipeline infers efficiently the luminosity and size distribution and evolution parameters with a very limited number of observables (three photometric bands). When compared to SED fitting based on the same set of observables, our method yields results that are more accurate and free from

  1. Identifying Shifts in Leaf-Litter Ant Assemblages (Hymenoptera: Formicidae across Ecosystem Boundaries Using Multiple Sampling Methods.

    Directory of Open Access Journals (Sweden)

    Michal Wiezik

    Full Text Available Global or regional environmental changes in climate or land use have been increasingly implied in shifts in boundaries (ecotones between adjacent ecosystems such as beech or oak-dominated forests and forest-steppe ecotones that frequently co-occur near the southern range limits of deciduous forest biome in Europe. Yet, our ability to detect changes in biological communities across these ecosystems, or to understand their environmental drivers, can be hampered when different sampling methods are required to characterize biological communities of the adjacent but ecologically different ecosystems. Ants (Hymenoptera: Formicidae have been shown to be particularly sensitive to changes in temperature and vegetation and they require different sampling methods in closed vs. open habitats. We compared ant assemblages of closed-forests (beech- or oak-dominated and open forest-steppe habitats in southwestern Carpathians using methods for closed-forest (litter sifting and open habitats (pitfall trapping, and developed an integrated sampling approach to characterize changes in ant assemblages across these adjacent ecosystems. Using both methods, we collected 5,328 individual ant workers from 28 species. Neither method represented ant communities completely, but pitfall trapping accounted for more species (24 than litter sifting (16. Although pitfall trapping characterized differences in species richness and composition among the ecosystems better, with beech forest being most species poor and ecotone most species rich, litter sifting was more successful in identifying characteristic litter-dwelling species in oak-dominated forest. The integrated sampling approach using both methods yielded more accurate characterization of species richness and composition, and particularly so in species-rich forest-steppe habitat where the combined sample identified significantly higher number of species compared to either of the two methods on their own. Thus, an integrated

  2. Identifying Shifts in Leaf-Litter Ant Assemblages (Hymenoptera: Formicidae) across Ecosystem Boundaries Using Multiple Sampling Methods.

    Science.gov (United States)

    Wiezik, Michal; Svitok, Marek; Wieziková, Adela; Dovčiak, Martin

    2015-01-01

    Global or regional environmental changes in climate or land use have been increasingly implied in shifts in boundaries (ecotones) between adjacent ecosystems such as beech or oak-dominated forests and forest-steppe ecotones that frequently co-occur near the southern range limits of deciduous forest biome in Europe. Yet, our ability to detect changes in biological communities across these ecosystems, or to understand their environmental drivers, can be hampered when different sampling methods are required to characterize biological communities of the adjacent but ecologically different ecosystems. Ants (Hymenoptera: Formicidae) have been shown to be particularly sensitive to changes in temperature and vegetation and they require different sampling methods in closed vs. open habitats. We compared ant assemblages of closed-forests (beech- or oak-dominated) and open forest-steppe habitats in southwestern Carpathians using methods for closed-forest (litter sifting) and open habitats (pitfall trapping), and developed an integrated sampling approach to characterize changes in ant assemblages across these adjacent ecosystems. Using both methods, we collected 5,328 individual ant workers from 28 species. Neither method represented ant communities completely, but pitfall trapping accounted for more species (24) than litter sifting (16). Although pitfall trapping characterized differences in species richness and composition among the ecosystems better, with beech forest being most species poor and ecotone most species rich, litter sifting was more successful in identifying characteristic litter-dwelling species in oak-dominated forest. The integrated sampling approach using both methods yielded more accurate characterization of species richness and composition, and particularly so in species-rich forest-steppe habitat where the combined sample identified significantly higher number of species compared to either of the two methods on their own. Thus, an integrated sampling

  3. Leaf anatomical traits determine the 18O enrichment of leaf water in coastal halophytes

    Science.gov (United States)

    Liang, J.; Lin, G., Sr.; Sternberg, L. O.

    2017-12-01

    Foliar anatomical adaptations to high-salinity environment in mangroves may be recorded by leaf water isotopes. Recent studies observed that a few mangrove species have lower 18O enrichment of leaf water (ΔL) relative to source water than the adjacent terrestrial trees, but what factors actually control this phenomenon is still disputable at present. To resolve this issue, we collected 15 species of true mangrove plants, 14 species of adjacent freshwater trees and 4 species of semi-mangrove plants at five study sites on the southeastern coast of China. Leaf stomatal density and pore size, water content, ΔL and other related leaf physiological traits were determined for the selected leaves of these plants. Our results confirmed that ΔL values of mangroves were generally 3 4 ‰ lower than those of the adjacent freshwater or semi-mangrove species. Higher leaf water per area (LWC) and lower leaf stomatal density (LS) of mangroves played co-dominant roles in lowering ΔL through elongating effective leaf mixing length by about 20%. The Péclet model incorporated by LWC and LS performed well in predicting ΔL. The demonstrated general law between leaf anatomy and ΔL in this paper based on a large pool of species bridges the gap between leaf functional traits and metabolic proxies derived ΔL, which will have considerable potential applications in vegetation succession and reconstruction of paleoclimate research.

  4. Non-regularized inversion method from light scattering applied to ferrofluid magnetization curves for magnetic size distribution analysis

    International Nuclear Information System (INIS)

    Rijssel, Jos van; Kuipers, Bonny W.M.; Erné, Ben H.

    2014-01-01

    A numerical inversion method known from the analysis of light scattering by colloidal dispersions is now applied to magnetization curves of ferrofluids. The distribution of magnetic particle sizes or dipole moments is determined without assuming that the distribution is unimodal or of a particular shape. The inversion method enforces positive number densities via a non-negative least squares procedure. It is tested successfully on experimental and simulated data for ferrofluid samples with known multimodal size distributions. The created computer program MINORIM is made available on the web. - Highlights: • A method from light scattering is applied to analyze ferrofluid magnetization curves. • A magnetic size distribution is obtained without prior assumption of its shape. • The method is tested successfully on ferrofluids with a known size distribution. • The practical limits of the method are explored with simulated data including noise. • This method is implemented in the program MINORIM, freely available online

  5. Wind increases leaf water use efficiency.

    Science.gov (United States)

    Schymanski, Stanislaus J; Or, Dani

    2016-07-01

    A widespread perception is that, with increasing wind speed, transpiration from plant leaves increases. However, evidence suggests that increasing wind speed enhances carbon dioxide (CO2 ) uptake while reducing transpiration because of more efficient convective cooling (under high solar radiation loads). We provide theoretical and experimental evidence that leaf water use efficiency (WUE, carbon uptake per water transpired) commonly increases with increasing wind speed, thus improving plants' ability to conserve water during photosynthesis. Our leaf-scale analysis suggests that the observed global decrease in near-surface wind speeds could have reduced WUE at a magnitude similar to the increase in WUE attributed to global rise in atmospheric CO2 concentrations. However, there is indication that the effect of long-term trends in wind speed on leaf gas exchange may be compensated for by the concurrent reduction in mean leaf sizes. These unintuitive feedbacks between wind, leaf size and water use efficiency call for re-evaluation of the role of wind in plant water relations and potential re-interpretation of temporal and geographic trends in leaf sizes. © 2015 The Authors. Plant, Cell & Environment published by John Wiley & Sons Ltd.

  6. Sorting it out: bedding particle size and nesting material processing method affect nest complexity.

    Science.gov (United States)

    Robinson-Junker, Amy; Morin, Amelia; Pritchett-Corning, Kathleen; Gaskill, Brianna N

    2017-04-01

    As part of routine husbandry, an increasing number of laboratory mice receive nesting material in addition to standard bedding material in their cages. Nesting material improves health outcomes and physiological performance in mice that receive it. Providing usable nesting material uniformly and efficiently to various strains of mice remains a challenge. The aim of this study was to determine how bedding particle size, method of nesting material delivery, and processing of the nesting material before delivery affected nest building in mice of strong (BALB/cAnNCrl) and weak (C3H/HeNCrl) gathering abilities. Our data suggest that processing nesting material through a grinder in conjunction with bedding material, although convenient for provision of bedding with nesting material 'built-in', negatively affects the integrity of the nesting material and subsequent nest-building outcomes. We also found that C3H mice, previously thought to be poor nest builders, built similarly scored nests to those of BALB/c mice when provided with unprocessed nesting material. This was true even when nesting material was mixed into the bedding substrate. We also observed that when nesting material was mixed into the bedding substrate, mice of both strains would sort their bedding by particle size more often than if it were not mixed in. Our findings support the utility of the practice of distributing nesting material mixed in with bedding substrate, but not that of processing the nesting material with the bedding in order to mix them.

  7. An analytical method to determine the optimal size of a photovoltaic plant

    Energy Technology Data Exchange (ETDEWEB)

    Barra, L; Catalanotti, S; Fontana, F; Lavorante, F

    1984-01-01

    In this paper, a simplified method for the optimal sizing of a photovoltaic system is presented. The results have been obtained for Italian meteorological data, but the methodology can be applied to any geographical area. The system studied is composed of a photovoltaic array, power tracker, battery storage, inverter and load. Computer simulation was used to obtain the performance of this system for many values of field area, battery storage value, solar flux and load by keeping constant the efficiencies. A simple fit was used to achieve a formula relating the system variables to the performance. Finally, the formulae for the optimal values of the field area and the battery storage value are shown.

  8. Strong Flux Pinning of Nano-Sized Ysz Particles in Ybco Films Prepared by Mod Method

    Science.gov (United States)

    Ye, S.; Suo, H. L.; Liu, M.; Tang, X.; Wu, Z. P.; Zhao, Y.; Zhou, M. L.

    The YBCO films with doped YSZ nanoparticles have been prepared successfully by metal organic doepositon method using trifluoroacetates (TFA-MOD) through dissolving Zr organic salt into the YBCO precursor solution. The doped films have well in-plane and out-plane textures detected by both XRD Φ-scan and ω-scan. The YSZ nanoparticles with the size of about 5 ~ 15 nm were observed on the surface of the YBCO films using both FE-SEM and TEM. By comparing the superconducting properties, it was found that the doped YBCO films had lower Tc than that of undoped YBCO films. However, as increasing the applied magnetic field, Jc of the doped YBCO films were much better than that of undoped one. The Jc was as higher as 2.5 times than that of undoped YBCO film at 77 K and 1 T applied field.

  9. Standard Test Method for Sizing and Counting Particulate Contaminant In and On Clean Room Garments

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2000-01-01

    1.1 This test method covers the determination of detachable particulate contaminant 5 m or larger, in and on the fabric of clean room garments. 1.2 This test method does not apply to nonporous fabrics such as Tyvek or Gortex. It only applies to fabrics that are porous such as cotton or polyester. 1.3 The values stated in SI units are to be regarded as the standard. The inch-pound values given in parentheses are for information only. 1.4 This test method provides not only the traditional optical microscopic analysis but also a size distribution and surface obscuration analysis for particles on a fine-textured membrane filter or in a tape lift sample. It utilizes transmitted illumination to render all particles darker than the background for gray level detection. Particles collected on opaque plates must be transferred to a suitable membrane filter. This standard may involve hazardous materials, operations, and equipment. This standard does not purport to address all of the safety concerns, if any, associat...

  10. The influence of body size on adult skeletal age estimation methods.

    Science.gov (United States)

    Merritt, Catherine E

    2015-01-01

    Accurate age estimations are essential to archaeological and forensic analyses. However, reliability for adult skeletal age estimations is poor, especially for individuals over the age of 40 years. This is the first study to show that body size influences skeletal age estimation. The İşcan et al., Lovejoy et al., Buckberry and Chamberlain, and Suchey-Brooks age methods were tested on 764 adult skeletons from the Hamann-Todd and William Bass Collections. Statures ranged from 1.30 to 1.93 m and body masses ranged from 24.0 to 99.8 kg. Transition analysis was used to evaluate the differences in the age estimations. For all four methods, the smallest individuals have the lowest ages at transition and the largest individuals have the highest ages at transition. Short and light individuals are consistently underaged, while tall and heavy individuals are consistently overaged. When femoral length and femoral head diameter are compared with the log-age model, results show the same trend as the known stature and body mass measurements. The skeletal remains of underweight individuals have fewer age markers while those of obese individuals have increased surface degeneration and osteophytic lipping. Tissue type and mechanical loading have been shown to affect bone turnover rates, and may explain the differing patterns of skeletal aging. From an archaeological perspective, the underaging of light, short individuals suggests the need to revisit the current research consensus on the young mortality rates of past populations. From a forensic perspective, understanding the influence of body size will impact efforts to identify victims of mass disasters, genocides, and homicides. © 2014 Wiley Periodicals, Inc.

  11. Estimativa da área foliar de Crambe abyssinica por discos foliares e por fotos digitais Estimate leaf area of Crambe abyssinica for leaf discs and digital photos

    Directory of Open Access Journals (Sweden)

    Marcos Toebe

    2010-02-01

    Full Text Available A área foliar é importante na determinação do crescimento e desenvolvimento das culturas agrícolas. Assim, os objetivos do trabalho foram comparar os métodos de discos foliares e de fotos digitais na estimativa da área foliar de Crambe abyssinica e modelar a área foliar em função do comprimento (C, da largura (L e ou do produto comprimento vezes largura (CxL de diferentes tamanhos de folhas. Para isso, em 308 folhas, foram determinados a área foliar, o comprimento, a largura e o produto comprimento vezes largura por meio dos métodos de discos foliares e de fotos digitais. Em seguida, foram comparados os métodos por meio do coeficiente de correlação linear entre a área foliar. A seguir, em cada método, modelou-se a área foliar (Y em função do C, da L e do CxL, por meio dos modelos: linear, linear simples, quadrático, geométrico e exponencial. Os coeficientes de correlação linear de Pearson e de Spearman entre a área foliar dos métodos de discos foliares e de fotos digitais foram de 0,9917 e 0,9889, respectivamente, o que revela métodos concordantes. Em ambos os métodos, os modelos quadráticos e geométricos apresentaram os melhores coeficientes de determinação da área foliar em função do comprimento e da largura das folhas. A largura da folha é a variável que melhor estima a área foliar. O método de fotos digitais pode ser utilizado para estimar a área foliar de crambe.Leaf area is important in determining the growth and development of agricultural crops. The aim of this study was to compare the methods of leaf discs and digital photos in estimating leaf area of Crambe abyssinica, and model leaf area according to length (C, width (L and/ or the product of length width (CxL for different sizes of leaves. For this, in 308 leaves it was determined the leaf area, length, width and the product of length width using the methods of leaf discs and digital photos. Then the methods were compared using the linear

  12. Population size estimation of men who have sex with men through the network scale-up method in Japan.

    Directory of Open Access Journals (Sweden)

    Satoshi Ezoe

    Full Text Available BACKGROUND: Men who have sex with men (MSM are one of the groups most at risk for HIV infection in Japan. However, size estimates of MSM populations have not been conducted with sufficient frequency and rigor because of the difficulty, high cost and stigma associated with reaching such populations. This study examined an innovative and simple method for estimating the size of the MSM population in Japan. We combined an internet survey with the network scale-up method, a social network method for estimating the size of hard-to-reach populations, for the first time in Japan. METHODS AND FINDINGS: An internet survey was conducted among 1,500 internet users who registered with a nationwide internet-research agency. The survey participants were asked how many members of particular groups with known population sizes (firepersons, police officers, and military personnel they knew as acquaintances. The participants were also asked to identify the number of their acquaintances whom they understood to be MSM. Using these survey results with the network scale-up method, the personal network size and MSM population size were estimated. The personal network size was estimated to be 363.5 regardless of the sex of the acquaintances and 174.0 for only male acquaintances. The estimated MSM prevalence among the total male population in Japan was 0.0402% without adjustment, and 2.87% after adjusting for the transmission error of MSM. CONCLUSIONS: The estimated personal network size and MSM prevalence seen in this study were comparable to those from previous survey results based on the direct-estimation method. Estimating population sizes through combining an internet survey with the network scale-up method appeared to be an effective method from the perspectives of rapidity, simplicity, and low cost as compared with more-conventional methods.

  13. Estimation of leaf traits from reflectance measurements: comparison between methods based on vegetation indices and several versions of the PROSPECT model.

    Science.gov (United States)

    Jiang, Jingyi; Comar, Alexis; Burger, Philippe; Bancal, Pierre; Weiss, Marie; Baret, Frédéric

    2018-01-01

    Leaf biochemical composition corresponds to traits related to the plant state and its functioning. This study puts the emphasis on the main leaf absorbers: chlorophyll a and b ([Formula: see text]), carotenoids ([Formula: see text]), water ([Formula: see text]) and dry mater ([Formula: see text]) contents. Two main approaches were used to estimate [[Formula: see text] [Formula: see text], [Formula: see text], [Formula: see text

  14. Phenotypic Plasticity of Leaf Shape along a Temperature Gradient in Acer rubrum

    Science.gov (United States)

    Royer, Dana L.; Meyerson, Laura A.; Robertson, Kevin M.; Adams, Jonathan M.

    2009-01-01

    Both phenotypic plasticity and genetic determination can be important for understanding how plants respond to environmental change. However, little is known about the plastic response of leaf teeth and leaf dissection to temperature. This gap is critical because these leaf traits are commonly used to reconstruct paleoclimate from fossils, and such studies tacitly assume that traits measured from fossils reflect the environment at the time of their deposition, even during periods of rapid climate change. We measured leaf size and shape in Acer rubrum derived from four seed sources with a broad temperature range and grown for two years in two gardens with contrasting climates (Rhode Island and Florida). Leaves in the Rhode Island garden have more teeth and are more highly dissected than leaves in Florida from the same seed source. Plasticity in these variables accounts for at least 6–19 % of the total variance, while genetic differences among ecotypes probably account for at most 69–87 %. This study highlights the role of phenotypic plasticity in leaf-climate relationships. We suggest that variables related to tooth count and leaf dissection in A. rubrum can respond quickly to climate change, which increases confidence in paleoclimate methods that use these variables. PMID:19893620

  15. Method development and validation for measuring the particle size distribution of pentaerythritol tetranitrate (PETN) powders.

    Energy Technology Data Exchange (ETDEWEB)

    Young, Sharissa Gay

    2005-09-01

    Currently, the critical particle properties of pentaerythritol tetranitrate (PETN) that influence deflagration-to-detonation time in exploding bridge wire detonators (EBW) are not known in sufficient detail to allow development of a predictive failure model. The specific surface area (SSA) of many PETN powders has been measured using both permeametry and gas absorption methods and has been found to have a critical effect on EBW detonator performance. The permeametry measure of SSA is a function of particle shape, packed bed pore geometry, and particle size distribution (PSD). Yet there is a general lack of agreement in PSD measurements between laboratories, raising concerns regarding collaboration and complicating efforts to understand changes in EBW performance related to powder properties. Benchmarking of data between laboratories that routinely perform detailed PSD characterization of powder samples and the determination of the most appropriate method to measure each PETN powder are necessary to discern correlations between performance and powder properties and to collaborate with partnering laboratories. To this end, a comparison was made of the PSD measured by three laboratories using their own standard procedures for light scattering instruments. Three PETN powder samples with different surface areas and particle morphologies were characterized. Differences in bulk PSD data generated by each laboratory were found to result from variations in sonication of the samples during preparation. The effect of this sonication was found to depend on particle morphology of the PETN samples, being deleterious to some PETN samples and advantageous for others in moderation. Discrepancies in the submicron-sized particle characterization data were related to an instrument-specific artifact particular to one laboratory. The type of carrier fluid used by each laboratory to suspend the PETN particles for the light scattering measurement had no consistent effect on the resulting

  16. Remote Sensing of Seagrass Leaf Area Index and Species: The Capability of a Model Inversion Method Assessed by Sensitivity Analysis and Hyperspectral Data of Florida Bay

    Directory of Open Access Journals (Sweden)

    John D. Hedley

    2017-11-01

    Full Text Available The capability for mapping two species of seagrass, Thalassia testudinium and Syringodium filiforme, by remote sensing using a physics based model inversion method was investigated. The model was based on a three-dimensional canopy model combined with a model for the overlying water column. The model included uncertainty propagation based on variation in leaf reflectances, canopy structure, water column properties, and the air-water interface. The uncertainty propagation enabled both a-priori predictive sensitivity analysis of potential capability and the generation of per-pixel error bars when applied to imagery. A primary aim of the work was to compare the sensitivity analysis to results achieved in a practical application using airborne hyperspectral data, to gain insight on the validity of sensitivity analyses in general. Results showed that while the sensitivity analysis predicted a weak but positive discrimination capability for species, in a practical application the relevant spectral differences were extremely small compared to discrepancies in the radiometric alignment of the model with the imagery—even though this alignment was very good. Complex interactions between spectral matching and uncertainty propagation also introduced biases. Ability to discriminate LAI was good, and comparable to previously published methods using different approaches. The main limitation in this respect was spatial alignment with the imagery with in situ data, which was heterogeneous on scales of a few meters. The results provide insight on the limitations of physics based inversion methods and seagrass mapping in general. Complex models can degrade unpredictably when radiometric alignment of the model and imagery is not perfect and incorporating uncertainties can have non-intuitive impacts on method performance. Sensitivity analyses are upper bounds to practical capability, incorporating a term for potential systematic errors in radiometric alignment may

  17. Does leaf chemistry differentially affect breakdown in tropical vs temperate streams? Importance of standardized analytical techniques to measure leaf chemistry

    Science.gov (United States)

    Marcelo Ard& #243; n; Catherine M. Pringle; Susan L. Eggert

    2009-01-01

    Comparisons of the effects of leaf litter chemistry on leaf breakdown rates in tropical vs temperate streams are hindered by incompatibility among studies and across sites of analytical methods used to measure leaf chemistry. We used standardized analytical techniques to measure chemistry and breakdown rate of leaves from common riparian tree species at 2 sites, 1...

  18. Heats of Formation of Medium-Size Organic Compounds from Contemporary Electronic Structure Methods

    KAUST Repository

    Minenkov, Yury; Wang, Heng; Wang, Zhandong; Sarathy, Mani; Cavallo, Luigi

    2017-01-01

    Computational electronic structure calculations are routinely undertaken to predict thermodynamic properties of the various species. However, the application of highly accurate wave function theory methods, such as the “gold standard” coupled cluster approach including single, double and partly triple excitations in perturbative fashion, CCSD(T), to large molecules is limited due to high computational cost. In this work, the promising domain based local pair natural orbital coupled cluster approach, DLPNO-CCSD(T), has been tested to reproduce 113 accurate formation enthalpies of medium-size molecules (few dozens heavy atoms) important for bio- and combustion chemistry via the reaction based Feller-Peterson-Dixon approach. As for comparison, 8 density functional theory (B3LYP, B3LYP-D3, PBE0, PBE0-D3, M06, M06-2X, ωB97X-D3, and ωB97M-V) and MP2-based (B2PLYP-D3, PWPB95-D3, B2T-PLYP, B2T-PLYP-D, B2GP-PLYP, DSD-PBEP86-D3, SCS-MP2, and OO-SCS-MP2) methods have been tested. The worst performance has been obtained for the standard hybrid DFT functionals, PBE0 (Mean unsigned error (MUE)/ Mean Signed Error (MSE)=9.1/6.0 kcal/mol) and B3LYP (MUE/MSE=13.5/-13.3 kcal/mol). An influence of an empirical dispersion correction term on these functionals performance is not homogenous: B3LYP performance is improved (B3LYP-D3 (MUE/MSE=6.0/0.8 kcal/mol)) meanwhile PBE0 performance is worse (PBE0-D3 (MUE/MSE=14.1/13.6 kcal/mol)). The Minnesota functionals, M06 (MUE/MSE=3.8/-2.0 kcal/mol) and M06-2X (MUE/MSE=3.5/3.0 kcal/mol), and recently developed ωB97X-D3 (MUE/MSE=3.2/0.2 kcal/mol) and ωB97M-V (MUE/MSE=2.2/1.3 kcal/mol) methods provided significantly better formation enthalpies. Enthalpies of similar quality can also be obtained from some double hybrid methods (B2PLYP-D3 (MUE/MSE=4.7/2.0 kcal/mol), PWPB95-D3 (MUE/MSE=4.3/3.2 kcal/mol), B2T-PLYP (MUE/MSE=4.1/-3.0 kcal/mol) and B2T-PLYP-D (MUE/MSE=3.3/1.7 kcal/mol)). The two spin component scaled (SCS) MP2 methods resulted in

  19. Heats of Formation of Medium-Size Organic Compounds from Contemporary Electronic Structure Methods

    KAUST Repository

    Minenkov, Yury

    2017-06-21

    Computational electronic structure calculations are routinely undertaken to predict thermodynamic properties of the various species. However, the application of highly accurate wave function theory methods, such as the “gold standard” coupled cluster approach including single, double and partly triple excitations in perturbative fashion, CCSD(T), to large molecules is limited due to high computational cost. In this work, the promising domain based local pair natural orbital coupled cluster approach, DLPNO-CCSD(T), has been tested to reproduce 113 accurate formation enthalpies of medium-size molecules (few dozens heavy atoms) important for bio- and combustion chemistry via the reaction based Feller-Peterson-Dixon approach. As for comparison, 8 density functional theory (B3LYP, B3LYP-D3, PBE0, PBE0-D3, M06, M06-2X, ωB97X-D3, and ωB97M-V) and MP2-based (B2PLYP-D3, PWPB95-D3, B2T-PLYP, B2T-PLYP-D, B2GP-PLYP, DSD-PBEP86-D3, SCS-MP2, and OO-SCS-MP2) methods have been tested. The worst performance has been obtained for the standard hybrid DFT functionals, PBE0 (Mean unsigned error (MUE)/ Mean Signed Error (MSE)=9.1/6.0 kcal/mol) and B3LYP (MUE/MSE=13.5/-13.3 kcal/mol). An influence of an empirical dispersion correction term on these functionals performance is not homogenous: B3LYP performance is improved (B3LYP-D3 (MUE/MSE=6.0/0.8 kcal/mol)) meanwhile PBE0 performance is worse (PBE0-D3 (MUE/MSE=14.1/13.6 kcal/mol)). The Minnesota functionals, M06 (MUE/MSE=3.8/-2.0 kcal/mol) and M06-2X (MUE/MSE=3.5/3.0 kcal/mol), and recently developed ωB97X-D3 (MUE/MSE=3.2/0.2 kcal/mol) and ωB97M-V (MUE/MSE=2.2/1.3 kcal/mol) methods provided significantly better formation enthalpies. Enthalpies of similar quality can also be obtained from some double hybrid methods (B2PLYP-D3 (MUE/MSE=4.7/2.0 kcal/mol), PWPB95-D3 (MUE/MSE=4.3/3.2 kcal/mol), B2T-PLYP (MUE/MSE=4.1/-3.0 kcal/mol) and B2T-PLYP-D (MUE/MSE=3.3/1.7 kcal/mol)). The two spin component scaled (SCS) MP2 methods resulted in

  20. Standardized Polyalthia longifolia leaf extract (PLME) inhibits cell proliferation and promotes apoptosis: The anti-cancer study with various microscopy methods.

    Science.gov (United States)

    Vijayarathna, Soundararajan; Chen, Yeng; Kanwar, Jagat R; Sasidharan, Sreenivasan

    2017-07-01

    Over the years a number of microscopy methods have been developed to assess the changes in cells. Some non-invasive techniques such as holographic digital microscopy (HDM), which although does not destroy the cells, but helps to monitor the events that leads to initiation of apoptotic cell death. In this study, the apoptogenic property and the cytotoxic effect of P. longifolia leaf methanolic extract (PLME) against the human cervical carcinoma cells (HeLa) was studied using light microscope (LM), holographic digital microscopy (HDM), scanning electron microscope (SEM) and transmission electron microscope (TEM). The average IC 50 value of PLME against HeLa cells obtained by MTT and CyQuant assay was 22.00μg/mL at 24h. However, noncancerous Vero cells tested with PLME exhibited no cytotoxicity with the IC 50 value of 51.07μg/mL at 24h by using MTT assay. Cytological observations showed nuclear condensation, cell shrinkage, multinucleation, abnormalities of mitochondrial cristae, membrane blebbing, disappearance of microvilli and filopodia, narrowing of lamellipodia, holes, formation of numerous smaller vacuoles, cytoplasmic extrusions and formation of apoptotic bodies as confirmed collectively by HDM, LM, SEM and TEM. In conclusion, PLME was able to produce distinctive morphological features of HeLa cell death that corresponds to apoptosis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  1. Use of NAP gene to manipulate leaf senescence in plants

    Science.gov (United States)

    Gan, Susheng; Guo, Yongfeng

    2013-04-16

    The present invention discloses transgenic plants having an altered level of NAP protein compared to that of a non-transgenic plant, where the transgenic plants display an altered leaf senescence phenotype relative to a non-transgenic plant, as well as mutant plants comprising an inactivated NAP gene, where mutant plants display a delayed leaf senescence phenotype compared to that of a non-mutant plant. The present invention also discloses methods for delaying leaf senescence in a plant, as well as methods of making a mutant plant having a decreased level of NAP protein compared to that of a non-mutant plant, where the mutant plant displays a delayed leaf senescence phenotype relative to a non-mutant plant. Methods for causing precocious leaf senescence or promoting leaf senescence in a plant are also disclosed. Also disclosed are methods of identifying a candidate plant suitable for breeding that displays a delayed leaf senescence and/or enhanced yield phenotype.

  2. Standardization and validation of a novel and simple method to assess lumbar dural sac size

    International Nuclear Information System (INIS)

    Daniels, M.L.A.; Lowe, J.R.; Roy, P.; Patrone, M.V.; Conyers, J.M.; Fine, J.P.; Knowles, M.R.; Birchard, K.R.

    2015-01-01

    Aim: To develop and validate a simple, reproducible method to assess dural sac size using standard imaging technology. Materials and methods: This study was institutional review board-approved. Two readers, blinded to the diagnoses, measured anterior–posterior (AP) and transverse (TR) dural sac diameter (DSD), and AP vertebral body diameter (VBD) of the lumbar vertebrae using MRI images from 53 control patients with pre-existing MRI examinations, 19 prospectively MRI-imaged healthy controls, and 24 patients with Marfan syndrome with prior MRI or CT lumbar spine imaging. Statistical analysis utilized linear and logistic regression, Pearson correlation, and receiver operating characteristic (ROC) curves. Results: AP-DSD and TR-DSD measurements were reproducible between two readers (r = 0.91 and 0.87, respectively). DSD (L1–L5) was not different between male and female controls in the AP or TR plane (p = 0.43; p = 0.40, respectively), and did not vary by age (p = 0.62; p = 0.25) or height (p = 0.64; p = 0.32). AP-VBD was greater in males versus females (p = 1.5 × 10 −8 ), resulting in a smaller dural sac ratio (DSR) (DSD/VBD) in males (p = 5.8 × 10 −6 ). Marfan patients had larger AP-DSDs and TR-DSDs than controls (p = 5.9 × 10 −9 ; p = 6.5 × 10 −9 , respectively). Compared to DSR, AP-DSD and TR-DSD better discriminate Marfan from control subjects based on area under the curve (AUC) values from unadjusted ROCs (AP-DSD p < 0.01; TR-DSD p = 0.04). Conclusion: Individual vertebrae and L1–L5 (average) AP-DSD and TR-DSD measurements are simple, reliable, and reproducible for quantitating dural sac size without needing to control for gender, age, or height. - Highlights: • DSD (L1-L5) does not differ in the AP or TR plane by gender, height, or age. • AP- and TR-DSD measures correlate well between readers with different experience. • Height is positively correlated to AP-VBD in both males and females. • Varying

  3. Simultaneous quantification of flavonoids in blood plasma by a high-performance liquid chromatography method after oral administration of Blumea balsamifera leaf extracts in rats.

    Science.gov (United States)

    Nessa, Fazilatun; Ismail, Zhari; Mohamed, Nornisah; Karupiah, Sundram

    2013-03-01

    The leaves of Blumea balsamifera are used as a folk medicine in kidney stone diseases in South-East Asia. Phytochemical investigation revealed leaves contained a number of flavonoids. In view of these, the present work was aimed to quantify and preliminary pharmacokinetic investigation of five flavonoids viz. dihydroquercetin-7,4¢-dimethyl ether (I), dihydroquercetin-4¢-methyl ether (II), 5,7,3¢,5¢-tetrahydroxyflavanone (III), blumeatin (IV) and quercetin (V) in rat plasma following oral administration (0.5g/Kg) of B. balsamifera leaf extract in rats. Quantification was achieved by using a validated, reproducible high-performance liquid chromatographic method. The mean recoveries of I, II, III, IV and V were 90.6, 93.4, 93.5, 91.2 and 90.3% respectively. The limit of quantification was 25 ng/mL for I and IV, 10 ng/mL for II and III and 100 ng/mL for V respectively. The within day and day-to-day precision for all the compounds were HPLC method herein was applied for pharmacokinetic studies and the main pharmacokinetic parameters were: t1/2 (hr) 5.8, 4.3, 2.9, 5.7 and 7.3, Cmax (ng/mL) 594.9, 1542.9 1659.9, 208.9 and 3040.4; Tmax (hr) 4.7, 1.0, 1.0, 3.5 and 2.3; AUC0-oo (ng hr/mL) 5040, 5893, 9260, 1064 and 27233 for I, II, III, IV and V respectively. The developed method was suitable for pharmacokinetic studies and this preliminary study also revealed significant absorption after oral dosing in rats.

  4. Reasons for discontinuation of contraceptive methods among couples with different family size and educational status.

    Science.gov (United States)

    Rizvi, Farwa; Irfan, Ghazia

    2012-01-01

    High rates of contraceptive discontinuation for reasons other than the desire for pregnancy are a public health concern because of their association with negative reproductive health outcomes. The objective of this study was to determine reasons for discontinuation of contraceptive methods among couples with different family size and educational status. This cross-sectional study was carried out at the Obstetrics/Gynaecology Out-Patient Department of Pakistan Institute of Medical Sciences, Islamabad from April-September 2012. Patients (241) were selected by consecutive sampling after informed written consent and acquiring approval of Ethical Committee. The survey interview tool was a semi-structured questionnaire. Majority (68%) of women belonged to urban, and the rest were from rural areas. Mean age of these women was 29.43 +/- 5.384 year. Reasons for discontinuation of contraceptives included fear of injectable contraceptives (2.9%), contraceptive failure/pregnancy (7.46%), desire to become pregnant (63.48%), husband away at job (2.49%), health concerns/side effects (16.18%), affordability (0.83%), inconvenient to use (1.24%), acceptability (0.83%) and accessibility/lack of information (4.56%). Association of different reasons of discontinuation (chi square test) with the family size (actual number of children) was significant (p = 0.019) but was not significant with husband's or wife's educational status (p = 0.33 and 0.285 respectively). Keeping in mind the complex socioeconomic conditions in our country, Family planning programmers and stake holders need to identify women who strongly want to avoid a pregnancy and finding ways to help the couples successfully initiate and maintain appropriate contraceptive use.

  5. A method for rapid testing of the photosynthesis-inhibiting activity of herbicides by leaf disk infiltration

    Directory of Open Access Journals (Sweden)

    Krzysztof Bielecki

    2013-12-01

    Full Text Available A method for rapid detection of photosynthesis inhibitors in low concentration (0.25-1.25 ppm was developed. The experiments were performed on disks cut from young bean leaves. The disks were infiltrated with solutions of the tested compounds and placed at the bottom of a crystallizer containing an acidic sodium carbonate solution and then illuminated. The toxicity of the tested substance was measured as the number of disks corning to the surface. It was found that linuron, monolinuron, metoksuron, atrazine and prometrine inhibited floating of the disks, whereas 2,4,5-T, MCPA and chlorpropham gave no effect. This confirms the specificity of the test which is appropriate for determining the phytotoxicity of typical photosynthesis inhibitors.

  6. THE FORMATION OF A MILKY WAY-SIZED DISK GALAXY. I. A COMPARISON OF NUMERICAL METHODS

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Qirong; Li, Yuexing, E-mail: qxz125@psu.edu [Department of Astronomy and Astrophysics, The Pennsylvania State University, 525 Davey Lab, University Park, PA 16802 (United States)

    2016-11-01

    The long-standing challenge of creating a Milky Way- (MW-) like disk galaxy from cosmological simulations has motivated significant developments in both numerical methods and physical models. We investigate these two fundamental aspects in a new comparison project using a set of cosmological hydrodynamic simulations of an MW-sized galaxy. In this study, we focus on the comparison of two particle-based hydrodynamics methods: an improved smoothed particle hydrodynamics (SPH) code Gadget, and a Lagrangian Meshless Finite-Mass (MFM) code Gizmo. All the simulations in this paper use the same initial conditions and physical models, which include star formation, “energy-driven” outflows, metal-dependent cooling, stellar evolution, and metal enrichment. We find that both numerical schemes produce a late-type galaxy with extended gaseous and stellar disks. However, notable differences are present in a wide range of galaxy properties and their evolution, including star-formation history, gas content, disk structure, and kinematics. Compared to Gizmo, the Gadget simulation produced a larger fraction of cold, dense gas at high redshift which fuels rapid star formation and results in a higher stellar mass by 20% and a lower gas fraction by 10% at z = 0, and the resulting gas disk is smoother and more coherent in rotation due to damping of turbulent motion by the numerical viscosity in SPH, in contrast to the Gizmo simulation, which shows a more prominent spiral structure. Given its better convergence properties and lower computational cost, we argue that the MFM method is a promising alternative to SPH in cosmological hydrodynamic simulations.

  7. Leaf litter production of mahogany along street and campus forest of Universitas Negeri Semarang, Indonesia

    Science.gov (United States)

    Martin, F. P.; Abdullah, M.; Solichin; Hadiyanti, L. N.; Widianingrum, K.

    2018-03-01

    The leaf litter of trees along the existing streets on campus UNNES if not managed properly will be scattered and become garbage. Leaf litter Production in UNNES campus is not known for certain. UNNES does not own mapping of leaf litter Production of dominant tree species on campus. This cause leaf waste management is not optimal yet. There is still a lot of leaf litter that is discharged (not processed) because it exceeds the capacity of the fertilizer production equipment in the compost house. Aims of this study were to examine leaf litter production of dominant trees in Universitas Negeri Semarang and evaluate the relationship between leaf litter and average rainfall. Purposive sampling method placed pouches of nylon gauze measuring 1 × 1 mm2 as litter trap container with size 1 x l m2 (10 points mounted along street and campus forest). Litter trap mounted at the height of 50 cm above ground level. Leaf litter will be taken once a week for three months to observe the litter production. The litter was then dried by the oven at 70 ° C for 48 hours to obtain constant dry weight. Based on the results of the research, it was known that Mahogany tree in UNNES campus area has the potential to produce the litter of about 10 ton/ha / 3months in campus forest area and 2.5 ton/ha / 3months along campus street. There is a significant relationship between litter production of Mahogany leaves and precipitation during August - October 2017.

  8. Green synthesis and characterization of silver nanoparticles using Lantana camara leaf extract

    International Nuclear Information System (INIS)

    Ajitha, B.; Ashok Kumar Reddy, Y.; Sreedhara Reddy, P.

    2015-01-01

    In this work, we have investigated on Lantana camara mediated silver nanoparticles (AgNPs) with different leaf extract (LE) quantity for the evaluation of efficient bactericidal activity. The AgNPs were prepared by simple, capable, eco-friendly and biosynthesis method using L. camara LE. This method allowed the synthesis of crystalline nanoparticles, which was confirmed by X-ray diffraction (XRD) and selected area electron diffraction (SAED) patterns. The X-ray photoelectron spectroscopy (XPS) analysis confirmed the formation of metallic silver and elucidates the surface state composition of AgNPs. UV–vis spectra of AgNPs and visual perception of brownish yellow color from colorless reaction mixture confirmed the AgNP formation. Involvement of functional groups of L. camara leaf extract in the reduction and capping process of nanoparticles was well displayed in Fourier transform infrared spectroscopy (FTIR). Decrement of particle size with an increment of leaf extract volume was evident in AFM, TEM images and also through a blue shift in the UV–vis spectra. The rate of formation and size of AgNPs were dependent on LE quantity. Meanwhile, these AgNPs exhibited effective antibacterial activity with the decrement of particle size against all tested bacterial cultures. - Highlights: • Monodispersed AgNPs are synthesized using L. camara leaf extract. • The higher the L. camara content, the smaller the particle size. • Green synthesized AgNPs are found to be photoluminescent. • Size dependence of antibacterial activity is reported. • The nanoparticle stability is improved by leaf extract quantity

  9. Green synthesis and characterization of silver nanoparticles using Lantana camara leaf extract

    Energy Technology Data Exchange (ETDEWEB)

    Ajitha, B., E-mail: ajithabondu@gmail.com [Department of Physics, Sri Venkateswara University, Tirupati 517502 (India); Ashok Kumar Reddy, Y. [Department of Electrical Engineering, Korea Advanced Institute of Science and Technology, 335 Gwahangno, Yuseong-gu, Daejeon 305-701 (Korea, Republic of); Sreedhara Reddy, P. [Department of Physics, Sri Venkateswara University, Tirupati 517502 (India)

    2015-04-01

    In this work, we have investigated on Lantana camara mediated silver nanoparticles (AgNPs) with different leaf extract (LE) quantity for the evaluation of efficient bactericidal activity. The AgNPs were prepared by simple, capable, eco-friendly and biosynthesis method using L. camara LE. This method allowed the synthesis of crystalline nanoparticles, which was confirmed by X-ray diffraction (XRD) and selected area electron diffraction (SAED) patterns. The X-ray photoelectron spectroscopy (XPS) analysis confirmed the formation of metallic silver and elucidates the surface state composition of AgNPs. UV–vis spectra of AgNPs and visual perception of brownish yellow color from colorless reaction mixture confirmed the AgNP formation. Involvement of functional groups of L. camara leaf extract in the reduction and capping process of nanoparticles was well displayed in Fourier transform infrared spectroscopy (FTIR). Decrement of particle size with an increment of leaf extract volume was evident in AFM, TEM images and also through a blue shift in the UV–vis spectra. The rate of formation and size of AgNPs were dependent on LE quantity. Meanwhile, these AgNPs exhibited effective antibacterial activity with the decrement of particle size against all tested bacterial cultures. - Highlights: • Monodispersed AgNPs are synthesized using L. camara leaf extract. • The higher the L. camara content, the smaller the particle size. • Green synthesized AgNPs are found to be photoluminescent. • Size dependence of antibacterial activity is reported. • The nanoparticle stability is improved by leaf extract quantity.

  10. The efficacy of Carica papaya leaf extract on some bacterial and a fungal strain by well diffusion method

    Directory of Open Access Journals (Sweden)

    C. Baskaran

    2012-10-01

    Full Text Available Objective: To investigate the antimicrobial activity and phytochemical screening Ethanol, methanol, Ethyl acetate, acetone, chloroform, Petroleum ether, hexane, hot water, and extracts of Carica papaya. Methods: The aim of the present study was to evaluate the qualitative analysis of phytochemicals and antimicrobial activity of various solvent extracts of Carica papaya. The antimicrobial activities of different solvent extracts of Carica papaya were tested against the Gram-positive and Gram-negative bacterial strains and fungus by observing the zone of inhibition. The Gram-positive bacteria used in the test were Staphylococcus aureus, Bacillus cereus and Micrococcus luteus, and the Gram-negative bacteria were Escherichia coli, and Klebsiella pneumoniae, fungus like Aspergillus niger, Aspergillus flavus, Candida albicans, Candida tropicalis, Cryptococcus neoformans, and Candida kefyr. Results: It was observed that ethanol, methanol, ethyl acetate, aceton, chloroform, petroleum ether, hexane and aquas extracts showed activity against bacteria and fungus. The chloroform extract of Carica papaya showed more activity against Micrococcus luteus, zone of diameter 15.17暲0.29mm and acetone extract of Carica papaya showed more activity against Candida albicans, zone of diameter 11.23暲0.25mm compared to other solvent extracts. Conclusions: In this study chloroform extract in bacteria and acetone extract in fungus showed a varying degree of inhibition to the growth of tested organism, than Ethanol, methanol, Ethyl acetate, Petroleum ether, hexane and hot water extracts. The results confirmed the presence of antibacterial and antifungal activity of Carica papaya extract against various human pathogenic bacteria. Presences of phytochemical and antimicrobial activity are confirmed.

  11. Effects of Different LiDAR Intensity Normalization Methods on Scotch Pine Forest Leaf Area Index Estimation

    Directory of Open Access Journals (Sweden)

    YOU Haotian

    2018-02-01

    Full Text Available The intensity data of airborne light detection and ranging (LiDAR are affected by many factors during the acquisition process. It is of great significance for the normalization and application of LiDAR intensity data to study the effective quantification and normalization of the effect from each factor. In this paper, the LiDAR data were normalized with range, angel of incidence, range and angle of incidence based on radar equation, respectively. Then two metrics, including canopy intensity sum and ratio of intensity, were extracted and used to estimate forest LAI, which was aimed at quantifying the effects of intensity normalization on forest LAI estimation. It was found that the range intensity normalization could improve the accuracy of forest LAI estimation. While the angle of incidence intensity normalization did not improve the accuracy and made the results worse. Although the range and incidence angle normalized intensity data could improve the accuracy, the improvement was less than the result of range intensity normalization. Meanwhile, the differences between the results of forest LAI estimation from raw intensity data and normalized intensity data were relatively big for canopy intensity sum metrics. However, the differences were relatively small for the ratio of intensity metrics. The results demonstrated that the effects of intensity normalization on forest LAI estimation were depended on the choice of affecting factor, and the influential level is closely related to the characteristics of metrics used. Therefore, the appropriate method of intensity normalization should be chosen according to the characteristics of metrics used in the future research, which could avoid the waste of cost and the reduction of estimation accuracy caused by the introduction of inappropriate affecting factors into intensity normalization.

  12. Measuring the sizes of nanospheres on a rough surface by using atomic force microscopy and a curvature-reconstruction method

    International Nuclear Information System (INIS)

    Oikawa, Koudai; Kim, Hyonchol; Watanabe, Naoya; Shigeno, Masatsugu; Shirakawabe, Yoshiharu; Yasuda, Kenji

    2007-01-01

    One of the advantages of atomic force microscopy (AFM) is that it can accurately measure the heights of targets on flat substrates. It is difficult, however, to determine the shape of nanoparticles on rough surfaces. We therefore propose a curvature-reconstruction method that estimates the sizes of particles by fitting sphere curvatures acquired from raw AFM data. We evaluated this fitting estimation using 15-, 30-, and 50-nm gold nanoparticles on mica and confirmed that particle sizes could be estimated within 5% from 20% of their curvature measured using a carbon nanotube (CNT) tip. We also estimated the sizes of nanoparticles on the rough surface of dried cells and found we also can estimate the size of those particles within 5%, which is difficult when we only used the height information. The results indicate the size of nanoparticles even on rough surfaces can be measured by using our method and a CNT tip

  13. Performance and separation occurrence of binary probit regression estimator using maximum likelihood method and Firths approach under different sample size

    Science.gov (United States)

    Lusiana, Evellin Dewi

    2017-12-01

    The parameters of binary probit regression model are commonly estimated by using Maximum Likelihood Estimation (MLE) method. However, MLE method has limitation if the binary data contains separation. Separation is the condition where there are one or several independent variables that exactly grouped the categories in binary response. It will result the estimators of MLE method become non-convergent, so that they cannot be used in modeling. One of the effort to resolve the separation is using Firths approach instead. This research has two aims. First, to identify the chance of separation occurrence in binary probit regression model between MLE method and Firths approach. Second, to compare the performance of binary probit regression model estimator that obtained by MLE method and Firths approach using RMSE criteria. Those are performed using simulation method and under different sample size. The results showed that the chance of separation occurrence in MLE method for small sample size is higher than Firths approach. On the other hand, for larger sample size, the probability decreased and relatively identic between MLE method and Firths approach. Meanwhile, Firths estimators have smaller RMSE than MLEs especially for smaller sample sizes. But for larger sample sizes, the RMSEs are not much different. It means that Firths estimators outperformed MLE estimator.

  14. Pixel-size-maintained image reconstruction of digital holograms on arbitrarily tilted planes by the angular spectrum method.

    Science.gov (United States)

    Jeong, Seung Jun; Hong, Chung Ki

    2008-06-01

    We present an effective method for the pixel-size-maintained reconstruction of images on arbitrarily tilted planes in digital holography. The method is based on the plane wave expansion of the diffraction wave fields and the three-axis rotation of the wave vectors. The images on the tilted planes are reconstructed without loss of the frequency contents of the hologram and have the same pixel sizes. Our method shows good results in the extreme cases of large tilting angles and in the region closer than the paraxial case. The effectiveness of the method is demonstrated by both simulation and experiment.

  15. Size of the coming solar cycle 24 based on Ohl's Precursor Method, final estimate

    Directory of Open Access Journals (Sweden)

    R. P. Kane

    2010-07-01

    Full Text Available In Ohl's Precursor Method (Ohl, 1966, 1976, the geomagnetic activity during the declining phase of a sunspot cycle is shown to be well correlated with the size (maximum sunspot number Rz(max of the next cycle. For solar cycle 24, Kane (2007a used aa(min=15.5 (12-month running mean, which occurred during March–May of 2006 and made a preliminary estimate Rz(max=124±26 (12-month running mean. However, in the next few months, the aa index first increased and then decreased to a new low value of 14.8 in July 2007. With this new low value, the prediction was Rz(max=117±26 (12-month running mean. However, even this proved a false signal. Since then, the aa values have decreased considerably and the last 12-monthly value is 8.7, centered at May 2009. For solar cycle 24, using aa(min=8.7, the latest prediction is, Rz(max=58.0±25.0.

  16. Body size distribution in ground beetles (Coleoptera: Carabidae) as a possible monitoring method of environmental impacts of transgenic maize

    DEFF Research Database (Denmark)

    Grumo, Davide di; Lövei, Gabor L.

    2015-01-01

    Despite the obligatory post-market environmental monitoring of genetically modified (GM) crops in Europe, there are no available standards on methods. Our aim was to examine the suitability of using changes in carabid body size distribution as a possible monitoring method. The sampling was carried...... informative Lorenz asymmetry coefficients. A total of 6339 carabids belonging to 38 species were captured and indentified. The analysis detected a shift in size distribution between months but no important differences in the assemblages in Bt vs. non-Bt maize plots were found. We concluded that an increasing...... body size trend from spring to autumn was evident, and the use of a multilevel analysis was important to correctly interpret the body size distribution. Therefore, the proposed methods are indeed sensitive to subtle changes in the structure of the carabid assemblages, and they have the potential...

  17. Fission track dating of volcanic glass: experimental evidence for the validity of the Size-Correction Method

    International Nuclear Information System (INIS)

    Bernardes, C.; Hadler Neto, J.C.; Lattes, C.M.G.; Araya, A.M.O.; Bigazzi, G.; Cesar, M.F.

    1986-01-01

    Two techniques may be employed for correcting thermally lowered fission track ages on glass material: the so called 'size-correcting method' and 'Plateau method'. Several results from fission track dating on obsidian were analysed in order to compare the model rising size-correction method with experimental evidences. The results from this work can be summarized as follows: 1) The assumption that mean size of spontaneous and induced etched tracks are equal on samples unaffected by partial fading is supported by experimental results. If reactor effects such as an enhancing of the etching rate in the irradiated fraction due to the radiation damage and/or to the fact that induced fission releases a quantity of energy slightly greater than spontaneous one exist, their influence on size-correction method is very small. 2) The above two correction techniques produce concordant results. 3) Several samples from the same obsidian, affected by 'instantaneous' as well as 'continuous' natural fading to different degrees were analysed: the curve showing decreasing of spontaneous track mean-size vs. fraction of spontaneous tracks lost by fading is in close agreement with the correction curve constructed for the same obsidian by imparting artificial thermal treatements on induced tracks. By the above points one can conclude that the assumptions on which size-correction method is based are well supported, at least in first approximation. (Author) [pt

  18. Modern methods of evaluation existing suppliers and suppliers selected by customer for small and medium-sized companies

    Directory of Open Access Journals (Sweden)

    Marie Jurová

    2010-01-01

    Full Text Available On existing conditions on global market (almost identical quality, almost identical purchasing values companies have to definite the total rating of importance of evaluative criteria. In post-crisis period the problem of suppliers’ evaluation is one of the biggest, because companies had to use all resources and all possibilities to develop their own business. Many authors wrote about collaborative planning and warehousing as one of possibilities to optimization work inside supply chain. For this paper define small and medium-sized enterprises (SME as enterprises with the size of maximum 250 em­ployers. In literature was read we couldn’t find information about own system of suppliers evaluation for small and medium-sized enterprises. SME can have some different types of business and in this case need the universal system of eva­lua­tion. The research of this paper is oriented on small and medium-sized enterprises with different types of business. The new theoretical universal method of calculation for evaluation existing suppliers for small and medium-sized enterprises will present in this paper. This theoretical method is based on average values. This method includes traditional evaluative criteria (quality, delivery time and other (mobility of supplier, possibilities of new level of partnership. This method of evaluation can not be used for continual manufacture. New method can improve the total evaluation of supplier in small and medium-sized enterprises.

  19. The measurement of activity-weighted size distributions of radon progeny: methods and laboratory intercomparison studies

    International Nuclear Information System (INIS)

    Hopke, P.K.; Strydom, R.; Ramamurthi, M.; Knutson, E.O.; Tu, K.W.; Scofield, P.; Holub, R.F.; Cheng, Y.S.; Su, Y.F.; Winklmayr, W.

    1992-01-01

    Over the past 5 y, there have been significant improvements in measurement of activity-weighted size distributions of airborne radon decay products. The modification of screen diffusion batteries to incorporate multiple screens of differing mesh number, called graded screen arrays, have permitted improved size resolution below 10 nm such that the size distributions can now be determined down to molecular sized activities (0.5 nm). In order to ascertain the utility and reliability of such systems, several intercomparison tests have been performed in a 2.4 m3 radon chamber in which particles of varying size have been produced by introducing SO2 and H2O along with the radon to the chamber. In April 1988, intercomparison studies were performed between direct measurements of the activity-weighted size distributions as measured by graded screen arrays and an indirect measurement of the distribution obtained by measuring the number size distribution with a differential mobility analyzer and multiplying by the theoretical attachment rate. Good agreement was obtained in these measurements. A second set of intercomparison studies among a number of groups with graded screen array systems was made in April 1989 with the objective of resolving spectral structure below 10 nm. Again, generally good agreement among the various groups was obtained although some differences were noted. It is thus concluded that such systems can be constructed and can be useful in making routine measurements of activity-weighted size distributions with reasonable confidence in the results obtained

  20. Relating Stomatal Conductance to Leaf Functional Traits.

    Science.gov (United States)

    Kröber, Wenzel; Plath, Isa; Heklau, Heike; Bruelheide, Helge

    2015-10-12

    Leaf functional traits are important because they reflect physiological functions, such as transpiration and carbon assimilation. In particular, morphological leaf traits have the potential to summarize plants strategies in terms of water use efficiency, growth pattern and nutrient use. The leaf economics spectrum (LES) is a recognized framework in functional plant ecology and reflects a gradient of increasing specific leaf area (SLA), leaf nitrogen, phosphorus and cation content, and decreasing leaf dry matter content (LDMC) and carbon nitrogen ratio (CN). The LES describes different strategies ranging from that of short-lived leaves with high photosynthetic capacity per leaf mass to long-lived leaves with low mass-based carbon assimilation rates. However, traits that are not included in the LES might provide additional information on the species' physiology, such as those related to stomatal control. Protocols are presented for a wide range of leaf functional traits, including traits of the LES, but also traits that are independent of the LES. In particular, a new method is introduced that relates the plants' regulatory behavior in stomatal conductance to vapor pressure deficit. The resulting parameters of stomatal regulation can then be compared to the LES and other plant functional traits. The results show that functional leaf traits of the LES were also valid predictors for the parameters of stomatal regulation. For example, leaf carbon concentration was positively related to the vapor pressure deficit (vpd) at the point of inflection and the maximum of the conductance-vpd curve. However, traits that are not included in the LES added information in explaining parameters of stomatal control: the vpd at the point of inflection of the conductance-vpd curve was lower for species with higher stomatal density and higher stomatal index. Overall, stomata and vein traits were more powerful predictors for explaining stomatal regulation than traits used in the LES.

  1. Preparation and magnetic properties of nano size nickel ferrite particles using hydrothermal method

    Directory of Open Access Journals (Sweden)

    Nejati Kamellia

    2012-03-01

    Full Text Available Abstract Background Nickel ferrite, a kind of soft magnetic materials is one of the most attracting class of materials due to its interesting and important properties and has many technical applications, such as in catalysis, sensors and so on. In this paper the synthesis of NiFe2O4 nanoparticles by the hydrothermal method is reported and the inhibition of surfactant (Glycerol or Sodium dodecyl sulfate on the particles growth is investigated. Methods For investigation of the inhibition effect of surfactant on NiFe2O4 particles growth, the samples were prepared in presence of Glycerol and Sodium dodecyl sulfate. The X-ray powder diffraction (XRD, transmission electron microscopy (TEM, Fourier transform infrared spectroscopy (FT-IR, vibrating sample magnetometer (VSM and inductively coupled plasma atomic emission spectrometer (ICP-AES techniques were used to characterize the samples. Results The results of XRD and ICP-AES show that the products were pure NiFe2O4 and also nanoparticles grow with increasing the temperature, while surfactant prevents the particle growth under the same condition. The average particle size was determined from the Scherrer's equation and TEM micrographs and found to be in the range of 50-60 nm that decreased up to 10-15 nm in presence of surfactant. The FT-IR results show two absorption bands near to 603 and 490 cm-1 for the tetrahedral and octahedral sites respectively. Furthermore, the saturated magnetization and coercivity of NiFe2O4 nanoparticles were in the range of 39.60 emu/g and 15.67 Qe that decreased for samples prepared in presence of surfactant. As well as, the nanoparticles exhibited a superparamagnetic behavior at room temperature. Conclusions Nanosized nickel ferrite particles were synthesized with and without surfactant assisted hydrothermal methods. The results show that with increasing of temperature, the crystallinity of nanoparticles is increased. In the presence of surfactants, the crystallinity of

  2. Antioxidant Activity and Cytotoxicity of the Leaf and Bark Extracts of ...

    African Journals Online (AJOL)

    Purpose: To investigate the antioxidant potential and cytotoxicity of the leaf and bark extracts of Tarchonanathus campharatus.. Methods: The antioxidant activity of the aqueous leaf extract (Aq LF), methanol leaf extract (MET LF), dichloromethane leaf extract (DCM LF), methanol bark extract (MET BK), dichloromethane bark ...

  3. The Nano-Sized In2O3 Powder Synthesis by Sol-Gel Method

    Institute of Scientific and Technical Information of China (English)

    潘庆谊; 程知萱; 等

    2002-01-01

    Wiwh InCl3·4H2O being used as raw materials,the precursor of nano-sized In2O3 powder was prepared by hydrolysis,peptization and gelation of InCl3·4H2O.After calcination,nano-sized In2O3 powder was obtained.The powder was characterized by thermogravimetric and differential thermal analysis(TG-DTA).X-ray diffractometry(XRD)and transmission electron microscopy(TEM),respectively,Calculation revealed that the mean crystablline size increased with increasing the calcination temperature,but crystal lattice distortion rate decreased with the increasing in the average crystalline size.This indicated that the smaller the particle size,the bigger the crystal lattice distortion,the worse the crystal growing.The activation energies for growth of nano-sized In2O3 were calculated to be 4.75kJ·mol-1 at the calcination temperature up tp 500℃ and 66.40kJ· mol-1 at the calcination temperature over 600℃.TEM photos revealed that the addition of the chemical additive(OP-10)greatly influenced the morphology and size of In2O3 particles.

  4. The Asymptotic Behavior of Particle Size Distribution Undergoing Brownian Coagulation Based on the Spline-Based Method and TEMOM Model

    Directory of Open Access Journals (Sweden)

    Qing He

    2018-01-01

    Full Text Available In this paper, the particle size distribution is reconstructed using finite moments based on a converted spline-based method, in which the number of linear system of equations to be solved reduced from 4m × 4m to (m + 3 × (m + 3 for (m + 1 nodes by using cubic spline compared to the original method. The results are verified by comparing with the reference firstly. Then coupling with the Taylor-series expansion moment method, the evolution of particle size distribution undergoing Brownian coagulation and its asymptotic behavior are investigated.

  5. The feasibility of using explicit method for linear correction of the particle size variation using NIR Spectroscopy combined with PLS2regression method

    Science.gov (United States)

    Yulia, M.; Suhandy, D.

    2018-03-01

    NIR spectra obtained from spectral data acquisition system contains both chemical information of samples as well as physical information of the samples, such as particle size and bulk density. Several methods have been established for developing calibration models that can compensate for sample physical information variations. One common approach is to include physical information variation in the calibration model both explicitly and implicitly. The objective of this study was to evaluate the feasibility of using explicit method to compensate the influence of different particle size of coffee powder in NIR calibration model performance. A number of 220 coffee powder samples with two different types of coffee (civet and non-civet) and two different particle sizes (212 and 500 µm) were prepared. Spectral data was acquired using NIR spectrometer equipped with an integrating sphere for diffuse reflectance measurement. A discrimination method based on PLS-DA was conducted and the influence of different particle size on the performance of PLS-DA was investigated. In explicit method, we add directly the particle size as predicted variable results in an X block containing only the NIR spectra and a Y block containing the particle size and type of coffee. The explicit inclusion of the particle size into the calibration model is expected to improve the accuracy of type of coffee determination. The result shows that using explicit method the quality of the developed calibration model for type of coffee determination is a little bit superior with coefficient of determination (R2) = 0.99 and root mean square error of cross-validation (RMSECV) = 0.041. The performance of the PLS2 calibration model for type of coffee determination with particle size compensation was quite good and able to predict the type of coffee in two different particle sizes with relatively high R2 pred values. The prediction also resulted in low bias and RMSEP values.

  6. Evaluation of Jacaranda mimosifolia T. (Stans) leaf meal as ...

    African Journals Online (AJOL)

    The economic benefit analysis indicated that as the leaf meal increased in the diets the cost of production of the broilers decreased. Jacaranda leaf meal could be best utilized at 5.0% level of inclusion though the 7.5% levels broilers attained market size in a recorded time. Animal Production Research Advances Vol.

  7. Bamboo leaf ash as the stabilizer for soft soil treatment

    Science.gov (United States)

    Rahman, A. S. A.; Jais, I. B. M.; Sidek, N.; Ahmad, J.; Rosli, M. I. F.

    2018-04-01

    Soft soil is a type of soil that have the size of particle less than 0.063mm. The strength of the soft soil does not fulfil the requirement for construction. The present of soft soil at the construction site always give a lot of problems and issues to geotechnical sector. Soil settlement is one of the problems that related to soft soil. The determination of the soft soil physical characteristics will provide a detail description on its characteristic. Soft soil need to be treated in order to gain the standard strength for construction. One of the method to strengthen the soft soil is by using pozzolanic material as a treatment method for soft soil. Furthermore bamboo leaf ash is one of the newly founded materials that contain pozzolanic material. Any material that consist of Silicon Dioxide (SiO2) as the main component and followed by Aluminium Oxide (Al2O3) and Iron Oxide (Fe2O3) are consider as pozzolanic material. Bamboo leaf ash is mix with the cement as the treatment material. Bamboo leaf ash will react with the cement to produce additional cement binder. Thus, it will increase the soil strength and will ease the geotechnical sector to achieve high quality of construction product.

  8. Seagrass leaf element content

    NARCIS (Netherlands)

    Vonk, J.A.; Smulders, Fee O.H.; Christianen, Marjolijn J.A.; Govers, Laura L.

    2017-01-01

    Knowledge on the role of seagrass leaf elements and in particular micronutrients and their ranges is limited. We present a global database, consisting of 1126 unique leaf values for ten elements, obtained from literature and unpublished data, spanning 25 different seagrass species from 28 countries.

  9. Method of evaluating the success of the small and medium-sized enterprises

    Directory of Open Access Journals (Sweden)

    Aleš Peprný

    2010-01-01

    Full Text Available At the time of increasing globalization and homogenization of the global markets, the development of information infrastructure technology and world market becomes accessible not only to large multinational companies but also for small and medium-sized enterprises (SMEs. This has resulted in increasing competition in the domestic market which domestic firms have to face. Therefore the pro­cess of internationalization of business is a step that allows businesses performing their activities in the domestic market to enter foreign markets and to exploit the opportunities and potential which these markets offer. The paper is focused on the draft of the method for quantification of the factors, which determine the success of the SMEs in foreign markets. In the proposed method the multidimensional assessment of indicators of success of SMEs in foreign markets are used, ie. not only the proportion of sales from exports is observed, but also the profitability of international activities in an absolute and in a relative rate. Other indicators of success are the satisfaction of the company management with international activities and the success of achieving defined targets for business activities in foreign markets. Evaluation is made up of both the objective and the subjective indicators of success. Among the objective indicators of success is included the intensity of international activities of SMEs, which is detected as the sum of revenues generated from international activities in relation to total sales company, the profitability of international activities, (ie. whether the foreign activities are profitable or not, and the relative profitability of international activities, where it is ascertained whether the foreign activities generate higher profit than the activities at the domestic market. The next subjective indicator of success is the success of objectives - it was found how many objectives related to operations in foreign markets has been

  10. Particle size distribution of iron nanomaterials in biological medium by SR-SAXS method

    International Nuclear Information System (INIS)

    Jing Long; Feng Weiyue; Wang Bing; Wang Meng; Ouyang Hong; Zhao Yuliang; Chai Zhifang; Wang Yun; Wang Huajiang; Zhu Motao; Wu Zhonghua

    2009-01-01

    A better understanding of biological effects of nanomaterials in organisms requests knowledge of the physicochemical properties of nanomaterials in biological systems. Affected by high concentration salts and proteins in biological medium, nanoparticles are much easy to agglomerate,hence the difficulties in characterizing size distribution of the nanomaterials in biological medium.In this work, synchrotron radiation small angle X-ray scattering(SR-SAXS) was used to determine size distributions of Fe, Fe 2 O 3 and Fe 3 O 4 nanoparticles of various concentrations in PBS and DMEM culture medium. The results show that size distributions of the nanomaterials could perfectly analyzed by SR-SAXS. The SR-SAXS data were not affected by the particle content and types of the dispersion medium.It is concluded that SR-SAXS can be used for size measurement of nanomaterials in unstable dispersion systems. (authors)

  11. Size-controlled fluorescent nanodiamonds: A facile method of fabrication and color-center counting

    KAUST Repository

    Mahfouz, Remi; Floyd, Daniel L.; Peng, Wei; Choy, Jennifer; Lončar, Marko; Bakr, Osman

    2013-01-01

    findings suggest that nanocrystal size separation by DGU may be used to control the number of defects per nanocrystal. The efficient approaches described herein to control and quantify DCCs are valuable to researchers as they explore applications for color

  12. Using spectral methods to obtain particle size information from optical data: applications to measurements from CARES 2010

    Science.gov (United States)

    Atkinson, Dean B.; Pekour, Mikhail; Chand, Duli; Radney, James G.; Kolesar, Katheryn R.; Zhang, Qi; Setyan, Ari; O'Neill, Norman T.; Cappa, Christopher D.

    2018-04-01

    Multi-wavelength in situ aerosol extinction, absorption and scattering measurements made at two ground sites during the 2010 Carbonaceous Aerosols and Radiative Effects Study (CARES) are analyzed using a spectral deconvolution method that allows extraction of particle-size-related information, including the fraction of extinction produced by the fine-mode particles and the effective radius of the fine mode. The spectral deconvolution method is typically applied to analysis of remote sensing measurements. Here, its application to in situ measurements allows for comparison with more direct measurement methods and validation of the retrieval approach. Overall, the retrieved fine-mode fraction and effective radius compare well with other in situ measurements, including size distribution measurements and scattering and absorption measurements made separately for PM1 and PM10, although there were some periods during which the different methods yielded different results. One key contributor to differences between the results obtained is the alternative, spectrally based definitions of fine and coarse modes from the optical methods, relative to instruments that use a physically defined cut point. These results indicate that for campaigns where size, composition and multi-wavelength optical property measurements are made, comparison of the results can result in closure or can identify unusual circumstances. The comparison here also demonstrates that in situ multi-wavelength optical property measurements can be used to determine information about particle size distributions in situations where direct size distribution measurements are not available.

  13. Using spectral methods to obtain particle size information from optical data: applications to measurements from CARES 2010

    Directory of Open Access Journals (Sweden)

    D. B. Atkinson

    2018-04-01

    Full Text Available Multi-wavelength in situ aerosol extinction, absorption and scattering measurements made at two ground sites during the 2010 Carbonaceous Aerosols and Radiative Effects Study (CARES are analyzed using a spectral deconvolution method that allows extraction of particle-size-related information, including the fraction of extinction produced by the fine-mode particles and the effective radius of the fine mode. The spectral deconvolution method is typically applied to analysis of remote sensing measurements. Here, its application to in situ measurements allows for comparison with more direct measurement methods and validation of the retrieval approach. Overall, the retrieved fine-mode fraction and effective radius compare well with other in situ measurements, including size distribution measurements and scattering and absorption measurements made separately for PM1 and PM10, although there were some periods during which the different methods yielded different results. One key contributor to differences between the results obtained is the alternative, spectrally based definitions of fine and coarse modes from the optical methods, relative to instruments that use a physically defined cut point. These results indicate that for campaigns where size, composition and multi-wavelength optical property measurements are made, comparison of the results can result in closure or can identify unusual circumstances. The comparison here also demonstrates that in situ multi-wavelength optical property measurements can be used to determine information about particle size distributions in situations where direct size distribution measurements are not available.

  14. Synthesis of nano-sized amorphous boron powders through active dilution self-propagating high-temperature synthesis method

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jilin [The State Key Laboratory of Advanced Technology for Materials Synthesis and Processing, Wuhan University of Technology, Wuhan 430070 (China); Gu, Yunle [School of Material Science and Engineering, Wuhan Institute of Technology, Wuhan 430073 (China); Li, Zili [The State Key Laboratory of Advanced Technology for Materials Synthesis and Processing, Wuhan University of Technology, Wuhan 430070 (China); Wang, Weimin, E-mail: wangwm@hotmail.com [The State Key Laboratory of Advanced Technology for Materials Synthesis and Processing, Wuhan University of Technology, Wuhan 430070 (China); Fu, Zhengyi [The State Key Laboratory of Advanced Technology for Materials Synthesis and Processing, Wuhan University of Technology, Wuhan 430070 (China)

    2013-06-01

    Graphical abstract: Nano-sized amorphous boron powders were synthesized by active dilution self-propagating high-temperature synthesis (SHS) method. The effects of endothermic reaction rate, the possible chemical reaction mechanism and active dilution model for synthesis of the product were also discussed. Highlights: ► Nano-sized amorphous boron powders were synthesized by active dilution self-propagating high-temperature synthesis method. ► The morphology, particle size and purity of the samples could be effectively controlled via changing the endothermic rate. ► The diluter KBH{sub 4} played an important role in active dilution synthesis of amorphous nano-sized boron powders. ► The active dilution method could be further popularized and become a common approach to prepare various inorganic materials. - Abstract: Nano-sized amorphous boron powders were synthesized by active dilution self-propagating high-temperature synthesis (SHS) method at temperatures ranging from 700 °C to 850 °C in a SHS furnace using Mg, B{sub 2}O{sub 3} and KBH{sub 4} as raw materials. Samples were characterized by X-ray powder diffraction (XRD), Laser particle size analyzer, Fourier transform infrared spectra (FTIR), X-ray energy dispersive spectroscopy (EDX), scanning electron microscopy (SEM), transmission electron microscopy (TEM) and high-resolution transmission TEM (HRTEM). The boron powders demonstrated an average particle size of 50 nm with a purity of 95.64 wt.%. The diluter KBH{sub 4} played an important role in the active dilution synthesis of amorphous nano-sized boron powders. The effects of endothermic reaction rate, the possible chemical reaction mechanism and active dilution model for synthesis of the product were also discussed.

  15. Synthesis of nano-sized amorphous boron powders through active dilution self-propagating high-temperature synthesis method

    International Nuclear Information System (INIS)

    Wang, Jilin; Gu, Yunle; Li, Zili; Wang, Weimin; Fu, Zhengyi

    2013-01-01

    Graphical abstract: Nano-sized amorphous boron powders were synthesized by active dilution self-propagating high-temperature synthesis (SHS) method. The effects of endothermic reaction rate, the possible chemical reaction mechanism and active dilution model for synthesis of the product were also discussed. Highlights: ► Nano-sized amorphous boron powders were synthesized by active dilution self-propagating high-temperature synthesis method. ► The morphology, particle size and purity of the samples could be effectively controlled via changing the endothermic rate. ► The diluter KBH 4 played an important role in active dilution synthesis of amorphous nano-sized boron powders. ► The active dilution method could be further popularized and become a common approach to prepare various inorganic materials. - Abstract: Nano-sized amorphous boron powders were synthesized by active dilution self-propagating high-temperature synthesis (SHS) method at temperatures ranging from 700 °C to 850 °C in a SHS furnace using Mg, B 2 O 3 and KBH 4 as raw materials. Samples were characterized by X-ray powder diffraction (XRD), Laser particle size analyzer, Fourier transform infrared spectra (FTIR), X-ray energy dispersive spectroscopy (EDX), scanning electron microscopy (SEM), transmission electron microscopy (TEM) and high-resolution transmission TEM (HRTEM). The boron powders demonstrated an average particle size of 50 nm with a purity of 95.64 wt.%. The diluter KBH 4 played an important role in the active dilution synthesis of amorphous nano-sized boron powders. The effects of endothermic reaction rate, the possible chemical reaction mechanism and active dilution model for synthesis of the product were also discussed

  16. Proposal for element size and time increment selection guideline by 3-D finite element method for elastic waves propagation analysis

    International Nuclear Information System (INIS)

    Ishida, Hitoshi; Meshii, Toshiyuki

    2008-01-01

    This paper proposes a guideline for selection of element size and time increment by 3-D finite element method, which is applied to elastic wave propagation analysis for a long distance of a large structure. An element size and a time increment are determined by quantitative evaluation of strain, which must be 0 on the analysis model with a uniform motion, caused by spatial and time discretization. (author)

  17. Adaptive step-size algorithm for Fourier beam-propagation method with absorbing boundary layer of auto-determined width.

    Science.gov (United States)

    Learn, R; Feigenbaum, E

    2016-06-01

    Two algorithms that enhance the utility of the absorbing boundary layer are presented, mainly in the framework of the Fourier beam-propagation method. One is an automated boundary layer width selector that chooses a near-optimal boundary size based on the initial beam shape. The second algorithm adjusts the propagation step sizes based on the beam shape at the beginning of each step in order to reduce aliasing artifacts.

  18. Offer a novel method for size appraise of NiO nanoparticles by PL analysis: Synthesis by sonochemical method

    Directory of Open Access Journals (Sweden)

    Seyid Javad Musevi

    2016-05-01

    Full Text Available In this work, we will discuss the optical properties of NiO nanoparticles that we have investigated recently by photoluminescence (PL spectroscopy. In particular, we will show the blue-shifts of PL, originating from the electron–hole recombination of the self-trapped exciton (STE, observed in smaller-sized NiO nanoparticles. To explain the size effect in relating to the STE PL shift, a question has been raised on whether it is appropriate to apply him quantum confinement (QC theory usually used for the Mott-Winner type excitons in semiconductors to wide band-gap material, such as silica. Variations in several parameters and their effects on the structural (crystal size and morphology properties of nanoparticles were investigated. Characterizations were carried out by X-ray diffraction (XRD, scanning electron microscopy (SEM, thermal stability (TGA and DTA, solid state UV and solid state florescent (PL.

  19. Bipartite networks improve understanding of effects of waterbody size and angling method on angler–fish interactions

    Science.gov (United States)

    Chizinski, Christopher J.; Martin, Dustin R.; Shizuka, Daizaburo; Pope, Kevin L.

    2018-01-01

    Networks used to study interactions could provide insights to fisheries. We compiled data from 27 297 interviews of anglers across waterbodies that ranged in size from 1 to 12 113 ha. Catch rates of fish species among anglers grouped by species targeted generally differed between angling methods (bank or boat). We constructed angler–catch bipartite networks (angling method specific) between anglers and fish and measured several network metrics. There was considerable variation in networks among waterbodies, with multiple metrics influenced by waterbody size. Number of species-targeting angler groups and number of fish species caught increased with increasing waterbody size. Mean number of links for species-targeting angler groups and fish species caught also increased with waterbody size. Connectance (realized proportion of possible links) of angler–catch interaction networks decreased slower for boat anglers than for bank anglers with increasing waterbody size. Network specialization (deviation of number of interactions from expected) was not significantly related to waterbody size or angling methods. Application of bipartite networks in fishery science requires careful interpretation of outputs, especially considering the numerous confounding factors prevalent in recreational fisheries.

  20. Evaluation of a Lagrangian Soot Tracking Method for the prediction of primary soot particle size under engine-like conditions

    DEFF Research Database (Denmark)

    Cai Ong, Jiun; Pang, Kar Mun; Walther, Jens Honore

    2018-01-01

    This paper reports the implementation and evaluation of a Lagrangian soot tracking (LST) method for the modeling of soot in diesel engines. The LST model employed here has the tracking capability of a Lagrangian method and the ability to predict primary soot particle sizing. The Moss-Brookes soot...... in predicting temporal soot cloud development, mean soot diameter and primary soot size distribution is evaluated using measurements of n-heptane and n-dodecane spray combustion obtained under diesel engine-like conditions. In addition, sensitivity studies are carried out to investigate the influence of soot....... A higher rate of soot oxidation due to OH causes the soot particles to be fully oxidized downstream of the flame. In general, the LST model performs better than the Eulerian method in terms of predicting soot sizing and accessing information of individual soot particles, both of which are shortcomings...

  1. Reliable and Accurate Release of Micro-Sized Objects with a Gripper that Uses the Capillary-Force Method

    Directory of Open Access Journals (Sweden)

    Suzana Uran

    2017-06-01

    Full Text Available There have been recent developments in grippers that are based on capillary force and condensed water droplets. These are used for manipulating micro-sized objects. Recently, one-finger grippers have been produced that are able to reliably grip using the capillary force. To release objects, either the van der Waals, gravitational or inertial-forces method is used. This article presents methods for reliably gripping and releasing micro-objects using the capillary force. The moisture from the surrounding air is condensed into a thin layer of water on the contact surfaces of the objects. From the thin layer of water, a water meniscus between the micro-sized object, the gripper and the releasing surface is created. Consequently, the water meniscus between the object and the releasing surface produces a high enough capillary force to release the micro-sized object from the tip of the one-finger gripper. In this case, either polystyrene, glass beads with diameters between 5–60 µm, or irregularly shaped dust particles of similar sizes were used. 3D structures made up of micro-sized objects could be constructed using this method. This method is reliable for releasing during assembly and also for gripping, when the objects are removed from the top of the 3D structure—the so-called “disassembling gripping” process. The accuracy of the release was lower than 0.5 µm.

  2. Leaf surface anatomy in some woody plants from northeastern Mexico

    International Nuclear Information System (INIS)

    Maiti, R.; Rodriguez, H.G.; Balboa, P.C.R.; Kumari, A

    2016-01-01

    Studies on leaf surface anatomy of woody plants and its significance are rare. The present study was undertaken in the Forest Science Faculty Experimental Research Station, UANL, Mexico, with objectives to determine the variability in leaf surface anatomy in the woody plants of the Tamaulipan thornscrub and its utility in taxonomy and possible adaptation to the prevailing semiarid conditions. The results show the presence of large variability in several leaf anatomical traits viz., waxy leaf surface, type of stomata, its size, and distribution. The species have been classified on the basis of various traits which can be used in species delimitation and adaptation to the semiarid condition such as waxy leaf surface, absence sparse stomata on the leaf surface, sunken stomata. The species identified as better adapters to semi-arid environments on the basis of the presence and absence of stomata on both adaxial and abaxial surface viz., Eysenhardtia texana, Parkinsonia texana, Gymnosperma glutinosum, Celtis laevigata, Condalia hookeri and Karwinskia humboldtiana. (author)

  3. Correlação entre composição das fôlhas e produção, e tamanho de frutos, em laranjeira baianinha Correlation between leaf composition and yields, and orange fruit sizes, as affected by fertilization

    Directory of Open Access Journals (Sweden)

    J. Romano Gallo

    1966-01-01

    significant: 1. Leaf nitrogen with yields (weights, r = 0.35**. 2. Leaf nitrogen with number of fruits, r = 0.40**. 3. Leaf nitrogen with fruit sizes (average weights, r = - 0.36**. 4. Leaf potassium with fruit sizes (average weights, r = 0.52**. 5. Leaf calcium with fruit yields (weights, r = 0.51**. Leaf phosphorus was not significantly correlated with yields (weights, number of fruits, or fruit sizes.

  4. Simplified Method of Optimal Sizing of a Renewable Energy Hybrid System for Schools

    Directory of Open Access Journals (Sweden)

    Jiyeon Kim

    2016-11-01

    Full Text Available Schools are a suitable public building for renewable energy systems. Renewable energy hybrid systems (REHSs have recently been introduced in schools following a new national regulation that mandates renewable energy utilization. An REHS combines the common renewable-energy sources such as geothermal heat pumps, solar collectors for water heating, and photovoltaic systems with conventional energy systems (i.e., boilers and air-source heat pumps. Optimal design of an REHS by adequate sizing is not a trivial task because it usually requires intensive work including detailed simulation and demand/supply analysis. This type of simulation-based approach for optimization is difficult to implement in practice. To address this, this paper proposes simplified sizing equations for renewable-energy systems of REHSs. A conventional optimization process is used to calculate the optimal combinations of an REHS for cases of different numbers of classrooms and budgets. On the basis of the results, simplified sizing equations that use only the number of classrooms as the input are proposed by regression analysis. A verification test was carried out using an initial conventional optimization process. The results show that the simplified sizing equations predict similar sizing results to the initial process, consequently showing similar capital costs within a 2% error.

  5. SU-E-T-247: Multi-Leaf Collimator Model Adjustments Improve Small Field Dosimetry in VMAT Plans

    Energy Technology Data Exchange (ETDEWEB)

    Young, L; Yang, F [University of Washington, Seattle, WA (United States)

    2014-06-01

    Purpose: The Elekta beam modulator linac employs a 4-mm micro multileaf collimator (MLC) backed by a fixed jaw. Out-of-field dose discrepancies between treatment planning system (TPS) calculations and output water phantom measurements are caused by the 1-mm leaf gap required for all moving MLCs in a VMAT arc. In this study, MLC parameters are optimized to improve TPS out-of-field dose approximations. Methods: Static 2.4 cm square fields were created with a 1-mm leaf gap for MLCs that would normally park behind the jaw. Doses in the open field and leaf gap were measured with an A16 micro ion chamber and EDR2 film for comparison with corresponding point doses in the Pinnacle TPS. The MLC offset table and tip radius were adjusted until TPS point doses agreed with photon measurements. Improvements to the beam models were tested using static arcs consisting of square fields ranging from 1.6 to 14.0 cm, with 45° collimator rotation, and 1-mm leaf gap to replicate VMAT conditions. Gamma values for the 3-mm distance, 3% dose difference criteria were evaluated using standard QA procedures with a cylindrical detector array. Results: The best agreement in point doses within the leaf gap and open field was achieved by offsetting the default rounded leaf end table by 0.1 cm and adjusting the leaf tip radius to 13 cm. Improvements in TPS models for 6 and 10 MV photon beams were more significant for smaller field sizes 3.6 cm or less where the initial gamma factors progressively increased as field size decreased, i.e. for a 1.6cm field size, the Gamma increased from 56.1% to 98.8%. Conclusion: The MLC optimization techniques developed will achieve greater dosimetric accuracy in small field VMAT treatment plans for fixed jaw linear accelerators. Accurate predictions of dose to organs at risk may reduce adverse effects of radiotherapy.

  6. Methods for studying the focal spot size and resolution of diagnostic X-ray tubes

    International Nuclear Information System (INIS)

    Fairbanks, R.; Doust, C.

    1979-01-01

    Attention is given to techniques appropriate for use in the clinical situation. The focal spot size is critical to geometric unsharpness and hence the quality of the finished radiograph, but pinhole imaging of the focal spot is extremely difficult in clinical practice. The resolution of an X-ray tube, although a function of focal spot size, is of more importance in radiography. A comparison is made of various resolution grids suitable for quality control use in X-ray departments. (U.K.)

  7. An Assessment of Transport Property Estimation Methods for Ammonia–Water Mixtures and Their Influence on Heat Exchanger Size

    DEFF Research Database (Denmark)

    Kærn, Martin Ryhl; Modi, Anish; Jensen, Jonas Kjær

    2015-01-01

    Transport properties of fluids are indispensable for heat exchanger design. The methods for estimating the transport properties of ammonia–water mixtures are not well established in the literature. The few existent methods are developed from none or limited, sometimes inconsistent experimental...... of ammonia–water mixtures. Firstly, the different methods are introduced and compared at various temperatures and pressures. Secondly, their individual influence on the required heat exchanger size (surface area) is investigated. For this purpose, two case studies related to the use of the Kalina cycle...... the interpolative methods in contrast to the corresponding state methods. Nevertheless, all possible mixture transport property combinations used herein resulted in a heat exchanger size within 4.3 % difference for the flue-gas heat recovery boiler, and within 12.3 % difference for the oil-based boiler....

  8. Comparison of COD, R6, and J-contour integral methods of defect assessment, modified to give critical flaw sizes

    International Nuclear Information System (INIS)

    Burdekin, F.M.; Turner, C.E.

    1982-01-01

    A comparative study of the application of different elastic-plastic fracture mechanics methods to the calculation of critical defect sizes in pressure vessels showed widely varying results. The present authors have investigated in detail the reasons for the variations resulting from the use of the CEGB R6, COD design curve, and J-design curve methods to the particular pressure vessel problems. To obtain reasonable agreement between the three methods for the calculation of critical flaw sizes in high stress gradient situations, the published COD method in PD6493 has to be modified to remove its inherent safety factor, and to allow for stress gradients, and a consistent treatment for gross yielding/collapse has to be adopted for all three methods. (author)

  9. Dynamic-MLC leaf control utilizing on-flight intensity calculations: A robust method for real-time IMRT delivery over moving rigid targets

    International Nuclear Information System (INIS)

    McMahon, Ryan; Papiez, Lech; Rangaraj, Dharanipathy

    2007-01-01

    An algorithm is presented that allows for the control of multileaf collimation (MLC) leaves based entirely on real-time calculations of the intensity delivered over the target. The algorithm is capable of efficiently correcting generalized delivery errors without requiring the interruption of delivery (self-correcting trajectories), where a generalized delivery error represents anything that causes a discrepancy between the delivered and intended intensity profiles. The intensity actually delivered over the target is continually compared to its intended value. For each pair of leaves, these comparisons are used to guide the control of the following leaf and keep this discrepancy below a user-specified value. To demonstrate the basic principles of the algorithm, results of corrected delivery are shown for a leading leaf positional error during dynamic-MLC (DMLC) IMRT delivery over a rigid moving target. It is then shown that, with slight modifications, the algorithm can be used to track moving targets in real time. The primary results of this article indicate that the algorithm is capable of accurately delivering DMLC IMRT over a rigid moving target whose motion is (1) completely unknown prior to delivery and (2) not faster than the maximum MLC leaf velocity over extended periods of time. These capabilities are demonstrated for clinically derived intensity profiles and actual tumor motion data, including situations when the target moves in some instances faster than the maximum admissible MLC leaf velocity. The results show that using the algorithm while calculating the delivered intensity every 50 ms will provide a good level of accuracy when delivering IMRT over a rigid moving target translating along the direction of MLC leaf travel. When the maximum velocities of the MLC leaves and target were 4 and 4.2 cm/s, respectively, the resulting error in the two intensity profiles used was 0.1±3.1% and -0.5±2.8% relative to the maximum of the intensity profiles. For

  10. Fluctuations, Finite-Size Effects and the Thermodynamic Limit in Computer Simulations: Revisiting the Spatial Block Analysis Method

    Directory of Open Access Journals (Sweden)

    Maziar Heidari

    2018-03-01

    Full Text Available The spatial block analysis (SBA method has been introduced to efficiently extrapolate thermodynamic quantities from finite-size computer simulations of a large variety of physical systems. In the particular case of simple liquids and liquid mixtures, by subdividing the simulation box into blocks of increasing size and calculating volume-dependent fluctuations of the number of particles, it is possible to extrapolate the bulk isothermal compressibility and Kirkwood–Buff integrals in the thermodynamic limit. Only by explicitly including finite-size effects, ubiquitous in computer simulations, into the SBA method, the extrapolation to the thermodynamic limit can be achieved. In this review, we discuss two of these finite-size effects in the context of the SBA method due to (i the statistical ensemble and (ii the finite integration domains used in computer simulations. To illustrate the method, we consider prototypical liquids and liquid mixtures described by truncated and shifted Lennard–Jones (TSLJ potentials. Furthermore, we show some of the most recent developments of the SBA method, in particular its use to calculate chemical potentials of liquids in a wide range of density/concentration conditions.

  11. Optimal sizing method for constituent elements of stand-alone photovoltaic power systems

    Energy Technology Data Exchange (ETDEWEB)

    Otsuka, Hirotada; Oi, Yoichi [Hokuriku Electric Power Co., Inc. Toyama (Japan)

    1988-12-25

    The purpose of the report was to calculate the optimal volume of constituent elements of stand-alone photovoltaic power systems, based on the distribution of global radiation on an inclined surface (herein-after called flux of solar radiation), which had been previously measured, and the size of load to be supplied. The least power generation cost was calculated, supposing that setting load was 176kWh/month and the loss of load probability (LOLP) was 1%, by using actual amount of solar radiation in May 1985. The cost was divided into two components: one was proportionate to the size of solar cell, and the other was in proportion to the battery volume. And then, the cost of twenty-year operation(TLC) was calculated. The size of array and the battery volume, which minimize the cost, can be determined when TLC is differentiate. Since auxiliary power source is not attached to this system, it is necessary to restrict the load in order to meet the electric power shortage. In case of the cost at construction in 1984, a standard model indicating the least power generation cost is a photovoltaic system with the array size of A=49.0m{sup 2} and the battery volume of Q=568(Ah). 4 refs., 9 figs., 10 tabs.

  12. A novel method for determination of particle size distribution in-process

    Science.gov (United States)

    Salaoru, Tiberiu A.; Li, Mingzhong; Wilkinson, Derek

    2009-07-01

    The pharmaceutical and fine chemicals industries are strongly concerned with the manufacture of high value-added speciality products, often in solid form. On-line measurement of solid particle size is vital for reliable control of product properties. The established techniques, such as laser diffraction or spectral extinction, require dilution of the process suspension when measuring from typical manufacturing streams because of their high concentration. Dilution to facilitate measurement can result in changes of both size and form of particles, especially during production processes such as crystallisation. In spectral extinction, the degree of light scattering and absorption by a suspension is measured. However, for concentrated suspensions the interpretation of light extinction measurements is difficult because of multiple scattering and inter-particle interaction effects and at higher concentrations extinction is essentially total so the technique can no longer be applied. At the same time, scattering by a dispersion also causes a change of phase which affects the real component of the suspension's effective refractive index which is a function of particle size and particle and dispersant refractive indices. In this work, a novel prototype instrument has been developed to measure particle size distribution in concentrated suspensions in-process by measuring suspension refractive index at incidence angles near the onset of total internal reflection. Using this technique, the light beam does not pass through the suspension being measured so suspension turbidity does not impair the measurement.

  13. Controlling coarse woody debris inventory quality: taper and relative size methods

    Science.gov (United States)

    C.W. Woodall; J.A. Westfall

    2008-01-01

    Accurately measuring the dimensions of coarse woody debris (CWD) is critical for ensuring the quality of CWD estimates and, hence, for accurately estimating forest ecosystem attributes (e.g., CWD carbon stocks). To improve the quality of CWD dimensional measurements, the distribution of taper (ratio of change in diameter and length) and relative size (RS; ratio of...

  14. Wavefront-sensor-induced beam size error: physical mechanism, sensitivity-analysis and correction method

    NARCIS (Netherlands)

    Koek, W.D.; Zwet, E.J. van

    2015-01-01

    When using a commonly-used quadri-wave lateral shearing interferometer wavefront sensor (QWLSI WFS) for beam size measurements on a high power CO2 laser, artefacts have been observed in the measured irradiance distribution. The grating in the QWLSI WFS not only generates the diffracted first orders

  15. Measurement for the MLC leaf velocity profile by considering the leaf leakage using a radiographic film

    International Nuclear Information System (INIS)

    Chow, James C L; Grigorov, Grigor N

    2006-01-01

    A method to measure the velocity profile of a multi-leaf collimator (MLC) leaf along its travel range using a radiographic film is reported by considering the intra-leaf leakage. A specific dynamic MLC field with leaves travelling from the field edge to the isocentre line was designed. The field was used to expose a radiographic film, which was then scanned, and the dose profile along the horizontal leaf axis was measured. The velocity at a sampling point on the film can be calculated by considering the horizontal distance between the sampling point and the isocentre line, dose at the sampling point, dose rate of the linear accelerator, the total leaf travel time from the field edge to isocentre line and the pre-measured dose rate of leaf leakage. With the leaf velocities and velocity profiles for all MLC leaves measured routinely, a comprehensive and simple QA for the MLC can be set up to test the consistency of the leaf velocity performance which is essential to the IMRT delivery using a sliding window technique. (note)

  16. Rapid, high-resolution measurement of leaf area and leaf orientation using terrestrial LiDAR scanning data

    International Nuclear Information System (INIS)

    Bailey, Brian N; Mahaffee, Walter F

    2017-01-01

    The rapid evolution of high performance computing technology has allowed for the development of extremely detailed models of the urban and natural environment. Although models can now represent sub-meter-scale variability in environmental geometry, model users are often unable to specify the geometry of real domains at this scale given available measurements. An emerging technology in this field has been the use of terrestrial LiDAR scanning data to rapidly measure the three-dimensional geometry of trees, such as the distribution of leaf area. However, current LiDAR methods suffer from the limitation that they require detailed knowledge of leaf orientation in order to translate projected leaf area into actual leaf area. Common methods for measuring leaf orientation are often tedious or inaccurate, which places constraints on the LiDAR measurement technique. This work presents a new method to simultaneously measure leaf orientation and leaf area within an arbitrarily defined volume using terrestrial LiDAR data. The novelty of the method lies in the direct measurement of the fraction of projected leaf area G from the LiDAR data which is required to relate projected leaf area to total leaf area, and in the new way in which radiation transfer theory is used to calculate leaf area from the LiDAR data. The method was validated by comparing LiDAR-measured leaf area to (1) ‘synthetic’ or computer-generated LiDAR data where the exact area was known, and (2) direct measurements of leaf area in the field using destructive sampling. Overall, agreement between the LiDAR and reference measurements was very good, showing a normalized root-mean-squared-error of about 15% for the synthetic tests, and 13% in the field. (paper)

  17. Genetic characterization of angular leaf spot resistance in selected ...

    African Journals Online (AJOL)

    Mr Tryphone

    2015-10-28

    Oct 28, 2015 ... Angular leaf spot disease (ALS) caused by Pseudocercospora griseola is one ... Author(s) agree that this article remains permanently open access under the terms ... that results in shrivelled seeds of reduced size and quality.

  18. Cross-scale modelling of transpiration from stomata via the leaf boundary layer

    Science.gov (United States)

    Defraeye, Thijs; Derome, Dominique; Verboven, Pieter; Carmeliet, Jan; Nicolai, Bart

    2014-01-01

    Background and Aims Leaf transpiration is a key parameter for understanding land surface–climate interactions, plant stress and plant structure–function relationships. Transpiration takes place at the microscale level, namely via stomata that are distributed discretely over the leaf surface with a very low surface coverage (approx. 0·2–5 %). The present study aims to shed more light on the dependency of the leaf boundary-layer conductance (BLC) on stomatal surface coverage and air speed. Methods An innovative three-dimensional cross-scale modelling approach was applied to investigate convective mass transport from leaves, using computational fluid dynamics. The gap between stomatal and leaf scale was bridged by including all these scales in the same computational model (10−5–10−1 m), which implies explicitly modelling individual stomata. Key Results BLC was strongly dependent on stomatal surface coverage and air speed. Leaf BLC at low surface coverage ratios (CR), typical for stomata, was still relatively high, compared with BLC of a fully wet leaf (hypothetical CR of 100 %). Nevertheless, these conventional BLCs (CR of 100 %), as obtained from experiments or simulations on leaf models, were found to overpredict the convective exchange. In addition, small variations in stomatal CR were found to result in large variations in BLCs. Furthermore, stomata of a certain size exhibited a higher mass transfer rate at lower CRs. Conclusions The proposed cross-scale modelling approach allows us to increase our understanding of transpiration at the sub-leaf level as well as the boundary-layer microclimate in a way currently not feasible experimentally. The influence of stomatal size, aperture and surface density, and also flow-field parameters can be studied using the model, and prospects for further improvement of the model are presented. An important conclusion of the study is that existing measures of conductances (e.g. from artificial leaves) can be

  19. Computer controlled multi-leaf conformation radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Matsuda, T [Tokyo Metropolitan Komagome Hospital (Japan); Inamura, K

    1981-10-01

    A conformation radiotherapy system with 5-split collimators of which openings can be controlled symmetrically by computerized techniques during rotational irradiation by a linear accelerator has been developed. Outline of the system performance and its clinical applications are described as follows. 1. Profile of the system: The hardware is composed of three parts, namely, the multi-split collimator, the electronic data processor, and the interface between those two parts. 1) The multi-leaf collimator is composed of 5 pairs (10 leaves) diaphragms. It can be mounted to the X-ray head of a linear accelerator when used, and can be dismounted after its use. 2) The electronic data processor sends control signal to the collimator according to the 5-leaf target volume data which can be stored into a minifloppy disc through the curve digitizer previously. This part is composed of a) dedicated micro processor, b) I/O expansion unit, c) color CRT display with key board, d) dual mini-floppy disc unit, e) curve digitizer and f) digital plotter for recording and verification of resulted accuracy. 2. Performance of the system: 1) Maximum field size: 15 cm x 15 cm at isocenter. 2) Maximum elongation ratio of the target volume: 3 : 1 when the longer diameter is 15 cm. 3) Control accuracy: Within +-3 mm deviation from planned beam focus at isocenter. 3. Clinical application: The method of treatment planning and clinical advantages of this irradiation method are explained by raising clinical experiences such as treating brain tumor and rectal cancer.

  20. Computer controlled multi-leaf conformation radiotherapy

    International Nuclear Information System (INIS)

    Matsuda, Tadayoshi; Inamura, Kiyonari.

    1981-01-01

    A conformation radiotherapy system with 5-split collimators of which openings can be controlled symmetrically by computerized techniques during rotational irradiation by a linear accelerator has been developed. Outline of the system performance and its clinical applications are described as follows. 1. Profile of the system: The hardware is composed of three parts, namely, the multi-split collimator, the electronic data processor, and the interface between those two parts. 1) The multi-leaf collimator is composed of 5 pairs (10 leaves) diaphragms. It can be mounted to the X-ray head of a linear accelerator when used, and can be dismounted after its use. 2) The electronic data processor sends control signal to the collimator according to the 5-leaf target volume data which can be stored into a minifloppy disc through the curve digitizer previously. This part is composed of a) dedicated micro processor, b) I/O expansion unit, c) color CRT display with key board, d) dual mini-floppy disc unit, e) curve digitizer and f) digital plotter for recording and verification of resulted accuracy. 2. Performance of the system: 1) Maximum field size: 15 cm x 15 cm at isocenter. 2) Maximum elongation ratio of the target volume: 3 : 1 when the longer diameter is 15 cm. 3) Control accuracy: Within +-3 mm deviation from planned beam focus at isocenter. 3. Clinical application: The method of treatment planning and clinical advantages of this irradiation method are explained by raising clinical experiences such as treating brain tumor and rectal cancer. (author)

  1. Evaluation of Indirect Measurement Method of Seasonal Patterns of Leaf Area Index in a High-Density Short Rotation Coppice Culture of Poplar

    Czech Academy of Sciences Publication Activity Database

    Tripathi, Abishek; Fischer, Milan; Orság, Matěj; Marek, Michal V.; Žalud, Zdeněk; Trnka, Miroslav

    2016-01-01

    Roč. 64, č. 2 (2016), s. 549-556 ISSN 1211-8516 R&D Projects: GA MŠk(CZ) LD13030; GA MŠk(CZ) ED1.1.00/02.0073; GA MŠk(CZ) EE2.3.20.0248 Institutional support: RVO:67179843 Keywords : SunScan Plant Canopy Analyzer * litterfall * specific leaf area * poplar clone J-105 Subject RIV: GC - Agronomy

  2. Field test comparison of an autocorrelation technique for determining grain size using a digital 'beachball' camera versus traditional methods

    Science.gov (United States)

    Barnard, P.L.; Rubin, D.M.; Harney, J.; Mustain, N.

    2007-01-01

    This extensive field test of an autocorrelation technique for determining grain size from digital images was conducted using a digital bed-sediment camera, or 'beachball' camera. Using 205 sediment samples and >1200 images from a variety of beaches on the west coast of the US, grain size ranging from sand to granules was measured from field samples using both the autocorrelation technique developed by Rubin [Rubin, D.M., 2004. A simple autocorrelation algorithm for determining grain size from digital images of sediment. Journal of Sedimentary Research, 74(1): 160-165.] and traditional methods (i.e. settling tube analysis, sieving, and point counts). To test the accuracy of the digital-image grain size algorithm, we compared results with manual point counts of an extensive image data set in the Santa Barbara littoral cell. Grain sizes calculated using the autocorrelation algorithm were highly correlated with the point counts of the same images (r2 = 0.93; n = 79) and had an error of only 1%. Comparisons of calculated grain sizes and grain sizes measured from grab samples demonstrated that the autocorrelation technique works well on high-energy dissipative beaches with well-sorted sediment such as in the Pacific Northwest (r2 ??? 0.92; n = 115). On less dissipative, more poorly sorted beaches such as Ocean Beach in San Francisco, results were not as good (r2 ??? 0.70; n = 67; within 3% accuracy). Because the algorithm works well compared with point counts of the same image, the poorer correlation with grab samples must be a result of actual spatial and vertical variability of sediment in the field; closer agreement between grain size in the images and grain size of grab samples can be achieved by increasing the sampling volume of the images (taking more images, distributed over a volume comparable to that of a grab sample). In all field tests the autocorrelation method was able to predict the mean and median grain size with ???96% accuracy, which is more than

  3. Effect of micro-computed tomography voxel size and segmentation method on trabecular bone microstructure measures in mice

    Directory of Open Access Journals (Sweden)

    Blaine A. Christiansen

    2016-12-01

    Full Text Available Micro-computed tomography (μCT is currently the gold standard for determining trabecular bone microstructure in small animal models. Numerous parameters associated with scanning and evaluation of μCT scans can strongly affect morphologic results obtained from bone samples. However, the effect of these parameters on specific trabecular bone outcomes is not well understood. This study investigated the effect of μCT scanning with nominal voxel sizes between 6–30 μm on trabecular bone outcomes quantified in mouse vertebral body trabecular bone. Additionally, two methods for determining a global segmentation threshold were compared: based on qualitative assessment of 2D images, or based on quantitative assessment of image histograms. It was found that nominal voxel size had a strong effect on several commonly reported trabecular bone parameters, in particular connectivity density, trabecular thickness, and bone tissue mineral density. Additionally, the two segmentation methods provided similar trabecular bone outcomes for scans with small nominal voxel sizes, but considerably different outcomes for scans with larger voxel sizes. The Qualitatively Selected segmentation method more consistently estimated trabecular bone volume fraction (BV/TV and trabecular thickness across different voxel sizes, but the Histogram segmentation method more consistently estimated trabecular number, trabecular separation, and structure model index. Altogether, these results suggest that high-resolution scans be used whenever possible to provide the most accurate estimation of trabecular bone microstructure, and that the limitations of accurately determining trabecular bone outcomes should be considered when selecting scan parameters and making conclusions about inter-group variance or between-group differences in studies of trabecular bone microstructure in small animals. Keywords: Trabecular bone, Microstructure, Micro-computed tomography, Voxel size, Resolution

  4. Estimating expenditure on male and female offspring in a sexually size-dimorphic bird : A comparison of different methods

    NARCIS (Netherlands)

    Magrath, Michael J. L.; Van Lieshout, Emile; Pen, Ido; Visser, G. Henk; Komdeur, Jan

    2007-01-01

    1. The parents of sexually size-dimorphic offspring are often assumed to invest more resources producing individuals of the larger sex. A range of different methods have been employed to estimate relative expenditure on the sexes, including quantifying sex-specific offspring growth, food intake,

  5. Estimating expenditure on male and female offspring in a sexually size-dimorphic bird : A comparison of different methods

    NARCIS (Netherlands)

    Magrath, Michael J. L.; Van Lieshout, Emile; Pen, Ido; Visser, G. Henk; Komdeur, Jan

    1. The parents of sexually size-dimorphic offspring are often assumed to invest more resources producing individuals of the larger sex. A range of different methods have been employed to estimate relative expenditure on the sexes, including quantifying sex-specific offspring growth, food intake,

  6. An efficient computational method for a stochastic dynamic lot-sizing problem under service-level constraints

    NARCIS (Netherlands)

    Tarim, S.A.; Ozen, U.; Dogru, M.K.; Rossi, R.

    2011-01-01

    We provide an efficient computational approach to solve the mixed integer programming (MIP) model developed by Tarim and Kingsman [8] for solving a stochastic lot-sizing problem with service level constraints under the static–dynamic uncertainty strategy. The effectiveness of the proposed method

  7. Relative Suitability Evaluation of Two Methods of Particle-Size Analysis for Selected Soils of Sudan Savanna of Nigeria

    OpenAIRE

    B. A. Lawal; B. R. Singh; G. A. Babaji; P. A. Tsado

    2013-01-01

    The two widely used methods base on the sedimentation principle (Bouyoucos hydrometer and International pipette) for particle-size analysis were comparatively evaluated on soils collected from various locations in Sudan savanna of Nigeria particularly from Sokoto and Zamfara States. The hydrometer method under-estimated the silt and over-estimated the clay content. Also, the hydrometer reading proved difficult and tended to submerge when floated for clay reading in the suspension of very sand...

  8. Influence of particle size and preparation methods on the physical and chemical stability of amorphous simvastatin

    DEFF Research Database (Denmark)

    Zhang, Fang; Aaltonen, Jaakko; Tian, Fang

    2009-01-01

    This study investigated the factors influencing the stability of amorphous simvastatin. Quench-cooled amorphous simvastatin in two particle size ranges, 150-180 microm (QC-big) and ... compared to the crystalline form. The rank of solubility was found to be QC-big=QC-small>CM>crystalline. For the physical stability, the highest crystallization rate was observed for CM, and the slowest rate was detected for QC-big, with an intermediate rate occurring for QC-small. QC exhibited lower...

  9. Particle size determination in small solid propellant rocket motors using the diffractively scattered light method.

    OpenAIRE

    Cramer, Robert Grewelle.

    1982-01-01

    Approved for public release; distribution unlimited A dual beam apparatus was developed which simultaneously measured particle size (D32) at the entrance and exit of an exhaust nozzle of a small solid propellant rocket motor. The diameters were determined using measurements of dif fractiveiy scattered laser power spectra. The apparatus was calibrated by using spherical glass beads and aluminum oxide powder. Measurements were successfully made at both locations. Because of...

  10. An analysis of interplanetary scintillation as a method of measuring the angular sizes of radio sources

    International Nuclear Information System (INIS)

    Hajivassiliou, C.A.; Duffett-Smith, P.J.

    1990-01-01

    Interplanetary scintillation has been widely used at metre wavelengths for estimating the angular sizes of radio sources in the range 0.1-2.0 arcsec. The estimates are based on observations of either the width of the temporal power spectrum or the shape of the scintillation index-elongation curve. We present a mathematical model of the latter procedure which reveals the biases introduced into an IPS survey as a result of the estimation process. (author)

  11. Induced leaf variations in faba bean

    International Nuclear Information System (INIS)

    Yasin, M.

    1996-01-01

    The frequency and spectrum of M2 chlorophyll and other leaf mutations after gamma ray, ethyl methane sulfonate (EMS) and nitrous oxide (N2O) seed treatment in two varieties of faba bean were studied. In general, cv JV1 was more sensitive and EMS treatment was most effective. The frequency of chlorina-type mutations was higher than that of xantha and chlorotica type chlorophyll mutations. The highest frequency of variations was observed in leaflet texture, followed by arrangement, shape and size in both varieties. The use of these leaf mutations in formulating an ideotype of Vicia faba L. are discussed

  12. Size dependence study of the ordering temperature in the Fast Monte Carlo method

    Energy Technology Data Exchange (ETDEWEB)

    Velasquez, E. A., E-mail: eavelas@gmail.com [Universidad de San Buenaventura Seccional Medellin, Grupo de Investigacion en Modelamiento y Simulacion Computacional, Facultad de Ingenierias (Colombia); Mazo-Zuluaga, J., E-mail: johanmazo@gmail.com [Universidad de Antioquia, Grupo de Estado Solido, Grupo de Instrumentacion Cientifica y Microelectronica, Instituto de Fisica-FCEN (Colombia); Mejia-Lopez, J., E-mail: jmejia@puc.cl [Universidad de Antioquia, Instituto de Fisica-FCEN (Colombia)

    2013-02-15

    Based on the framework of the Fast Monte Carlo approach, we study the diameter dependence of the ordering temperature in magnetic nanostructures of cylindrical shape. For the purposes of this study, Fe cylindrical-shaped samples of different sizes (20 nm height, 30-100 nm in diameter) have been chosen, and their magnetic properties have been computed as functions of the scaled temperature. Two main set of results are concluded: (a) the ordering temperature of nanostructures follows a linear scaling relationship as a function of the scaling factor x, for all the studied sizes. This finding rules out a scaling relation T Prime {sub c} = x{sup 3{eta}}T{sub c} (where {eta} is a scaling exponent, and T Prime {sub c} and T{sub c} are the scaled and true ordering temperatures) that has been proposed in the literature, and suggests that temperature should scale linearly with the scaling factor x. (b) For the nanostructures, there are three different order-disorder magnetic transition modes depending on the system's size, in very good agreement with previous experimental reports.

  13. Numerical method for estimating the size of chaotic regions of phase space

    International Nuclear Information System (INIS)

    Henyey, F.S.; Pomphrey, N.

    1987-10-01

    A numerical method for estimating irregular volumes of phase space is derived. The estimate weights the irregular area on a surface of section with the average return time to the section. We illustrate the method by application to the stadium and oval billiard systems and also apply the method to the continuous Henon-Heiles system. 15 refs., 10 figs

  14. Geometric leaf placement strategies

    International Nuclear Information System (INIS)

    Fenwick, J D; Temple, S W P; Clements, R W; Lawrence, G P; Mayles, H M O; Mayles, W P M

    2004-01-01

    Geometric leaf placement strategies for multileaf collimators (MLCs) typically involve the expansion of the beam's-eye-view contour of a target by a uniform MLC margin, followed by movement of the leaves until some point on each leaf end touches the expanded contour. Film-based dose-distribution measurements have been made to determine appropriate MLC margins-characterized through an index d 90 -for multileaves set using one particular strategy to straight lines lying at various angles to the direction of leaf travel. Simple trigonometric relationships exist between different geometric leaf placement strategies and are used to generalize the results of the film work into d 90 values for several different strategies. Measured d 90 values vary both with angle and leaf placement strategy. A model has been derived that explains and describes quite well the observed variations of d 90 with angle. The d 90 angular variations of the strategies studied differ substantially, and geometric and dosimetric reasoning suggests that the best strategy is the one with the least angular variation. Using this criterion, the best straightforwardly implementable strategy studied is a 'touch circle' approach for which semicircles are imagined to be inscribed within leaf ends, the leaves being moved until the semicircles just touch the expanded target outline

  15. The role of aqueous leaf extract of Tinospora crispa as reducing and capping agents for synthesis of gold nanoparticles

    Science.gov (United States)

    Apriandanu, D. O. B.; Yulizar, Y.

    2017-04-01

    Environmentally friendly method for green synthesis of Au nanoparticles (AuNP) using aqueous leaf extract of Tinospora crispa (TLE) was reported. TLE has the ability for reducing and capping AuNP. Identification of active compounds in aqueous leaf extract was obtained by phytochemical analysis and Fourier transform infrared spectroscopy (FTIR). The AuNP-TLE growth was characterized using UV-Vis spectrophotometer. The particle size and the distribution of AuNP were confirmed by particle size analyzer (PSA). AuNP-TLE formation was optimized by varying the extract concentration and time of the synthesis process. UV-Vis absorption spectrum of optimum AuNP formation displayed by the surface plasmon resonance at maximum wavelength of λmax 536 nm. The PSA result showed that AuNP has size distribution of 80.60 nm and stable up to 21 days. TEM images showed that the size of the AuNP is ± 25 nm.

  16. Comparison of dosimetric properties of three commercial multi leaf collimator systems

    International Nuclear Information System (INIS)

    Hoever, K.H.; Hesse, B.M.; Haering, P.; Rhein, B.; Bannach, B.; Doll, T.; Doerner, K.J.

    1996-01-01

    Purpose: The dosimetric properties of different designs of multi leaf collimators used for the generation of irregular fields will be measured and compared with each other. Using multi leaf collimators is a practical method of achieving conformal therapy. The use for complex conformal treatment fields to be given in either in static or dynamic mode depends much on the leaf end penumbra and the leaf side penumbra as well as the transmission through the leafs. Penumbra and leakage caused by the leaves therefore are of special interest in this intercomparison. Material and Methods: To investigate the dosimetric properties of three multi leaf collimators of different technical design, measurements have been taken at two different facilities. Until now, comparative measurements have been performed for the following devices. The new Siemens double focusing MLC with 29 opposite leaf pairs, installed at the Mevatron Experimental in the German Cancer Research Center, Heidelberg. The energy used was 15 MV and 6 MV. The Philips quasi-double focusing MLC with 40 opposite leaf pairs, installed at the SL25 in the University Duesseldorf. The leaves move in a plane rather than on a circular arc and have rounded ends to reduce penumbra. The energy used was 25 MV and 6 MV. The Leibinger non-focusing micro-MLC with 40 opposite leaf pairs. This MLC was specially designed for stereotactic irradiation of the brain. The comparative study is to be continued and extended to involve additional devices in the future. Both, the film densitometry and a newly designed ten-bit Beam Imaging System BIS-710 developed by Wellhoefer company were used. The BIS-710 was developed especially for quantitative dose measuring, whereas most of the existing Portal Imaging Systems are used for image display only. The BIS-710 contains a camera for 10-bit digital data output. The size of each of the 512 x 512 detector elements is 0.6 mm x 0.6 mm Results: Measurements taken with the BIS-710 and with film

  17. Comparison of different methods to retrieve optical-equivalent snow grain size in central Antarctica

    Directory of Open Access Journals (Sweden)

    T. Carlsen

    2017-11-01

    Full Text Available The optical-equivalent snow grain size affects the reflectivity of snow surfaces and, thus, the local surface energy budget in particular in polar regions. Therefore, the specific surface area (SSA, from which the optical snow grain size is derived, was observed for a 2-month period in central Antarctica (Kohnen research station during austral summer 2013/14. The data were retrieved on the basis of ground-based spectral surface albedo measurements collected by the COmpact RAdiation measurement System (CORAS and airborne observations with the Spectral Modular Airborne Radiation measurement sysTem (SMART. The snow grain size and pollution amount (SGSP algorithm, originally developed to analyze spaceborne reflectance measurements by the MODerate Resolution Imaging Spectroradiometer (MODIS, was modified in order to reduce the impact of the solar zenith angle on the retrieval results and to cover measurements in overcast conditions. Spectral ratios of surface albedo at 1280 and 1100 nm wavelength were used to reduce the retrieval uncertainty. The retrieval was applied to the ground-based and airborne observations and validated against optical in situ observations of SSA utilizing an IceCube device. The SSA retrieved from CORAS observations varied between 27 and 89 m2 kg−1. Snowfall events caused distinct relative maxima of the SSA which were followed by a gradual decrease in SSA due to snow metamorphism and wind-induced transport of freshly fallen ice crystals. The ability of the modified algorithm to include measurements in overcast conditions improved the data coverage, in particular at times when precipitation events occurred and the SSA changed quickly. SSA retrieved from measurements with CORAS and MODIS agree with the in situ observations within the ranges given by the measurement uncertainties. However, SSA retrieved from the airborne SMART data slightly underestimated the ground-based results.

  18. Comparison of different methods to retrieve optical-equivalent snow grain size in central Antarctica

    Science.gov (United States)

    Carlsen, Tim; Birnbaum, Gerit; Ehrlich, André; Freitag, Johannes; Heygster, Georg; Istomina, Larysa; Kipfstuhl, Sepp; Orsi, Anaïs; Schäfer, Michael; Wendisch, Manfred

    2017-11-01

    The optical-equivalent snow grain size affects the reflectivity of snow surfaces and, thus, the local surface energy budget in particular in polar regions. Therefore, the specific surface area (SSA), from which the optical snow grain size is derived, was observed for a 2-month period in central Antarctica (Kohnen research station) during austral summer 2013/14. The data were retrieved on the basis of ground-based spectral surface albedo measurements collected by the COmpact RAdiation measurement System (CORAS) and airborne observations with the Spectral Modular Airborne Radiation measurement sysTem (SMART). The snow grain size and pollution amount (SGSP) algorithm, originally developed to analyze spaceborne reflectance measurements by the MODerate Resolution Imaging Spectroradiometer (MODIS), was modified in order to reduce the impact of the solar zenith angle on the retrieval results and to cover measurements in overcast conditions. Spectral ratios of surface albedo at 1280 and 1100 nm wavelength were used to reduce the retrieval uncertainty. The retrieval was applied to the ground-based and airborne observations and validated against optical in situ observations of SSA utilizing an IceCube device. The SSA retrieved from CORAS observations varied between 27 and 89 m2 kg-1. Snowfall events caused distinct relative maxima of the SSA which were followed by a gradual decrease in SSA due to snow metamorphism and wind-induced transport of freshly fallen ice crystals. The ability of the modified algorithm to include measurements in overcast conditions improved the data coverage, in particular at times when precipitation events occurred and the SSA changed quickly. SSA retrieved from measurements with CORAS and MODIS agree with the in situ observations within the ranges given by the measurement uncertainties. However, SSA retrieved from the airborne SMART data slightly underestimated the ground-based results.

  19. Estimation of lattice strain in nanocrystalline RuO2 by Williamson-Hall and size-strain plot methods

    Science.gov (United States)

    Sivakami, R.; Dhanuskodi, S.; Karvembu, R.

    2016-01-01

    RuO2 nanoparticles (RuO2 NPs) have been successfully synthesized by the hydrothermal method. Structure and the particle size have been determined by X-ray diffraction (XRD), scanning electron microscopy (SEM), atomic force microscopy (AFM) and transmission electron microscopy (TEM). UV-Vis spectra reveal that the optical band gap of RuO2 nanoparticles is red shifted from 3.95 to 3.55 eV. BET measurements show a high specific surface area (SSA) of 118-133 m2/g and pore diameter (10-25 nm) has been estimated by Barret-Joyner-Halenda (BJH) method. The crystallite size and lattice strain in the samples have been investigated by Williamson-Hall (W-H) analysis assuming uniform deformation, deformation stress and deformation energy density, and the size-strain plot method. All other relevant physical parameters including stress, strain and energy density have been calculated. The average crystallite size and the lattice strain evaluated from XRD measurements are in good agreement with the results of TEM.

  20. Estimation of lattice strain in nanocrystalline RuO2 by Williamson-Hall and size-strain plot methods.

    Science.gov (United States)

    Sivakami, R; Dhanuskodi, S; Karvembu, R

    2016-01-05

    RuO2 nanoparticles (RuO2 NPs) have been successfully synthesized by the hydrothermal method. Structure and the particle size have been determined by X-ray diffraction (XRD), scanning electron microscopy (SEM), atomic force microscopy (AFM) and transmission electron microscopy (TEM). UV-Vis spectra reveal that the optical band gap of RuO2 nanoparticles is red shifted from 3.95 to 3.55eV. BET measurements show a high specific surface area (SSA) of 118-133m(2)/g and pore diameter (10-25nm) has been estimated by Barret-Joyner-Halenda (BJH) method. The crystallite size and lattice strain in the samples have been investigated by Williamson-Hall (W-H) analysis assuming uniform deformation, deformation stress and deformation energy density, and the size-strain plot method. All other relevant physical parameters including stress, strain and energy density have been calculated. The average crystallite size and the lattice strain evaluated from XRD measurements are in good agreement with the results of TEM. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. COMPARING PARTICLE SIZE DISTRIBUTION ANALYSIS BY SEDIMENTATION AND LASER DIFFRACTION METHOD

    OpenAIRE

    Vito Ferro; Stefano Mirabile

    2009-01-01

    In this paper a brief review of the laser diffraction method is firstly carried out. Then, for 30 soil samples having a different texture classification sampled in Sicilian basin, a comparison between the two techniques is developed. The analysis demonstrated that the sand content measured by Sieve-Hydrometer method can be assumed equal to the one determinated by laser diffraction technique while an overestimation of the clay fraction measured by Sieve-Hydrometer method respect to laser diffr...

  2. COMPARING PARTICLE SIZE DISTRIBUTION ANALYSIS BY SEDIMENTATION AND LASER DIFFRACTION METHOD

    Directory of Open Access Journals (Sweden)

    Vito Ferro

    2009-06-01

    Full Text Available In this paper a brief review of the laser diffraction method is firstly carried out. Then, for 30 soil samples having a different texture classification sampled in Sicilian basin, a comparison between the two techniques is developed. The analysis demonstrated that the sand content measured by Sieve-Hydrometer method can be assumed equal to the one determinated by laser diffraction technique while an overestimation of the clay fraction measured by Sieve-Hydrometer method respect to laser diffraction technique was obtained. Finally a set of equations useful to refer LD measurements to SH method was proposed.

  3. Relation between electrocardiographic and enzymatic methods of estimating acute myocardial infarct size.

    Science.gov (United States)

    Hindman, N; Grande, P; Harrell, F E; Anderson, C; Harrison, D; Ideker, R E; Selvester, R H; Wagner, G S

    1986-07-01

    The extent of initial acute myocardial infarction (AMI) and subsequent patient prognosis were studied using 2 independent indicators of AMI size. Two inexpensive, readily available techniques, the complete Selvester QRS score from the standard 12-lead electrocardiogram and the peak value of the isoenzyme MB of creatine kinase (CK-MB), were evaluated in 125 patients with initial AMI. The overall correlation between peak CK-MB and QRS score was fair (0.57), with marked difference according to anterior (0.72) or inferior (0.35) location. The prognostic capabilities of each measurement varied. Peak CK-MB provided significant information concerning hospital morbidity or early mortality (within 30 days) for both anterior (chi 2 = 9.83) and inferior (chi 2 = 7.68) AMI locations; however, the QRS score was significant only for anterior AMI (chi 2 = 9.50). For total 24-month mortality, the QRS score alone provided the most information (chi 2 = 10.0, p = 0.0016), which was not improved with the addition of CK-MB (chi 2 = 0.07, p = 0.79). This study shows a good relation between these 2 independent estimates of AMI size for patients with anterior AMI location. Both QRS and CK-MB results are significantly related to early morbidity and mortality; however, only the QRS score is related to total 24-month prognosis.

  4. [Particle size determination by radioisotope x-ray absorptiometry with sedimentation method].

    Science.gov (United States)

    Matsui, Y; Furuta, T; Miyagawa, S

    1976-09-01

    The possibility of radioisotope X-ray absorptiometry to determine the particle size of powder in conjunction with sedimentation was investigated. The experimental accuracy was primarily determined by Cow and X-ray intensity. where Co'=weight concentration of the particle in the suspension w'=(micron/rho)l/(mu/rho)s-rhol/rhos rho; density micron/rho; mass absorption coefficient, suffix l and s indicate dispersion and particle, respectively. The radiosiotopes, Fe-55, Pu-238 and Cd-109 have high w-values over the wide range of the atomic number. However, a source of high micron value such as Fe-55 is not suitable because the optimal X-ray transmission length, Lopt is decided by the expression, micronlLopt approximately 2/(1+C'ow') by using Cd-109 AgKX-ray source, the weight size distribution of particles from the heavy elements such as PbO2 to light elements such as Al2O3 or flyash was determined.

  5. Formation of graphene on BN substrate by vapor deposition method and size effects on its structure

    Science.gov (United States)

    Giang, Nguyen Hoang; Hanh, Tran Thi Thu; Ngoc, Le Nhu; Nga, Nguyen To; Van Hoang, Vo

    2018-04-01

    We report MD simulation of the growth of graphene by the vapor deposition on a two-dimensional hBN substrate. The systems (containing carbon vapor and hBN substrate) are relaxed at high temperature (1500 K), and then it is cooled down to room one (300 K). Carbon atoms interact with the substrate via the Lennard-Jones potential while the interaction between carbon atoms is computed via the Tersoff potential. Depending on the size of the model, different crystalline honeycomb structures have been found. Structural properties of the graphene obtained at 300 K are studied by analyzing radial distribution functions (RDFs), coordination numbers, ring statistics, interatomic distances, bond-angle distributions and 2D visualization of atomic configurations. We find that the models containing various numbers of atoms have a honeycomb structure. Besides, differences in structural properties of graphene formed by the vapor deposition on the substrate and free standing one are found. Moreover, the size effect on the structure is significant.

  6. A Numerical Algorithm and a Graphical Method to Size a Heat Exchanger

    DEFF Research Database (Denmark)

    Berning, Torsten

    2011-01-01

    This paper describes the development of a numerical algorithm and a graphical method that can be employed in order to determine the overall heat transfer coefficient inside heat exchangers. The method is based on an energy balance and utilizes the spreadsheet application software Microsoft ExcelTM...

  7. A Numerical Algorithm and a Graphical Method to Size a Heat Exchanger

    DEFF Research Database (Denmark)

    Berning, Torsten

    2011-01-01

    This paper describes the development of a numerical algorithm and a graphical method that can be employed in order to determine the overall heat transfer coefficient inside heat exchangers. The method is based on an energy balance and utilizes the spreadsheet application software Microsoft Excel...

  8. Fourier and granulometry methods on 3D images of soil surfaces for evaluating soil aggregate size distribution

    DEFF Research Database (Denmark)

    Jensen, T.; Green, O.; Munkholm, Lars Juhl

    2016-01-01

    The goal of this research is to present and compare two methods for evaluating soil aggregate size distribution based on high resolution 3D images of the soil surface. The methods for analyzing the images are discrete Fourier transform and granulometry. The results of these methods correlate...... with a measured weight distribution of the soil aggregates. The results have shown that it is possible to distinguish between the cultivated and the uncultivated soil surface. A sensor system suitable for capturing in-situ high resolution 3D images of the soil surface is also described. This sensor system...

  9. A simple non-invasive method for measuring gross brain size in small live fish with semi-transparent heads

    Directory of Open Access Journals (Sweden)

    Joacim Näslund

    2014-09-01

    Full Text Available This paper describes a non-invasive method for estimating gross brain size in small fish with semi-transparent heads, using system camera equipment. Macro-photographs were taken from above on backlit free-swimming fish undergoing light anaesthesia. From the photographs, the width of the optic tectum was measured. This measure (TeO-measure correlates well with the width of the optic tectum as measured from out-dissected brains in both brown trout fry and zebrafish (Pearson r > 0.90. The TeO-measure also correlates well with overall brain wet weight in brown trout fry (r = 0.90, but less well for zebrafish (r = 0.79. A non-invasive measure makes it possible to quickly assess brain size from a large number of individuals, as well as repeatedly measuring brain size of live individuals allowing calculation of brain growth.

  10. Size Control of Iron Oxide Nanoparticles Using Reverse Microemulsion Method: Morphology, Reduction, and Catalytic Activity in CO Hydrogenation

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Housaindokht

    2013-01-01

    Full Text Available Iron oxide nanoparticles were prepared by microemulsion method and evaluated in Fischer-Tropsch synthesis. The precipitation process was performed in a single-phase microemulsion operating region. Different HLB values of surfactant were prepared by mixing of sodium dodecyl sulfate (SDS and Triton X-100. Transmission electron microscopy (TEM, surface area, pore volume, average pore diameter, pore size distribution, and XRD patterns were used to analyze size distribution, shape, and structure of precipitated hematite nanoparticles. Furthermore, temperature programmed reduction (TPR and catalytic activity in CO hydrogenation were implemented to assess the performance of the samples. It was found that methane and CO2 selectivity and also the syngas conversion increased as the HLB value of surfactant decreased. In addition, the selectivity to heavy hydrocarbons and chain growth probability (α decreased by decreasing the catalyst crystal size.

  11. Size validity of plasma-metamaterial cloaking monitored by scattering wave in finite-difference time-domain method

    Directory of Open Access Journals (Sweden)

    Alexandre Bambina

    2018-01-01

    Full Text Available Limitation of the cloak-size reduction is investigated numerically by a finite-difference time-domain (FDTD method. A metallic pole that imitates an antenna is cloaked with an anisotropic and parameter-gradient medium against electromagnetic-wave propagation in microwave range. The cloaking structure is a metamaterial submerged in a plasma confined in a vacuum chamber made of glass. The smooth-permittivity plasma can be compressed in the radial direction, which enables us to decrease the size of the cloak. Theoretical analysis is performed numerically by comparing scattering waves in various cases; there exists a high reduction of the scattering wave when the radius of the cloak is larger than a quarter of one wavelength. This result indicates that the required size of the cloaking layer is more than an object scale in the Rayleigh scattering regime.

  12. Analyzing Damping Vibration Methods of Large-Size Space Vehicles in the Earth's Magnetic Field

    Directory of Open Access Journals (Sweden)

    G. A. Shcheglov

    2016-01-01

    Full Text Available It is known that most of today's space vehicles comprise large antennas, which are bracket-attached to the vehicle body. Dimensions of reflector antennas may be of 30 ... 50 m. The weight of such constructions can reach approximately 200 kg.Since the antenna dimensions are significantly larger than the size of the vehicle body and the points to attach the brackets to the space vehicles have a low stiffness, conventional dampers may be inefficient. The paper proposes to consider the damping antenna in terms of its interaction with the Earth's magnetic field.A simple dynamic model of the space vehicle equipped with a large-size structure is built. The space vehicle is a parallelepiped to which the antenna is attached through a beam.To solve the model problems, was used a simplified model of Earth's magnetic field: uniform, with intensity lines parallel to each other and perpendicular to the plane of the antenna.The paper considers two layouts of coils with respect to the antenna, namely: a vertical one in which an axis of magnetic dipole is perpendicular to the antenna plane, and a horizontal layout in which an axis of magnetic dipole lies in the antenna plane. It also explores two ways for magnetic damping of oscillations: through the controlled current that is supplied from the power supply system of the space vehicle, and by the self-induction current in the coil. Thus, four objectives were formulated.In each task was formulated an oscillation equation. Then a ratio of oscillation amplitudes and their decay time were estimated. It was found that each task requires the certain parameters either of the antenna itself, its dimensions and moment of inertia, or of the coil and, respectively, the current, which is supplied from the space vehicle. In each task for these parameters were found the ranges, which allow us to tell of efficient damping vibrations.The conclusion can be drawn based on the analysis of tasks that a specialized control system

  13. Mesh-size errors in diffusion-theory calculations using finite-difference and finite-element methods

    International Nuclear Information System (INIS)

    Baker, A.R.

    1982-07-01

    A study has been performed of mesh-size errors in diffusion-theory calculations using finite-difference and finite-element methods. As the objective was to illuminate the issues, the study was performed for a 1D slab model of a reactor with one neutron-energy group for which analytical solutions were possible. A computer code SLAB was specially written to perform the finite-difference and finite-element calculations and also to obtain the analytical solutions. The standard finite-difference equations were obtained by starting with an expansion of the neutron current in powers of the mesh size, h, and keeping terms as far as h 2 . It was confirmed that these equations led to the well-known result that the criticality parameter varied with the square of the mesh size. An improved form of the finite-difference equations was obtained by continuing the expansion for the neutron current as far as the term in h 4 . In this case, the critical parameter varied as the fourth power of the mesh size. The finite-element solutions for 2 and 3 nodes per element revealed that the criticality parameter varied as the square and fourth power of the mesh size, respectively. Numerical results are presented for a bare reactive core of uniform composition with 2 zones of different uniform mesh and for a reactive core with an absorptive reflector. (author)

  14. A Modified Thermal Treatment Method for the Up-Scalable Synthesis of Size-Controlled Nanocrystalline Titania

    Directory of Open Access Journals (Sweden)

    Aysar Sabah Keiteb

    2016-10-01

    Full Text Available Considering the increasing demand for titania nanoparticles with controlled quality for various applications, the present work reports the up-scalable synthesis of size-controlled titanium dioxide nanocrystals with a simple and convenient thermal treatment route. Titanium dioxide nanocrystals with tetragonal structure were synthesized directly from an aqueous solution containing titanium (IV isopropoxide as the main reactant, polyvinyl pyrrolidone (PVP as the capping agent, and deionized water as a solvent. With the elimination of the drying process in a thermal treatment method, an attempt was made to decrease the synthesis time. The mixture directly underwent calcination to form titanium dioxide (TiO2 nanocrystalline powder, which was confirmed by FT-IR, energy dispersive X-ray spectroscopy (EDX, and X-ray diffraction (XRD analysis. The control over the size and optical properties of nanocrystals was achieved via variation in calcination temperatures. The obtained average sizes from XRD spectra and transmission electron microscopy (TEM images showed exponential variation with increasing calcination temperature. The optical properties showed a decrease in the band gap energy with increasing calcination temperature due to the enlargement of the nanoparticle size. These results prove that direct calcination of reactant solution is a convenient thermal treatment route for the potential large-scale production of size-controlled Titania nanoparticles.

  15. Synthesis, optical characterization, and size distribution determination by curve resolution methods of water-soluble CdSe quantum dots

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Calink Indiara do Livramento; Carvalho, Melissa Souza; Raphael, Ellen; Ferrari, Jefferson Luis; Schiavon, Marco Antonio, E-mail: schiavon@ufsj.edu.br [Universidade Federal de Sao Joao del-Rei (UFSJ), MG (Brazil). Grupo de Pesquisa em Quimica de Materiais; Dantas, Clecio [Universidade Estadual do Maranhao (LQCINMETRIA/UEMA), Caxias, MA (Brazil). Lab. de Quimica Computacional Inorganica e Quimiometria

    2016-11-15

    In this work a colloidal approach to synthesize water-soluble CdSe quantum dots (QDs) bearing a surface ligand, such as thioglycolic acid (TGA), 3-mercaptopropionic acid (MPA), glutathione (GSH), or thioglycerol (TGH) was applied. The synthesized material was characterized by X-ray diffraction (XRD), Fourier-transform infrared spectroscopy (FT-IR), UV-visible spectroscopy (UV-Vis), and fluorescence spectroscopy (PL). Additionally, a comparative study of the optical properties of different CdSe QDs was performed, demonstrating how the surface ligand affected crystal growth. The particles sizes were calculated from a polynomial function that correlates the particle size with the maximum fluorescence position. Curve resolution methods (EFA and MCR-ALS) were employed to decompose a series of fluorescence spectra to investigate the CdSe QDs size distribution and determine the number of fraction with different particle size. The results for the MPA-capped CdSe sample showed only two main fraction with different particle sizes with maximum emission at 642 and 686 nm. The calculated diameters from these maximum emission were, respectively, 2.74 and 3.05 nm. (author)

  16. A stochastic method for battery sizing with uninterruptible-power and demand shift capabilities in PV (photovoltaic) systems

    International Nuclear Information System (INIS)

    Tan, Chee Wei; Green, Tim C.; Hernandez-Aramburo, Carlos A.

    2010-01-01

    This paper presents a stochastic simulation using Monte Carlo technique to size a battery to meet dual objectives of demand shift at peak electricity cost times and outage protection in BIPV (building integrated photovoltaic) systems. Both functions require battery storage and the sizing of battery using numerical optimization is popularly used. However, the weather conditions, outage events and demand peaks are not deterministic in nature. Therefore, the sizing of battery storage capacity should also be based on a probabilistic approach. The Monte Carlo simulation is a rigorous method to sizing BIPV system as it takes into account a real building load profiles, the weather information and the local historical outage distribution. The simulation is split into seasonal basis for the analysis of demand shifting and outage events in order to match the seasonal weather conditions and load profiles. Five configurations of PV (photovoltaic) are assessed that cover different areas and orientations. The simulation output includes the predicted PV energy yield, the amount of energy required for demand management and outage event. Therefore, consumers can base sizing decisions on the historical data and local risk of outage statistics and the success rate of meeting the demand shift required. Finally, the economic evaluations together with the sensitivity analysis and the assessment of customers' outage cost are discussed.

  17. Light extinction method for diagnostics of particles sizes formed in magnetic field

    Science.gov (United States)

    Myshkin, Vyacheslav; Izhoykin, Dmitry; Grigoriev, Alexander; Gamov, Denis; Leonteva, Daria

    2018-03-01

    The results of laser diagnostics of dispersed particles formed upon cooling of Zn vapor are presented. The radiation attenuation in the wavelength range 420-630 nm with a step of 0.3 nm was registered. The attenuation coefficients spectral dependence was processed using known algorithms for integral equation solving. The 10 groups of 8 attenuation coefficients were formed. Each group was processed taking with considering of previous decisions. After processing of the 10th group of data, calculations were repeated from the first one. Data of the particles sizes formed in a magnetic field of 0, 44 and 76 mT are given. A model of physical processes in a magnetic field is discussed.

  18. New Technology/Old Technology: Comparing Lunar Grain Size Distribution Data and Methods

    Science.gov (United States)

    Fruland, R. M.; Cooper, Bonnie L.; Gonzalexz, C. P.; McKay, David S.

    2011-01-01

    Laser diffraction technology generates reproducible grain size distributions and reveals new structures not apparent in old sieve data. The comparison of specific sieve fractions with the Microtrac distribution curve generated for those specific fractions shows a reasonable match for the mean of each fraction between the two techniques, giving us confidence that the large existing body of sieve data can be cross-correlated with new data based on laser diffraction. It is well-suited for lunar soils, which have as much as 25% of the material in the less than 20 micrometer fraction. The fines in this range are of particular interest because they may contain a record of important space weathering processes.

  19. Green method for producing hierarchically assembled pristine porous ZnO nanoparticles with narrow particle size distribution

    International Nuclear Information System (INIS)

    Escobedo-Morales, A.; Téllez-Flores, D.; Ruiz Peralta, Ma. de Lourdes; Garcia-Serrano, J.; Herrera-González, Ana M.; Rubio-Rosas, E.; Sánchez-Mora, E.; Olivares Xometl, O.

    2015-01-01

    A green method for producing pristine porous ZnO nanoparticles with narrow particle size distribution is reported. This method consists in synthesizing ZnO 2 nanopowders via a hydrothermal route using cheap and non-toxic reagents, and its subsequent thermal decomposition at low temperature under a non-protective atmosphere (air). The morphology, structural and optical properties of the obtained porous ZnO nanoparticles were studied by means of powder X-ray diffraction, scanning electron microscopy, transmission electron microscopy, Raman spectroscopy, and nitrogen adsorption–desorption measurements. It was found that after thermal decomposition of the ZnO 2 powders, pristine ZnO nanoparticles are obtained. These particles are round-shaped with narrow size distribution. A further analysis of the obtained ZnO nanoparticles reveals that they are hierarchical self-assemblies of primary ZnO particles. The agglomeration of these primary particles at the very early stage of the thermal decomposition of ZnO 2 powders provides to the resulting ZnO nanoparticles a porous nature. The possibility of using the synthesized porous ZnO nanoparticles as photocatalysts has been evaluated on the degradation of rhodamine B dye. - Highlights: • A green synthesis method for obtaining porous ZnO nanoparticles is reported. • The obtained ZnO nanoparticles have narrow particle size distribution. • This method allows obtaining pristine ZnO nanoparticles avoiding unintentional doping. • A growth mechanism for the obtained porous ZnO nanoparticles is proposed

  20. Detection of Potato Leaf Roll Virus (PLRV), Potato Virus Y (PVY) and Potato Virus X (PVX) on Five Potato Varieties by Using of DAS-ELISA and RT-PCR Methods

    OpenAIRE

    Kuswinanti, Tutik

    2012-01-01

    Potato is a staple food crop that widely grown around the world. Virus infection is main factor that affects great loss of the potato production. Potato virus X(PVX), potato virus Y(PVY),and potato leaf roll virus(PLRV) are top three viruses that result in decreased yield of potato in Indonesia. Therefore, the rapid methods of DAS-ELISA was studied to test tuber samples of five potato varieties, Granola, Atlantik, Raja, Super John, Kalosi, and Masalle. Two simple, rapid, sensitive, reliable...

  1. SU-F-T-350: Continuous Leaf Optimization (CLO) for IMRT Leaf Sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Long, T; Chen, M; Jiang, S; Lu, W [UT Southwestern Medical Center, Dallas, TX (United States)

    2016-06-15

    Purpose: To study a new step-and-shoot IMRT leaf sequencing model that avoids the two main pitfalls of conventional leaf sequencing: (1) target fluence being stratified into a fixed number of discrete levels and/or (2) aperture leaf positions being restricted to a discrete set of locations. These assumptions induce error into the sequence or reduce the feasible region of potential plans, respectively. Methods: We develop a one-dimensional (single leaf pair) methodology that does not make assumptions (1) or (2) that can be easily extended to a multi-row model. The proposed continuous leaf optimization (CLO) methodology takes in an existing set of apertures and associated intensities, or solution “seed,” and improves the plan without the restrictiveness of 1or (2). It then uses a first-order descent algorithm to converge onto a locally optimal solution. A seed solution can come from models that assume (1) and (2), thus allowing the CLO model to improve upon existing leaf sequencing methodologies. Results: The CLO model was applied to 208 generated target fluence maps in one dimension. In all cases for all tested sequencing strategies, the CLO model made improvements on the starting seed objective function. The CLO model also was able to keep MUs low. Conclusion: The CLO model can improve upon existing leaf sequencing methods by avoiding the restrictions of (1) and (2). By allowing for more flexible leaf positioning, error can be reduced when matching some target fluence. This study lays the foundation for future models and solution methodologies that can incorporate continuous leaf positions explicitly into the IMRT treatment planning model. Supported by Cancer Prevention & Research Institute of Texas (CPRIT) - ID RP150485.

  2. The Role of Isolation Methods on a Nanoscale Surface Structure and Its Effect on the Size of Exosomes

    Directory of Open Access Journals (Sweden)

    JungReem Woo

    2016-06-01

    Full Text Available Exosomes are ~100 nanometre diameter vesicles secreted by mammalian cells. These emerging disease biomarkers carry nucleic acids, proteins and lipids specific to the parental cells that secrete them. Exosomes are typically isolated in bulk by ultracentrifugation, filtration or immu‐ noaffinity precipitation for downstream proteomic, genomic, or lipidomic analysis. However, the structural properties and heterogeneity of isolated exosomes at the single vesicle level are not well characterized due to their small size. In this paper, by using high-resolution atomic force microscope imaging, we show the nanoscale mor‐ phology and structural heterogeneity in exosomes derived from U87 cells. Quantitative assessment of single exosomes reveals nanoscale variations in morphology, surface roughness and counts isolated by ultracentrifugation (UC and immunoaffinity (IA purification. Both methods produce intact globular, 30-120 nm sized vesicles when imaged under fluid and in air. However, IA exosomes had higher surface roughness and bimodal size population compared to UC exosomes. The study highlights the differences in size and surface topography of exosomes purified from a single cell type using different isolation methods.

  3. A NEW METHOD FOR ESTIMATING THE 3D SIZE-DISTRIBUTIONCURVE OF FRAGMENTED ROCKS OUT OF 2D IMAGES

    Directory of Open Access Journals (Sweden)

    Souhaïl Outal

    2011-05-01

    Full Text Available Image analysis of rock fragmentation is used in mines and quarries to control the quality of blasting. Obtained information is the particle-size-distribution curve relating volume-proportions to the sizes of fragments. Calculation by image analysis of this particle-size-distribution is carried out in several steps, and each step has its inherent limitations. We will focus in this paper on one of themost crucial steps: reconstructing the volumes (3D. For the 3D-step, we have noticed that, due to the current acquisition method, there is no correlation between the average grey level of surfaces of the fragments and their third dimension. Consequently volumes (3D as well as the sizes (1D has to be calculated indirectly from the extracted projected areas of the visible fragments of images. For this purpose, we have built in laboratory a set of images of fragmented rocks resulting from blasting. Moreover, several tests based on comparisons between image analysis and screening measurements were carried out. A new stereological method, based on the comparison of the densities of probability (histograms of the samemeasurements (with very weak covering and overlappingwas elaborated. It allows us to estimate correctly, for a given type of rock, two intrinsic laws weighing the projected areas distribution in order to predict the volumic distribution.

  4. Use of methods for specifying the target difference in randomised controlled trial sample size calculations: Two surveys of trialists' practice.

    Science.gov (United States)

    Cook, Jonathan A; Hislop, Jennifer M; Altman, Doug G; Briggs, Andrew H; Fayers, Peter M; Norrie, John D; Ramsay, Craig R; Harvey, Ian M; Vale, Luke D

    2014-06-01

    the most recent trial, the target difference was usually one viewed as important by a stakeholder group, mostly also viewed as a realistic difference given the interventions under evaluation, and sometimes one that led to an achievable sample size. The response rates achieved were relatively low despite the surveys being short, well presented, and having utilised reminders. Substantial variations in practice exist with awareness, use, and willingness to recommend methods varying substantially. The findings support the view that sample size calculation is a more complex process than would appear to be the case from trial reports and protocols. Guidance on approaches for sample size estimation may increase both awareness and use of appropriate formal methods. © The Author(s), 2014.

  5. [Size of testes and epididymes in boys up to 17 years of life assessed by ultrasound method and method of external linear measurements].

    Science.gov (United States)

    Osemlak, Paweł

    2011-01-01

    1. Determination of the size of testes and epididymes on the right and left side, in healthy boys in various age groups with use of non-invasive ultrasound examination method and the method of external linear measurements. 2. Determination of age, when intensive growth of testicular and epididymal size starts. 3. Determination whether there are statistically significant differences between the size of the right and the left testis, as well as between the right and left epididymis. 4. Evaluation of the ultrasound method and method of external linear measurements in their use for scientific investigations. 309 boys, aged from 1 day to 17 years of life, treated in the Clinical Department of Paediatric Surgery and Traumatology of the Medical University in Lublin from 2009 to 2010 due to diseases needed to be treated surgically, but not the scrotum, were examined in this study. No pathologies influencing the development of genital organs were found in these boys. Dimension of the testes was studied with ultrasound method and with method of external linear measurements. Dimension of epididymes was only examined with ultrasound method. In every age group the author calculated mean arithmetical values for: testiscular length, thickness, width and volume, as well as epididymal depth and basis. With consideration of standard deviation (X+/-1 SD) it was possible to define the range of dimension of healthy testes and epididymes and their change with age. Final dimensions of the right and left testis as well as of the right and left epididymis were compared. Dimensions of the testis on the same side of body acquired with the ultrasound method and acquired with the method of external linear measurements were compared. Statistical work-up with Wilcoxon test for two dependent groups was implemented. Ultrasound evaluation pointed to intensive 2.5-times increase in testicular length and width, and 2-times increase in testicular thickness in boys aged 10 to 17 years. Mean volume of

  6. Nanometer, submicron and micron sized aluminum powder prepared by semi-solid mechanical stirring method with addition of ceramic particles

    International Nuclear Information System (INIS)

    Qin, X.H.; Jiang, D.L.; Dong, S.M.

    2004-01-01

    Composite powder, which is a mixture of Al/Al 2 O 3 composite particles and nanometer, submicron and micron sized aluminum powder, was prepared by semi-solid mechanical stirring method with addition of Al 2 O 3 ceramic particles. The ceramic particles have an average diameter of 80 μm and a volume fraction of 15% in the slurry. The methods used to measure the size distribution of particles greater than 50 μm and less than 50 μm were sieve analysis and photosedimentation, respectively. The surface morphology and transverse sections of the composite powder of different sizes were examined by scanning electron microscope (SEM), optical microscope and auger electron spectroscopy (AES). The results indicate that the composite powder prepared in present work have a wide size distribution ranging from less than 50-900 μm, and the aluminum particles and Al/Al 2 O 3 composite particles are separated and isolated. The particles greater than 200 μm and less than 50 μm are almost pure aluminum powder. The rate of conversion of ingot aluminum into particles less than 1 μm containing nanometer and submicron sizes is 1.777 wt.% in this work. The aluminum powder of different sizes has different shape and surface morphology, quasi-spherical in shape with rough surface for aluminum particles of micron scale, irregular in shape for aluminum particles of submicron scale, and quite close to a globular or an excellent globular in shape for aluminum particles of nanometer size. On the other hand, the surface of ceramic particle was coated by aluminum particles with maximum thickness less than 10 μm containing nanometer and submicron sizes as a single layer. It is suggested that the surface of ceramic particles can provide more nucleation sites for solidification of liquid aluminum and the nucleation of liquid aluminum can take place readily, grow and adhere on the surface of ceramic particles, although it is poorly wetted by the liquid aluminum and the semi-solid slurry can

  7. Two-dimensional simulation of intermediate-sized bubbles in low viscous liquids using counter diffusion lattice Boltzmann method

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Seungyeob, E-mail: syryu@kaeri.re.kr [Korea Atomic Energy Research Institute (KAERI), 1045 Daeduk-daero, Yuseong-gu, Daejeon 305-353 (Korea, Republic of); Kim, Youngin; Kang, Hanok; Kim, Keung Koo [Korea Atomic Energy Research Institute (KAERI), 1045 Daeduk-daero, Yuseong-gu, Daejeon 305-353 (Korea, Republic of); Ko, Sungho, E-mail: sunghoko@cnu.ac.kr [Department of Mechanical Design Engineering, Chungnam National University, 220 Gung-dong, Yuseong-gu, Daejeon 305-764 (Korea, Republic of)

    2016-08-15

    Highlights: • We directly simulate intermediate-sized bubbles in low viscous liquids. • The path instability and shape oscillation can be successfully simulated. • The motion of a pair bubble and bubble swarm is presented. • Bubbles with high-Reynolds-number can be simulated with under-resolved grids. • The counter diffusion multiphase method is feasible for the direct simulation of bubbly flows. - Abstract: The counter diffusion lattice Boltzmann method (LBM) is used to simulate intermediate-sized bubbles in low viscous liquids. Bubbles at high Reynolds numbers ranging from hundreds to thousands are simulated successfully, which cannot be done for the existing LBM versions. The characteristics of the path instability of two rising bubbles are studied for a wide range of Eotvos and Morton numbers. Finally, the study presented how bubble swarms move within the flow and how the flow surrounding the bubbles is affected by the bubble motions.

  8. Improvement of a magnetization method on a small-size superconducting bulk magnet system

    International Nuclear Information System (INIS)

    Yokoyama, K.; Oka, T.; Noto, K.

    2011-01-01

    This paper proposed an effective magnetizing method of high-T c bulk superconductors. The magnetic pass was artificially formed by field-cooling using a permanent magnet. The trapped field was increased by 20-25% as compared with the conventional method. We observed that the channel was formed partially in the trapped field distribution. A pulsed-filed magnetization (PFM) is an important technique for industrial applications of superconducting bulk magnets, and several advanced PFM methods are proposed to enhance the trapped field. In the well-known IMRA method, the channel through the magnetic flux is formed by the flux flow caused by heat generation when applying the strong pulsed-field, and the magnetic flux is made to penetrate into the bulk through the channel in the following pulse application. On the other hand, large applied field leads to large heat generation, and, therefore, the trapped field is decreased greatly. This paper proposes an effective magnetizing method in which the channel composed of magnetic field is artificially formed by field-cooling (FC) using a permanent magnet and the magnetic flux by PFM is induced to the channel. To confirm the validity of this method, the bulk was magnetized by FC using Nd-Fe-B magnets of the rectangular and the ring shapes, and thereafter, a pulsed-field of 6.2 T was applied. As a result, the trapped field of the bulk magnetized by FC using the ring magnet was increased by about 20-25% as compared with that of the conventional PFM, and, moreover, it was observed that the channel was formed partially by measurement of the magnetic field distribution.

  9. Size-dependent photodegradation of CdS particles deposited onto TiO2 mesoporous films by SILAR method

    International Nuclear Information System (INIS)

    Ahmed, Rasin; Will, Geoffrey; Bell, John; Wang Hongxia

    2012-01-01

    The particle size, size distribution and photostability of CdS nanoparticles incorporated onto mesoporous TiO 2 films by a successive ionic layer adsorption and reaction (SILAR) method were investigated by Raman spectroscopy, UV–Visible spectroscopy, transmission electron microscopy (TEM) and X-ray photoelectron spectroscopy (XPS). High-resolution TEM indicated that the synthesized CdS particles were hexagonal phase and the particle sizes were less than 5 nm for up to nine SILAR deposition cycles. Quantum size effect was found with the CdS-sensitized TiO 2 films prepared with up to nine SILAR cycles. The band gap of CdS nanoparticles decreased from 2.65 to 2.37 eV with the increase of the SILAR cycles from 1 to 11. The investigation of the stability of the CdS/TiO 2 films in air under illumination (440.6 μW/cm 2 ) showed that the photodegradation rate was up to 85 % per day for the sample prepared with three SILAR cycles. XPS analysis indicated that the photodegradation was due to the oxidation of CdS, leading to the transformation from sulphide to sulphate (CdSO 4 ). Furthermore, the degradation rate was strongly dependent upon the particle size of CdS. Smaller particles showed faster degradation rate. The size-dependent photo-induced oxidization was rationalized with the variation of size-dependent distribution of surface atoms of CdS particles. Molecular dynamics-based theoretical calculation has indicated that the surface sulphide anion of a large CdS particle such as CdS made with 11 cycles (CdS × 11, average particle size = 5.6 nm) accounts for 9.6 % of the material whereas this value is increased to 19.2 % for (CdS × 3)-based smaller particles (average particle size = 2.7 nm). The photostability of CdS nanoparticles was significantly enhanced when coated with ZnS particles deposited with four SILAR cycles. The growth mechanism of ZnS upon CdS nanoparticles was discussed.

  10. Novel Method for Sizing Metallic Bottom Crack Depth Using Multi-frequency Alternating Current Potential Drop Technique

    OpenAIRE

    Li Yuting; Gan Fangji; Wan Zhengjun; Liao Junbi; Li Wenqiang

    2015-01-01

    Potential drop techniques are of two types: the direct current potential drop (DCPD) technique and alternating current potential drop (ACPD) technique, and both of them are used in nondestructive testing. ACPD, as a kind of valid method in sizing metal cracks, has been applied to evaluate metal structures. However, our review of most available approaches revealed that some improvements can be done in measuring depth of metal bottom crack by means of ACPD, such as accuracy and sensitivity of s...

  11. An investigation into the pricing methods used by small and medium-sized enterprises / Hamilton Tshegofatso Gape

    OpenAIRE

    Gape, Hamilton Tshegofatso

    2007-01-01

    This thesis investigates the pricing methods used by small and medium-sized enterprises (SMEs). Prices are a key determinant of demand which influences revenue and in turn the business' profits. A business may fail if products and services are priced incorrectly. Pricing decision is, therefore, one of the critical success factors of a business, including SMEs. There is consensus widely disseminated in the textbook literature, that successful pricing can only be achieved when...

  12. Dynamic determination of modulus of elasticity of full-size wood composite panels using a vibration method

    Science.gov (United States)

    Cheng Guan; Houjiang Zhang; Lujing Zhou; Xiping Wang

    2015-01-01

    A vibration testing method based on free vibration theory in a ‘‘free–free” support condition was investigated for evaluating the modulus of elasticity (MOE) of full-size wood composite panels (WCPs). Vibration experiments were conducted on three types of WCPs (medium density fibreboard, particleboard, and plywood) to determine the dynamic MOE of the panels. Static...

  13. Vacuum system for applying reflective coatings on large-size optical components using the method of magnetron sputtering

    Science.gov (United States)

    Azerbaev, Alexander A.; Abdulkadyrov, Magomed A.; Belousov, Sergey P.; Ignatov, Aleksandr N.; Mukhammedzyanov, Timur R.

    2016-10-01

    Vacuum system for reflective coatings deposition on large-size optical components up to 4.0 m diameter using the method of magnetron sputtering was built at JSC LZOS. The technological process for deposition of reflective Al coating with protective SiO2 layer was designed and approved. After climatic tests the lifetime of such coating was estimated as 30 years. Uniformity of coating thickness ±5% was achieved on maximum diameter 4.0 m.

  14. A uniform measurement expression for cross method comparison of nanoparticle aggregate size distributions

    DEFF Research Database (Denmark)

    Dudkiewicz, Agnieszka; Wagner, Stephan; Lehner, Angela

    2015-01-01

    Available measurement methods for nanomaterials are based on very different measurement principles and hence produce different values when used on aggregated nanoparticle dispersions. This paper provides a solution for relating measurements of nanomaterials comprised of nanoparticle aggregates de...... and clarifications in current regulations and definitions concerning nanomaterials....

  15. Sampling bee communities using pan traps: alternative methods increase sample size

    Science.gov (United States)

    Monitoring of the status of bee populations and inventories of bee faunas require systematic sampling. Efficiency and ease of implementation has encouraged the use of pan traps to sample bees. Efforts to find an optimal standardized sampling method for pan traps have focused on pan trap color. Th...

  16. Molar mass determination of lignins by size-exclusion chromatography: towards standardisation of the method

    NARCIS (Netherlands)

    Baumberger, S.; Abaecherli, A.; Fasching, M.; Gellerstedt, G.; Gosselink, R.J.A.; Hortling, B.; Li, J.; Saake, B.; Jong, de E.

    2007-01-01

    The reactivity and physicochemical properties of lignins are partly governed by their molar mass distribution. The development of reliable standard methods for determination of the molar mass distribution is not only relevant for designing technical lignins for specific applications, but also for

  17. A critical evaluation of deterministic methods in size optimisation of reliable and cost effective standalone hybrid renewable energy systems

    International Nuclear Information System (INIS)

    Maheri, Alireza

    2014-01-01

    Reliability of a hybrid renewable energy system (HRES) strongly depends on various uncertainties affecting the amount of power produced by the system. In the design of systems subject to uncertainties, both deterministic and nondeterministic design approaches can be adopted. In a deterministic design approach, the designer considers the presence of uncertainties and incorporates them indirectly into the design by applying safety factors. It is assumed that, by employing suitable safety factors and considering worst-case-scenarios, reliable systems can be designed. In fact, the multi-objective optimisation problem with two objectives of reliability and cost is reduced to a single-objective optimisation problem with the objective of cost only. In this paper the competence of deterministic design methods in size optimisation of reliable standalone wind–PV–battery, wind–PV–diesel and wind–PV–battery–diesel configurations is examined. For each configuration, first, using different values of safety factors, the optimal size of the system components which minimises the system cost is found deterministically. Then, for each case, using a Monte Carlo simulation, the effect of safety factors on the reliability and the cost are investigated. In performing reliability analysis, several reliability measures, namely, unmet load, blackout durations (total, maximum and average) and mean time between failures are considered. It is shown that the traditional methods of considering the effect of uncertainties in deterministic designs such as design for an autonomy period and employing safety factors have either little or unpredictable impact on the actual reliability of the designed wind–PV–battery configuration. In the case of wind–PV–diesel and wind–PV–battery–diesel configurations it is shown that, while using a high-enough margin of safety in sizing diesel generator leads to reliable systems, the optimum value for this margin of safety leading to a

  18. Measuring a ballooning gap size of irradiated fuels by the indirect method of neutron radiography

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Cheul Muu; Lee, Seung Wook; Lim, In Cheol; Hong, Kwang Pyo; Kim, Young Jin

    2003-11-01

    An indirect method of a neutron radiography is mobilized for inspecting post irradiated nuclear fuel pins, UO{sub 2}Si clad with Al, which swallowing, crack, ballooning, plug gap, thinning and so on, occurred. The system of an indirect method consists of a cask of carrying fuel pins, Dy converter, linear controller of converter, camera of monitoring fuel cassette. The nuclear sample pins of RISO and KAERI are exposed for 25 min. at the first exposure room, 10{sup 7} cm{sup 2}/sec flux. An activation image formed in the Dy foil is subsequently transferred in a dark room for a more than 8 hours to SR film using the decay radiation. Due to L/D ratio an unsharpness of 9.82{approx}14{mu}m and a magnification of 1.0003 are given. After digitizing an image of SR film, the ballooning gap of plug is discernible by H/V filter of image processing.

  19. Measuring a ballooning gap size of irradiated fuels by the indirect method of neutron radiography

    International Nuclear Information System (INIS)

    Sim, Cheul Muu; Lee, Seung Wook; Lim, In Cheol; Hong, Kwang Pyo; Kim, Young Jin

    2003-11-01

    An indirect method of a neutron radiography is mobilized for inspecting post irradiated nuclear fuel pins, UO 2 Si clad with Al, which swallowing, crack, ballooning, plug gap, thinning and so on, occurred. The system of an indirect method consists of a cask of carrying fuel pins, Dy converter, linear controller of converter, camera of monitoring fuel cassette. The nuclear sample pins of RISO and KAERI are exposed for 25 min. at the first exposure room, 10 7 cm 2 /sec flux. An activation image formed in the Dy foil is subsequently transferred in a dark room for a more than 8 hours to SR film using the decay radiation. Due to L/D ratio an unsharpness of 9.82∼14μm and a magnification of 1.0003 are given. After digitizing an image of SR film, the ballooning gap of plug is discernible by H/V filter of image processing

  20. Application of probabilistic methods for sizing of safety factors in studies on defect harm fullness

    International Nuclear Information System (INIS)

    Ardillon, E.; Pitner, P.

    1996-01-01

    The design rules that are currently under application in nuclear engineering recommend the use of deterministic analysis methods. Probabilistic methods allow the uncertainties inherent in input variables of the analytical model to be taken into account owing to data provided by operation feedback so as to better evaluate the link between the deterministic margins adopted and the actual risk level. In the Resistance R/Loading L elementary case where the variables are Gaussian, there is an explicit relation between the required safety level and the partial safety coefficients which affect each variable. In the complex case of a flawed pipe subjected to various modes of ruin where many random variables are not Gaussian, one can obtain implicit relations. These relations allow a certain flexibility when choosing the coefficients, which poses the problem of their optimum calibration. The choice of coefficients based upon the coordinates of the ''most probable failure point'' illustrates this approach. (authors). 7 refs., 5 figs., 2 tabs

  1. Size-dependent magnetic anisotropy of PEG coated Fe3O4 nanoparticles; comparing two magnetization methods

    Science.gov (United States)

    Nayek, C.; Manna, K.; Imam, A. A.; Alqasrawi, A. Y.; Obaidat, I. M.

    2018-02-01

    Understanding the size dependent magnetic anisotropy of iron oxide nanoparticles is essential for the successful application of these nanoparticles in several technological and medical fields. PEG-coated iron oxide (Fe3O4) nanoparticles with core diameters of 12 nm, 15 nm, and 16 nm were synthesized by the usual co-precipitation method. The morphology and structure of the nanoparticles were investigated using transmission electron microscopy (TEM), high resolution transmission electron microscopy (HRTEM), selected area electron diffraction (SAED), and X-ray diffraction (XRD). Magnetic measurements were conducted using a SQUID. The effective magnetic anisotropy was calculated using two methods from the magnetization measurements. In the first method the zero-field-cooled magnetization versus temperature measurements were used at several applied magnetic fields. In the second method we used the temperature-dependent coercivity curves obtained from the zero-field-cooled magnetization versus magnetic field hysteresis loops. The role of the applied magnetic field on the effective magnetic anisotropy, calculated form the zero-field-cooled magnetization versus temperature measurements, was revealed. The size dependence of the effective magnetic anisotropy constant Keff obtained by the two methods are compared and discussed.

  2. Comparison study on biosynthesis of silver nanoparticles using fresh and hot air oven dried IMPERATA CYLINDRICA leaf

    Science.gov (United States)

    Najmi Bonnia, Noor; Fairuzi, Afiza Ahmad; Akhir, Rabiatuladawiyah Md.; Yahya, Sabrina M.; Rani, Mohd Azri Ab; Ratim, Suzana; Rahman, Norafifah A.; Akil, Hazizan Md

    2018-01-01

    The perennial rhizomatous grass; Imperata cylindrica (I. cylindrica) has been reported rich in various phytochemicals. In present study, silver nanoparticles were synthesized from aqueous leaf extract of I. cylindrica at two different leaf conditions; fresh leaves and hot-air oven dried leaves. Biosynthesized silver nanoparticles were characterized by UV-visible spectroscopy, field emission scanning electron microscopy (FESEM) and Fourier transform infrared spectroscopy (FTIR). Maximum absorption was recorded between 400 nm to 500 nm. FESEM analysis revealed that the silver nanoparticles predominantly form spherical shapes. The particles sizes were ranging from 22-37 nm. The elemental composition of the synthesized silver nanoparticles was confirmed by using energy dispersive X-ray spectroscopy (EDX) analysis. Fourier transform infrared spectroscopy (FTIR) confirmed the reducing and stabilizing actions came from biomolecules associated with I. cylindrica leaf extract. Thus in this investigation, an environmentally safe method to synthesized silver nanoparticles using local plant extract was successfully established.

  3. Automated Method for Fractographic Analysis of Shape and Size of Dimples on Fracture Surface of High-Strength Titanium Alloys

    Directory of Open Access Journals (Sweden)

    Ihor Konovalenko

    2018-03-01

    Full Text Available An automated method for analyzing the shape and size of dimples of ductile tearing formed during static and impact fracture of titanium alloys VT23 and VT23M is proposed. The method is based on the analysis of the image topology. The method contains the operations of smoothing the initial fractographic image; its convolution with a filter to identify the topological ridges; thresholding with subsequent skeletonization to identify boundaries between dimples; clustering to isolate the connected areas that represent the sought objects—dimples. For each dimple, the following quantitative characteristics were calculated: area, coefficient of roundness and visual depth in units of image intensity. The surface of ductile tearing was studied by analyzing the peculiarities of parameter distribution of the found dimples. The proposed method is applied to fractograms of fracture surfaces of titanium alloys VT23 and VT23M.

  4. Determination of the growth restriction factor and grain size for aluminum alloys by a quasi-binary equivalent method

    International Nuclear Information System (INIS)

    Mitrašinović, A.M.; Robles Hernández, F.C.

    2012-01-01

    Highlights: ► A new method to determine the growth restricting factor. (Q) is proposed ► The proposed method is highly accurate (R 2 = 0.99) and simple. ► A major novelty of this method is the determination of Q for non-dilute samples. ► The method proposed herein is based on quasi-binary phase diagrams and composition. ► This method can be easily implemented industrially or as a research tool. - Abstract: In the present research paper is suggested a new methodology to determine the growth restricting factor (Q) and grain size (GS) for various Al-alloys. The present method combines a thermodynamical component based on the liquidus behavior of each alloying element that is later incorporated into the well known growth restricting models for multi-component alloys. This approach that can be used to determine Q and/or GS based on the chemical composition and the slope of the liquidus temperature of any Al-alloy solidified in close to equilibrium conditions. This method can be modified further in order to assess the effect of cooling rate or thermomechanical processing on growth restricting factor and grain size. In the present paper is proposed a highly accurate (R 2 = 0.99) and validated model for Al–Si alloys, but it can be modified for any other Al–X alloying system. The present method can be used for alloys with relatively high solute content and due to the use of the thermodynamics of liquidus this system considers the poisoning effects of single and multi-component alloying elements.

  5. Comparison of the microdosimetric event-size method and the twin-chamber method of separating dose into neutron and gamma components

    International Nuclear Information System (INIS)

    Stinchcomb, T.G.; Kuchnir, F.T.; Skaggs, L.S.

    1980-01-01

    Microdosimetric measurements of event-size spectra, made with a proportional counter, are being used increasingly for separation of dose components in mixed n-γ fields. Measurements in fields produced by 8.3 MeV deuteron bombardment of thick beryllium and deuterium targets were made in air and at 6 and 12 cm depth in water with a spherical tissue-equivalent (TE) proportional counter and with a pair of calibrated ion chambers (TE-TE and Mg-Ar). The dose results obtained with the two methods agree well for the neutron components, but the gamma components do not demonstrate consistent agreement. An important source of error in the microdosimetric method is the matching of the spectra measured at different gain settings to cover the large range of event sizes. The effect of this and other sources of error is analysed. (author)

  6. Regression dilution bias: tools for correction methods and sample size calculation.

    Science.gov (United States)

    Berglund, Lars

    2012-08-01

    Random errors in measurement of a risk factor will introduce downward bias of an estimated association to a disease or a disease marker. This phenomenon is called regression dilution bias. A bias correction may be made with data from a validity study or a reliability study. In this article we give a non-technical description of designs of reliability studies with emphasis on selection of individuals for a repeated measurement, assumptions of measurement error models, and correction methods for the slope in a simple linear regression model where the dependent variable is a continuous variable. Also, we describe situations where correction for regression dilution bias is not appropriate. The methods are illustrated with the association between insulin sensitivity measured with the euglycaemic insulin clamp technique and fasting insulin, where measurement of the latter variable carries noticeable random error. We provide software tools for estimation of a corrected slope in a simple linear regression model assuming data for a continuous dependent variable and a continuous risk factor from a main study and an additional measurement of the risk factor in a reliability study. Also, we supply programs for estimation of the number of individuals needed in the reliability study and for choice of its design. Our conclusion is that correction for regression dilution bias is seldom applied in epidemiological studies. This may cause important effects of risk factors with large measurement errors to be neglected.

  7. An Effective Transform Unit Size Decision Method for High Efficiency Video Coding

    Directory of Open Access Journals (Sweden)

    Chou-Chen Wang

    2014-01-01

    Full Text Available High efficiency video coding (HEVC is the latest video coding standard. HEVC can achieve higher compression performance than previous standards, such as MPEG-4, H.263, and H.264/AVC. However, HEVC requires enormous computational complexity in encoding process due to quadtree structure. In order to reduce the computational burden of HEVC encoder, an early transform unit (TU decision algorithm (ETDA is adopted to pruning the residual quadtree (RQT at early stage based on the number of nonzero DCT coefficients (called NNZ-EDTA to accelerate the encoding process. However, the NNZ-ETDA cannot effectively reduce the computational load for sequences with active motion or rich texture. Therefore, in order to further improve the performance of NNZ-ETDA, we propose an adaptive RQT-depth decision for NNZ-ETDA (called ARD-NNZ-ETDA by exploiting the characteristics of high temporal-spatial correlation that exist in nature video sequences. Simulation results show that the proposed method can achieve time improving ratio (TIR about 61.26%~81.48% when compared to the HEVC test model 8.1 (HM 8.1 with insignificant loss of image quality. Compared with the NNZ-ETDA, the proposed method can further achieve an average TIR about 8.29%~17.92%.

  8. A simple method to approximate liver size on cross-sectional images using living liver models

    International Nuclear Information System (INIS)

    Muggli, D.; Mueller, M.A.; Karlo, C.; Fornaro, J.; Marincek, B.; Frauenfelder, T.

    2009-01-01

    Aim: To assess whether a simple. diameter-based formula applicable to cross-sectional images can be used to calculate the total liver volume. Materials and methods: On 119 cross-sectional examinations (62 computed tomography and 57 magnetic resonance imaging) a simple, formula-based method to approximate the liver volume was evaluated. The total liver volume was approximated measuring the largest craniocaudal (cc), ventrodorsal (vd), and coronal (cor) diameters by two readers and implementing the equation: Vol estimated =ccxvdxcorx0.31. Inter-rater reliability, agreement, and correlation between liver volume calculation and virtual liver volumetry were analysed. Results: No significant disagreement between the two readers was found. The formula correlated significantly with the volumetric data (r > 0.85, p < 0.0001). In 81% of cases the error of the approximated volume was <10% and in 92% of cases <15% compared to the volumetric data. Conclusion: Total liver volume can be accurately estimated on cross-sectional images using a simple, diameter-based equation.

  9. Bridging meta-analysis and the comparative method: a test of seed size effect on germination after frugivores' gut passage.

    Science.gov (United States)

    Verdú, Miguel; Traveset, Anna

    2004-02-01

    Most studies using meta-analysis try to establish relationships between traits across taxa from interspecific databases and, thus, the phylogenetic relatedness among these taxa should be taken into account to avoid pseudoreplication derived from common ancestry. This paper illustrates, with a representative example of the relationship between seed size and the effect of frugivore's gut on seed germination, that meta-analytic procedures can also be phylogenetically corrected by means of the comparative method. The conclusions obtained in the meta-analytical and phylogenetical approaches are very different. The meta-analysis revealed that the positive effects that gut passage had on seed germination increased with seed size in the case of gut passage through birds whereas decreased in the case of gut passage through non-flying mammals. However, once the phylogenetic relatedness among plant species was taken into account, the effects of gut passage on seed germination did not depend on seed size and were similar between birds and non-flying mammals. Some methodological considerations are given to improve the bridge between the meta-analysis and the comparative method.

  10. Complementary methods to estimate population size of Antillean Manatees (Sirenia: Trichechidae at Cienaga de Paredes, Santander, Colombia

    Directory of Open Access Journals (Sweden)

    G.K. Arevalo-Gonzalez

    2014-06-01

    Full Text Available Information on manatee population size in Colombia is limited. This study was aimed at determining manatee population size in the Cienaga de Paredes (Colombia by three different methods: boat-based surveys, side-scan Sonar (SSS surveys and local interviews. Manatees were counted during breathing events by direct observation during the dry season, with the number of sightings per hour (NSH and maximum number of simultaneous sightings (MNSS used as occurrence indices. In 2002, we obtained an average NSH of 27.62 (SD=12.34 and the MNSS was 18; in 2010 the values were 55.71 (SD=29.79 and four respectively. Using linear-transect SSS data we estimated a population size of 12 individuals (%CV=27.3. The local community claimed that no hunting or entanglements had taken place in the area for over 20 years. These methods have pros and cons in terms of investment, effort, efficiency and community involvement, and their efficiency may vary in different seasons. Applying them in a complementary way and at greater spatial and temporal scales could enhance the accuracy of results.

  11. Detecting spatial structures in throughfall data: The effect of extent, sample size, sampling design, and variogram estimation method

    Science.gov (United States)

    Voss, Sebastian; Zimmermann, Beate; Zimmermann, Alexander

    2016-09-01

    In the last decades, an increasing number of studies analyzed spatial patterns in throughfall by means of variograms. The estimation of the variogram from sample data requires an appropriate sampling scheme: most importantly, a large sample and a layout of sampling locations that often has to serve both variogram estimation and geostatistical prediction. While some recommendations on these aspects exist, they focus on Gaussian data and high ratios of the variogram range to the extent of the study area. However, many hydrological data, and throughfall data in particular, do not follow a Gaussian distribution. In this study, we examined the effect of extent, sample size, sampling design, and calculation method on variogram estimation of throughfall data. For our investigation, we first generated non-Gaussian random fields based on throughfall data with large outliers. Subsequently, we sampled the fields with three extents (plots with edge lengths of 25 m, 50 m, and 100 m), four common sampling designs (two grid-based layouts, transect and random sampling) and five sample sizes (50, 100, 150, 200, 400). We then estimated the variogram parameters by method-of-moments (non-robust and robust estimators) and residual maximum likelihood. Our key findings are threefold. First, the choice of the extent has a substantial influence on the estimation of the variogram. A comparatively small ratio of the extent to the correlation length is beneficial for variogram estimation. Second, a combination of a minimum sample size of 150, a design that ensures the sampling of small distances and variogram estimation by residual maximum likelihood offers a good compromise between accuracy and efficiency. Third, studies relying on method-of-moments based variogram estimation may have to employ at least 200 sampling points for reliable variogram estimates. These suggested sample sizes exceed the number recommended by studies dealing with Gaussian data by up to 100 %. Given that most previous

  12. Finite element method calculations of GMI in thin films and sandwiched structures: Size and edge effects

    International Nuclear Information System (INIS)

    Garcia-Arribas, A.; Barandiaran, J.M.; Cos, D. de

    2008-01-01

    The impedance values of magnetic thin films and magnetic/conductor/magnetic sandwiched structures with different widths are computed using the finite element method (FEM). The giant magneto-impedance (GMI) is calculated from the difference of the impedance values obtained with high and low permeability of the magnetic material. The results depend considerably on the width of the sample, demonstrating that edge effects are decisive for the GMI performance. It is shown that, besides the usual skin effect that is responsible for GMI, an 'unexpected' increase of the current density takes place at the lateral edge of the sample. In magnetic thin films this effect is dominant when the permeability is low. In the trilayers, it is combined with the lack of shielding of the central conductor at the edge. The resulting effects on GMI are shown to be large for both kinds of samples. The conclusions of this study are of great importance for the successful design of miniaturized GMI devices

  13. Quantitative optical extinction-based parametric method for sizing a single core-shell Ag-Ag2O nanoparticle

    International Nuclear Information System (INIS)

    Santillan, J M J; Scaffardi, L B; Schinca, D C

    2011-01-01

    This paper develops a parametric method for determining the core radius and shell thickness in small silver-silver-oxide core-shell nanoparticles (Nps) based on single particle optical extinction spectroscopy. The method is based on the study of the relationship between plasmon peak wavelength, full width at half maximum (FWHM) and contrast of the extinction spectra as a function of core radius and shell thickness. This study reveals that plasmon peak wavelength is strongly dependent on shell thickness, whereas FWHM and contrast depend on both variables. These characteristics may be used for establishing an easy and fast stepwise procedure to size core-shell NPs from single particle absorption spectrum. The importance of the method lies in the possibility of monitoring the growth of the silver-oxide layer around small spherical silver Nps in real time. Using the electrostatic approximation of Mie theory, core-shell single particle extinction spectra were calculated for a silver particle's core size smaller than about 20 nm and different thicknesses of silver oxide around it. Analysis of the obtained curves shows a very particular characteristic of the plasmon peak of small silver-silver-oxide Nps, expressed in the fact that its position is strongly dependent on oxide thickness and weakly dependent on the core radius. Even a very thin oxide layer shifts the plasmon peak noticeably, enabling plasmon tuning with appropriate shell thickness. This characteristic, together with the behaviour of FWHM and contrast of the extinction spectra can be combined into a parametric method for sizing both core and shell of single silver Nps in a medium using only optical information. In turn, shell thickness can be related to oxygen content in the Np's surrounding media. The method proposed is applied to size silver Nps from single particle extinction spectrum. The results are compared with full optical spectrum fitting using the electrostatic approximation in Mie theory. The method

  14. Experimental validation of the intrinsic spatial efficiency method over a wide range of sizes for cylindrical sources

    Energy Technology Data Exchange (ETDEWEB)

    Ortiz-Ramŕez, Pablo, E-mail: rapeitor@ug.uchile.cl; Larroquette, Philippe [Departamento de Física, Facultad de Ciencias, Universidad de Chile (Chile); Camilla, S. [Departamento de Física, Universidad Tecnológica Metropolitana (Chile)

    2016-07-07

    The intrinsic spatial efficiency method is a new absolute method to determine the efficiency of a gamma spectroscopy system for any extended source. In the original work the method was experimentally demonstrated and validated for homogeneous cylindrical sources containing {sup 137}Cs, whose sizes varied over a small range (29.5 mm radius and 15.0 to 25.9 mm height). In this work we present an extension of the validation over a wide range of sizes. The dimensions of the cylindrical sources vary between 10 to 40 mm height and 8 to 30 mm radius. The cylindrical sources were prepared using the reference material IAEA-372, which had a specific activity of 11320 Bq/kg at july 2006. The obtained results were better for the sources with 29 mm radius showing relative bias lesser than 5% and for the sources with 10 mm height showing relative bias lesser than 6%. In comparison with the obtained results in the work where we present the method, the majority of these results show an excellent agreement.

  15. Aerobic method for the synthesis of nearly size-monodisperse bismuth nanoparticles from a redox non-innocent precursor

    Science.gov (United States)

    Winter, H.; Christopher-Allison, E.; Brown, A. L.; Goforth, A. M.

    2018-04-01

    Herein, we report an aerobic synthesis method to produce bismuth nanoparticles (Bi NPs) with average diameters in the range 40-80 nm using commercially available bismuth triiodide (BiI3) as the starting material; the method uses only readily available chemicals and conventional laboratory equipment. Furthermore, size data from replicates of the synthesis under standard reaction conditions indicate that this method is highly reproducible in achieving Bi NP populations with low standard deviations in the mean diameters. We also investigated the mechanism of the reaction, which we determined results from the reduction of a soluble alkylammonium iodobismuthate precursor species formed in situ. Under appropriate concentration conditions of iodobismuthate anion, we demonstrate that burst nucleation of Bi NPs results from reduction of Bi3+ by the coordinated, redox non-innocent iodide ligands when a threshold temperature is exceeded. Finally, we demonstrate phase transfer and silica coating of the Bi NPs, which results in stable aqueous colloids with retention of size, morphology, and colloidal stability. The resultant, high atomic number, hydrophilic Bi NPs prepared using this synthesis method have potential for application in emerging x-ray contrast and x-ray therapeutic applications.

  16. Incomplete resistance to coffee leaf rust (Hemileia vastatrix)

    NARCIS (Netherlands)

    Eskes, A.B.

    1983-01-01

    Incomplete resistance to coffee leaf rust ( Hemileia vastatrix ) may be of value in obtaining durable resistance, which is of great importance for the perennial coffee crop. Methods were developed to assess incomplete resistance to coffee leaf rust by using illustrated scales

  17. Composition of the Essential Oil of Clausena Suffruticosa Leaf and ...

    African Journals Online (AJOL)

    Purpose: To investigate the essential oil content of Clausena suffruticosa leaf for its in-vitro antibacterial, antifungal and cytotoxic activities. Methods: The essential oil of Clausena suffruticosa leaf was extracted by hydrodistillation using a modified Clevenger-type apparatus and was analyzed by GC-MS using electron impact ...

  18. Influence of grain size on structural and optic properties of PbS thin films produced by SILAR method

    International Nuclear Information System (INIS)

    Güneri, E.; Göde, F.; Çevik, S.

    2015-01-01

    In this the paper, we use the successive ion layer adsorption and reaction technique (SILAR) chemical deposition method to fabricate good quality PbS thin films and the effects of grain size on the structural and optical properties of the thin films were determined by varying deposition cases. All of the films obtained in different dipping cycles show cubic rock-salt (NaCl) structure. The preferred orientation changed from the (111) direction to the (200) direction with increasing dipping cycles. Grain size determined from scanning electron microscopy (SEM) increased from 32 nm to 104 nm. Moreover, changing of atomic ratio of the thin films is determined according to the results of energy dispersive X-ray (EDX). The transmission of the thin films was characterized by UV–Vis measurements from 400 nm to 1100 nm. It was determined from the allowed direct graphics that the energy band gaps of the thin films shift from 1.33 eV to 1.92 eV in connection with deposition conditions. The variation in band gap may be attributed to the variation of grain size. Additionally, the refractive index (n), extinction coefficient (k), real (ε 1 ) and imaginary (ε 2 ) dielectric constants varied with increasing immersion cycles. - Highlights: • The effects of grain size on the structural, optical properties of PbS thin films deposited by SILAR were investigated. • The preferred orientation varied from the (111) direction to the (200) direction with changing grain size. • The energy band gaps of the thin films shift from 1.33 eV to 1.92 eV in connection with deposition conditions. • The refractive index, extinction coefficient, real and imaginary dielectric constants varied with increasing dipping cycles

  19. Influence of grain size on structural and optic properties of PbS thin films produced by SILAR method

    Energy Technology Data Exchange (ETDEWEB)

    Güneri, E., E-mail: emineg7@gmail.com [Department of Primary Education, Erciyes University, Kayseri 38039, Turkey. (Turkey); Göde, F.; Çevik, S. [Department of Physics, Mehmet Akif Ersoy University, Burdur 15030, Turkey. (Turkey)

    2015-08-31

    In this the paper, we use the successive ion layer adsorption and reaction technique (SILAR) chemical deposition method to fabricate good quality PbS thin films and the effects of grain size on the structural and optical properties of the thin films were determined by varying deposition cases. All of the films obtained in different dipping cycles show cubic rock-salt (NaCl) structure. The preferred orientation changed from the (111) direction to the (200) direction with increasing dipping cycles. Grain size determined from scanning electron microscopy (SEM) increased from 32 nm to 104 nm. Moreover, changing of atomic ratio of the thin films is determined according to the results of energy dispersive X-ray (EDX). The transmission of the thin films was characterized by UV–Vis measurements from 400 nm to 1100 nm. It was determined from the allowed direct graphics that the energy band gaps of the thin films shift from 1.33 eV to 1.92 eV in connection with deposition conditions. The variation in band gap may be attributed to the variation of grain size. Additionally, the refractive index (n), extinction coefficient (k), real (ε{sub 1}) and imaginary (ε{sub 2}) dielectric constants varied with increasing immersion cycles. - Highlights: • The effects of grain size on the structural, optical properties of PbS thin films deposited by SILAR were investigated. • The preferred orientation varied from the (111) direction to the (200) direction with changing grain size. • The energy band gaps of the thin films shift from 1.33 eV to 1.92 eV in connection with deposition conditions. • The refractive index, extinction coefficient, real and imaginary dielectric constants varied with increasing dipping cycles.

  20. Discrete element method modeling of the triboelectric charging of polyethylene particles: Can particle size distribution and segregation reduce the charging?

    International Nuclear Information System (INIS)

    Konopka, Ladislav; Kosek, Juraj

    2015-01-01

    Polyethylene particles of various sizes are present in industrial gas-dispersion reactors and downstream processing units. The contact of the particles with a device wall as well as the mutual particle collisions cause electrons on the particle surface to redistribute in the system. The undesirable triboelectric charging results in several operational problems and safety risks in industrial systems, for example in the fluidized-bed polymerization reactor. We studied the charging of polyethylene particles caused by the particle-particle interactions in gas. Our model employs the Discrete Element Method (DEM) describing the particle dynamics and incorporates the ‘Trapped Electron Approach’ as the physical basis for the considered charging mechanism. The model predicts the particle charge distribution for systems with various particle size distributions and various level of segregation. Simulation results are in a qualitative agreement with experimental observations of similar particulate systems specifically in two aspects: 1) Big particles tend to gain positive charge and small particles the negative one. 2) The wider the particle size distribution is, the more pronounced is the charging process. Our results suggest that not only the size distribution, but also the effect of the spatial segregation of the polyethylene particles significantly influence the resulting charge distribution ‘generated’ in the system. The level of particle segregation as well as the particle size distribution of polyethylene particles can be in practice adjusted by the choice of supported catalysts, by the conditions in the fluidized-bed polymerization reactor and by the fluid dynamics. We also attempt to predict how the reactor temperature affects the triboelectric charging of particles. (paper)

  1. A Mixed-Methods Evaluation of the Choose Less, Weigh Less Portion Size Health Marketing Campaign in Los Angeles County.

    Science.gov (United States)

    Gase, Lauren N; Barragan, Noel C; Robles, Brenda; Leighs, Michael; Kuo, Tony

    2015-01-01

    To assess the impact of the Choose Less, Weigh Less portion size health marketing campaign. A mixed-methods, cross-sectional evaluation. A quantitative Internet panel survey was administered through an online sampling vendor and qualitative interviews were conducted by street intercept. The panel survey included 796 participants, weighted to represent Los Angeles County. Street intercept interviews were conducted with 50 other participants. The Choose Less, Weigh Less campaign included print media on transit shelters, bus and rail cars, and billboards; radio and online advertising; and Web site content and social media outreach. The panel survey measured self-reported campaign exposure and outcomes, including knowledge of recommended daily calorie limits, attitudes toward portion sizes, and intent to reduce calories and portion size. Intercept interviews assessed campaign appeal, clarity, and utility. Weighted survey data were analyzed using logistic regression to assess the association between campaign exposure and outcomes. Interview data were analyzed for themes. The campaign reached 19.7% of the Los Angeles County population. Significant differences were seen for 2 of the 10 outcomes assessed. Participants who saw the campaign were more likely than those who did not to report fast-food portion sizes as being too large (adjusted odds ratio [Adj. OR]: 1.89; 95% confidence interval [CI]: 1.16, 3.07) and intention to choose a smaller portion (Adj. OR: 1.99; 95% CI: 1.20, 3.31). Qualitative data revealed three themes about appeal, clarity, and utility. Health marketing efforts targeting portion size can have relatively broad reach and limited but positive impacts on consumer attitudes and intent to select smaller portions.

  2. Synthesis and characterization of hexagonal nano-sized nickel selenide by simple hydrothermal method assisted by CTAB

    Energy Technology Data Exchange (ETDEWEB)

    Sobhani, Azam [Department of Inorganic Chemistry, Faculty of Chemistry, University of Kashan, Kashan, P.O. Box 87317-51167 (Iran, Islamic Republic of); Davar, Fatemeh [Institute of Nano Science and Nano Technology, University of Kashan, Kashan, P.O. Box 87317-51167 (Iran, Islamic Republic of); Salavati-Niasari, Masoud, E-mail: salavati@kashanu.ac.ir [Department of Inorganic Chemistry, Faculty of Chemistry, University of Kashan, Kashan, P.O. Box 87317-51167 (Iran, Islamic Republic of); Institute of Nano Science and Nano Technology, University of Kashan, Kashan, P.O. Box 87317-51167 (Iran, Islamic Republic of)

    2011-07-01

    Nano-sized nickel selenide powders have been successfully synthesized via an improved hydrothermal route based on the reaction between NiCl{sub 2}.6H{sub 2}O, SeCl{sub 4} and hydrazine (N{sub 2}H{sub 4}.H{sub 2}O) in water, in present of cetyltrimethyl ammonium bromide (CTAB) as surfactant, at various conditions. The products were characterized by X-ray diffraction, scanning electron microscopy, transmission electron microscopy and X-ray energy dispersive spectroscopy analysis. Effects of temperature, reaction time and reductant agent on the morphology, the particle sizes and the phase of the final products have been investigated. It was found that the phase and morphology of the products could be greatly influenced by these parameters. The synthesis procedure is simple and uses less toxic reagents than the previously reported methods. Photoluminescence (PL) was used to study the optical properties of NiSe samples.

  3. Green method for producing hierarchically assembled pristine porous ZnO nanoparticles with narrow particle size distribution

    Energy Technology Data Exchange (ETDEWEB)

    Escobedo-Morales, A., E-mail: alejandro.escobedo@correo.buap.mx [Facultad de Ingeniería Química, Benemérita Universidad Autónoma de Puebla, C.P. 72570 Puebla, Pue. (Mexico); Téllez-Flores, D.; Ruiz Peralta, Ma. de Lourdes [Facultad de Ingeniería Química, Benemérita Universidad Autónoma de Puebla, C.P. 72570 Puebla, Pue. (Mexico); Garcia-Serrano, J.; Herrera-González, Ana M. [Centro de Investigaciones en Materiales y Metalurgia, Universidad Autónoma del Estado de Hidalgo, Carretera Pachuca Tulancingo Km 4.5, Pachuca, Hidalgo (Mexico); Rubio-Rosas, E. [Centro Universitario de Vinculación y Transferencia de Tecnología, Benemérita Universidad Autónoma de Puebla, C.P. 72570 Puebla, Pue. (Mexico); Sánchez-Mora, E. [Instituto de Física, Benemérita Universidad Autónoma de Puebla, Apdo. Postal J-48, 72570 Puebla, Pue. (Mexico); Olivares Xometl, O. [Facultad de Ingeniería Química, Benemérita Universidad Autónoma de Puebla, C.P. 72570 Puebla, Pue. (Mexico)

    2015-02-01

    A green method for producing pristine porous ZnO nanoparticles with narrow particle size distribution is reported. This method consists in synthesizing ZnO{sub 2} nanopowders via a hydrothermal route using cheap and non-toxic reagents, and its subsequent thermal decomposition at low temperature under a non-protective atmosphere (air). The morphology, structural and optical properties of the obtained porous ZnO nanoparticles were studied by means of powder X-ray diffraction, scanning electron microscopy, transmission electron microscopy, Raman spectroscopy, and nitrogen adsorption–desorption measurements. It was found that after thermal decomposition of the ZnO{sub 2} powders, pristine ZnO nanoparticles are obtained. These particles are round-shaped with narrow size distribution. A further analysis of the obtained ZnO nanoparticles reveals that they are hierarchical self-assemblies of primary ZnO particles. The agglomeration of these primary particles at the very early stage of the thermal decomposition of ZnO{sub 2} powders provides to the resulting ZnO nanoparticles a porous nature. The possibility of using the synthesized porous ZnO nanoparticles as photocatalysts has been evaluated on the degradation of rhodamine B dye. - Highlights: • A green synthesis method for obtaining porous ZnO nanoparticles is reported. • The obtained ZnO nanoparticles have narrow particle size distribution. • This method allows obtaining pristine ZnO nanoparticles avoiding unintentional doping. • A growth mechanism for the obtained porous ZnO nanoparticles is proposed.

  4. A new method for estimating the leaf area index of cucumber and tomato plants Um novo método para estimar o índice de área foliar de plantas de pepino e tomate

    Directory of Open Access Journals (Sweden)

    Flávio Favaro Blanco

    2003-12-01

    Full Text Available Non-destructive methods of leaf area measurement are useful for small plant populations, such as experiments with potted plants, and allow the measurement of the same plant several times during the growing period. A methodology was developed to estimate the leaf area index (LAI of cucumber and tomato plants through the evaluation of the leaf area distribution pattern (LADP of the plants and the relative height of the leaves in the plants. Plant and leaf height, as well as the length and width of all leaves were measured and the area of some leaves was determined by a digital area meter. The obtained regression equations were used to estimate the leaf area for all relative heights along the plant. The LADP adjusted to a quadratic model for both crops and LAI were estimated by measuring the length and width of the leaves located at the relative heights representing the mean leaf area of the plants. The LAI estimations presented high precision and accuracy when the proposed methodology was used resulting in time and effort savings and being useful for both crops.Métodos não destrutivos para a medição da área foliar são úteis para pequena população de plantas, como experimentos com plantas conduzidas em vasos, e permitem que a mesma planta seja medida várias vezes durante o período de cultivo. O objetivo desse trabalho foi desenvolver uma metodologia para a estimativa do índice de área foliar (IAF do pepino e do tomate pela determinação do padrão de distribuição de área foliar (PDAF das plantas e da altura relativa da folha que representa a área foliar média da planta. A altura da planta e da folha, assim como o comprimento e a largura de todas as folhas, foram medidos e algumas folhas tiveram sua área determinada por um medidor digital de área foliar. As equações de regressão obtidas foram utilizadas para estimar a área foliar para todas as alturas relativas ao longo da planta. O PDAF ajustou-se a um modelo quadr

  5. Comparing spatial grain-size trends inferred from textural parameters using percentile statistical parameters and those based on the log-hyperbolic method

    DEFF Research Database (Denmark)

    Bartholdy, Jesper; Christiansen, C.; Pedersen, Jørn Bjarke Torp

    2007-01-01

    The Folk&Ward (F&W) and the log-hyperbolic methods are applied to a small - and easy to overlook - number of typical sand sized grain-size distributions from the Danish Wadden Sea. The sand originates from the same source, and the pattern of change in the grain-size distributions is, therefore...

  6. Effect of concentration of imperata cylindrica L leaf extraction synthesis process of gold nanoparticles

    International Nuclear Information System (INIS)

    Iwan Syahjoko Saputra; Yoki Yulizar; Sudirman

    2018-01-01

    Gold Nanoparticles (Gold NPs) successful was performed using HAuCl 4 precursor as Au 3+ ion source with 7 x 10 -4 M concentration. There search aims to knows effect of concentration variation of Imperata cylindrica L leaf extract on synthesis process of gold nanoparticles. There search used of green synthesis method. Colloid of nanoparticles which is formed in analyzed using UV - Vis Spectrophotometer, FT-IR Spectroscopy, PSA, PZC, XRD and TEM. The results of synthesis showed the best concentration of Imperata cilyndrica L leaf extract at 3.46 %, happen a shift of wave length at UV-Vis from 216 nm to 530 nm with 1.779 absorbance value. The PSA analysis showed a particle size of 51.87 nm and a PZC value of -19.2 mV. The result of FT - IR indicated a shift of wave number in the hydroxyl group from 3354 cm -1 to 3390 cm -1 and showed a interaction of hydroxyl group at imperata cylindrica L leaf extract with Au 3+ ion. TEM analysis shows the morphology of Gold NPs that spherical shape with a particle size of 20 nm. XRD calculation results show crystallite size of gold nano particles is 15.47 nm. (author)

  7. Novel Method for Sizing Metallic Bottom Crack Depth Using Multi-frequency Alternating Current Potential Drop Technique

    Science.gov (United States)

    Li, Yuting; Gan, Fangji; Wan, Zhengjun; Liao, Junbi; Li, Wenqiang

    2015-10-01

    Potential drop techniques are of two types: the direct current potential drop (DCPD) technique and alternating current potential drop (ACPD) technique, and both of them are used in nondestructive testing. ACPD, as a kind of valid method in sizing metal cracks, has been applied to evaluate metal structures. However, our review of most available approaches revealed that some improvements can be done in measuring depth of metal bottom crack by means of ACPD, such as accuracy and sensitivity of shallow crack. This paper studied a novel method which utilized the slope of voltage ratio-frequency curve to solve bottom crack depth by using a simple mathematic equation based on finite element analysis. It is found that voltage ratio varies linearly with frequency in the range of 5-15 Hz; this range is slightly higher than the equivalent frequency and lower than semi-permeable frequency. Simulation and experiment show that the novel method can measure the bottom crack depth accurately.

  8. Silver nano fabrication using leaf disc of Passiflora foetida Linn

    Science.gov (United States)

    Lade, Bipin D.; Patil, Anita S.

    2017-06-01

    The main purpose of the experiment is to develop a greener low cost SNP fabrication steps using factories of secondary metabolites from Passiflora leaf extract. Here, the leaf extraction process is omitted, and instead a leaf disc was used for stable SNP fabricated by optimizing parameters such as a circular leaf disc of 2 cm (1, 2, 3, 4, 5) instead of leaf extract and grade of pH (7, 8, 9, 11). The SNP synthesis reaction is tried under room temperature, sun, UV and dark condition. The leaf disc preparation steps are also discussed in details. The SNP obtained using (1 mM: 100 ml AgNO3+ singular leaf disc: pH 9, 11) is applied against featured room temperature and sun condition. The UV spectroscopic analysis confirms that sun rays synthesized SNP yields stable nano particles. The FTIR analysis confirms a large number of functional groups such as alkanes, alkyne, amines, aliphatic amine, carboxylic acid; nitro-compound, alcohol, saturated aldehyde and phenols involved in reduction of silver salt to zero valent ions. The leaf disc mediated synthesis of silver nanoparticles, minimizes leaf extract preparation step and eligible for stable SNP synthesis. The methods sun and room temperature based nano particles synthesized within 10 min would be use certainly for antimicrobial activity.

  9. An analytical approach for optimizing the leaf design of a multi-leaf collimator in a linear accelerator

    International Nuclear Information System (INIS)

    Topolnjak, R; Heide, U A van der

    2008-01-01

    In this study, we present an analytical approach for optimizing the leaf design of a multi-leaf collimator (MLC) in a linear accelerator. Because leaf designs vary between vendors, our goal is to characterize and quantify the effects of different compromises which have to be made between performance parameters. Subsequently, an optimal leaf design for an earlier proposed six-bank MLC which combines a high-resolution field-shaping ability with a large field size is determined. To this end a model of the linac is created that includes the following parameters: the source size, the maximum field size, the distance between source and isocenter, and the leaf's design parameters. First, the optimal radius of the leaf tip was found. This optimum was defined by the requirement that the fluence intensity should fall from 80% of the maximum value to 20% in a minimal distance, defining the width of the fluence penumbra. A second requirement was that this penumbra width should be constant when a leaf moves from one side of the field to the other. The geometric, transmission and total penumbra width (80-20%) were calculated depending on the design parameters. The analytical model is in agreement with Elekta, Varian and Siemens collimator designs. For leaves thinner than 4 cm, the transmission penumbra becomes dominant, and for leaves close to the source the geometric penumbra plays a role. Finally, by choosing the leaf thickness of 3.5 cm, 4 cm and 5 cm from the lowest to the highest bank, respectively, an optimal leaf design for a six-bank MLC is achieved

  10. Sizing up arthropod genomes: an evaluation of the impact of environmental variation on genome size estimates by flow cytometry and the use of qPCR as a method of estimation.

    Science.gov (United States)

    Gregory, T Ryan; Nathwani, Paula; Bonnett, Tiffany R; Huber, Dezene P W

    2013-09-01

    A study was undertaken to evaluate both a pre-existing method and a newly proposed approach for the estimation of nuclear genome sizes in arthropods. First, concerns regarding the reliability of the well-established method of flow cytometry relating to impacts of rearing conditions on genome size estimates were examined. Contrary to previous reports, a more carefully controlled test found negligible environmental effects on genome size estimates in the fly Drosophila melanogaster. Second, a more recently touted method based on quantitative real-time PCR (qPCR) was examined in terms of ease of use, efficiency, and (most importantly) accuracy using four test species: the flies Drosophila melanogaster and Musca domestica and the beetles Tribolium castaneum and Dendroctonus ponderosa. The results of this analysis demonstrated that qPCR has the tendency to produce substantially different genome size estimates from other established techniques while also being far less efficient than existing methods.

  11. Tangential Flow Ultrafiltration: A “Green” Method for the Size Selection and Concentration of Colloidal Silver Nanoparticles

    Science.gov (United States)

    Anders, Catherine B.; Baker, Joshua D.; Stahler, Adam C.; Williams, Austin J.; Sisco, Jackie N.; Trefry, John C.; Wooley, Dawn P.; Pavel Sizemore, Ioana E.

    2012-01-01

    Nowadays, AgNPs are extensively used in the manufacture of consumer products,1 water disinfectants,2 therapeutics,1, 3 and biomedical devices4 due to their powerful antimicrobial properties.3-6 These nanoparticle applications are strongly influenced by the AgNP size and aggregation state. Many challenges exist in the controlled fabrication7 and size-based isolation4,8 of unfunctionalized, homogenous AgNPs that are free from chemically aggressive capping/stabilizing agents or organic solvents.7-13 Limitations emerge from the toxicity of reagents, high costs or reduced efficiency of the AgNP synthesis or isolation methods (e.g., centrifugation, size-dependent solubility, size-exclusion chromatography, etc.).10,14-18 To overcome this, we recently showed that TFU permits greater control over the size, concentration and aggregation state of Creighton AgNPs (300 ml of 15.3 μg ml-1 down to 10 ml of 198.7 μg ml-1) than conventional methods of isolation such as ultracentrifugation.19 TFU is a recirculation method commonly used for the weight-based isolation of proteins, viruses and cells.20,21 Briefly, the liquid sample is passed through a series of hollow fiber membranes with pore size ranging from 1,000 kD to 10 kD. Smaller suspended or dissolved constituents in the sample will pass through the porous barrier together with the solvent (filtrate), while the larger constituents are retained (retentate). TFU may be considered a "green" method as it neither damages the sample nor requires additional solvent to eliminate toxic excess reagents and byproducts. Furthermore, TFU may be applied to a large variety of nanoparticles as both hydrophobic and hydrophilic filters are available. The two main objectives of this study were: 1) to illustrate the experimental aspects of the TFU approach through an invited video experience and 2) to demonstrate the feasibility of the TFU method for larger volumes of colloidal nanoparticles and smaller volumes of retentate. First

  12. Green synthesis and antimicrobial activity of monodisperse silver nanoparticles synthesized using Ginkgo Biloba leaf extract

    Energy Technology Data Exchange (ETDEWEB)

    Ren, Yan-yu [School of Food and Biological Engineering, Shaanxi University of Science & Technology, Xi' an 710021 (China); Yang, Hui, E-mail: 549456369@qq.com [School of Food and Biological Engineering, Shaanxi University of Science & Technology, Xi' an 710021 (China); Wang, Tao [School of Food and Biological Engineering, Shaanxi University of Science & Technology, Xi' an 710021 (China); Wang, Chuang [Department of Highway & Bridge, Shaanxi Railway Institute, Weinan 714000 (China)

    2016-11-25

    Various parts of plants can be used as a raw material for the synthesis of nanoparticles, which is eco-friendly way and does not involve any harmful chemicals. In this project, Ginkgo biloba leaf, an abundantly available medicinal plant in China, was for the first time adopted as a reducing and stabilizing agent to synthesize smaller sized and stable silver nanoparticles (AgNPs). To improve the quality of AgNPs, the reduction was accelerated by changing the concentrations of initial Ag{sup +} (0.02, 0.04, 0.06 and 0.08 mol/L) of the reaction mixture consisting of silver nitrate solution (AgNO{sub 3}) and Ginkgo biloba leaf extract. At pH = 8 and lower AgNO{sub 3} concentration (0.02 mol/L), a colloid consisting of well-dispersed spherical nanoparticles was obtained. The synthesized nanocrystals were successfully characterized by UV–vis and XRD. TEM images revealed the size of the spherical AgNPs ranged between 10–16 nm. FTIR analysis revealed that biological macromolecules with groups of −NH{sub 2}, −OH, and others were distributed on the surface of the nanoparticles. The biosynthesized AgNPs exhibited good antibacterial activities against gram-negative bacteria and gram-positive bacteria. Compared to traditional chemical methods, Ginkgo biloba leaf extract provides an easy green synthetical way. It is anticipated that the biosynthesized AgNPs can be used in areas such as cosmetics, foods and medical applications. - Highlights: • Monodisperse silver nanoparticles were first prepared by a green synthetical way through Ginkgo Biloba leaf extract. • The synthesized AgNPs is of high crystallinity, stable and good dispersion with smaller sizes between 10–16 nm. • The achieved AgNPs exhibits good antibacterial activities. • The biosynthesis method is advantageous for its cost effectiveness, availability, portability, nontoxic and environmentally benign.

  13. Green synthesis and antimicrobial activity of monodisperse silver nanoparticles synthesized using Ginkgo Biloba leaf extract

    International Nuclear Information System (INIS)

    Ren, Yan-yu; Yang, Hui; Wang, Tao; Wang, Chuang

    2016-01-01

    Various parts of plants can be used as a raw material for the synthesis of nanoparticles, which is eco-friendly way and does not involve any harmful chemicals. In this project, Ginkgo biloba leaf, an abundantly available medicinal plant in China, was for the first time adopted as a reducing and stabilizing agent to synthesize smaller sized and stable silver nanoparticles (AgNPs). To improve the quality of AgNPs, the reduction was accelerated by changing the concentrations of initial Ag + (0.02, 0.04, 0.06 and 0.08 mol/L) of the reaction mixture consisting of silver nitrate solution (AgNO 3 ) and Ginkgo biloba leaf extract. At pH = 8 and lower AgNO 3 concentration (0.02 mol/L), a colloid consisting of well-dispersed spherical nanoparticles was obtained. The synthesized nanocrystals were successfully characterized by UV–vis and XRD. TEM images revealed the size of the spherical AgNPs ranged between 10–16 nm. FTIR analysis revealed that biological macromolecules with groups of −NH 2 , −OH, and others were distributed on the surface of the nanoparticles. The biosynthesized AgNPs exhibited good antibacterial activities against gram-negative bacteria and gram-positive bacteria. Compared to traditional chemical methods, Ginkgo biloba leaf extract provides an easy green synthetical way. It is anticipated that the biosynthesized AgNPs can be used in areas such as cosmetics, foods and medical applications. - Highlights: • Monodisperse silver nanoparticles were first prepared by a green synthetical way through Ginkgo Biloba leaf extract. • The synthesized AgNPs is of high crystallinity, stable and good dispersion with smaller sizes between 10–16 nm. • The achieved AgNPs exhibits good antibacterial activities. • The biosynthesis method is advantageous for its cost effectiveness, availability, portability, nontoxic and environmentally benign.

  14. Exploring topographic methods for monitoring morphological changes in mountain channels of different size and slope

    Science.gov (United States)

    Theule, Joshua; Bertoldi, Gabriele; Comiti, Francesco; Macconi, Pierpaolo; Mazzorana, Bruno

    2015-04-01

    High resolution digital elevation models (DEM) can easily be obtained using either laser scanning technology or photogrammetry with structure from motion (SFM). The scale, resolution, and accuracy can vary according to how the data is acquired, such as by helicopter, drone, or extendable pole. In the Autonomous Province of Bozen-Bolzano (Northern Italy), we had the opportunity to compare several of these techniques at different scales in mountain streams ranging from low-gradient braided rivers to steep debris flow channels. The main objective is to develop protocols for efficient monitoring of morphologic changes in different parts of the river systems. For SFM methods, we used the software "Photoscan Professional" (Agisoft) to generate densified point clouds. Both artificial and natural targets were used to georeference them. In some cases, targets were not even necessary and point clouds could be aligned with older point clouds by using the iterative closest point algorithm in the freeware "CloudCompare". At the Mareit/Mareta River, a restored braided river, an airborne laser scan survey (2011) was compared to a SFM DEM derived from a helicopter photo survey (2014) carried out (by the Autonomous Province of Bolzano) at approximately 100 m above ground. Photogrammetry point clouds had an alignment error of 1.5 cm and had three times more data coverage than laser scanning. Indeed, the large spacing and clustering of 2011 ALS swaths led to areas of no data when a 10-cm grid is developed. In the Gadria basin, a debris flow monitoring catchment, we used a sediment retention basin to compare debris flow volumes resulting from i) a drone (by the "Mavtech" company) survey at 10 m above ground (with GoPro camera), ii) a 5-m pole-mounted camera (with Canon EOS 700D) and iii) a 3-m pole-mounted camera (with GoPro Hero Silver3+) to a iv) TLS survey. As the drone had limited load capacity (especially at high elevations) we used the lightweight GoPro Hero 3+, but due to the

  15. METHOD OF ESTIMATION INFLUENCE OF MASS AND SIZE INDEXES OF SYNCHRONOUS GENERATORS ON THEIR DYNAMIC STABILITY AT EXTERNAL INDIGNATIONS

    OpenAIRE

    Chernyuk, Artem Mikhaylovich; Egorov, Оleksii Borisovich; Budanov, Pavlo Feofanovch; Bykova, Viktoriya Sergeyevna

    2015-01-01

    The analysis of methods of decline of mass and size indexes of synchronous generators and increase of their tecnik and economic descriptions is conducted in the article. Possible changes are certain in the modes of operations of machine as a result of change of its массо-габаритных indexes. Dependence of dynamic stability of work of machine as function of moment of inertia of its rotor is shown. Descriptions of speed of change of corner of ä of synchronous generator are got depending on the m...

  16. A method to determine size-specific natural mortality applied to westcoast steenbras ( Lithognathus aureti ) in Namibia

    DEFF Research Database (Denmark)

    Beyer, Jan; Kirchner, C.H.; Holtzhausen, J.A.

    1999-01-01

    in stocks that are close to a virgin state. Size-specific natural mortality rates of westcoast steenbras (Lithognathus aureti) were determined by using length frequencies of rod-caught fish from a lightly exploited and closed population at Meob Bay, Namibia. It was assumed that natural mortality...... with a constant coefficient of variation in length at age. The simple method works within 10% precision criteria in most real cases. It is shown that overestimating mean length at old ((L) over bar(infinity)) counteracts the effects of overlapping lengths for consecutive age groups. This fact can be used...

  17. Utilization of Cellulose from Pineapple Leaf Fibers as Nanofiller in Polyvinyl Alcohol-Based Film

    Directory of Open Access Journals (Sweden)

    Kendri Wahyuningsih

    2016-08-01

    Full Text Available Cellulose from pineapple leaf fibers as one of the natural polymer which has biodegradable property in a nanometer’s scale, can be formed as a filler in composite of Poly(vinyl Alcohol/PVA is expected to increase the physical, thermal, and barrier properties of composite films similar to conventional plastic. The aim of this study was to examine the effect of fibrillation of cellulose fibers from pineapple leaf fibers using a combined technique of chemical-mechanical treatments, to investigate the reinforcing effect of concentration of nanocellulose fibrils in the polyvinyl alcohol (PVA matrix on physical properties, thermal properties, water vapor transmission rate, light transmittance and morphological with and without addition of glycerol. Nanocellulose was made from cellulose of pineapple leaf fiber using wet milling (Ultra Fine Grinder. The composite film production was carried out by using casting solution method by mixing PVA solution with nanocellulose (10-50% and glycerol (0-1%. The characterization of film covered physical properties (thickness, moisture content and density, thermal properties, permeability (WVTR, light transmittance, morphology, and crystallinity. Nanocellulose from pineapple leaf fibers was produced by Ultra Fine Grinder shows that the size reduction process was accurate. Nanocellulose addition on PVA composite film was affected to increasing the physical, thermal, and barrier properties. Meanwhile, decreasing the percentage of composite film transmittance, thus the transparency decrease (opaque. Water vapor transmission rate (WVTR the film was increased with increasing glycerol concentration, but the physical and thermal properties was decreased.

  18. Extracellular synthesis of silver nanoparticles using the leaf extract of Coleus amboinicus Lour

    Energy Technology Data Exchange (ETDEWEB)

    Narayanan, Kannan Badri [Department of Biotechnology, School of Life Sciences, Pondicherry University, Kalapet, Puducherry 605014 (India); Sakthivel, Natarajan, E-mail: puns2005@gmail.com [Department of Biotechnology, School of Life Sciences, Pondicherry University, Kalapet, Puducherry 605014 (India)

    2011-10-15

    Highlights: {yields} Synthesis of AgNPs using the leaf extract of Coleus amboinicus L. was described. {yields} UV-vis absorption spectra showed the formation of isotrophic AgNPs at 437 nm in 6 h. {yields} XRD analysis showed intense peaks corresponding to fcc structure of AgNPs. {yields} HR-TEM analysis revealed the formation of stable anisotrophic and isotrophic AgNPs. -- Abstract: In the present investigation, Coleus amboinicus Lour. leaf extract-mediated green chemistry approach for the synthesis of silver nanoparticles was described. The nanoparticles were characterized by ultraviolet-visible (UV-Vis) spectroscopy, X-ray diffraction (XRD), energy dispersive X-ray analysis (EDAX), Fourier transform infrared spectroscopy (FTIR) and transmission electron microscopy (TEM). The influence of leaf extract on the control of size and shape of silver nanoparticles is reported. Upon an increase in the concentration of leaf extract, there was a shift in the shape of nanoparticles from anisotrophic nanostructures like triangle, decahedral and hexagonal to isotrophic spherical nanoparticles. Crystalline nature of fcc structured nanoparticles was confirmed by XRD spectrum with peaks corresponding to (1 1 1), (2 0 0), (2 2 0) and (3 1 1) planes and bright circular spots in the selected-area electron diffraction (SAED). Such environment friendly and sustainable methods are non-toxic, cheap and alternative to hazardous chemical procedures.

  19. Optimization of Blending Parameters and Fiber Size of Kenaf-Bast-Fiber-Reinforced the Thermoplastic Polyurethane Composites by Taguchi Method

    Directory of Open Access Journals (Sweden)

    Y. A. El-Shekeil

    2013-01-01

    Full Text Available “Kenaf-fibers- (KF-” reinforced “thermoplastic polyurethane (TPU” composites were prepared by the melt-blending method followed by compression molding. Composite specimens were cut from the sheets that were prepared by compression molding. The criteria of optimization were testing the specimens by tensile test and comparing the ultimate tensile strength. The aim of this study is to optimize processing parameters (e.g., processing temperature, time, and speed and fiber size using the Taguchi approach. These four parameters were investigated in three levels each. The L9 orthogonal array was used based on the number of parameters and levels that has been selected. Furthermore, analysis of variance (ANOVA was used to determine the significance of different parameters. The results showed that the optimum values were 180°C, 50 rpm, 13 min, and 125–300 micron for processing temperature, processing speed, processing time, and fiber size, respectively. Using ANOVA, processing temperature showed the highest significance value followed by fiber size. Processing time and speed did not show any significance on the optimization of TPU/KF.

  20. An evaluation of gating window size, delivery method, and composite field dosimetry of respiratory-gated IMRT

    International Nuclear Information System (INIS)

    Hugo, Geoffrey D.; Agazaryan, Nzhde; Solberg, Timothy D.

    2002-01-01

    A respiratory gating system has been developed based on a commercial patient positioning system. The purpose of this study is to investigate the ability of the gating system to reproduce normal, nongated IMRT operation and to quantify the errors produced by delivering a nongated IMRT treatment onto a moving target. A moving phantom capable of simultaneous two-dimensional motion was built, and an analytical liver motion function was used to drive the phantom. Studies were performed to assess the effect of gating window size and choice of delivery method (segmented and dynamic multileaf collimation). Additionally, two multiple field IMRT cases were delivered to quantify the error in gated and nongated IMRT with motion. Dosimetric error between nonmoving and moving deliveries is related to gating window size. By reducing the window size, the error can be reduced. Delivery error can be reduced for both dynamic and segmented delivery with gating. For the implementation of dynamic IMRT delivery in this study, dynamic delivery was found to generate larger delivery errors than segmented delivery in most cases studied. For multiple field IMRT delivery, the largest errors were generated in regions where high field modulation was present parallel to the axis of motion. Gating was found to reduce these large errors to clinically acceptable levels

  1. Cluster size statistic and cluster mass statistic: two novel methods for identifying changes in functional connectivity between groups or conditions.

    Science.gov (United States)

    Ing, Alex; Schwarzbauer, Christian

    2014-01-01

    Functional connectivity has become an increasingly important area of research in recent years. At a typical spatial resolution, approximately 300 million connections link each voxel in the brain with every other. This pattern of connectivity is known as the functional connectome. Connectivity is often compared between experimental groups and conditions. Standard methods used to control the type 1 error rate are likely to be insensitive when comparisons are carried out across the whole connectome, due to the huge number of statistical tests involved. To address this problem, two new cluster based methods--the cluster size statistic (CSS) and cluster mass statistic (CMS)--are introduced to control the family wise error rate across all connectivity values. These methods operate within a statistical framework similar to the cluster based methods used in conventional task based fMRI. Both methods are data driven, permutation based and require minimal statistical assumptions. Here, the performance of each procedure is evaluated in a receiver operator characteristic (ROC) analysis, utilising a simulated dataset. The relative sensitivity of each method is also tested on real data: BOLD (blood oxygen level dependent) fMRI scans were carried out on twelve subjects under normal conditions and during the hypercapnic state (induced through the inhalation of 6% CO2 in 21% O2 and 73%N2). Both CSS and CMS detected significant changes in connectivity between normal and hypercapnic states. A family wise error correction carried out at the individual connection level exhibited no significant changes in connectivity.

  2. Classification of molecular structure images by using ANN, RF, LBP, HOG, and size reduction methods for early stomach cancer detection

    Science.gov (United States)

    Aytaç Korkmaz, Sevcan; Binol, Hamidullah

    2018-03-01

    Patients who die from stomach cancer are still present. Early diagnosis is crucial in reducing the mortality rate of cancer patients. Therefore, computer aided methods have been developed for early detection in this article. Stomach cancer images were obtained from Fırat University Medical Faculty Pathology Department. The Local Binary Patterns (LBP) and Histogram of Oriented Gradients (HOG) features of these images are calculated. At the same time, Sammon mapping, Stochastic Neighbor Embedding (SNE), Isomap, Classical multidimensional scaling (MDS), Local Linear Embedding (LLE), Linear Discriminant Analysis (LDA), t-Distributed Stochastic Neighbor Embedding (t-SNE), and Laplacian Eigenmaps methods are used for dimensional the reduction of the features. The high dimension of these features has been reduced to lower dimensions using dimensional reduction methods. Artificial neural networks (ANN) and Random Forest (RF) classifiers were used to classify stomach cancer images with these new lower feature sizes. New medical systems have developed to measure the effects of these dimensions by obtaining features in different dimensional with dimensional reduction methods. When all the methods developed are compared, it has been found that the best accuracy results are obtained with LBP_MDS_ANN and LBP_LLE_ANN methods.

  3. When one size does not fit all: a simple statistical method to deal with across-individual variations of effects.

    Science.gov (United States)

    Vindras, Philippe; Desmurget, Michel; Baraduc, Pierre

    2012-01-01

    In science, it is a common experience to discover that although the investigated effect is very clear in some individuals, statistical tests are not significant because the effect is null or even opposite in other individuals. Indeed, t-tests, Anovas and linear regressions compare the average effect with respect to its inter-individual variability, so that they can fail to evidence a factor that has a high effect in many individuals (with respect to the intra-individual variability). In such paradoxical situations, statistical tools are at odds with the researcher's aim to uncover any factor that affects individual behavior, and not only those with stereotypical effects. In order to go beyond the reductive and sometimes illusory description of the average behavior, we propose a simple statistical method: applying a Kolmogorov-Smirnov test to assess whether the distribution of p-values provided by individual tests is significantly biased towards zero. Using Monte-Carlo studies, we assess the power of this two-step procedure with respect to RM Anova and multilevel mixed-effect analyses, and probe its robustness when individual data violate the assumption of normality and homoscedasticity. We find that the method is powerful and robust even with small sample sizes for which multilevel methods reach their limits. In contrast to existing methods for combining p-values, the Kolmogorov-Smirnov test has unique resistance to outlier individuals: it cannot yield significance based on a high effect in one or two exceptional individuals, which allows drawing valid population inferences. The simplicity and ease of use of our method facilitates the identification of factors that would otherwise be overlooked because they affect individual behavior in significant but variable ways, and its power and reliability with small sample sizes (<30-50 individuals) suggest it as a tool of choice in exploratory studies.

  4. When one size does not fit all: a simple statistical method to deal with across-individual variations of effects.

    Directory of Open Access Journals (Sweden)

    Philippe Vindras

    Full Text Available In science, it is a common experience to discover that although the investigated effect is very clear in some individuals, statistical tests are not significant because the effect is null or even opposite in other individuals. Indeed, t-tests, Anovas and linear regressions compare the average effect with respect to its inter-individual variability, so that they can fail to evidence a factor that has a high effect in many individuals (with respect to the intra-individual variability. In such paradoxical situations, statistical tools are at odds with the researcher's aim to uncover any factor that affects individual behavior, and not only those with stereotypical effects. In order to go beyond the reductive and sometimes illusory description of the average behavior, we propose a simple statistical method: applying a Kolmogorov-Smirnov test to assess whether the distribution of p-values provided by individual tests is significantly biased towards zero. Using Monte-Carlo studies, we assess the power of this two-step procedure with respect to RM Anova and multilevel mixed-effect analyses, and probe its robustness when individual data violate the assumption of normality and homoscedasticity. We find that the method is powerful and robust even with small sample sizes for which multilevel methods reach their limits. In contrast to existing methods for combining p-values, the Kolmogorov-Smirnov test has unique resistance to outlier individuals: it cannot yield significance based on a high effect in one or two exceptional individuals, which allows drawing valid population inferences. The simplicity and ease of use of our method facilitates the identification of factors that would otherwise be overlooked because they affect individual behavior in significant but variable ways, and its power and reliability with small sample sizes (<30-50 individuals suggest it as a tool of choice in exploratory studies.

  5. Comparison of three analytical methods to measure the size of silver nanoparticles in real environmental water and wastewater samples

    International Nuclear Information System (INIS)

    Chang, Ying-jie; Shih, Yang-hsin; Su, Chiu-Hun; Ho, Han-Chen

    2017-01-01

    Highlights: • Three emerging techniques to detect NPs in the aquatic environment were evaluated. • The pretreatment of centrifugation to decrease the interference was established. • Asymmetric flow field flow fractionation has a low recovery of NPs. • Hydrodynamic chromatography is recommended to be a low-cost screening tool. • Single particle ICPMS is recommended to accurately measure trace NPs in water. - Abstract: Due to the widespread application of engineered nanoparticles, their potential risk to ecosystems and human health is of growing concern. Silver nanoparticles (Ag NPs) are one of the most extensively produced NPs. Thus, this study aims to develop a method to detect Ag NPs in different aquatic systems. In complex media, three emerging techniques are compared, including hydrodynamic chromatography (HDC), asymmetric flow field flow fractionation (AF4) and single particle inductively coupled plasma-mass spectrometry (SP-ICP-MS). The pre-treatment procedure of centrifugation is evaluated. HDC can estimate the Ag NP sizes, which were consistent with the results obtained from DLS. AF4 can also determine the size of Ag NPs but with lower recoveries, which could result from the interactions between Ag NPs and the working membrane. For the SP-ICP-MS, both the particle size and concentrations can be determined with high Ag NP recoveries. The particle size resulting from SP-ICP-MS also corresponded to the transmission electron microscopy observation (p > 0.05). Therefore, HDC and SP-ICP-MS are recommended for environmental analysis of the samples after our established pre-treatment process. The findings of this study propose a preliminary technique to more accurately determine the Ag NPs in aquatic environments and to use this knowledge to evaluate the environmental impact of manufactured NPs.

  6. Comparison of three analytical methods to measure the size of silver nanoparticles in real environmental water and wastewater samples

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Ying-jie [Department of Agricultural Chemistry, National Taiwan University, Taipei 106, Taiwan (China); Shih, Yang-hsin, E-mail: yhs@ntu.edu.tw [Department of Agricultural Chemistry, National Taiwan University, Taipei 106, Taiwan (China); Su, Chiu-Hun [Material and Chemical Research Laboratories, Industrial Technology Research Institute, Hsinchu 310, Taiwan (China); Ho, Han-Chen [Department of Anatomy, Tzu-Chi University, Hualien 970, Taiwan (China)

    2017-01-15

    Highlights: • Three emerging techniques to detect NPs in the aquatic environment were evaluated. • The pretreatment of centrifugation to decrease the interference was established. • Asymmetric flow field flow fractionation has a low recovery of NPs. • Hydrodynamic chromatography is recommended to be a low-cost screening tool. • Single particle ICPMS is recommended to accurately measure trace NPs in water. - Abstract: Due to the widespread application of engineered nanoparticles, their potential risk to ecosystems and human health is of growing concern. Silver nanoparticles (Ag NPs) are one of the most extensively produced NPs. Thus, this study aims to develop a method to detect Ag NPs in different aquatic systems. In complex media, three emerging techniques are compared, including hydrodynamic chromatography (HDC), asymmetric flow field flow fractionation (AF4) and single particle inductively coupled plasma-mass spectrometry (SP-ICP-MS). The pre-treatment procedure of centrifugation is evaluated. HDC can estimate the Ag NP sizes, which were consistent with the results obtained from DLS. AF4 can also determine the size of Ag NPs but with lower recoveries, which could result from the interactions between Ag NPs and the working membrane. For the SP-ICP-MS, both the particle size and concentrations can be determined with high Ag NP recoveries. The particle size resulting from SP-ICP-MS also corresponded to the transmission electron microscopy observation (p > 0.05). Therefore, HDC and SP-ICP-MS are recommended for environmental analysis of the samples after our established pre-treatment process. The findings of this study propose a preliminary technique to more accurately determine the Ag NPs in aquatic environments and to use this knowledge to evaluate the environmental impact of manufactured NPs.

  7. Simulations of two sedimenting-interacting spheres with different sizes and initial configurations using immersed boundary method

    Science.gov (United States)

    Liao, Chuan-Chieh; Hsiao, Wen-Wei; Lin, Ting-Yu; Lin, Chao-An

    2015-06-01

    Numerical investigations are carried out for the drafting, kissing and tumbling (DKT) phenomenon of two freely falling spheres within a long container by using an immersed-boundary method. The method is first validated with flows induced by a sphere settling under gravity in a small container for which experimental data are available. The hydrodynamic interactions of two spheres are then studied with different sizes and initial configurations. When a regular sphere is placed below the larger one, the duration of kissing decreases in pace with the increase in diameter ratio. On the other hand, the time duration of the kissing stage increases in tandem with the increase in diameter ratio as the large sphere is placed below the regular one, and there is no DKT interactions beyond threshold diameter ratio. Also, the gap between homogeneous spheres remains constant at the terminal velocity, whereas the gaps between the inhomogeneous spheres increase due to the differential terminal velocity.

  8. Optimal Sizing of Decentralized Photovoltaic Generation and Energy Storage Units for Malaysia Residential Household Using Iterative Method

    Directory of Open Access Journals (Sweden)

    Rahman Hasimah Abdul

    2016-01-01

    Full Text Available World’s fuel sources are decreasing, and global warming phenomena cause the necessity of urgent search for alternative energy sources. Photovoltaic generating system has a high potential, since it is clean, environmental friendly and secure energy sources. This paper presents an optimal sizing of decentralized photovoltaic system and electrical energy storage for a residential household using iterative method. The cost of energy, payback period, degree of autonomy and degree of own-consumption are defined as optimization parameters. A case study is conducted by employing Kuala Lumpur meteorological data, typical load profile from rural area in Malaysia, decentralized photovoltaic generation unit and electrical storage and it is analyzed in hourly basis. An iterative method is used with photovoltaic array variable from 0.1kW to 4.0kW and storage system variable from 50Ah to 400Ah was performed to determine the optimal design for the proposed system.

  9. Growth of large size lithium niobate single crystals of high quality by tilting-mirror-type floating zone method

    Energy Technology Data Exchange (ETDEWEB)

    Sarker, Abdur Razzaque, E-mail: razzaque_ru2000@yahoo.com [Department of Physics, University of Rajshahi (Bangladesh)

    2016-05-15

    Large size high quality LiNbO{sub 3} single crystals were grown successfully by tilting-mirror-type floating zone (TMFZ) technique. The grown crystals were characterized by X-ray diffraction, etch pits density measurement, Impedance analysis, Vibrating sample magnetometry (VSM) and UV-Visible spectrometry. The effect of mirror tilting during growth on the structural, electrical, optical properties and defect density of the LiNbO{sub 3} crystals were investigated. It was found that the defect density in the crystals reduced for tilting the mirror in the TMFZ method. The chemical analysis revealed that the grown crystals were of high quality with uniform composition. The single crystals grown by TMFZ method contains no low-angle grain boundaries, indicating that they can be used for high efficiency optoelectronic devices. (author)

  10. Effect of smelting method on the austenite grain size and properties of heat-resisting pearlitic steel

    International Nuclear Information System (INIS)

    Balakhovskaya, M.B.; Khusainova, N.A.; Davlyatova, L.N.

    1975-01-01

    Influence of smelting method on austenite grain size and properties of refractory perlite steel were studied. An opportunity was found to increase the steel refractoriness without deteriorating its other properties. The steel 12Kh1MF of electric or common open-hearth smelting was used. The dependence of kinetics of austenite grain growth on the smelting method was studied in the temperature range 950 deg - 1200 deg C with 1 hour exposure. The grain size of austenite in steel is supposedly determined by aluminium nitrides and vanadium carbides. In tests of normalized (kept for 20 minutes at 950-980 deg C) and tempered (kept for 3 hours at 730 deg C) transverse (tangential) pipe cross-section samples the electric steel had higher impact viscosity than the open-hearth metal. At working temperatures (540 deg -580 deg C) the difference in viscosity has its minimum. Viscosity of both steels 12Kh1MF begins to sharply decrease from 20 deg C. However, electric steel has rather high viscosity even at - 40 deg C, while the open-hearth one becomes brittle as early as at - 20 deg C. Long-term strength tests at 580 deg C under stresses 10-14 kG/mm 2 show that the coarse-grain steel is more refractory, i.e. time till fracture of open-hearth steel samples is twice as long as that of electric steel samples

  11. Effect of smelting method on the austenite grain size and properties of heat-resisting pearlitic steel

    Energy Technology Data Exchange (ETDEWEB)

    Balakhovskaya, M B; Khusainova, N A; Davlyatova, L N [Vsesoyuznyj Nauchno-Issledovatel' skij Teplotekhnicheskij Inst., Moscow (USSR)

    1975-12-01

    Influence of smelting method on austenite grain size and properties of refractory perlite steel were studied. An opportunity was found to increase the steel refractoriness without deteriorating its other properties. The steel 12Kh1MF of electric or common open-hearth smelting was used. The dependence of kinetics of austenite grain growth on the smelting method was studied in the temperature range 950 deg - 1200 deg C with 1 hour exposure. The grain size of austenite in steel is supposedly determined by aluminium nitrides and vanadium carbides. In tests of normalized (kept for 20 minutes at 950-980 deg C) and tempered (kept for 3 hours at 730 deg C) transverse (tangential) pipe cross-section samples the electric steel had higher impact viscosity than the open-hearth metal. At working temperatures (540 deg -580 deg C) the difference in viscosity has its minimum. Viscosity of both steels 12Kh1MF begins to sharply decrease from 20 deg C. However, electric steel has rather high viscosity even at /sup -/40 deg C, while the open-hearth one becomes brittle as early as at /sup -/20 deg C. Long-term strength tests at 580 deg C under stresses 10-14 kG/mm/sup 2/ show that the coarse-grain steel is more refractory, i.e. time till fracture of open-hearth steel samples is twice as long as that of electric steel samples.

  12. Introducing micrometer-sized artificial objects into live cells: a method for cell-giant unilamellar vesicle electrofusion.

    Directory of Open Access Journals (Sweden)

    Akira C Saito

    Full Text Available Here, we report a method for introducing large objects of up to a micrometer in diameter into cultured mammalian cells by electrofusion of giant unilamellar vesicles. We prepared GUVs containing various artificial objects using a water-in-oil (w/o emulsion centrifugation method. GUVs and dispersed HeLa cells were exposed to an alternating current (AC field to induce a linear cell-GUV alignment, and then a direct current (DC pulse was applied to facilitate transient electrofusion. With uniformly sized fluorescent beads as size indexes, we successfully and efficiently introduced beads of 1 µm in diameter into living cells along with a plasmid mammalian expression vector. Our electrofusion did not affect cell viability. After the electrofusion, cells proliferated normally until confluence was reached, and the introduced fluorescent beads were inherited during cell division. Analysis by both confocal microscopy and flow cytometry supported these findings. As an alternative approach, we also introduced a designed nanostructure (DNA origami into live cells. The results we report here represent a milestone for designing artificial symbiosis of functionally active objects (such as micro-machines in living cells. Moreover, our technique can be used for drug delivery, tissue engineering, and cell manipulation.

  13. Design of a QA method to characterize submillimeter-sized PBS beam properties using a 2D ionization chamber array

    Science.gov (United States)

    Lin, Yuting; Bentefour, Hassan; Flanz, Jacob; Kooy, Hanne; Clasie, Benjamin

    2018-05-01

    Pencil beam scanning (PBS) periodic quality assurance (QA) programs ensure the beam delivered to patients is within technical specifications. Two critical specifications for PBS delivery are the beam width and position. The aim of this study is to investigate whether a 2D ionization chamber array, such as the MatriXX detector (IBA Dosimetry, Schwarzenbruck, Germany), can be used to characterize submillimeter-sized PBS beam properties. The motivation is to use standard equipment, which may have pixel spacing coarser than the pencil beam size, and simplify QA workflow. The MatriXX pixels are cylindrical in shape with 4.5 mm diameter and are spaced 7.62 mm from center to center. Two major effects limit the ability of using the MatriXX to measure the spot position and width accurately. The first effect is that too few pixels sample the Gaussian shaped pencil beam profile and the second effect is volume averaging of the Gaussian profile over the pixel sensitive volumes. We designed a method that overcomes both limitations and hence enables the use of the MatriXX to characterize sub-millimeter-sized PBS beam properties. This method uses a cross-like irradiation pattern that is designed to increase the number of sampling data points and a modified Gaussian fitting technique to correct for volume averaging effects. Detector signals were calculated in this study and random noise and setup errors were added to simulate measured data. With the techniques developed in this work, the MatriXX detector can be used to characterize the position and width of sub-millimeter, σ  =  0.7 mm, sized pencil beams with uncertainty better than 3% relative to σ. With the irradiation only covering 60% of the MatriXX, the position and width of σ  =  0.9 mm sized pencil beams can be determined with uncertainty better than 3% relative to σ. If one were to not use a cross-like irradiation pattern, then the position and width of σ  =  3.6 mm sized pencil beams

  14. Influence of Vegetation Structure on Lidar-derived Canopy Height and Fractional Cover in Forested Riparian Buffers During Leaf-Off and Leaf-On Conditions

    Science.gov (United States)

    Wasser, Leah; Day, Rick; Chasmer, Laura; Taylor, Alan

    2013-01-01

    Estimates of canopy height (H) and fractional canopy cover (FC) derived from lidar data collected during leaf-on and leaf-off conditions are compared with field measurements from 80 forested riparian buffer plots. The purpose is to determine if existing lidar data flown in leaf-off conditions for applications such as terrain mapping can effectively estimate forested riparian buffer H and FC within a range of riparian vegetation types. Results illustrate that: 1) leaf-off and leaf-on lidar percentile estimates are similar to measured heights in all plots except those dominated by deciduous compound-leaved trees where lidar underestimates H during leaf off periods; 2) canopy height models (CHMs) underestimate H by a larger margin compared to percentile methods and are influenced by vegetation type (conifer needle, deciduous simple leaf or deciduous compound leaf) and canopy height variability, 3) lidar estimates of FC are within 10% of plot measurements during leaf-on periods, but are underestimated during leaf-off periods except in mixed and conifer plots; and 4) depth of laser pulse penetration lower in the canopy is more variable compared to top of the canopy penetration which may influence within canopy vegetation structure estimates. This study demonstrates that leaf-off lidar data can be used to estimate forested riparian buffer canopy height within diverse vegetation conditions and fractional canopy cover within mixed and conifer forests when leaf-on lidar data are not available. PMID:23382966

  15. Estimativa da área foliar de plantas de lima ácida 'Tahiti' usando métodos não-destrutivos Leaf area estimative of young 'Tahiti' lime using non-destructive methods

    Directory of Open Access Journals (Sweden)

    Maurício Antonio Coelho Filho

    2005-04-01

    Full Text Available O objetivo desse estudo foi avaliar métodos não-destrutivos para a determinação da área foliar de plantas jovens de lima ácida 'Tahiti'(Citrus latifolia Tan., em campo. Foram utilizadas informações de variáveis biométricas de 28 plantas jovens (0,07 a 1,44 m² e imagens digitais da área frontal de cada planta (silhueta de copa. Essas variáveis foram correlacionadas com medidas diretas (contagem total de folhas x área foliar média. Como resultado, foi possível estimar a área foliar total das plantas (AFT com base na equação: AFT = 88,936 x DI - 1,4017 (R²=0,75, em que DI representa o diâmetro do caule 5 cm abaixo do ponto em que a copa foi enxertada, e a silhueta da planta em m² (IM: AFT = 2,4951 x IM (R²=0,72. A área foliar dos ramos secundários das plantas (AFR pode ser estimada mediante uma equação exponencial envolvendo o diâmetro do ramo (DR: AFR = 0,0144e277,02 x DR (R²=0,71. Estas metodologias podem ser utilizadas quando o interesse for por um valor médio de área foliar no pomar, não sendo indicadas quando é necessária elevada precisão, pois os erros são elevados.The objective of this study was to evaluate non-destructive methods of estimating total leaf area of young 'Tahiti' lime (Citrus latifolia Tan. plants grown in the field. Information of biometrical variables of 28 young plants (0.07 to 1.44 m² and digitized image of front area of each plant (plant silhouette were used. These variables were correlated to the direct measurements (leaves and average leaf area counting. As a result, it was possible to estimate total plant leaf area (AFT based upon the equation: AFT = 88.936 x DI - 1.4017 (R²=0.75, where DI stands for the trunk diameter taken 5 cm below the graft and the silhouette area in m² (IM: AFT = 2.4951 x IM (R²=0.72. The leaf area of secondary branches (AFR can be estimated by an exponential equation with the branch diameter (DR: AFR = 0.0144e277.02 x DR (R²=0.71. These methodologies can

  16. Leaf area index from litter collection: impact of specific leaf area variability within a beech stand

    Energy Technology Data Exchange (ETDEWEB)

    Bouriaud, O. [Inst. National de la Recherche Agronomique, Centre de Recherches Forestieres de Nancy, Champenoux (France); Soudani, K. [Univ. Paris-Sud XI, Dept. d' Ecophysiologie Vegetale, Lab. Ecologie Systematique et Evolution, Orsay Cedex (France); Breda, N. [Inst. National de la Recherche Agronomique, Centre de Recherches Forestieres de Nancy, Champenoux (France)

    2003-06-01

    Litter fall collection is a direct method widely used to estimate leaf area index (LAI) in broad-leaved forest stands. Indirect measurements using radiation transmittance and gap fraction theory are often compared and calibrated against litter fall, which is considered as a reference method, but few studies address the question of litter specific leaf area (SLA) measurement and variability. SLA (leaf area per unit of dry weight, m{sup 2}{center_dot}g{sup -1}) is used to convert dry leaf litter biomass (g .m{sup -}2) into leaf area per ground unit area (m{sup 2}{center_dot}m{sup -2}). We paid special attention to this parameter in two young beech stands (dense and thinned) in northeastern France. The variability of both canopy (closure, LAI) and site conditions (soil properties, vegetation) was investigated as potential contributing factors to beech SLA variability. A systematic description of soil and floristic composition was performed and three types of soil were identified. Ellenberg's indicator values were averaged for each plot to assess nitrogen soil content. SLA of beech litter was measured three times during the fall in 23 plots in the stands (40 ha). Litter was collected bimonthly in square-shaped traps (0.5 m{sup 2}) and dried. Before drying, 30 leaves per plot and for each date were sampled, and leaf length, width, and area were measured with the help of a LI-COR areameter. SLA was calculated as the ratio of cumulated leaf area to total dry weight of the 30 leaves. Leaves characteristics per plot were averaged for the three dates of litter collection. Plant area index (PAI), estimated using the LAI-2000 plant canopy analyser and considering only the upper three rings, ranged from 2.9 to 8.1. Specific leaf area of beech litter was also highly different from one plot to the other, ranging from 150 to 320 cm{sup 2}{center_dot}g{sup -1}. Nevertheless, no relationship was found between SLA and stand canopy closure or PAI On the contrary, a significant

  17. Leaf area index from litter collection: impact of specific leaf area variability within a beech stand

    International Nuclear Information System (INIS)

    Bouriaud, O.; Soudani, K.; Breda, N.

    2003-01-01

    Litter fall collection is a direct method widely used to estimate leaf area index (LAI) in broad-leaved forest stands. Indirect measurements using radiation transmittance and gap fraction theory are often compared and calibrated against litter fall, which is considered as a reference method, but few studies address the question of litter specific leaf area (SLA) measurement and variability. SLA (leaf area per unit of dry weight, m 2 ·g -1 ) is used to convert dry leaf litter biomass (g .m - 2) into leaf area per ground unit area (m 2 ·m -2 ). We paid special attention to this parameter in two young beech stands (dense and thinned) in northeastern France. The variability of both canopy (closure, LAI) and site conditions (soil properties, vegetation) was investigated as potential contributing factors to beech SLA variability. A systematic description of soil and floristic composition was performed and three types of soil were identified. Ellenberg's indicator values were averaged for each plot to assess nitrogen soil content. SLA of beech litter was measured three times during the fall in 23 plots in the stands (40 ha). Litter was collected bimonthly in square-shaped traps (0.5 m 2 ) and dried. Before drying, 30 leaves per plot and for each date were sampled, and leaf length, width, and area were measured with the help of a LI-COR areameter. SLA was calculated as the ratio of cumulated leaf area to total dry weight of the 30 leaves. Leaves characteristics per plot were averaged for the three dates of litter collection. Plant area index (PAI), estimated using the LAI-2000 plant canopy analyser and considering only the upper three rings, ranged from 2.9 to 8.1. Specific leaf area of beech litter was also highly different from one plot to the other, ranging from 150 to 320 cm 2 ·g -1 . Nevertheless, no relationship was found between SLA and stand canopy closure or PAI On the contrary, a significant relationship between SLA and soil properties was observed. Both SLA

  18. Non-destructive measurement of soybean leaf thickness via X-ray computed tomography allows the study of diel leaf growth rhythms in the third dimension.

    Science.gov (United States)

    Pfeifer, Johannes; Mielewczik, Michael; Friedli, Michael; Kirchgessner, Norbert; Walter, Achim

    2018-01-01

    Present-day high-resolution leaf growth measurements provide exciting insights into diel (24-h) leaf growth rhythms and their control by the circadian clock, which match photosynthesis with oscillating environmental conditions. However, these methods are based on measurements of leaf area or elongation and neglect diel changes of leaf thickness. In contrast, the influence of various environmental stress factors to which leaves are exposed to during growth on the final leaf thickness has been studied extensively. Yet, these studies cannot elucidate how variation in leaf area and thickness are simultaneously regulated and influenced on smaller time scales. Only few methods are available to measure the thickness of young, growing leaves non-destructively. Therefore, we evaluated X-ray computed tomography to simultaneously and non-invasively record diel changes and growth of leaf thickness and area. Using conventional imaging and X-ray computed tomography leaf area, thickness and volume growth of young soybean leaves were simultaneously and non-destructively monitored at three cardinal time points during night and day for a period of 80 h under non-stressful growth conditions. Reference thickness measurements on paperboards were in good agreement to CT measurements. Comparison of CT with leaf mass data further proved the consistency of our method. Exploratory analysis showed that measurements were accurate enough for recording and analyzing relative diel changes of leaf thickness, which were considerably different to those of leaf area. Relative growth rates of leaf area were consistently positive and highest during 'nights', while diel changes in thickness fluctuated more and were temporarily negative, particularly during 'evenings'. The method is suitable for non-invasive, accurate monitoring of diel variation in leaf volume. Moreover, our results indicate that diel rhythms of leaf area and thickness show some similarity but are not tightly coupled. These

  19. Improving IMRT-plan quality with MLC leaf position refinement post plan optimization

    International Nuclear Information System (INIS)

    Niu Ying; Zhang Guowei; Berman, Barry L.; Parke, William C.; Yi Byongyong; Yu, Cedric X.

    2012-01-01

    Purpose: In intensity-modulated radiation therapy (IMRT) planning, reducing the pencil-beam size may lead to a significant improvement in dose conformity, but also increase the time needed for the dose calculation and plan optimization. The authors develop and evaluate a postoptimization refinement (POpR) method, which makes fine adjustments to the multileaf collimator (MLC) leaf positions after plan optimization, enhancing the spatial precision and improving the plan quality without a significant impact on the computational burden. Methods: The authors’ POpR method is implemented using a commercial treatment planning system based on direct aperture optimization. After an IMRT plan is optimized using pencil beams with regular pencil-beam step size, a greedy search is conducted by looping through all of the involved MLC leaves to see if moving the MLC leaf in or out by half of a pencil-beam step size will improve the objective function value. The half-sized pencil beams, which are used for updating dose distribution in the greedy search, are derived from the existing full-sized pencil beams without need for further pencil-beam dose calculations. A benchmark phantom case and a head-and-neck (HN) case are studied for testing the authors’ POpR method. Results: Using a benchmark phantom and a HN case, the authors have verified that their POpR method can be an efficient technique in the IMRT planning process. Effectiveness of POpR is confirmed by noting significant improvements in objective function values. Dosimetric benefits of POpR are comparable to those of using a finer pencil-beam size from the optimization start, but with far less computation and time. Conclusions: The POpR is a feasible and practical method to significantly improve IMRT-plan quality without compromising the planning efficiency.

  20. Evaluation of size distribution of starch granules in selected wheat varieties by the Low Angle Laser Light Scattering method

    International Nuclear Information System (INIS)

    Capouchová, I.; Petr, J.; Marešová, D.

    2003-01-01

    The distribution of the size of wheat starch granules using the method LALLS (Low Angle Laser Light Scattering), followed by the evaluation of the effect of variety, experimental site and intensity of cultivation on the vol. % of the starch A (starch granules > 10 μm) was determined. The total starch content and crude protein content in dry matter of flour T530 in selected collection of five winter wheat varieties were determined. Vol. % of the starch A in evaluated collection of wheat varieties varied between 65.31 and 72.34%. The effect of a variety on the vol. % of starch A seemed to be more marked than the effect of site and intensity of cultivation. The highest vol. % of starch A reached evaluated varieties from the quality group C, i.e. varieties unsuitable for baking utilisation (except variety Contra with high total content of starch in dry matter of flour T530, but relatively low vol. % of starch A). A low vol. % of starch A was also found in the variety Hana (very good variety for baking utilisation). Certain variety differences followed from the evaluation of distribution of starch fractions of starch granules, forming starch A. In the case of varieties Hana, Contra and Siria higher representation of fractions up to 30 μm was recorded, while starch A in the varieties Estica and Versailles was formed in higher degree by size fractions of starch granules over 30 μm and particularly size fraction > 50 μm was greatest in these varieties of all evaluated samples. With increasing total starch content in dry matter of flour T530 the crude protein content decreased; the vol. % of starch A not always increased proportionally with increasing total starch content. (author)

  1. Biosynthesis of silver nanoparticles using Ocimum sanctum (Tulsi) leaf extract and screening its antimicrobial activity

    Science.gov (United States)

    Singhal, Garima; Bhavesh, Riju; Kasariya, Kunal; Sharma, Ashish Ranjan; Singh, Rajendra Pal

    2011-07-01

    Development of green nanotechnology is generating interest of researchers toward ecofriendly biosynthesis of nanoparticles. In this study, biosynthesis of stable silver nanoparticles was done using Tulsi ( Ocimum sanctum) leaf extract. These biosynthesized nanoparticles were characterized with the help of UV-vis spectrophotometer, Atomic Absorption Spectroscopy (AAS), Dynamic light scattering (DLS), X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), and Transmission electron microscopy (TEM). Stability of bioreduced silver nanoparticles was analyzed using UV-vis absorption spectra, and their antimicrobial activity was screened against both gram-negative and gram-positive microorganisms. It was observed that O. sanctum leaf extract can reduce silver ions into silver nanoparticles within 8 min of reaction time. Thus, this method can be used for rapid and ecofriendly biosynthesis of stable silver nanoparticles of size range 4-30 nm possessing antimicrobial activity suggesting their possible application in medical industry.

  2. Biosynthesis of silver nanoparticles using Ocimum sanctum (Tulsi) leaf extract and screening its antimicrobial activity

    International Nuclear Information System (INIS)

    Singhal, Garima; Bhavesh, Riju; Kasariya, Kunal; Sharma, Ashish Ranjan; Singh, Rajendra Pal

    2011-01-01

    Development of green nanotechnology is generating interest of researchers toward ecofriendly biosynthesis of nanoparticles. In this study, biosynthesis of stable silver nanoparticles was done using Tulsi (Ocimum sanctum) leaf extract. These biosynthesized nanoparticles were characterized with the help of UV–vis spectrophotometer, Atomic Absorption Spectroscopy (AAS), Dynamic light scattering (DLS), X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), and Transmission electron microscopy (TEM). Stability of bioreduced silver nanoparticles was analyzed using UV–vis absorption spectra, and their antimicrobial activity was screened against both gram-negative and gram-positive microorganisms. It was observed that O. sanctum leaf extract can reduce silver ions into silver nanoparticles within 8 min of reaction time. Thus, this method can be used for rapid and ecofriendly biosynthesis of stable silver nanoparticles of size range 4–30 nm possessing antimicrobial activity suggesting their possible application in medical industry.

  3. Microstructure and Mechanical Properties of Nano-Size Zirconium Carbide Dispersion Strengthened Tungsten Alloys Fabricated by Spark Plasma Sintering Method

    International Nuclear Information System (INIS)

    Xie Zhuoming; Liu Rui; Fang Qianfeng; Zhang Tao; Jiang Yan; Wang Xianping; Liu Changsong

    2015-01-01

    W-(0.2, 0.5, 1.0)wt% ZrC alloys with a relative density above 97.5% were fabricated through the spark plasma sintering (SPS) method. The grain size of W-1.0wt% ZrC is about 2.7 μm, smaller than that of pure W and W-(0.2, 0.5)wt% ZrC. The results indicated that the W-ZrC alloys exhibit higher hardness at room temperature, higher tensile strength at high temperature, and a lower ductile to brittle transition temperature (DBTT) than pure W. The tensile strength and total elongation of W-0.5wt% ZrC alloy at 700 °C is 535 MPa and 24.8%, which are respectively 59% and 114% higher than those of pure W (337 MPa, 11.6%). The DBTT of W-(0.2, 0.5, 1.0)wt% ZrC materials is in the range of 500°C–600°C, which is about 100 °C lower than that of pure W. Based on microstructure analysis, the improved mechanical properties of the W-ZrC alloys were suggested to originate from the enhanced grain boundary cohesion by ZrC capturing the impurity oxygen in tungsten and nano-size ZrC dispersion strengthening. (paper)

  4. A hybrid artificial bee colony algorithm and pattern search method for inversion of particle size distribution from spectral extinction data

    Science.gov (United States)

    Wang, Li; Li, Feng; Xing, Jian

    2017-10-01

    In this paper, a hybrid artificial bee colony (ABC) algorithm and pattern search (PS) method is proposed and applied for recovery of particle size distribution (PSD) from spectral extinction data. To be more useful and practical, size distribution function is modelled as the general Johnson's ? function that can overcome the difficulty of not knowing the exact type beforehand encountered in many real circumstances. The proposed hybrid algorithm is evaluated through simulated examples involving unimodal, bimodal and trimodal PSDs with different widths and mean particle diameters. For comparison, all examples are additionally validated by the single ABC algorithm. In addition, the performance of the proposed algorithm is further tested by actual extinction measurements with real standard polystyrene samples immersed in water. Simulation and experimental results illustrate that the hybrid algorithm can be used as an effective technique to retrieve the PSDs with high reliability and accuracy. Compared with the single ABC algorithm, our proposed algorithm can produce more accurate and robust inversion results while taking almost comparative CPU time over ABC algorithm alone. The superiority of ABC and PS hybridization strategy in terms of reaching a better balance of estimation accuracy and computation effort increases its potentials as an excellent inversion technique for reliable and efficient actual measurement of PSD.

  5. Synthesis of Magnetic Rattle-Type Silica with Controllable Magnetite and Tunable Size by Pre-Shell-Post-Core Method.

    Science.gov (United States)

    Chen, Xue; Tan, Longfei; Meng, Xianwei

    2016-03-01

    In this study, we have developed the pre-shell-post-core route to synthesize the magnetic rattle-type silica. This method has not only simplified the precursor's process and reduced the reacting time, but also ameliorated the loss of magnetite and made the magnetite content and the inner core size controllable and tunable. The magnetite contents and inner core size can be easily controlled by changing the type and concentration of alkali, reaction system and addition of water. The results show that alkali aqueous solution promotes the escape of the precursor iron ions from the inner space of rattle-type silica and results in the loss of magnetite. In this case, NaOH ethanol solution is better for the formation of magnetite than ammonia because it not only offers an appropriate alkalinity to facilitate the synthesis of. magnetic particles, but also avoids the escape of the iron ions from the mesopores of rattle-type silica. The synthesis process is very simple and efficient, and it takes no more than 2 hours to complete the total preparation and handling of the magnetic rattle-type silica. The end-product Fe3O4@SiO2 nanocomposites also have good magnetic properties which will perform potential application in biomedical science.

  6. Sustainable Sizing.

    Science.gov (United States)

    Robinette, Kathleen M; Veitch, Daisy

    2016-08-01

    To provide a review of sustainable sizing practices that reduce waste, increase sales, and simultaneously produce safer, better fitting, accommodating products. Sustainable sizing involves a set of methods good for both the environment (sustainable environment) and business (sustainable business). Sustainable sizing methods reduce (1) materials used, (2) the number of sizes or adjustments, and (3) the amount of product unsold or marked down for sale. This reduces waste and cost. The methods can also increase sales by fitting more people in the target market and produce happier, loyal customers with better fitting products. This is a mini-review of methods that result in more sustainable sizing practices. It also reviews and contrasts current statistical and modeling practices that lead to poor fit and sizing. Fit-mapping and the use of cases are two excellent methods suited for creating sustainable sizing, when real people (vs. virtual people) are used. These methods are described and reviewed. Evidence presented supports the view that virtual fitting with simulated people and products is not yet effective. Fit-mapping and cases with real people and actual products result in good design and products that are fit for person, fit for purpose, with good accommodation and comfortable, optimized sizing. While virtual models have been shown to be ineffective for predicting or representing fit, there is an opportunity to improve them by adding fit-mapping data to the models. This will require saving fit data, product data, anthropometry, and demographics in a standardized manner. For this success to extend to the wider design community, the development of a standardized method of data collection for fit-mapping with a globally shared fit-map database is needed. It will enable the world community to build knowledge of fit and accommodation and generate effective virtual fitting for the future. A standardized method of data collection that tests products' fit methodically

  7. Measurement of liquid mixing characteristics in large-sized ion exchange column for isotope separation by stepwise response method

    International Nuclear Information System (INIS)

    Fujine, Sachio; Saito, Keiichiro; Iwamoto, Kazumi; Itoi, Toshiaki.

    1981-07-01

    Liquid mixing in a large-sized ion exchange column for isotope separation was measured by the step-wise response method, using NaCl solution as tracer. A 50 cm diameter column was packed with an ion exchange resin of 200 μm in mean diameter. Experiments were carried out for several types of distributor and collector, which were attached to each end of the column. The smallest mixing was observed for the perforated plate type of the collector, coupled with a minimum stagnant volume above the ion exchange resin bed. The 50 cm diameter column exhibited the better characteristics of liquid mixing than the 2 cm diameter column for which the good performance of lithium isotope separation had already been confirmed. These results indicate that a large increment of throughput is attainable by the scale-up of column diameter with the same performance of isotope separation as for the 2 cm diameter column. (author)

  8. Green Synthesis of Silver Nanoparticles by using Eucalyptus Globulus Leaf Extract

    Science.gov (United States)

    Balamurugan, Madheswaran; Saravanan, Shanmugam

    2017-12-01

    A single step eco-friendly, energy efficient and economically scalable green method was employed to synthesize silver nanoparticles. In this work, the synthesis of silver nanoparticles using Eucalyptus globulus leaf extract as reducing and capping agent along with water as solvent at normal room temperature is described. Silver nanoparticles were prepared from aqueous silver nitrate solution by adding the leaf extract. The prepared nanoparticles were characterized by using UV-visible Spectrophotometer, X-ray diffractometer, High Resolution Transmission Electron Microscope (HR-TEM) and Fourier Transform Infrared Spectroscope (FTIS). X-ray diffraction studies brought to light the crystalline nature and the face centered cubic structure of the silver nanoparticles. Using HR-TEM. the nano sizes and morphology of the particles were studied. The mean sizes of the prepared silver nanoparticles ranged from 30 to 36 nm. The density of the particles was tuned by varying the molar ratio of silver nitrate. FTIS studies showed the functional group of organic molecules which were located on the surface of the silver nanoparticles. Originating from the leaf extracts, these organic molecules reduced and capped the particles.

  9. Green synthesis and antimicrobial activity of monodisperse silver nanoparticles synthesized using Ginkgo Biloba leaf extract

    Science.gov (United States)

    Ren, Yan-yu; Yang, Hui; Wang, Tao; Wang, Chuang

    2016-11-01

    Various parts of plants can be used as a raw material for the synthesis of nanoparticles, which is eco-friendly way and does not involve any harmful chemicals. In this project, Ginkgo biloba leaf, an abundantly available medicinal plant in China, was for the first time adopted as a reducing and stabilizing agent to synthesize smaller sized and stable silver nanoparticles (AgNPs). To improve the quality of AgNPs, the reduction was accelerated by changing the concentrations of initial Ag+ (0.02, 0.04, 0.06 and 0.08 mol/L) of the reaction mixture consisting of silver nitrate solution (AgNO3) and Ginkgo biloba leaf extract. At pH = 8 and lower AgNO3 concentration (0.02 mol/L), a colloid consisting of well-dispersed spherical nanoparticles was obtained. The synthesized nanocrystals were successfully characterized by UV-vis and XRD. TEM images revealed the size of the spherical AgNPs ranged between 10-16 nm. FTIR analysis revealed that biological macromolecules with groups of sbnd NH2, sbnd OH, and others were distributed on the surface of the nanoparticles. The biosynthesized AgNPs exhibited good antibacterial activities against gram-negative bacteria and gram-positive bacteria. Compared to traditional chemical methods, Ginkgo biloba leaf extract provides an easy green synthetical way. It is anticipated that the biosynthesized AgNPs can be used in areas such as cosmetics, foods and medical applications.

  10. Novel Method for Sizing Metallic Bottom Crack Depth Using Multi-frequency Alternating Current Potential Drop Technique

    Directory of Open Access Journals (Sweden)

    Li Yuting

    2015-10-01

    Full Text Available Potential drop techniques are of two types: the direct current potential drop (DCPD technique and alternating current potential drop (ACPD technique, and both of them are used in nondestructive testing. ACPD, as a kind of valid method in sizing metal cracks, has been applied to evaluate metal structures. However, our review of most available approaches revealed that some improvements can be done in measuring depth of metal bottom crack by means of ACPD, such as accuracy and sensitivity of shallow crack. This paper studied a novel method which utilized the slope of voltage ratio-frequency curve to solve bottom crack depth by using a simple mathematic equation based on finite element analysis. It is found that voltage ratio varies linearly with frequency in the range of 5-15 Hz; this range is slightly higher than the equivalent frequency and lower than semi-permeable frequency. Simulation and experiment show that the novel method can measure the bottom crack depth accurately.

  11. A simple method for purification of lipopolysaccharides from E. coli 55:B5 using size exclusion chromatography

    International Nuclear Information System (INIS)

    Perdomo, Rolando; Montero, Vivian

    2006-01-01

    Several methods for the extraction of endotoxin or lipopolysaccharide from Gram negative bacteria have been described. However, the product is often contaminated with nucleic acids or proteins in a proportion depending on the extraction method used. Molecular and immunological studies require further purification of the raw LPS. We present here, a simple method for the purification of raw LPS obtained by the standard hot phenol-water procedure using size exclusion chromatography in Sepharose CL-6B. We demonstrated that the using of DNAse and RNAse treatment of the sample before the chromatographic step is necessary to abrogate the nucleic acid contamination in the LPS fraction. The spectrophotometric properties of the pure LPS were verified, supporting the immediate online detection of the LPS and oligonucleotides fractions spectrophotometrically at 206 nm. The mobile phase used (NaCl 0.2 M) do not absorb at 206 nm while maintains the LPS aggregates and therefore, allows the separation of the LPS fraction from the oligoribonucleotide and desoxioligoribonucleotide fractions. The yield of pure LPS was around 98%. Chemical and biological characterizations were conducted in order to assess the feasibility of the procedure developed. (Author)

  12. Effects of methanol leaf extracts of Loranthus micranthus Linn from ...

    African Journals Online (AJOL)

    blood glucose, lipid profile and other biochemical indices of diabetic rats. Methods: The ... Diabetes mellitus is a disease of metabolic origin which is .... Fasting blood sugar level after ..... (Iridaceae) leaf extract in ICR mice fed high fat diet.

  13. Development and beyond: Strategy for long-term maintenance of an online laser diffraction particle size method in a spray drying manufacturing process.

    Science.gov (United States)

    Medendorp, Joseph; Bric, John; Connelly, Greg; Tolton, Kelly; Warman, Martin

    2015-08-10

    The purpose of this manuscript is to present the intended use and long-term maintenance strategy of an online laser diffraction particle size method used for process control in a spray drying process. A Malvern Insitec was used for online particle size measurements and a Malvern Mastersizer was used for offline particle size measurements. The two methods were developed in parallel with the Mastersizer serving as the reference method. Despite extensive method development across a range of particle sizes, the two instruments demonstrated different sensitivities to material and process changes over the product lifecycle. This paper will describe the procedure used to ensure consistent alignment of the two methods, thus allowing for continued use of online real-time laser diffraction as a surrogate for the offline system over the product lifecycle. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Leaf extraction and analysis framework graphical user interface: segmenting and analyzing the structure of leaf veins and areoles.

    Science.gov (United States)

    Price, Charles A; Symonova, Olga; Mileyko, Yuriy; Hilley, Troy; Weitz, Joshua S

    2011-01-01

    Interest in the structure and function of physical biological networks has spurred the development of a number of theoretical models that predict optimal network structures across a broad array of taxonomic groups, from mammals to plants. In many cases, direct tests of predicted network structure are impossible given the lack of suitable empirical methods to quantify physical network geometry with sufficient scope and resolution. There is a long history of empirical methods to quantify the network structure of plants, from roots, to xylem networks in shoots and within leaves. However, with few exceptions, current methods emphasize the analysis of portions of, rather than entire networks. Here, we introduce the Leaf Extraction and Analysis Framework Graphical User Interface (LEAF GUI), a user-assisted software tool that facilitates improved empirical understanding of leaf network structure. LEAF GUI takes images of leaves where veins have been enhanced relative to the background, and following a series of interactive thresholding and cleaning steps, returns a suite of statistics and information on the structure of leaf venation networks and areoles. Metrics include the dimensions, position, and connectivity of all network veins, and the dimensions, shape, and position of the areoles they surround. Available for free download, the LEAF GUI software promises to facilitate improved understanding of the adaptive and ecological significance of leaf vein network structure.

  15. Spatial accuracy of a simplified disaggregation method for traffic emissions applied in seven mid-sized Chilean cities

    Science.gov (United States)

    Ossés de Eicker, Margarita; Zah, Rainer; Triviño, Rubén; Hurni, Hans

    The spatial accuracy of top-down traffic emission inventory maps obtained with a simplified disaggregation method based on street density was assessed in seven mid-sized Chilean cities. Each top-down emission inventory map was compared against a reference, namely a more accurate bottom-up emission inventory map from the same study area. The comparison was carried out using a combination of numerical indicators and visual interpretation. Statistically significant differences were found between the seven cities with regard to the spatial accuracy of their top-down emission inventory maps. In compact cities with a simple street network and a single center, a good accuracy of the spatial distribution of emissions was achieved with correlation values>0.8 with respect to the bottom-up emission inventory of reference. In contrast, the simplified disaggregation method is not suitable for complex cities consisting of interconnected nuclei, resulting in correlation valuessituation to get an overview on the spatial distribution of the emissions generated by traffic activities.

  16. Grey Wolf Optimization-Based Optimum Energy-Management and Battery-Sizing Method for Grid-Connected Microgrids

    Directory of Open Access Journals (Sweden)

    Kutaiba Sabah Nimma

    2018-04-01

    Full Text Available In the revolution of green energy development, microgrids with renewable energy sources such as solar, wind and fuel cells are becoming a popular and effective way of controlling and managing these sources. On the other hand, owing to the intermittency and wide range of dynamic responses of renewable energy sources, battery energy-storage systems have become an integral feature of microgrids. Intelligent energy management and battery sizing are essential requirements in the microgrids to ensure the optimal use of the renewable sources and reduce conventional fuel utilization in such complex systems. This paper presents a novel approach to meet these requirements by using the grey wolf optimization (GWO technique. The proposed algorithm is implemented for different scenarios, and the numerical simulation results are compared with other optimization methods including the genetic algorithm (GA, particle swarm optimization (PSO, the Bat algorithm (BA, and the improved bat algorithm (IBA. The proposed method (GWO shows outstanding results and superior performance compared with other algorithms in terms of solution quality and computational efficiency. The numerical results show that the GWO with a smart utilization of battery energy storage (BES helped to minimize the operational costs of microgrid by 33.185% in comparison with GA, PSO, BA and IBA.

  17. Evaluation of inductive heating energy of sub-size improved DPC-C conductor by calorimetric method

    International Nuclear Information System (INIS)

    Ito, Toshinobu; Koizumi, Norikiyo; Wakabayashi, Hiroshi; Miura, Yuushi; Fujisaki, Hiroshi; Matsui, Kunihiro; Takahashi, Yoshikazu; Tsuji, Hiroshi

    1996-08-01

    The improved DPC-U conductor consisting of 648 chrome plated NbTi strands was fabricated and its stability has been investigated using 1/24 sub-size conductor. In the stability experiment, the inductive heating method was applied to originate initial normal zone. Since it is difficult to calculate the inductive heating energy deposited on the conductor because of complicate geometry of the twisted multi-strand cable, inductive heating energy had to be experimentally evaluated using calorimetric method. The heating energy is in proportion to integration of square of an applied sinusoidal wave pulsed current over the heating period. The experimental result shows the proportional constants for the conductor and conduit are 2.062 x 10 -3 [J/A 2 s] and 0.771 x 10 -3 [J/A 2 s], respectively. The coupling between the eddy currents in the strands and conduit might take effect on the heating energy put in the strands. It was shown this effect was however small in this experiment. Consequently, the inductive heating energy applied in the strands was estimated to be the proportional constant of 1.291 x 10 -3 [J/A 2 s] from the difference of the heat energies in the conductor and conduit. (author)

  18. Particle size distribution in soils and marine sediments by laser diffraction using Malvern Mastersizer 2000—method uncertainty including the effect of hydrogen peroxide pretreatment

    DEFF Research Database (Denmark)

    Callesen, Ingeborg; Keck, Hannes; Andersen, Thorbjørn Joest

    2018-01-01

    with less than 1% C and some marine sediments. Materials and methods: The method uncertainty for particle size analysis by the laser diffraction method using or not using H2O2 pretreatment followed by 2 min ultrasound and 1-mm sieving was determined for two soil samples and two aquatic sediments......Purpose: Methods for particle size distribution (PSD) determination by laser diffraction are not standardized and differ between disciplines and sectors. The effect of H2O2 pretreatment before a sonication treatment in laser diffraction analysis of soils and marine sediments was examined on soils...... pretreatment on the PSD was small and not significant. The standard deviation (std) in particle size fractions increased with particle size. PSDs and std for some samples were presented for future reference. Similar to other studies, the content of clay and silt (by sieving/hydrometer, SHM) was lower...

  19. (TECTONA GRANDIS LEAF POWDER

    Directory of Open Access Journals (Sweden)

    Yash Mishra

    2015-01-01

    Full Text Available In this study, the adsorption potential of Teak (Tectona grandis leaf powder (TLP toremove Methylene blue (MB and Malachite Green (MG dye molecules from aqueoussolution was investigated. Batch experiments were conducted to evaluate the influenceof operational parameters such as, pH (2−9, adsorbent dosage (1−7 g/L, contact time(15−150 minutes and initial dye concentration (20−120 mg/L at stirring speed of 150rpm for the adsorption of MB and MG on TLP. Maximum removal efficiency of 98.4%and 95.1% was achieved for MB and MG dye, respectively. The experimentalequilibrium data were analysed using Langmuir, Freundlich and Temkin isothermmodels and it was found that, it fitted well to the Freundlich isotherm model. Thesurface structure and morphology of the adsorbent was characterized using scanningelectron microscopy (SEM and the presence of functional groups and its interactionwith the dye molecules were analysed using Fourier transform infrared spectroscopy(FTIR. Based on the investigation, it has been demonstrated that the teak leaf powderhas good potential for effective adsorption of methylene blue and malachite green dye.

  20. Methods for sorting out the defects according to size in automated ultrasonic testing of large-diameter thin-walled tubes

    International Nuclear Information System (INIS)

    Golovkin, A.M.; Matveev, A.S

    1977-01-01

    Two methods have been considered of identifying defects according to their size in the course of an automated ultrasonic testing, namely, according to the echo-signal amplitude, and according to the conventional depth of a defect. T