WorldWideScience

Sample records for methods include conventional

  1. Conventional laboratory methods for cyanotoxins.

    Science.gov (United States)

    Lawton, Linda A; Edwards, C

    2008-01-01

    It is clear from the literature that numerous methods are available for most cyanotoxins, although many publications on monitoring data indicate that the favored approach is the use proven, robust methods for individual toxins. The most effective approach is the utilization of a robust rapid screen, where positive samples are followed up by qualitative and quantitative analysis to provide the essential decision making data needed for successful management strategies (Fig. 2). Currently, rapid screens are available for microcystins, saxitoxins and anatoxin-a(s), whilst optimisation and validation is needed, many publications report good correlation with the mouse bioassay and HPLC. There is an urgent need for rapid, simple, and inexpensive assays for cylindrospermopsins, anatoxin-a and BMAA. Although methods exist for analysis of BMAA, the fact that a recent study showed 95% of cyanobacteria producing this, some at levels > 6,000 microg g(-1) dry wt, is of concern and rapid screening followed by robust analysis needed. An ideal approach would be a single method capable of extracting and detecting all cyanotoxins. Several publications describe such approaches using LC-MS, but as expected from a group of compounds with diverse chemistry, there are obvious limitations in recoveries during sample processing, chromatographic performance and sensitivity (Dahlmann et al. 2003, Dell'Aversano et al. 2004, Pietsch et al. 2001). Selection of methods must be based on the application requirements, equipment available and cost. For many organisations it may be more cost effective to out-source the occasional analysis. However, as the incidence of blooms appears to be increasing, the need for more rigorous monitoring is needed, sensible investment is needed to meet recommended guidelines. Most of the methods discussed in this paper are suitable for achieving this goal, although clean-up and concentration is usually necessary for physicochemical methods.

  2. Fuzzy logic control to be conventional method

    Energy Technology Data Exchange (ETDEWEB)

    Eker, Ilyas [University of Gaziantep, Gaziantep (Turkey). Department of Electrical and Electronic Engineering; Torun, Yunis [University of Gaziantep, Gaziantep (Turkey). Technical Vocational School of Higher Education

    2006-03-01

    Increasing demands for flexibility and fast reactions in modern process operation and production methods result in nonlinear system behaviour of partly unknown systems, and this necessitates application of alternative control methods to meet the demands. Fuzzy logic (FL) control can play an important role because knowledge based design rules can easily be implemented in systems with unknown structure, and it is going to be a conventional control method since the control design strategy is simple and practical and is based on linguistic information. Computational complexity is not a limitation any more because the computing power of computers has been significantly improved even for high speed industrial applications. This makes FL control an important alternative method to the conventional PID control method for use in nonlinear industrial systems. This paper presents a practical implementation of the FL control to an electrical drive system. Such drive systems used in industry are composed of masses moving under the action of position and velocity dependent forces. These forces exhibit nonlinear behaviour. For a multi-mass drive system, the nonlinearities, like Coulomb friction and dead zone, significantly influence the operation of the systems. The proposed FL control configuration is based on speed error and change of speed error. The feasibility and effectiveness of the control method are experimentally demonstrated. The results obtained from conventional FL control, fuzzy PID and adaptive FL control are compared with traditional PID control for the dynamic responses of the closed loop drive system. (author)

  3. Fuzzy logic control to be conventional method

    International Nuclear Information System (INIS)

    Eker, Ilyas; Torun, Yunis

    2006-01-01

    Increasing demands for flexibility and fast reactions in modern process operation and production methods result in nonlinear system behaviour of partly unknown systems, and this necessitates application of alternative control methods to meet the demands. Fuzzy logic (FL) control can play an important role because knowledge based design rules can easily be implemented in systems with unknown structure, and it is going to be a conventional control method since the control design strategy is simple and practical and is based on linguistic information. Computational complexity is not a limitation any more because the computing power of computers has been significantly improved even for high speed industrial applications. This makes FL control an important alternative method to the conventional PID control method for use in nonlinear industrial systems. This paper presents a practical implementation of the FL control to an electrical drive system. Such drive systems used in industry are composed of masses moving under the action of position and velocity dependent forces. These forces exhibit nonlinear behaviour. For a multi-mass drive system, the nonlinearities, like Coulomb friction and dead zone, significantly influence the operation of the systems. The proposed FL control configuration is based on speed error and change of speed error. The feasibility and effectiveness of the control method are experimentally demonstrated. The results obtained from conventional FL control, fuzzy PID and adaptive FL control are compared with traditional PID control for the dynamic responses of the closed loop drive system

  4. Non-conventional energy and propulsion methods

    International Nuclear Information System (INIS)

    Valone, T.

    1991-01-01

    From the disaster of the Space Shuttle, Challenger, to the Kuwaiti oil well fires, we are reminded constantly of our dependence on dangerous, combustible fuels for energy and propulsion. Over the past ten years, there has been a considerable production of new and exciting inventions which defy conventional analysis. The term non-conventional was coined in 1980 by a Canadian engineer to designate a separate technical discipline for this type of endeavor. Since then, several conferences have been devoted solely to these inventions. Integrity Research Corp., an affiliate of the Institute, has made an effort to investigate each viable product, develop business plans for several to facilitate development and marketing, and in some cases, assign an engineering student intern to building a working prototype. Each inventor discussed in this presentation has produced a unique device for free energy generation or highly efficient force production. Included in this paper is also a short summary for non-specialists explaining the physics of free energy generation along with a working definition. The main topics of discussion include: space power, inertial propulsion, kinetobaric force, magnetic motors, thermal fluctuations, over-unity hat pumps, ambient temperature superconductivity and nuclear battery

  5. Principles of cobalt-60 teletherapy including an introduction to the compendium. Definitions and conventions

    International Nuclear Information System (INIS)

    Cohen, M.; Mitchell, J.S.

    1984-01-01

    The convention used in the display of the transverse sections of the human body in the plans for radiotherapy follows the editorial policy of the Journal of Computer Assisted Tomography. For the purpose of this Compendium the convention is defined as: The ''seen from above'' convention is used for the head and upper neck, in which is included the oropharynx. This is the 'anatomical convention' now used with the computed tomography (CT) head scanner and is accepted generally by neuroradiologists, neurosurgeons and neurologists. This convention is also employed in the display of isotope scans of the head. The ''seen from below'' convention is used for the rest of the body, i.e. below the level of the lower border of the third cervical vertebral body; this includes the hypopharynx, larynx and thyroid. This is the usual 'radiological convention', i.e. the patient's right is on the observer's left. This is the convention generally used in total body CT scanning of the thorax and abdomen; the same convention is used in isotope and ultrasonic imaging

  6. Issues in identifying germ tube positive yeasts by conventional methods.

    Science.gov (United States)

    Yazdanpanah, Atta; Khaithir, Tzar Mohd Nizam

    2014-01-01

    Candida speciation is vital for epidemiology and management of candidiasis. Nonmolecular conventional methods often fail to identify closely related germ tube positive yeasts from clinical specimens. The present study was conducted to identify these yeasts and to highlight issues in conventional versus molecular methods of identification. A total of 98 germ tube positive yeasts from high vaginal swabs were studied over a 12-month period. Isolates were examined with various methods including growth at 42 °C and 45 °C on Sabouraud dextrose agar (SDA), color development on CHROMagar Candida medium, chlamydospore production on corn meal agar at 25 °C, carbohydrate assimilation using ID 32C system, and polymerase chain reaction using a single pair of primers targeting the hyphal wall protein 1 (Hwp1) gene. Of all the isolates studied, 97 were molecularly confirmed as C. albicans and one isolate was identified as C. dubliniensis. No C. africana was detected in this study. The molecular method used in our study was an accurate and useful tool for discriminating C. albicans, C. dubliniensis, and C. africana. The conventional methods, however, were less accurate and riddled with many issues that will be discussed in further details. © 2013 Wiley Periodicals, Inc.

  7. REMOVAL OF URANIUM FROM DRINKING WATER BY CONVENTIONAL TREATMENT METHODS

    Science.gov (United States)

    The USEPA currently does not regulate uranium in drinking water but will be revising the radionuclide regulations during 1989 and will propose a maximum contaminant level for uranium. The paper presents treatment technology information on the effectiveness of conventional method...

  8. Conventional cable testing methods: strengths, weaknesses and possibilities

    International Nuclear Information System (INIS)

    Reynolds, P.H.

    1988-01-01

    The paper reviews the major conventional methods that can be used to test power plant cables. It assesses their usefulness in diagnosing the condition of the insulation of the cable and then proposes some possible directions for innovation. The methods examined are dc insulation resistance measurement, ac signal injection for continuous monitoring and fault location, and the ac measurement of capacitance and loss angle. Specific subjects considered are the effects of temperature, cable construction and installation, and the validity of insulation resistance or loss angle measurement. The innovative proposals refer to the use of automation in the measurement and of computer-based Expert Systems for the evaluation of the results

  9. In-Patient Treatment of Fibromyalgia: A Controlled Nonrandomized Comparison of Conventional Medicine versus Integrative Medicine including Fasting Therapy

    Directory of Open Access Journals (Sweden)

    Andreas Michalsen

    2013-01-01

    Full Text Available Fibromyalgia poses a challenge for therapy. Recent guidelines suggest that fibromyalgia should be treated within a multidisciplinary therapy approach. No data are available that evaluated multimodal treatment strategies of Integrative Medicine (IM. We conducted a controlled, nonrandomized pilot study that compared two inpatient treatment strategies, an IM approach that included fasting therapy and a conventional rheumatology (CM approach. IM used fasting cure and Mind-Body-Medicine as specific methods. Of 48 included consecutive patients, 28 were treated with IM, 20 with CM. Primary outcome was change in the Fibromyalgia Impact Questionnaire (FIQ score after the 2-week hospital stay. Secondary outcomes included scores of pain, depression, anxiety, and well being. Assessments were repeated after 12 weeks. At 2 weeks, there were significant improvements in the FIQ (P<0.014 and for most of secondary outcomes for the IM group compared to the CM group. The beneficial effects for the IM approach were reduced after 12 weeks and no longer statistically significant with the exception of anxiety. Findings indicate that a multimodal IM treatment with fasting therapy might be superior to CM in the short term and not inferior in the mid term. Longer-term studies are warranted to assess the clinical impact of integrative multimodal treatment in fibromyalgia.

  10. Survey and assessment of conventional software verification and validation methods

    International Nuclear Information System (INIS)

    Miller, L.A.; Groundwater, E.; Mirsky, S.M.

    1993-04-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 134 methods so identified were classified according to their appropriateness for various phases of a developmental lifecycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods' power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V ampersand V (determined by ratings of a system's complexity and required-integrity). Methods were then rank-ordered for each of the three classes in terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each method for the four identified components of knowledge-based and expert systems, as well as the system as a whole

  11. The clinical significance of computerized axial tomography (CAT) in consideration of conventional diagnostic methods

    International Nuclear Information System (INIS)

    Huenig, R.

    1976-01-01

    Regarding CAT of the intracranial region, the article informs on a) techniques of examination including the production of normal structures, b) the recognizable pathological changes, c) possibilities of enhancement, d) possibilities of course observation, e) limitations of the methods, as well as on f) risk/benefit aspects g) benefit/cost calculations as compared to conventional methods, and on h) the influence of CAT on the frequency of conventional methods of examination. Regarding CAT of the extracranial region, the information available up to the meeting is reported on. (orig./LH) [de

  12. Catalyst support structure, catalyst including the structure, reactor including a catalyst, and methods of forming same

    Science.gov (United States)

    Van Norman, Staci A.; Aston, Victoria J.; Weimer, Alan W.

    2017-05-09

    Structures, catalysts, and reactors suitable for use for a variety of applications, including gas-to-liquid and coal-to-liquid processes and methods of forming the structures, catalysts, and reactors are disclosed. The catalyst material can be deposited onto an inner wall of a microtubular reactor and/or onto porous tungsten support structures using atomic layer deposition techniques.

  13. Root canal preparation in endodontics: conventional versus laser methods

    Science.gov (United States)

    Goodis, Harold E.; White, Joel M.; Marshall, Sally J.; Marshall, Grayson W.; Moskowitz, Emrey

    1992-06-01

    Conventional cleaning and shaping of root canal systems employs hand and/or rotary instrumentation to remove the contents of the canal and shape the canal to receive a filling material. With the advent of the Nd:YAG laser system another method of accomplishing proper cleaning and shaping is evaluated. Single rooted teeth were radiographed bucco- lingually and mesio-distally and were divided into 2 groups. The first group was accessed and the root canal systems cleaned and shaped with a step back technique utilizing hand files and gates glidden burs. At completion of the procedure the teeth were again radiographed at the same positions as those prior to the procedure. The teeth were split longitudinally and examined under scanning electron microscopy to assess cleaning. The second group of teeth were accessed, and cleaning and shaping was accomplished using the Nd:YAG laser in combination with hand files and rotary instruments. These teeth were subjected to the same analysis as those in the first group. The before and after radiographs of each group were subjected to image analysis to determine effectiveness of the two methods in shaping the canal systems. We will discuss the ability of Nd:YAG to clean and shape root canal spaces and remove smear layer and organic tissue remnants from those areas.

  14. Microfluidic devices and methods including porous polymer monoliths

    Science.gov (United States)

    Hatch, Anson V; Sommer, Gregory J; Singh, Anup K; Wang, Ying-Chih; Abhyankar, Vinay V

    2014-04-22

    Microfluidic devices and methods including porous polymer monoliths are described. Polymerization techniques may be used to generate porous polymer monoliths having pores defined by a liquid component of a fluid mixture. The fluid mixture may contain iniferters and the resulting porous polymer monolith may include surfaces terminated with iniferter species. Capture molecules may then be grafted to the monolith pores.

  15. Methods of producing adsorption media including a metal oxide

    Science.gov (United States)

    Mann, Nicholas R; Tranter, Troy J

    2014-03-04

    Methods of producing a metal oxide are disclosed. The method comprises dissolving a metal salt in a reaction solvent to form a metal salt/reaction solvent solution. The metal salt is converted to a metal oxide and a caustic solution is added to the metal oxide/reaction solvent solution to adjust the pH of the metal oxide/reaction solvent solution to less than approximately 7.0. The metal oxide is precipitated and recovered. A method of producing adsorption media including the metal oxide is also disclosed, as is a precursor of an active component including particles of a metal oxide.

  16. The comparative evaluation of patients′ body dry weight under hemodialysis using two methods: Bioelectrical impedance analysis and conventional method

    Directory of Open Access Journals (Sweden)

    Neda Alijanian

    2012-01-01

    Full Text Available Background: Dry weight (DW is an important concept related to patients undergoing hemodialysis. Conventional method seems to be time consuming and operator dependent. Bio impedance analysis (BIA is a new and simple method reported to be an accurate way for estimating DW. In this study, we aimed to compare the conventional estimation of DW with measuring DW by BIA. Materials and Methods: This study involved 130 uremic patients, performed in Isfahan, Iran. DW was calculated by both conventional (CDW and BIA (BIADW method and results were compared based on different grouping factors including sex, underlying cause of renal failure (RF (diabetic RF and non-diabetic RF, body mass index (BMI status, and sessions of hemodialysis. We also calculated the difference between DWs of 2 methods (DW diff = CDW-BIADW. Results: The mean of BIADW was significantly lower than CDW (57.20 ± 1.82 vs 59.36 ± 1.77, P value < 0.001. After grouping cases according to the underlying cause, BMI, sex, and dialysis sessions BIADW was significantly lower than CDW. Conclusion: Based on the combination of problems with CDW measurement which are corrected by BIA, and more clinical reliability of CDW, we concluded that although conventional method is a time-consuming and operator-dependent way to assess DW, DW could be estimated by combining both of these methods by finding the mathematic correlation between these methods.

  17. Unsteady panel method for complex configurations including wake modeling

    CSIR Research Space (South Africa)

    Van Zyl, Lourens H

    2008-01-01

    Full Text Available implementations of the DLM are however not very versatile in terms of geometries that can be modeled. The ZONA6 code offers a versatile surface panel body model including a separated wake model, but uses a pressure panel method for lifting surfaces. This paper...

  18. Initiation devices, initiation systems including initiation devices and related methods

    Energy Technology Data Exchange (ETDEWEB)

    Daniels, Michael A.; Condit, Reston A.; Rasmussen, Nikki; Wallace, Ronald S.

    2018-04-10

    Initiation devices may include at least one substrate, an initiation element positioned on a first side of the at least one substrate, and a spark gap electrically coupled to the initiation element and positioned on a second side of the at least one substrate. Initiation devices may include a plurality of substrates where at least one substrate of the plurality of substrates is electrically connected to at least one adjacent substrate of the plurality of substrates with at least one via extending through the at least one substrate. Initiation systems may include such initiation devices. Methods of igniting energetic materials include passing a current through a spark gap formed on at least one substrate of the initiation device, passing the current through at least one via formed through the at least one substrate, and passing the current through an explosive bridge wire of the initiation device.

  19. Changing perspective on tissue processing - comparison of microwave histoprocessing method with the conventional method

    Directory of Open Access Journals (Sweden)

    G Shrestha

    2015-09-01

    Full Text Available Background: Histopathological examination of tissues requires sliver of formalin fixed tissue that has been chemically processed and then stained with Haematoxylin and Eosin. The time honored conventional method of tissue processing, which requires 12 to 13 hours for completion, is employed at majority of laboratories but is now seeing the

  20. Dosimetry comparison of pelvimetry methods using conventional radiographs and CT

    International Nuclear Information System (INIS)

    Resten, A.; Suissa, M.; Musset, D.; Mausoleo, F.; Valero, M.; Taylor, S.

    2001-01-01

    To determine the fetal and maternal exposure to radiation by use of thermoluminescent dosimeters in order to compare conventional and CT-scan X-ray. Dosimetry was performed with an anthropomorph phantom. Thermoluminescent dosimeters were positioned on the surface and in the depth of the phantom. Digital radiography of the pelvis was performed according to a standard technique. CT-scan of the pelvis was performed according to the Buthiau's technique. With CT, the dose reached 0.31 to 4.95 mGy, with a dose of 2.32 mGy for the fetal gonads. With standard technique, the doses reached 0.03 to 0.39 mGy, with a dose of 0.39 mGy for the fetal gonads. With CT the fetus and the mother were exposed to 1/10. of the total dose delivered using conventional X-rays and the dose distribution was more homogeneous. (author)

  1. A review on mathematical methods of conventional and Islamic derivatives

    Science.gov (United States)

    Hisham, Azie Farhani Badrol; Jaffar, Maheran Mohd

    2014-12-01

    Despite the impressive growth of risk management tools in financial institutions, Islamic finance remains miles away behind the conventional institutions. Islamic finance products need to comply with the syariah law and prohibitions, therefore they can use fewer of the available risk management tools compared to conventional. Derivatives have proven to be the effective hedging technique and instrument that broadly being used in the conventional institutions to manage their risks. However, derivatives are not generally accepted as the legitimate products in Islamic finance and they remain controversial issues among the Islamic scholars. This paper reviews the evolution of derivatives such as forwards, futures and options and then explores the mathematical models that being used to solve derivatives such as random walk model, asset pricing model that follows Brownian motion and Black-Scholes model. Other than that, this paper also critically discuss the perspective of derivatives from Islamic point of view. In conclusion, this paper delivers the traditional Islamic products such as salam, urbun and istijrar that can be used to create building blocks of Islamic derivatives.

  2. Effect of conventional cooking methods on lipid oxidation indices in lamb meat

    OpenAIRE

    A Pourkhalili; M Mirlohi; E Rahimi; M Hojatoleslami

    2012-01-01

    Lipid oxidation is one of the most deteriorative reactions occurred in foodstuff which has harmful impacts on the both food quality and consumer's health. This study was designed to speculate the influence of three conventional cooking methods including boiling, frying and grilling on lipid oxidation parameters in cooked lamb meat. Sections of lamb meat from longissimus dorsi muscle, taken from native Lori-Bakhtiary sheep species were cut into uniform pieces and cooked using boiling, frying a...

  3. A Critical Analysis of the Conventionally Employed Creep Lifing Methods.

    Science.gov (United States)

    Abdallah, Zakaria; Gray, Veronica; Whittaker, Mark; Perkins, Karen

    2014-04-29

    The deformation of structural alloys presents problems for power plants and aerospace applications due to the demand for elevated temperatures for higher efficiencies and reductions in greenhouse gas emissions. The materials used in such applications experience harsh environments which may lead to deformation and failure of critical components. To avoid such catastrophic failures and also increase efficiency, future designs must utilise novel/improved alloy systems with enhanced temperature capability. In recognising this issue, a detailed understanding of creep is essential for the success of these designs by ensuring components do not experience excessive deformation which may ultimately lead to failure. To achieve this, a variety of parametric methods have been developed to quantify creep and creep fracture in high temperature applications. This study reviews a number of well-known traditionally employed creep lifing methods with some more recent approaches also included. The first section of this paper focuses on predicting the long-term creep rupture properties which is an area of interest for the power generation sector. The second section looks at pre-defined strains and the re-production of full creep curves based on available data which is pertinent to the aerospace industry where components are replaced before failure.

  4. Comparative study of the geostatistical ore reserve estimation method over the conventional methods

    International Nuclear Information System (INIS)

    Kim, Y.C.; Knudsen, H.P.

    1975-01-01

    Part I contains a comprehensive treatment of the comparative study of the geostatistical ore reserve estimation method over the conventional methods. The conventional methods chosen for comparison were: (a) the polygon method, (b) the inverse of the distance squared method, and (c) a method similar to (b) but allowing different weights in different directions. Briefly, the overall result from this comparative study is in favor of the use of geostatistics in most cases because the method has lived up to its theoretical claims. A good exposition on the theory of geostatistics, the adopted study procedures, conclusions and recommended future research are given in Part I. Part II of this report contains the results of the second and the third study objectives, which are to assess the potential benefits that can be derived by the introduction of the geostatistical method to the current state-of-the-art in uranium reserve estimation method and to be instrumental in generating the acceptance of the new method by practitioners through illustrative examples, assuming its superiority and practicality. These are given in the form of illustrative examples on the use of geostatistics and the accompanying computer program user's guide

  5. Conventional and more recent methods of radiodiagnosis of mammary carcinoma

    International Nuclear Information System (INIS)

    Kutarna, A.; Klacko, J.; Malatin, O.; Glomba, J.; Celovsky, F.

    1988-01-01

    The methods are listed and briefly characterized. They are categorized by energy used and for some, future applications are given. X-ray methods are believed to be the most frequently used and deemed to remain so. (M.D.)

  6. Conservation Farming and Changing Climate: More Beneficial than Conventional Methods for Degraded Ugandan Soils

    Directory of Open Access Journals (Sweden)

    Drake N. Mubiru

    2017-06-01

    Full Text Available The extent of land affected by degradation in Uganda ranges from 20% in relatively flat and vegetation-covered areas to 90% in the eastern and southwestern highlands. Land degradation has adversely affected smallholder agro-ecosystems including direct damage and loss of critical ecosystem services such as agricultural land/soil and biodiversity. This study evaluated the extent of bare grounds in Nakasongola, one of the districts in the Cattle Corridor of Uganda and the yield responses of maize (Zea mays and common bean (Phaseolus vulgaris L. to different tillage methods in the district. Bare ground was determined by a supervised multi-band satellite image classification using the Maximum Likelihood Classifier (MLC. Field trials on maize and bean grain yield responses to tillage practices used a randomized complete block design with three replications, evaluating conventional farmer practice (CFP; permanent planting basins (PPB; and rip lines, with or without fertilizer in maize and bean rotations. Bare ground coverage in the Nakasongola District was 187 km2 (11% of the 1741 km2 of arable land due to extreme cases of soil compaction. All practices, whether conventional or the newly introduced conservation farming practices in combination with fertilizer increased bean and maize grain yields, albeit with minimal statistical significance in some cases. The newly introduced conservation farming tillage practices increased the bean grain yield relative to conventional practices by 41% in PPBs and 43% in rip lines. In maize, the newly introduced conservation farming tillage practices increased the grain yield by 78% on average, relative to conventional practices. Apparently, conservation farming tillage methods proved beneficial relative to conventional methods on degraded soils, with the short-term benefit of increasing land productivity leading to better harvests and food security.

  7. Interphase Chromosome Profiling: A Method for Conventional Banded Chromosome Analysis Using Interphase Nuclei.

    Science.gov (United States)

    Babu, Ramesh; Van Dyke, Daniel L; Dev, Vaithilingam G; Koduru, Prasad; Rao, Nagesh; Mitter, Navnit S; Liu, Mingya; Fuentes, Ernesto; Fuentes, Sarah; Papa, Stephen

    2018-02-01

    - Chromosome analysis on bone marrow or peripheral blood samples fails in a small proportion of attempts. A method that is more reliable, with similar or better resolution, would be a welcome addition to the armamentarium of the cytogenetics laboratory. - To develop a method similar to banded metaphase chromosome analysis that relies only on interphase nuclei. - To label multiple targets in an equidistant fashion along the entire length of each chromosome, including landmark subtelomere and centromere regions. Each label so generated by using cloned bacterial artificial chromosome probes is molecularly distinct with unique spectral characteristics, so the number and position of the labels can be tracked to identify chromosome abnormalities. - Interphase chromosome profiling (ICP) demonstrated results similar to conventional chromosome analysis and fluorescence in situ hybridization in 55 previously studied cases and obtained useful ICP chromosome analysis results on another 29 cases in which conventional methods failed. - ICP is a new and powerful method to karyotype peripheral blood and bone marrow aspirate preparations without reliance on metaphase chromosome preparations. It will be of particular value for cases with a failed conventional analysis or when a fast turnaround time is required.

  8. Tomographs based on non-conventional radiation sources and methods

    International Nuclear Information System (INIS)

    Barbuzza, R.; Fresno, M. del; Venere, Marcelo J.; Clausse, Alejandro; Moreno, C.

    2000-01-01

    Computer techniques for tomographic reconstruction of objects X-rayed with a compact plasma focus (PF) are presented. The implemented reconstruction algorithms are based on stochastic searching of solutions of Radon equation, using Genetic Algorithms and Monte Carlo methods. Numerical experiments using actual projections were performed concluding the feasibility of the application of both methods in tomographic reconstruction problem. (author)

  9. A method to determine the number of nanoparticles in a cluster using conventional optical microscopes

    International Nuclear Information System (INIS)

    Kang, Hyeonggon; Attota, Ravikiran; Tondare, Vipin; Vladár, András E.; Kavuri, Premsagar

    2015-01-01

    We present a method that uses conventional optical microscopes to determine the number of nanoparticles in a cluster, which is typically not possible using traditional image-based optical methods due to the diffraction limit. The method, called through-focus scanning optical microscopy (TSOM), uses a series of optical images taken at varying focus levels to achieve this. The optical images cannot directly resolve the individual nanoparticles, but contain information related to the number of particles. The TSOM method makes use of this information to determine the number of nanoparticles in a cluster. Initial good agreement between the simulations and the measurements is also presented. The TSOM method can be applied to fluorescent and non-fluorescent as well as metallic and non-metallic nano-scale materials, including soft materials, making it attractive for tag-less, high-speed, optical analysis of nanoparticles down to 45 nm diameter

  10. Conventional estimating method of earthquake response of mechanical appendage system

    International Nuclear Information System (INIS)

    Aoki, Shigeru; Suzuki, Kohei

    1981-01-01

    Generally, for the estimation of the earthquake response of appendage structure system installed in main structure system, the method of floor response analysis using the response spectra at the point of installing the appendage system has been used. On the other hand, the research on the estimation of the earthquake response of appendage system by the statistical procedure based on probability process theory has been reported. The development of a practical method for simply estimating the response is an important subject in aseismatic engineering. In this study, the method of estimating the earthquake response of appendage system in the general case that the natural frequencies of both structure systems were different was investigated. First, it was shown that floor response amplification factor was able to be estimated simply by giving the ratio of the natural frequencies of both structure systems, and its statistical property was clarified. Next, it was elucidated that the procedure of expressing acceleration, velocity and displacement responses with tri-axial response spectra simultaneously was able to be applied to the expression of FRAF. The applicability of this procedure to nonlinear system was examined. (Kako, I.)

  11. Strategy for identification & characterization of Bartonella henselae with conventional & molecular methods

    Directory of Open Access Journals (Sweden)

    Kavita Diddi

    2013-01-01

    Full Text Available Background & objectives: Bartonella henselae is a fastidious gram-negative bacterium usually causing self limiting infections in immunocompetent individuals but often causes potentially life threatening infection, such as bacillary angiomatosis in immunocompromised patients. Both diagnosis of infections and research into molecular mechanisms of pathogenesis have been hindered by lack of appropriate and reliable diagnostic techniques. We undertook this study to standardize methods to characterize B. henselae in clinical samples to diagnose Bartonella infection correctly. Methods: B. henselae ATCC 49882 strain was procured from American type culture collection, USA. This strain was revived and maintained in the laboratory, and identification and characterization of this strain was done by conventional and molecular techniques, which included culture on various media, staining by different methods including electron microscopy, biochemical analysis by conventional methods and API, polymerase chain reaction (PCR for amplification of citrate synthase gene followed by restriction fragment length polymorphism (RFLP. Results: This organism was biochemically inert due to slow growth and generated unique identification code with API. The amplification of the citrate-synthase gene with primers yielded a 381 bp product followed by specific RFLP profile for B. henselae. Interpretation & conclusions: Bartonella is fastidious and fragile organism and should be handled carefully. Extra effort and careful observation are required to isolate and characterize this organism.

  12. Comparison of Concept Mapping and Conventional Teaching Methods on Critical Thinking Skills of Nursing Students

    Directory of Open Access Journals (Sweden)

    Masoumeh Delaram

    2017-06-01

    Full Text Available Background and Objective: Development of critical thinking and practical skills has remained a serious and considerable challenge throughout the nursing educational system in Iran. Conventional methods of teaching such as lectures as the dominant method used in higher education system is a passive style which ignores critical thinking. Therefore, the aim of this study was to compare the effect of instruction by Concept-Mapping and conventional Method on critical thinking skills of nursing students. Materials and Methods:This quasi-experimental study was carried out on 70 nursing students of Tehran Nursing and Midwifery schoolwho were selected through convenient sampling method, then were divided randomly into the two equal Experimental and Control groups. Educational content was presented in the form of Concept-Mapping in the Experimental group and Lecture,Demonstration and Practicalexercises in the control group. Data collection included a demographic information and California Critical Thinking Skills (form B questionnairewhich was completed at the beginning and at the end of the fourth week of Instructional period. Data were analyzed using SPSS software (V: 21, descriptive and analytical Statistics; at the significant level P<0.05. Results: Before the intervention, the mean of critical thinking skill score was 9.71±2.66 in concept mapping group and 9.64 ± 2.14 in conventional group and the difference was not significant (P=0.121, but after the intervention, a significant difference was found between the intervention and conventionalgroup (15.20±2.71 vs 10.25±2.06, P=0.003. Conclusion: Using Concept mapping strategy in the education of nursing students may lead to developing critical thinking skills as one of the important missions of higher education. So it is recommended to usethis method in clinical nursing education.

  13. Energy indices in irrigated wheat production under conservation and conventional tillage and planting methods

    Directory of Open Access Journals (Sweden)

    S. M Hosseini

    2016-04-01

    Full Text Available Introduction: Conservation tillage system was recommended for soil erosion control in North America for the first time 60 years ago (Wang et al., 2006. Using this tillage system including minimum and zero tillage has been rapidly developed in recent years. Thearea covered by zero tillage in 2006 was 95 million ha all over the world (Dumanski et al., 2006. In addition to saving soil and water resources, conservation tillage system reduces energy consumption and improves energy indices by combining different tillage and planting operations. Results of research conducted in Fars province shows that conservation tillage saves fuel consumption for 77% compared to the conventional system (Afzalinia et al., 2009. Conservation tillage also reduces energy consumption from 23.6 to 42.8% in comparison to the conventional tillage (Rusu, 2005. Since energy indices would be affected by reduced input energies in conservation tillage, this research was conducted to evaluate the effect of different tillage and planting methods on energy inputs and energy indices in irrigated wheat production in Eghlid region. Materials and Methods: This research was performed to evaluate and compare the energy indices in irrigated wheat production under different tillage and planting methods. The study was conducted in the form of a randomized complete block experimental design with five treatments and three replications in Eghlid region. The treatments were included, conventional tillage and seed broadcasting (A, conventional tillage and planting with Machine Barzegar grain drill (B, reduced tillage and seeding with Roto-seeder (C, direct seeding with Jairan Sanaat grain drill (D, and direct seeding with Sfoggia direct drill (E. Experimental plots with 10 by 50 m dimensions were used in this study. Loss crop residues were taken out of the experimental plots and standing crop residues were retained in the plots. In the conventional tillage method, primary tillage was performed

  14. Genetic improvement of olive (Olea europaea L.) by conventional and in vitro biotechnology methods.

    Science.gov (United States)

    Rugini, E; Cristofori, V; Silvestri, C

    2016-01-01

    In olive (Olea europaea L.) traditional methods of genetic improvement have up to now produced limited results. Intensification of olive growing requires appropriate new cultivars for fully mechanized groves, but among the large number of the traditional varieties very few are suitable. High-density and super high-density hedge row orchards require genotypes with reduced size, reduced apical dominance, a semi-erect growth habit, easy to propagate, resistant to abiotic and biotic stresses, with reliably high productivity and quality of both fruits and oil. Innovative strategies supported by molecular and biotechnological techniques are required to speed up novel hybridisation methods. Among traditional approaches the Gene Pool Method seems a reasonable option, but it requires availability of widely diverse germplasm from both cultivated and wild genotypes, supported by a detailed knowledge of their genetic relationships. The practice of "gene therapy" for the most important existing cultivars, combined with conventional methods, could accelerate achievement of the main goals, but efforts to overcome some technical and ideological obstacles are needed. The present review describes the benefits that olive and its products may obtain from genetic improvement using state of the art of conventional and unconventional methods, and includes progress made in the field of in vitro techniques. The uses of both traditional and modern technologies are discussed with recommendations. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Evaluation of quinua lines obtained trough mutagenesis and conventional methods

    International Nuclear Information System (INIS)

    De la Cruz, E.; Garcia, J. M; Gonzalez, J.; Brunner, I.; Rubluo, A.; Guadarrama, S

    2001-01-01

    Chenopodium quinoa is an ancient crop that due to its hardiness, nutritive value, and ability to strive under marginal conditions is considered as a crop for modern times, considering the current demands of highly nutritive products obtained through sustainable agricultural practices. The research on quinua began in Mexico in the early eighties, considering it as an alternative crop to peasants living in impoverished regions, characterised by marginal soils. Research institutions such as the Instituto de Investigacion Agricola del Estado de Mexico (ICAMEX), Colegio de Postgraduados and Universidad Autonoma Chapingo, began to evaluate varieties from South-America and eventually established a breeding programme on quinua. One goal of the quinua research programme in Mexico is the reduction of saponin content, so a mutation breeding approach was designed in the early nineties being the Instituto Nacional de Investigaciones Nucleares (ININ) involved. In the 1999-2000 period, field trials of low saponin putative mutants obtained through irradiation of Barandales variety were performed, including also elite lines supplied by the National Germplasm Bank (NGB) at Chapingo, Mexico. The results from this trials indicate that the low saponin content character in the putative mutants remains in the M5 generation. Also eleven early maturing lines were detected. Climatic conditions prevalent in that period exhibited the resistance of quinua to spring frosts, furthermore, the evaluation of advanced lines from the (NGB) showed high variability regarding to morphological, agronomic and seed quality characters which Hill allow us to advance in the search for superior quinua lines

  16. A FILTRATION METHOD AND APPARATUS INCLUDING A ROLLER WITH PORES

    DEFF Research Database (Denmark)

    2008-01-01

    The present invention offers a method for separating dry matter from a medium. A separation chamber is at least partly defined by a plurality of rollers (2,7) and is capable of being pressure regulated. At least one of the rollers is a pore roller (7) having a surface with pores allowing permeabi...

  17. SU-F-J-86: Method to Include Tissue Dose Response Effect in Deformable Image Registration

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, J; Liang, J; Chen, S; Qin, A; Yan, D [Beaumont Health Systeml, Royal Oak, MI (United States)

    2016-06-15

    Purpose: Organ changes shape and size during radiation treatment due to both mechanical stress and radiation dose response. However, the dose response induced deformation has not been considered in conventional deformable image registration (DIR). A novel DIR approach is proposed to include both tissue elasticity and radiation dose induced organ deformation. Methods: Assuming that organ sub-volume shrinkage was proportional to the radiation dose induced cell killing/absorption, the dose induced organ volume change was simulated applying virtual temperature on each sub-volume. Hence, both stress and heterogeneity temperature induced organ deformation. Thermal stress finite element method with organ surface boundary condition was used to solve deformation. Initial boundary correspondence on organ surface was created from conventional DIR. Boundary condition was updated by an iterative optimization scheme to minimize elastic deformation energy. The registration was validated on a numerical phantom. Treatment dose was constructed applying both the conventional DIR and the proposed method using daily CBCT image obtained from HN treatment. Results: Phantom study showed 2.7% maximal discrepancy with respect to the actual displacement. Compared with conventional DIR, subvolume displacement difference in a right parotid had the mean±SD (Min, Max) to be 1.1±0.9(−0.4∼4.8), −0.1±0.9(−2.9∼2.4) and −0.1±0.9(−3.4∼1.9)mm in RL/PA/SI directions respectively. Mean parotid dose and V30 constructed including the dose response induced shrinkage were 6.3% and 12.0% higher than those from the conventional DIR. Conclusion: Heterogeneous dose distribution in normal organ causes non-uniform sub-volume shrinkage. Sub-volume in high dose region has a larger shrinkage than the one in low dose region, therefore causing more sub-volumes to move into the high dose area during the treatment course. This leads to an unfavorable dose-volume relationship for the normal organ

  18. Composite material including nanocrystals and methods of making

    Science.gov (United States)

    Bawendi, Moungi G.; Sundar, Vikram C.

    2010-04-06

    Temperature-sensing compositions can include an inorganic material, such as a semiconductor nanocrystal. The nanocrystal can be a dependable and accurate indicator of temperature. The intensity of emission of the nanocrystal varies with temperature and can be highly sensitive to surface temperature. The nanocrystals can be processed with a binder to form a matrix, which can be varied by altering the chemical nature of the surface of the nanocrystal. A nanocrystal with a compatibilizing outer layer can be incorporated into a coating formulation and retain its temperature sensitive emissive properties.

  19. Review of conventional and novel food processing methods on food allergens.

    Science.gov (United States)

    Vanga, Sai Kranthi; Singh, Ashutosh; Raghavan, Vijaya

    2017-07-03

    With the turn of this century, novel food processing techniques have become commercially very important because of their profound advantages over the traditional methods. These novel processing methods tend to preserve the characteristic properties of food including their organoleptic and nutritional qualities better when compared with the conventional food processing methods. During the same period of time, there is a clear rise in the populations suffering from food allergies, especially infants and children. Though, this fact is widely attributed to the changing livelihood of population in both developed and developing nations and to the introduction of new food habits with advent of novel foods and new processing techniques, their complete role is still uncertain. Under the circumstance, it is very important to understand the structural changes in the protein as food is processed to comprehend whether the specific processing technique (conventional and novel) is increasing or mitigating the allergenicity. Various modern means are now being employed to understand the conformational changes in the protein which can affect the allergenicity. In this review, the processing effects on protein structure and allergenicity are discussed along with the insinuations of recent studies and techniques for establishing a platform to investigate future pathway to reduce or eliminate allergenicity in the population.

  20. Methods for forming complex oxidation reaction products including superconducting articles

    International Nuclear Information System (INIS)

    Rapp, R.A.; Urquhart, A.W.; Nagelberg, A.S.; Newkirk, M.S.

    1992-01-01

    This patent describes a method for producing a superconducting complex oxidation reaction product of two or more metals in an oxidized state. It comprises positioning at least one parent metal source comprising one of the metals adjacent to a permeable mass comprising at least one metal-containing compound capable of reaction to form the complex oxidation reaction product in step below, the metal component of the at least one metal-containing compound comprising at least a second of the two or more metals, and orienting the parent metal source and the permeable mass relative to each other so that formation of the complex oxidation reaction product will occur in a direction towards and into the permeable mass; and heating the parent metal source in the presence of an oxidant to a temperature region above its melting point to form a body of molten parent metal to permit infiltration and reaction of the molten parent metal into the permeable mass and with the oxidant and the at least one metal-containing compound to form the complex oxidation reaction product, and progressively drawing the molten parent metal source through the complex oxidation reaction product towards the oxidant and towards and into the adjacent permeable mass so that fresh complex oxidation reaction product continues to form within the permeable mass; and recovering the resulting complex oxidation reaction product

  1. Membrane for distillation including nanostructures, methods of making membranes, and methods of desalination and separation

    KAUST Repository

    Lai, Zhiping; Huang, Kuo-Wei; Chen, Wei

    2016-01-01

    In accordance with the purpose(s) of the present disclosure, as embodied and broadly described herein, embodiments of the present disclosure provide membranes, methods of making the membrane, systems including the membrane, methods of separation, methods of desalination, and the like.

  2. Membrane for distillation including nanostructures, methods of making membranes, and methods of desalination and separation

    KAUST Repository

    Lai, Zhiping

    2016-01-21

    In accordance with the purpose(s) of the present disclosure, as embodied and broadly described herein, embodiments of the present disclosure provide membranes, methods of making the membrane, systems including the membrane, methods of separation, methods of desalination, and the like.

  3. CAM visual stimulation with conventional method of occlusion treatment in amblyopia: a randomized clinical trial

    Directory of Open Access Journals (Sweden)

    Ali Reza Jafari

    2014-04-01

    Conclusion: Using of CAM visual stimulation along with conventional occlusion will further improve visual acuity and stereopsis in amblyopic children. These findings recommended the CAM visual stimulation as an accompanying and complementary method in amblyopia treatment.

  4. Investigation of Industrialised Building System Performance in Comparison to Conventional Construction Method

    Directory of Open Access Journals (Sweden)

    Othuman Mydin M.A.

    2014-03-01

    Full Text Available Conventional construction methods are still widely practised, although many researches have indicated that this method is less effective compared to the IBS construction method. The existence of the IBS has added to the many techniques within the construction industry. This study is aimed at making comparisons between the two construction approaches. Case studies were conducted at four sites in the state of Penang, Malaysia. Two projects were IBS-based while the remaining two deployed the conventional method of construction. Based on an analysis of the results, it can be concluded that the IBS approach has more to offer compared to the conventional method. Among these advantages are shorter construction periods, reduced overall costs, less labour needs, better site conditions and the production of higher quality components.

  5. In vivo precision of conventional and digital methods for obtaining quadrant dental impressions

    OpenAIRE

    Ender, Andreas; Zimmermann, Moritz; Attin, Thomas; Mehl, Albert

    2016-01-01

    OBJECTIVES Quadrant impressions are commonly used as alternative to full-arch impressions. Digital impression systems provide the ability to take these impressions very quickly; however, few studies have investigated the accuracy of the technique in vivo. The aim of this study is to assess the precision of digital quadrant impressions in vivo in comparison to conventional impression techniques. MATERIALS AND METHODS Impressions were obtained via two conventional (metal full-arch tray, CI, ...

  6. 10 CFR Appendix I to Subpart B of... - Uniform Test Method for Measuring the Energy Consumption of Conventional Ranges, Conventional...

    Science.gov (United States)

    2010-01-01

    ... PROGRAM FOR CONSUMER PRODUCTS Test Procedures Pt. 430, Subpt. B, App. I Appendix I to Subpart B of Part... between the center and the corners of the conventional gas oven on the diagonals of a horizontal plane...

  7. Conventional and digital radiographic methods in the detection of simulated external root resorptions: A comparative study

    Directory of Open Access Journals (Sweden)

    C J Sanjay

    2009-01-01

    Full Text Available Objective : To evaluate and compare the efficacy of conventional and digital radiographic methods in the detection of simulated external root resorption cavities and also to evaluate whether the detectability was influenced by resorption cavity sizes. Methods : Thirty-two selected teeth from human dentate mandibles were radiographed in orthoradial, mesioradial and distoradial aspect using conventional film (Insight Kodak F-speed; Eastman Kodak, Rochester, NY and a digital sensor (Trophy RVG advanced imaging system with 0.7mm and 1.0mm deep cavities prepared on their vestibular, mesial and distal surfaces at the cervical, middle and apical thirds. Three dental professionals, an endodontist, a radiologist and a general practitioner, evaluated the images twice with a one-week time interval. Results : No statistical significance was seen in the first observation for both conventional and digital radiographic methods in the detection of simulated external root resorptions and for small and medium cavities but statistical difference was noted in the second observation (P< 0.001 for both the methods. Conclusion : Considering the methodology and the overall results, conventional radiographic method (F-speed performed slightly better than the digital radiographic method in the detection of simulated radiographic method but better consistency was seen with the digital system. Overall size of the resorption cavity had no influence on the performance of both methods and suggests that initial external root resorption lesion is not well-appreciated with both the methods as compared to the advanced lesion.

  8. Comparison between laser terahertz emission microscope and conventional methods for analysis of polycrystalline silicon solar cell

    Directory of Open Access Journals (Sweden)

    Hidetoshi Nakanishi

    2015-11-01

    Full Text Available A laser terahertz emission microscope (LTEM can be used for noncontact inspection to detect the waveforms of photoinduced terahertz emissions from material devices. In this study, we experimentally compared the performance of LTEM with conventional analysis methods, e.g., electroluminescence (EL, photoluminescence (PL, and laser beam induced current (LBIC, as an inspection method for solar cells. The results showed that LTEM was more sensitive to the characteristics of the depletion layer of the polycrystalline solar cell compared with EL, PL, and LBIC and that it could be used as a complementary tool to the conventional analysis methods for a solar cell.

  9. Comparison of the efficacy of conventional slow freezing and rapid cryopreservation methods for bovine embryos

    NARCIS (Netherlands)

    Wagtendonk-de Leeuw, van A.M.; Daas, den J.H.; Kruip, T.A.; Rail, W.F.

    1995-01-01

    Day 7 bovine morulae and early blastocysts were randomly assigned to one of four cryopreservation methods: (i) a modified conventional controlled slow freezing and stepwise dilution after thawing; and three methods which enable direct transfer of the embryo into the recipient upon thawing: (ii)

  10. A Conceptual Design and Analysis Method for Conventional and Unconventional Airplanes

    NARCIS (Netherlands)

    Elmendorp, R.J.M.; Vos, R.; La Rocca, G.

    2014-01-01

    A design method is presented that has been implemented in a software program to investigate the merits of conventional and unconventional transport airplanes. Design and analysis methods are implemented in a design tool capable of creating a conceptual design based on a set of toplevel requirements.

  11. Toxoplasmosis: The value of molecular methods in diagnosis compared to conventional methods

    Directory of Open Access Journals (Sweden)

    Zineb Tlamçani

    2013-06-01

    Full Text Available Toxoplasmosis is a parasitic infection due to Toxoplasma gondii an obligate intracellular protozoan parasite. It is considerateone of the most common parasite worldwide. The contamination of the parasite is generally occurred via consumptionof infected food or water or, undercooked contaminated meat. Toxoplasma gondii infection may lead to seriousillness when the organism is contracted while pregnancy or when it is reactivated in immune-suppressed persons.Diagnosis of toxoplasmosis in humans is elaborated using various techniques such as detection of anti-Toxoplasmaantibodies, mouse inoculation, histological revelation of tachyzoites in tissue sections or smears of body fluid, but thedetection of Toxoplasma gondii DNA by molecular methods has revolutionized prenatal diagnosis of congenital toxoplasmosisand in immunocompromised patients. In this paper we will discuss the parasite and different methods ofdiagnosis including the usefulness of molecular methods. J Microbiol Infect Dis 2013; 3(2: 93-99Key words: Toxoplamosis, Toxoplasma gondii, diagnosis

  12. Effect of conventional cooking methods on lipid oxidation indices in lamb meat

    Directory of Open Access Journals (Sweden)

    A Pourkhalili

    2012-05-01

    Full Text Available Lipid oxidation is one of the most deteriorative reactions occurred in foodstuff which has harmful impacts on the both food quality and consumer's health. This study was designed to speculate the influence of three conventional cooking methods including boiling, frying and grilling on lipid oxidation parameters in cooked lamb meat. Sections of lamb meat from longissimus dorsi muscle, taken from native Lori-Bakhtiary sheep species were cut into uniform pieces and cooked using boiling, frying and roasting methods according to the cooking routine and tradition in Iranian society, in terms of temperature and time. Proximate compositions (moisture, lipid, ash and protein in the raw and cooked meat were determined using the standard methods of analysis. Moreover, weight loss was measured after each treatment. Lipid oxidation parameters such as peroxide value, conjugated diene and TBARS indices were measured in the raw and cooked samples. Evaluation of lipid oxidation parameters showed that peroxide value was significantly decreased in all cooked samples. In contrast, conjugated diene value was significantly increased in the fried and grilled samples (p

  13. Why conventional detection methods fail in identifying the existence of contamination events.

    Science.gov (United States)

    Liu, Shuming; Li, Ruonan; Smith, Kate; Che, Han

    2016-04-15

    Early warning systems are widely used to safeguard water security, but their effectiveness has raised many questions. To understand why conventional detection methods fail to identify contamination events, this study evaluates the performance of three contamination detection methods using data from a real contamination accident and two artificial datasets constructed using a widely applied contamination data construction approach. Results show that the Pearson correlation Euclidean distance (PE) based detection method performs better for real contamination incidents, while the Euclidean distance method (MED) and linear prediction filter (LPF) method are more suitable for detecting sudden spike-like variation. This analysis revealed why the conventional MED and LPF methods failed to identify existence of contamination events. The analysis also revealed that the widely used contamination data construction approach is misleading. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. In vivo precision of conventional and digital methods of obtaining complete-arch dental impressions.

    Science.gov (United States)

    Ender, Andreas; Attin, Thomas; Mehl, Albert

    2016-03-01

    Digital impression systems have undergone significant development in recent years, but few studies have investigated the accuracy of the technique in vivo, particularly compared with conventional impression techniques. The purpose of this in vivo study was to investigate the precision of conventional and digital methods for complete-arch impressions. Complete-arch impressions were obtained using 5 conventional (polyether, POE; vinylsiloxanether, VSE; direct scannable vinylsiloxanether, VSES; digitized scannable vinylsiloxanether, VSES-D; and irreversible hydrocolloid, ALG) and 7 digital (CEREC Bluecam, CER; CEREC Omnicam, OC; Cadent iTero, ITE; Lava COS, LAV; Lava True Definition Scanner, T-Def; 3Shape Trios, TRI; and 3Shape Trios Color, TRC) techniques. Impressions were made 3 times each in 5 participants (N=15). The impressions were then compared within and between the test groups. The cast surfaces were measured point-to-point using the signed nearest neighbor method. Precision was calculated from the (90%-10%)/2 percentile value. The precision ranged from 12.3 μm (VSE) to 167.2 μm (ALG), with the highest precision in the VSE and VSES groups. The deviation pattern varied distinctly according to the impression method. Conventional impressions showed the highest accuracy across the complete dental arch in all groups, except for the ALG group. Conventional and digital impression methods differ significantly in the complete-arch accuracy. Digital impression systems had higher local deviations within the complete arch cast; however, they achieve equal and higher precision than some conventional impression materials. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

  15. A new method to characterize dopant profiles in NMOSFETs using conventional transmission electron microscopy

    International Nuclear Information System (INIS)

    Kawamura, Kazuo; Ikeda, Kazuto; Terauchi, Masami

    2004-01-01

    We have developed a new method using conventional transmission electron microscopy (TEM) to obtain two dimensional dopant profiles in silicon and applied it to 40 nm-gate-length N + /p metal oxide semiconductor field effect transistors (MOSFETs). The results are consistent with those of selective-chemically etched samples observed by TEM. This method, using focused ion beam (FIB) sample preparation and conventional TEM, has the great advantage of simple sample preparation and high spatial resolution compared to other characterization methods, such as atomic capacitance microscopy, spreading resistance microscopy, and TEM combined with selective chemical etching. This indicates that this method can be applicable to the analysis of FETs at the 65 nm or smaller node

  16. Screening for depression in epilepsy clinics. A comparison of conventional and visual-analog methods.

    Science.gov (United States)

    Rampling, Jeremy; Mitchell, Alex J; Von Oertzen, Tim; Docker, James; Jackson, Jemima; Cock, Hannah; Agrawal, Niruj

    2012-10-01

    Depression is an important but underdiagnosed complication of epilepsy. This study compares potentially suitable screening tools head-to-head. We enrolled 266 attendees with a confirmed diagnosis of epilepsy at a specialized neurologic epilepsy service in London and compared verbal self-report and visual analog (VAS) screening methods for depression. These included two generic depression scales (Hospital Anxiety and Depression Scale [HADS], Beck Depression Inventory II [BDI-II]), one epilepsy specific scale (Neurological Disorders Depression Inventory for Epilepsy [NDDI-E]) and one new visual-analog scale (Emotional Thermometers [ET]). We used Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) criteria for major depression and International Classification of Diseases, Tenth Revision (ICD-10) criteria for depressive episode as the reference standard. Against ICD-10-defined depression the most accurate scales by receiver operating characteristic (ROC) curve area were HADS Total (HADS-T, 0.924), BDI-II (0.898) and NDDI-E (0.897). New visual-analog methods had similar accuracy measured either in combination or individually. Although no test performed well in a case-finding role, several performed well as a rule-out initial step, owing to high negative predictive value and specificity. In this role, the optimal performing conventional tools were the HADS depression subsscale (HADS-D) and the NDDI-E and the optimal single VAS were the depression thermometer (DepT) and the distress thermometer (DT). Against DSM-IV- defined major depression, results were similar with optimal performance by the HADS-T, BDI-II, and NDDI-E, but here the anxiety thermometer (AnxT) as well as DepT and DT also offered good performance. Given that no test performed well in a case-finding role, we suggest that these tests are used as an initial first step to rule out patients who are unlikely to have depression. We suggest that the six-item NDDI-E or seven-item HADS

  17. Assessment of the hardness of different orthodontic wires and brackets produced by metal injection molding and conventional methods

    Directory of Open Access Journals (Sweden)

    Shiva Alavi

    2017-01-01

    Conclusion: MIM orthodontic brackets exhibited hardness values much lower than those of SS orthodontic archwires and were more compatible with NiTi and beta-titanium archwires. A wide range of microhardness values has been reported for conventional orthodontic brackets and it should be considered that the manufacturing method might be only one of the factors affecting the mechanical properties of orthodontic brackets including hardness.

  18. Conventional and Alternative Disinfection Methods of Legionella in Water Distribution Systems – Review

    Directory of Open Access Journals (Sweden)

    Pūle Daina

    2016-12-01

    Full Text Available Prevalence of Legionella in drinking water distribution systems is a widespread problem. Outbreaks of Legionella caused diseases occur despite various disinfectants are used in order to control Legionella. Conventional methods like thermal disinfection, silver/copper ionization, ultraviolet irradiation or chlorine-based disinfection have not been effective in the long term for control of biofilm bacteria. Therefore, research to develop more effective disinfection methods is still necessary.

  19. Methods for assessing phosphorus overfeeding on organic and conventional dairy farms.

    Science.gov (United States)

    Nordqvist, M; Holtenius, K; Spörndly, R

    2014-02-01

    Phosphorus (P) losses from dairy farms can severely damage aquatic ecosystems, so it is important to have tools to assess overfeeding of P. This study screened P intake and faecal excretion of different P fractions in dairy cows on conventional and organic farms, compared the P feeding level of the herds against the recommendations and analysed different sampling and analysis methods for assessing the general status of P feeding on the farms. The organic (n=14) and conventional farms (n=15) were of comparable size and were located in southern Sweden. On each farm, feed intake was registered for 10 cows representing four different lactation stages and their P intake was calculated and related to current recommendations. Faecal samples taken from the same cows were analysed for total P (TP) and soluble P. Milk production data for the cows were obtained from the Swedish official milk recording scheme. TP was determined in one slurry sample per farm. More than 70% of the cows studied, representing both conventional and organic herds, consumed P in excess of the recommendations. Conventional herds had higher P content in the ration than organic herds, and lactating cows in conventional herds had higher faecal concentrations of total and soluble P than those in organic herds. However in dry cows, the P content of the ration and soluble P and TP in faeces did not differ between the two management systems. Soluble P was well correlated to TP in faeces, and both were good indicators of P overfeeding.

  20. New practical method for evaluation of a conventional flat plate continuous pistachio dryer

    International Nuclear Information System (INIS)

    Kouchakzadeh, Ahmad; Tavakoli, Teymur

    2011-01-01

    Highlights: → Evaluation of a conventional flat plate continuous pistachio dryer with a new feasible method. → Using thermophysical properties of air and matter. → This manner could be utilized in similar dryer for other agricultural products. → Method shows the heat loss and power separately. -- Abstract: Testing a dryer is necessary to evaluate its absolute and comparative performance with other dryers. A conventional flat plate continuous pistachio dryer was tested by a new practical method of mass and energy equilibrium. Results showed that the average power consumption and heat loss in three tests are 62.13 and 18.99 kW, respectively. The ratio of heat loss on power consumption showed that the efficiency of practical pistachios flat plate dryer is about 69.4%.

  1. New practical method for evaluation of a conventional flat plate continuous pistachio dryer

    Energy Technology Data Exchange (ETDEWEB)

    Kouchakzadeh, Ahmad [Agri Machinery Engineering, Ilam University, Ilam (Iran, Islamic Republic of); Tavakoli, Teymur [Agri Machinery Engineering, Tarbyat Modares University, Tehran (Iran, Islamic Republic of)

    2011-07-15

    Highlights: {yields} Evaluation of a conventional flat plate continuous pistachio dryer with a new feasible method. {yields} Using thermophysical properties of air and matter. {yields} This manner could be utilized in similar dryer for other agricultural products. {yields} Method shows the heat loss and power separately. -- Abstract: Testing a dryer is necessary to evaluate its absolute and comparative performance with other dryers. A conventional flat plate continuous pistachio dryer was tested by a new practical method of mass and energy equilibrium. Results showed that the average power consumption and heat loss in three tests are 62.13 and 18.99 kW, respectively. The ratio of heat loss on power consumption showed that the efficiency of practical pistachios flat plate dryer is about 69.4%.

  2. Diagnostic utility of the cell block method versus the conventional smear study in pleural fluid cytology

    Directory of Open Access Journals (Sweden)

    Udasimath Shivakumarswamy

    2012-01-01

    Full Text Available Background: The cytological examinations of serous effusions have been well-accepted, and a positive diagnosis is often considered as a definitive diagnosis. It helps in staging, prognosis and management of the patients in malignancies and also gives information about various inflammatory and non-inflammatory lesions. Diagnostic problems arise in everyday practice to differentiate reactive atypical mesothelial cells and malignant cells by the routine conventional smear (CS method. Aims: To compare the morphological features of the CS method with those of the cell block (CB method and also to assess the utility and sensitivity of the CB method in the cytodiagnosis of pleural effusions. Materials and Methods: The study was conducted in the cytology section of the Department of Pathology. Sixty pleural fluid samples were subjected to diagnostic evaluation for over a period of 20 months. Along with the conventional smears, cell blocks were prepared by using 10% alcohol-formalin as a fixative agent. Statistical analysis with the ′z test′ was performed to identify the cellularity, using the CS and CB methods. Mc. Naemer′s χ2 test was used to identify the additional yield for malignancy by the CB method. Results: Cellularity and additional yield for malignancy was 15% more by the CB method. Conclusions: The CB method provides high cellularity, better architectural patterns, morphological features and an additional yield of malignant cells, and thereby, increases the sensitivity of the cytodiagnosis when compared with the CS method.

  3. A combination of small bowel imaging methods: conventional enteroclysis with complementary magnetic resonance enteroclysis

    Energy Technology Data Exchange (ETDEWEB)

    Akman, C. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Korman, U. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey)]. E-mail: ugurk9@istanbul.edu.tr; Oguet, G. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Kurugoglu, S. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Urger, E. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Ulus, S. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Esen, G. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Tasci, I. [Department of Surgery, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey)

    2005-07-01

    AIM: The aim of this prospective study was to evaluate the overall findings of conventional enteroclysis (CE) with complementary magnetic resonance enteroclysis (MRE) in small bowel disease. METHODS: The study included 32 patients referred from various clinical departments, with known or suspected small bowel disease and abnormalities on CE. Immediately after CE, true fast imaging with steady-state precession (true FISP), and unenhanced and gadolinium-enhanced T1-weighted fast low-angle shot (FLASH) sequences with fat saturation were obtained. Mucosal, mural and luminal changes of the small bowel were evaluated by each technique. In addition, bowel wall thickening, bowel wall enhancement and perienteric changes were assessed by MRE. The radiological findings obtained were evaluated together as a combination, and the role of MRE in the determination of the activity and complications of the small bowel disease was assessed. Radiological findings were correlated with clinical evaluation and follow-up in all cases, including endoscopy in 14 cases and surgery in 5 cases. RESULTS: MRE provided important supplementary mural and extramural information, including degree of pathological wall thickness, mural enhancement pattern associated with disease activity, perivisceral collection, abscess formation, mesenteric fibrofatty proliferation, lymphadenopathy and increase in perienteric vascularity. Short strictures were not revealed on MRE; however, for patients with a history of abdominal malignancy, MRE helped characterize the level of any obstruction and the extent of the disease. CONCLUSION: We recommend MRE for patients who have findings of advanced inflammatory bowel disease or neoplasm on CE examination. The combination of these two techniques can provide important information on the degree and extent of the disorder.

  4. Selecting the patients for morning report sessions: case-based vs. conventional method.

    Science.gov (United States)

    Rabiei, Mehdi; Saeidi, Masumeh; Kiani, Mohammad Ali; Amin, Sakineh Mohebi; Ahanchian, Hamid; Jafari, Seyed Ali; Kianifar, Hamidreza

    2015-08-01

    One of the most important issues in morning report sessions is the number of patients. The aim of this study was to investigate and compare the number of cases reported in the morning report sessions in terms of case-based and conventional methods from the perspective of pediatric residents of Mashhad University of Medical Sciences. The present study was conducted on 24 pediatric residents of Mashhad University of Medical Sciences in the academic year 2014-2015. In this survey, the residents replied to a 20-question researcher-made questionnaire that had been designed to measure the views of residents regarding the number of patients in the morning report sessions using case-based and conventional methods. The validity of the questionnaire was confirmed by experts' views and its reliability by calculating Cronbach's alpha coefficients. Data were analyzed by t-test analysis. The mean age of the residents was 30.852 ± 2.506, and 66.6% of them were female. The results showed that there was no significant relationship among the variables of academic year, gender, and residents' perspective to choosing the number of patients in the morning report sessions (P > 0.05). T-test analysis showed a significant relationship among the average scores of residents in the selection of the case-based method in comparison to the conventional method (P case-based morning report was preferred compared to the conventional method. This method makes residents pay more attention to the details of patients' issues and therefore helps them to better plan how to address patient problems and improve their differential diagnosis skills.

  5. Comparison of multimedia system and conventional method in patients’ selecting prosthetic treatment

    Directory of Open Access Journals (Sweden)

    Baghai R

    2010-12-01

    Full Text Available "nBackground and Aims: Selecting an appropriate treatment plan is one of the most critical aspects of dental treatments. The purpose of this study was to compare multimedia system and conventional method in patients' selecting prosthetic treatment and the time consumed."nMaterials and Methods: Ninety patients were randomly divided into three groups. Patients in group A, once were instructed using the conventional method of dental office and once multimedia system and time was measured in seconds from the beginning of the instruction till the patient had came to decision. The patients were asked about the satisfaction of the method used for them. In group B, patients were only instructed using the conventional method, whereas they were only exposed to soft ware in group C. The data were analyzed with Paired-T-test"n(in group A and T-test and Mann-Whitney test (in groups B and C."nResult: There was a significant difference between multimedia system and conventional method in group A and also between groups B and C (P<0.001. In group A and between groups B and C, patient's satisfaction about multimedia system was better. However, in comparison between groups B and C, multimedia system did not have a significant effect in treatment selection score (P=0.08."nConclusion: Using multimedia system is recommended due to its high ability in giving answers to a large number of patient's questions as well as in terms of marketing.

  6. Effectiveness of Video Demonstration over Conventional Methods in Teaching Osteology in Anatomy.

    Science.gov (United States)

    Viswasom, Angela A; Jobby, Abraham

    2017-02-01

    Technology and its applications are the most happening things in the world. So, is it in the field of medical education. This study was an evaluation of whether the conventional methods can compete with the test of technology. A comparative study of traditional method of teaching osteology in human anatomy with an innovative visual aided method. The study was conducted on 94 students admitted to MBBS 2014 to 2015 batch of Travancore Medical College. The students were divided into two academically validated groups. They were taught using conventional and video demonstrational techniques in a systematic manner. Post evaluation tests were conducted. Analysis of the mark pattern revealed that the group taught using traditional method scored better when compared to the visual aided method. Feedback analysis showed that, the students were able to identify bony features better with clear visualisation and three dimensional view when taught using the video demonstration method. The students identified visual aided method as the more interesting one for learning which helped them in applying the knowledge gained. In most of the questions asked, the two methods of teaching were found to be comparable on the same scale. As the study ends, we discover that, no new technique can be substituted for time tested techniques of teaching and learning. The ideal method would be incorporating newer multimedia techniques into traditional classes.

  7. Diagnostic utility of the cell block method versus the conventional smear study in pleural fluid cytology.

    Science.gov (United States)

    Shivakumarswamy, Udasimath; Arakeri, Surekha U; Karigowdar, Mahesh H; Yelikar, Br

    2012-01-01

    The cytological examinations of serous effusions have been well-accepted, and a positive diagnosis is often considered as a definitive diagnosis. It helps in staging, prognosis and management of the patients in malignancies and also gives information about various inflammatory and non-inflammatory lesions. Diagnostic problems arise in everyday practice to differentiate reactive atypical mesothelial cells and malignant cells by the routine conventional smear (CS) method. To compare the morphological features of the CS method with those of the cell block (CB) method and also to assess the utility and sensitivity of the CB method in the cytodiagnosis of pleural effusions. The study was conducted in the cytology section of the Department of Pathology. Sixty pleural fluid samples were subjected to diagnostic evaluation for over a period of 20 months. Along with the conventional smears, cell blocks were prepared by using 10% alcohol-formalin as a fixative agent. Statistical analysis with the 'z test' was performed to identify the cellularity, using the CS and CB methods. Mc. Naemer's χ(2)test was used to identify the additional yield for malignancy by the CB method. Cellularity and additional yield for malignancy was 15% more by the CB method. The CB method provides high cellularity, better architectural patterns, morphological features and an additional yield of malignant cells, and thereby, increases the sensitivity of the cytodiagnosis when compared with the CS method.

  8. Evaluation of stream discharges measurement using radioisotope and conventional method at Sungai Weng catchment area, Kedah

    International Nuclear Information System (INIS)

    Nazrul Hizam Yusoff and Wan Zakaria Wan MuhdTahir

    2006-01-01

    A number of discharge measurements using radioisotope and current metering techniques at selected streams in Sg. Weng Experimental Catchment were conducted by MINT and JPS gauging teams starting from 2003-2005. This study aims to prepare stage-discharge relationships or rating curves of the selected streams during variable flow conditions. The rating curve of the stream is one of the important parameters and usually appraised in certain routine operations of hydrological studies. It may be used in the planning of water resources management and flood control scheme. The radioisotope method employed in this study involved the injection of short-lived radioisotope tracer, that is, technetium-99m ( 99m Tc having its half-life ∼ 6.023 hrs) which was supplied from a high activity technetium generator (55.5 Gbq). Measurement of stream discharges were concurrently undertaken by JPS staff using a current meter type 0TT-C2 mounted on a wading rod at selected gauging stations for comparison purposes. Methodologies from the two methods of discharge measurements, comparison of results and identifying the uncertainties (errors) in performing the measurement during low, medium and high turbulent flows were explained in this paper. Generally, the entire results of streamflow data (2003-2005) measured by both methods during low flows (Q 3 /s) exhibit almost comparable values to each other. However, for moderate flows (1.0 m 3 /s 3 /s), the different in gauging results are slightly higher using radioisotope method ( i.e. Q isotope > Q current meter and may goes up to 40%) , and during high turbulent flows (Q>6.0 m 3 /s) the radioisotope method presented more than 40% higher discharge values as compared to the measurement made by the conventional current-meter. Observation made on site anticipated that inaccurate gauging data measured by conventional means during high flow and turbulent conditions are expected. The average estimated measurement error associated with isotope method

  9. Imaging method of brain surface anatomy structures using conventional T2-weighted MR images

    International Nuclear Information System (INIS)

    Hatanaka, Masahiko; Machida, Yoshio; Yoshida, Tadatoki; Katada, Kazuhiro.

    1992-01-01

    As a non-invasive technique for visualizing the brain surface structure by MRI, surface anatomy scanning (SAS) and the multislice SAS methods have been developed. Both techniques require additional MRI scanning to obtain images for the brain surface. In this paper, we report an alternative method to obtain the brain surface image using conventional T2-weighted multislice images without any additional scanning. The power calculation of the image pixel values, which is incorporated in the routine processing, has been applied in order to enhance the cerebrospinal fluid (CSF) contrast. We think that this method is one of practical approaches for imaging the surface anatomy of the brain. (author)

  10. Evaluation of positional plagiocephaly: Conventional anthropometric measurement versus laser scanning method.

    Science.gov (United States)

    Nahles, Susanne; Klein, Martin; Yacoub, Anke; Neyer, Julia

    2018-01-01

    The incidence of plagiocephaly has increased in the 25 years since the "Back to Sleep" campaign in 1991 to prevent sudden infant death. Plagiocephaly is not considered to be a pathological condition. It is more of an esthetic impairment and could have potentially negative psychological or psychosocial consequences; therefore, treatment is recommended. The aim of this study is to compare conventional anthropometry and laser scanning - two different measurement methods - as diagnostic instruments for plagiocephaly. The present study also tests the measurement time of both methods and whether one method is easier on the patient than the other. A total of 44 children (21 girls, 23 boys) with a mean age of 8.8 months were involved in the present study. Of all patients, the following parameters were routinely evaluated using a standard protocol with the conventional anthropometric method and the scan method: head circumference, head length, head width, head diagonals, and distances ex-t. Furthermore, the time required to obtain measurements and the behavior of the children during measurement were documented. For statistical analysis, a t-test and a Wilcoxon test were used to analyze differences between the two methods. The results for head circumference showed a mean of 441.5 mm for the anthropometric measurements and 441.6 mm for the scan method, with no significant difference between the two methods. A significant difference was found regarding the head width, head length, diagonals, and distance ex-t. The measurement process using the scan method needed a mean of 579.6 s in contrast to the manual anthropometric method, which required a mean time of 180.5 s. In comparison with the conventional anthropometric method, measurements made with a 3D laser scanner yield inconsistent results. Moreover, the current state of technology of 3D cephalometry has no advantages compared with the conventional anthropometric method. Disadvantages worth mentioning appear to be the

  11. Comparison of Different Recruitment Methods for Sexual and Reproductive Health Research: Social Media-Based Versus Conventional Methods.

    Science.gov (United States)

    Motoki, Yoko; Miyagi, Etsuko; Taguri, Masataka; Asai-Sato, Mikiko; Enomoto, Takayuki; Wark, John Dennis; Garland, Suzanne Marie

    2017-03-10

    Prior research about the sexual and reproductive health of young women has relied mostly on self-reported survey studies. Thus, participant recruitment using Web-based methods can improve sexual and reproductive health research about cervical cancer prevention. In our prior study, we reported that Facebook is a promising way to reach young women for sexual and reproductive health research. However, it remains unknown whether Web-based or other conventional recruitment methods (ie, face-to-face or flyer distribution) yield comparable survey responses from similar participants. We conducted a survey to determine whether there was a difference in the sexual and reproductive health survey responses of young Japanese women based on recruitment methods: social media-based and conventional methods. From July 2012 to March 2013 (9 months), we invited women of ages 16-35 years in Kanagawa, Japan, to complete a Web-based questionnaire. They were recruited through either a social media-based (social networking site, SNS, group) or by conventional methods (conventional group). All participants enrolled were required to fill out and submit their responses through a Web-based questionnaire about their sexual and reproductive health for cervical cancer prevention. Of the 243 participants, 52.3% (127/243) were recruited by SNS, whereas 47.7% (116/243) were recruited by conventional methods. We found no differences between recruitment methods in responses to behaviors and attitudes to sexual and reproductive health survey, although more participants from the conventional group (15%, 14/95) chose not to answer the age of first intercourse compared with those from the SNS group (5.2%, 6/116; P=.03). No differences were found between recruitment methods in the responses of young Japanese women to a Web-based sexual and reproductive health survey. ©Yoko Motoki, Etsuko Miyagi, Masataka Taguri, Mikiko Asai-Sato, Takayuki Enomoto, John Dennis Wark, Suzanne Marie Garland. Originally

  12. [A comparative study of blood culture conventional method vs. a modified lysis/centrifugation technique for the diagnosis of fungemias].

    Science.gov (United States)

    Santiago, Axel Rodolfo; Hernández, Betsy; Rodríguez, Marina; Romero, Hilda

    2004-12-01

    The purpose of this work was to compare the efficacy of blood culture conventional method vs. a modified lysis/centrifugation technique. Out of 450 blood specimens received in one year, 100 where chosen for this comparative study: 60 from patients with AIDS, 15 from leukemic patients, ten from febrile neutropenic patients, five from patients with respiratory infections, five from diabetics and five from septicemic patients. The specimens were processed, simultaneously, according to the above mentioned methodologies with daily inspections searching for fungal growth in order to obtain the final identification of the causative agent. The number (40) of isolates recovered was the same using both methods, which included; 18 Candida albicans (45%), ten Candida spp. (25%), ten Histoplasma capsulatum (25%), and two Cryptococcus neoformans (5%). When the fungal growth time was compared by both methods, growth was more rapid when using the modified lysis/centrifugation technique than when using the conventional method. Statistical analysis revealed a significant difference (pcentrifugation technique showed to be more efficacious than the conventional one, and therefore the implementation of this methodology is highly recommended for the isolation of fungi from blood.

  13. COMPARATIVE EVALUATION OF CONVENTIONAL VERSUS RAPID METHODS FOR AMPLIFIABLE GENOMIC DNA ISOLATION OF CULTURED Azospirillum sp. JG3

    Directory of Open Access Journals (Sweden)

    Stalis Norma Ethica

    2013-12-01

    Full Text Available As an initial attempt to reveal genetic information of Azospirillum sp. JG3 strain, which is still absence despite of the strains' ability in producing valued enzymes, two groups of conventional methods: lysis-enzyme and column-kit; and two rapid methods: thermal disruption and intact colony were evaluated. The aim is to determine the most practical method for obtaining high-grade PCR product using degenerate primers as part of routine-basis protocols for studying the molecular genetics of the Azospirillal bacteria. The evaluation includes the assessment of electrophoresis gel visualization, pellet appearance, preparation time, and PCR result of extracted genomic DNA from each method. Our results confirmed that the conventional methods were more superior to the rapid methods in generating genomic DNA isolates visible on electrophoresis gel. However, modification made in the previously developed DNA isolation protocol giving the simplest and most rapid method of all methods used in this study for extracting PCR-amplifiable DNA of Azospirillum sp. JG3. Intact bacterial cells (intact colony loaded on electrophoresis gel could present genomic DNA band, but could not be completely amplified by PCR without thermal treatment. It can also be inferred from our result that the 3 to 5-min heating in dH2O step is critical for the pre-treatment of colony PCR of Azospirillal cells.

  14. MAXILLARY INCISORS CHANGES DURING SPACE CLOSURE WITH CONVENTIONAL AND SKELETAL ANCHORAGE METHODS: A SYSTEMATIC REVIEW

    Directory of Open Access Journals (Sweden)

    Yasas Shri Nalaka JAYARATNE

    2017-12-01

    Full Text Available Purpose: The objective of this systematic review was to compare the antero-posterior, vertical and angular changes of maxillary incisors with conventional anchorage control techniques and mini-implant based space closure methods. Materials and Methods: The electronic databases Pubmed, Scopus, ISI Web of knowledge, Cochrane Library and Open Grey were searched for potentially eligible studies using a set of predetermined keywords. Full texts meeting the inclusion criteria as well as their references were manually searched. The primary outcome data (linear, angular, and vertical maxillary incisor changes and secondary outcome data (overbite changes, soft tissue changes, biomechanical factors, root resorption and treatment duration were extracted from the selected articles and entered into spreadsheets based on the type of anchorage used. The methodological quality of each study was assessed. Results: Six studies met the inclusion criteria. The amount of incisor retraction was greater with buccally placed mini-implants than conventional anchorage techniques. The incisor retraction with indirect anchorage from palatal mini-implants was less when compared with buccally placed mini-implants. Incisor intrusion occurred with buccal mini-implants, whereas extrusion was seen with conventional anchorage. Limited data on the biomechanical variables or adverse effects such as root resorption were reported in these studies. Conclusion: More RCT’s that take in to account relevant biomechanical variables and employ three-dimensional quantification of tooth movements are required to provide information on incisor changes during space closure.

  15. Ergonomic evaluation of conventional and improved methods of aonla pricking with women workers.

    Science.gov (United States)

    Rai, Arpana; Gandhi, Sudesh; Sharma, D K

    2012-01-01

    Conventional and improved methods of aonla pricking were evaluated ergonomically on an experiment conducted for 20 minute with women workers. The working heart rate, energy expenditure rate, total cardiac cost of work and physiological cost of work with conventional tools varied from 93-102 beats.min-1, 6-7.5 kJ.min-1, 285-470 beats, 14 -23 beats.min-1 while with machine varied from 96-105 beats.min-1, 6.5-8 kJ.min-1 , 336-540 beats, 16-27 beats.min-1 respectively. OWAS score for conventional method was 2 indicating corrective measures in near future while with machine was 1 indicating no corrective measures. Result of Nordic Musculoskeletal Questionnaire revealed that subjects complaint of pain in back, neck, right shoulder and right hand due to unnatural body posture and repetitive movement with hand tool. Moreover pricking was carried out in improper lighting conditions (200-300 lux) resulting into finger injuries from sharp edges of hand tool, whereas with machine no such problems were observed. Output with machine increased thrice than hand pricking in a given time. Machine was found useful in terms of saving time, increased productivity, enhanced safety and comfort as involved improved posture, was easy to handle and operate, thus increasing efficiency of the worker leading to better quality of life.

  16. Development of Extended Ray-tracing method including diffraction, polarization and wave decay effects

    Science.gov (United States)

    Yanagihara, Kota; Kubo, Shin; Dodin, Ilya; Nakamura, Hiroaki; Tsujimura, Toru

    2017-10-01

    Geometrical Optics Ray-tracing is a reasonable numerical analytic approach for describing the Electron Cyclotron resonance Wave (ECW) in slowly varying spatially inhomogeneous plasma. It is well known that the result with this conventional method is adequate in most cases. However, in the case of Helical fusion plasma which has complicated magnetic structure, strong magnetic shear with a large scale length of density can cause a mode coupling of waves outside the last closed flux surface, and complicated absorption structure requires a strong focused wave for ECH. Since conventional Ray Equations to describe ECW do not have any terms to describe the diffraction, polarization and wave decay effects, we can not describe accurately a mode coupling of waves, strong focus waves, behavior of waves in inhomogeneous absorption region and so on. For fundamental solution of these problems, we consider the extension of the Ray-tracing method. Specific process is planned as follows. First, calculate the reference ray by conventional method, and define the local ray-base coordinate system along the reference ray. Then, calculate the evolution of the distributions of amplitude and phase on ray-base coordinate step by step. The progress of our extended method will be presented.

  17. Ayurvedic versus conventional dietary and lifestyle counseling for mothers with burnout-syndrome: A randomized controlled pilot study including a qualitative evaluation.

    Science.gov (United States)

    Kessler, Christian S; Eisenmann, Clemens; Oberzaucher, Frank; Forster, Martin; Steckhan, Nico; Meier, Larissa; Stapelfeldt, Elmar; Michalsen, Andreas; Jeitler, Michael

    2017-10-01

    Ayurveda claims to be effective in the treatment of psychosomatic disorders by means of lifestyle and nutritional counseling. In a randomized controlled study mothers with burnout were randomized into two groups: Ayurvedic nutritional counseling (according to tradition), and conventional nutritional counseling (following the recommendations of a family doctor). Patients received five counseling sessions over twelve weeks. Outcomes included levels of burnout, quality of life, sleep, stress, depression/anxiety, and spirituality at three and six months. It also included a qualitative evaluation of the communication processes. We randomized thirty four patients; twenty three participants were included in the per protocol analysis. No significant differences were observed between the groups. However, significant and clinically relevant intra-group mean changes for the primary outcome burnout, and secondary outcomes sleep, stress, depression and mental health were only found in the Ayurveda group. The qualitative part of the study identified different conversational styles and counseling techniques between the two study groups. In conventional consultations questions tended to be category bound, while counseling-advice was predominantly admonitory. The Ayurvedic practitioner used open-ended interrogative forms, devices for displaying understanding, and positive re-evaluation more frequently, leading to an overall less asymmetrical interaction. We found positive effects for both groups, which however were more pronounced in the Ayurvedic group. The conversational and counseling techniques in the Ayurvedic group offered more opportunities for problem description by patients as well as patient-centered practice and resource-oriented recommendations by the physician. NCT01797887. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Comparison of Tooth Color Change After Bleaching With Conventional and Different Light-Activated Methods.

    Science.gov (United States)

    Shahabi, Sima; Assadian, Hadi; Mahmoudi Nahavandi, Alireza; Nokhbatolfoghahaei, Hanieh

    2018-01-01

    Introduction: The demand for esthetic dental treatments is increasing in recent years mainly due to improved oral hygiene and better maintenance of oral health and teeth in older individuals. Bleaching of discolored anterior teeth is the most popular among esthetic dental treatments. Even individuals with sound teeth and adequate esthetics seek to have whiter teeth in the anterior region. The aim of this study was to evaluate tooth color changes following conventional in-office bleaching techniques compared to light-activated methods using different light sources. Methods: Seventy sound anterior teeth (devoided of caries and/or fracture), extracted for periodontal and orthodontic reasons were selected and allocated to 7 groups: (A) control, (B) conventional bleaching (C) LED-activated bleaching, (D) KTP laser-activated bleaching, (E) diode laser-activated bleaching, (F) Nd:YAG laser-activated bleaching and (G) CO2 laser-activated bleaching. Colorimetric evaluation was carried out before and after treatment using a spectrophotoradiometer. Data were analyzed by one- and two-way analysis of variance (ANOVA) as well as multiple comparison methods. Results: The results showed that all bleaching procedures were effective in reducing the yellowness index. However, the KTP laser-activated bleaching was significantly more effective than the other techniques in 95% confidence level. It was also seen that CO2 laser activated method has outperformed groups E, F and G and the conventional bleaching without light activation was not effective at all and represented similar results with the control group. Furthermore, the groups E and G had almost the same results in decreasing the yellowness index. Conclusion: The results showed that all bleaching techniques were effective however, the KTP laser-activated bleaching was significantly more efficient, closely followed by the CO2 laser-activated bleaching technique.

  19. In vivo precision of conventional and digital methods of obtaining complete-arch dental impressions

    OpenAIRE

    Ender, Andreas; Attin, Thomas; Mehl, Albert

    2016-01-01

    STATEMENT OF PROBLEM: Digital impression systems have undergone significant development in recent years, but few studies have investigated the accuracy of the technique in vivo, particularly compared with conventional impression techniques. PURPOSE: The purpose of this in vivo study was to investigate the precision of conventional and digital methods for complete-arch impressions. MATERIAL AND METHODS: Complete-arch impressions were obtained using 5 conventional (polyether, POE; vinylsilox...

  20. Reinforcing the role of the conventional C-arm--a novel method for simplified distal interlocking.

    Science.gov (United States)

    Windolf, Markus; Schroeder, Josh; Fliri, Ladina; Dicht, Benno; Liebergall, Meir; Richards, R Geoff

    2012-01-25

    shot to screw tightened) was on average 22% reduced by guided freehand (p = 0.018). In an experimental setting, the newly developed guided freehand technique for distal interlocking has proven to markedly reduce radiation exposure when compared to the conventional freehand technique. The method utilizes established clinical workflows and does not require cost intensive add-on devices or extensive training. The underlying principle carries potential to assist implant positioning in numerous other applications within orthopedics and trauma from screw insertions to placement of plates, nails or prostheses.

  1. Maxillary incisors changes during space closure with conventional and skeletal anchorage methods: a systematic review.

    Science.gov (United States)

    Jayaratne, Yasas Shri Nalaka; Uribe, Flavio; Janakiraman, Nandakumar

    2017-01-01

    The objective of this systematic review was to compare the antero-posterior, vertical and angular changes of maxillary incisors with conventional anchorage control techniques and mini-implant based space closure methods. The electronic databases Pubmed, Scopus, ISI Web of knowledge, Cochrane Library and Open Grey were searched for potentially eligible studies using a set of predetermined keywords. Full texts meeting the inclusion criteria as well as their references were manually searched. The primary outcome data (linear, angular, and vertical maxillary incisor changes) and secondary outcome data (overbite changes, soft tissue changes, biomechanical factors, root resorption and treatment duration) were extracted from the selected articles and entered into spreadsheets based on the type of anchorage used. The methodological quality of each study was assessed. Six studies met the inclusion criteria. The amount of incisor retraction was greater with buccally placed mini-implants than conventional anchorage techniques. The incisor retraction with indirect anchorage from palatal mini-implants was less when compared with buccally placed mini-implants. Incisor intrusion occurred with buccal mini-implants, whereas extrusion was seen with conventional anchorage. Limited data on the biomechanical variables or adverse effects such as root resorption were reported in these studies. More RCT's that take in to account relevant biomechanical variables and employ three-dimensional quantification of tooth movements are required to provide information on incisor changes during space closure.

  2. Reinforcing the role of the conventional C-arm - a novel method for simplified distal interlocking

    Directory of Open Access Journals (Sweden)

    Windolf Markus

    2012-01-01

    Full Text Available Abstract Background The common practice for insertion of distal locking screws of intramedullary nails is a freehand technique under fluoroscopic control. The process is technically demanding, time-consuming and afflicted to considerable radiation exposure of the patient and the surgical personnel. A new concept is introduced utilizing information from within conventional radiographic images to help accurately guide the surgeon to place the interlocking bolt into the interlocking hole. The newly developed technique was compared to conventional freehand in an operating room (OR like setting on human cadaveric lower legs in terms of operating time and radiation exposure. Methods The proposed concept (guided freehand, generally based on the freehand gold standard, additionally guides the surgeon by means of visible landmarks projected into the C-arm image. A computer program plans the correct drilling trajectory by processing the lens-shaped hole projections of the interlocking holes from a single image. Holes can be drilled by visually aligning the drill to the planned trajectory. Besides a conventional C-arm, no additional tracking or navigation equipment is required. Ten fresh frozen human below-knee specimens were instrumented with an Expert Tibial Nail (Synthes GmbH, Switzerland. The implants were distally locked by performing the newly proposed technique as well as the conventional freehand technique on each specimen. An orthopedic resident surgeon inserted four distal screws per procedure. Operating time, number of images and radiation time were recorded and statistically compared between interlocking techniques using non-parametric tests. Results A 58% reduction in number of taken images per screw was found for the guided freehand technique (7.4 ± 3.4 (mean ± SD compared to the freehand technique (17.6 ± 10.3 (p p = 0.001. Operating time per screw (from first shot to screw tightened was on average 22% reduced by guided freehand (p = 0

  3. A comparison of methods for demonstrating artificial bone lesions; conventional versus computer tomography

    International Nuclear Information System (INIS)

    Heller, M.; Wenk, M.; Jend, H.H.

    1984-01-01

    Conventional tomography (T) and computer tomography (CT) were used for examining 97 artificial bone lesions at various sites. The purpose of the study was to determine how far CT can replace T in the diagnosis of skeletal abnormalities. The results have shown that modern CT, particularly in its high resolution form, equals T and provides additional information (substrate of a lesion, its relationship to neighbouring tissues, simultaneous demonstration of soft tissue etc.). These cannot be shown successfully by T. It follows that CT is indicated as the primary method of examination for lesions of the facial skeleton, skull base, spine, pelvis and, to some extent, extremities. (orig.) [de

  4. Radiation exposure in X-ray angiography and comparisons between digital and conventional methods of imaging

    International Nuclear Information System (INIS)

    Schaberg, J.

    1987-01-01

    The more recent developments and techniques in the field of angiography are examined for associated radiation exposure risks for patients and investigators and then compared to the conventional methods of angiography. It could be shown that digital subtraction angiography is generally associated with a lesser risk of somatic exposure of the patient, provided that the equipment used offers an adjustable useful-beam range and focus. The fact that above-table X-ray tubes are now generally replaced with X-ray systems installed under the examination table permits the relatively high doses, to which investigators are exposed during angiography, to be reduced by a factor of 3. (DG) [de

  5. Composite materials and bodies including silicon carbide and titanium diboride and methods of forming same

    Science.gov (United States)

    Lillo, Thomas M.; Chu, Henry S.; Harrison, William M.; Bailey, Derek

    2013-01-22

    Methods of forming composite materials include coating particles of titanium dioxide with a substance including boron (e.g., boron carbide) and a substance including carbon, and reacting the titanium dioxide with the substance including boron and the substance including carbon to form titanium diboride. The methods may be used to form ceramic composite bodies and materials, such as, for example, a ceramic composite body or material including silicon carbide and titanium diboride. Such bodies and materials may be used as armor bodies and armor materials. Such methods may include forming a green body and sintering the green body to a desirable final density. Green bodies formed in accordance with such methods may include particles comprising titanium dioxide and a coating at least partially covering exterior surfaces thereof, the coating comprising a substance including boron (e.g., boron carbide) and a substance including carbon.

  6. Development of a quantitative safety assessment method for nuclear I and C systems including human operators

    International Nuclear Information System (INIS)

    Kim, Man Cheol

    2004-02-01

    Conventional PSA (probabilistic safety analysis) is performed in the framework of event tree analysis and fault tree analysis. In conventional PSA, I and C systems and human operators are assumed to be independent for simplicity. But, the dependency of human operators on I and C systems and the dependency of I and C systems on human operators are gradually recognized to be significant. I believe that it is time to consider the interdependency between I and C systems and human operators in the framework of PSA. But, unfortunately it seems that we do not have appropriate methods for incorporating the interdependency between I and C systems and human operators in the framework of Pasa. Conventional human reliability analysis (HRA) methods are not developed to consider the interdependecy, and the modeling of the interdependency using conventional event tree analysis and fault tree analysis seem to be, event though is does not seem to be impossible, quite complex. To incorporate the interdependency between I and C systems and human operators, we need a new method for HRA and a new method for modeling the I and C systems, man-machine interface (MMI), and human operators for quantitative safety assessment. As a new method for modeling the I and C systems, MMI and human operators, I develop a new system reliability analysis method, reliability graph with general gates (RGGG), which can substitute conventional fault tree analysis. RGGG is an intuitive and easy-to-use method for system reliability analysis, while as powerful as conventional fault tree analysis. To demonstrate the usefulness of the RGGG method, it is applied to the reliability analysis of Digital Plant Protection System (DPPS), which is the actual plant protection system of Ulchin 5 and 6 nuclear power plants located in Republic of Korea. The latest version of the fault tree for DPPS, which is developed by the Integrated Safety Assessment team in Korea Atomic Energy Research Institute (KAERI), consists of 64

  7. Exposure to radiation through the residual activity of waste treated by conventional methods

    International Nuclear Information System (INIS)

    Deckert, A.; Hoppe, G.; John, T.; Thierfeldt, S.

    1993-01-01

    Data obtained by questionnaires provided information on the type, amount, nuclide vector and maximum permissible value of low-level radioactive residues that occur in nuclear installations of due to industrial, scientific and medical uses of radioactive materials and are officially released to be disposed of by conventional methods. The general legal background of waste disposal methods, in particular the official regulations surrounding the waste disposal law, were described. On this basis, parameters and maximum radioactive burdens were specifically defined for garbage dumps for refuse from private households and those for building rubbish. Investigations were carried out into exposure paths that may have a role in the radioactive doses taken up by personnel (inhalation) or the general population (ingestion) through contaminated water. The radiation dose attributable to those exposure paths were expressed in relation to a specific unit activity of waste (1 bq/G). A dose of 10 μ Sv/r was taken as a standard to define a threshold value for each individual nuclide released for conventional waste disposal. It appears reasonable that such values are determined for groups of nuclides. (HP) [de

  8. Extraction and comparison of proteins from natural rubber latex by conventional and ionizing radiation methods

    International Nuclear Information System (INIS)

    Rogero, Sizue O.; Spencer, Patrick J.; Campos, Vania E.; Lusvarghi, Fabio M.; Higa, Olga Z.

    1997-01-01

    Several proteins in natural rubber latex (NRL) have been assigned to be significant allergens. It is known that proteins submitted to ionizing radiation suffer denaturation and immunochemical modification resulting in low antigenic reactivity. The aim of this study was to extract and compare water extractable proteins from NRL films vulcanized by conventional and by ionizing radiation methods. SDS-polyacrylamide gel electrophoresis (SDS--PAGE) and high pressure liquid chromatography (HPLC) showed a diffuse protein band of about 14 KDa, which we believe is rubber elongation factor (REF), in both eluates, but smaller in latex film vulcanized by ionizing radiation. REF has been suggested to be a major latex allergen. These data suggest that ionizing radiation vulcanization could be an useful method for the production of NRL goods with low antigenicity. (author). 8 refs., 2 figs., 1 tab

  9. Intestinal preparation for colon enema with fosfo-soda fleet versus the conventional method

    International Nuclear Information System (INIS)

    Vecchioli Caldazza, A.; Celi, G.; De Franco, A.; Parrella, A.; Minordi, L.M.; Marano, P.

    1999-01-01

    The authors evaluate the possible optimization of a well-tolerated and versatile method of intestinal preparation able to adequately free the lumen and consequently improve diagnostic results with a lower risk of prolonged hospital stay for incorrectly prepared patients. They examined 40 patients, namely 20 men and 20 women referred to the Institute of radiology of the 'Sacro Cuore' Catholic University of Rome (Italy), Gastrointestinal tract unit, to undergo double contrast colonic enema. The statistical analysis of all data was performed with Wilcoxon test. Intestinal preparation with fosfo-soda fleet appeared to be definitely better than the conventional method relative to tolerance, while providing similarly satisfactory data relative to the other parameters [it

  10. Sectional localization of a small hepatocellular carcinoma in the right hepatic lobe by computed tomography: Comparison between the conventional and portal vein tracing methods

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Chun-Gao [Seoul National University Hospital, Department of Radiology, Jongro-gu, Seoul (Korea, Republic of); The First Affiliated Hospital of Nanjing Medical University, Department of Interventional Radiology, Nanjing (China); Chung, Jin Wook; Hur, Saebeom; Lee, Myungsu; Kim, Hyo-Cheol; Jae, Hwan Jun; Yin, Yong-Hu; Kim, Young Il [Seoul National University Hospital, Department of Radiology, Jongro-gu, Seoul (Korea, Republic of); Ahn, Sang-bu [Dongnam Institution of Radiological and Medical Sciences, Department of Radiology, Busan (Korea, Republic of); Cho, Baik Hwan [Chonbuk National University Hospital, Department of Radiology, Jeonju (Korea, Republic of)

    2016-12-15

    To compare the accuracy of the conventional and portal vein tracing methods in the right hepatic lobe in multidetector computed tomography (MDCT). This retrospective study included patients with hepatocellular carcinoma (HCC) lesions in the right hepatic lobe who underwent multiphasic MDCT and C-arm CT hepatic arteriography (C-arm CTHA) for chemoembolization. The accuracies of the conventional and portal vein tracing methods were evaluated using C-arm CTHA as the gold standard. A total of 147 patients with 205 HCC nodules were included. The C-arm CTHA could identify all the tumour-feeding arteries and consequently demonstrated that 120 lesions were located in the anterior section, 78 in the posterior section, and 7 in the border zone. The accuracy rates of conventional vs. portal vein tracing methods were 71.7 % vs. 98.3 % for the anterior section lesions, 67.9 % vs. 96.2 % for the posterior section, and 28.6 % vs. 57.1 % for the border zone. The portal vein tracing method was more accurate than the conventional method (P<0.001). The portal vein tracing method should be used for sectional localization of HCCs in the right lobe, because it predicts the location more accurately than the conventional method. (orig.)

  11. Recent advances in conventional and contemporary methods for remediation of heavy metal-contaminated soils.

    Science.gov (United States)

    Sharma, Swati; Tiwari, Sakshi; Hasan, Abshar; Saxena, Varun; Pandey, Lalit M

    2018-04-01

    Remediation of heavy metal-contaminated soils has been drawing our attention toward it for quite some time now and a need for developing new methods toward reclamation has come up as the need of the hour. Conventional methods of heavy metal-contaminated soil remediation have been in use for decades and have shown great results, but they have their own setbacks. The chemical and physical techniques when used singularly generally generate by-products (toxic sludge or pollutants) and are not cost-effective, while the biological process is very slow and time-consuming. Hence to overcome them, an amalgamation of two or more techniques is being used. In view of the facts, new methods of biosorption, nanoremediation as well as microbial fuel cell techniques have been developed, which utilize the metabolic activities of microorganisms for bioremediation purpose. These are cost-effective and efficient methods of remediation, which are now becoming an integral part of all environmental and bioresource technology. In this contribution, we have highlighted various augmentations in physical, chemical, and biological methods for the remediation of heavy metal-contaminated soils, weighing up their pros and cons. Further, we have discussed the amalgamation of the above techniques such as physiochemical and physiobiological methods with recent literature for the removal of heavy metals from the contaminated soils. These combinations have showed synergetic effects with a many fold increase in removal efficiency of heavy metals along with economic feasibility.

  12. Solar cells, structures including organometallic halide perovskite monocrystalline films, and methods of preparation thereof

    KAUST Repository

    Bakr, Osman; Peng, Wei; Wang, Lingfei

    2017-01-01

    Embodiments of the present disclosure provide for solar cells including an organometallic halide perovskite monocrystalline film (see fig. 1.1B), other devices including the organometallic halide perovskite monocrystalline film, methods of making

  13. A proposal on evaluation method of neutron absorption performance to substitute conventional neutron attenuation test

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Je Hyun; Shim, Chang Ho [Dept. of Nuclear Engineering, Hanyang University, Seoul (Korea, Republic of); Kim, Sung Hyun [Nuclear Fuel Cycle Waste Treatment Research Division, Research Reactor Institute, Kyoto University, Osaka (Japan); Choe, Jung Hun; Cho, In Hak; Park, Hwan Seo [Ionizing Radiation Center, Nuclear Fuel Cycle Waste Treatment Research Division, Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Park, Hyun Seo; Kim, Jung Ho; Kim, Yoon Ho [Ionizing Radiation Center, Korea Research Institute of Standards and Science, Daejeon (Korea, Republic of)

    2016-12-15

    For a verification of newly-developed neutron absorbers, one of guidelines on the qualification and acceptance of neutron absorbers is the neutron attenuation test. However, this approach can cause a problem for the qualifications that it cannot distinguish how the neutron attenuates from materials. In this study, an estimation method of neutron absorption performances for materials is proposed to detect both direct penetration and back-scattering neutrons. For the verification of the proposed method, MCNP simulations with the experimental system designed in this study were pursued using the polyethylene, iron, normal glass and the vitrified form. The results show that it can easily test neutron absorption ability using single absorber model. Also, from simulation results of single absorber and double absorbers model, it is verified that the proposed method can evaluate not only the direct thermal neutrons passing through materials, but also the scattered neutrons reflected to the materials. Therefore, the neutron absorption performances can be accurately estimated using the proposed method comparing with the conventional neutron attenuation test. It is expected that the proposed method can contribute to increase the reliability of the performance of neutron absorbers.

  14. A proposal on evaluation method of neutron absorption performance to substitute conventional neutron attenuation test

    International Nuclear Information System (INIS)

    Kim, Je Hyun; Shim, Chang Ho; Kim, Sung Hyun; Choe, Jung Hun; Cho, In Hak; Park, Hwan Seo; Park, Hyun Seo; Kim, Jung Ho; Kim, Yoon Ho

    2016-01-01

    For a verification of newly-developed neutron absorbers, one of guidelines on the qualification and acceptance of neutron absorbers is the neutron attenuation test. However, this approach can cause a problem for the qualifications that it cannot distinguish how the neutron attenuates from materials. In this study, an estimation method of neutron absorption performances for materials is proposed to detect both direct penetration and back-scattering neutrons. For the verification of the proposed method, MCNP simulations with the experimental system designed in this study were pursued using the polyethylene, iron, normal glass and the vitrified form. The results show that it can easily test neutron absorption ability using single absorber model. Also, from simulation results of single absorber and double absorbers model, it is verified that the proposed method can evaluate not only the direct thermal neutrons passing through materials, but also the scattered neutrons reflected to the materials. Therefore, the neutron absorption performances can be accurately estimated using the proposed method comparing with the conventional neutron attenuation test. It is expected that the proposed method can contribute to increase the reliability of the performance of neutron absorbers

  15. Measuring serotonin synthesis: from conventional methods to PET tracers and their (pre)clinical implications

    Energy Technology Data Exchange (ETDEWEB)

    Visser, Anniek K.D.; Waarde, Aren van; Willemsen, Antoon T.M. [University of Groningen, University Medical Center Groningen, Department of Nuclear Medicine and Molecular Imaging, Groningen (Netherlands); Bosker, Fokko J. [University of Groningen, University Medical Center Groningen, University Center of Psychiatry, Groningen (Netherlands); Luiten, Paul G.M. [University of Groningen, Center for Behavior and Neurosciences, Department of Molecular Neurobiology, Haren (Netherlands); Boer, Johan A. den [University of Groningen, University Medical Center Groningen, Department of Nuclear Medicine and Molecular Imaging, Groningen (Netherlands); University of Groningen, University Medical Center Groningen, University Center of Psychiatry, Groningen (Netherlands); Kema, Ido P. [University of Groningen, University Medical Center Groningen, Department of Laboratory Medicine, Groningen (Netherlands); Dierckx, Rudi A.J.O. [University of Groningen, University Medical Center Groningen, Department of Nuclear Medicine and Molecular Imaging, Groningen (Netherlands); University Hospital Ghent, Department of Nuclear Medicine, Ghent (Belgium)

    2011-03-15

    The serotonergic system of the brain is complex, with an extensive innervation pattern covering all brain regions and endowed with at least 15 different receptors (each with their particular distribution patterns), specific reuptake mechanisms and synthetic processes. Many aspects of the functioning of the serotonergic system are still unclear, partially because of the difficulty of measuring physiological processes in the living brain. In this review we give an overview of the conventional methods of measuring serotonin synthesis and methods using positron emission tomography (PET) tracers, more specifically with respect to serotonergic function in affective disorders. Conventional methods are invasive and do not directly measure synthesis rates. Although they may give insight into turnover rates, a more direct measurement may be preferred. PET is a noninvasive technique which can trace metabolic processes, like serotonin synthesis. Tracers developed for this purpose are {alpha}-[{sup 11}C]methyltryptophan ([{sup 11}C]AMT) and 5-hydroxy-L-[{beta}-{sup 11}C]tryptophan ([{sup 11}C]5-HTP). Both tracers have advantages and disadvantages. [{sup 11}C]AMT can enter the kynurenine pathway under inflammatory conditions (and thus provide a false signal), but this tracer has been used in many studies leading to novel insights regarding antidepressant action. [{sup 11}C]5-HTP is difficult to produce, but trapping of this compound may better represent serotonin synthesis. AMT and 5-HTP kinetics are differently affected by tryptophan depletion and changes of mood. This may indicate that both tracers are associated with different enzymatic processes. In conclusion, PET with radiolabelled substrates for the serotonergic pathway is the only direct way to detect changes of serotonin synthesis in the living brain. (orig.)

  16. In vivo precision of conventional and digital methods for obtaining quadrant dental impressions.

    Science.gov (United States)

    Ender, Andreas; Zimmermann, Moritz; Attin, Thomas; Mehl, Albert

    2016-09-01

    Quadrant impressions are commonly used as alternative to full-arch impressions. Digital impression systems provide the ability to take these impressions very quickly; however, few studies have investigated the accuracy of the technique in vivo. The aim of this study is to assess the precision of digital quadrant impressions in vivo in comparison to conventional impression techniques. Impressions were obtained via two conventional (metal full-arch tray, CI, and triple tray, T-Tray) and seven digital impression systems (Lava True Definition Scanner, T-Def; Lava Chairside Oral Scanner, COS; Cadent iTero, ITE; 3Shape Trios, TRI; 3Shape Trios Color, TRC; CEREC Bluecam, Software 4.0, BC4.0; CEREC Bluecam, Software 4.2, BC4.2; and CEREC Omnicam, OC). Impressions were taken three times for each of five subjects (n = 15). The impressions were then superimposed within the test groups. Differences from model surfaces were measured using a normal surface distance method. Precision was calculated using the Perc90_10 value. The values for all test groups were statistically compared. The precision ranged from 18.8 (CI) to 58.5 μm (T-Tray), with the highest precision in the CI, T-Def, BC4.0, TRC, and TRI groups. The deviation pattern varied distinctly depending on the impression method. Impression systems with single-shot capture exhibited greater deviations at the tooth surface whereas high-frame rate impression systems differed more in gingival areas. Triple tray impressions displayed higher local deviation at the occlusal contact areas of upper and lower jaw. Digital quadrant impression methods achieve a level of precision, comparable to conventional impression techniques. However, there are significant differences in terms of absolute values and deviation pattern. With all tested digital impression systems, time efficient capturing of quadrant impressions is possible. The clinical precision of digital quadrant impression models is sufficient to cover a broad variety of

  17. Assessment of the hardness of different orthodontic wires and brackets produced by metal injection molding and conventional methods.

    Science.gov (United States)

    Alavi, Shiva; Kachuie, Marzie

    2017-01-01

    This study was conducted to assess the hardness of orthodontic brackets produced by metal injection molding (MIM) and conventional methods and different orthodontic wires (stainless steel, nickel-titanium [Ni-Ti], and beta-titanium alloys) for better clinical results. A total of 15 specimens from each brand of orthodontic brackets and wires were examined. The brackets (Elite Opti-Mim which is produced by MIM process and Ultratrimm which is produced by conventional brazing method) and the wires (stainless steel, Ni-Ti, and beta-titanium) were embedded in epoxy resin, followed by grinding, polishing, and coating. Then, X-ray energy dispersive spectroscopy (EDS) microanalysis was applied to assess their elemental composition. The same specimen surfaces were repolished and used for Vickers microhardness assessment. Hardness was statistically analyzed with Kruskal-Wallis test, followed by Mann-Whitney test at the 0.05 level of significance. The X-ray EDS analysis revealed different ferrous or co-based alloys in each bracket. The maximum mean hardness values of the wires were achieved for stainless steel (SS) (529.85 Vickers hardness [VHN]) versus the minimum values for beta-titanium (334.65 VHN). Among the brackets, Elite Opti-Mim exhibited significantly higher VHN values (262.66 VHN) compared to Ultratrimm (206.59 VHN). VHN values of wire alloys were significantly higher than those of the brackets. MIM orthodontic brackets exhibited hardness values much lower than those of SS orthodontic archwires and were more compatible with NiTi and beta-titanium archwires. A wide range of microhardness values has been reported for conventional orthodontic brackets and it should be considered that the manufacturing method might be only one of the factors affecting the mechanical properties of orthodontic brackets including hardness.

  18. Increased recovery of touch DNA evidence using FTA paper compared to conventional collection methods.

    Science.gov (United States)

    Kirgiz, Irina A; Calloway, Cassandra

    2017-04-01

    Tape lifting and FTA paper scraping methods were directly compared to traditional double swabbing for collecting touch DNA from car steering wheels (n = 70 cars). Touch DNA was collected from the left or right side of each steering wheel (randomized) using two sterile cotton swabs, while the other side was sampled using water-soluble tape or FTA paper cards. DNA was extracted and quantified in duplicate using qPCR. Quantifiable amounts of DNA were detected for 100% of the samples (n = 140) collected independent of the method. However, the DNA collection yield was dependent on the collection method. A statistically significant difference in DNA yield was observed between FTA scraping and double swabbing methods (p = 0.0051), with FTA paper collecting a two-fold higher amount. Statistical analysis showed no significant difference in DNA yields between the double swabbing and tape lifting techniques (p = 0.21). Based on the DNA concentration required for 1 ng input, 47% of the samples collected using FTA paper would be expected to yield a short tandem repeat (STR) profile compared to 30% and 23% using double swabbing or tape, respectively. Further, 55% and 77% of the samples collected using double swabbing or tape, respectively, did not yield a high enough DNA concentration for the 0.5 ng of DNA input recommended for conventional STR kits and would be expected to result in a partial or no profile compared to 35% of the samples collected using FTA paper. STR analysis was conducted for a subset of the higher concentrated samples to confirm that the DNA collected from the steering wheel was from the driver. 32 samples were selected with DNA amounts of at least 1 ng total DNA (100 pg/μl when concentrated if required). A mixed STR profile was observed for 26 samples (88%) and the last driver was the major DNA contributor for 29 samples (94%). For one sample, the last driver was the minor DNA contributor. A full STR profile of the last driver was observed for

  19. Conventional and improved cytotoxicity test methods of newly developed biodegradable magnesium alloys

    Science.gov (United States)

    Han, Hyung-Seop; Kim, Hee-Kyoung; Kim, Yu-Chan; Seok, Hyun-Kwang; Kim, Young-Yul

    2015-11-01

    Unique biodegradable property of magnesium has spawned countless studies to develop ideal biodegradable orthopedic implant materials in the last decade. However, due to the rapid pH change and extensive amount of hydrogen gas generated during biocorrosion, it is extremely difficult to determine the accurate cytotoxicity of newly developed magnesium alloys using the existing methods. Herein, we report a new method to accurately determine the cytotoxicity of magnesium alloys with varying corrosion rate while taking in-vivo condition into the consideration. For conventional method, extract quantities of each metal ion were determined using ICP-MS and the result showed that the cytotoxicity due to pH change caused by corrosion affected the cell viability rather than the intrinsic cytotoxicity of magnesium alloy. In physiological environment, pH is regulated and adjusted within normal pH (˜7.4) range by homeostasis. Two new methods using pH buffered extracts were proposed and performed to show that environmental buffering effect of pH, dilution of the extract, and the regulation of eluate surface area must be taken into consideration for accurate cytotoxicity measurement of biodegradable magnesium alloys.

  20. Synthesis of novel chalcone derivatives by conventional and microwave irradiation methods and their pharmacological activities

    Directory of Open Access Journals (Sweden)

    Mohammed Rayees Ahmad

    2016-09-01

    Full Text Available Chalcones are abundant in edible plants and are considered to be the precursors of flavonoids and isoflavonoids. Chalcones belong to an important class of flavonoids, which may be prepared by Claisen–Schmidt condensation. They possess a wide range of biological activities and industrial applications. The cytotoxicity against tumour cell lines may be the result of disruption of the cell cycle, inhibition of angiogenesis, interference with p53-MDM2 interaction, mitochondrial uncoupling or induction of apoptosis. Chalcones are synthesized by conventional and microwave assisted synthesis methods. By microwave assisted synthesis, a considerable increase in the reaction rate has been observed and that too, with better yields. The compounds have been screened for cytotoxic activity and antioxidant activity.

  1. Evaluation of head and neck cancer with 18F-FDG PET: a comparison with conventional methods

    International Nuclear Information System (INIS)

    Kresnik, E.; Mikosch, P.; Gallowitsch, H.J.; Heinisch, M.; Unterweger, O.; Kumnig, G.; Gomez, I.; Lind, P.; Kogler, D.; Wieser, S.; Gruenbacher, G.; Raunik, W.

    2001-01-01

    The aim of this study was to evaluate the usefulness of 18 F-FDG PET in the diagnosis and staging of primary and recurrent malignant head and neck tumours in comparison with conventional imaging methods [including ultrasonography, radiography, computed tomography (CT) and magnetic resonance imaging (MRI)], physical examination, panendoscopy and biopsies in clinical routine. A total of 54 patients (13 female, 41 male, age 61.3±12 years) were investigated retrospectively. Three groups were formed. In group I, 18 F-FDG PET was performed in 15 patients to detect unknown primary cancers. In group II, 24 studies were obtained for preoperative staging of proven head and neck cancer. In group III, 18 F-FDG PET was used in 15 patients to monitor tumour recurrence after radiotherapy and/or chemotherapy. In all patients, imaging was obtained at 70 min after the intravenous administration of 180 MBq 18 F-FDG. In 11 of the 15 patients in group I, the primary cancer could be found with 18 F-FDG, yielding a detection rate of 73.3%. In 4 of the 15 patients, CT findings were also suggestive of the primary cancer but were nonetheless equivocal. In these patients, 18 F-FDG showed increased 18 F-FDG uptake by the primary tumour, which was confirmed by histology. One patient had recurrence of breast carcinoma that could not be detected with 18 F-FDG PET, but was detected by CT. In three cases, the primary cancer could not be found with any imaging method. Among the 24 patients in group II investigated for staging purposes, 18 F-FDG PET detected a total of 13 local and three distant lymph node metastases, whereas the conventional imaging methods detected only nine local and one distant lymph node metastases. The results of 18 F-FDG PET led to an upstaging in 5/24 (20.8%) patients. The conventional imaging methods were false positive in 5/24 (20.8%). There was one false positive result using 18 F-FDG PET. Among the 15 patients of group III with suspected recurrence after radiotherapy

  2. Evaluation of osteoporosis using conventional radiographic methods and dual energy x-ray absorptiometry

    International Nuclear Information System (INIS)

    Anburajan, M.

    2001-01-01

    In India, conventional radiographs play a major part in evaluating osteoporosis since advanced bone densitometers are expensive and not widely available. Our aim in this study was to investigate the usefulness of conventional radiographic methods, viz., clavicle and metacarpal radiogrammetry, quantitative vertebral morphometry, Singh's index, hip geometry compared to a sophisticated method, viz., DXA for studying osteoporosis in south Indian men (n=663) and women (n=741). This study provides data on BMD of the proximal femur in normal south Indian females. In women, aged above 65 years, BMD of femoral neck, trochanter, and Ward's triangle decreased by 0.90%, 0.84%, and 1.66% per annum, respectively. In 45 pre- and post-menopausal women without fractures, total hip BMD correlated significantly ( p 2 =0.47), medial cortical thickness of the femoral shaft (r 2 =0.38) and neck (r 2 =0.29), combined cortical thickness (CCT) and %CCT of the clavicle (r 2 =0.54 each), and the second metacarpal (r 2 =0.51 and r 2 =0.53, respectively). On comparing variables studied for osteoporotic women with corresponding values in the premenopausal group, the average difference in SD from the mean was greatest for clavicle radiogrammetry (-3.7 SD for %CCT of the clavicle). An empirical formula for predicting total hip BMD with good sensitivity was derived from a multiple linear regression equation involving three independent variables, viz., CCT, %CCT of the clavicle (measured from the chest radiograph) and the patient's age. This author's equation, with modified weightings, has 82% sensitivity and 94% specificity and a positive and negative predictive value of 88% and 91% respectively. A chest radiograph in combination with the formula would serve as a readily available, inexpensive tool for assessing post-menopausal osteoporosis, especially in developing countries

  3. System Response Analysis and Model Order Reduction, Using Conventional Method, Bond Graph Technique and Genetic Programming

    Directory of Open Access Journals (Sweden)

    Lubna Moin

    2009-04-01

    Full Text Available This research paper basically explores and compares the different modeling and analysis techniques and than it also explores the model order reduction approach and significance. The traditional modeling and simulation techniques for dynamic systems are generally adequate for single-domain systems only, but the Bond Graph technique provides new strategies for reliable solutions of multi-domain system. They are also used for analyzing linear and non linear dynamic production system, artificial intelligence, image processing, robotics and industrial automation. This paper describes a unique technique of generating the Genetic design from the tree structured transfer function obtained from Bond Graph. This research work combines bond graphs for model representation with Genetic programming for exploring different ideas on design space tree structured transfer function result from replacing typical bond graph element with their impedance equivalent specifying impedance lows for Bond Graph multiport. This tree structured form thus obtained from Bond Graph is applied for generating the Genetic Tree. Application studies will identify key issues and importance for advancing this approach towards becoming on effective and efficient design tool for synthesizing design for Electrical system. In the first phase, the system is modeled using Bond Graph technique. Its system response and transfer function with conventional and Bond Graph method is analyzed and then a approach towards model order reduction is observed. The suggested algorithm and other known modern model order reduction techniques are applied to a 11th order high pass filter [1], with different approach. The model order reduction technique developed in this paper has least reduction errors and secondly the final model retains structural information. The system response and the stability analysis of the system transfer function taken by conventional and by Bond Graph method is compared and

  4. Comparison of different methods to include recycling in LCAs of aluminium cans and disposable polystyrene cups

    NARCIS (Netherlands)

    Harst-Wintraecken, van der Eugenie; Potting, José; Kroeze, Carolien

    2016-01-01

    Many methods have been reported and used to include recycling in life cycle assessments (LCAs). This paper evaluates six widely used methods: three substitution methods (i.e. substitution based on equal quality, a correction factor, and alternative material), allocation based on the number of

  5. A coupling method for a cardiovascular simulation model which includes the Kalman filter.

    Science.gov (United States)

    Hasegawa, Yuki; Shimayoshi, Takao; Amano, Akira; Matsuda, Tetsuya

    2012-01-01

    Multi-scale models of the cardiovascular system provide new insight that was unavailable with in vivo and in vitro experiments. For the cardiovascular system, multi-scale simulations provide a valuable perspective in analyzing the interaction of three phenomenons occurring at different spatial scales: circulatory hemodynamics, ventricular structural dynamics, and myocardial excitation-contraction. In order to simulate these interactions, multiscale cardiovascular simulation systems couple models that simulate different phenomena. However, coupling methods require a significant amount of calculation, since a system of non-linear equations must be solved for each timestep. Therefore, we proposed a coupling method which decreases the amount of calculation by using the Kalman filter. In our method, the Kalman filter calculates approximations for the solution to the system of non-linear equations at each timestep. The approximations are then used as initial values for solving the system of non-linear equations. The proposed method decreases the number of iterations required by 94.0% compared to the conventional strong coupling method. When compared with a smoothing spline predictor, the proposed method required 49.4% fewer iterations.

  6. Calculation method of rate and area of sedimentation, by non-conventional mathematical process of data treatment

    International Nuclear Information System (INIS)

    Cota, P.L.

    1987-01-01

    The used methods for calculating the rate and area of sedimentation are based in techniques of graphical resolution. The solution of the problem by a mathematical resolution, using computational methods, is more fast and more accuracy. The comparison between the results from this methods and the conventional method is shown. (E.G.) [pt

  7. Conventional and molecular methods used in the detection and subtyping of Yersinia enterocolitica in food.

    Science.gov (United States)

    Petsios, Stefanos; Fredriksson-Ahomaa, Maria; Sakkas, Hercules; Papadopoulou, Chrissanthy

    2016-11-21

    Yersinia enterocolitica is an important foodborne pathogen, but the prevalence in food is underestimated due to drawbacks in the detection methods. Problems arise from the low concentration of pathogenic strains present in food samples, similarities with other Enterobacteriaceae and Y. enterocolitica-like species and the heterogeneity of Y. enterocolitica as it comprises both pathogenic and non-pathogenic isolates. New rapid, cost-effective and more sensitive culture media and molecular techniques have been developed to overcome the drawbacks of conventional culture methods. Recent molecular subtyping methods have been applied to Y. enterocolitica strains to track infection sources and to investigate phylogenetic relationships between different Yersinia strains. Further application of modern subtyping tools such as WGS in a variety of bioserotypes, and comparison with other members of the genus will help to better understanding of the virulence determinants of pathogenic Y. enterocolitica, its mechanisms to cope in the host environments, and can contribute to the development of more specific detection and typing strategies.

  8. Comparison of INSURE method with conventional mechanical ventilation after surfactant administration in preterm infants with respiratory distress syndrome: therapeutic challenge.

    Directory of Open Access Journals (Sweden)

    Fatemeh Sadat Nayeri

    2014-08-01

    Full Text Available Administration of endotracheal surfactant is potentially the main treatment for neonates suffering from RDS (Respiratory Distress Syndrome, which is followed by mechanical ventilation. Late and severe complications may develop as a consequence of using mechanical ventilation. In this study, conventional methods for treatment of RDS are compared with surfactant administration, use of mechanical ventilation for a brief period and NCPAP (Nasal Continuous Positive Airway Pressure, (INSURE method ((Intubation, Surfactant administration and extubation. A randomized clinical trial study was performed, including all newborn infants with diagnosed RDS and a gestational age of 35 weeks or less, who were admitted in NICU of Valiasr hospital. The patients were then divided randomly into two CMV (Conventional Mechanical Ventilation and INSURE groups. Surfactant administration and consequent long-term mechanical ventilation were done in the first group (CMV group. In the second group (INSURE group, surfactant was administered followed by a short-term period of mechanical ventilation. The infants were then extubated, and NCPAP was embedded. The comparison included crucial duration of mechanical ventilation and oxygen therapy, IVH (Intraventricular Hemorrhage, PDA (Patent Ductus Arteriosus, air-leak syndromes, BPD (Broncho-Pulmonary Dysplasia and mortality rate. The need for mechanical ventilation in 5th day of admission was 43% decreased (P=0.005 in INSURE group in comparison to CMV group. A decline (P=0.01 in the incidence of IVH and PDA was also achieved. Pneumothorax, chronic pulmonary disease and mortality rates, were not significantly different among two groups. (P=0.25, P=0.14, P=0.25, respectively. This study indicated that INSURE method in the treatment of RDS decreases the need for mechanical ventilation and oxygen-therapy in preterm neonates. Moreover, relevant complications as IVH and PDA were observed to be reduced. Thus, it seems rationale to

  9. Comparison of digital radiography and apex locator with the conventional method in root length determination of primary teeth

    Directory of Open Access Journals (Sweden)

    I E Neena

    2011-01-01

    Full Text Available Aim: The purpose of this study was to compare the Working length in primary teeth endodontics using intra oral digital radiovisiography and apex locator with conventional method for accuracy. Materials and Methods: This in vivo study was conducted on 30 primary teeth which were indicated for pulpectomy in the patients of the age group of 5-11 years All experimental teeth had adequate remaining tooth structure for rubber dam isolation and radiographicaly visible canals. Endodontic treatment was required due to irreversible pulpitis or pulp necrosis. A standardized intraoral periapical radiograph of the tooth was taken using conventional method by paralleling technique. The distance between the source and the tooth, tooth and the films were standardized using X-ray positioning device. During the pulpectomy procedure, the working length was determined by digital radiograph and apex locator. The measurements were then compared with the conventional method of root canal measurement technique for accuracy Result: From the results obtained we can conclude that Working length determined in primary molars using digital radiography and Apex locator did not show any significant difference in the mean working length measurements when compared with the conventional radiographic method. Conclusions: Apex locator is comparable to conventional radiograph in determining the working length without radiation in the primary teeth. Intraoral digital radiography is the safest method in determining the working length with significant reduction in radiation exposure.Hence, both the techniques can be safely used as alternatives to conventional radiographic methods in determining working length in primary teeth.

  10. An Alternative to Conventional Rock Fragmentation Methods Using SCDA: A Review

    Directory of Open Access Journals (Sweden)

    Radhika Vidanage De Silva

    2016-11-01

    Full Text Available Global energy and material consumption are expected to rise in exponential proportions during the next few decades, generating huge demands for deep earth energy (oil/gas recovery and mineral processing. Under such circumstances, the continuation of existing methods in rock fragmentation in such applications is questionable due to the proven adverse environmental impacts associated with them. In this regard; the possibility of using more environmentally friendly options as Soundless Chemical Demolition Agents (SCDAs play a vital role in replacing harmful conventional rock fragmentation techniques for gas; oil and mineral recovery. This study reviews up to date research on soundless cracking demolition agent (SCDA application on rock fracturing including its limitations and strengths, possible applications in the petroleum industry and the possibility of using existing rock fragmentation models for SCDA-based rock fragmentation; also known as fracking. Though the expansive properties of SCDAs are currently used in some demolition works, the poor usage guidelines available reflect the insufficient research carried out on its material’s behavior. SCDA is a cementitious powdery substance with quicklime (CaO as its primary ingredient that expands upon contact with water; which results in a huge expansive pressure if this CaO hydration reaction occurs in a confined condition. So, the mechanism can be used for rock fragmentation by injecting the SCDA into boreholes of a rock mass; where the resulting expansive pressure is sufficient to create an effective fracture network in the confined rock mass around the borehole. This expansive pressure development, however, dependent on many factors, where formation water content creates a negative influence on this due to required greater degree of hydration under greater water contents and temperature creates a positive influence by accelerating the reaction. Having a precise understanding of the fracture

  11. Guidelines for the verification and validation of expert system software and conventional software: Survey and assessment of conventional software verification and validation methods. Volume 2

    Energy Technology Data Exchange (ETDEWEB)

    Mirsky, S.M.; Groundwater, E.H.; Hayes, J.E.; Miller, L.A. [Science Applications International Corp., McLean, VA (United States)

    1995-03-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 153 methods so identified were classified according to their appropriateness for various phases of a developmental life-cycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods` power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V&V (determined by ratings of a system`s complexity and required-integrity). Methods were then rank-ordered for each of the three classes by terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each for the identified components of knowledge-based and expert systems, as well as the system as a whole.

  12. Guidelines for the verification and validation of expert system software and conventional software: Survey and assessment of conventional software verification and validation methods. Volume 2

    International Nuclear Information System (INIS)

    Mirsky, S.M.; Groundwater, E.H.; Hayes, J.E.; Miller, L.A.

    1995-03-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 153 methods so identified were classified according to their appropriateness for various phases of a developmental life-cycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods' power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V ampersand V (determined by ratings of a system's complexity and required-integrity). Methods were then rank-ordered for each of the three classes by terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each for the identified components of knowledge-based and expert systems, as well as the system as a whole

  13. Systems and Methods for Fabricating Structures Including Metallic Glass-Based Materials Using Low Pressure Casting

    Science.gov (United States)

    Hofmann, Douglas C. (Inventor); Kennett, Andrew (Inventor)

    2018-01-01

    Systems and methods to fabricate objects including metallic glass-based materials using low-pressure casting techniques are described. In one embodiment, a method of fabricating an object that includes a metallic glass-based material includes: introducing molten alloy into a mold cavity defined by a mold using a low enough pressure such that the molten alloy does not conform to features of the mold cavity that are smaller than 100 microns; and cooling the molten alloy such that it solidifies, the solid including a metallic glass-based material.

  14. Artificial neural networks versus conventional methods for boiling water reactor stability monitoring

    International Nuclear Information System (INIS)

    Hagen, T.H.J.J. van der

    1995-01-01

    The application of an artificial neural network (ANN) for boiling water reactor (BWR) stability monitoring was studied. A three-layer perceptron was trained on synthetic autocorrelation functions to estimate the decay ratio and the resonance frequency from measured neutron noise. Training of the ANN was improved by adding noise to the training patterns and by applying nonconventional error definitions in the generalized delta rule. The performance of the developed ANN was compared with those of conventional stability monitoring techniques. Explicit care was taken for generating unbiased test data. It is found that the trained ANN is capable of monitoring the stability of the Dodewaard BWR for four specific cases. By comparing properties such as the false alarm ratio, the alarm failure ratio, and the average time to alarm, it is shown that it performs worse than model-based methods in stability monitoring of exact second-order systems but that it is more robust (better resistant to corruptions of the input data and to deviations of the system at issue from an exact second-order system) than other methods. The latter explains its good performance on the Dodewaard BWR and is promising for the application of an ANN for stability monitoring of other reactors and for other operating conditions

  15. Treatment of waste water by a combined technique of radiation and conventional method

    International Nuclear Information System (INIS)

    Sakumoto, A.; Miyata, T.

    1984-01-01

    Treatment of waste water by radiation in combination with a conventional method such as biological oxidation, coagulation with Fe 2 (SO 4 ) 3 , and ozonation has been studied for reducing necessary dose. Ethylene glycol ethers, polyoxyethylene n-nonyl phenyl ether (NPE), polyvinyl alcohol (PVA), ethylene glycol, phenol, and oxalic acid were used as a model pollutant. The combined use of radiation and biological oxidation markedly improved the removal of TOC in aqueous oxygenated solution of ethylene glycol ethers. The combined use of radiation and coagulation had remarkable effects on the reduction of TOC in aqueous deoxygenated solution of NPE or PVA. The simultaneous use of radiation and ozone gave a synergistic effect on oxidative degradation of organic pollutants. The synergistic effect was suggested to arise from chain reactions having a powerful oxidizing agent (OH radical). The rate of TOC removal by the process depended on dose rate. Aqueous solution of 150 mg/l oxalic acid was treated by the combined use of electron beams and ozone using a new type of irradiation vessel to reduce TOC with G(-TOC) of 87 at 2.3 x 10 7 rad/h. The simultaneous use of radiation and ozone is superior to the removal of TOC by other combined methods and can be applied irrespective of the type of organic matter. (author)

  16. A method for the computation of turbulent polymeric liquids including hydrodynamic interactions and chain entanglements

    Energy Technology Data Exchange (ETDEWEB)

    Kivotides, Demosthenes, E-mail: demosthenes.kivotides@strath.ac.uk

    2017-02-12

    An asymptotically exact method for the direct computation of turbulent polymeric liquids that includes (a) fully resolved, creeping microflow fields due to hydrodynamic interactions between chains, (b) exact account of (subfilter) residual stresses, (c) polymer Brownian motion, and (d) direct calculation of chain entanglements, is formulated. Although developed in the context of polymeric fluids, the method is equally applicable to turbulent colloidal dispersions and aerosols. - Highlights: • An asymptotically exact method for the computation of polymer and colloidal fluids is developed. • The method is valid for all flow inertia and all polymer volume fractions. • The method models entanglements and hydrodynamic interactions between polymer chains.

  17. Development of calculation method for one-dimensional kinetic analysis in fission reactors, including feedback effects

    International Nuclear Information System (INIS)

    Paixao, S.B.; Marzo, M.A.S.; Alvim, A.C.M.

    1986-01-01

    The calculation method used in WIGLE code is studied. Because of the non availability of such a praiseworthy solution, expounding the method minutely has been tried. This developed method has been applied for the solution of the one-dimensional, two-group, diffusion equations in slab, axial analysis, including non-boiling heat transfer, accountig for feedback. A steady-state program (CITER-1D), written in FORTRAN 4, has been implemented, providing excellent results, ratifying the developed work quality. (Author) [pt

  18. Solar cells, structures including organometallic halide perovskite monocrystalline films, and methods of preparation thereof

    KAUST Repository

    Bakr, Osman M.

    2017-03-02

    Embodiments of the present disclosure provide for solar cells including an organometallic halide perovskite monocrystalline film (see fig. 1.1B), other devices including the organometallic halide perovskite monocrystalline film, methods of making organometallic halide perovskite monocrystalline film, and the like.

  19. A rigorous assessment of tree height measurements obtained using airborne LIDAR and conventional field methods.

    Science.gov (United States)

    Hans-Erik Andersen; Stephen E. Reutebuch; Robert J. McGaughey

    2006-01-01

    Tree height is an important variable in forest inventory programs but is typically time-consuming and costly to measure in the field using conventional techniques. Airborne light detection and ranging (LIDAR) provides individual tree height measurements that are highly correlated with field-derived measurements, but the imprecision of conventional field techniques does...

  20. Correlation and agreement of a digital and conventional method to measure arch parameters.

    Science.gov (United States)

    Nawi, Nes; Mohamed, Alizae Marny; Marizan Nor, Murshida; Ashar, Nor Atika

    2018-01-01

    The aim of the present study was to determine the overall reliability and validity of arch parameters measured digitally compared to conventional measurement. A sample of 111 plaster study models of Down syndrome (DS) patients were digitized using a blue light three-dimensional (3D) scanner. Digital and manual measurements of defined parameters were performed using Geomagic analysis software (Geomagic Studio 2014 software, 3D Systems, Rock Hill, SC, USA) on digital models and with a digital calliper (Tuten, Germany) on plaster study models. Both measurements were repeated twice to validate the intraexaminer reliability based on intraclass correlation coefficients (ICCs) using the independent t test and Pearson's correlation, respectively. The Bland-Altman method of analysis was used to evaluate the agreement of the measurement between the digital and plaster models. No statistically significant differences (p > 0.05) were found between the manual and digital methods when measuring the arch width, arch length, and space analysis. In addition, all parameters showed a significant correlation coefficient (r ≥ 0.972; p digital and manual measurements. Furthermore, a positive agreement between digital and manual measurements of the arch width (90-96%), arch length and space analysis (95-99%) were also distinguished using the Bland-Altman method. These results demonstrate that 3D blue light scanning and measurement software are able to precisely produce 3D digital model and measure arch width, arch length, and space analysis. The 3D digital model is valid to be used in various clinical applications.

  1. Limitations of the Conventional Phase Advance Method for Constant Power Operation of the Brushless DC Motor

    International Nuclear Information System (INIS)

    Lawler, J.S.

    2001-01-01

    The brushless dc motor (BDCM) has high-power density and efficiency relative to other motor types. These properties make the BDCM well suited for applications in electric vehicles provided a method can be developed for driving the motor over the 4 to 6:1 constant power speed range (CPSR) required by such applications. The present state of the art for constant power operation of the BDCM is conventional phase advance (CPA)[1]. In this paper, we identify key limitations of CPA. It is shown that the CPA has effective control over the developed power but that the current magnitude is relatively insensitive to power output and is inversely proportional to motor inductance. If the motor inductance is low, then the rms current at rated power and high speed may be several times larger than the current rating. The inductance required to maintain rms current within rating is derived analytically and is found to be large relative to that of BDCM designs using high-strength rare earth magnets. Th us, the CPA requires a BDCM with a large equivalent inductance

  2. Treatment of children with Helicobacter pylori infection and malabsorption syndromes with probiotics: Comparison with conventional methods

    International Nuclear Information System (INIS)

    Ghoos, Y.; Brunser, O.; Lawson, F.; Muzeke, A.; Ndjaye, M.F.

    2000-01-01

    It is stated that in developing countries a high rate of Helicobacter pylori infection among newborns and young children occurs. It is further assumed that this incidence may lead to inhibition of defense mechanism (inhibition of acid secretion) against bacteria, per orally ingested. This may result in excessive colonisation of the small intestine by bacteria. This situation may become a major cause for chronic malnutrition and diarrhoea syndrome with failure to thrive. This project aims at determining the occurrence of Helicobacter pylori infection in children at young age. It is aimed also at tracing the relationship between the Helicobacter pylori infection and the state of undernourishment. Finally it is aimed at comparing the usefulness of pre-/probiotics as anti-infection treatment. The methods used to demonstrate above mentioned parameters are based on stable isotopes, 13 CO 2 and H 2 breath tests mainly. To assess nutritional status and progress in growth conventional anthropometric techniques will be used, complementary to the results obtained by stable isotopes. It is put forward that the use of pre-/probiotics, instead of antibiotics, will suppress upper gastrointestinal infection and restore the intestinal cell capacity to assimilate all food ingredients. (author)

  3. Treatment of children with Helicobacter pylori infection and malabsorption syndromes with probiotics: Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Ghoos, Y [UZ Gasthuisberg, Gastrointestinal Pathophysiology, Leuven (Belgium); Brunser, O [Institute of Nutrition and Food Technology, Santiago (Chile); Lawson, F [Clinique Padre Pio, Cotonou (Benin); Muzeke, A [Faculte de Medicine, University of Kinshasa, Kinshasa (Congo); Ndjaye, M F [Cercle Senegalais Gastroenterologie, Dakar (Senegal)

    2000-07-01

    It is stated that in developing countries a high rate of Helicobacter pylori infection among newborns and young children occurs. It is further assumed that this incidence may lead to inhibition of defense mechanism (inhibition of acid secretion) against bacteria, per orally ingested. This may result in excessive colonisation of the small intestine by bacteria. This situation may become a major cause for chronic malnutrition and diarrhoea syndrome with failure to thrive. This project aims at determining the occurrence of Helicobacter pylori infection in children at young age. It is aimed also at tracing the relationship between the Helicobacter pylori infection and the state of undernourishment. Finally it is aimed at comparing the usefulness of pre-/probiotics as anti-infection treatment. The methods used to demonstrate above mentioned parameters are based on stable isotopes, {sup 13}CO{sub 2} and H{sub 2} breath tests mainly. To assess nutritional status and progress in growth conventional anthropometric techniques will be used, complementary to the results obtained by stable isotopes. It is put forward that the use of pre-/probiotics, instead of antibiotics, will suppress upper gastrointestinal infection and restore the intestinal cell capacity to assimilate all food ingredients. (author)

  4. Evaluation of various conventional methods for sampling weeds in potato and spinach crops

    Directory of Open Access Journals (Sweden)

    David Jamaica

    2014-04-01

    Full Text Available This study aimed to evaluate (at an exploratory level, some of the different conventional sampling designs in a section of a potato crop and in a commercial crop of spinach. Weeds were sampled in a 16 x 48 m section of a potato crop with a set grid of 192 sections. The cover and density of the weeds were registered in squares of from 0.25 to 64 m². The results were used to create a database that allowed for the simulation of different sampling designs: variables and square size. A second sampling was carried out with these results in a spinach crop of 1.16 ha with a set grid of 6 x 6 m cells, evaluating the cover in 4 m² squares. Another database was created with this information, which was used to simulate other sampling designs such as distribution and quantity of sampling squares. According to the obtained results, a good method for approximating the quantity of squares for diverse samples is 10-12 squares (4 m² for richness per ha and 18 or more squares for abundance per hectare. This square size is optimal since it allows for a sampling of more area without losing sight of low-profile species, with the cover variable best representing the abundance of the weeds.

  5. Comparison of the lysis centrifugation method with the conventional blood culture method in cases of sepsis in a tertiary care hospital.

    Science.gov (United States)

    Parikh, Harshal R; De, Anuradha S; Baveja, Sujata M

    2012-07-01

    Physicians and microbiologists have long recognized that the presence of living microorganisms in the blood of a patient carries with it considerable morbidity and mortality. Hence, blood cultures have become critically important and frequently performed test in clinical microbiology laboratories for diagnosis of sepsis. To compare the conventional blood culture method with the lysis centrifugation method in cases of sepsis. Two hundred nonduplicate blood cultures from cases of sepsis were analyzed using two blood culture methods concurrently for recovery of bacteria from patients diagnosed clinically with sepsis - the conventional blood culture method using trypticase soy broth and the lysis centrifugation method using saponin by centrifuging at 3000 g for 30 minutes. Overall bacteria recovered from 200 blood cultures were 17.5%. The conventional blood culture method had a higher yield of organisms, especially Gram positive cocci. The lysis centrifugation method was comparable with the former method with respect to Gram negative bacilli. The sensitivity of lysis centrifugation method in comparison to conventional blood culture method was 49.75% in this study, specificity was 98.21% and diagnostic accuracy was 89.5%. In almost every instance, the time required for detection of the growth was earlier by lysis centrifugation method, which was statistically significant. Contamination by lysis centrifugation was minimal, while that by conventional method was high. Time to growth by the lysis centrifugation method was highly significant (P value 0.000) as compared to time to growth by the conventional blood culture method. For the diagnosis of sepsis, combination of the lysis centrifugation method and the conventional blood culture method with trypticase soy broth or biphasic media is advocable, in order to achieve faster recovery and a better yield of microorganisms.

  6. Force measuring valve assemblies, systems including such valve assemblies and related methods

    Science.gov (United States)

    DeWall, Kevin George [Pocatello, ID; Garcia, Humberto Enrique [Idaho Falls, ID; McKellar, Michael George [Idaho Falls, ID

    2012-04-17

    Methods of evaluating a fluid condition may include stroking a valve member and measuring a force acting on the valve member during the stroke. Methods of evaluating a fluid condition may include measuring a force acting on a valve member in the presence of fluid flow over a period of time and evaluating at least one of the frequency of changes in the measured force over the period of time and the magnitude of the changes in the measured force over the period of time to identify the presence of an anomaly in a fluid flow and, optionally, its estimated location. Methods of evaluating a valve condition may include directing a fluid flow through a valve while stroking a valve member, measuring a force acting on the valve member during the stroke, and comparing the measured force to a reference force. Valve assemblies and related systems are also disclosed.

  7. Strategies for Solving Potential Problems Associated with Laboratory Diffusion and Batch Experiments - Part 1: An Overview of Conventional Test Methods

    International Nuclear Information System (INIS)

    Zhang, M.; Takeda, M.; Nakajima, H.

    2006-01-01

    Laboratory diffusion testing as well as batch experiments are well established and widely adopted techniques for characterizing the diffusive and adsorptive properties of geological, geotechnical, and synthetic materials in both scientific and applied fields, including geological disposal of radioactive waste. Although several types of diffusion test, such as the through- diffusion test, in-diffusion test, out-diffusion test, and column test, are currently available, different methods may have different advantages and disadvantages. In addition, traditional methods may have limitations, such as the need for relatively long test times, cumbersome test procedures, and the possibility of errors due to differences between analytical assumptions and actual test conditions. Furthermore, traditional batch experiments using mineral powders are known to overestimate the sorption coefficient. In part 1 of this report, we present a brief overview of laboratory diffusion and batch experiments. The advantages, disadvantages, limitations, and/or potential problems associated with individual tests were compared and summarized. This comprehensive report will provide practical references for reviewing the results obtained from relevant experiments, especially from the viewpoint of regulation. To solve and/or eliminate the potential problems associated with conventional methods, and to obtain the diffusion coefficient and rock capacity factor from a laboratory test both rapidly and accurately, part 2 of this study discusses possible strategies involving the development of rigorous solutions to some relevant test methods, and sensitivity analyses for the related tests that may be helpful to judge the accuracy of the two parameters to be determined from individual tests. (authors)

  8. Listeria spp. in broiler flocks: recovery rates and species distribution investigated by conventional culture and the EiaFoss method

    DEFF Research Database (Denmark)

    Petersen, Line Hedegård; Madsen, Mogens

    2000-01-01

    The occurrence of Listeria monocytogenes in samples from broiler houses and cloacal swabs taken at the abattoir was investigated. An automated immunobased method (EiaFoss) was used, and 42 samples were also analysed by conventional culture; both methods were based on a two-step selective enrichment....... monocytogenes in enrichment broths may lead to an underestimation of the prevalence of L. monocytogenes. Furthermore, as L. inocua was also detected by the EiaFoss method, a significant amount of bacterial confirmation work had to be done. Of 42 samples analysed by conventional culture, four yielded L. inocua......, of which two were not positive by EiaFoss....

  9. Electrode assemblies, plasma apparatuses and systems including electrode assemblies, and methods for generating plasma

    Science.gov (United States)

    Kong, Peter C; Grandy, Jon D; Detering, Brent A; Zuck, Larry D

    2013-09-17

    Electrode assemblies for plasma reactors include a structure or device for constraining an arc endpoint to a selected area or region on an electrode. In some embodiments, the structure or device may comprise one or more insulating members covering a portion of an electrode. In additional embodiments, the structure or device may provide a magnetic field configured to control a location of an arc endpoint on the electrode. Plasma generating modules, apparatus, and systems include such electrode assemblies. Methods for generating a plasma include covering at least a portion of a surface of an electrode with an electrically insulating member to constrain a location of an arc endpoint on the electrode. Additional methods for generating a plasma include generating a magnetic field to constrain a location of an arc endpoint on an electrode.

  10. Arthroscopic release using F and C method versus conventional open release method in the treatment of gluteal muscle contracture: a comparative study.

    Science.gov (United States)

    Rai, Saroj; Jin, Shengyang; Meng, Chunqing; Chaudhary, Nabin; Tamang, Nira; Wang, Xiaohong; Liu, Xianzhe; Wang, Hong; Yang, Shuhua

    2017-03-16

    Gluteal muscle contracture (GMC), a debilitating disease, usually starts in early childhood after variable dose of injections around the buttock, if left untreated it worsens gradually and persists throughout the life. Because the disease mostly affects adolescents and adults, there is always an aesthetic concerns. Purposeof the study was to introduce the arthroscopic F and C method of GMC release, and to compare its clinical efficiency with conventional open surgery in terms of clinical outcome, rate of complications, patient's satisfactions, and recurrence. Between Jan 2013 and July 2015, 75 patients received an arthroscopic release with F and C release method and 71 patients received conventional open release of GMC. Primary surgeries in 16 years or older patients were included in the study. Two groups were compared clinically using Hip Outcome Scores - Activities of Daily Living Subscale (HOS-ADL), Hip Outcome Scores - Sports Subscale (HOS-Sports), Visual Analogue Scale (VAS), and Ye et al. evaluation criteria. No statistically significant differences were observed in Hip Outcome Scores - Activities of Daily Living Subscale (HOS-ADL) (P = 0.078), Hip Outcome Scores - Sports Subscale (HOS-Sports) (P = 0.340), and Visual Analogue Scale (VAS) (P = 0.524) between the two groups. 74 (98.7%) patients in the arthroscopic surgery group had good to excellent results, whereas 69 (97.1%) patients in the conventional open surgery group had good to excellent results (P = 0.727). No statistically significant difference was observed in recurrence rate (P = 0.612). Statistically significant differences were observed in incision length, use of post-operative analgesia, post-operative off-bed activity, and hospital stay. Complications were significantly higher in the conventional open surgery group (n = 21) than in the arthroscopic surgery group (n = 10) (P = 0.016). More importantly, cosmetic satisfaction was 100% in arthroscopic release group

  11. Including mixed methods research in systematic reviews: Examples from qualitative syntheses in TB and malaria control

    Science.gov (United States)

    2012-01-01

    Background Health policy makers now have access to a greater number and variety of systematic reviews to inform different stages in the policy making process, including reviews of qualitative research. The inclusion of mixed methods studies in systematic reviews is increasing, but these studies pose particular challenges to methods of review. This article examines the quality of the reporting of mixed methods and qualitative-only studies. Methods We used two completed systematic reviews to generate a sample of qualitative studies and mixed method studies in order to make an assessment of how the quality of reporting and rigor of qualitative-only studies compares with that of mixed-methods studies. Results Overall, the reporting of qualitative studies in our sample was consistently better when compared with the reporting of mixed methods studies. We found that mixed methods studies are less likely to provide a description of the research conduct or qualitative data analysis procedures and less likely to be judged credible or provide rich data and thick description compared with standalone qualitative studies. Our time-related analysis shows that for both types of study, papers published since 2003 are more likely to report on the study context, describe analysis procedures, and be judged credible and provide rich data. However, the reporting of other aspects of research conduct (i.e. descriptions of the research question, the sampling strategy, and data collection methods) in mixed methods studies does not appear to have improved over time. Conclusions Mixed methods research makes an important contribution to health research in general, and could make a more substantial contribution to systematic reviews. Through our careful analysis of the quality of reporting of mixed methods and qualitative-only research, we have identified areas that deserve more attention in the conduct and reporting of mixed methods research. PMID:22545681

  12. A novel technique for including surface tension in PLIC-VOF methods

    Energy Technology Data Exchange (ETDEWEB)

    Meier, M.; Yadigaroglu, G. [Swiss Federal Institute of Technology, Nuclear Engineering Lab. ETH-Zentrum, CLT, Zurich (Switzerland); Smith, B. [Paul Scherrer Inst. (PSI), Villigen (Switzerland). Lab. for Thermal-Hydraulics

    2002-02-01

    Various versions of Volume-of-Fluid (VOF) methods have been used successfully for the numerical simulation of gas-liquid flows with an explicit tracking of the phase interface. Of these, Piecewise-Linear Interface Construction (PLIC-VOF) appears as a fairly accurate, although somewhat more involved variant. Including effects due to surface tension remains a problem, however. The most prominent methods, Continuum Surface Force (CSF) of Brackbill et al. and the method of Zaleski and co-workers (both referenced later), both induce spurious or 'parasitic' currents, and only moderate accuracy in regards to determining the curvature. We present here a new method to determine curvature accurately using an estimator function, which is tuned with a least-squares-fit against reference data. Furthermore, we show how spurious currents may be drastically reduced using the reconstructed interfaces from the PLIC-VOF method. (authors)

  13. Treatment of children with Helicobacter pylori infection and malabsorption syndrome with probiotics: Comparison with conventional method

    Energy Technology Data Exchange (ETDEWEB)

    Ndiaye, M F; Mbengue, M; Mbaye, P S; Diouf, S [Societe Senegalaise de Gasto-enterologie et d' hepatologie, Dakar (Senegal); Ghoos, Y [Labo. Digestie Absorptie, Leuven (Belgium); Brunser, O [Institute of Nutrition and Food Technology, Santiago (Chile)

    2004-07-01

    Helicobacter pylori infection is one of the most common bacterial infection (82 %) in Senegal where malnutrition is common in children (25 %). Our aims were to definite prevalence of H. pylori, to determine the relationship between Hp infection and undernourishment and to verify the efficiency of treatment with probiotic. In some studies a positive effect of Saccharomyces boulardii has been demonstrated against H. pylori. We have included healthy children 7 to 10 years of age. 108 out of 129 (84%) were H. pylori-positive by breath-test. Two groups were randomised. Group A was treated with ten days' standard triple therapy (Omeprazole 1 mg Kg/day in single day gift, Amoxycillin 50 mg/kg/two times per day and Clarithromycin 250 mg two times per day). Group B received probiotic (250 mg of Saccharomyces boulardii with 5g Inulin three times per day) for 3 months. Evaluation of treatment was done one month after the end of therapy. Seventy one children out of 110 (64.5%) had digestive symptoms in their medical history. The main signs were recurrent abdominal pain in 64 cases. BMI were less than 18.50 in all the children with H. pylori infection without other nutritional abnormaly. Eight children were eradicated after treatment seven in the group under conventional treatment (58%) and one in the group under probiotics (6%). We concluded that prevalence of H. pylori infection is very high in young children as of the 7 years' age in urban as in rural environments. Symptoms are not specific. No significant difference in the nutritional state is observed between H. pylori-positive and H. pylori-negative children. Treatment by probiotics does not seem to give efficient results for eradication of H. pylori. (author)

  14. Comparison of different methods to include recycling in LCAs of aluminium cans and disposable polystyrene cups.

    Science.gov (United States)

    van der Harst, Eugenie; Potting, José; Kroeze, Carolien

    2016-02-01

    Many methods have been reported and used to include recycling in life cycle assessments (LCAs). This paper evaluates six widely used methods: three substitution methods (i.e. substitution based on equal quality, a correction factor, and alternative material), allocation based on the number of recycling loops, the recycled-content method, and the equal-share method. These six methods were first compared, with an assumed hypothetical 100% recycling rate, for an aluminium can and a disposable polystyrene (PS) cup. The substitution and recycled-content method were next applied with actual rates for recycling, incineration and landfilling for both product systems in selected countries. The six methods differ in their approaches to credit recycling. The three substitution methods stimulate the recyclability of the product and assign credits for the obtained recycled material. The choice to either apply a correction factor, or to account for alternative substituted material has a considerable influence on the LCA results, and is debatable. Nevertheless, we prefer incorporating quality reduction of the recycled material by either a correction factor or an alternative substituted material over simply ignoring quality loss. The allocation-on-number-of-recycling-loops method focusses on the life expectancy of material itself, rather than on a specific separate product. The recycled-content method stimulates the use of recycled material, i.e. credits the use of recycled material in products and ignores the recyclability of the products. The equal-share method is a compromise between the substitution methods and the recycled-content method. The results for the aluminium can follow the underlying philosophies of the methods. The results for the PS cup are additionally influenced by the correction factor or credits for the alternative material accounting for the drop in PS quality, the waste treatment management (recycling rate, incineration rate, landfilling rate), and the

  15. Methods of using structures including catalytic materials disposed within porous zeolite materials to synthesize hydrocarbons

    Science.gov (United States)

    Rollins, Harry W [Idaho Falls, ID; Petkovic, Lucia M [Idaho Falls, ID; Ginosar, Daniel M [Idaho Falls, ID

    2011-02-01

    Catalytic structures include a catalytic material disposed within a zeolite material. The catalytic material may be capable of catalyzing a formation of methanol from carbon monoxide and/or carbon dioxide, and the zeolite material may be capable of catalyzing a formation of hydrocarbon molecules from methanol. The catalytic material may include copper and zinc oxide. The zeolite material may include a first plurality of pores substantially defined by a crystal structure of the zeolite material and a second plurality of pores dispersed throughout the zeolite material. Systems for synthesizing hydrocarbon molecules also include catalytic structures. Methods for synthesizing hydrocarbon molecules include contacting hydrogen and at least one of carbon monoxide and carbon dioxide with such catalytic structures. Catalytic structures are fabricated by forming a zeolite material at least partially around a template structure, removing the template structure, and introducing a catalytic material into the zeolite material.

  16. Conventional versus molecular methods for diagnosis of tuberculosis in a tertiary care center: A study from Punjab

    Directory of Open Access Journals (Sweden)

    Shavi Nagpal

    2016-01-01

    Full Text Available Background: A fast and accurate diagnosis is necessary to control and eliminate tuberculosis (TB. There have been various studies evaluating the efficacy of polymerase chain reaction (PCR testing in clinical practice. Most of these studies have found PCR as a useful tool to diagnose TB and more so for the extra-pulmonary cases. Aims and Objectives: The aim of the study was to evaluate the results of TB by real-time PCR versus the conventional methods of diagnosis in a tertiary care center in Punjab. Materials and Methods: This study was done in a tertiary care center of Punjab to look for the results of clinical samples tested for TB using PCR, Ziehl–Neelsen staining and culture on Lowenstein–Jensen medium. 16S rRNA gene was used for Mycobacterium tuberculosis detection in PCR. This study included all samples tested for TB from July 2015 to October 2015. Results: A total of 214 samples were tested for TB using smear microscopy, culture and PCR (including 194 [90.6%] extra-pulmonary and 20 [9.3%] pulmonary samples. These included 76 cerebrospinal fluid, 30 pleural fluid, 42 tissues, 17 ascitic fluid, 13 urine, 15 bronchoalveolar lavage (BAL, 16 pus, and 5 sputum samples. Smear microscopy was positive in a total of 4 samples out of 214 (1.8%, which included 2 sputum, 1 tissue, and 1 ascitic fluid samples, while culture was positive for 6 samples (2.8% which included 2 sputum, 1 pus, 1 BAL, 1 tissue, and 1 ascitic fluid sample. The TB PCR results were positive in a total of 71 (33.1% samples out of 214. In addition, three samples also tested positive for Mycobacteria other than TB. Conclusion: PCR is a very rapid and accurate diagnostic tool for early detection of TB in particularly for extrapulmonary TB.

  17. Including mixed methods research in systematic reviews: examples from qualitative syntheses in TB and malaria control.

    Science.gov (United States)

    Atkins, Salla; Launiala, Annika; Kagaha, Alexander; Smith, Helen

    2012-04-30

    Health policy makers now have access to a greater number and variety of systematic reviews to inform different stages in the policy making process, including reviews of qualitative research. The inclusion of mixed methods studies in systematic reviews is increasing, but these studies pose particular challenges to methods of review. This article examines the quality of the reporting of mixed methods and qualitative-only studies. We used two completed systematic reviews to generate a sample of qualitative studies and mixed method studies in order to make an assessment of how the quality of reporting and rigor of qualitative-only studies compares with that of mixed-methods studies. Overall, the reporting of qualitative studies in our sample was consistently better when compared with the reporting of mixed methods studies. We found that mixed methods studies are less likely to provide a description of the research conduct or qualitative data analysis procedures and less likely to be judged credible or provide rich data and thick description compared with standalone qualitative studies. Our time-related analysis shows that for both types of study, papers published since 2003 are more likely to report on the study context, describe analysis procedures, and be judged credible and provide rich data. However, the reporting of other aspects of research conduct (i.e. descriptions of the research question, the sampling strategy, and data collection methods) in mixed methods studies does not appear to have improved over time. Mixed methods research makes an important contribution to health research in general, and could make a more substantial contribution to systematic reviews. Through our careful analysis of the quality of reporting of mixed methods and qualitative-only research, we have identified areas that deserve more attention in the conduct and reporting of mixed methods research.

  18. Influence of Detection Methods in Characterizing Escherichia coli O157:H7 in Raw Goat Meat Using Conventional and Molecular Methods.

    Science.gov (United States)

    Tabashsum, Zajeba; Nazneen, Mafruha; Ahsan, C R; Bari, M L; Yasmin, M

    2016-01-01

     Presence of Escherichia coli O157:H7 on fresh goat meat samples (n= 40) of Dhaka city was analyzed using conventional and molecular methods. A total of 86 presumptive E. coli O157:H7 colonies were isolated from 60% of the samples using selective agar plating method. After conventional biochemical assay followed by API 20E assay, only 11 isolates were found to be E. coli O157:H7. Further serological test identified only four isolates that has strong agglutination reaction against anti-H7 sensitized latex. The biochemically and serologically confirmed isolates were then screened for major virulence factors include eaeA, rfbE, fliC, stx1 and stx2 genes by PCR. PCR analysis of positive isolates showed, 10 isolates were eaeA and rfbE genes positive but fliC gene was only in six, indicating that these isolates were H7 positive with flagellum antigens which might not expressed or detected in serotyping tests. Multiplex PCR against eaeA, stx1 and stx2 genes of the isolates showed similar results as when done individually. These results revealed that only 7% of the primary presumptive E. coli O157:H7 was found to be stx producing E. coli O157:H7 and thus greatly influenced the detection of the pathogen in meat samples.

  19. Comparison of Land, Water, and Energy Requirements of Lettuce Grown Using Hydroponic vs. Conventional Agricultural Methods.

    Science.gov (United States)

    Barbosa, Guilherme Lages; Gadelha, Francisca Daiane Almeida; Kublik, Natalya; Proctor, Alan; Reichelm, Lucas; Weissinger, Emily; Wohlleb, Gregory M; Halden, Rolf U

    2015-06-16

    The land, water, and energy requirements of hydroponics were compared to those of conventional agriculture by example of lettuce production in Yuma, Arizona, USA. Data were obtained from crop budgets and governmental agricultural statistics, and contrasted with theoretical data for hydroponic lettuce production derived by using engineering equations populated with literature values. Yields of lettuce per greenhouse unit (815 m2) of 41 ± 6.1 kg/m2/y had water and energy demands of 20 ± 3.8 L/kg/y and 90,000 ± 11,000 kJ/kg/y (±standard deviation), respectively. In comparison, conventional production yielded 3.9 ± 0.21 kg/m2/y of produce, with water and energy demands of 250 ± 25 L/kg/y and 1100 ± 75 kJ/kg/y, respectively. Hydroponics offered 11 ± 1.7 times higher yields but required 82 ± 11 times more energy compared to conventionally produced lettuce. To the authors' knowledge, this is the first quantitative comparison of conventional and hydroponic produce production by example of lettuce grown in the southwestern United States. It identified energy availability as a major factor in assessing the sustainability of hydroponics, and it points to water-scarce settings offering an abundance of renewable energy (e.g., from solar, geothermal, or wind power) as particularly attractive regions for hydroponic agriculture.

  20. Effect of Chemistry Triangle Oriented Learning Media on Cooperative, Individual and Conventional Method on Chemistry Learning Result

    Science.gov (United States)

    Latisma D, L.; Kurniawan, W.; Seprima, S.; Nirbayani, E. S.; Ellizar, E.; Hardeli, H.

    2018-04-01

    The purpose of this study was to see which method are well used with the Chemistry Triangle-oriented learning media. This quasi experimental research involves first grade of senior high school students in six schools namely each two SMA N in Solok city, in Pasaman and two SMKN in Pariaman. The sampling technique was done by Cluster Random Sampling. Data were collected by test and analyzed by one-way anova and Kruskall Wallish test. The results showed that the high school students in Solok learning taught by cooperative method is better than the results of student learning taught by conventional and Individual methods, both for students who have high initial ability and low-ability. Research in SMK showed that the overall student learning outcomes taught by conventional method is better than the student learning outcomes taught by cooperative and individual methods. Student learning outcomes that have high initial ability taught by individual method is better than student learning outcomes that are taught by cooperative method and for students who have low initial ability, there is no difference in student learning outcomes taught by cooperative, individual and conventional methods. Learning in high school in Pasaman showed no significant difference in learning outcomes of the three methods undertaken.

  1. VOLATILE CONSTITUENTS OF GINGER OIL PREPARED ACCORDING TO IRANIAN TRADITIONAL MEDICINE AND CONVENTIONAL METHOD: A COMPARATIVE STUDY.

    Science.gov (United States)

    Shirooye, Pantea; Mokaberinejad, Roshanak; Ara, Leila; Hamzeloo-Moghadam, Maryam

    2016-01-01

    Herbal medicines formulated as oils were believed to possess more powerful effects than their original plants in Iranian Traditional Medicine (ITM). One of the popular oils suggested for treatment of various indications was ginger oil. In the present study, to suggest a more convenient method of oil preparation (compared to the traditional method), ginger oil has been prepared according to both the traditional and conventional maceration methods and the volatile oil constituents have been compared. Ginger oil was obtained in sesame oil according to both the traditional way and the conventional (maceration) methods. The volatile oil of dried ginger and both oils were obtained by hydro-distillation and analyzed by gas chromatography/mass spectroscopy. Fifty five, fifty nine and fifty one components consisting 94 %, 94 % and 98 % of the total compounds were identified in the volatile oil of ginger, traditional and conventional oils, respectively. The most dominant compounds of the traditional and conventional oils were almost similar; however they were different from ginger essential oil which has also been to possess limited amounts of anti-inflammatory components. It was concluded that ginger oil could be prepared through maceration method and used for indications mentioned in ITM.

  2. Complete Tangent Stiffness for eXtended Finite Element Method by including crack growth parameters

    DEFF Research Database (Denmark)

    Mougaard, J.F.; Poulsen, P.N.; Nielsen, L.O.

    2013-01-01

    the crack geometry parameters, such as the crack length and the crack direction directly in the virtual work formulation. For efficiency, it is essential to obtain a complete tangent stiffness. A new method in this work is presented to include an incremental form the crack growth parameters on equal terms......The eXtended Finite Element Method (XFEM) is a useful tool for modeling the growth of discrete cracks in structures made of concrete and other quasi‐brittle and brittle materials. However, in a standard application of XFEM, the tangent stiffness is not complete. This is a result of not including...... with the degrees of freedom in the FEM‐equations. The complete tangential stiffness matrix is based on the virtual work together with the constitutive conditions at the crack tip. Introducing the crack growth parameters as direct unknowns, both equilibrium equations and the crack tip criterion can be handled...

  3. Manufacturing and characterization of ceramic pigment Zn1-xFexCr2O4 by synthetic non conventional methods

    International Nuclear Information System (INIS)

    Nieves, Leidy Johana Jaramillo; Baena, Oscar Jaime Restrepo

    2012-01-01

    The ceramic pigment with structure Zn 1-x Fe x Cr 2 O 4 (x = 0, 0.5, 1) was synthesized by non conventional methods of coprecipitation assisted by ultrasound and milling of high energy. This pigment was characterized by XRD, XRF, SEM, UV-VIS spectrophotometry and CIELab colorimetry. The aim of this work was studied two alternative methods to the traditional method of synthesis, evaluating the pigment properties, varying the stoichiometry, such as structure, composition, morphology and colorimetric coordinates. The results showed that is possible to obtain the desired crystalline structure at temperatures below 1000 ° C in both cases, also expected hues are obtained according to each stoichiometry, which shows the advantages of using methods non conventional when produce these pigments, since it has a higher controlling the composition, stoichiometry and is obtained at temperatures below compared with traditional ceramic method

  4. Clinical outcomes for patients finished with the SureSmile™ method compared with conventional fixed orthodontic therapy

    Science.gov (United States)

    Alford, Timothy J.; Roberts, W. Eugene; Hartsfield, James K.; Eckert, George J.; Snyder, Ronald J.

    2016-01-01

    Objective Utilize American Board of Orthodontics (ABO) cast/radiographic evaluation (CRE) to compare a series of 63 consecutive patients, finished with manual wire bending (conventional) treatment, vs a subsequent series of 69 consecutive patients, finished by the same orthodontist using the SureSmile™ (SS) method. Materials and Methods Records of 132 nonextraction patients were scored by a calibrated examiner blinded to treatment mode. Age and discrepancy index (DI) between groups were compared by t-tests. A chi-square test was used to compare for differences in sex and whether the patient was treated using braces only (no orthopedic correction). Analysis of covariance tested for differences in CRE outcomes and treatment times, with sex and DI included as covariates. A logarithmic transformation of CRE outcomes and treatment times was used because their distributions were skewed. Significance was defined as P space closure; however, second-order root angulation (RA) was inferior. Conclusion SS patients were treated in less time to better CRE scores for first-order rotation (AR) and interproximal space closure (IC) but on the average, malocclusions were less complex and second order root alignment was inferior, compared with patients finished with manual wire bending. PMID:21261488

  5. Earthquake analysis of structures including structure-soil interaction by a substructure method

    International Nuclear Information System (INIS)

    Chopra, A.K.; Guttierrez, J.A.

    1977-01-01

    A general substructure method for analysis of response of nuclear power plant structures to earthquake ground motion, including the effects of structure-soil interaction, is summarized. The method is applicable to complex structures idealized as finite element systems and the soil region treated as either a continuum, for example as a viscoelastic halfspace, or idealized as a finite element system. The halfspace idealization permits reliable analysis for sites where essentially similar soils extend to large depths and there is no rigid boundary such as soil-rock interface. For sites where layers of soft soil are underlain by rock at shallow depth, finite element idealization of the soil region is appropriate; in this case, the direct and substructure methods would lead to equivalent results but the latter provides the better alternative. Treating the free field motion directly as the earthquake input in the substructure method eliminates the deconvolution calculations and the related assumption -regarding type and direction of earthquake waves- required in the direct method. The substructure method is computationally efficient because the two substructures-the structure and the soil region- are analyzed separately; and, more important, it permits taking advantage of the important feature that response to earthquake ground motion is essentially contained in the lower few natural modes of vibration of the structure on fixed base. For sites where essentially similar soils extend to large depths and there is no obvious rigid boundary such as a soil-rock interface, numerical results for earthquake response of a nuclear reactor structure are presented to demonstrate that the commonly used finite element method may lead to unacceptable errors; but the substructure method leads to reliable results

  6. Treatment of children with Helicobacter infection and malabsorption syndromes with probiotics: Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Lawson, P F [Clinique des Maladies de l' Appareil Digestif, Cotonou (Benin); Lawson, W [Clinique des Maladies de l' Appareil Digestif, Cotonou (Benin); De Maio, G; Andriulli, A [Ospedale Casa Sollievo della Sofferenza, San Giovanni Rotondo (Italy); Ghoos, Y [Lab. Digestie Absoptie, Leuven (Belgium); Brunser, O [Institute of Nutrition and Food Technology, Santiago (Chile)

    2004-07-01

    There is a large interest about Heliobacter pylori infection in childhood nowadays. The prevalence of infection is very high in developing countries and this is extremely correlated to the living conditions with consequences on the future health of children. Contamination mode is not well known but environment factors are involved. We used {sup 13}C Urea Breath Test to assess the prevalence rate in beninese asymptomatic children aged 7-11 years old (about 86%). We evaluated the influence of either conventional or probiotics therapy in eradicating Hp infection and some relationships with growth parameters. We concluded that conventional therapy or use of probiotics might improve infection status and probably influence growth factors in childhood. (author)

  7. The efficacy of selective calculus ablation at 400 nm: comparison to conventional calculus removal methods

    Science.gov (United States)

    Schoenly, Joshua E.; Seka, Wolf; Romanos, Georgios; Rechmann, Peter

    A desired outcome of scaling and root planing is the complete removal of calculus and infected root tissue and preservation of healthy cementum for rapid healing of periodontal tissues. Conventional periodontal treatments for calculus removal, such as hand instrument scaling and ultrasonic scaling, often deeply scrape the surface of the underlying hard tissue and may leave behind a smear layer. Pulsed lasers emitting at violet wavelengths (specifically, 380 to 400 nm) are a potential alternative treatment since they can selectively ablate dental calculus without ablating pristine hard tissue (i.e., enamel, cementum, and dentin). In this study, light and scanning electron microscopy are used to compare and contrast the efficacy of in vitro calculus removal for several conventional periodontal treatments (hand instruments, ultrasonic scaler, and Er:YAG laser) to calculus removal with a frequency-doubled Ti:sapphire (λ = 400 nm). After calculus removal, enamel and cementum surfaces are investigated for calculus debris and damage to the underlying hard tissue surface. Compared to the smear layer, grooves, and unintentional hard tissue removal typically found using these conventional treatments, calculus removal using the 400-nm laser is complete and selective without any removal of pristine dental hard tissue. Based on these results, selective ablation from the 400-nm laser appears to produce a root surface that would be more suitable for successful healing of periodontal tissues.

  8. Comparative study on flow rate measurement by nuclear and conventional methods in selected rivers at Ulu Langat district, Selangor

    Energy Technology Data Exchange (ETDEWEB)

    Wan Mohamad Tahir, Wan Zakaria; Mohamad, Daud; Hamzah, Abdul Razak; Yusuf, Johari Mohamad; Aziz Wan Mohamad, Wan Abdul

    1986-06-01

    A radiotracer technique using Tc-99 to measure flows of small rivers was introduced in Malaysia. Three rivers in the Ulu Langat District were selected for a comparative study on flow rate determination by conventional and radioisotope methods. Radioisotopic approach, comprising injection procedures, calibration, mixing length and safety aspects are discussed. The results measured by radioisotope method are compared to the Drainage and Irrigation Department's (DID's) discharge curves data collected from 1980 to 1982 which is calibrated using a current meter. The results are comparable and fall within the range obtained by conventional method. Related to this study, a comprehensive work on stream gauging of moderate and high flow rates using both methods is proposed to be carried out directly.

  9. Spine surgeon's kinematics during discectomy, part II: operating table height and visualization methods, including microscope.

    Science.gov (United States)

    Park, Jeong Yoon; Kim, Kyung Hyun; Kuh, Sung Uk; Chin, Dong Kyu; Kim, Keun Su; Cho, Yong Eun

    2014-05-01

    Surgeon spine angle during surgery was studied ergonomically and the kinematics of the surgeon's spine was related with musculoskeletal fatigue and pain. Spine angles varied depending on operation table height and visualization method, and in a previous paper we showed that the use of a loupe and a table height at the midpoint between the umbilicus and the sternum are optimal for reducing musculoskeletal loading. However, no studies have previously included a microscope as a possible visualization method. The objective of this study is to assess differences in surgeon spine angles depending on operating table height and visualization method, including microscope. We enrolled 18 experienced spine surgeons for this study, who each performed a discectomy using a spine surgery simulator. Three different methods were used to visualize the surgical field (naked eye, loupe, microscope) and three different operating table heights (anterior superior iliac spine, umbilicus, the midpoint between the umbilicus and the sternum) were studied. Whole spine angles were compared for three different views during the discectomy simulation: midline, ipsilateral, and contralateral. A 16-camera optoelectronic motion analysis system was used, and 16 markers were placed from the head to the pelvis. Lumbar lordosis, thoracic kyphosis, cervical lordosis, and occipital angle were compared between the different operating table heights and visualization methods as well as a natural standing position. Whole spine angles differed significantly depending on visualization method. All parameters were closer to natural standing values when discectomy was performed with a microscope, and there were no differences between the naked eye and the loupe. Whole spine angles were also found to differ from the natural standing position depending on operating table height, and became closer to natural standing position values as the operating table height increased, independent of the visualization method

  10. Earthquake analysis of structures including structure-soil interaction by a substructure method

    International Nuclear Information System (INIS)

    Chopra, A.K.; Guttierrez, J.A.

    1977-01-01

    A general substructure method for analysis of response of nuclear power plant structures to earthquake ground motion, including the effects of structure-soil interaction, is summarized. The method is applicable to complex structures idealized as finite element systems and the soil region treated as either a continuum, for example as a viscoelastic halfspace, or idealized as a finite element system. The halfspace idealization permits reliable analysis for sites where essentially similar soils extend to large depths and there is no rigid boundary such as soil-rock interface. For sites where layers of soft soil are underlain by rock at shallow depth, finite element idealization of the soil region is appropriate; in this case, the direct and substructure methods would lead to equivalent results but the latter provides the better alternative. Treating the free field motion directly as the earthquake input in the substructure eliminates the deconvolution calculations and the related assumption-regarding type and direction of earthquake waves-required in the direct method. (Auth.)

  11. Modified prepubic TVT-obturator tape procedure versus the conventional method: a preliminary study.

    Science.gov (United States)

    Long, Cheng-Yu; Wu, Ming-Ping; Wang, Chiu-Lin; Lin, Kun-Ling; Liu, Cheng-Min; Wu, Shu-Hui; Juan, Yung-Shun

    2013-12-01

    To compare the efficacy and safety of the modified prepubic tension-free vaginal tape-obturator (PTVT-O) system procedure with the original TVT-O methods. One hundred and ninety women with urodynamic stress incontinence (USI) were included in this study (93 cases in the TVT-O group and 97 in the PTVT-O group). Clinical assessments before and one year after surgery included urinalyses, 1-h pad tests, urodynamic studies, and a personal interview with the overactive bladder symptom score (OABSS) questionnaire. There were no differences between the two groups in mean age, parity, menopausal status, mean operative time and subjective cure rates (P>0.05), but the efficacy of surgery (cure and improvement) in the PTVT-O group was significantly higher than that in the TVT-O group (P=0.038). Complication rates and visual analog scale (VAS) scores were found to be similar (P>0.05). OABSS decreased significantly after surgery in both groups (P0.05). Our modified procedure is a safe and effective treatment for female USI. It has an advantage over the original TVT-O with better surgical efficacy and comparable postoperative pain, although the follow-up times in this study are different. Copyright © 2013. Published by Elsevier Ireland Ltd.

  12. Method and apparatus for controlling a powertrain system including a multi-mode transmission

    Science.gov (United States)

    Hessell, Steven M.; Morris, Robert L.; McGrogan, Sean W.; Heap, Anthony H.; Mendoza, Gil J.

    2015-09-08

    A powertrain including an engine and torque machines is configured to transfer torque through a multi-mode transmission to an output member. A method for controlling the powertrain includes employing a closed-loop speed control system to control torque commands for the torque machines in response to a desired input speed. Upon approaching a power limit of a power storage device transferring power to the torque machines, power limited torque commands are determined for the torque machines in response to the power limit and the closed-loop speed control system is employed to determine an engine torque command in response to the desired input speed and the power limited torque commands for the torque machines.

  13. In-vitro evaluation of the accuracy of conventional and digital methods of obtaining full-arch dental impressions.

    Science.gov (United States)

    Ender, Andreas; Mehl, Albert

    2015-01-01

    To investigate the accuracy of conventional and digital impression methods used to obtain full-arch impressions by using an in-vitro reference model. Eight different conventional (polyether, POE; vinylsiloxanether, VSE; direct scannable vinylsiloxanether, VSES; and irreversible hydrocolloid, ALG) and digital (CEREC Bluecam, CER; CEREC Omnicam, OC; Cadent iTero, ITE; and Lava COS, LAV) full-arch impressions were obtained from a reference model with a known morphology, using a highly accurate reference scanner. The impressions obtained were then compared with the original geometry of the reference model and within each test group. A point-to-point measurement of the surface of the model using the signed nearest neighbour method resulted in a mean (10%-90%)/2 percentile value for the difference between the impression and original model (trueness) as well as the difference between impressions within a test group (precision). Trueness values ranged from 11.5 μm (VSE) to 60.2 μm (POE), and precision ranged from 12.3 μm (VSE) to 66.7 μm (POE). Among the test groups, VSE, VSES, and CER showed the highest trueness and precision. The deviation pattern varied with the impression method. Conventional impressions showed high accuracy across the full dental arch in all groups, except POE and ALG. Conventional and digital impression methods show differences regarding full-arch accuracy. Digital impression systems reveal higher local deviations of the full-arch model. Digital intraoral impression systems do not show superior accuracy compared to highly accurate conventional impression techniques. However, they provide excellent clinical results within their indications applying the correct scanning technique.

  14. Effect of amaranth dye on the growth and properties of conventional and SR method grown KAP single crystals

    Science.gov (United States)

    Babu Rao, G.; P., Rajesh; Ramasamy, P.

    2018-04-01

    The 0.1 mol% amaranth added KAP single crystals were grown from aqueous solutions by both slow evaporation solution technique and Sankaranarayanan-Ramasamy method. The single crystal having dimension of 45 mm length and 12 mm diameter was grown with growth rate of 1.5 mm/day using SR method. 87 % transmittance is obtained for SR method grown amaranth added KAP single crystal. The high intense luminescence at 661 nm is obtained from amaranth added conventional and SR method grown KAP single crystal. The amaranth added KAP single crystal possesses good mechanical and laser damage threshold stability.

  15. DNA extraction on bio-chip: history and preeminence over conventional and solid-phase extraction methods.

    Science.gov (United States)

    Ayoib, Adilah; Hashim, Uda; Gopinath, Subash C B; Md Arshad, M K

    2017-11-01

    This review covers a developmental progression on early to modern taxonomy at cellular level following the advent of electron microscopy and the advancement in deoxyribonucleic acid (DNA) extraction for expatiation of biological classification at DNA level. Here, we discuss the fundamental values of conventional chemical methods of DNA extraction using liquid/liquid extraction (LLE) followed by development of solid-phase extraction (SPE) methods, as well as recent advances in microfluidics device-based system for DNA extraction on-chip. We also discuss the importance of DNA extraction as well as the advantages over conventional chemical methods, and how Lab-on-a-Chip (LOC) system plays a crucial role for the future achievements.

  16. Quasimonochromatic x-ray computed tomography by the balanced filter method using a conventional x-ray source

    International Nuclear Information System (INIS)

    Saito, Masatoshi

    2004-01-01

    A quasimonochromatic x-ray computed tomography (CT) system utilizing balanced filters has recently been developed for acquiring quantitative CT images. This system consisted of basic components such as a conventional x-ray generator for radiography, a stage for mounting and rotating objects, and an x-ray line sensor camera. Metallic sheets of Er and Yb were used as the balanced filters for obtaining quasimonochromatic incident x rays that include the characteristic lines of the W Kα doublet from a tungsten target. The mean energy and energy width of the quasimonochromatic x rays were determined to be 59.0 and 1.9 keV, respectively, from x-ray spectroscopic measurements using a high-purity Ge detector. The usefulness of the present x-ray CT system was demonstrated by obtaining spatial distributions of the linear attenuation coefficients of three selected samples--a 20 cm diameter cylindrical water phantom, a 3.5 cm diameter aluminum rod, and a human head phantom. The results clearly indicate that this apparatus is surprisingly effective for estimating the distribution of the linear attenuation coefficients without any correction of the beam-hardening effect. Thus, implementing the balanced filter method on an x-ray CT scanner has promise in producing highly quantitative CT images

  17. A frequency domain linearized Navier-Stokes method including acoustic damping by eddy viscosity using RANS

    Science.gov (United States)

    Holmberg, Andreas; Kierkegaard, Axel; Weng, Chenyang

    2015-06-01

    In this paper, a method for including damping of acoustic energy in regions of strong turbulence is derived for a linearized Navier-Stokes method in the frequency domain. The proposed method is validated and analyzed in 2D only, although the formulation is fully presented in 3D. The result is applied in a study of the linear interaction between the acoustic and the hydrodynamic field in a 2D T-junction, subject to grazing flow at Mach 0.1. Part of the acoustic energy at the upstream edge of the junction is shed as harmonically oscillating disturbances, which are conveyed across the shear layer over the junction, where they interact with the acoustic field. As the acoustic waves travel in regions of strong shear, there is a need to include the interaction between the background turbulence and the acoustic field. For this purpose, the oscillation of the background turbulence Reynold's stress, due to the acoustic field, is modeled using an eddy Newtonian model assumption. The time averaged flow is first solved for using RANS along with a k-ε turbulence model. The spatially varying turbulent eddy viscosity is then added to the spatially invariant kinematic viscosity in the acoustic set of equations. The response of the 2D T-junction to an incident acoustic field is analyzed via a plane wave scattering matrix model, and the result is compared to experimental data for a T-junction of rectangular ducts. A strong improvement in the agreement between calculation and experimental data is found when the modification proposed in this paper is implemented. Discrepancies remaining are likely due to inaccuracies in the selected turbulence model, which is known to produce large errors e.g. for flows with significant rotation, which the grazing flow across the T-junction certainly is. A natural next step is therefore to test the proposed methodology together with more sophisticated turbulence models.

  18. Reliability and limitation of various diagnostic methods including nuclear medicine in myocardial disease

    International Nuclear Information System (INIS)

    Tokuyasu, Yoshiki; Kusakabe, Kiyoko; Yamazaki, Toshio

    1981-01-01

    Electrocardiography (ECG), echocardiography, nuclear method, cardiac catheterization, left ventriculography and endomyocardial biopsy (biopsy) were performed in 40 cases of cardiomyopathy (CM), 9 of endocardial fibroelastosis and 19 of specific heart muscle disease, and the usefulness and limitation of each method was comparatively estimated. In CM, various methods including biopsy were performed. The 40 patients were classified into 3 groups, i.e., hypertrophic (17), dilated (20) and non-hypertrophic.non-dilated (3) on the basis of left ventricular ejection fraction and hypertrophy of the ventricular wall. The hypertrophic group was divided into 4 subgroups: 9 septal, 4 apical, 2 posterior and 2 anterior. The nuclear study is useful in assessing the site of the abnormal ventricular thickening, perfusion defect and ventricular function. Echocardiography is most useful in detecting asymmetric septal hypertrophy. The biopsy gives the sole diagnostic clue, especially in non-hypertrophic.non-dilated cardiomyopathy. ECG is useful in all cases but correlation with the site of disproportional hypertrophy was not obtained. (J.P.N.)

  19. A method for including external feed in depletion calculations with CRAM and implementation into ORIGEN

    International Nuclear Information System (INIS)

    Isotalo, A.E.; Wieselquist, W.A.

    2015-01-01

    Highlights: • A method for handling external feed in depletion calculations with CRAM. • Source term can have polynomial or exponentially decaying time-dependence. • CRAM with source term and adjoint capability implemented to ORIGEN in SCALE. • The new solver is faster and more accurate than the original solver of ORIGEN. - Abstract: A method for including external feed with polynomial time dependence in depletion calculations with the Chebyshev Rational Approximation Method (CRAM) is presented and the implementation of CRAM to the ORIGEN module of the SCALE suite is described. In addition to being able to handle time-dependent feed rates, the new solver also adds the capability to perform adjoint calculations. Results obtained with the new CRAM solver and the original depletion solver of ORIGEN are compared to high precision reference calculations, which shows the new solver to be orders of magnitude more accurate. Furthermore, in most cases, the new solver is up to several times faster due to not requiring similar substepping as the original one

  20. Improved Riccati Transfer Matrix Method for Free Vibration of Non-Cylindrical Helical Springs Including Warping

    Directory of Open Access Journals (Sweden)

    A.M. Yu

    2012-01-01

    Full Text Available Free vibration equations for non-cylindrical (conical, barrel, and hyperboloidal types helical springs with noncircular cross-sections, which consist of 14 first-order ordinary differential equations with variable coefficients, are theoretically derived using spatially curved beam theory. In the formulation, the warping effect upon natural frequencies and vibrating mode shapes is first studied in addition to including the rotary inertia, the shear and axial deformation influences. The natural frequencies of the springs are determined by the use of improved Riccati transfer matrix method. The element transfer matrix used in the solution is calculated using the Scaling and Squaring method and Pad'e approximations. Three examples are presented for three types of springs with different cross-sectional shapes under clamped-clamped boundary condition. The accuracy of the proposed method has been compared with the FEM results using three-dimensional solid elements (Solid 45 in ANSYS code. Numerical results reveal that the warping effect is more pronounced in the case of non-cylindrical helical springs than that of cylindrical helical springs, which should be taken into consideration in the free vibration analysis of such springs.

  1. [Study on friction and wear properties of dental zirconia ceramics processed by microwave and conventional sintering methods].

    Science.gov (United States)

    Guoxin, Hu; Ying, Yang; Yuemei, Jiang; Wenjing, Xia

    2017-04-01

    This study evaluated the wear of an antagonist and friction and wear properties of dental zirconia ceramic that was subjected to microwave and conventional sintering methods. Ten specimens were fabricated from Lava brand zirconia and randomly assigned to microwave and conventional sintering groups. A profile tester for surface roughness was used to measure roughness of the specimens. Wear test was performed, and steatite ceramic was used as antagonist. Friction coefficient curves were recorded, and wear volume were calculated. Finally, optical microscope was used to observe the surface morphology of zirconia and steatite ceramics. Field emission scanning electron microscopy was used to observe the microstructure of zirconia. Wear volumes of microwave and conventionally sintered zirconia were (6.940±1.382)×10⁻², (7.952±1.815) ×10⁻² mm³, respectively. Moreover, wear volumes of antagonist after sintering by the considered methods were (14.189±4.745)×10⁻², (15.813±3.481)×10⁻² mm³, correspondingly. Statistically significant difference was not observed in the wear resistance of zirconia and wear volume of steatite ceramic upon exposure to two kinds of sintering methods. Optical microscopy showed that ploughed surfaces were apparent in zirconia. The wear surface of steatite ceramic against had craze, accompanied by plough. Scanning electron microscopy showed that zirconia was sintered compactly when subjected to both conventional sintering and microwave methods, whereas grains of zirconia sintered by microwave alone were smaller and more uniform. Two kinds of sintering methods are successfully used to produce dental zirconia ceramics with similar friction and wear properties.
.

  2. Engine including hydraulically actuated valvetrain and method of valve overlap control

    Science.gov (United States)

    Cowgill, Joel [White Lake, MI

    2012-05-08

    An exhaust valve control method may include displacing an exhaust valve in communication with the combustion chamber of an engine to an open position using a hydraulic exhaust valve actuation system and returning the exhaust valve to a closed position using the hydraulic exhaust valve actuation assembly. During closing, the exhaust valve may be displaced for a first duration from the open position to an intermediate closing position at a first velocity by operating the hydraulic exhaust valve actuation assembly in a first mode. The exhaust valve may be displaced for a second duration greater than the first duration from the intermediate closing position to a fully closed position at a second velocity at least eighty percent less than the first velocity by operating the hydraulic exhaust valve actuation assembly in a second mode.

  3. Flexible barrier film, method of forming same, and organic electronic device including same

    Science.gov (United States)

    Blizzard, John; Tonge, James Steven; Weidner, William Kenneth

    2013-03-26

    A flexible barrier film has a thickness of from greater than zero to less than 5,000 nanometers and a water vapor transmission rate of no more than 1.times.10.sup.-2 g/m.sup.2/day at 22.degree. C. and 47% relative humidity. The flexible barrier film is formed from a composition, which comprises a multi-functional acrylate. The composition further comprises the reaction product of an alkoxy-functional organometallic compound and an alkoxy-functional organosilicon compound. A method of forming the flexible barrier film includes the steps of disposing the composition on a substrate and curing the composition to form the flexible barrier film. The flexible barrier film may be utilized in organic electronic devices.

  4. Structural and electrical properties of copper-nickel-aluminum alloys obtained by conventional powder metallurgy method

    International Nuclear Information System (INIS)

    Monteiro, Waldemar A.; Carrio, Juan A.G.; Silveira, C.R. da; Pertile, H.K.S.

    2009-01-01

    This work looked for to search out systematically, in scale of laboratory, copper-nickel-aluminum alloys (Cu-Ni-Al) with conventional powder metallurgy processing, in view of the maintenance of the electric and mechanical properties with the intention of getting electric connectors of high performance or high mechanical damping. After cold uniaxial pressing (1000 kPa), sintering (780 deg C) and convenient homogenization treatments (500 deg C for different times) under vacuum (powder metallurgy), the obtained Cu-Ni-Al alloys were characterized by optical microscopy, electrical conductivity, Vickers hardness. X rays powder diffraction data were collected for the sintered samples in order to a structural and microstructural analysis. The comparative analysis is based on the sintered density, hardness, macrostructures and microstructures of the samples. (author)

  5. The Evaluation of Conventional X-ray Exposure Parameters Including Tube Voltage and Exposure Time in Private and Governmental Hospitals of Lorestan Province, Iran

    Directory of Open Access Journals (Sweden)

    Mehrdad Gholami

    2015-07-01

    Full Text Available Introduction In radiography, dose and image quality are dependent on radiographic parameters. The problem is caused from incorrect use of radiography equipment and from the radiation exposure to patients much more than required. Therefore, the aim of this study was to implement a quality-control program to detect changes in exposure parameters, which may affect diagnosis or patient radiation dose. Materials and Methods This cross-sectional study was performed on seven stationary X-ray units in sixhospitals of Lorestan province. The measurements were performed, using a factory-calibrated Barracuda dosimeter (model: SE-43137. Results According to the results, the highest output was obtained in A Hospital (M1 device, ranging from 107×10-3 to 147×10-3 mGy/mAs. The evaluation of tube voltage accuracy showed a deviation from the standard value, which ranged between 0.81% (M1 device and 17.94% (M2 device at A Hospital. The deviation ranges at other hospitals were as follows: 0.30-27.52% in B Hospital (the highest in this study, 8.11-20.34% in C Hospital, 1.68-2.58% in D Hospital, 0.90-2.42% in E Hospital and 0.10-1.63% in F Hospital. The evaluation of exposure time accuracy showed that E, C, D and A (M2 device hospitals complied with the requirements (allowing a deviation of ±5%, whereas A (M1 device, F and B hospitals exceeded the permitted limit. Conclusion The results of this study showed that old X-ray equipments with poor or no maintenance are probably the main sources of reducing radiographic image quality and increasing patient radiation dose.

  6. Zirconium-based alloys, nuclear fuel rods and nuclear reactors including such alloys, and related methods

    Science.gov (United States)

    Mariani, Robert Dominick

    2014-09-09

    Zirconium-based metal alloy compositions comprise zirconium, a first additive in which the permeability of hydrogen decreases with increasing temperatures at least over a temperature range extending from 350.degree. C. to 750.degree. C., and a second additive having a solubility in zirconium over the temperature range extending from 350.degree. C. to 750.degree. C. At least one of a solubility of the first additive in the second additive over the temperature range extending from 350.degree. C. to 750.degree. C. and a solubility of the second additive in the first additive over the temperature range extending from 350.degree. C. to 750.degree. C. is higher than the solubility of the second additive in zirconium over the temperature range extending from 350.degree. C. to 750.degree. C. Nuclear fuel rods include a cladding material comprising such metal alloy compositions, and nuclear reactors include such fuel rods. Methods are used to fabricate such zirconium-based metal alloy compositions.

  7. Supercritical CO2 Extracts and Volatile Oil of Basil (Ocimum basilicum L. Comparison with Conventional Methods

    Directory of Open Access Journals (Sweden)

    José Coelho

    2018-03-01

    Full Text Available Interest in new products from aromatic plants as medical and nutritional compounds is increasing. The aim of this work was to apply different extraction methods, including the use of supercritical carbon dioxide extraction, and to test the antioxidant activity of basil (Ocimum basilicum L. extracts. In vitro efficacy assessments were performed using enzymatic assays. Essential oil obtained by hydrodistillation and volatile oil obtained from supercritical fluid extraction were analyzed by gas chromatography to quantify components. The total phenolic content in the extracts ranged from 35.5 ± 2.9 to 85.3 ± 8.6 mg of gallic acid equivalents and the total flavonoid content ranged from 35.5 ± 2.9 to 93.3 ± 3.9 micromole catechin equivalents per gram of dry weight of extract. All the extracts showed an antioxidant activity with 2,2-diphenyl-1-picrylhydrazyl (DPPH, 2,2-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid (ABTS, and the reducing power test. Extracts obtained from methanol had a higher antioxidant capacity per the DPPH test results (IC50 = 3.05 ± 0.36 mg/mL and the reducing power test assay 306.8 ± 21.8 μmol of trolox equivalents per gram of extract (TE/g compared with ethanolic or supercritical fluid extracts. However, using the ABTS assay, the extract obtained by supercritical fluid extraction had a higher antioxidant capacity with an IC50 of 1.74 ± 0.05 mg/mL. Finally, the examined extracts showed practically no acetylcholinesterase (AChE inhibitory capacity and a slight inhibitory activity against tyrosinase.

  8. Comparison of the Lysis Centrifugation Method with the Conventional Blood Culture Method in Cases of Sepsis in a Tertiary Care Hospital

    OpenAIRE

    Parikh, Harshal R; De, Anuradha S; Baveja, Sujata M

    2012-01-01

    Introduction : Physicians and microbiologists have long recognized that the presence of living microorganisms in the blood of a patient carries with it considerable morbidity and mortality. Hence, blood cultures have become critically important and frequently performed test in clinical microbiology laboratories for diagnosis of sepsis. Objectives: To compare the conventional blood culture method with the lysis centrifugation method in cases of sepsis. Materials and Methods: Two hundred ...

  9. SELECTION OF NON-CONVENTIONAL MACHINING PROCESSES USING THE OCRA METHOD

    Directory of Open Access Journals (Sweden)

    Miloš Madić

    2015-04-01

    Full Text Available Selection of the most suitable nonconventional machining process (NCMP for a given machining application can be viewed as multi-criteria decision making (MCDM problem with many conflicting and diverse criteria. To aid these selection processes, different MCDM methods have been proposed. This paper introduces the use of an almost unexplored MCDM method, i.e. operational competitiveness ratings analysis (OCRA method for solving the NCMP selection problems. Applicability, suitability and computational procedure of OCRA method have been demonstrated while solving three case studies dealing with selection of the most suitable NCMP. In each case study the obtained rankings were compared with those derived by the past researchers using different MCDM methods. The results obtained using the OCRA method have good correlation with those derived by the past researchers which validate the usefulness of this method while solving complex NCMP selection problems.

  10. Comparison of a radiometric method (BACTEC) and conventional culture media for recovery of mycobacteria from smear-negative specimens

    International Nuclear Information System (INIS)

    Morgan, M.A.; Horstmeier, C.D.; DeYoung, D.R.; Roberts, G.D.

    1983-01-01

    The BACTEC system and three conventional media (Middlebrook 7H10, selective Middlebrook 7H11 [S7H11], and Lowenstein-Jensen [LJ] were compared for their mean recovery times and recovery rates of mycobacteria from acid-fast, smear-negative clinical specimens. Of the 71 smear-negative, culture-positive specimens recovered from 2,165 submitted smear-negative cultures, the BACTEC system detected 71.8%, compared with 88.7% for the conventional three-medium system. When media were individually compared, BACTEC medium (Middlebrook 7H12) was more successful in recovering mycobacteria (71.8%) than was LJ (62%), Middlebrook medium 7H10 (55.9%), or Middlebrook S7H11 medium (52.1%). Middlebrook 7H11 medium containing sodium selenate was also evaluated and did not increase the recovery rate or decrease the recovery time of mycobacterial species when compared with LJ, Middlebrook 7H10, S7H11, and 7H12 media. The mean detection time for the BACTEC system was less than that by conventional methods for the seven species of mycobacteria recovered. Detection times for Mycobacterium tuberculosis on the BACTEC system and conventional cultural systems were 13.7 and 26.3 days, respectively

  11. Comparative Analysis of Conventional Method with Activity Based Costing in PT Mulia Sejati Gallery

    OpenAIRE

    Erena, Irma Nadia; Gani, Engelwati

    2016-01-01

    The goal of this research was to provide readers the information about the calculation methods, both traditional and activity-based costing in the application of the cost of production. The method used in this research was the qualitative method. The analysis was done by calculating the amount of the production cost using the traditional system and the magnitude of the production cost when using the activity-based costing system. The amount of each acquisition was then performed into data ana...

  12. National implementation of the UNECE convention on long-range transboundary air pollution (effects). Pt. 1. Deposition loads: methods, modelling and mapping results, trends

    Energy Technology Data Exchange (ETDEWEB)

    Gauger, Thomas [Federal Agricultural Research Centre, Braunschweig (DE). Inst. of Agroecology (FAL-AOE); Stuttgart Univ. (Germany). Inst. of Navigation; Haenel, Hans-Dieter; Roesemann, Claus [Federal Agricultural Research Centre, Braunschweig (DE). Inst. of Agroecology (FAL-AOE)

    2008-09-15

    The report on the implementation of the UNECE convention on long-range transboundary air pollution Pt.1, deposition loads (methods, modeling and mapping results, trends) includes the following chapters: Introduction, deposition on air pollutants used for the input for critical loads in exceeding calculations, methods applied for mapping total deposition loads, mapping wet deposition, wet deposition mapping results, mapping dry deposition, dry deposition mapping results, cloud and fog mapping results, total deposition mapping results, modeling the air concentration of acidifying components and heavy metals, agricultural emissions of acidifying and eutrophying species.

  13. Comparison of methods used to estimate conventional undiscovered petroleum resources: World examples

    Science.gov (United States)

    Ahlbrandt, T.S.; Klett, T.R.

    2005-01-01

    Various methods for assessing undiscovered oil, natural gas, and natural gas liquid resources were compared in support of the USGS World Petroleum Assessment 2000. Discovery process, linear fractal, parabolic fractal, engineering estimates, PETRIMES, Delphi, and the USGS 2000 methods were compared. Three comparisons of these methods were made in: (1) the Neuquen Basin province, Argentina (different assessors, same input data); (2) provinces in North Africa, Oman, and Yemen (same assessors, different methods); and (3) the Arabian Peninsula, Arabian (Persian) Gulf, and North Sea (different assessors, different methods). A fourth comparison (same assessors, same assessment methods but different geologic models), between results from structural and stratigraphic assessment units in the North Sea used only the USGS 2000 method, and hence compared the type of assessment unit rather than the method. In comparing methods, differences arise from inherent differences in assumptions regarding: (1) the underlying distribution of the parent field population (all fields, discovered and undiscovered), (2) the population of fields being estimated; that is, the entire parent distribution or the undiscovered resource distribution, (3) inclusion or exclusion of large outlier fields; (4) inclusion or exclusion of field (reserve) growth, (5) deterministic or probabilistic models, (6) data requirements, and (7) scale and time frame of the assessment. Discovery process, Delphi subjective consensus, and the USGS 2000 method yield comparable results because similar procedures are employed. In mature areas such as the Neuquen Basin province in Argentina, the linear and parabolic fractal and engineering methods were conservative compared to the other five methods and relative to new reserve additions there since 1995. The PETRIMES method gave the most optimistic estimates in the Neuquen Basin. In less mature areas, the linear fractal method yielded larger estimates relative to other methods

  14. Second-principles method for materials simulations including electron and lattice degrees of freedom

    Science.gov (United States)

    García-Fernández, Pablo; Wojdeł, Jacek C.; Íñiguez, Jorge; Junquera, Javier

    2016-05-01

    We present a first-principles-based (second-principles) scheme that permits large-scale materials simulations including both atomic and electronic degrees of freedom on the same footing. The method is based on a predictive quantum-mechanical theory—e.g., density functional theory—and its accuracy can be systematically improved at a very modest computational cost. Our approach is based on dividing the electron density of the system into a reference part—typically corresponding to the system's neutral, geometry-dependent ground state—and a deformation part—defined as the difference between the actual and reference densities. We then take advantage of the fact that the bulk part of the system's energy depends on the reference density alone; this part can be efficiently and accurately described by a force field, thus avoiding explicit consideration of the electrons. Then, the effects associated to the difference density can be treated perturbatively with good precision by working in a suitably chosen Wannier function basis. Further, the electronic model can be restricted to the bands of interest. All these features combined yield a very flexible and computationally very efficient scheme. Here we present the basic formulation of this approach, as well as a practical strategy to compute model parameters for realistic materials. We illustrate the accuracy and scope of the proposed method with two case studies, namely, the relative stability of various spin arrangements in NiO (featuring complex magnetic interactions in a strongly-correlated oxide) and the formation of a two-dimensional electron gas at the interface between band insulators LaAlO3 and SrTiO3 (featuring subtle electron-lattice couplings and screening effects). We conclude by discussing ways to overcome the limitations of the present approach (most notably, the assumption of a fixed bonding topology), as well as its many envisioned possibilities and future extensions.

  15. Teaching Dental Students to Understand the Temporomandibular Joint Using MRI: Comparison of Conventional and Digital Learning Methods.

    Science.gov (United States)

    Arús, Nádia A; da Silva, Átila M; Duarte, Rogério; da Silveira, Priscila F; Vizzotto, Mariana B; da Silveira, Heraldo L D; da Silveira, Heloisa E D

    2017-06-01

    The aims of this study were to evaluate and compare the performance of dental students in interpreting the temporomandibular joint (TMJ) with magnetic resonance imaging (MRI) scans using two learning methods (conventional and digital interactive learning) and to examine the usability of the digital learning object (DLO). The DLO consisted of tutorials about MRI and anatomic and functional aspects of the TMJ. In 2014, dental students in their final year of study who were enrolled in the elective "MRI Interpretation of the TMJ" course comprised the study sample. After exclusions for nonattendance and other reasons, 29 of the initial 37 students participated in the study, for a participation rate of 78%. The participants were divided into two groups: a digital interactive learning group (n=14) and a conventional learning group (n=15). Both methods were assessed by an objective test applied before and after training and classes. Aspects such as support and training requirements, complexity, and consistency of the DLO were also evaluated using the System Usability Scale (SUS). A significant between-group difference in the posttest results was found, with the conventional learning group scoring better than the DLO group, indicated by mean scores of 9.20 and 8.11, respectively, out of 10. However, when the pretest and posttest results were compared, both groups showed significantly improved performance. The SUS score was 89, which represented a high acceptance of the DLO by the users. The students who used the conventional method of learning showed superior performance in interpreting the TMJ using MRI compared to the group that used digital interactive learning.

  16. Determination of in vitro susceptibility of Mycobacterium tuberculosis to cephalosporins by radiometric and conventional methods

    International Nuclear Information System (INIS)

    Heifets, L.B.; Iseman, M.D.; Cook, J.L.; Lindholm-Levy, P.J.; Drupa, I.

    1985-01-01

    Among eight cephalosporins and cephamycins tested in preliminary in vitro screening against Mycobacterium tuberculosis, the most promising for further study was found to be ceforanide, followed by ceftizoxime, cephapirin, and cefotaxime. Moxalactam, cefoxitin, cefamandole, and cephalothin were found to be not active enough against M. tuberculosis to be considered for further in vitro studies. The antibacterial activity of various ceforanide concentrations was investigated by three methods: (i) the dynamics of radiometric readings (growth index) in 7H12 broth; (ii) the number of CFU in the same medium; and (iii) the proportion method on 7H11 agar plates. There was a good correlation among the results obtained with these methods. The MIC for most strains ranged from 6.0 to 25.0 micrograms/ml. The BACTEC radiometric method is a reliable, rapid, and convenient method for preliminary screening and determination of the level of antibacterial activity of drugs not commonly used against M. tuberculosis

  17. Comparative study of age estimation using dentinal translucency by digital and conventional methods

    Science.gov (United States)

    Bommannavar, Sushma; Kulkarni, Meena

    2015-01-01

    Introduction: Estimating age using the dentition plays a significant role in identification of the individual in forensic cases. Teeth are one of the most durable and strongest structures in the human body. The morphology and arrangement of teeth vary from person-to-person and is unique to an individual as are the fingerprints. Therefore, the use of dentition is the method of choice in the identification of the unknown. Root dentin translucency is considered to be one of the best parameters for dental age estimation. Traditionally, root dentin translucency was measured using calipers. Recently, the use of custom built software programs have been proposed for the same. Objectives: The present study describes a method to measure root dentin translucency on sectioned teeth using a custom built software program Adobe Photoshop 7.0 version (Adobe system Inc, Mountain View California). Materials and Methods: A total of 50 single rooted teeth were sectioned longitudinally to derive a 0.25 mm uniform thickness and the root dentin translucency was measured using digital and caliper methods and compared. The Gustafson's morphohistologic approach is used in this study. Results: Correlation coefficients of translucency measurements to age were statistically significant for both the methods (P < 0.125) and linear regression equations derived from both methods revealed better ability of the digital method to assess age. Conclusion: The custom built software program used in the present study is commercially available and widely used image editing software. Furthermore, this method is easy to use and less time consuming. The measurements obtained using this method are more precise and thus help in more accurate age estimation. Considering these benefits, the present study recommends the use of digital method to assess translucency for age estimation. PMID:25709325

  18. Applicability of a panel method, which includes nonlinear effects, to a forward-swept-wing aircraft

    Science.gov (United States)

    Ross, J. C.

    1984-01-01

    The ability of a lower order panel method VSAERO, to accurately predict the lift and pitching moment of a complete forward-swept-wing/canard configuration was investigated. The program can simulate nonlinear effects including boundary-layer displacement thickness, wake roll up, and to a limited extent, separated wakes. The predictions were compared with experimental data obtained using a small-scale model in the 7- by 10- Foot Wind Tunnel at NASA Ames Research Center. For the particular configuration under investigation, wake roll up had only a small effect on the force and moment predictions. The effect of the displacement thickness modeling was to reduce the lift curve slope slightly, thus bringing the predicted lift into good agreement with the measured value. Pitching moment predictions were also improved by the boundary-layer simulation. The separation modeling was found to be sensitive to user inputs, but appears to give a reasonable representation of a separated wake. In general, the nonlinear capabilities of the code were found to improve the agreement with experimental data. The usefullness of the code would be enhanced by improving the reliability of the separated wake modeling and by the addition of a leading edge separation model.

  19. Methods of forming aluminum oxynitride-comprising bodies, including methods of forming a sheet of transparent armor

    Science.gov (United States)

    Chu, Henry Shiu-Hung [Idaho Falls, ID; Lillo, Thomas Martin [Idaho Falls, ID

    2008-12-02

    The invention includes methods of forming an aluminum oxynitride-comprising body. For example, a mixture is formed which comprises A:B:C in a respective molar ratio in the range of 9:3.6-6.2:0.1-1.1, where "A" is Al.sub.2O.sub.3, "B" is AlN, and "C" is a total of one or more of B.sub.2O.sub.3, SiO.sub.2, Si--Al--O--N, and TiO.sub.2. The mixture is sintered at a temperature of at least 1,600.degree. C. at a pressure of no greater than 500 psia effective to form an aluminum oxynitride-comprising body which is at least internally transparent and has at least 99% maximum theoretical density.

  20. Consumer acceptance and aroma characterization of navy bean (Phaseolus vulgaris) powders prepared by extrusion and conventional processing methods.

    Science.gov (United States)

    Szczygiel, Edward J; Harte, Janice B; Strasburg, Gale M; Cho, Sungeun

    2017-09-01

    Food products produced with bean ingredients are gaining in popularity among consumers due to the reported health benefits. Navy bean (Phaseolus vulgaris) powder produced through extrusion can be considered as a resource-efficient alternative to conventional methods, which often involve high water inputs. Therefore, navy bean powders produced with extrusion and conventional methods were assessed for the impact of processing on consumer liking in end-use products and odor-active compounds. Consumer acceptance results reveal significant differences in flavor, texture and overall acceptance scores of several products produced with navy bean powder. Crackers produced with extruded navy bean powder received higher hedonic flavor ratings than those produced with commercial navy bean powder (P < 0.001). GC-O data showed that the commercial powder produced through conventional processing had much greater contents of several aliphatic aldehydes commonly formed via lipid oxidation, such as hexanal, octanal and nonanal with descriptors of 'grassy', 'nutty', 'fruity', 'dusty', and 'cleaner', compared to the extruded powder. Extrusion processed navy bean powders were preferred over commercial powders for certain navy bean powder applications. This is best explained by substantial differences in aroma profiles of the two powders that may have been caused by lipid oxidation. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  1. Prospective, Double-Blind Evaluation of Umbilicoplasty Techniques Using Conventional and Crowdsourcing Methods

    NARCIS (Netherlands)

    Veldhuisen, C.L. Van; Kamali, P.; Wu, W.; Becherer, B.E.; Sinno, H.H.; Ashraf, A.A.; Ibrahim, A.M.S.; Tobias, A.; Lee, B.T.; Lin, S.J.

    2017-01-01

    BACKGROUND: Umbilical reconstruction is an important component of deep inferior epigastric perforator (DIEP) flap breast reconstruction. This study evaluated the aesthetics of three different umbilical reconstruction techniques during DIEP flap breast reconstruction. METHODS: From January to April

  2. An overview on the conventional and nonconventional methods for manufacturing the metallic glasses

    Directory of Open Access Journals (Sweden)

    Axinte Eugen

    2017-01-01

    Full Text Available Metallic glasses (MGs, first discovered in 1959 at Caltech are currently among the most studied metallic materials. MGs called also glassy metals, amorphous metals, liquid metals, are considered to be among the materials of the future. The “classic” methods for industrialization of MGs are : end-casting in copper molds and protected environment, die forging , atomization for obtaining MG powder ,selective laser melting , imprinting in molds, thermoplastic shaping in the super-cooled temperature region. These methods are suitable for producing high value-added precision components but the problems still exists: expensive tools, limited lifetime of tools and the occurring of crystallization. Actually methods (thermoplastic shaping, casting and die forging are limited by the low flexibility of production and by higher costs of tools and accessories. More suitable methods are greatly desired to machine MGs for their wider applications.

  3. Conventional methods fail to measure cp(omega) of glass-forming liquids

    DEFF Research Database (Denmark)

    Christensen, Tage Emil; Olsen, Niels Boye; Dyre, Jeppe

    2007-01-01

    thermal-wave method does not measure the isobaric frequency-dependent specific heat cp(omega). This method rather measures a "longitudinal" frequency-dependent specific heat, a quantity defined and detailed here that is in between cp(omega) and cV(omega). This result means that no reliable wide......-frequency measurements of cp(omega) on liquids approaching the calorimetric glass transition exist. We briefly discuss consequences for experiment....

  4. Detection of Staphylococcus aureus among coagulase positive staphylococci from animal origin based on conventional and molecular methods

    Directory of Open Access Journals (Sweden)

    Nikolina Velizarova Rusenova

    2017-03-01

    Full Text Available The present study aimed to detect Staphylococcus aureus (S. aureus among other coagulase positive staphylococci from animal origin by using conventional methods (biochemical tests and latex agglutination and a molecular method, based on the nuc gene, as the gold standard and to assess the usefulness of these methods. For this purpose, total of 344 staphylococcal isolates were collected and analysed. A total of 156 isolates suspicious for S. aureus were detected by a conventional biochemical method – 88 from cows, 18 from goats, 7 from pigs, 17 from poultry, 7 from rabbits and 19 from dogs. The majority of S. aureus strains gave typical biochemical reactions with the exception of 30 (19.2% and 25 (16% that were VP negative and weak positive in fermenting mannitol, respectively. Twelve strains were found to be non-haemolytic (7.7% and four strains did not ferment trehalose (2.6%. Other staphylococci were identified as S. pseudintermedius (n = 103, S. hyicus (n = 23 and the rest were coagulase-negative staphylococci. Latex agglutination test resulted in rapid positive reactions with S. aureus with exception of 5 strains (3.2% from cow mastitis milk. Positive agglutination reactions were also established with S. pseudintermedius, and S. hyicus. PCR confirmed all strains that were preliminary identified as S. aureus by amplification of 270 bp fragment of nuc gene specific for this species. The atypical reactions in certain strains established in this study have shown that the precise detection of S. aureus from animal origin should be done by combination of conventional and molecular methods.

  5. A non-conventional watershed partitioning method for semi-distributed hydrological modelling: the package ALADHYN

    Science.gov (United States)

    Menduni, Giovanni; Pagani, Alessandro; Rulli, Maria Cristina; Rosso, Renzo

    2002-02-01

    The extraction of the river network from a digital elevation model (DEM) plays a fundamental role in modelling spatially distributed hydrological processes. The present paper deals with a new two-step procedure based on the preliminary identification of an ideal drainage network (IDN) from contour lines through a variable mesh size, and the further extraction of the actual drainage network (AND) from the IDN using land morphology. The steepest downslope direction search is used to identify individual channels, which are further merged into a network path draining to a given node of the IDN. The contributing area, peaks and saddles are determined by means of a steepest upslope direction search. The basin area is thus partitioned into physically based finite elements enclosed by irregular polygons. Different methods, i.e. the constant and variable threshold area methods, the contour line curvature method, and a topologic method descending from the Hortonian ordering scheme, are used to extract the ADN from the IDN. The contour line curvature method is shown to provide the most appropriate method from a comparison with field surveys. Using the ADN one can model the hydrological response of any sub-basin using a semi-distributed approach. The model presented here combines storm abstraction by the SCS-CN method with surface runoff routing as a geomorphological dispersion process. This is modelled using the gamma instantaneous unit hydrograph as parameterized by river geomorphology. The results are implemented using a project-oriented software facility for the Analysis of LAnd Digital HYdrological Networks (ALADHYN).

  6. Comparative Analysis Of Conventional Method With Activity Based Costing In PT Mulia Sejati Gallery

    Directory of Open Access Journals (Sweden)

    Irma Nadia Erena

    2016-09-01

    Full Text Available The goal of this research was to provide readers the information about the calculation methods, both traditional and activity-based costing in the application of the cost of production. The method used in this research was the qualitative method. The analysis was done by calculating the amount of the production cost using the traditional system and the magnitude of the production cost when using the activity-based costing system. The amount of each acquisition was then performed into data analysis. The results achieved are massive distortion between the calculations using traditional systems and activity based costing system. The conclusions of the whole thesis are activity-based costing system is considered more relevant than traditional systems that are currently used by the company.

  7. Comparison of accuracies of an intraoral spectrophotometer and conventional visual method for shade matching using two shade guide systems.

    Science.gov (United States)

    Parameswaran, Vidhya; Anilkumar, S; Lylajam, S; Rajesh, C; Narayan, Vivek

    2016-01-01

    This in vitro study compared the shade matching abilities of an intraoral spectrophotometer and the conventional visual method using two shade guides. The results of previous investigations between color perceived by human observers and color assessed by instruments have been inconclusive. The objectives were to determine accuracies and interrater agreement of both methods and effectiveness of two shade guides with either method. In the visual method, 10 examiners with normal color vision matched target control shade tabs taken from the two shade guides (VITAPAN Classical™ and VITAPAN 3D Master™) with other full sets of the respective shade guides. Each tab was matched 3 times to determine repeatability of visual examiners. The spectrophotometric shade matching was performed by two independent examiners using an intraoral spectrophotometer (VITA Easyshade™) with five repetitions for each tab. Results revealed that visual method had greater accuracy than the spectrophotometer. The spectrophotometer; however, exhibited significantly better interrater agreement as compared to the visual method. While VITAPAN Classical shade guide was more accurate with the spectrophotometer, VITAPAN 3D Master shade guide proved better with visual method. This in vitro study clearly delineates the advantages and limitations of both methods. There were significant differences between the methods with the visual method producing more accurate results than the spectrophotometric method. The spectrophotometer showed far better interrater agreement scores irrespective of the shade guide used. Even though visual shade matching is subjective, it is not inferior and should not be underrated. Judicious combination of both techniques is imperative to attain a successful and esthetic outcome.

  8. A Predictive-Control-Based Over-Modulation Method for Conventional Matrix Converters

    DEFF Research Database (Denmark)

    Zhang, Guanguan; Yang, Jian; Sun, Yao

    2018-01-01

    To increase the voltage transfer ratio of the matrix converter and improve the input/output current performance simultaneously, an over-modulation method based on predictive control is proposed in this paper, where the weighting factor is selected by an automatic adjusting mechanism, which is able...... to further enhance the system performance promptly. This method has advantages like the maximum voltage transfer ratio can reach 0.987 in the experiments; the total harmonic distortion of the input and output current are reduced, and the losses in the matrix converter are decreased. Moreover, the specific...

  9. Alternative sintering methods compared to conventional thermal sintering for inkjet printed silver nanoparticle ink

    NARCIS (Netherlands)

    Niittynen, J.; Abbel, R.; Mäntysalo, M.; Perelaer, J.; Schubert, U.S.; Lupo, D.

    2014-01-01

    In this contribution several alternative sintering methods are compared to traditional thermal sintering as high temperature and long process time of thermal sintering are increasing the costs of inkjet-printing and preventing the use of this technology in large scale manufacturing. Alternative

  10. A comparison of new and conventional methods for quantification of tooth color

    NARCIS (Netherlands)

    Burgt, van der T.P.; Bosch, ten J.J.; Borsboom, P.C.F.; Kortsmit, W.J.P.M.

    1990-01-01

    Tooth color is caused by volume reflection, that is, passage of incident light through the tooth followed by backward emergence. This passage is concurrent with sideward displacement of photons that, in effect, influences the result of usual instrumental methods of determining tooth color. This

  11. Near infrared spectrometry for faecal fat measurement: comparison with conventional gravimetric and titrimetric methods.

    Science.gov (United States)

    Benini, L; Caliari, S; Guidi, G C; Vaona, B; Talamini, G; Vantini, I; Scuro, L A

    1989-01-01

    This investigation was aimed at comparing a new method for measuring faecal fat excretion, carried out with a semi-automated instrument by using near infrared analysis (NIRA), with the traditional titrimetric (Van de Kamer) and gravimetric (Sobel) methods. Near infrared analysis faecal fat was assayed on the three day stool collection from 118 patients (68 chronic pancreatitis, 19 organic diseases of the gastrointestinal tract, 19 alcoholic liver disease, 12 functional gastrointestinal disorders). A strict linear correlation was found between NIRA and both the titrimetric (r = 0.928, p less than 0.0001) and the gravimetric (r = 0.971, p less than 0.0001) methods. On homogenised faeces, a mean coefficient of variation of 2.1 (SD 1.71)% was found. Before homogenisation (where a mean coefficient of variation of 7% was found) accurate results were obtained when the mean of five measurements was considered. In conclusion, the assay of faecal fat excretion by the near infrared reflessometry appears a simple, rapid and reliable method for measuring steatorrhoea. PMID:2583563

  12. Rapid descriptive sensory methods – Comparison of Free Multiple Sorting, Partial Napping, Napping, Flash Profiling and conventional profiling

    DEFF Research Database (Denmark)

    Dehlholm, Christian; Brockhoff, Per B.; Meinert, Lene

    2012-01-01

    is a modal restriction of Napping to specific sensory modalities, directing sensation and still allowing a holistic approach to products. The new methods are compared to Flash Profiling, Napping and conventional descriptive sensory profiling. Evaluations are performed by several panels of expert assessors......Two new rapid descriptive sensory evaluation methods are introduced to the field of food sensory evaluation. The first method, free multiple sorting, allows subjects to perform ad libitum free sortings, until they feel that no more relevant dissimilarities among products remain. The second method...... are applied for the graphical validation and comparisons. This allows similar comparisons and is applicable to single-block evaluation designs such as Napping. The partial Napping allows repetitions on multiple sensory modalities, e.g. appearance, taste and mouthfeel, and shows the average...

  13. MANIKIN DEMONSTRATION IN TEACHING CONSERVATIVE MANAGEMENT OF POSTPARTUM HAEMORRHAGE: A COMPARISON WITH CONVENTIONAL METHODS

    Directory of Open Access Journals (Sweden)

    Sathi Mangalam Saraswathi

    2016-07-01

    Full Text Available BACKGROUND Even though there are many innovative methods to make classes more interesting and effective, in my department, topics are taught mainly by didactic lectures. This study attempts to compare the effectiveness of manikin demonstration and didactic lectures in teaching conservative management of post-partum haemorrhage. OBJECTIVE To compare the effectiveness of manikin demonstration and didactic lectures in teaching conservative management of postpartum haemorrhage. MATERIALS AND METHODS This is an observational study. Eighty four ninth-semester MBBS students posted in Department of Obstetrics and Gynaecology, Government Medical College, Kottayam were selected. They were divided into 2 groups by lottery method. Pre-test was conducted for both groups. Group A was taught by manikin demonstration. Group B was taught by didactic lecture. Feedback response from the students collected after demonstration class was analysed. Post-test was conducted for both the groups after one week. Gain in knowledge of both the groups were calculated from pre-test and post-test scores and compared by Independent sample t test. RESULTS The mean gain in knowledge in group A was 6.4 when compared to group B which is 4.3 and the difference was found to be statistically significant. All of the students in group A felt satisfied and more confident after the class and wanted more topics to be taken by demonstration. CONCLUSION Manikin demonstration class is more effective in teaching conservative management of post-partum haemorrhage and this method can be adopted to teach similar topics in clinical subjects.

  14. Dry matter genotypes of Cynodon by microwave and conventional oven methods

    Directory of Open Access Journals (Sweden)

    Euclides Reuter de Oliveira

    2013-02-01

    Full Text Available The aimed of this work was to comparing the drying process in a microwave oven and forced air ventilation, as well as their effects on the chemical composition of different genotypes of the genus Cynodon (Tifton 85, Jiggs, Russell, Tifton 68 and Vaquero collected at different ages cutting (28, 48, 63 and 79 days. The experimental design was a randomized block in a split-plot design, with 4 replicates. There was no difference (P>0.05 between the methods analyzed on the chemical composition of the genotypes studied. Increasing age cutoff negatively influenced (P<0.05 the crude protein content of the different plant parts. A significant increase (P<0.05 of dry matter, neutral detergent fiber, acid detergent fiber and dry matter production was observed with increasing age cut. The use of the microwave oven is a quick and precise method obtain the dry matter content of the fodder showing efficiency similar to the method of drying in an oven with forced air circulation. The genotypes showed better chemical composition results when handled at age 28 days.

  15. Comparison of conventional and bio-treated methods as dust suppressants.

    Science.gov (United States)

    Naeimi, Maryam; Chu, Jian

    2017-10-01

    Dust is an environmental, geotechnical, health, and economical hazard. Fugitive dust emanating along transportation systems such as roads, railways, and airports especially can have significant impacts on health, safety, material loss, cost of maintenance, and interfere with the facilities. Quantitative studies on the effectiveness of the proper dust palliatives and their environmental impact have been studied with a number of biological and chemical methods. The objective of this study was to establish a method for using the microbial Induced calcium carbonate precipitation (MICP) approach to reduce the percent of mass loss against erosive force of wind regarding to the concentration and characteristics of aggregate used, climate, and traffic amounts. The results of this study showed that the required precipitation for dust control of sand by 70% is less than 15 g CaCO 3 /m 2 between sand grains in bio-treated sand. The wind tunnel test results of this study also indicate that the effectiveness of the bio-treatment method for dust control depends on many variables, such as the percent of precipitated calcium carbonate and tensile strength.

  16. Comparison of conventional versus Hybrid knife peroral endoscopic myotomy methods for esophageal achalasia: a case-control study.

    Science.gov (United States)

    Tang, Xiaowei; Gong, Wei; Deng, Zhiliang; Zhou, Jieqiong; Ren, Yutang; Zhang, Qiang; Chen, Zhenyu; Jiang, Bo

    2016-01-01

    Peroral endoscopic myotomy (POEM) has been developed to treat achalasia as a novel less invasive modality. We aimed to compare the efficacy and safety of conventional knife versus Hybrid knife (HK) during POEM procedure. Between June 2012 and July 2014, 31 patients underwent POEM using HK in our department (HK group), and 36 patients underwent POEM using conventional method (injection needle and triangular tip [TT] knife, TT group). Procedure-related parameters, symptom relief, adverse events were compared between two groups. There were no significant differences in the age, sex and other baseline characteristics between the two groups. The mean procedural time was significantly shorter in HK group than TT group (53.0 ± 17.2 vs. 67.6 ± 28.4 min, p = 0.015). The mean frequency of devices exchange was 4.7 ± 1.7 in HK group and 10.9 ± 1.8 in TT group (p = 0.000). No serious adverse events occurred postoperatively in both groups. At one-year follow-up, a total of 94% treatment success was achieved in all patients (93.5% in HK group and 94.4% in TT group, p = 0.877). HK in POEM can shorten the procedural time, and achieve similar treatment success compared to conventional TT knife.

  17. Has the ThinPrep method of cervical screening maintained its improvement over conventional smears in terms of specimen adequacy?

    LENUS (Irish Health Repository)

    Treacy, A

    2009-04-01

    Liquid-based cytology (LBC) has replaced conventional smear assessment in many centers over recent years. In our laboratory this transfer took place in 1999. At that time we performed a split sample study comparing the conventional method of cervical smear evaluation with the ThinPrep system. This split sample study identified a dramatic improvement in specimen adequacy with LBC. While 11% of conventional preparations were reported as unsatisfactory and almost 9% were reported as suboptimal, evaluation of the same cases using LBC saw this combined figure reduced to 2.3%. AIM: To evaluate whether this dramatic fall in unsatisfactory smears has been maintained with the use of LBC. The database for all smears reported for 2005 (100% LBC) was interrogated. The number of unsatisfactory reports was calculated. The reason for an unsatisfactory report was recorded for each case. The overall unsatisfactory rate was compared with that reported in the 1999 split sample study. A total of 41,312 smear tests were reported in 2005. 1,342 (3.25%) were reported as unsatisfactory. Our findings support the ongoing value of LBC in a routine cervical screening laboratory in terms of continuing to maintain a low rate of unsatisfactory smears.

  18. Energy indices in irrigated wheat production under conservation and conventional tillage and planting methods

    OpenAIRE

    S. M Hosseini; S Afzalinia; K Mollaei

    2016-01-01

    Introduction: Conservation tillage system was recommended for soil erosion control in North America for the first time 60 years ago (Wang et al., 2006). Using this tillage system including minimum and zero tillage has been rapidly developed in recent years. Thearea covered by zero tillage in 2006 was 95 million ha all over the world (Dumanski et al., 2006). In addition to saving soil and water resources, conservation tillage system reduces energy consumption and improves energy indices by com...

  19. Implementation aspects of the Boundary Element Method including viscous and thermal losses

    DEFF Research Database (Denmark)

    Cutanda Henriquez, Vicente; Juhl, Peter Møller

    2014-01-01

    The implementation of viscous and thermal losses using the Boundary Element Method (BEM) is based on the Kirchhoff’s dispersion relation and has been tested in previous work using analytical test cases and comparison with measurements. Numerical methods that can simulate sound fields in fluids...

  20. Life Cycle Assessment and Water Footprint of Hydrogen Production Methods: From Conventional to Emerging Technologies

    Directory of Open Access Journals (Sweden)

    Andi Mehmeti

    2018-02-01

    Full Text Available A common sustainability issue, arising in production systems, is the efficient use of resources for providing goods or services. With the increased interest in a hydrogen (H2 economy, the life-cycle environmental performance of H2 production has special significance for assisting in identifying opportunities to improve environmental performance and to guide challenging decisions and select between technology paths. Life cycle impact assessment methods are rapidly evolving to analyze multiple environmental impacts of the production of products or processes. This study marks the first step in developing process-based streamlined life cycle analysis (LCA of several H2 production pathways combining life cycle impacts at the midpoint (17 problem-oriented and endpoint (3 damage-oriented levels using the state-of-the-art impact assessment method ReCiPe 2016. Steam reforming of natural gas, coal gasification, water electrolysis via proton exchange membrane fuel cell (PEM, solid oxide electrolyzer cell (SOEC, biomass gasification and reforming, and dark fermentation of lignocellulosic biomass were analyzed. An innovative aspect is developed in this study is an analysis of water consumption associated with H2 production pathways by life-cycle stage to provide a better understanding of the life cycle water-related impacts on human health and natural environment. For water-related scope, Water scarcity footprint (WSF quantified using Available WAter REmaining (AWARE method was applied as a stand-alone indicator. The paper discusses the strengths and weaknesses of each production pathway, identify the drivers of environmental impact, quantify midpoint environmental impact and its influence on the endpoint environmental performance. The findings of this study could serve as a useful theoretical reference and practical basis to decision-makers of potential environmental impacts of H2 production systems.

  1. Identification of Burkholderia spp. in the Clinical Microbiology Laboratory: Comparison of Conventional and Molecular Methods

    Science.gov (United States)

    van Pelt, Cindy; Verduin, Cees M.; Goessens, Wil H. F.; Vos, Margreet C.; Tümmler, Burkhard; Segonds, Christine; Reubsaet, Frans; Verbrugh, Henri; van Belkum, Alex

    1999-01-01

    Cystic fibrosis (CF) predisposes patients to bacterial colonization and infection of the lower airways. Several species belonging to the genus Burkholderia are potential CF-related pathogens, but microbiological identification may be complicated. This situation is not in the least due to the poorly defined taxonomic status of these bacteria, and further validation of the available diagnostic assays is required. A total of 114 geographically diverse bacterial isolates, previously identified in reference laboratories as Burkholderia cepacia (n = 51), B. gladioli (n = 14), Ralstonia pickettii (n = 6), B. multivorans (n = 2), Stenotrophomonas maltophilia (n = 3), and Pseudomonas aeruginosa (n = 11), were collected from environmental, clinical, and reference sources. In addition, 27 clinical isolates putatively identified as Burkholderia spp. were recovered from the sputum of Dutch CF patients. All isolates were used to evaluate the accuracy of two selective growth media, four systems for biochemical identification (API 20NE, Vitek GNI, Vitek NFC, and MicroScan), and three different PCR-based assays. The PCR assays amplify different parts of the ribosomal DNA operon, either alone or in combination with cleavage by various restriction enzymes (PCR-restriction fragment length polymorphism [RFLP] analysis). The best system for the biochemical identification of B. cepacia appeared to be the API 20NE test. None of the biochemical assays successfully grouped the B. gladioli strains. The PCR-RFLP method appeared to be the optimal method for accurate nucleic acid-mediated identification of the different Burkholderia spp. With this method, B. gladioli was also reliably classified in a separate group. For the laboratory diagnosis of B. cepacia, we recommend parallel cultures on blood agar medium and selective agar plates. Further identification of colonies with a Burkholderia phenotype should be performed with the API 20NE test. For final confirmation of species identities, PCR

  2. Evaluation of purity with its uncertainty value in high purity lead stick by conventional and electro-gravimetric methods.

    Science.gov (United States)

    Singh, Nahar; Singh, Niranjan; Tripathy, S Swarupa; Soni, Daya; Singh, Khem; Gupta, Prabhat K

    2013-06-26

    A conventional gravimetry and electro-gravimetry study has been carried out for the precise and accurate purity determination of lead (Pb) in high purity lead stick and for preparation of reference standard. Reference materials are standards containing a known amount of an analyte and provide a reference value to determine unknown concentrations or to calibrate analytical instruments. A stock solution of approximate 2 kg has been prepared after dissolving approximate 2 g of Pb stick in 5% ultra pure nitric acid. From the stock solution five replicates of approximate 50 g have been taken for determination of purity by each method. The Pb has been determined as PbSO4 by conventional gravimetry, as PbO2 by electro gravimetry. The percentage purity of the metallic Pb was calculated accordingly from PbSO4 and PbO2. On the basis of experimental observations it has been concluded that by conventional gravimetry and electro-gravimetry the purity of Pb was found to be 99.98 ± 0.24 and 99.97 ± 0.27 g/100 g and on the basis of Pb purity the concentration of reference standard solutions were found to be 1000.88 ± 2.44 and 1000.81 ± 2.68 mg kg-1 respectively with 95% confidence level (k = 2). The uncertainty evaluation has also been carried out in Pb determination following EURACHEM/GUM guidelines. The final analytical results quantifying uncertainty fulfills this requirement and gives a measure of the confidence level of the concerned laboratory. Gravimetry is the most reliable technique in comparison to titremetry and instrumental method and the results of gravimetry are directly traceable to SI unit. Gravimetric analysis, if methods are followed carefully, provides for exceedingly precise analysis. In classical gravimetry the major uncertainties are due to repeatability but in electro-gravimetry several other factors also affect the final results.

  3. Comparison of conventional and nuclear-medical examination methods in the field of nephro-urology

    International Nuclear Information System (INIS)

    Pfannenstiel, P.

    1975-07-01

    Main part of this study is a further simplification of the 131 I-hippuran total body clearance, a method which was first described by Oberhausen (1968). As a result of the study the clearance can now be calculated with only one scintillation detector after i.v. injection of 131 I-hippuran. Essential for this simplification is the exact localisation of the detector at the right or left shoulder region of the patient. The unilateral clearance is calculated from the total body clearance in conjunction with the simultaneously registered isotope renogram. This method was routinely applied to 4,138 patients during November 15th 1971 and March 31st 1975. In special groups of patients sequential renal studies with the gamma-camera, renal rectilinear scans, xenon-133-washout curves from the kidneys and radioimmuno-assays of angiotensin were performed for comparison. All data were analysed in view of other clinical and radiological data. Recommendations for rational procedures in diagnosis and control of therapy of the most common nephro-urological disorders were derived from a joint study of 16 hospitals analysing 1,979 cases. (orig.) [de

  4. Comparison of conventional culture methods and two commercial enzyme immunoassays for detection of Salmonella in porcine fecal samples and cecal contents

    DEFF Research Database (Denmark)

    Wegener, Henrik Caspar; Baggesen, Dorte Lau

    1997-01-01

    Two commercial enzyme immunoassays, designated EIA-1 and EIA-2, for the detection of salmonella in feces and cecal contents were compared to conventional culture methods. Out of 362 cecal content samples, 35 were positive by EIA-1 and 30 were positive by EIA-2 and conventional methods. Out of 189...

  5. Comparison of Polyacetylene Content in Organically and Conventionally Grown Carrots Using a Fast Ultrasonic Liquid Extraction Method

    DEFF Research Database (Denmark)

    Søltoft, Malene; Eriksen, Morten Rosbjørn; Träger, Anne Wibe Brændholt

    2010-01-01

    deviations (RSDs) of 2.3−3.6%], and recovery (93% of falcarindiol) of the polyacetylenes. The applicability of the method was documented by comparative analyses of carrots grown organically or conventionally in a 2 year field trial study. The average concentrations of falcarindiol, falcarindiol-3-acetate......, and falcarinol in year 1 were 222, 30, and 94 μg of falcarindiol equiv/g of dry weight, respectively, and 3−15% lower in year 2. The concentrations were not significantly influenced by the growth system, but a significant year−year variation was observed for falcarindiol-3-acetate....

  6. Kinetics study of hydrochlorothiazide lactose liquid state interaction using conventional isothermal arrhenius method under basic and neutral conditions

    Directory of Open Access Journals (Sweden)

    Faranak Ghaderi

    Full Text Available ABSTRACT The Maillard reaction of hydrochlorothiazide (HCTZ and lactose has been previously demonstrated in pharmaceutical formulations. In this study, the activation energy of - hydrohlorothiazide and lactose interaction in the liquid state was ascertained under basic and neutral conditions. Conventional isothermal High Performance Liquid Chromatography (HPLC technique was employed to ascertain the kinetic parameters using Arrhenius method. Results: The activation energy obtained was 82.43 and 100.28 kJ/mol under basic and neutral conditions, respectively. Consequently, it can be inferred that Maillard reaction is significantly affected by pH, which can be used as a control factor whenever the reaction potentially occurs.

  7. Neutron activation analysis of archaeological artifacts using the conventional relative method: a realistic approach for analysis of large samples

    International Nuclear Information System (INIS)

    Bedregal, P.S.; Mendoza, A.; Montoya, E.H.; Cohen, I.M.; Universidad Tecnologica Nacional, Buenos Aires; Oscar Baltuano

    2012-01-01

    A new approach for analysis of entire potsherds of archaeological interest by INAA, using the conventional relative method, is described. The analytical method proposed involves, primarily, the preparation of replicates of the original archaeological pottery, with well known chemical composition (standard), destined to be irradiated simultaneously, in a well thermalized external neutron beam of the RP-10 reactor, with the original object (sample). The basic advantage of this proposal is to avoid the need of performing complicated effect corrections when dealing with large samples, due to neutron self shielding, neutron self-thermalization and gamma ray attenuation. In addition, and in contrast with the other methods, the main advantages are the possibility of evaluating the uncertainty of the results and, fundamentally, validating the overall methodology. (author)

  8. Expanded image database of pistachio x-ray images and classification by conventional methods

    Science.gov (United States)

    Keagy, Pamela M.; Schatzki, Thomas F.; Le, Lan Chau; Casasent, David P.; Weber, David

    1996-12-01

    In order to develop sorting methods for insect damaged pistachio nuts, a large data set of pistachio x-ray images (6,759 nuts) was created. Both film and linescan sensor images were acquired, nuts dissected and internal conditions coded using the U.S. Grade standards and definitions for pistachios. A subset of 1199 good and 686 insect damaged nuts was used to calculate and test discriminant functions. Statistical parameters of image histograms were evaluated for inclusion by forward stepwise discrimination. Using three variables in the discriminant function, 89% of test set nuts were correctly identified. Comparable data for 6 human subjects ranged from 67 to 92%. If the loss of good nuts is held to 1% by requiring a high probability to discard a nut as insect damaged, approximately half of the insect damage present in clean pistachio nuts may be detected and removed by x-ray inspection.

  9. Turbomachine combustor nozzle including a monolithic nozzle component and method of forming the same

    Science.gov (United States)

    Stoia, Lucas John; Melton, Patrick Benedict; Johnson, Thomas Edward; Stevenson, Christian Xavier; Vanselow, John Drake; Westmoreland, James Harold

    2016-02-23

    A turbomachine combustor nozzle includes a monolithic nozzle component having a plate element and a plurality of nozzle elements. Each of the plurality of nozzle elements includes a first end extending from the plate element to a second end. The plate element and plurality of nozzle elements are formed as a unitary component. A plate member is joined with the nozzle component. The plate member includes an outer edge that defines first and second surfaces and a plurality of openings extending between the first and second surfaces. The plurality of openings are configured and disposed to register with and receive the second end of corresponding ones of the plurality of nozzle elements.

  10. Comparison of E-test with other conventional susceptibility testing methods for ciprofloxacin and gentamicin against gram negative enteric bacilli.

    Science.gov (United States)

    Ogbolu, D O; Terry-Alli, O A; Daini, O A; Olabiyi, F A; Igharo, E A

    2012-06-01

    Increasing antibiotic resistance in Gram negative bacteria has led to the need for a faster and reliable method for determining antimicrobial susceptibility testing. In a resource poor setting like ours, it's also important to look for methods that will be clinically and economically beneficial to the patient. This study was aimed at evaluating the Epsilometer test (E-test) and conventional methods for determining antimicrobial susceptibility of isolates of Gram-negative enteric bacteria to ciprofloxacin and gentamicin. Disc diffusion, E-test, broth dilution and agar dilution methods were performed on 54 bacterial isolates. Using the E-test, 88.9% of bacterial isolates were resistant to ciprofloxacin, 92.6% were resistant using broth microdilution, 96.3% were resistant using agar dilution and 72.2% were resistant using disc diffusion. Minimum inhibitory concentration (MIC50) of isolates for gentamicin showed significant difference for all the techniques (p 0.05). Both E-test and broth dilution methods showed high levels of agreement (p > 0.05), there were low levels of agreement between E-test and agar dilution method (p < 0.05), especially at MIC50. The E-test can therefore be considered a reliable method to determine antimicrobial susceptibility testing and it gives results which are at least as accurate as those obtained by the broth dilution method.

  11. Treatment of children with (Helicobacter pylori) infection and malabsorption syndromes with probiotics comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Lawson, P F [CDU Padre Pio, Cotonou (Benin); De Maio, G; Andriulli, A [Ospedale CSS, San Giovanni Rotondo (Italy); Ghoos, Y [Lab. Digestie Absorptie, Leuven (Belgium)

    2000-07-01

    The prevalence of Helicobacter pylori infection is very high in the developing world where primary infection is acquired in early infancy. It may play a role as aggravating factor of malnutrition. This prevalence is decreasing in industrialised countries. In more cases symptomatology include recurrent abdominal pain, vomiting and diarrhoea. Endoscopy in children is not always available in developing countries. The non-invasive {sup 13}CO{sub 2} Urea Breath Test is particularly indicated in these cases and has been validated as a reliable diagnostic and follow-up tool. The main problem in some countries is to find the good antibiotics without resistance. In this project the authors aim at long-term studying the relationship of Helicobacter pylori infection and nutritional status in young children of developing countries. The conditions of infection as well as absorption and pre- and post treatment period will be monitored by {sup 13}CO{sub 2} Urea Breath Tests. (author)

  12. Treatment of children with (Helicobacter pylori) infection and malabsorption syndromes with probiotics comparison with conventional methods

    International Nuclear Information System (INIS)

    Lawson, P.F.; De Maio, G.; Andriulli, A.; Ghoos, Y.

    2000-01-01

    The prevalence of Helicobacter pylori infection is very high in the developing world where primary infection is acquired in early infancy. It may play a role as aggravating factor of malnutrition. This prevalence is decreasing in industrialised countries. In more cases symptomatology include recurrent abdominal pain, vomiting and diarrhoea. Endoscopy in children is not always available in developing countries. The non-invasive 13 CO 2 Urea Breath Test is particularly indicated in these cases and has been validated as a reliable diagnostic and follow-up tool. The main problem in some countries is to find the good antibiotics without resistance. In this project the authors aim at long-term studying the relationship of Helicobacter pylori infection and nutritional status in young children of developing countries. The conditions of infection as well as absorption and pre- and post treatment period will be monitored by 13 CO 2 Urea Breath Tests. (author)

  13. The Second Zambian National Tuberculosis Drug Resistance survey - a comparison of conventional and molecular methods.

    Science.gov (United States)

    Kapata, Nathan; Mbulo, Grace; Cobelens, Frank; de Haas, Petra; Schaap, Ab; Mwamba, Pike; Mwanza, Winnie; Muvwimi, Mweemba; Muyoyeta, Monde; Moyo, Maureen; Mulenga, Lutinala; Grobusch, Martin P; Godfrey-Faussett, Peter; Ayles, Helen

    2015-11-01

    The prevalence of MDR-TB in Zambia was estimated to be 1.8% in 2001. A second drug resistance survey was conducted in 2008 to determine trends; the use of the Genotype MTBDRplus assay was applied to compare results to the gold standard. A two-stage cluster sampling, with health facilities as primary sampling units. Processed sputum specimens were inoculated on solid media for culture; heat-inactivated bacterial suspensions from sputum samples were tested on a commercial line probe assay for the identification of rifampicin and isoniazid resistance. A total of 917 patients with TB were enrolled and 883 (96.3%) analysed. A total of 574 (65%) had LJ results and 824 (93.3%) had results from MTBDRplus assay. The median age was 32, and 63.3% were males. MDR-TB according to LJ-based DST was 1.1% (CI 0.1-2.4) whereas according to MDTBDRplus assay was 1.6% (CI 0.6-2.6). Isoniazid monoresistance in new cases was 2.4% (CI 0.613-4.26) based on LJ results and 5.0% (CI 3.2-6.7) based on the MTBDRplus; in retreatment cases, it was 4.4% (CI 0.3-8.6) and 2.40% (CI <0.1-5.1) on LJ and MTBDRplus, respectively. Rifampicin monoresistance in new cases was 0.1% (CI <0.1-0.4) based on LJ and 0.6% (CI 0.01-1.1) based on the MTBDRplus; in retreatment cases, it was 0% (CI 0-3.8) and 1.8% (CI <0.1-4.0) on LJ and MTBDRplus, respectively. There were no XDR-TB cases found and no association between MDR-TB and HIV. There was no increase in MDR-TB prevalence in Zambia from 2001 to 2008; results from the two methods were similar. Molecular methods were quicker and simpler to use. © 2015 John Wiley & Sons Ltd.

  14. Effect of the irradiation of bacteria upon their survival rate during conventional methods of meat preservation

    International Nuclear Information System (INIS)

    Szczawinska, M.

    1981-01-01

    The purpose of this paper is to define the effect of irradiation upon the survival rate of non-sporing bacteria (Staphylococcus aureus, Salmonella typhimurium, Escherichia coli, Pseudomonas fluorescens) during basic methods of meat preservation. The bacteria were irradiated in broth by X-rays at a dose that destroyed about 90% of the bacteria (D 10 ). The survival rate of unirradiated and irradiated bacteria during cooling and freezing, in solutions of sodium chloride, nitrates and liquid smoke, was defined. The number of microorganisms was determined directly after irradiation as well as 1, 3, 7, 14, 21 and 28 days after irradiation. The effect of irradiation upon heat resistance of the examined species of bacteria was also defined. The microorganisms were heated in broth, at 70 0 C for 1, 2 and 5 minutes. The obtained results were subjected to statistical analysis. On the basis of the research results, a faster dying rate of irradiated populations of S. aureus and E. coli during any type of preservation treatment, the lack of any reaction to irradiation regarding the survival rate of S. typhimurium, and the lack of any effect of irradiation upon the rate of deterioration of P. fluorescens during freezing and storage in a solution with 10% addition of NaCI, were observed. On the other hand, a pronounced effect of irradiation upon the lowering of the heat resistance of the bacteria, as well as delayed growth in other variants of the experiment, was determined. (author)

  15. Use of non-conventional cell disruption method for extraction of proteins from black yeasts

    Directory of Open Access Journals (Sweden)

    Maja eLeitgeb

    2016-04-01

    Full Text Available The influence of pressure and treatment time on cells disruption of different black yeasts and on activities of extracted proteins using supercritical carbon dioxide process was studied. The cells of three different black yeasts Phaeotheca triangularis, Trimatostroma salinum and Wallemia ichthyophaga were exposed to supercritical carbon dioxide (SC CO2 by varying pressure at fixed temperature (35 °C. The black yeasts cell walls were disrupted and the content of the cells was spilled into the liquid medium. The impact of SC CO2 conditions on secretion of enzymes and proteins from black yeast cells suspension was studied. The residual activity of the enzymes cellulase, β-glucosidase, α-amylase and protease was studied by enzymatic assay. The viability of black yeast cells was determined by measuring the optical density of the cell suspension at 600 nm. The total protein concentration in the suspension was determined on UV-Vis spectrophotometer at 595 nm. The release of intracellular and extracellular products from black yeast cells was achieved. Also, the observation by an environmental scanning electron microscopy shows major morphological changes with SC CO2 treated cells. The advantages of the proposed method are in a simple use which is also possible for heat sensitive materials on one hand and on the other hand integration of the extraction of enzymes and their use in biocatalytical reactions.

  16. Use of Non-Conventional Cell Disruption Method for Extraction of Proteins from Black Yeasts

    Science.gov (United States)

    Čolnik, Maja; Primožič, Mateja; Knez, Željko; Leitgeb, Maja

    2016-01-01

    The influence of pressure and treatment time on cells disruption of different black yeasts and on activities of extracted proteins using supercritical carbon dioxide process was studied. The cells of three different black yeasts Phaeotheca triangularis, Trimatostroma salinum, and Wallemia ichthyophaga were exposed to supercritical carbon dioxide (SC CO2) by varying pressure at fixed temperature (35°C). The black yeasts cell walls were disrupted, and the content of the cells was spilled into the liquid medium. The impact of SC CO2 conditions on secretion of enzymes and proteins from black yeast cells suspension was studied. The residual activity of the enzymes cellulase, β-glucosidase, α-amylase, and protease was studied by enzymatic assay. The viability of black yeast cells was determined by measuring the optical density of the cell suspension at 600 nm. The total protein concentration in the suspension was determined on UV–Vis spectrophotometer at 595 nm. The release of intracellular and extracellular products from black yeast cells was achieved. Also, the observation by an environmental scanning electron microscopy shows major morphological changes with SC CO2-treated cells. The advantages of the proposed method are in a simple use, which is also possible for heat-sensitive materials on one hand and on the other hand integration of the extraction of enzymes and their use in biocatalytical reactions. PMID:27148527

  17. Method of extruding and packaging a thin sample of reactive material including forming the extrusion die

    International Nuclear Information System (INIS)

    Lewandowski, E.F.; Peterson, L.L.

    1985-01-01

    This invention teaches a method of cutting a narrow slot in an extrusion die with an electrical discharge machine by first drilling spaced holes at the ends of where the slot will be, whereby the oil can flow through the holes and slot to flush the material eroded away as the slot is being cut. The invention further teaches a method of extruding a very thin ribbon of solid highly reactive material such as lithium or sodium through the die in an inert atmosphere of nitrogen, argon or the like as in a glovebox. The invention further teaches a method of stamping out sample discs from the ribbon and of packaging each disc by sandwiching it between two aluminum sheets and cold welding the sheets together along an annular seam beyond the outer periphery of the disc. This provides a sample of high purity reactive material that can have a long shelf life

  18. Comparison between gamma radiation and conventional methods on bacteria removal from sewage sludge

    International Nuclear Information System (INIS)

    El-Motaium, R.A.; Ahmed, A.S.

    2009-01-01

    Digested liquid sludge (3% solid content)was collected from El-Gabal El-Asfar wastewater treatment plant (North East of Cairo City). The sludge was tested, before and after irradiation, for its pathogenic bacteria content (total coliform, faecal coliform, e.coli, salmonellae and shigella). treatment included sludge exposed to different doses of gamma radiation (0.0, 0.5, 1.0,1.5,2.0,2.5,3.0,3.5,4.0,4.5,5.0,5.5,6.0 kGy). Determination of the lethal dose of every species was performed. Results indicated that primary, secondary and digestion treatments are not efficient in removing pathogenic bacteria. Digestion for 27 days at 35 degree c resulted in sludge with high content of pathogenic bacteria. Therefore, radiation treatment is recommended. The lethal radiation dose for the different species vary. The lethal doses are as follows: 3.5 kGy for total coliform, 3.0 kGy for faecal coliform,3.0 kGy for e.coli and 2.5 kGy for salmonella and shigella. The re-growth at room temperature indicated that there is a potential for re-growth at the low radiation doses (<3.5 kGy)

  19. Treatment of children with Helicobacter pylori infection and malabsorption syndrome with probiotics: Comparison with conventional methods

    International Nuclear Information System (INIS)

    Fadel Ndiaye, M.

    2000-01-01

    Helicobacter pylori infection is one of the most common bacterial infection in the world. In Senegal prevalence rates is high as well in symptomatic patients (85,8%) as in general population (82%). Helicobacter pylori infection occurs in earlier age and leads to chronic infection (80% of children under 5 years old are infected in Senegal). On the other hand, malnutrition is common in children under 5 years old in Senegal (25%). H. pylori can cause malnutrition in a variety of ways including decreased food intake due to dyspepsia, defective digestion/absorption, diarrhea and may impact on the growth of children. H. pylori infection is a deep public health problem because non-invasive diagnosis tests are not available in routine practice and mainly because there are many difficulties in its treatment: no availability of drug (Clarithromycine); too much high cost of classic and effective therapeutic strategy ( three times minimal salary); high rate of resistance to antibiotics: 60-95% to Metronidazole, 50-60% to Tetracyclines, 30-40% to Macrolides as Azithromycine and Roxithromycine. So, the main problem in Senegal is to find the good, available and cheep treatment without resistance. Probiotics have been considered as a possible tool for this purpose

  20. Treatment of children with Helicobacter pylori infection and malabsorption syndrome with probiotics: Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Fadel Ndiaye, M [Institute Cercle Senegalais de Gastro-Enterlogie, Dakar (Senegal)

    2000-07-01

    Helicobacter pylori infection is one of the most common bacterial infection in the world. In Senegal prevalence rates is high as well in symptomatic patients (85,8%) as in general population (82%). Helicobacter pylori infection occurs in earlier age and leads to chronic infection (80% of children under 5 years old are infected in Senegal). On the other hand, malnutrition is common in children under 5 years old in Senegal (25%). H. pylori can cause malnutrition in a variety of ways including decreased food intake due to dyspepsia, defective digestion/absorption, diarrhea and may impact on the growth of children. H. pylori infection is a deep public health problem because non-invasive diagnosis tests are not available in routine practice and mainly because there are many difficulties in its treatment: no availability of drug (Clarithromycine); too much high cost of classic and effective therapeutic strategy ( three times minimal salary); high rate of resistance to antibiotics: 60-95% to Metronidazole, 50-60% to Tetracyclines, 30-40% to Macrolides as Azithromycine and Roxithromycine. So, the main problem in Senegal is to find the good, available and cheep treatment without resistance. Probiotics have been considered as a possible tool for this purpose.

  1. Analysis 'in vivo' of the employ of the Er:YAG laser and conventional method to remove carious tissue

    International Nuclear Information System (INIS)

    Ribeiro, Rafael Cardoso

    2002-01-01

    The aim of this study was to evaluate the removal of carious tissue employing the use of Er:YAG laser in comparison with the conventional burr rotary instrument. The wavelength of this laser is 2,64 μm and have a good absorption by the water and hydroxyapatite present in dental hard tissue. For this purpose were selected 24 molar teeth with occlusal carious, which were divided in random in two groups. For enamel, the laser energy used was in the interval from 250 mJ to 400 mJ, and the frequency range from 2 Hz to 4 Hz; for the dentine the energy laser range was from 150 mJ to 200 mJ and the laser frequency was in the range from 2 Hz to 6 Hz. For the evaluation of the results was used a questionaire to critical evaluation of the professional and another one to evaluation of the patient. The results have shown that the Er:YAG laser is able to remove carious enamel and dentin, without cause crunch or fracture and the irradiated surface was creasy. The patients reported greatest comfort when the cavity preparation was done with the Er:YAG laser than the conventional burr and all the patients treated reported prefer to future treatments the use of the Er:YAG laser. In conclusion, for the critical evaluation of the professional the treatment with the Er:YAG laser is a safe and effective method, and for the critical evaluation of the patient the treatment is one alternative more comfortable than the conventional method to remove caries. (author)

  2. Familiarity Vs Trust: A Comparative Study of Domain Scientists' Trust in Visual Analytics and Conventional Analysis Methods.

    Science.gov (United States)

    Dasgupta, Aritra; Lee, Joon-Yong; Wilson, Ryan; Lafrance, Robert A; Cramer, Nick; Cook, Kristin; Payne, Samuel

    2017-01-01

    Combining interactive visualization with automated analytical methods like statistics and data mining facilitates data-driven discovery. These visual analytic methods are beginning to be instantiated within mixed-initiative systems, where humans and machines collaboratively influence evidence-gathering and decision-making. But an open research question is that, when domain experts analyze their data, can they completely trust the outputs and operations on the machine-side? Visualization potentially leads to a transparent analysis process, but do domain experts always trust what they see? To address these questions, we present results from the design and evaluation of a mixed-initiative, visual analytics system for biologists, focusing on analyzing the relationships between familiarity of an analysis medium and domain experts' trust. We propose a trust-augmented design of the visual analytics system, that explicitly takes into account domain-specific tasks, conventions, and preferences. For evaluating the system, we present the results of a controlled user study with 34 biologists where we compare the variation of the level of trust across conventional and visual analytic mediums and explore the influence of familiarity and task complexity on trust. We find that despite being unfamiliar with a visual analytic medium, scientists seem to have an average level of trust that is comparable with the same in conventional analysis medium. In fact, for complex sense-making tasks, we find that the visual analytic system is able to inspire greater trust than other mediums. We summarize the implications of our findings with directions for future research on trustworthiness of visual analytic systems.

  3. Conventional methods and emerging wastewater polishing technologies for palm oil mill effluent treatment: a review.

    Science.gov (United States)

    Liew, Wai Loan; Kassim, Mohd Azraai; Muda, Khalida; Loh, Soh Kheang; Affam, Augustine Chioma

    2015-02-01

    The Malaysian palm oil industry is a major revenue earner and the country is ranked as one of the largest producers in the world. However, growth of the industry is synonymous with a massive production of agro-industrial wastewater. As an environmental protection and public health concern, the highly polluting palm oil mill effluent (POME) has become a major attention-grabber. Hence, the industry is targeting for POME pollution abatement in order to promote a greener image of palm oil and to achieve sustainability. At present, most palm oil mills have adopted the ponding system for treatment. Due to the successful POME pollution abatement experiences, Malaysia is currently planning to revise the effluent quality standards towards a more stringent discharge limits. Hence, the current trend of POME research focuses on developing tertiary treatment or polishing systems for better effluent management. Biotechnologically-advanced POME tertiary (polishing) technologies as well as other physicochemical methods are gaining much attention as these processes are the key players to push the industry towards the goal of environmental sustainability. There are still ongoing treatment technologies being researched and the outcomes maybe available in a while. However, the research completed so far are compiled herein and reported for the first time to acquire a better perspective and insight on the subject with a view of meeting the new standards. To this end, the most feasible technology could be the combination of advanced biological processes (bioreactor systems) with extended aeration, followed by solids separation prior to discharge. Chemical dosing is favoured only if effluent of higher quality is anticipated. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Treatment of children with H. pylori infection with probiotics: Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Brunser, O; Cruchet, S; Gotteland, M; Verbeke, S [Gastroenterology Unit, Institute of Nutrition and Food Technology (INTA), University of Chile, Santiago (Chile)

    2000-07-01

    Helicobacter pylori colonizes the gastric mucosa of a high proportion of the population of the less developed countries since an early age. In the developed countries this occurs at a later age and with less frequency. This pathogen causes mostly asymptomatic infection but in a proportion of the population it is associated with chronic gastritis, peptic ulcer, atrophic gastritis. A subset of these individuals will eventually develop gastric carcinoma. For this reason there has always been considerable interest in developing innocuous, fast, inexpensive, sensitive, specific and noninvasive methods for diagnosis. The {sup 13}C-urea breath test ({sup 13}C-UBT) satisfies most of these requirements. Eradication of H. pylori is accomplished by administration of proton pump blockers and a variety of antibiotics singly or in associations. The rate of success is rather high but treatment is long, expensive, it has secondary effects and it increases bacterial resistance. For this reason it is worth looking at other forms of treatment. Probiotics have demonstrated capacity to stimulate defensive mechanisms and to inhibit and even kill H. pylori in vitro and in animal experiments. We propose to conduct a study in which children 10 to 18 years of age colonized by H. pylori will receive a probiotic (Lactobacillus GG) twice daily for 4 or 8 weeks and the rate of infection will be assessed by the {sup 13}C-UBT. Local immune responses will be evaluated by measuring quantitatively total salivary slgA and specific slgA. A group of children who will not receive Lactobacillus GG will serve as controls for all procedures. We believe that Lactobacillus GG will eradicate H. pylori and thus make it possible to treat this infection without recourse to antibiotics.

  5. Treatment of children with H. pylori infection with probiotics: Comparison with conventional methods

    International Nuclear Information System (INIS)

    Brunser, O.; Cruchet, S.; Gotteland, M.; Verbeke, S.

    2000-01-01

    Helicobacter pylori colonizes the gastric mucosa of a high proportion of the population of the less developed countries since an early age. In the developed countries this occurs at a later age and with less frequency. This pathogen causes mostly asymptomatic infection but in a proportion of the population it is associated with chronic gastritis, peptic ulcer, atrophic gastritis. A subset of these individuals will eventually develop gastric carcinoma. For this reason there has always been considerable interest in developing innocuous, fast, inexpensive, sensitive, specific and noninvasive methods for diagnosis. The 13 C-urea breath test ( 13 C-UBT) satisfies most of these requirements. Eradication of H. pylori is accomplished by administration of proton pump blockers and a variety of antibiotics singly or in associations. The rate of success is rather high but treatment is long, expensive, it has secondary effects and it increases bacterial resistance. For this reason it is worth looking at other forms of treatment. Probiotics have demonstrated capacity to stimulate defensive mechanisms and to inhibit and even kill H. pylori in vitro and in animal experiments. We propose to conduct a study in which children 10 to 18 years of age colonized by H. pylori will receive a probiotic (Lactobacillus GG) twice daily for 4 or 8 weeks and the rate of infection will be assessed by the 13 C-UBT. Local immune responses will be evaluated by measuring quantitatively total salivary slgA and specific slgA. A group of children who will not receive Lactobacillus GG will serve as controls for all procedures. We believe that Lactobacillus GG will eradicate H. pylori and thus make it possible to treat this infection without recourse to antibiotics

  6. Method for including detailed evaluation of daylight levels in Be06

    DEFF Research Database (Denmark)

    Petersen, Steffen

    2008-01-01

    Good daylight conditions in office buildings have become an important issue due to new European regulatory demands which include energy consumption for electrical lighting in the building energy frame. Good daylight conditions in offices are thus in increased focus as an energy conserving measure....... In order to evaluate whether a certain design is good daylight design or not building designers must perform detailed evaluation of daylight levels, including the daylight performance of dynamic solar shadings, and include these in the energy performance evaluation. However, the mandatory national...... calculation tool in Denmark (Be06) for evaluating the energy performance of buildings is currently using a simple representation of available daylight in a room and simple assumptions regarding the control of shading devices. In a case example, this is leading to an overestimation of the energy consumption...

  7. A novel method of including Landau level mixing in numerical studies of the quantum Hall effect

    International Nuclear Information System (INIS)

    Wooten, Rachel; Quinn, John; Macek, Joseph

    2013-01-01

    Landau level mixing should influence the quantum Hall effect for all except the strongest applied magnetic fields. We propose a simple method for examining the effects of Landau level mixing by incorporating multiple Landau levels into the Haldane pseudopotentials through exact numerical diagonalization. Some of the resulting pseudopotentials for the lowest and first excited Landau levels will be presented

  8. Indication of Importance of Including Soil Microbial Characteristics into Biotope Valuation Method.

    Czech Academy of Sciences Publication Activity Database

    Trögl, J.; Pavlorková, Jana; Packová, P.; Seják, J.; Kuráň, P.; Kuráň, J.; Popelka, J.; Pacina, J.

    2016-01-01

    Roč. 8, č. 3 (2016), č. článku 253. ISSN 2071-1050 Institutional support: RVO:67985858 Keywords : biotope assessment * biotope valuation method * soil microbial communities Subject RIV: DJ - Water Pollution ; Quality Impact factor: 1.789, year: 2016

  9. Towards non-conventional methods of designing register-based epidemiological studies: An application to pediatric research.

    Science.gov (United States)

    Gong, Tong; Brew, Bronwyn; Sjölander, Arvid; Almqvist, Catarina

    2017-07-01

    Various epidemiological designs have been applied to investigate the causes and consequences of fetal growth restriction in register-based observational studies. This review seeks to provide an overview of several conventional designs, including cohort, case-control and more recently applied non-conventional designs such as family-based designs. We also discuss some practical points regarding the application and interpretation of family-based designs. Definitions of each design, the study population, the exposure and the outcome measures are briefly summarised. Examples of study designs are taken from the field of low birth-weight research for illustrative purposes. Also examined are relative advantages and disadvantages of each design in terms of assumptions, potential selection and information bias, confounding and generalisability. Kinship data linkage, statistical models and result interpretation are discussed specific to family-based designs. When all information is retrieved from registers, there is no evident preference of the case-control design over the cohort design to estimate odds ratios. All conventional designs included in the review are prone to bias, particularly due to residual confounding. Family-based designs are able to reduce such bias and strengthen causal inference. In the field of low birth-weight research, family-based designs have been able to confirm a negative association not confounded by genetic or shared environmental factors between low birth weight and the risk of asthma. We conclude that there is a broader need for family-based design in observational research as evidenced by the meaningful contributions to the understanding of the potential causal association between low birth weight and subsequent outcomes.

  10. Comparison of conventional methods for diagnosis of visceral leishmaniasis in children of the Center-West Region of Brazil

    Directory of Open Access Journals (Sweden)

    Yvone M. Brustoloni

    Full Text Available In Brazil, sophisticated techniques currently employed for diagnosis of visceral leishmaniasis, such as polymerase chain reaction-based assays, are only available in major research centers, whereas conventional methods are still used in many areas where the disease occurs. In the state of Mato Grosso do Sul, in the country's Center-West Region, visceral leishmaniasis has recently emerged in many cities, and duration of the disease, from the onset of symptoms to diagnosis, has been short. Considering that results of diagnostic tests may depend on the phase of the disease, we compared direct examination of bone marrow aspirates (BMAs, BMA culture, and serology by Indirect Immunofluorescence Antibody Test (IFAT for diagnosis in children, according to time of evolution (30 days and to spleen size ( 5 cm at admission. Duration of the illness did not interfere with test positivity: direct smear examination and IFAT were positive in more than 80% of patients, as was culture in around 60%. Results of positive microscopy, however, where predominant in patients with larger spleens. Thanks to the association of traditional techniques, only a few patients had to begin a treatment trial without confirming the diagnosis. Conventional methods for diagnosis of visceral leishmaniasis are still indispensable in our region, and training professionals in basic techniques should be incremented. The highest sensitivity in laboratory diagnosis among the cases investigated was that obtained with a combination of BMA direct examination and IFAT, nearing 100%.

  11. Method of preparing a negative electrode including lithium alloy for use within a secondary electrochemical cell

    Science.gov (United States)

    Tomczuk, Zygmunt; Olszanski, Theodore W.; Battles, James E.

    1977-03-08

    A negative electrode that includes a lithium alloy as active material is prepared by briefly submerging a porous, electrically conductive substrate within a melt of the alloy. Prior to solidification, excess melt can be removed by vibrating or otherwise manipulating the filled substrate to expose interstitial surfaces. Electrodes of such as solid lithium-aluminum filled within a substrate of metal foam are provided.

  12. Thick electrodes including nanoparticles having electroactive materials and methods of making same

    Science.gov (United States)

    Xiao, Jie; Lu, Dongping; Liu, Jun; Zhang, Jiguang; Graff, Gordon L.

    2017-02-21

    Electrodes having nanostructure and/or utilizing nanoparticles of active materials and having high mass loadings of the active materials can be made to be physically robust and free of cracks and pinholes. The electrodes include nanoparticles having electroactive material, which nanoparticles are aggregated with carbon into larger secondary particles. The secondary particles can be bound with a binder to form the electrode.

  13. Characterization and stability studies of a novel liposomal cyclosporin A prepared using the supercritical fluid method: comparison with the modified conventional Bangham method

    Directory of Open Access Journals (Sweden)

    Karn PR

    2013-01-01

    Full Text Available Pankaj Ranjan Karn,1,3 Wonkyung Cho,1,3 Hee-Jun Park,1,3 Jeong-Sook Park,3 Sung-Joo Hwang1,21Yonsei Institute of Pharmaceutical Sciences, Yonsei University, Yeonsu-gu, Incheon, Republic of Korea; 2College of Pharmacy, Yonsei University, Yeonsu-gu, Incheon, Republic of Korea; 3College of Pharmacy, Chungnam National University, Yuseong-gu, Daejeon, Republic of KoreaAbstract: A novel method to prepare cyclosporin A encapsulated liposomes was introduced using supercritical fluid of carbon dioxide (SCF-CO2 as an antisolvent. To investigate the strength of the newly developed SCF-CO2 method compared with the modified conventional Bangham method, particle size, zeta potential, and polydispersity index (PDI of both liposomal formulations were characterized and compared. In addition, entrapment efficiency (EE and drug loading (DL characteristics were analyzed by reversed-phase high-performance liquid chromatography. Significantly larger particle size and PDI were revealed from the conventional method, while EE (% and DL (% did not exhibit any significant differences. The SCF-CO2 liposomes were found to be relatively smaller, multilamellar, and spherical with a smoother surface as determined by transmission electron microscopy. SCF-CO2 liposomes showed no significant differences in their particle size and PDI after more than 3 months, whereas conventional liposomes exhibited significant changes in their particle size. The initial yield (%, EE (%, and DL (% of SCF-CO2 liposomes and conventional liposomes were 90.98 ± 2.94, 92.20 ± 1.36, 20.99 ± 0.84 and 90.72 ± 2.83, 90.24 ± 1.37, 20.47 ± 0.94, respectively, which changed after 14 weeks to 86.65 ± 0.30, 87.63 ± 0.72, 18.98 ± 0.22 and 75.04 ± 8.80, 84.59 ± 5.13, 15.94 ± 2.80, respectively. Therefore, the newly developed SCF-CO2 method could be a better alternative compared with the conventional method and may provide a promising approach for large-scale production of liposomes

  14. Method for pulse control in a laser including a stimulated brillouin scattering mirror system

    Science.gov (United States)

    Dane, C. Brent; Hackel, Lloyd; Harris, Fritz B.

    2007-10-23

    A laser system, such as a master oscillator/power amplifier system, comprises a gain medium and a stimulated Brillouin scattering SBS mirror system. The SBS mirror system includes an in situ filtered SBS medium that comprises a compound having a small negative non-linear index of refraction, such as a perfluoro compound. An SBS relay telescope having a telescope focal point includes a baffle at the telescope focal point which blocks off angle beams. A beam splitter is placed between the SBS mirror system and the SBS relay telescope, directing a fraction of the beam to an alternate beam path for an alignment fiducial. The SBS mirror system has a collimated SBS cell and a focused SBS cell. An adjustable attenuator is placed between the collimated SBS cell and the focused SBS cell, by which pulse width of the reflected beam can be adjusted.

  15. NON-CONVENTIONAL MACHINING PROCESSES SELECTION USING MULTI-OBJECTIVE OPTIMIZATION ON THE BASIS OF RATIO ANALYSIS METHOD

    Directory of Open Access Journals (Sweden)

    MILOŠ MADIĆ

    2015-11-01

    Full Text Available The role of non-conventional machining processes (NCMPs in today’s manufacturing environment has been well acknowledged. For effective utilization of the capabilities and advantages of different NCMPs, selection of the most appropriate NCMP for a given machining application requires consideration of different conflicting criteria. The right choice of the NCMP is critical to the success and competitiveness of the company. As the NCMP selection problem involves consideration of different conflicting criteria, of different relative importance, the multi-criteria decision making (MCDM methods are very useful in systematical selection of the most appropriate NCMP. This paper presents the application of a recent MCDM method, i.e., the multi-objective optimization on the basis of ratio analysis (MOORA method to solve NCMP selection which has been defined considering different performance criteria of four most widely used NCMPs. In order to determine the relative significance of considered quality criteria a pair-wise comparison matrix of the analytic hierarchy process was used. The results obtained using the MOORA method showed perfect correlation with those obtained by the technique for order preference by similarity to ideal solution (TOPSIS method which proves the applicability and potentiality of this MCDM method for solving complex NCMP selection problems.

  16. Impact of Including Authentic Inquiry Experiences in Methods Courses for Pre-Service Secondary Teachers

    Science.gov (United States)

    Slater, T. F.; Elfring, L.; Novodvorsky, I.; Talanquer, V.; Quintenz, J.

    2007-12-01

    Science education reform documents universally call for students to have authentic and meaningful experiences using real data in the context of their science education. The underlying philosophical position is that students analyzing data can have experiences that mimic actual research. In short, research experiences that reflect the scientific spirit of inquiry potentially can: prepare students to address real world complex problems; develop students' ability to use scientific methods; prepare students to critically evaluate the validity of data or evidence and of the consequent interpretations or conclusions; teach quantitative skills, technical methods, and scientific concepts; increase verbal, written, and graphical communication skills; and train students in the values and ethics of working with scientific data. However, it is unclear what the broader pre-service teacher preparation community is doing in preparing future teachers to promote, manage, and successful facilitate their own students in conducting authentic scientific inquiry. Surveys of undergraduates in secondary science education programs suggests that students have had almost no experiences themselves in conducting open scientific inquiry where they develop researchable questions, design strategies to pursue evidence, and communicate data-based conclusions. In response, the College of Science Teacher Preparation Program at the University of Arizona requires all students enrolled in its various science teaching methods courses to complete an open inquiry research project and defend their findings at a specially designed inquiry science mini-conference at the end of the term. End-of-term surveys show that students enjoy their research experience and believe that this experience enhances their ability to facilitate their own future students in conducting open inquiry.

  17. Comparison of some biased estimation methods (including ordinary subset regression) in the linear model

    Science.gov (United States)

    Sidik, S. M.

    1975-01-01

    Ridge, Marquardt's generalized inverse, shrunken, and principal components estimators are discussed in terms of the objectives of point estimation of parameters, estimation of the predictive regression function, and hypothesis testing. It is found that as the normal equations approach singularity, more consideration must be given to estimable functions of the parameters as opposed to estimation of the full parameter vector; that biased estimators all introduce constraints on the parameter space; that adoption of mean squared error as a criterion of goodness should be independent of the degree of singularity; and that ordinary least-squares subset regression is the best overall method.

  18. Use of the potentiometric titration method to investigate heterogeneous systems including phosphorylated complexones

    International Nuclear Information System (INIS)

    Tereshin, G.S.; Kharitonova, L.K.; Kuznetsova, O.B.

    1979-01-01

    Heterogeneous systems Y(NO 3 ) 3 (YCl 3 )-Hsub(n)L-KNO 3 (KCl)-H 2 O are investigated by potentiometric titration (with coulomb-meter generation of oH - ions). Hsub(n)L is one of the following: oxyethylidendiphosphonic; aminobenzilidendiphosphonic; glycine-bis-methyl-phosphonic; nitrilotrimethylphosphonic (H 6 L) and ethylenediaminetetramethylphosphonic acids. The range of the exsistence of YHsub(nL3)LxyH 2 O has been determined. The possibility of using potentiometric titration for investigating heterogeneous systems is demonstrated by the stUdy of the system Y(NO 3 ) 3 -H 6 L-KOH-H 2 o by the method of residual concentration. The two methods have shown that at pH 3 LxyH 2 O; at pH=6, KYH 2 Lxy'H 2 O, and at pH=7, K 2 YHLxy''H 2 O. The complete solubility products of nitrilotrimethylphosphonates are evaluated

  19. A convolution method for predicting mean treatment dose including organ motion at imaging

    International Nuclear Information System (INIS)

    Booth, J.T.; Zavgorodni, S.F.; Royal Adelaide Hospital, SA

    2000-01-01

    Full text: The random treatment delivery errors (organ motion and set-up error) can be incorporated into the treatment planning software using a convolution method. Mean treatment dose is computed as the convolution of a static dose distribution with a variation kernel. Typically this variation kernel is Gaussian with variance equal to the sum of the organ motion and set-up error variances. We propose a novel variation kernel for the convolution technique that additionally considers the position of the mobile organ in the planning CT image. The systematic error of organ position in the planning CT image can be considered random for each patient over a population. Thus the variance of the variation kernel will equal the sum of treatment delivery variance and organ motion variance at planning for the population of treatments. The kernel is extended to deal with multiple pre-treatment CT scans to improve tumour localisation for planning. Mean treatment doses calculated with the convolution technique are compared to benchmark Monte Carlo (MC) computations. Calculations of mean treatment dose using the convolution technique agreed with MC results for all cases to better than ± 1 Gy in the planning treatment volume for a prescribed 60 Gy treatment. Convolution provides a quick method of incorporating random organ motion (captured in the planning CT image and during treatment delivery) and random set-up errors directly into the dose distribution. Copyright (2000) Australasian College of Physical Scientists and Engineers in Medicine

  20. System and method for detecting components of a mixture including a valving scheme for competition assays

    Energy Technology Data Exchange (ETDEWEB)

    Koh, Chung-Yan; Piccini, Matthew E.; Singh, Anup K.

    2017-09-19

    Examples are described including measurement systems for conducting competition assays. A first chamber of an assay device may be loaded with a sample containing a target antigen. The target antigen in the sample may be allowed to bind to antibody-coated beads in the first chamber. A control layer separating the first chamber from a second chamber may then be opened to allow a labeling agent loaded in a first portion of the second chamber to bind to any unoccupied sites on the antibodies. A centrifugal force may then be applied to transport the beads through a density media to a detection region for measurement by a detection unit.

  1. System and method for detecting components of a mixture including a valving scheme for competition assays

    Science.gov (United States)

    Koh, Chung-Yan; Piccini, Matthew E.; Singh, Anup K.

    2017-07-11

    Examples are described including measurement systems for conducting competition assays. A first chamber of an assay device may be loaded with a sample containing a target antigen. The target antigen in the sample may be allowed to bind to antibody-coated beads in the first chamber. A control layer separating the first chamber from a second chamber may then be opened to allow a labeling agent loaded in a first portion of the second chamber to bind to any unoccupied sites on the antibodies. A centrifugal force may then be applied to transport the beads through a density media to a detection region for measurement by a detection unit.

  2. Electromagnetic Radiation : Variational Methods, Waveguides and Accelerators Including seminal papers of Julian Schwinger

    CERN Document Server

    Milton, Kimball A

    2006-01-01

    This is a graduate level textbook on the theory of electromagnetic radiation and its application to waveguides, transmission lines, accelerator physics and synchrotron radiation. It has grown out of lectures and manuscripts by Julian Schwinger prepared during the war at MIT's Radiation Laboratory, updated with material developed by Schwinger at UCLA in the 1970s and 1980s, and by Milton at the University of Oklahoma since 1994. The book includes a great number of straightforward and challenging exercises and problems. It is addressed to students in physics, electrical engineering, and applied mathematics seeking a thorough introduction to electromagnetism with emphasis on radiation theory and its applications.

  3. Decoding Facial Esthetics to Recreate an Esthetic Hairline: A Method Which Includes Forehead Curvature.

    Science.gov (United States)

    Garg, Anil K; Garg, Seema

    2017-01-01

    The evidence suggests that our perception of physical beauty is based on how closely the features of one's face reflect phi (the golden ratio) in their proportions. By that extension, it must certainly be possible to use a mathematical parameter to design an anterior hairline in all faces. To establish a user-friendly method to design an anterior hairline in cases of male pattern alopecia. We need a flexible measuring tape and skin marker. A reference point A (glabella) is taken in between eyebrows. Mark point E, near the lateral canthus, 8 cm horizontal on either side from the central point A. A mid-frontal point (point B) is marked 8 cm from point A on the forehead in a mid-vertical plane. The frontotemporal points (C and C') are marked on the frontotemporal area, 8 cm in a horizontal plane from point B and 8 cm in a vertical plane from point E. The temporal peak points (D and D') are marked on the line joining the frontotemporal point C to the lateral canthus point E, slightly more than halfway toward lateral canthus, usually 5 cm from the frontotemporal point C. This line makes an anterior border of the temporal triangle. We have conducted a study with 431 cases of male pattern alopecia. The average distance of the mid-frontal point from glabella was 7.9 cm. The patient satisfaction reported was 94.7%. Our method gives a skeletal frame of the anterior hairline with minimal criteria, with no need of visual imagination and experience of the surgeon. It automatically takes care of the curvature of the forehead and is easy to use for a novice surgeon.

  4. Determination of Consumers'Preferences for Conventional, Healthy and Organic Cucumbers in Isfahan City Using Choice Experiment Method

    Directory of Open Access Journals (Sweden)

    A. Sandoghi

    2016-03-01

    specificproduct in a choice situation.Determining and arranging selected sets based on a review of studies and theoretical basis design scenarios of the experiment method, includes environmental characteristics, taste, appearance, price, duration of storage, the disease and the long-term complications. Results and Discussion: Most of the respondents were female, with average age of 41.6 years, academic education level (39.5% and the average monthly income of 9,760 thousand Rials. The results show that 77.1%, 12.4% and 10.1% of consumers, respectively selected the healthy, organic and conventional crops as a first choice. Moreover, the consumer's awareness towards healthy food products is low. According to the logistic regression results, the most important factors affecting the consumers' healthier choices are income, consumer knowledge about the characteristics of healthy and organic crops, the level of consumer’s attitudes toward the importance of environmental protection and human health and having an elderly or sick member in the household. On the other hand, healthy shopping concern, age, gender, employment status and education have no significant impact on the consumer’s selection. In other words, the likelihood of choosing healthy and organic products is more in people who care about their health and nutritional status, as well as with more health consciousness, environmental concerns and knowledge regarding the risks of pesticides and characteristics of free of pesticide fruit and vegetables. Conclusion: There is no difference between academic and non-academic respondent’s preferences for healthy crops, because of no general academic courses on the importance of environmental protection, healthy shopping, production and consumption of healthy and organic products in Iran'seducationalsystem.Moreover, attitude and awareness play fundamental rolesin consumers' preferences.Willingness to pay for healthy food products in women is observed to be more than men. This could

  5. Consensus for nonmelanoma skin cancer treatment: basal cell carcinoma, including a cost analysis of treatment methods.

    Science.gov (United States)

    Kauvar, Arielle N B; Cronin, Terrence; Roenigk, Randall; Hruza, George; Bennett, Richard

    2015-05-01

    Basal cell carcinoma (BCC) is the most common cancer in the US population affecting approximately 2.8 million people per year. Basal cell carcinomas are usually slow-growing and rarely metastasize, but they do cause localized tissue destruction, compromised function, and cosmetic disfigurement. To provide clinicians with guidelines for the management of BCC based on evidence from a comprehensive literature review, and consensus among the authors. An extensive review of the medical literature was conducted to evaluate the optimal treatment methods for cutaneous BCC, taking into consideration cure rates, recurrence rates, aesthetic and functional outcomes, and cost-effectiveness of the procedures. Surgical approaches provide the best outcomes for BCCs. Mohs micrographic surgery provides the highest cure rates while maximizing tissue preservation, maintenance of function, and cosmesis. Mohs micrographic surgery is an efficient and cost-effective procedure and remains the treatment of choice for high-risk BCCs and for those in cosmetically sensitive locations. Nonsurgical modalities may be used for low-risk BCCs when surgery is contraindicated or impractical, but the cure rates are lower.

  6. A 4-year non-randomized comparative phase-IV study of early rheumatoid arthritis: integrative anthroposophic medicine for patients with preference against DMARDs versus conventional therapy including DMARDs for patients without preference

    Directory of Open Access Journals (Sweden)

    Hamre HJ

    2018-03-01

    Full Text Available Harald J Hamre,1 Van N Pham,2 Christian Kern,3 Rolf Rau,4 Jörn Klasen,3 Ute Schendel,5 Lars Gerlach,6 Attyla Drabik,2 Ludger Simon6,† 1Institute for Applied Epistemology and Medical Methodology at the Witten/Herdecke University, Freiburg, Germany; 2Institute of Statistics in Medicine, Universitätsklinikum Düsseldorf, Düsseldorf, Germany; 3Department of Integrative Medicine, Asklepios Westklinikum, Hamburg, Germany; 4Department of Rheumatology, Evangelisches Fachkrankenhaus Ratingen, Ratingen, Germany; 5Department of Rheumatology, m&i-Fachklinik Bad Pyrmont, Bad Pyrmont, Germany; 6Department of Internal Medicine and Gastroenterology, Filderklinik, Filderstadt, Germany †Dr Ludger Simon passed away on June 10, 2016 Background: While disease-modifying antirheumatic drugs (DMARDs are a mainstay of therapy for rheumatoid arthritis (RA, some patients with early RA refuse DMARDs. In anthroposophic medicine (AM, a treatment strategy for early RA without DMARDs has been developed. Preliminary data suggest that RA symptoms and inflammatory markers can be reduced under AM, without DMARDs. Patients and methods: Two hundred and fifty-one self-selected patients aged 16–70 years, starting treatment for RA of <3 years duration, without prior DMARD therapy, participated in a prospective, non-randomized, comparative Phase IV study. C-patients were treated in clinics offering conventional therapy including DMARDs, while A-patients had chosen treatment in anthroposophic clinics, without DMARDs. Both groups received corticosteroids and nonsteroidal anti-inflammatory drugs (NSAIDs. Primary outcomes were intensity of RA symptoms measured by self-rating on visual analog scales, C-reactive protein, radiological progression, study withdrawals, serious adverse events (SAE, and adverse drug reactions in months 0–48. Results: The groups were similar in most baseline characteristics, while A-patients had longer disease duration (mean 15.1 vs 10.8 months, p<0

  7. Development method of Hybrid Energy Storage System, including PEM fuel cell and a battery

    International Nuclear Information System (INIS)

    Ustinov, A; Khayrullina, A; Khmelik, M; Sveshnikova, A; Borzenko, V

    2016-01-01

    Development of fuel cell (FC) and hydrogen metal-hydride storage (MH) technologies continuously demonstrate higher efficiency rates and higher safety, as hydrogen is stored at low pressures of about 2 bar in a bounded state. A combination of a FC/MH system with an electrolyser, powered with a renewable source, allows creation of an almost fully autonomous power system, which could potentially replace a diesel-generator as a back-up power supply. However, the system must be extended with an electro-chemical battery to start-up the FC and compensate the electric load when FC fails to deliver the necessary power. Present paper delivers the results of experimental and theoretical investigation of a hybrid energy system, including a proton exchange membrane (PEM) FC, MH- accumulator and an electro-chemical battery, development methodology for such systems and the modelling of different battery types, using hardware-in-the-loop approach. The economic efficiency of the proposed solution is discussed using an example of power supply of a real town of Batamai in Russia. (paper)

  8. Development method of Hybrid Energy Storage System, including PEM fuel cell and a battery

    Science.gov (United States)

    Ustinov, A.; Khayrullina, A.; Borzenko, V.; Khmelik, M.; Sveshnikova, A.

    2016-09-01

    Development of fuel cell (FC) and hydrogen metal-hydride storage (MH) technologies continuously demonstrate higher efficiency rates and higher safety, as hydrogen is stored at low pressures of about 2 bar in a bounded state. A combination of a FC/MH system with an electrolyser, powered with a renewable source, allows creation of an almost fully autonomous power system, which could potentially replace a diesel-generator as a back-up power supply. However, the system must be extended with an electro-chemical battery to start-up the FC and compensate the electric load when FC fails to deliver the necessary power. Present paper delivers the results of experimental and theoretical investigation of a hybrid energy system, including a proton exchange membrane (PEM) FC, MH- accumulator and an electro-chemical battery, development methodology for such systems and the modelling of different battery types, using hardware-in-the-loop approach. The economic efficiency of the proposed solution is discussed using an example of power supply of a real town of Batamai in Russia.

  9. Detection and enumeration of Salmonella enteritidis in homemade ice cream associated with an outbreak: comparison of conventional and real-time PCR methods.

    Science.gov (United States)

    Seo, K H; Valentin-Bon, I E; Brackett, R E

    2006-03-01

    Salmonellosis caused by Salmonella Enteritidis (SE) is a significant cause of foodborne illnesses in the United States. Consumption of undercooked eggs and egg-containing products has been the primary risk factor for the disease. The importance of the bacterial enumeration technique has been enormously stressed because of the quantitative risk analysis of SE in shell eggs. Traditional enumeration methods mainly depend on slow and tedious most-probable-number (MPN) methods. Therefore, specific, sensitive, and rapid methods for SE quantitation are needed to collect sufficient data for risk assessment and food safety policy development. We previously developed a real-time quantitative PCR assay for the direct detection and enumeration of SE and, in this study, applied it to naturally contaminated ice cream samples with and without enrichment. The detection limit of the real-time PCR assay was determined with artificially inoculated ice cream. When applied to the direct detection and quantification of SE in ice cream, the real-time PCR assay was as sensitive as the conventional plate count method in frequency of detection. However, populations of SE derived from real-time quantitative PCR were approximately 1 log higher than provided by MPN and CFU values obtained by conventional culture methods. The detection and enumeration of SE in naturally contaminated ice cream can be completed in 3 h by this real-time PCR method, whereas the cultural enrichment method requires 5 to 7 days. A commercial immunoassay for the specific detection of SE was also included in the study. The real-time PCR assay proved to be a valuable tool that may be useful to the food industry in monitoring its processes to improve product quality and safety.

  10. Isolation and Identification of Campylobacter spp. from Poultry and Poultry By-Products in Tunisia by Conventional Culture Method and Multiplex Real-Time PCR.

    Science.gov (United States)

    Jribi, Hela; Sellami, Hanen; Mariam, Siala; Smaoui, Salma; Ghorbel, Asma; Hachicha, Salma; Benejat, Lucie; Messadi-Akrout, Feriel; Mégraud, Francis; Gdoura, Radhouane

    2017-10-01

    Thermophilic Campylobacter spp. are one of the primary causes of bacterial human diarrhea. The consumption of poultry meats, by-products, or both is suspected to be a major cause of human campylobacteriosis. The aims of this study were to determine the prevalence of thermophilic Campylobacter spp. in fresh poultry meat and poultry by-products by conventional culture methods and to confirm Campylobacter jejuni and Campylobacter coli isolates by using the multiplex PCR assay. Two hundred fifty fresh poultry samples were collected from a variety of supermarkets and slaughterhouses located in Sfax, Tunisia, including chicken (n =149) and turkey (n =101). The samples were analyzed using conventional microbiological examinations according to the 2006 International Organization for Standardization method (ISO 10272-1) for Campylobacter spp. Concurrently, a real-time PCR was used for identification of C. jejuni and C. coli . Of the 250 samples of poultry meat and poultry by-products, 25.6% (n = 64) were contaminated with Campylobacter spp. The highest prevalence of Campylobacter spp. was found in chicken meat (26.8%) followed by turkey meat (23.7%). Among the different products, poultry breasts showed the highest contamination (36.6%) followed by poultry by-products (30%), poultry wings (28%) and poultry legs (26%) showed the lowest contamination, and no contamination was found on neck skin. Of the 64 thermophilic Campylobacter isolates, C. jejuni (59.7%) was the most frequently isolated species and 10.9% of the isolates were identified as C. coli . All of the 64 Campylobacter isolates identified by the conventional culture methods were further confirmed by PCR. The seasonal peak of Campylobacter spp. contamination was in the warm seasons (spring and summer). The study concluded that high proportions of poultry meat and poultry by-products marketed in Tunisia are contaminated by Campylobacter spp. Furthermore, to ensure food safety, poultry meats must be properly cooked

  11. The comparison of assessment of pigeon semen motility and sperm concentration by conventional methods and the CASA system (HTM IVOS).

    Science.gov (United States)

    Klimowicz, M D; Nizanski, W; Batkowski, F; Savic, M A

    2008-07-01

    The aim of these experiments was to compare conventional, microscopic methods of evaluating pigeon sperm motility and concentration to those measured by computer-assisted sperm analysis (CASA system). Semen was collected twice a week from two groups of pigeons, each of 40 males (group I: meat-type breed; group II: fancy pigeon) using the lumbo-sacral and cloacal region massage method. Ejaculates collected in each group were diluted 1:100 in BPSE solution and divided into two equal samples. One sample was examined subjectively by microscope and the second one was analysed using CASA system. The sperm concentration was measured by CASA using the anti-collision (AC) system and fluorescent staining (IDENT). There were not any significant differences between the methods of evaluation of sperm concentration. High positive correlations in both groups were observed between the sperm concentration estimated by Thom counting chamber and AC (r=0.87 and r=0.91, respectively), and between the sperm concentration evaluated by Thom counting chamber and IDENT (r=0.85 and r=0.90, respectively). The mean values for CASA measurement of proportion of motile spermatozoa (MOT) and progressive movement (PMOT) were significantly lower than the values estimated subjectively in both groups of pigeons (pCASA system is very rapid, objective and sensitive method in detecting subtle motility characteristics as well as sperm concentration and is recommended for future research into pigeon semen.

  12. ''Augmented reality'' in conventional simulation by projection of 3-D structures into 2-D images. A comparison with virtual methods

    International Nuclear Information System (INIS)

    Deutschmann, H.; Nairz, O.; Zehentmayr, F.; Fastner, G.; Sedlmayer, F.; Steininger, P.; Kopp, P.; Merz, F.; Wurstbauer, K.; Kranzinger, M.; Kametriser, G.; Kopp, M.

    2008-01-01

    Background and purpose: in this study, a new method is introduced, which allows the overlay of three-dimensional structures, that have been delineated on transverse slices, onto the fluoroscopy from conventional simulators in real time. Patients and methods: setup deviations between volumetric imaging and simulation were visualized, measured and corrected for 701 patient isocenters. Results: comparing the accuracy to mere virtual simulation lacking additional X-ray imaging, a clear benefit of the new method could be shown. On average, virtual prostate simulations had to be corrected by 0.48 cm (standard deviation [SD] 0.38), and those of the breast by 0.67 cm (SD 0.66). Conclusion: the presented method provides an easy way to determine entity-specific safety margins related to patient setup errors upon registration of bony anatomy (prostate 0.9 cm for 90% of cases, breast 1.3 cm). The important role of planar X-ray imaging was clearly demonstrated. The innovation can also be applied to adaptive image-guided radiotherapy (IGRT) protocols. (orig.)

  13. Storage stability of margarines produced from enzymatically interesterified fats compared to those prepared by conventional methods - Chemical properties

    DEFF Research Database (Denmark)

    Zhang, Hong; Jacobsen, Charlotte; Pedersen, Lars Saaby

    2006-01-01

    margarines in a pilot plant. Storage stability studies were carried out at storage temperatures of 5 and 25øC for 12wk. Margarines from the enzymatically interesterified fats were compared to the margarines produced by the conventional methods (chemical interesterification and physical blending......In this study, four margarine hardstocks were produced, two from enzymatically interesterified fats at 80 and 100% conversion, one from chemically randomized fat and one from physically mixed fat. These four hardstocks, blended with 50% sunflower oil, were mainly used for the production of table...... interesterified fat had higher PV in weeks4, 8 and10 than the margarines produced from the enzymatically interesterified fats and the physically blended fat. These differences were not caused by different contents of tocopherols in the hardstocks. The differences between the processes for chemical and enzymatic...

  14. Comparison of porcelain bond strength of different metal frameworks prepared by using conventional and recently introduced fabrication methods.

    Science.gov (United States)

    Kaleli, Necati; Saraç, Duygu

    2017-07-01

    Most studies evaluating dental laser sintering systems have focused on the marginal accuracy of the restorations. However, the bond strength at the metal-ceramic interface is another important factor that affects the survival of restorations, and currently, few studies focus on this aspect. The purpose of this in vitro study was to compare the porcelain bond strength of cobalt-chromium (Co-Cr) metal frameworks prepared by using the conventional lost-wax technique, milling, direct metal laser sintering (DMLS), and laser cusing, a direct process powder-bed system. A total of 96 metal frameworks (n=24 in each group) were prepared by using conventional lost-wax (group C), milling (group M), DMLS (group LS), and direct process powder-bed (group LC) methods according to International Organization for Standardization standard ISO 9693-1. After porcelain application, a 3-point bend test was applied to each specimen by using a universal testing machine. Data were statistically analyzed using 1-way ANOVA and Tukey honest significant difference tests (α=.05). Failure types at the metal-ceramic interfaces were examined using stereomicroscopy. Additionally, 1 specimen from each group was prepared for scanning electron microscopy analysis to evaluate the surface topography of metal frameworks. The mean bond strength was 38.08 ±3.82 MPa for group C, 39.29 ±3.51 MPa for group M, 40.73 ±3.58 MPa for group LS, and 41.24 ±3.75 MPa for group LC. Statistically significant differences were observed among the 4 groups (P=.016). All groups, except for LS, exhibited adhesive and mixed type bond failure. Both of the laser sintering methods were found to be successful in terms of metal-ceramic bond strength. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

  15. Comparing Amazon's Mechanical Turk Platform to Conventional Data Collection Methods in the Health and Medical Research Literature.

    Science.gov (United States)

    Mortensen, Karoline; Hughes, Taylor L

    2018-04-01

    The goal of this article is to conduct an assessment of the peer-reviewed primary literature with study objectives to analyze Amazon.com 's Mechanical Turk (MTurk) as a research tool in a health services research and medical context. Searches of Google Scholar and PubMed databases were conducted in February 2017. We screened article titles and abstracts to identify relevant articles that compare data from MTurk samples in a health and medical context to another sample, expert opinion, or other gold standard. Full-text manuscript reviews were conducted for the 35 articles that met the study criteria. The vast majority of the studies supported the use of MTurk for a variety of academic purposes. The literature overwhelmingly concludes that MTurk is an efficient, reliable, cost-effective tool for generating sample responses that are largely comparable to those collected via more conventional means. Caveats include survey responses may not be generalizable to the US population.

  16. Comparative evaluation of the anti-diabetic activity of Pterocarpus marsupium Roxb. heartwood in alloxan induced diabetic rats using extracts obtained by optimized conventional and non conventional extraction methods.

    Science.gov (United States)

    Devgan, Manish; Nanda, Arun; Ansari, Shahid Husain

    2013-09-01

    The aim of the present study was to assess the anti-diabetic activity of Pterocarpus marsupium Roxb. heartwood in alloxan induced diabetic rats using extracts obtained by optimized conventional and non conventional extraction methods. Aqueous and ethanol extracts of Pterocarpus marsupium heartwood were prepared by conventional methods (infusion, decoction, maceration and percolation) and non conventional methods, such as ultrasound-assisted extraction (UAE) and microwave-assisted extraction (MAE). The crude aqueous extracts were administered orally to both normal and alloxan induced male albino rats (Sprague-Dawley strain). The experimental set up consisted of 48 male albino rats divided into 6 groups: Normal control, diabetic control (sterile normal saline, 1 ml/100 g body weight), standard (gliclazide, 25 mg/1000g of body weight), groups 4-6 (crude aqueous percolation, optimized UAE and MAE extract, 250 mg/1000g of body weight). In acute treatment, the reduction of blood glucose level was statistically significant with the oral administration of UAE and percolation aqueous extracts to the hyperglycemic rats. In sub-acute treatment, the UAE aqueous extract led to consistent and statistically significant (p<0.001) reduction in the blood glucose levels. There was no abnormal change in body weight of the hyperglycemic animals after 10 days of administration of plant extracts and gliclazide. This study justifies the traditional claim and provides a rationale for the use of Pterocarpus marsupium to treat diabetes mellitus. The antidiabetic activity of Pterocarpus marsupium can be enhanced by extracting the heartwood by non conventional method of UAE.

  17. Additivity methods for prediction of thermochemical properties. The Laidler method revisited. 2. Hydrocarbons including substituted cyclic compounds

    International Nuclear Information System (INIS)

    Santos, Rui C.; Leal, Joao P.; Martinho Simoes, Jose A.

    2009-01-01

    A revised parameterization of the extended Laidler method for predicting standard molar enthalpies of atomization and standard molar enthalpies of formation at T = 298.15 K for several families of hydrocarbons (alkanes, alkenes, alkynes, polyenes, poly-ynes, cycloalkanes, substituted cycloalkanes, cycloalkenes, substituted cycloalkenes, benzene derivatives, and bi and polyphenyls) is presented. Data for a total of 265 gas-phase and 242 liquid-phase compounds were used for the calculation of the parameters. Comparison of the experimental values with those obtained using the additive scheme led to an average absolute difference of 0.73 kJ . mol -1 for the gas-phase standard molar enthalpy of formation and 0.79 kJ . mol -1 for the liquid-phase standard molar enthalpy of formation. The database used to establish the parameters was carefully reviewed by using, whenever possible, the original publications. A worksheet to simplify the calculation of standard molar enthalpies of formation and standard molar enthalpies of atomization at T = 298.15 K based on the extended Laidler parameters defined in this paper is provided as supplementary material.

  18. A case study comparing the use of laser induced fluorescence with cone penetrometer testing to more conventional screening methods

    International Nuclear Information System (INIS)

    Earley, K.; Rapp, K.

    1995-01-01

    Site assessments utilizing in-situ techniques to characterize subsurface stratigraphy and contaminant distribution are becoming more accepted and commonly used. Laser Induced Fluorescence (LIF) spectroscopy with Cone Penetrometer Test (CPT) is a new technology that provides real-time data on stratigraphy and petroleum hydrocarbons (PHCs) in the subsurface environment. Over the last two years, LIF technological advances have led to field equipment with improved durability, reduced bulk and weight, and the ability to integrate LIF systems with CPT equipment. The Rapid Optical Screening Tool (a Unisys registered trademark hereafter referred to as ROST) presents the development of an in-situ data collection system which couples state-of-the-art LIF technology with CPT. ROST/CPT technology has recently been utilized in a variety of field and soil conditions. These advances, along with the need for rapid in-situ information on the horizontal and vertical distribution of petroleum hydrocarbons (PHCs) have resulted in equipment that is now available for commercial applications. This paper presents a comparison of ROST/CPT to more conventional characterization methods at a manufacturing site in Nebraska. Various PHCs were stored in underground and above ground storage tanks across the site. One of these PHC spill areas consisting of a mixture of diesel fuel oil and kerosene was selected for a comparative study between various site assessment methods

  19. Ultrasound-assisted extraction of natural antioxidants from the flower of Limonium sinuatum: Optimization and comparison with conventional methods.

    Science.gov (United States)

    Xu, Dong-Ping; Zheng, Jie; Zhou, Yue; Li, Ya; Li, Sha; Li, Hua-Bin

    2017-02-15

    Natural antioxidants are widely used as dietary supplements or food additives. An optimized method of ultrasound-assisted extraction (UAE) was proposed for the effective extraction of antioxidants from the flowers of Limonium sinuatum and evaluated by response surface methodology. In this study, ethanol concentration, ratio of solvent to solid, ultrasonication time and temperature were investigated and optimized using a central composite rotatable design. The optimum extraction conditions were as follows: ethanol concentration, 60%; ratio of solvent to solid, 56.9:1mL/g; ultrasonication time, 9.8min; and temperature, 40°C. Under the optimal UAE conditions, the experimental values (483.01±15.39μmolTrolox/gDW) matched with those predicted (494.13μmolTrolox/gDW) within a 95% confidence level. In addition, the antioxidant activities of UAE were compared with those of conventional maceration and Soxhlet extraction methods, and the ultrasound-assisted extraction could give higher yield of antioxidants and markedly reduce the extraction time. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. A comparison of diamond growth rate using in-liquid and conventional plasma chemical vapor deposition methods

    International Nuclear Information System (INIS)

    Takahashi, Yoshiyuki; Toyota, Hiromichi; Nomura, Shinfuku; Mukasa, Shinobu; Inoue, Toru

    2009-01-01

    In order to make high-speed deposition of diamond effective, diamond growth rates for gas-phase microwave plasma chemical vapor deposition and in-liquid microwave plasma chemical vapor deposition are compared. A mixed gas of methane and hydrogen is used as the source gas for the gas-phase deposition, and a methanol solution of ethanol is used as the source liquid for the in-liquid deposition. The experimental system pressure is in the range of 60-150 kPa. While the growth rate of diamond increases as the pressure increases, the amount of input microwave energy per unit volume of diamond is 1 kW h/mm 3 regardless of the method used. Since the in-liquid deposition method provides a superior cooling effect through the evaporation of the liquid itself, a higher electric input power can be applied to the electrodes under higher pressure environments. The growth rate of in-liquid microwave plasma chemical vapor deposition process is found to be greater than conventional gas-phase microwave plasma chemical vapor deposition process under the same pressure conditions.

  1. A comparison of diamond growth rate using in-liquid and conventional plasma chemical vapor deposition methods

    Science.gov (United States)

    Takahashi, Yoshiyuki; Toyota, Hiromichi; Nomura, Shinfuku; Mukasa, Shinobu; Inoue, Toru

    2009-06-01

    In order to make high-speed deposition of diamond effective, diamond growth rates for gas-phase microwave plasma chemical vapor deposition and in-liquid microwave plasma chemical vapor deposition are compared. A mixed gas of methane and hydrogen is used as the source gas for the gas-phase deposition, and a methanol solution of ethanol is used as the source liquid for the in-liquid deposition. The experimental system pressure is in the range of 60-150 kPa. While the growth rate of diamond increases as the pressure increases, the amount of input microwave energy per unit volume of diamond is 1 kW h/mm3 regardless of the method used. Since the in-liquid deposition method provides a superior cooling effect through the evaporation of the liquid itself, a higher electric input power can be applied to the electrodes under higher pressure environments. The growth rate of in-liquid microwave plasma chemical vapor deposition process is found to be greater than conventional gas-phase microwave plasma chemical vapor deposition process under the same pressure conditions.

  2. Microstructural and Mechanical Properties of Porous 60NiTi Prepared by Conventional Press-and-sinter Method

    Directory of Open Access Journals (Sweden)

    Khanlari Khashayar

    2017-01-01

    Full Text Available An intermetallic nickel-titanium alloy, 60NiTi, comprised of approximately 60 wt.% Ni and 40 wt.% Ti, contains a broad combination of physical and mechanical properties such as high hardness, low elastic modulus, resistance to aqueous corrosion and good biocompatibility. These unique combinations make this alloy an attractive candidate for medical components such as implants and prosthesis, where biocompatible materials with high hardness and low stiffness are typically used. The conventional press-and-sinter method which represents the least complex, most flexible and economic powder metallurgy method was used to produce porous 60NiTi parts suitable for biomedical applications. The effect of sintering holding time on the microstructure and mechanical properties is investigated. The structure of the as sintered parts is quite porous which is beneficial based on the medical point of view. The ultimate compressive strength of the samples is higher than that of the compact human bone and can, therefore, meet the strength demand of implants for general bone replacement applications.

  3. Interrogating the Conventional Boundaries of Research Methods in Social Sciences: The Role of Visual Representation in Ethnography

    Directory of Open Access Journals (Sweden)

    Nel Glass

    2008-05-01

    Full Text Available The author will propose that the use of performative social science is a means to deliberately interrogate long held conventions of established research. The innovative role of visual art representation in data collection, analysis and public engagement with research will be discussed. Examples will be drawn from two postmodern feminist ethnographic research which investigated academic professional development, resilience, hope and optimism in the UK, US, Australia and New Zealand from 1997-2005. Artwork was initially created as data collection and digitalised as representation to intentionally validate the voices of research participants, the researcher and viewers of the work. The research participants and viewers were given opportunities to actively engage with the visual work. Artwork complimented two additional research methods: critical conversational interviewing and reflective journaling. This paper will address the ways inclusion of art methods contributed and deepened data representation. The role of crafting artwork in the field, the artistic changes that represented the complexity of data analysis and engagement with the work will be explored. It will be argued that the creation and engagement with artwork in research is an empowering and dynamic process for researchers and participants. It is an innovative means of representing intersubjectivity that results in reciprocity. URN: urn:nbn:de:0114-fqs0802509

  4. [Comparison between conventional methods, ChromAgar Candida® and PCR method for the identification of Candida species in clinical isolates].

    Science.gov (United States)

    Estrada-Barraza, Deyanira; Dávalos Martínez, Arturo; Flores-Padilla, Luis; Mendoza-De Elias, Roberto; Sánchez-Vargas, Luis Octavio

    2011-01-01

    The increase in the incidence of yeast species causing fungemia in susceptible immunocompromised patients in the last two decades and the low sensitivity of conventional blood culture has led to the need to develop alternative approaches for the early detection and identification of causative species. The aim of this study was to compare the usefulness of molecular testing by the polymerase chain reaction (PCR) and conventional methods to identify clinical isolates of different species, using the ID32C ATB system (bioMérieux, France), chromogenic culture Chromagar Candida® (CHROMagar, France) and morphogenesis in corn meal agar. We studied 79 isolates, in which the most prevalent species using the system ID32C and PCR was C. albicans, followed by C. tropicalis, C. glabrata and C .krusei. PCR patterns obtained for the identification of clinical isolates were stable and consistent in the various independent studies and showed good reproducibility, concluding that PCR with species-specific primers that amplify genes ITS1 and ITS2 for rRNA or topoisomerase II primers is a very specific and sensitive method for the identification of C. glabrata, C. krusei, C. albicans, and with less specificity for C. tropicalis. Copyright © 2010 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  5. Comparison on extraction yield of sennoside A and sennoside B from senna (Cassia angustifolia) using conventional and non conventional extraction techniques and their quantification using a validated HPLC-PDA detection method.

    Science.gov (United States)

    Dhanani, Tushar; Singh, Raghuraj; Reddy, Nagaraja; Trivedi, A; Kumar, Satyanshu

    2017-05-01

    Senna is an important medicinal plant and is used in many Ayurvedic formulations. Dianthraquinone glucosides are the main bioactive phytochemicals present in leaves and pods of senna. The extraction efficiency in terms of yield and composition of the extract of senna prepared using both conventional (cold percolation at room temperature and refluxing) and non conventional (ultrasound and microwave assisted solvent extraction as well as supercritical fluid extraction) techniques were compared in the present study. Also a rapid reverse phase HPLC-PDA detection method was developed and validated for the simultaneous determination of sennoside A and sennoside B in the different extracts of senna leaves. Ultrasound and microwave assisted solvent extraction techniques were more effective in terms of yield and composition of the extracts compared to cold percolation at room temperature and refluxing methods of extraction.

  6. A comparative study of conventional and supercritical fluid extraction methods for the recovery of secondary metabolites from Syzygium campanulatum Korth#

    Science.gov (United States)

    Memon, Abdul Hakeem; Hamil, Mohammad Shahrul Ridzuan; Laghari, Madeeha; Rithwan, Fahim; Zhari, Salman; Saeed, Mohammed Ali Ahmed; Ismail, Zhari; Majid, Amin Malik Shah Abdul

    2016-01-01

    Syzygium campanulatum Korth is a plant, which is a rich source of secondary metabolites (especially flavanones, chalcone, and triterpenoids). In our present study, three conventional solvent extraction (CSE) techniques and supercritical fluid extraction (SFE) techniques were performed to achieve a maximum recovery of two flavanones, chalcone, and two triterpenoids from S. campanulatum leaves. Furthermore, a Box-Behnken design was constructed for the SFE technique using pressure, temperature, and particle size as independent variables, and yields of crude extract, individual and total secondary metabolites as the dependent variables. In the CSE procedure, twenty extracts were produced using ten different solvents and three techniques (maceration, soxhletion, and reflux). An enriched extract of five secondary metabolites was collected using n-hexane:methanol (1:1) soxhletion. Using food-grade ethanol as a modifier, the SFE methods produced a higher recovery (25.5%‒84.9%) of selected secondary metabolites as compared to the CSE techniques (0.92%‒66.00%). PMID:27604860

  7. A comparative study of conventional and supercritical fluid extraction methods for the recovery of secondary metabolites from Syzygium campanulatum Korth.

    Science.gov (United States)

    Memon, Abdul Hakeem; Hamil, Mohammad Shahrul Ridzuan; Laghari, Madeeha; Rithwan, Fahim; Zhari, Salman; Saeed, Mohammed Ali Ahmed; Ismail, Zhari; Majid, Amin Malik Shah Abdul

    2016-09-01

    Syzygium campanulatum Korth is a plant, which is a rich source of secondary metabolites (especially flavanones, chalcone, and triterpenoids). In our present study, three conventional solvent extraction (CSE) techniques and supercritical fluid extraction (SFE) techniques were performed to achieve a maximum recovery of two flavanones, chalcone, and two triterpenoids from S. campanulatum leaves. Furthermore, a Box-Behnken design was constructed for the SFE technique using pressure, temperature, and particle size as independent variables, and yields of crude extract, individual and total secondary metabolites as the dependent variables. In the CSE procedure, twenty extracts were produced using ten different solvents and three techniques (maceration, soxhletion, and reflux). An enriched extract of five secondary metabolites was collected using n-hexane:methanol (1:1) soxhletion. Using food-grade ethanol as a modifier, the SFE methods produced a higher recovery (25.5%‒84.9%) of selected secondary metabolites as compared to the CSE techniques (0.92%‒66.00%).

  8. Comparison of Microleakage of Glass Ionomer Restoration in Primary Teeth Prepared by Er: YAG Laser and the Conventional Method

    Directory of Open Access Journals (Sweden)

    M. Ghandehari

    2012-01-01

    Full Text Available Objective: One of the main criteria in evaluating the restorative materials is the degree of microleakage. The aim of this study was to compare the microleakage of glass ionomer restored cavities prepared by Er:YAG laser or turbine and bur.Materials and Methods: Twenty extracted caries-free deciduous posterior teeth were selected for this study. The teeth were randomly divided into two groups for cavity preparation. Cavities in group one were prepared by high speed turbine and bur. In the second group, Er:YAG laser with a 3W output power, 300 mJ energy and 10 Hz frequency was used. Cavities were restored with GC Fuji II LC. After thermocycling, the samples were immersed into 0.5% methylene blue solution. They were sectioned for examination under optic microscope.Results: The Wilcoxon signed ranks test showed no significant difference between microleakage of the laser group and the conventional group (P>0.05.Conclusion: Er:YAG laser with its advantages in pediatric dentistry may be suggested as an alternative device for cavity preparation.Key Words: Er:YAG laser, Glass ionomer, Microleakage

  9. Detection of fungi by conventional methods and semi-nested PCR in patients with presumed fungal keratitis.

    Science.gov (United States)

    Haghani, I; Amirinia, F; Nowroozpoor-Dailami, K; Shokohi, T

    2015-06-01

    Fungal keratitis is a suppurative, ulcerative, and sight-threatening infection of the cornea that sometimes leads to blindness. The aims of this study were: recuperating facilities for laboratory diagnosis, determining the causative microorganisms, and comparing conventional laboratory diagnostic tools and semi-nested PCR. Sampling was conducted in patients with suspected fungal keratitis. Two corneal scrapings specimens, one for direct smear and culture and the other for semi- nested PCR were obtained. Of the 40 expected cases of mycotic keratitis, calcofluor white staining showed positivity in 25%, culture in 17.5%, KOH in 10%, and semi-nested PCR in 27.5%. The sensitivities of semi-nested PCR, KOH, and CFW were 57.1%, 28.5%, and 42% while the specificities were 78.7%, 94%, and 78.7%, respectively. The time taken for PCR assay was 4 to 8 hours, whereas positive fungal cultures took at least 5 to 7 days. Due to the increasing incidence of fungal infections in people with weakened immune systems, uninformed using of topical corticosteroids and improper use of contact lens, fast diagnosis and accurate treatment of keratomycosis seems to be essential . Therefore, according to the current study, molecular methods can detect mycotic keratitis early and correctly leading to appropriate treatment.

  10. POSITIONING ANALYSIS OF ISLAMIC BANK vis-àvis CONVENTIONAL BANK IN INDONESIA USING PARAMETRIC SFA AND DFA METHODS15

    Directory of Open Access Journals (Sweden)

    Ir Ascarya

    2014-03-01

    Full Text Available This study will measure and compare the efficiency of Conventional and Islamic banks in Indonesia using parametric approach stochastic frontier approach (SFA and distribution free approach (DFA. These measurements will provide comprehensive and robust results of efficiency of individual bank compare to its peer group. The results using parametric SFA show that in 2002, conventional banks (0.79 were slightly more efficient than Islamic banks (0.77, while in 2003, the efficiency of Islamic banks improved to 0.84 and the efficiency of conventional banks worsen to 0.76, so that Islamic banks have become more efficient than conventional banks. Conventional and Islamic banks have been improving and converged to the highest level of efficiency (1.00 since 2004. The DFA results show that conventional banks (0.89 are only slightly more efficient than Islamic banks (0.87. Conventional public bank (0.93 is the most efficient, while Islamic regional bank (0.84 is the least efficient. Moreover, efficient banks (conventional and Islamic do not always have lower OCOI (operating costs divided by operating income, while banks with better OCOI usually are more profitable (have better return on assets or ROA. Therefore, technically, Islamic banks have shown their readiness to compete head to head with their conventional counterparts. However, other aspects, such as, number of networks and branches, service quality, convenience, products and services provided, human resources, and pricing, should have become the next priorities for improvements.JEL Classification : C10, C33, G21, G28Keywords : Islamic Banking, Efficiency, Stochastic Frontier Approach, Distribution Free Approach

  11. Narrowing of the middle cerebral artery: artificial intelligence methods and comparison of transcranial color coded duplex sonography with conventional TCD.

    Science.gov (United States)

    Swiercz, Miroslaw; Swiat, Maciej; Pawlak, Mikolaj; Weigele, John; Tarasewicz, Roman; Sobolewski, Andrzej; Hurst, Robert W; Mariak, Zenon D; Melhem, Elias R; Krejza, Jaroslaw

    2010-01-01

    The goal of the study was to compare performances of transcranial color-coded duplex sonography (TCCS) and transcranial Doppler sonography (TCD) in the diagnosis of the middle cerebral artery (MCA) narrowing in the same population of patients using statistical and nonstatistical intelligent models for data analysis. We prospectively collected data from 179 consecutive routine digital subtraction angiography (DSA) procedures performed in 111 patients (mean age 54.17+/-14.4 years; 59 women, 52 men) who underwent TCD and TCCS examinations simultaneously. Each patient was examined independently using both ultrasound techniques, 267 M1 segments of MCA were assessed and narrowings were classified as 50% lumen reduction. Diagnostic performance was estimated by two statistical and two artificial neural networks (ANN) classification methods. Separate models were constructed for the TCD and TCCS sonographic data, as well as for detection of "any narrowing" and "severe narrowing" of the MCA. Input for each classifier consisted of the peak-systolic, mean and end-diastolic velocities measured with each sonographic method; the output was MCA narrowing. Arterial narrowings less or equal 50% of lumen reduction were found in 55 and >50% narrowings in 26 out of 267 arteries, as indicated by DSA. In the category of "any narrowing" the rate of correct assignment by all models was 82% to 83% for TCCS and 79% to 81% for TCD. In the diagnosis of >50% narrowing the overall classification accuracy remained in the range of 89% to 90% for TCCS data and 90% to 91% for TCD data. For the diagnosis of any narrowing, the sensitivity of the TCCS was significantly higher than that of the TCD, while for diagnosis of >50% MCA narrowing, sensitivity of the TCCS was similar to sensitivity of the TCD. Our study showed that TCCS outperforms conventional TCD in detection of diagnosis of >50% MCA narrowing. (E-mail: jaroslaw.krejza@uphs.upenn.edu).

  12. Comparison of type and frequency of chromosome aberrations by conventional and G-staining methods in Hiroshima atomic bomb survivors

    International Nuclear Information System (INIS)

    Ohtaki, Kazuo; Shimba, Hachiro; Sofuni, Toshio; Awa, A.A.

    1982-07-01

    Somatic chromosomes derived from cultured lymphocytes of 23 atomic bomb survivors of Hiroshima were analyzed to determine the type and frequency of radiation-induced structural aberrations, using in sequence the ordinary staining method (O-method) and the trypsin G-banding method (G-method). Of 896 cells examined, 342 were found to contain induced aberrations, including 31 cells in which the precise identification of the type of aberrations was not possible even by the G-method. The number of chromosome aberrations observed was 376 in the 311 cells where aberrant precise identification was possible. The majority (288 or 76.6%) were intra- or inter-chromosomal symmetric exchanges due to a two-break event, while only 24 were found to be asymmetric exchanges (dicentrics, rings, and interstitial deletions). Further, there were 28 aberrations showing acentric fragments and terminal deletions, and the remaining 36 were complex intra- and inter-chromosomal exchanges involving three or more breaks which result in insertions and double translocations. A comparative karyotype analysis of the same metaphases examined by the sequential 0- And G-methods was carried out independently on 361 aberrations, mostly of the symmetric type. It was found that 78 (21.6%) of the 361 were detected only by the G-method; among these were 14 paracentric inversions, 48 reciprocal interchanges of chromosome segments with either equal length (11) or unequal length (37), 14 minor deletions and 2 complex rearrangements, all of which were nevertheless judged to fall within the normal range of variation by theO-method. In contrast, 25 aberrations detected in O-method chromosomes which were overcontracted or twisted, were shown to have normal banding patterns by the G-method. (author)

  13. Conventional imaging in paediatric uroradiology

    International Nuclear Information System (INIS)

    Riccabona, M.; Lindbichler, F.; Sinzig, M.

    2002-01-01

    Objective: To briefly describe basic conventional imaging in paediatric uroradiology. Method: The state of the art performance of standard imaging techniques (intravenous urography (IVU), voiding cystourethrography (VCU), and ultrasound (US)) is described, with emphasis on technical aspects, indications, and patient preparation such as adequate hydration. Only basic applications as used in routine clinical work are included. Result and conclusion: Conventional imaging methods are irreplaceable. They cover the majority of daily clinical routine queries, with consecutive indication of more sophisticated modalities in those patients who need additional imaging for establishing the final diagnosis or outlining therapeutic options

  14. Conventional imaging in paediatric uroradiology

    Energy Technology Data Exchange (ETDEWEB)

    Riccabona, M. E-mail: michael.riccabona@kfunigraz.ac.at; Lindbichler, F.; Sinzig, M

    2002-08-01

    Objective: To briefly describe basic conventional imaging in paediatric uroradiology. Method: The state of the art performance of standard imaging techniques (intravenous urography (IVU), voiding cystourethrography (VCU), and ultrasound (US)) is described, with emphasis on technical aspects, indications, and patient preparation such as adequate hydration. Only basic applications as used in routine clinical work are included. Result and conclusion: Conventional imaging methods are irreplaceable. They cover the majority of daily clinical routine queries, with consecutive indication of more sophisticated modalities in those patients who need additional imaging for establishing the final diagnosis or outlining therapeutic options.

  15. Teaching Methods in Biology Education and Sustainability Education Including Outdoor Education for Promoting Sustainability—A Literature Review

    Directory of Open Access Journals (Sweden)

    Eila Jeronen

    2016-12-01

    Full Text Available There are very few studies concerning the importance of teaching methods in biology education and environmental education including outdoor education for promoting sustainability at the levels of primary and secondary schools and pre-service teacher education. The material was selected using special keywords from biology and sustainable education in several scientific databases. The article provides an overview of 24 selected articles published in peer-reviewed scientific journals from 2006–2016. The data was analyzed using qualitative content analysis. Altogether, 16 journals were selected and 24 articles were analyzed in detail. The foci of the analyses were teaching methods, learning environments, knowledge and thinking skills, psychomotor skills, emotions and attitudes, and evaluation methods. Additionally, features of good methods were investigated and their implications for teaching were emphasized. In total, 22 different teaching methods were found to improve sustainability education in different ways. The most emphasized teaching methods were those in which students worked in groups and participated actively in learning processes. Research points toward the value of teaching methods that provide a good introduction and supportive guidelines and include active participation and interactivity.

  16. Teaching Methods in Biology Education and Sustainability Education Including Outdoor Education for Promoting Sustainability--A Literature Review

    Science.gov (United States)

    Jeronen, Eila; Palmberg, Irmeli; Yli-Panula, Eija

    2017-01-01

    There are very few studies concerning the importance of teaching methods in biology education and environmental education including outdoor education for promoting sustainability at the levels of primary and secondary schools and pre-service teacher education. The material was selected using special keywords from biology and sustainable education…

  17. Method for assessment of stormwater treatment facilities - Synthetic road runoff addition including micro-pollutants and tracer.

    Science.gov (United States)

    Cederkvist, Karin; Jensen, Marina B; Holm, Peter E

    2017-08-01

    Stormwater treatment facilities (STFs) are becoming increasingly widespread but knowledge on their performance is limited. This is due to difficulties in obtaining representative samples during storm events and documenting removal of the broad range of contaminants found in stormwater runoff. This paper presents a method to evaluate STFs by addition of synthetic runoff with representative concentrations of contaminant species, including the use of tracer for correction of removal rates for losses not caused by the STF. A list of organic and inorganic contaminant species, including trace elements representative of runoff from roads is suggested, as well as relevant concentration ranges. The method was used for adding contaminants to three different STFs including a curbstone extension with filter soil, a dual porosity filter, and six different permeable pavements. Evaluation of the method showed that it is possible to add a well-defined mixture of contaminants despite different field conditions by having a flexibly system, mixing different stock-solutions on site, and use bromide tracer for correction of outlet concentrations. Bromide recovery ranged from only 12% in one of the permeable pavements to 97% in the dual porosity filter, stressing the importance of including a conservative tracer for correction of contaminant retention values. The method is considered useful in future treatment performance testing of STFs. The observed performance of the STFs is presented in coming papers. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Dumping convention

    International Nuclear Information System (INIS)

    Roche, P.

    1992-01-01

    Sea dumping of radioactive waste has, since 1983, been precluded under a moratorium established by the London Dumping Convention. Pressure from the nuclear industry to allow ocean dumping of nuclear waste is reported in this article. (author)

  19. On-line high-performance liquid chromatography-ultraviolet-nuclear magnetic resonance method of the markers of nerve agents for verification of the Chemical Weapons Convention.

    Science.gov (United States)

    Mazumder, Avik; Gupta, Hemendra K; Garg, Prabhat; Jain, Rajeev; Dubey, Devendra K

    2009-07-03

    This paper details an on-flow liquid chromatography-ultraviolet-nuclear magnetic resonance (LC-UV-NMR) method for the retrospective detection and identification of alkyl alkylphosphonic acids (AAPAs) and alkylphosphonic acids (APAs), the markers of the toxic nerve agents for verification of the Chemical Weapons Convention (CWC). Initially, the LC-UV-NMR parameters were optimized for benzyl derivatives of the APAs and AAPAs. The optimized parameters include stationary phase C(18), mobile phase methanol:water 78:22 (v/v), UV detection at 268nm and (1)H NMR acquisition conditions. The protocol described herein allowed the detection of analytes through acquisition of high quality NMR spectra from the aqueous solution of the APAs and AAPAs with high concentrations of interfering background chemicals which have been removed by preceding sample preparation. The reported standard deviation for the quantification is related to the UV detector which showed relative standard deviations (RSDs) for quantification within +/-1.1%, while lower limit of detection upto 16mug (in mug absolute) for the NMR detector. Finally the developed LC-UV-NMR method was applied to identify the APAs and AAPAs in real water samples, consequent to solid phase extraction and derivatization. The method is fast (total experiment time approximately 2h), sensitive, rugged and efficient.

  20. Genetic and geological classification wetlands proposed. Application to the spanish wetlands included in the Ramsar convention; Propuesta de clasificacion genetico-geologica de humedales. Aplicacion a los humedales espanoles incluidos en el Convenio de Ramsar

    Energy Technology Data Exchange (ETDEWEB)

    Duran Valsero, J. J.; Garcia de Domingo, A.; Robledo Ardila, P.

    2009-07-01

    The classification represents the first step in the research of the wetlands. There are several types of classifications established according different criteria: geographic, genetic, geologic, functional, hydric, biologic and others. In this work we considered the genetic and geologic classifications criteria are the more suitable because the criteria used are very concrete, descriptive and its application should be easier to put into practice. Every group established in this type of classification determines the develop naturals conditions allowing us to establish the evolution guidelines and same main management lines. The criteria used to develop this classification have been fundamentally: geologic, geomorphologic, tectonics, stratigraphic, and hydrogeologic because these determine greatly the physical wetland characteristics (geometric parameters, hydric nourishment system, hydrochemical characteristics and others). The general characteristics, guidelines behavior of the wetland, and the early evolution of every group of wetland could be essentials to detect and identified those actuations modifying the natural evolution in each concrete wetland. In this work we are applying these classification criteria to the Spanish wetlands included in the Ramsar Convention (until February 2006), defining twelve types of basic wetlands according the geologic and genetic characteristics. (Author) 19 refs.

  1. Guidelines for the verification and validation of expert system software and conventional software: Volume 2, Survey and assessment of conventional software verification and validation methods Revision 1, Final report

    International Nuclear Information System (INIS)

    Miller, L.A.; Groundwater, E.H.; Hayes, J.E.; Mirsky, S.M.

    1995-05-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 153 methods so identified were classified according to their appropriateness for various phases of a developmental life-cycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods' power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit Metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V ampersand V (determined by ratings of a system's complexity and required-integrity). Methods were then rank-ordered for each of the three classes in terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each method for the four identified components of knowledge-based and expert systems, as well as the system as a whole

  2. Comparison Of INAA Methods (Long Conventional, Cyclic And Pseudo-Cyclic) For The Determination Of Se In Biological Samples

    International Nuclear Information System (INIS)

    Sarheel, A.

    2004-01-01

    Selenium content in serum blood, sample were received from international comparison programme (SABC) has been determined by Cyclic irradiation, pseudo-cyclic irradiation and long irradiation conventional Instrumental neutron activation analysis through the 162 keV gamma ray of the 77m Se nuclide for both cyclic and pseudo-cyclic and 264 keV gamma ray of 75 Se nuclide for conventional (long irradiation). The CINAA involve irradiation of samples for 20 s, decay for 15 s and counting for 20 s, samples recycling four times to improve the precision. The PCINAA involve irradiation of samples for 20 s, decay for 20 s and counting for 30s, samples recycling four times day by day. The Conventional (long irradiation) involve irradiation of samples for 20 hr (1 week), decay for 4 weeks and counting for 20 hr. The accuracy has been evaluated by analyzing the certified reference materials. (Author)

  3. Analysis of Longitudinal Studies With Repeated Outcome Measures: Adjusting for Time-Dependent Confounding Using Conventional Methods.

    Science.gov (United States)

    Keogh, Ruth H; Daniel, Rhian M; VanderWeele, Tyler J; Vansteelandt, Stijn

    2018-05-01

    Estimation of causal effects of time-varying exposures using longitudinal data is a common problem in epidemiology. When there are time-varying confounders, which may include past outcomes, affected by prior exposure, standard regression methods can lead to bias. Methods such as inverse probability weighted estimation of marginal structural models have been developed to address this problem. However, in this paper we show how standard regression methods can be used, even in the presence of time-dependent confounding, to estimate the total effect of an exposure on a subsequent outcome by controlling appropriately for prior exposures, outcomes, and time-varying covariates. We refer to the resulting estimation approach as sequential conditional mean models (SCMMs), which can be fitted using generalized estimating equations. We outline this approach and describe how including propensity score adjustment is advantageous. We compare the causal effects being estimated using SCMMs and marginal structural models, and we compare the two approaches using simulations. SCMMs enable more precise inferences, with greater robustness against model misspecification via propensity score adjustment, and easily accommodate continuous exposures and interactions. A new test for direct effects of past exposures on a subsequent outcome is described.

  4. Efficacious and safe orotracheal intubation for laboratory mice using slim torqueable guidewire-based technique: comparisons between a modified and a conventional method.

    Science.gov (United States)

    Su, Chieh-Shou; Lai, Hui-Chin; Wang, Chih-Yen; Lee, Wen-Lieng; Wang, Kuo-Yang; Yang, Ya-Ling; Wang, Li-Chun; Liu, Chia-Ning; Liu, Tsun-Jui

    2016-01-18

    Tracheal intubation of laboratory mice remains essential yet challenging for most researchers. The aim of this study was to investigate whether this procedure can be more efficiently and safely accomplished by a novel method using slim and torqueable guidewires to guide access to the trachea. This study was carried out in an animal laboratory affiliated to a tertiary medical center. Mice weighing 22 to 28 g were subjected to various open-chest experiments after being anesthetized with intraperitoneal ketamine (100 mg/kg) and lidocaine hydrochloride (10 mg/kg). The oropharyngeal cavity was opened with angled tissue forceps, and the trachea was transilluminated using an external light. The vocal cords were then crossed using either the Conventional method with a 38-mm-long, end-blunted stiff needle as a guide for insertion of a 22-gauge, 25-mm-long intravenous catheter into the trachea, or the Modified method utilizing using a 0.014-inch-thin torqueable wire as the guide to introduce an identical tube over it into the trachea. The epithelial integrity of the trachea was later examined histologically when the animals were sacrificed either immediately after the surgery or at 28 days post-surgery, depending on the corresponding research protocols. Orotracheal intubation was successfully completed in all mice using either the Conventional (N = 42) or the Modified method (N = 50). With the Modified method, intubation took less time (1.73 vs. 2.17 min, Modified vs. Conventional, p Conventional method. Histological analysis revealed a significantly lower incidence of immediate (0% vs. 39%, p Conventional method. Tracheal intubation for laboratory mice can be completed efficiently, safely and atraumatically using the proposed Modified method employing readily available inexpensive instruments.

  5. A robust two-node, 13 moment quadrature method of moments for dilute particle flows including wall bouncing

    Science.gov (United States)

    Sun, Dan; Garmory, Andrew; Page, Gary J.

    2017-02-01

    For flows where the particle number density is low and the Stokes number is relatively high, as found when sand or ice is ingested into aircraft gas turbine engines, streams of particles can cross each other's path or bounce from a solid surface without being influenced by inter-particle collisions. The aim of this work is to develop an Eulerian method to simulate these types of flow. To this end, a two-node quadrature-based moment method using 13 moments is proposed. In the proposed algorithm thirteen moments of particle velocity, including cross-moments of second order, are used to determine the weights and abscissas of the two nodes and to set up the association between the velocity components in each node. Previous Quadrature Method of Moments (QMOM) algorithms either use more than two nodes, leading to increased computational expense, or are shown here to give incorrect results under some circumstances. This method gives the computational efficiency advantages of only needing two particle phase velocity fields whilst ensuring that a correct combination of weights and abscissas is returned for any arbitrary combination of particle trajectories without the need for any further assumptions. Particle crossing and wall bouncing with arbitrary combinations of angles are demonstrated using the method in a two-dimensional scheme. The ability of the scheme to include the presence of drag from a carrier phase is also demonstrated, as is bouncing off surfaces with inelastic collisions. The method is also applied to the Taylor-Green vortex flow test case and is found to give results superior to the existing two-node QMOM method and is in good agreement with results from Lagrangian modelling of this case.

  6. Clinical target volume localization using conventional methods (anatomy and palpation) and ultrasonography in early breast cancer post-operative external irradiation

    International Nuclear Information System (INIS)

    Valdagni, Riccardo; Italia, Corrado; Montanaro, Paolo; Ciocca, Mario; Morandi, Giovanni; Salvadori, Bruno

    1997-01-01

    %, respectively (P = 0.02). Also, in the subgroup of pre-menopausal patients the CTV defined by palpatory reference lines appeared to be more accurate than A-method (P < 0.01). Conclusions: Conventional methods frequently appear inadequate to localize residual mammary gland in EBC post-operative external irradiation. This analysis evidentiates the inaccuracy of empirical CTV definition, and suggests that palpation or anatomical reference borders should be critically used and that state of art imaging methods should be included in treatment planning, particularly in pre-menopausal pts. If economical or individual variables have to be taken into account, palpation might be considered in post-menopausal women

  7. Synthesis of hydroxyapatite nanorods for application in water defluoridation and optimization of process variables: Advantage of ultrasonication with precipitation method over conventional method.

    Science.gov (United States)

    Mehta, Dhiraj; Mondal, Poonam; Saharan, Virendra Kumar; George, Suja

    2017-07-01

    This research work presents the synthesis of hydroxyapatite (Hap) nanorods for defluoridation of drinking water by using both conventional (CM) and ultrasonication with precipitation (USPM) methods. Calcium nitrate was reacted with potassium phosphate in presence of ammonia for controlled pH to synthesize Hap nanorods, which was characterized using FTIR, XRD, SEM, TG-DTA, and TEM/EDS for determining its phase composition, structural and thermal decomposition behavior. When USPM method was used for synthesis, the yield of the Hap nanorods was improved from 83.24±1.0% to 90.2±1.0%, and complete phase transformation occurred with formation of elongated Hap nanorods. Effects of process parameters such as solution pH, contact time and adsorbent dose were studied through response surface methodology (RSM). A simple quadratic model was developed using Central Composite Design (CCD) and optimum parameters for fluoride adsorption process were determined to be pH 7, contact time 3h and adsorbent dose 7g/L for maximum removal capacity. Fluoride removal efficiency was predicted to be 93.64% which was very close to the experimental value obtained at 92.86% using ultrasonically prepared Hap. Fluoride adsorption isotherms fitted the Freundlich isotherm with an adsorption capacity of 1.49mg/g, while the kinetic studies revealed that the process followed pseudo-second order model. The treated water quality parameters such as residual fluoride, calcium leached, total hardness and alkalinity was investigated, and it was observed that all these parameters were within the permissible limits as per WHO and BIS standards. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. TRANSAT-- method for detecting the conserved helices of functional RNA structures, including transient, pseudo-knotted and alternative structures.

    Science.gov (United States)

    Wiebe, Nicholas J P; Meyer, Irmtraud M

    2010-06-24

    The prediction of functional RNA structures has attracted increased interest, as it allows us to study the potential functional roles of many genes. RNA structure prediction methods, however, assume that there is a unique functional RNA structure and also do not predict functional features required for in vivo folding. In order to understand how functional RNA structures form in vivo, we require sophisticated experiments or reliable prediction methods. So far, there exist only a few, experimentally validated transient RNA structures. On the computational side, there exist several computer programs which aim to predict the co-transcriptional folding pathway in vivo, but these make a range of simplifying assumptions and do not capture all features known to influence RNA folding in vivo. We want to investigate if evolutionarily related RNA genes fold in a similar way in vivo. To this end, we have developed a new computational method, Transat, which detects conserved helices of high statistical significance. We introduce the method, present a comprehensive performance evaluation and show that Transat is able to predict the structural features of known reference structures including pseudo-knotted ones as well as those of known alternative structural configurations. Transat can also identify unstructured sub-sequences bound by other molecules and provides evidence for new helices which may define folding pathways, supporting the notion that homologous RNA sequence not only assume a similar reference RNA structure, but also fold similarly. Finally, we show that the structural features predicted by Transat differ from those assuming thermodynamic equilibrium. Unlike the existing methods for predicting folding pathways, our method works in a comparative way. This has the disadvantage of not being able to predict features as function of time, but has the considerable advantage of highlighting conserved features and of not requiring a detailed knowledge of the cellular

  9. Method of fabricating electrodes including high-capacity, binder-free anodes for lithium-ion batteries

    Science.gov (United States)

    Ban, Chunmei; Wu, Zhuangchun; Dillon, Anne C.

    2017-01-10

    An electrode (110) is provided that may be used in an electrochemical device (100) such as an energy storage/discharge device, e.g., a lithium-ion battery, or an electrochromic device, e.g., a smart window. Hydrothermal techniques and vacuum filtration methods were applied to fabricate the electrode (110). The electrode (110) includes an active portion (140) that is made up of electrochemically active nanoparticles, with one embodiment utilizing 3d-transition metal oxides to provide the electrochemical capacity of the electrode (110). The active material (140) may include other electrochemical materials, such as silicon, tin, lithium manganese oxide, and lithium iron phosphate. The electrode (110) also includes a matrix or net (170) of electrically conductive nanomaterial that acts to connect and/or bind the active nanoparticles (140) such that no binder material is required in the electrode (110), which allows more active materials (140) to be included to improve energy density and other desirable characteristics of the electrode. The matrix material (170) may take the form of carbon nanotubes, such as single-wall, double-wall, and/or multi-wall nanotubes, and be provided as about 2 to 30 percent weight of the electrode (110) with the rest being the active material (140).

  10. [A comparative study between the Vitek YBC and Microscan Walk Away RYID automated systems with conventional phenotypic methods for the identification of yeasts of clinical interest].

    Science.gov (United States)

    Ferrara, Giuseppe; Mercedes Panizol, Maria; Mazzone, Marja; Delia Pequeneze, Maria; Reviakina, Vera

    2014-12-01

    The aim of this study was to compare the identification of clin- ically relevant yeasts by the Vitek YBC and Microscan Walk Away RYID automated methods with conventional phenotypic methods. One hundred and ninety three yeast strains isolated from clinical samples and five controls strains were used. All the yeasts were identified by the automated methods previously mentioned and conventional phenotypic methods such as carbohydrate assimilation, visualization of microscopic morphology on corn meal agar and the use of chromogenic agar. Variables were assessed by 2 x 2 contingency tables, McNemar's Chi square, the Kappa index, and concordance values were calculated, as well as major and minor errors for the automated methods. Yeasts were divided into two groups: (1) frequent isolation and (2) rare isolation. The Vitek YBC and Microscan Walk Away RYID systems were concordant in 88.4 and 85.9% respectively, when compared to conventional phenotypic methods. Although both automated systems can be used for yeasts identification, the presence of major and minor errors indicates the possibility of misidentifications; therefore, the operator of this equipment must use in parallel, phenotypic tests such as visualization of microscopic morphology on corn meal agar and chromogenic agar, especially against infrequently isolated yeasts. Automated systems are a valuable tool; however, the expertise and judgment of the microbiologist are an important strength to ensure the quality of the results.

  11. Comparison of the quantitative dry culture methods with both conventional media and most probable number method for the enumeration of coliforms and Escherichia coli/coliforms in food.

    Science.gov (United States)

    Teramura, H; Sota, K; Iwasaki, M; Ogihara, H

    2017-07-01

    Sanita-kun™ CC (coliform count) and EC (Escherichia coli/coliform count), sheet quantitative culture systems which can avoid chromogenic interference by lactase in food, were evaluated in comparison with conventional methods for these bacteria. Based on the results of inclusivity and exclusivity studies using 77 micro-organisms, sensitivity and specificity of both Sanita-kun™ met the criteria for ISO 16140. Both media were compared with deoxycholate agar, violet red bile agar, Merck Chromocult™ coliform agar (CCA), 3M Petrifilm™ CC and EC (PEC) and 3-tube MPN, as reference methods, in 100 naturally contaminated food samples. The correlation coefficients of both Sanita-kun™ for coliform detection were more than 0·95 for all comparisons. For E. coli detection, Sanita-kun™ EC was compared with CCA, PEC and MPN in 100 artificially contaminated food samples. The correlation coefficients for E. coli detection of Sanita-kun™ EC were more than 0·95 for all comparisons. There were no significant differences in all comparisons when conducting a one-way analysis of variance (anova). Both Sanita-kun™ significantly inhibited colour interference by lactase when inhibition of enzymatic staining was assessed using 40 natural cheese samples spiked with coliform. Our results demonstrated Sanita-kun™ CC and EC are suitable alternatives for the enumeration of coliforms and E. coli/coliforms, respectively, in a variety of foods, and specifically in fermented foods. Current chromogenic media for coliforms and Escherichia coli/coliforms have enzymatic coloration due to breaking down of chromogenic substrates by food lactase. The novel sheet culture media which have film layer to avoid coloration by food lactase have been developed for enumeration of coliforms and E. coli/coliforms respectively. In this study, we demonstrated these media had comparable performance with reference methods and less interference by food lactase. These media have a possibility not only

  12. Accuracy and precision of 3 intraoral scanners and accuracy of conventional impressions: A novel in vivo analysis method.

    Science.gov (United States)

    Nedelcu, R; Olsson, P; Nyström, I; Rydén, J; Thor, A

    2018-02-01

    To evaluate a novel methodology using industrial scanners as a reference, and assess in vivo accuracy of 3 intraoral scanners (IOS) and conventional impressions. Further, to evaluate IOS precision in vivo. Four reference-bodies were bonded to the buccal surfaces of upper premolars and incisors in five subjects. After three reference-scans, ATOS Core 80 (ATOS), subjects were scanned three times with three IOS systems: 3M True Definition (3M), CEREC Omnicam (OMNI) and Trios 3 (TRIOS). One conventional impression (IMPR) was taken, 3M Impregum Penta Soft, and poured models were digitized with laboratory scanner 3shape D1000 (D1000). Best-fit alignment of reference-bodies and 3D Compare Analysis was performed. Precision of ATOS and D1000 was assessed for quantitative evaluation and comparison. Accuracy of IOS and IMPR were analyzed using ATOS as reference. Precision of IOS was evaluated through intra-system comparison. Precision of ATOS reference scanner (mean 0.6 μm) and D1000 (mean 0.5 μm) was high. Pairwise multiple comparisons of reference-bodies located in different tooth positions displayed a statistically significant difference of accuracy between two scanner-groups: 3M and TRIOS, over OMNI (p value range 0.0001 to 0.0006). IMPR did not show any statistically significant difference to IOS. However, deviations of IOS and IMPR were within a similar magnitude. No statistical difference was found for IOS precision. The methodology can be used for assessing accuracy of IOS and IMPR in vivo in up to five units bilaterally from midline. 3M and TRIOS had a higher accuracy than OMNI. IMPR overlapped both groups. Intraoral scanners can be used as a replacement for conventional impressions when restoring up to ten units without extended edentulous spans. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. Applications of the conjugate gradient FFT method in scattering and radiation including simulations with impedance boundary conditions

    Science.gov (United States)

    Barkeshli, Kasra; Volakis, John L.

    1991-01-01

    The theoretical and computational aspects related to the application of the Conjugate Gradient FFT (CGFFT) method in computational electromagnetics are examined. The advantages of applying the CGFFT method to a class of large scale scattering and radiation problems are outlined. The main advantages of the method stem from its iterative nature which eliminates a need to form the system matrix (thus reducing the computer memory allocation requirements) and guarantees convergence to the true solution in a finite number of steps. Results are presented for various radiators and scatterers including thin cylindrical dipole antennas, thin conductive and resistive strips and plates, as well as dielectric cylinders. Solutions of integral equations derived on the basis of generalized impedance boundary conditions (GIBC) are also examined. The boundary conditions can be used to replace the profile of a material coating by an impedance sheet or insert, thus, eliminating the need to introduce unknown polarization currents within the volume of the layer. A general full wave analysis of 2-D and 3-D rectangular grooves and cavities is presented which will also serve as a reference for future work.

  14. The environmental impact of coal technology: Politics and methods of achieving an international convention to protect the earth's atmosphere

    International Nuclear Information System (INIS)

    1992-01-01

    Particular attention will be paid to the following points during the international Round Table discussions: Technology transfer and political opportunities for the environmentally-compatible use of coal in developing and transitional countries who rely on coal to meet their energy needs. Supporting this challenge for the international community of coal-based energy conservation in these countries, particularly through development aid. To increasingly accept our collective responsibility for energy considerations and environmental effects, based on a better understanding of the countries' differing limits and obligations in achieving the goal of a convention to protect the earth's atmosphere. (orig.) [de

  15. Transfer of pharmacopoeial liquid chromatography reversedphase methods for determination of related compounds in diclofenac sodium and metamizole sodium from conventional to core-shell column

    Directory of Open Access Journals (Sweden)

    Katerina Brezovska

    2015-04-01

    Full Text Available Core-shell silica particles were developed as a new material for chromatographic stationary phases in order to provide fast and high efficiency separations of small and large molecules and complex samples, at pressures compatible with conventional HPLC equipment. The aim of our work was to show the applicability of the HPLC columns based on a core-shell technology for determination of related substances in diclofenac sodium and in metamizole sodium using the methods described in the corresponding monographs of the European pharmacopoeia. The obtained results have shown that the proposed methods can be successfully transferred on core shell column, with suitable adjustment of injection volume and flow rate. The advantage of using core-shell column is fast and highly efficient separation on conventional HPLC equipment with increased sensitivity of the method and high throughput of the analysis, providing enhanced lab productivity and reduced costs.

  16. A simple gold nanoparticle-mediated immobilization method to fabricate highly homogeneous DNA microarrays having higher capacities than those prepared by using conventional techniques

    International Nuclear Information System (INIS)

    Jung, Cheulhee; Mun, Hyo Young; Li, Taihua; Park, Hyun Gyu

    2009-01-01

    A simple, highly efficient immobilization method to fabricate DNA microarrays, that utilizes gold nanoparticles as the mediator, has been developed. The fabrication method begins with electrostatic attachment of amine-modified DNA to gold nanoparticles. The resulting gold-DNA complexes are immobilized on conventional amine or aldehyde functionalized glass slides. By employing gold nanoparticles as the immobilization mediator, implementation of this procedure yields highly homogeneous microarrays that have higher binding capacities than those produced by conventional methods. This outcome is due to the increased three-dimensional immobilization surface provided by the gold nanoparticles as well as the intrinsic effects of gold on emission properties. This novel immobilization strategy gives microarrays that produce more intense hybridization signals for the complementary DNA. Furthermore, the silver enhancement technique, made possible only in the case of immobilized gold nanoparticles on the microarrays, enables simple monitoring of the integrity of the immobilized DNA probe.

  17. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    Directory of Open Access Journals (Sweden)

    Sung-Hye You

    2017-01-01

    Full Text Available Purpose The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL, for measuring the volume of parathyroid glands. Methods Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D and three-dimensional (3D methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. Results The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. Conclusion The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism.

  18. Evaluation of conventional therapeutic methods versus maggot therapy in the evolution of healing of tegumental injuries in Wistar rats with and without diabetes mellitus.

    Science.gov (United States)

    Masiero, Franciéle Souza; Thyssen, Patricia Jacqueline

    2016-06-01

    Larval therapy consists on the application of sterilized carrion flies larvae, reared in laboratory, on acute, chronic, and/or infected wounds in order to promote healing. Conventional methods for treating injuries include mechanical debridement or silver-based dressings; however, they are not always effective for wound healing. Larval therapy is a feasible and safe treatment for therapeutic application and, in many cases, the only and the most recommended alternative for difficult healing injuries. Thus, this study aimed to evaluate the competence of Cochliomyia macellaria F. (Diptera: Calliphoridae) as a suitable species for therapeutic application and evaluate time and effectiveness of the types of treatments most commonly used to treat integumental injuries. C. macellaria eggs were obtained from colonies established in laboratory and sterilized prior to application. Twenty-five larvae were applied for each centimeter squared of lesion. Lesions were induced in 24 Wistar rats; type 1 diabetes mellitus was induced in 12 of them. Animals were divided in four groups with three individuals each, being denominated: larval therapy, larval therapy associated with foam dressing with silver release, mechanical debridement with foam dressing silver and control group, without treatment. All treatments were applied once and held for 24 h. Medical application of larvae was found to be safe, as only dead tissue was removed, and efficient to accelerate healing process when compared to other treatments.

  19. Evaluation of the effect of salts on chemical, structural, textural, sensory and heating properties of cheese: Contribution of conventional methods and spectral ones.

    Science.gov (United States)

    Loudiyi, M; Aït-Kaddour, A

    2018-03-21

    Chemical composition, sensory characteristics, textural and functional properties are among the most important characteristics, which directly relates to the global quality of cheese and to consumer acceptability. A number of factors including milk composition, processing conditions and salt content, influences these properties. The past decades many investigations were performed on the possibilities to reduce salt content of cheese due to its adverse health effects, the current lifestyle and the awareness of the consumers for nutrition quality products. Due to the multiple potential effects of reducing NaCl (simple reduction or substitution) on cheese attributes, it is of utmost importance to identify and understand those effects in order to control the global quality and safety of the final product. In the present review a collection of the different results and conclusions drawn after studying the effect of salts by conventional (e.g. wet chemistry) and instrumental (e.g. spectral) methods on chemical, structural, textural, sensory and heating properties of cheese are presented.

  20. A study on modeling nitrogen dioxide concentrations using land-use regression and conventionally used exposure assessment methods

    Science.gov (United States)

    Choi, Giehae; Bell, Michelle L.; Lee, Jong-Tae

    2017-04-01

    The land-use regression (LUR) approach to estimate the levels of ambient air pollutants is becoming popular due to its high validity in predicting small-area variations. However, only a few studies have been conducted in Asian countries, and much less research has been conducted on comparing the performances and applied estimates of different exposure assessments including LUR. The main objectives of the current study were to conduct nitrogen dioxide (NO2) exposure assessment with four methods including LUR in the Republic of Korea, to compare the model performances, and to estimate the empirical NO2 exposures of a cohort. The study population was defined as the year 2010 participants of a government-supported cohort established for bio-monitoring in Ulsan, Republic of Korea. The annual ambient NO2 exposures of the 969 study participants were estimated with LUR, nearest station, inverse distance weighting, and ordinary kriging. Modeling was based on the annual NO2 average, traffic-related data, land-use data, and altitude of the 13 regularly monitored stations. The final LUR model indicated that area of transportation, distance to residential area, and area of wetland were important predictors of NO2. The LUR model explained 85.8% of the variation observed in the 13 monitoring stations of the year 2009. The LUR model outperformed the others based on leave-one out cross-validation comparing the correlations and root-mean square error. All NO2 estimates ranged from 11.3-18.0 ppb, with that of LUR having the widest range. The NO2 exposure levels of the residents differed by demographics. However, the average was below the national annual guidelines of the Republic of Korea (30 ppb). The LUR models showed high performances in an industrial city in the Republic of Korea, despite the small sample size and limited data. Our findings suggest that the LUR method may be useful in similar settings in Asian countries where the target region is small and availability of data is

  1. Infliximab, adalimumab and golimumab for treating moderately to severely active ulcerative colitis after the failure of conventional therapy (including a review of TA140 and TA262): clinical effectiveness systematic review and economic model.

    Science.gov (United States)

    Archer, Rachel; Tappenden, Paul; Ren, Shijie; Martyn-St James, Marrissa; Harvey, Rebecca; Basarir, Hasan; Stevens, John; Carroll, Christopher; Cantrell, Anna; Lobo, Alan; Hoque, Sami

    2016-05-01

    achieve clinical response and remission than those receiving placebo (PBO). Hospitalisation data were limited, but suggested more favourable outcomes for ADA- and IFX-treated patients. Data on the use of surgical intervention were sparse, with a potential benefit for intervention-treated patients. Data were available from one trial to support the use of IFX in paediatric patients. Safety issues identified included serious infections, malignancies and administration site reactions. Based on the NMA, in the induction phase, all biological treatments were associated with statistically significant beneficial effects relative to PBO, with the greatest effect associated with IFX. For patients in response following induction, all treatments except ADA and GOL 100 mg at 32-52 weeks were associated with beneficial effects when compared with PBO, although these were not significant. The greatest effects at 8-32 and 32-52 weeks were associated with 100 mg of GOL and 5 mg/kg of IFX, respectively. For patients in remission following induction, all treatments except ADA at 8-32 weeks and GOL 50 mg at 32-52 weeks were associated with beneficial effects when compared with PBO, although only the effect of ADA at 32-52 weeks was significant. The greatest effects were associated with GOL (at 8-32 weeks) and ADA (at 32-52 weeks). The economic analysis suggests that colectomy is expected to dominate drug therapies, but for some patients, colectomy may not be considered acceptable. In circumstances in which only drug options are considered, IFX and GOL are expected to be ruled out because of dominance, while the incremental cost-effectiveness ratio for ADA versus conventional treatment is approximately £50,300 per QALY gained. The health economic model is subject to several limitations: uncertainty associated with extrapolating trial data over a lifetime horizon, the model does not consider explicit sequential pathways of non-biological treatments, and evidence relating to

  2. Evaluation and Comparison of Multiple Test Methods, Including Real-time PCR, for Legionella Detection in Clinical Specimens

    Science.gov (United States)

    Peci, Adriana; Winter, Anne-Luise; Gubbay, Jonathan B.

    2016-01-01

    Legionella is a Gram-negative bacterium that can cause Pontiac fever, a mild upper respiratory infection and Legionnaire’s disease, a more severe illness. We aimed to compare the performance of urine antigen, culture, and polymerase chain reaction (PCR) test methods and to determine if sputum is an acceptable alternative to the use of more invasive bronchoalveolar lavage (BAL). Data for this study included specimens tested for Legionella at Public Health Ontario Laboratories from 1st January, 2010 to 30th April, 2014, as part of routine clinical testing. We found sensitivity of urinary antigen test (UAT) compared to culture to be 87%, specificity 94.7%, positive predictive value (PPV) 63.8%, and negative predictive value (NPV) 98.5%. Sensitivity of UAT compared to PCR was 74.7%, specificity 98.3%, PPV 77.7%, and NPV 98.1%. Out of 146 patients who had a Legionella-positive result by PCR, only 66 (45.2%) also had a positive result by culture. Sensitivity for culture was the same using either sputum or BAL (13.6%); sensitivity for PCR was 10.3% for sputum and 12.8% for BAL. Both sputum and BAL yield similar results regardless testing methods (Fisher Exact p-values = 1.0, for each test). In summary, all test methods have inherent weaknesses in identifying Legionella; therefore, more than one testing method should be used. Obtaining a single specimen type from patients with pneumonia limits the ability to diagnose Legionella, particularly when urine is the specimen type submitted. Given ease of collection and similar sensitivity to BAL, clinicians are encouraged to submit sputum in addition to urine when BAL submission is not practical from patients being tested for Legionella. PMID:27630979

  3. Evaluation and comparison of multiple test methods, including real-time PCR, for Legionella detection in clinical specimens.

    Directory of Open Access Journals (Sweden)

    Adriana Peci

    2016-08-01

    Full Text Available Legionella is a gram-negative bacterium that can cause Pontiac fever, a mild upper respiratory infection and Legionnaire’s disease, a more severe illness. We aimed to compare the performance of urine antigen, culture and PCR test methods and to determine if sputum is an alternative to the use of more invasive bronchoalveolar lavage (BAL. Data for this study included specimens tested for Legionella at PHOL from January 1, 2010 to April 30, 2014, as part of routine clinical testing. We found sensitivity of UAT compared to culture to be 87%, specificity 94.7%, positive predictive value (PPV 63.8% and negative predictive value (NPV 98.5%. Sensitivity of UAT compared to PCR was 74.7%, specificity 98.3%, PPV 77.7% and NPV 98.1%. Of 146 patients who had a Legionella positive result by PCR, only 66(45.2% also had a positive result by culture. Sensitivity for culture was the same using either sputum or BAL (13.6%; sensitivity for PCR was 10.3% for sputum and 12.8% for BAL. Both sputum and BAL yield similar results despite testing methods (Fisher Exact p-values=1.0, for each test. In summary, all test methods have inherent weaknesses in identifying Legionella; thereforemore than one testing method should be used. Obtaining a single specimen type from patients with pneumonia limits the ability to diagnose Legionella, particularly when urine is the specimen type submitted. Given ease of collection, and similar sensitivity to BAL, clinicians are encouraged to submit sputum in addition to urine when BAL submission is not practical, from patients being tested for Legionella.

  4. No major differences found between the effects of microwave-based and conventional heat treatment methods on two different liquid foods.

    Science.gov (United States)

    Géczi, Gábor; Horváth, Márk; Kaszab, Tímea; Alemany, Gonzalo Garnacho

    2013-01-01

    Extension of shelf life and preservation of products are both very important for the food industry. However, just as with other processes, speed and higher manufacturing performance are also beneficial. Although microwave heating is utilized in a number of industrial processes, there are many unanswered questions about its effects on foods. Here we analyze whether the effects of microwave heating with continuous flow are equivalent to those of traditional heat transfer methods. In our study, the effects of heating of liquid foods by conventional and continuous flow microwave heating were studied. Among other properties, we compared the stability of the liquid foods between the two heat treatments. Our goal was to determine whether the continuous flow microwave heating and the conventional heating methods have the same effects on the liquid foods, and, therefore, whether microwave heat treatment can effectively replace conventional heat treatments. We have compared the colour, separation phenomena of the samples treated by different methods. For milk, we also monitored the total viable cell count, for orange juice, vitamin C contents in addition to the taste of the product by sensory analysis. The majority of the results indicate that the circulating coil microwave method used here is equivalent to the conventional heating method based on thermal conduction and convection. However, some results in the analysis of the milk samples show clear differences between heat transfer methods. According to our results, the colour parameters (lightness, red-green and blue-yellow values) of the microwave treated samples differed not only from the untreated control, but also from the traditional heat treated samples. The differences are visually undetectable, however, they become evident through analytical measurement with spectrophotometer. This finding suggests that besides thermal effects, microwave-based food treatment can alter product properties in other ways as well.

  5. No major differences found between the effects of microwave-based and conventional heat treatment methods on two different liquid foods.

    Directory of Open Access Journals (Sweden)

    Gábor Géczi

    Full Text Available Extension of shelf life and preservation of products are both very important for the food industry. However, just as with other processes, speed and higher manufacturing performance are also beneficial. Although microwave heating is utilized in a number of industrial processes, there are many unanswered questions about its effects on foods. Here we analyze whether the effects of microwave heating with continuous flow are equivalent to those of traditional heat transfer methods. In our study, the effects of heating of liquid foods by conventional and continuous flow microwave heating were studied. Among other properties, we compared the stability of the liquid foods between the two heat treatments. Our goal was to determine whether the continuous flow microwave heating and the conventional heating methods have the same effects on the liquid foods, and, therefore, whether microwave heat treatment can effectively replace conventional heat treatments. We have compared the colour, separation phenomena of the samples treated by different methods. For milk, we also monitored the total viable cell count, for orange juice, vitamin C contents in addition to the taste of the product by sensory analysis. The majority of the results indicate that the circulating coil microwave method used here is equivalent to the conventional heating method based on thermal conduction and convection. However, some results in the analysis of the milk samples show clear differences between heat transfer methods. According to our results, the colour parameters (lightness, red-green and blue-yellow values of the microwave treated samples differed not only from the untreated control, but also from the traditional heat treated samples. The differences are visually undetectable, however, they become evident through analytical measurement with spectrophotometer. This finding suggests that besides thermal effects, microwave-based food treatment can alter product properties in other

  6. Evaluation of conventional and alternative monitoring methods for a recreational marine beach with nonpoint source of fecal contamination.

    Science.gov (United States)

    Shibata, Tomoyuki; Solo-Gabriele, Helena M; Sinigalliano, Christopher D; Gidley, Maribeth L; Plano, Lisa R W; Fleisher, Jay M; Wang, John D; Elmir, Samir M; He, Guoqing; Wright, Mary E; Abdelzaher, Amir M; Ortega, Cristina; Wanless, David; Garza, Anna C; Kish, Jonathan; Scott, Troy; Hollenbeck, Julie; Backer, Lorraine C; Fleming, Lora E

    2010-11-01

    The objectives of this work were to compare enterococci (ENT) measurements based on the membrane filter, ENT(MF) with alternatives that can provide faster results including alternative enterococci methods (e.g., chromogenic substrate (CS), and quantitative polymerase chain reaction (qPCR)), and results from regression models based upon environmental parameters that can be measured in real-time. ENT(MF) were also compared to source tracking markers (Staphylococcus aureus, Bacteroidales human and dog markers, and Catellicoccus gull marker) in an effort to interpret the variability of the signal. Results showed that concentrations of enterococci based upon MF (turbidity and tidal height. Enterococci by MF and CS were also inversely correlated with solar radiation but enterococci by qPCR was not. The regression model based on environmental variables provided fair qualitative predictions of enterococci by MF in real-time, for daily geometric mean levels, but not for individual samples. Overall, ENT(MF) was not significantly correlated with source tracking markers with the exception of samples collected during one storm event. The inability of the regression model to predict ENT(MF) levels for individual samples is likely due to the different sources of ENT impacting the beach at any given time, making it particularly difficult to to predict short-term variability of ENT(MF) for environmental parameters.

  7. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    Energy Technology Data Exchange (ETDEWEB)

    You, Sung Hye; Son, Gyu Ri; Lee, Nam Joon [Dept. of Radiology, Korea University Anam Hospital, Seoul (Korea, Republic of); Suh, Sangil; Ryoo, In Seon; Seol, Hae Young [Dept. of Radiology, Korea University Guro Hospital, Seoul (Korea, Republic of); Lee, Young Hen; Seo, Hyung Suk [Dept. of Radiology, Korea University Ansan Hospital, Ansan (Korea, Republic of)

    2017-01-15

    The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL), for measuring the volume of parathyroid glands. Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D) and three-dimensional (3D) methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs) and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism.

  8. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    International Nuclear Information System (INIS)

    You, Sung Hye; Son, Gyu Ri; Lee, Nam Joon; Suh, Sangil; Ryoo, In Seon; Seol, Hae Young; Lee, Young Hen; Seo, Hyung Suk

    2017-01-01

    The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL), for measuring the volume of parathyroid glands. Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D) and three-dimensional (3D) methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs) and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism

  9. Method for contamination control and barrier apparatus with filter for containing waste materials that include dangerous particulate matter

    Science.gov (United States)

    Pinson, Paul A.

    1998-01-01

    A container for hazardous waste materials that includes air or other gas carrying dangerous particulate matter has incorporated in barrier material, preferably in the form of a flexible sheet, one or more filters for the dangerous particulate matter sealably attached to such barrier material. The filter is preferably a HEPA type filter and is preferably chemically bonded to the barrier materials. The filter or filters are preferably flexibly bonded to the barrier material marginally and peripherally of the filter or marginally and peripherally of air or other gas outlet openings in the barrier material, which may be a plastic bag. The filter may be provided with a backing panel of barrier material having an opening or openings for the passage of air or other gas into the filter or filters. Such backing panel is bonded marginally and peripherally thereof to the barrier material or to both it and the filter or filters. A coupling or couplings for deflating and inflating the container may be incorporated. Confining a hazardous waste material in such a container, rapidly deflating the container and disposing of the container, constitutes one aspect of the method of the invention. The chemical bonding procedure for producing the container constitutes another aspect of the method of the invention.

  10. Contributors to Frequent Telehealth Alerts Including False Alerts for Patients with Heart Failure: A Mixed Methods Exploration

    Science.gov (United States)

    Radhakrishna, K.; Bowles, K.; Zettek-Sumner, A.

    2013-01-01

    Summary Background Telehealth data overload through high alert generation is a significant barrier to sustained adoption of telehealth for managing HF patients. Objective To explore the factors contributing to frequent telehealth alerts including false alerts for Medicare heart failure (HF) patients admitted to a home health agency. Materials and Methods A mixed methods design that combined quantitative correlation analysis of patient characteristic data with number of telehealth alerts and qualitative analysis of telehealth and visiting nurses’ notes on follow-up actions to patients’ telehealth alerts was employed. All the quantitative and qualitative data was collected through retrospective review of electronic records of the home heath agency. Results Subjects in the study had a mean age of 83 (SD = 7.6); 56% were female. Patient co-morbidities (ppatient characteristics along with establishing patient-centered telehealth outcome goals may allow meaningful generation of telehealth alerts. Reducing avoidable telehealth alerts could vastly improve the efficiency and sustainability of telehealth programs for HF management. PMID:24454576

  11. Method for contamination control and barrier apparatus with filter for containing waste materials that include dangerous particulate matter

    International Nuclear Information System (INIS)

    Pinson, P.A.

    1998-01-01

    A container for hazardous waste materials that includes air or other gas carrying dangerous particulate matter has incorporated barrier material, preferably in the form of a flexible sheet, and one or more filters for the dangerous particulate matter sealably attached to such barrier material. The filter is preferably a HEPA type filter and is preferably chemically bonded to the barrier materials. The filter or filters are preferably flexibly bonded to the barrier material marginally and peripherally of the filter or marginally and peripherally of air or other gas outlet openings in the barrier material, which may be a plastic bag. The filter may be provided with a backing panel of barrier material having an opening or openings for the passage of air or other gas into the filter or filters. Such backing panel is bonded marginally and peripherally thereof to the barrier material or to both it and the filter or filters. A coupling or couplings for deflating and inflating the container may be incorporated. Confining a hazardous waste material in such a container, rapidly deflating the container and disposing of the container, constitutes one aspect of the method of the invention. The chemical bonding procedure for producing the container constitutes another aspect of the method of the invention. 3 figs

  12. Safety of type and screen method compared to conventional antiglobulin crossmatch procedures for compatibility testing in Indian setting

    Directory of Open Access Journals (Sweden)

    Chaudhary Rajendra

    2011-01-01

    Full Text Available Background: Over the past 30 years, pretransfusion tests have undergone considerable modification. In 1984, AABB recommended that the full cross match could be replaced by an abbreviated cross match in patients with negative antibody screen. However, before implementation of such a policy, issue regarding safety of T & S needs to be evaluated. Objectives: The aim of pretransfusion testing (PTT is to ensure that enough red blood cells (RBCs in the selected red cell components will survive when transfused. Results and Conclusion: We have, therefore in this study; evaluated safety of T & S procedure for PTT in comparison with conventional test tube cross match. The T & S procedure gave a safety of 91.6%. Also, the usefulness of the T & S was shown through the detection of unexpected antibodies in 0.75% (15 out of 2026 of cases.

  13. An elemental concentration open source database for Hogdahl-Convention and Westcott-Formalism based on K0-INAA method in Malaysia

    International Nuclear Information System (INIS)

    Yavar, A.R.; Sukiman Sarmani; Tan, C.Y.; Rafie, N.N.; Lim, S.W.E.; Khoo, K.S.

    2012-01-01

    An electronic database has been developed and implemented for K 0 -INAA method in Malaysia. Databases are often developed according to national requirements. This database contains constant nuclear data for k 0 -INAA method. Hogdahl-convention and Westcott-formalism as 3 separate command user interfaces. It has been created using Microsoft Access 2007 under a Windows operating system. This database saves time and the quality of results can be assured when the calculation of neutron flux parameters and concentration of elements by k 0 -INAA method are utilised. An evaluation of the database was conducted by IAEA Soil7 where the results published which showed a high level of consistency. (Author)

  14. Comparison of the heat shock response induced by conventional heating and two methods of delivery of pulsed radiofrequency energy

    International Nuclear Information System (INIS)

    Laurence, J.A.; University of Sydney, NSW; McKenzie, D.R.; Veas, L.; French, P.W.

    2002-01-01

    Full text: In 2001, we published a (hypothetical) mechanism by which radiofrequency (RF) radiation from mobile phones could induce cancer, via the chronic induction of the heat shock response (HSR). This hypothesis provides the focus for our research. Other groups have reported induction of the HSR by RF at apparently non thermal levels. The aim of this study was to determine whether the HSR induced by RF is (a) truly non thermal and (b) quantitatively or qualitatively different from that induced by conventional heating of cells. A rat mast cell line, RBL-2H3, was chosen as the target RBL-2H3 cells were exposed in an air incubator at 41.1 deg C for 45 minutes and 75 minutes, and then returned to a 37 deg C incubator. Sham exposures were performed in the same air incubator at 37 deg C. Cells were exposed for 1 hour in the two pulsed RF exposure systems. The first was a converted 750W microwave oven that emits a short burst of 2.45GHz pulses at the start of each contiguous six minute period. This exposes cells to an average specific energy absorption rate (SAR) of 20W/kg. The second system was a TEM cell, which simulates. GSM pulses - the earner frequency is 0.9GHz pulse modulated at 217Hz. The SAR was approx 0.1W/kg. Both of these exposure systems are housed in incubators maintained at 37 deg C. Sham exposures were performed in the two systems with the same conditions but with no RF radiation present. Cell samples for the conventional heating and microwave exposures were taken 0, 2. 5, 5 and 20 hours after exposure, and expression of heat shock proteins hsp 110, 90, 70, 60 and 56 were determined by Western Blotting and compared between exposures

  15. Difference in target definition using three different methods to include respiratory motion in radiotherapy of lung cancer.

    Science.gov (United States)

    Sloth Møller, Ditte; Knap, Marianne Marquard; Nyeng, Tine Bisballe; Khalil, Azza Ahmed; Holt, Marianne Ingerslev; Kandi, Maria; Hoffmann, Lone

    2017-11-01

    Minimizing the planning target volume (PTV) while ensuring sufficient target coverage during the entire respiratory cycle is essential for free-breathing radiotherapy of lung cancer. Different methods are used to incorporate the respiratory motion into the PTV. Fifteen patients were analyzed. Respiration can be included in the target delineation process creating a respiratory GTV, denoted iGTV. Alternatively, the respiratory amplitude (A) can be measured based on the 4D-CT and A can be incorporated in the margin expansion. The GTV expanded by A yielded GTV + resp, which was compared to iGTV in terms of overlap. Three methods for PTV generation were compared. PTV del (delineated iGTV expanded to CTV plus PTV margin), PTV σ (GTV expanded to CTV and A was included as a random uncertainty in the CTV to PTV margin) and PTV ∑ (GTV expanded to CTV, succeeded by CTV linear expansion by A to CTV + resp, which was finally expanded to PTV ∑ ). Deformation of tumor and lymph nodes during respiration resulted in volume changes between the respiratory phases. The overlap between iGTV and GTV + resp showed that on average 7% of iGTV was outside the GTV + resp implying that GTV + resp did not capture the tumor during the full deformable respiration cycle. A comparison of the PTV volumes showed that PTV σ was smallest and PTV Σ largest for all patients. PTV σ was in mean 14% (31 cm 3 ) smaller than PTV del , while PTV del was 7% (20 cm 3 ) smaller than PTV Σ . PTV σ yields the smallest volumes but does not ensure coverage of tumor during the full respiratory motion due to tumor deformation. Incorporating the respiratory motion in the delineation (PTV del ) takes into account the entire respiratory cycle including deformation, but at the cost, however, of larger treatment volumes. PTV Σ should not be used, since it incorporates the disadvantages of both PTV del and PTV σ .

  16. Comparison of the accuracy of two conventional phenotypic methods and two MALDI-TOF MS systems with that of DNA sequencing analysis for correctly identifying clinically encountered yeasts.

    Science.gov (United States)

    Chao, Qiao-Ting; Lee, Tai-Fen; Teng, Shih-Hua; Peng, Li-Yun; Chen, Ping-Hung; Teng, Lee-Jene; Hsueh, Po-Ren

    2014-01-01

    We assessed the accuracy of species-level identification of two commercially available matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) systems (Bruker Biotyper and Vitek MS) and two conventional phenotypic methods (Phoenix 100 YBC and Vitek 2 Yeast ID) with that of rDNA gene sequencing analysis among 200 clinical isolates of commonly encountered yeasts. The correct identification rates of the 200 yeast isolates to species or complex (Candida parapsilosis complex, C. guilliermondii complex and C. rugosa complex) levels by the Bruker Biotyper, Vitek MS (using in vitro devices [IVD] database), Phoenix 100 YBC and Vitek 2 Yeast ID (Sabouraud's dextrose agar) systems were 92.5%, 79.5%, 89%, and 74%, respectively. An additional 72 isolates of C. parapsilosis complex and 18 from the above 200 isolates (30 in each of C. parapsilosis, C. metapsilosis, and C. orthopsilosis) were also evaluated separately. Bruker Biotyper system could accurately identify all C. parapsilosis complex to species level. Using Vitek 2 MS (IVD) system, all C. parapsilosis but none of C. metapsilosis, or C. orthopsilosis could be accurately identified. Among the 89 yeasts misidentified by the Vitek 2 MS (IVD) system, 39 (43.8%), including 27 C. orthopsilosis isolates, could be correctly identified Using the Vitek MS Plus SARAMIS database for research use only. This resulted in an increase in the rate of correct identification of all yeast isolates (87.5%) by Vitek 2 MS. The two species in C. guilliermondii complex (C. guilliermondii and C. fermentati) isolates were correctly identified by cluster analysis of spectra generated by the Bruker Biotyper system. Based on the results obtained in the current study, MALDI-TOF MS systems present a promising alternative for the routine identification of yeast species, including clinically commonly and rarely encountered yeast species and several species belonging to C. parapsilosis complex, C. guilliermondii complex

  17. Comparison of the accuracy of two conventional phenotypic methods and two MALDI-TOF MS systems with that of DNA sequencing analysis for correctly identifying clinically encountered yeasts.

    Directory of Open Access Journals (Sweden)

    Qiao-Ting Chao

    Full Text Available We assessed the accuracy of species-level identification of two commercially available matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS systems (Bruker Biotyper and Vitek MS and two conventional phenotypic methods (Phoenix 100 YBC and Vitek 2 Yeast ID with that of rDNA gene sequencing analysis among 200 clinical isolates of commonly encountered yeasts. The correct identification rates of the 200 yeast isolates to species or complex (Candida parapsilosis complex, C. guilliermondii complex and C. rugosa complex levels by the Bruker Biotyper, Vitek MS (using in vitro devices [IVD] database, Phoenix 100 YBC and Vitek 2 Yeast ID (Sabouraud's dextrose agar systems were 92.5%, 79.5%, 89%, and 74%, respectively. An additional 72 isolates of C. parapsilosis complex and 18 from the above 200 isolates (30 in each of C. parapsilosis, C. metapsilosis, and C. orthopsilosis were also evaluated separately. Bruker Biotyper system could accurately identify all C. parapsilosis complex to species level. Using Vitek 2 MS (IVD system, all C. parapsilosis but none of C. metapsilosis, or C. orthopsilosis could be accurately identified. Among the 89 yeasts misidentified by the Vitek 2 MS (IVD system, 39 (43.8%, including 27 C. orthopsilosis isolates, could be correctly identified Using the Vitek MS Plus SARAMIS database for research use only. This resulted in an increase in the rate of correct identification of all yeast isolates (87.5% by Vitek 2 MS. The two species in C. guilliermondii complex (C. guilliermondii and C. fermentati isolates were correctly identified by cluster analysis of spectra generated by the Bruker Biotyper system. Based on the results obtained in the current study, MALDI-TOF MS systems present a promising alternative for the routine identification of yeast species, including clinically commonly and rarely encountered yeast species and several species belonging to C. parapsilosis complex, C. guilliermondii

  18. Comparison of conventional liquid chromatography-tandem mass spectrometry versus microflow liquid chromatography-tandem mass spectrometry within the framework of full method validation for simultaneous quantification of 40 antidepressants and neuroleptics in whole blood.

    Science.gov (United States)

    Steuer, Andrea E; Poetzsch, Michael; Koenig, Magdalena; Tingelhoff, Eva; Staeheli, Sandra N; Roemmelt, Andreas T; Kraemer, Thomas

    2015-02-13

    Microflow liquid chromatography (MFLC) coupled to mass spectrometry (MS) is claimed to improve analysis throughput, reduce matrix effects and lower mobile phase consumption. This statement was checked within the framework of method validation of a multi-analyte procedure in clinical and forensic toxicology employing MFLC-MS/MS and conventional LC-MS/MS. 200 μL whole blood were spiked with 50 μL internal standard mixture and extracted by protein precipitation. The concentrated extract was separated into two vials. One was analyzed using a Thermo Fisher Ultimate liquid chromatography system coupled to an ABSciex 5500 QTrap mass spectrometer (LC-MS/MS) and one by an ABSciex Eksigent Microflow LC system coupled to an ABSciex 4500 linear ion trap quadrupole MS (MFLC-MS/MS). Both methods were fully validated and compared in terms of selectivity, stability, limits, calibration model, recovery (RE), matrix effects (ME), bias, imprecision and beta tolerance interval for 40 antidepressants and neuroleptics including 9 metabolites. Both methods had comparable LODs, LOQs and calibration models with some exceptions. The MFLC system showed slightly higher coefficients of variation (CVs) in the RE experiments. ME were reproducible in both systems but with lower CVs in the conventional LC system. Acceptance criteria for imprecision and bias were fulfilled for 32 analytes on the LC and for 28 analytes on the MFLC system. Beta tolerance intervals indicated better reproducibility in terms of narrower intervals for the conventional LC system. The advantages of the MFLC system were low mobile phase consumption, short run time, and better peak separation. The systems were comparable in terms of peak interference, LOD, ME, bias and imprecision. The advantages of the conventional LC system were more data points per peak, linear calibration models, stable retention times and better beta tolerance intervals. Due to higher robustness, the conventional LC system was finally chosen for

  19. The efficiency of conventional microscopic selection is comparable to the hyaluronic acid binding method in selecting spermatozoa for male infertility patients

    OpenAIRE

    Meng-Ting Huang; Robert Kuo-Kuang Lee; Chung-Hao Lu; Ying-Jie Chen; Sheng-Hsiang Li; Yuh-Ming Hwu

    2015-01-01

    Objective: To evaluate if hyaluronic acid (HA)-bound spermatozoa surpassed conventional microscopy-selected spermatozoa in the status of sperm DNA integrity by acridine orange (AO) fluorescence staining. Materials and methods: Spermatozoa obtained from couples with indication for the intracytoplasmic sperm injection (ICSI) procedure due to male infertility (n = 34) and control males with normal sperm parameters (n = 12) were analyzed using AO fluorescence staining after density-gradient ce...

  20. Convention on nuclear safety

    International Nuclear Information System (INIS)

    1994-01-01

    The Convention on Nuclear Safety was adopted on 17 June 1994 by Diplomatic Conference convened by the International Atomic Energy Agency at its Headquarters from 14 to 17 June 1994. The Convention will enter into force on the ninetieth day after the date of deposit with the Depository (the Agency's Director General) of the twenty-second instrument of ratification, acceptance or approval, including the instruments of seventeen States, having each at leas one nuclear installation which has achieved criticality in a reactor core. The text of the Convention as adopted is reproduced in the Annex hereto for the information of all Member States

  1. Religious versus Conventional Psychotherapy for Major Depression in Patients with Chronic Medical Illness: Rationale, Methods, and Preliminary Results

    Directory of Open Access Journals (Sweden)

    Harold G. Koenig

    2012-01-01

    Full Text Available This paper (1 reviews the physical and religious barriers to CBT that disabled medically ill-depressed patients face, (2 discusses research on the relationship between religion and depression-induced physiological changes, (3 describes an ongoing randomized clinical trial of religious versus secular CBT in chronically ill patients with mild-to-moderate major depression designed to (a overcome physical and religious barriers to CBT and (b compare the efficacy of religious versus secular CBT in relieving depression and improving immune and endocrine functions, and (4 presents preliminary results that illustrate the technical difficulties that have been encountered in implementing this trial. CBT is being delivered remotely via instant messaging, telephone, or Skype, and Christian, Jewish, Muslim, Buddhist, and Hindu versions of religious CBT are being developed. The preliminary results described here are particular to the technologies employed in this study and are not results from the CBT clinical trial whose findings will be published in the future after the study ends and data are analyzed. The ultimate goal is to determine if a psychotherapy delivered remotely that integrates patients’ religious resources improves depression more quickly than a therapy that ignores them, and whether religious CBT is more effective than conventional CBT in reversing depression-induced physiological changes.

  2. The usefulness of levin tube inserted drip infusion spiral CT: comparison with conventional method in subtotal gastrectomy patients

    International Nuclear Information System (INIS)

    Park, Young Jin; Kim, Young Hwan; Yoon, Jung Hee; Cha, Soon Joo; Kim, Jeong Sook; Kim, Sung Rok; Hur, Gham; Rhim, Hyun Chul

    1998-01-01

    The purpose of this study is to access the usefulness of newly designed Levin tube inserted drip infusion spiral CT for the evaluation of remnant stomach and anastomosis site in patients who have undergone subtotal gastrectomy for stomach cancer. A new technique named Levin tube inserted drip infusion spiral CT was used to prospectively study 23 patients. A 16Fr Levin tube was inserted into the remnant stomach; 500 ml of tap water was drip infused just before CT scanning and an additional 500 ml of water was infused during IV contrast injection. Water was infused by gravity, using a water bottle suspended at a height of 90 cm (Group A). The 31 patients who underwent conventional spiral CT scanning immediately after the divided ingestion of 900 ml diluted gastrografin were selected as a control group (Group B). The anatomic delineation of the anastomosis site was graded by two radiologists as excellent (3), good(2), fair (1) or poor (0). To evaluate the degree of distension, the maximal diameters of remnant stomach and the anastomosis site, and the thickness of the stomach wall, were also measured. In patients who had undergone subtobal gastrectomy, Levin tube inserted drip infusion spiral CT showed excellent anatomic delineation of the site of anastomosis and remnant stomach. We found that because it increases the distension of remnant stomach and the anastomosis site, this technique is effective for the evaluation of postoperative stomach. (author). 10 refs., 2 tabs., 3 figs

  3. Preparation of nickel and Ni_3Sn nanoparticles via extension of conventional citric acid and ethylene diamine tetraacetic acid mediated sol–gel method

    International Nuclear Information System (INIS)

    Li, Pingyun; Deng, Guodong; Guo, Xiaode; Liu, Hongying; Jiang, Wei; Li, Fengsheng

    2016-01-01

    This work aims to extend the application field of sol–gel process from conventional oxides, carbides, sulfides to metallic nanocrystalline materials. Metallic ions were coordinated with chelating agents of citric acid (CA) and ethylene diamine tetraacetic acid (EDTA) in aqueous solution. Then the solutions were dried at 383 K, resulting in the formation of sol and gel. Heating treatments of dried gels were then carried out with protection of N_2 atmosphere. Ni and Ni_3Sn alloy nanoparticles were obtained by this sol–gel method in the range of 623–823 K. The as-prepared Ni and Ni_3Sn alloy nanoparticles have average grain sizes of 15 and 30 nm, and have face-centred-cubic (fcc) crystalline phase. Our results provide new insight into the application of conventional sol–gel method. - Graphical abstract: Sol–gel method is conventionally applied to prepare oxides, carbides, and sulfides. In this work, the application field of sol–gel method is extended to metallic nanoparticles. By using citric acid (CA) and ethylene diamine tetraacetic acid (EDTA) mediated sol–gel method, metallic Ni (a and c) and Ni_3Sn (b and d) alloy nanoparticles can be prepared when the heating treatments are performed under N_2 protecting atmosphere. The Ni and Ni_3Sn nanoparticles have face-centered-cubic (fcc) crystalline phase and ultrafine grain sizes. Diffraction peaks of (110) superstructure reflection plane of Ni_3Sn nanoparticles can also be observed in Figure b, which can be considered as direct evidence of formation of alloy crystalline phase by performing this sol–gel method. - Highlights: • Ni and Ni_3Sn alloy nanoparticles have been prepared by sol–gel processes. • Citric acid and ethylene diamine tetraacetic acid were applied as chelating agent. • Diffraction peak of superstructure reflection plane of Ni_3Sn was detected by XRD. • A novel strategy for preparation of alloy nanoparticles has been presented.

  4. New Multigrid Method Including Elimination Algolithm Based on High-Order Vector Finite Elements in Three Dimensional Magnetostatic Field Analysis

    Science.gov (United States)

    Hano, Mitsuo; Hotta, Masashi

    A new multigrid method based on high-order vector finite elements is proposed in this paper. Low level discretizations in this method are obtained by using low-order vector finite elements for the same mesh. Gauss-Seidel method is used as a smoother, and a linear equation of lowest level is solved by ICCG method. But it is often found that multigrid solutions do not converge into ICCG solutions. An elimination algolithm of constant term using a null space of the coefficient matrix is also described. In three dimensional magnetostatic field analysis, convergence time and number of iteration of this multigrid method are discussed with the convectional ICCG method.

  5. Calculation of the energy provided by a PV generator. Comparative study: Conventional methods vs. artificial neural networks

    International Nuclear Information System (INIS)

    Almonacid, F.; Rus, C.; Perez-Higueras, P.; Hontoria, L.

    2011-01-01

    The use of photovoltaics for electricity generation purposes has recorded one of the largest increases in the field of renewable energies. The energy production of a grid-connected PV system depends on various factors. In a wide sense, it is considered that the annual energy provided by a generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. However, a range of factors is influencing the expected outcome by reducing the generation of energy. The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network developed by the R and D Group for Solar and Automatic Energy at the University of Jaen. The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study, mainly due to the fact that this method takes also into account some second order effects, such as low irradiance, angular and spectral effects. -- Research highlights: → It is considered that the annual energy provided by a PV generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. → A range of factors are influencing the expected outcome by reducing the generation of energy (mismatch losses, dirt and dust, Ohmic losses,.). → The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network. → The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study. While classical methods have only taken into account temperature losses, the method based in

  6. Comparison of conventional, model-based quantitative planar, and quantitative SPECT image processing methods for organ activity estimation using In-111 agents

    International Nuclear Information System (INIS)

    He, Bin; Frey, Eric C

    2006-01-01

    Accurate quantification of organ radionuclide uptake is important for patient-specific dosimetry. The quantitative accuracy from conventional conjugate view methods is limited by overlap of projections from different organs and background activity, and attenuation and scatter. In this work, we propose and validate a quantitative planar (QPlanar) processing method based on maximum likelihood (ML) estimation of organ activities using 3D organ VOIs and a projector that models the image degrading effects. Both a physical phantom experiment and Monte Carlo simulation (MCS) studies were used to evaluate the new method. In these studies, the accuracies and precisions of organ activity estimates for the QPlanar method were compared with those from conventional planar (CPlanar) processing methods with various corrections for scatter, attenuation and organ overlap, and a quantitative SPECT (QSPECT) processing method. Experimental planar and SPECT projections and registered CT data from an RSD Torso phantom were obtained using a GE Millenium VH/Hawkeye system. The MCS data were obtained from the 3D NCAT phantom with organ activity distributions that modelled the uptake of 111 In ibritumomab tiuxetan. The simulations were performed using parameters appropriate for the same system used in the RSD torso phantom experiment. The organ activity estimates obtained from the CPlanar, QPlanar and QSPECT methods from both experiments were compared. From the results of the MCS experiment, even with ideal organ overlap correction and background subtraction, CPlanar methods provided limited quantitative accuracy. The QPlanar method with accurate modelling of the physical factors increased the quantitative accuracy at the cost of requiring estimates of the organ VOIs in 3D. The accuracy of QPlanar approached that of QSPECT, but required much less acquisition and computation time. Similar results were obtained from the physical phantom experiment. We conclude that the QPlanar method, based

  7. Identification and quantification of genetically modified Moonshade carnation lines using conventional and TaqMan real-time polymerase chain reaction methods.

    Science.gov (United States)

    Li, Peng; Jia, Junwei; Bai, Lan; Pan, Aihu; Tang, Xueming

    2013-07-01

    Genetically modified carnation (Dianthus caryophyllus L.) Moonshade was approved for planting and commercialization in several countries from 2004. Developing methods for analyzing Moonshade is necessary for implementing genetically modified organism labeling regulations. In this study, the 5'-transgene integration sequence was isolated using thermal asymmetric interlaced (TAIL)-PCR. Based upon the 5'-transgene integration sequence, conventional and TaqMan real-time PCR assays were established. The relative limit of detection for the conventional PCR assay was 0.05 % for Moonshade using 100 ng total carnation genomic DNA, corresponding to approximately 79 copies of the carnation haploid genome, and the limits of detection and quantification of the TaqMan real-time PCR assay were estimated to be 51 and 254 copies of haploid carnation genomic DNA, respectively. These results are useful for identifying and quantifying Moonshade and its derivatives.

  8. Incidence of pulmonary aspergillosis and correlation of conventional diagnostic methods with nested PCR and real-time PCR assay using BAL fluid in intensive care unit patients.

    Science.gov (United States)

    Zarrinfar, Hossein; Makimura, Koichi; Satoh, Kazuo; Khodadadi, Hossein; Mirhendi, Hossein

    2013-05-01

    Although the incidence of invasive aspergillosis in the intensive care unit (ICU) is scarce, it has emerged as major problems in critically ill patients. In this study, the incidence of pulmonary aspergillosis (PA) in ICU patients has evaluated and direct microscopy and culture has compared with nested polymerase chain reaction (PCR) and real-time PCR for detection of Aspergillus fumigatus and A. flavus in bronchoalveolar lavage (BAL) samples of the patients. Thirty BAL samples obtained from ICU patients during a 16-month period were subjected to direct examinations on 20% potassium hydroxide (KOH) and culture on two culture media. Nested PCR targeting internal transcribed spacer ribosomal DNA and TaqMan real-time PCR assay targeting β-tubulin gene were used for the detection of A. fumigatus and A. flavus. Of 30 patients, 60% were men and 40% were women. The diagnosis of invasive PA was probable in 1 (3%), possible in 11 (37%), and not IPA in 18 (60%). Nine samples were positive in nested PCR including seven samples by A. flavus and two by A. fumigatus specific primers. The lowest amount of DNA that TaqMan real-time PCR could detect was ≥40 copy numbers. Only one of the samples had a positive result of A. flavus real-time PCR with Ct value of 37.5. Although a significant number of specimens were positive in nested PCR, results of this study showed that establishment of a correlation between the conventional methods with nested PCR and real-time PCR needs more data confirmed by a prospective study with a larger sample group. © 2013 Wiley Periodicals, Inc.

  9. Field evaluation of piglet vaccination with a Mycoplasma hyopneumoniae bacterin as compared to a ready-to-use product including porcine circovirus 2 and M. hyopneumoniae in a conventional French farrow-to-finish farm.

    Science.gov (United States)

    Duivon, Didier; Corrégé, Isabelle; Hémonic, Anne; Rigaut, Martial; Roudaut, David; Jolie, Rika

    2018-01-01

    A controlled randomized trial was performed on a well-managed conventional French 180-sow farm. The trial compared the growth performances of piglets vaccinated at weaning (single shot) either with a commercial monovalent Mycoplasma hyopneumoniae bacterin vaccine or with a commercial bivalent vaccine (Porcilis® PCV M Hyo) against M. hyopneumoniae and porcine circovirus 2 (PCV2). The farm's porcine reproductive and respiratory syndrome status was stable, and most diseases (enzootic pneumonia, atrophic rhinitis, post-weaning multisystemic wasting syndrome) were controlled by routine vaccination. During the post-weaning phase, the growth performances of the piglets vaccinated with the bivalent vaccine were not significantly different from those vaccinated with the monovalent vaccine. However, during the fattening phase the group vaccinated with the bivalent vaccine had a significantly improved ADG (+34 g/d, p  = 0. 047), resulting in a 5-day earlier shipment to slaughter. The group also had a shorter and lower PCV2 load in serum during the fattening period, and an improved lung lesions score. In both groups, three pigs died during the peak PCV2 viraemia (16-23 weeks of age). Immunohistochemistry of the lymph nodes showed that in the group vaccinated with the bivalent vaccine, none of these pigs had PCV2-like lesions, while 2 out of the 3 from the other group did. Results suggest that the added PCV2 valence in the vaccination protocol helps countering the negative impact of subclinical PCV2 infection on growth. The calculated return on investment of the added PCV2 vaccine valence was €1.7 extra revenue per slaughtered pig (€ 39 additional revenue per sow and per year), despite the fact that the cost of the bivalent vaccine was higher than the monovalent M. hyopneumoniae vaccine. In this healthy conventional sow farm, the combined M. hyopneumoniae and PCV2 vaccination was efficacious, convenient to administer and profitable.

  10. Clinical comparative study between the use of lasers and conventional methods of diagnosis and treatment in deciduous teeth with presence of carious lesion

    International Nuclear Information System (INIS)

    Pulga, Fabiane Galvao

    2001-01-01

    The aim of this work was to evaluate the efficiency of deciduous tooth cavity preparation by the Er:YAG laser in comparison with the conventional burr rotary instrument. Besides, we have used the laser fluorescence technique (DIAGNOdent equipment) for diagnosis and compared it to the usual tactile and visual examination as well as X-ray diagnosis. For this purpose, 20 chronic occlusal carious deciduous molar teeth from children with the ages between 5 to 10 years old were selected. Selection was ma de according to visual inspection, X-ray periapical image and measures of the DIAGNOdent. For treatment the teeth were divided in two groups, 10 to be treated by the Er:YAG laser and 10 with conventional burr. For enamel, the laser energy used was in the interval from 200 to 300 mJ; for the dentine the range was from 100 mJ to 200 mJ. In both cases, the laser frequency was in the range from 2 to 4 Hz. The results have shown that the laser treatment was more accepted by the children than the conventional burro Clinical evaluation of the cavity preparation indicates that the Er:YAG laser treatment is recommend. The DIAGNOdent evaluation method was very effective for diagnosis of carious tissue for initial detection. After successful removal of the carious tissue, confirmed by visual inspection, the DIAGNOdent evaluation method was only effective for the treatment with conventional burro For evaluation of the tooth after cavity preparation with the Er:YAG laser, the measurements oscillate covering the full range of the equipment. Therefore, the use of the DIAGNOdent equipment is indicated only for initial caries diagnosis. (author)

  11. Distribution of Malassezia species on the skin of patients with atopic dermatitis, psoriasis, and healthy volunteers assessed by conventional and molecular identification methods.

    Science.gov (United States)

    Jagielski, Tomasz; Rup, Elżbieta; Ziółkowska, Aleksandra; Roeske, Katarzyna; Macura, Anna B; Bielecki, Jacek

    2014-03-07

    The Malassezia yeasts which belong to the physiological microflora of human skin have also been implicated in several dermatological disorders, including pityriasis versicolor (PV), atopic dermatitis (AD), and psoriasis (PS). The Malassezia genus has repeatedly been revised and it now accommodates 14 species, all but one being lipid-dependent species. The traditional, phenotype-based identification schemes of Malassezia species are fraught with interpretative ambiguities and inconsistencies, and are thus increasingly being supplemented or replaced by DNA typing methods. The aim of this study was to explore the species composition of Malassezia microflora on the skin of healthy volunteers and patients with AD and PS. Species characterization was performed by conventional, culture-based methods and subsequently molecular techniques: PCR-RFLP and sequencing of the internal transcribed spacer (ITS) 1/2 regions and the D1/D2 domains of the 26S rRNA gene. The Chi-square test and Fisher's exact test were used for statistical analysis. Malassezia sympodialis was the predominant species, having been cultured from 29 (82.9%) skin samples collected from 17 out of 18 subjects under the study. Whereas AD patients yielded exclusively M. sympodialis isolates, M. furfur isolates were observed only in PS patients. The isolation of M. sympodialis was statistically more frequent among AD patients and healthy volunteers than among PS patients (P < 0.03). Whether this mirrors any predilection of particular Malassezia species for certain clinical conditions needs to be further evaluated. The overall concordance between phenotypic and molecular methods was quite high (65%), with the discordant results being rather due to the presence of multiple species in a single culture (co-colonization) than true misidentification. All Malassezia isolates were susceptible to cyclopiroxolamine and azole drugs, with M. furfur isolates being somewhat more drug tolerant than other Malassezia species

  12. Are the Conventional Commercial Yeast Identification Methods Still Helpful in the Era of New Clinical Microbiology Diagnostics? A Meta-Analysis of Their Accuracy.

    Science.gov (United States)

    Posteraro, Brunella; Efremov, Ljupcho; Leoncini, Emanuele; Amore, Rosarita; Posteraro, Patrizia; Ricciardi, Walter; Sanguinetti, Maurizio

    2015-08-01

    Accurate identification of pathogenic species is important for early appropriate patient management, but growing diversity of infectious species/strains makes the identification of clinical yeasts increasingly difficult. Among conventional methods that are commercially available, the API ID32C, AuxaColor, and Vitek 2 systems are currently the most used systems in routine clinical microbiology. We performed a systematic review and meta-analysis to estimate and to compare the accuracy of the three systems, in order to assess whether they are still of value for the species-level identification of medically relevant yeasts. After adopting rigorous selection criteria, we included 26 published studies involving Candida and non-Candida yeasts that were tested with the API ID32C (674 isolates), AuxaColor (1,740 isolates), and Vitek 2 (2,853 isolates) systems. The random-effects pooled identification ratios at the species level were 0.89 (95% confidence interval [CI], 0.80 to 0.95) for the API ID32C system, 0.89 (95% CI, 0.83 to 0.93) for the AuxaColor system, and 0.93 (95% CI, 0.89 to 0.96) for the Vitek 2 system (P for heterogeneity, 0.255). Overall, the accuracy of studies using phenotypic analysis-based comparison methods was comparable to that of studies using molecular analysis-based comparison methods. Subanalysis of studies conducted on Candida yeasts showed that the Vitek 2 system was significantly more accurate (pooled ratio, 0.94 [95% CI, 0.85 to 0.99]) than the API ID32C system (pooled ratio, 0.84 [95% CI, 0.61 to 0.99]) and the AuxaColor system (pooled ratio, 0.76 [95% CI, 0.67 to 0.84]) with respect to uncommon species (P for heterogeneity, 0.05). Nonetheless, clinical microbiologists should reconsider the usefulness of these systems, particularly in light of new diagnostic tools such as matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry, which allow for considerably shortened turnaround times and/or avoid the requirement

  13. Method for Derivatization and Detection of Chemical Weapons Convention Related Sulfur Chlorides via Electrophilic Addition with 3-Hexyne.

    Science.gov (United States)

    Goud, D Raghavender; Pardasani, Deepak; Purohit, Ajay Kumar; Tak, Vijay; Dubey, Devendra Kumar

    2015-07-07

    Sulfur monochloride (S2Cl2) and sulfur dichloride (SCl2) are important precursors of the extremely toxic chemical warfare agent sulfur mustard and classified, respectively, into schedule 3.B.12 and 3.B.13 of the Chemical Weapons Convention (CWC). Hence, their detection and identification is of vital importance for verification of CWC. These chemicals are difficult to detect directly using chromatographic techniques as they decompose and do not elute. Until now, the use of gas chromatographic approaches to follow the derivatized sulfur chlorides is not reported in the literature. The electrophilic addition reaction of sulfur monochloride and sulfur dichloride toward 3-hexyne was explored for the development of a novel derivatization protocol, and the products were subjected to gas chromatography-mass spectrometric (GC-MS) analysis. Among various unsaturated reagents like alkenes and alkynes, symmetrical alkyne 3-hexyne was optimized to be the suitable derivatizing agent for these analytes. Acetonitrile was found to be the suitable solvent for the derivatization reaction. The sample preparation protocol for the identification of these analytes from hexane spiked with petrol matrix was also optimized. Liquid-liquid extraction followed by derivatization was employed for the identification of these analytes from petrol matrix. Under the established conditions, the detection and quantification limits are 2.6 μg/mL, 8.6 μg/mL for S2Cl2 and 2.3 μg/mL, 7.7 μg/mL for SCl2, respectively, in selected ion monitoring (SIM) mode. The calibration curve had a linear relationship with y = 0.022x - 0.331 and r(2) = 0.992 for the working range of 10 to 500 μg/mL for S2Cl2 and y = 0.007x - 0.064 and r(2) = 0.991 for the working range of 10 to 100 μg/mL for SCl2, respectively. The intraday RSDs were between 4.80 to 6.41%, 2.73 to 6.44% and interday RSDs were between 2.20 to 7.25% and 2.34 to 5.95% for S2Cl2 and SCl2, respectively.

  14. Effectiveness of two conventional methods for seismic retrofit of steel and RC moment resisting frames based on damage control criteria

    Science.gov (United States)

    Beheshti Aval, Seyed Bahram; Kouhestani, Hamed Sadegh; Mottaghi, Lida

    2017-07-01

    This study investigates the efficiency of two types of rehabilitation methods based on economic justification that can lead to logical decision making between the retrofitting schemes. Among various rehabilitation methods, concentric chevron bracing (CCB) and cylindrical friction damper (CFD) were selected. The performance assessment procedure of the frames is divided into two distinct phases. First, the limit state probabilities of the structures before and after rehabilitation are investigated. In the second phase, the seismic risk of structures in terms of life safety and financial losses (decision variables) using the recently published FEMA P58 methodology is evaluated. The results show that the proposed retrofitting methods improve the serviceability and life safety performance levels of steel and RC structures at different rates when subjected to earthquake loads. Moreover, these procedures reveal that financial losses are greatly decreased, and were more tangible by the application of CFD rather than using CCB. Although using both retrofitting methods reduced damage state probabilities, incorporation of a site-specific seismic hazard curve to evaluate mean annual occurrence frequency at the collapse prevention limit state caused unexpected results to be obtained. Contrary to CFD, the collapse probability of the structures retrofitted with CCB increased when compared with the primary structures.

  15. A comparison between the conventional manual ROI method and an automatic algorithm for semiquantitative analysis of SPECT studies

    International Nuclear Information System (INIS)

    Pagan, L; Novi, B; Guidarelli, G; Tranfaglia, C; Galli, S; Lucchi, G; Fagioli, G

    2011-01-01

    In this study, the performance of a free software for automatic segmentation of striatal SPECT brain studies (BasGanV2 - www.aimn.it) and a standard manual Region Of Interest (ROI) method were compared. The anthropomorphic Alderson RSD phantom, filled with solutions at different concentration of 123 I-FP-CIT with Caudate-Putamen to Background ratios between 1 and 8.7 and Caudate to Putamen ratios between 1 and 2, was imaged on a Philips-Irix triple head gamma camera. Images were reconstructed using filtered back-projection and processed with both BasGanV2, that provides normalized striatal uptake values on volumetric anatomical ROIs, and a manual method, based on average counts per voxel in ROIs drawn in a three-slice section. Caudate-Putamen/Background and Caudate/Putamen ratios obtained with the two methods were compared with true experimental ratios. Good correlation was found for each method; BasGanV2, however, has higher R index (BasGan R mean = 0.95, p mean = 0.89, p 123 I-FP-CIT SPECT data with, moreover, the advantage of the availability of a control subject's database.

  16. Comparative evaluation of the efficacy of chemomechanical caries removal agent (Papacarie and conventional method of caries removal: An in vitro study

    Directory of Open Access Journals (Sweden)

    Jawa D

    2010-06-01

    Full Text Available Painless dentistry, minimal intervention and thus giving comfort, relief and solace and instill positive attitude toward dental treatments, are some of the factors justifying the specialty of pediatric dentistry. Thus, this in vitro study was undertaken to compare the efficacy of a new chemomechanical caries removal agent, Papacarie (Formula and Acao, with conventional slow-speed rotary instrument (bur. Papacarie is a new formulation and has the main active ingredient papain, an endoprotein with bactericidal, bacteriostatic and anti-inflammatory actions. Twenty extracted human molar teeth with deep dentine caries and no enamel coverage were selected for the study. After the preparation of the teeth and removal of the caries with the respective methods, they were decalcified, dehydrated and embedded in paraffin blocks for histologic studies. Serial sections of 5 μm thickness were examined for the presence of bacteria under light microscope. Though complete removal of caries was achieved significantly in both the methods, there was less marked destruction of dentinal tubules in chemomechanical caries removal method by Papacarie. Thus, Papacarie is recommended as an efficient, easy to perform, comfortable and less destructive solution for the patient seeking an alternative to the conventional method.

  17. Ex Vivo Comparison of Mtwo and RaCe Rotary File Systems in Root Canal Deviation: One File Only versus the Conventional Method.

    Science.gov (United States)

    Aminsobhani, Mohsen; Razmi, Hasan; Nozari, Solmaz

    2015-07-01

    Cleaning and shaping of the root canal system is an important step in endodontic therapy. New instruments incorporate new preparation techniques that can improve the efficacy of cleaning and shaping. The aim of this study was to compare the efficacy of Mtwo and RaCe rotary file systems in straightening the canal curvature using only one file or the conventional method. Sixty mesial roots of extracted human mandibular molars were prepared by RaCe and Mtwo nickel-titanium (NiTi) rotary files using the conventional and only one rotary file methods. The working length was 18 mm and the curvatures of the root canals were between 15-45°. By superimposing x-ray images before and after the instrumentation, deviation of the canals was assessed using Adobe Photoshop CS3 software. Preparation time was recorded. Data were analyzed using three-way ANOVA and Tukey's post hoc test. There were no significant differences between RaCe and Mtwo or between the two root canal preparation methods in root canal deviation in buccolingual and mesiodistal radiographs (P>0.05). Changes of root canal curvature in >35° subgroups were significantly more than in other subgroups with smaller canal curvatures. Preparation time was shorter in one file only technique. According to the results, the two rotary systems and the two root canal preparation methods had equal efficacy in straightening the canals; but the preparation time was shorter in one file only group.

  18. Efficacy of adding the Kinesio Taping method to guideline-endorsed conventional physiotherapy in patients with chronic nonspecific low back pain: a randomised controlled trial.

    Science.gov (United States)

    Added, Marco Aurélio Nemitalla; Costa, Leonardo Oliveira Pena; Fukuda, Thiago Yukio; de Freitas, Diego Galace; Salomão, Evelyn Cassia; Monteiro, Renan Lima; Costa, Lucíola da Cunha Menezes

    2013-10-24

    Chronic nonspecific low back pain is a significant health condition with high prevalence worldwide and it is associated with enormous costs to society. Clinical practice guidelines show that many interventions are available to treat patients with chronic low back pain, but the vast majority of these interventions have a modest effect in reducing pain and disability. An intervention that has been widespread in recent years is the use of elastic bandages called Kinesio Taping. Although Kinesio Taping has been used extensively in clinical practice, current evidence does not support the use of this intervention; however these conclusions are based on a small number of underpowered studies. Therefore, questions remain about the effectiveness of the Kinesio Taping method as an additional treatment to interventions, such as conventional physiotherapy, that have already been recommended by the current clinical practice guidelines in robust and high-quality randomised controlled trials. We aim to determine the effectiveness of the addition of the use of Kinesio Taping in patients with chronic nonspecific low back pain who receive guideline-endorsed conventional physiotherapy. One hundred and forty-eight patients will be randomly allocated to receive either conventional physiotherapy, which consists of a combination of manual therapy techniques, general exercises, and specific stabilisation exercises (Guideline-Endorsed Conventional Physiotherapy Group) or to receive conventional physiotherapy with the addition of Kinesio Taping to the lumbar spine (Conventional Physiotherapy plus Kinesio Taping Group) over a period of 5 weeks (10 sessions of treatment). Clinical outcomes (pain intensity, disability and global perceived effect) will be collected at baseline and at 5 weeks, 3 months, and 6 months after randomisation. We will also collect satisfaction with care and adverse effects after treatment. Data will be collected by a blinded assessor. All statistical analysis will be

  19. Assessing the Applicability of Currently Available Methods for Attributing Foodborne Disease to Sources, Including Food and Food Commodities

    DEFF Research Database (Denmark)

    Pires, Sara Monteiro

    2013-01-01

    on the public health question being addressed, on the data requirements, on advantages and limitations of the method, and on the data availability of the country or region in question. Previous articles have described available methods for source attribution, but have focused only on foodborne microbiological...

  20. Comparing personal alpha dosimetry with the conventional area monitoring-time weighting methods of exposure estimation: a Canadian assessment

    International Nuclear Information System (INIS)

    Balint, A.B.; Viljoen, J.

    1988-01-01

    An experimental personal alpha dosimetry program for monitoring exposures of uranium mining facility workers in Canada has been completed. All licenced operating mining facilities were participating. Dosimetry techniques, description of dosimeters used by licences, performance and problems associated with the implementation of the programme as well as technical and administrative advantages and difficulties experienced are discussed. Area monitoring-time weighting methods used and results obtained to determine individual radon and thoron daughter exposure and exposure results generated by using dosimeters are assessed and compared

  1. Comparison of Vitek Matrix-assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry Versus Conventional Methods in Candida Identification.

    Science.gov (United States)

    Keçeli, Sema Aşkın; Dündar, Devrim; Tamer, Gülden Sönmez

    2016-02-01

    Candida species are generally identified by conventional methods such as germ tube or morphological appearance on corn meal agar, biochemical methods using API kits and molecular biological methods. Alternative to these methods, rapid and accurate identification methods of microorganisms called matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDİ-TOF MS) has recently been described. In this study, Candida identification results by API Candida kit, API 20C AUX kit and identifications on corn meal agar (CMA) are compared with the results obtained on Vitek-MS. All results were confirmed by sequencing internal transcribed spacer (ITS) regions of rDNA. Totally, 97 Candida strains were identified by germ tube test, CMA, API and Vitek-MS. Vitek-MS results were compatible with 74.2 % of API 20C AUX and 81.4 % of CMA results. The difference between the results of API Candida and API 20C AUX was detected. The ratio of discrepancy between Vitek-MS and API 20C AUX was 25.8 %. Candida species mostly identified as C. famata or C. tropicalis by and not compatible with API kits were identified as C. albicans by Vitek-MS. Sixteen Candida species having discrepant results with Vitek-MS, API or CMA were randomly chosen, and ITS sequence analysis was performed. The results of sequencing were compatible 56.2 % with API 20C AUX, 50 % with CMA and 93.7 % with Vitek-MS. When compared with conventional identification methods, MS results are more reliable and rapid for Candida identification. MS system may be used as routine identification method in clinical microbiology laboratories.

  2. Prediction of postoperative pulmonary function. Preliminary comparison of single-breath dual-energy xenon CT with three conventional methods

    International Nuclear Information System (INIS)

    Yanagita, Hisami; Honda, Norinari; Nakayama, Mitsuo

    2013-01-01

    The purpose of this study was to assess the use of xenon ventilation maps (Xe-images) for predicting postoperative pulmonary function. After study approval by the institutional review board, written informed consent was obtained from 30 patients with lung tumors who underwent pre- and postoperative spirometry, pulmonary perfusion single photon emission computed tomography (SPECT) and dual-energy CT (80 kV and 140 kV/Sn) after single-breath inspiration of 35% xenon. Xe-images were calculated by three-material decomposition. Sum of pixel values of the part to be resected (A) and of the whole lung (B) on Xe-images or lung perfusion SPECT, and volumes or the number of segments of the part to be resected (A) and of the whole lung (B) on Xe-images were enumerated, respectively. We multiplied (1-A/B) by each preoperative value from spirometry for prediction. Predictions by each of the four methods were compared with postoperative values. Predicted values for vital capacity (VC), forced vital capacity (FVC) and forced expiratory volume in 1 s (FEV 1 ) by the four methods regressed significantly with measured values (R 2 =0.56-0.77, p 1 with accuracy comparable to that of CT volumetry. (author)

  3. Integrated functional modeling method for NPP plant DiD risk monitor and its application for conventional PWR

    Energy Technology Data Exchange (ETDEWEB)

    Yoshikawa, Hidekazu; Yang, Ming; Zhang, Zhijian [Harbin Engineering University, Harbin (China)

    2014-08-15

    The development of a new risk monitor system is introduced in this paper, which can be applied not only to severe accident prevention in daily operation but also to serve as to mitigate the radiological hazard just after severe accident happens and long term management of post-severe accident consequences. The summary of the fundamental method is summarized on how to configure the Plant Defense in-Depth (Did) Risk Monitor by object-oriented software system based on functional modeling approach. Following the authors??preceding preliminary study for AP1000, the way of realizing the proposed method of configuring the plant Did risk monitor was investigated for a safety-enhanced Japanese PWR design to meet with the tight anti-severe accident requirements set by national regulation in Japan after Fukushima Daiichi accident. The result of this example practice of the presented preliminary study for Japanese PWR was for the level 4 of the Did in case of beyond design basis accident, that is, loss of all AC power + RCP seal LOCA, against the former case of AP1000 for level 3 Did in case of large LOCA.

  4. Clinical value of FDG hybrid-PET in staging and restaging of malignant lymphoma. Compared with conventional diagnostic methods

    International Nuclear Information System (INIS)

    Pichler, R.; Maschek, W.; Hatzl-Griesenhofer, M.; Huber, H.; Wimmer, G.; Wahl, G.; Fridrik, M.

    2000-01-01

    Aim of the present retrospective study was to validate the clinical value of F-18-FDG PET imaging in lymphoma patients with a dual head camera modified for coincidence detection. Staging before and after oncological treatment was compared with a conservative diagnostic approach. Methods: 48 patients (28 non-Hodgkin lymphoma, 20 Hodgkin's disease) received FDG-Hybrid-PET scans. Pretherapeutic staging was realized in 28 patients, 9 of them had control studies after they had completed therapy. Totally 29 persons were examined for posttherapeutic restaging. Computed tomography imaging and lymph node sonography was performed in all cases. Results were validated by clinical follow-up, in three cases a recidive was proven by biopsy. Results: CT and ultrasound detected 77 lesions in 28 patients compared with 100 visualized by PET, but this difference in pretherapeutic staging did not reach significance at p>0.05 by Fisher's t-test. Hybrid-PET obtained a sensitivity of 93%, a specifity of 79%, a positive of 82% and a negative predictive value of 92% for detection of residual disease. The values for CT+US were 87%, 64%, 72% and 88% respectively. Conclusion: FDG Hybrid-PET is as or even more accurate than standard morphologic diagnostic methods for prestaging in malignant lymphoma. Additionally, there is a substancial benefit for therapy monitoring of residual disease using coincidence detection PET with a 3/4-inch crystal gamma camera. (orig.) [de

  5. Comparison of conventional straight and swan-neck straight catheters inserted by percutaneous method for continuous ambulatory peritoneal dialysis: a single-center study.

    Science.gov (United States)

    Singh, Shivendra; Prakash, Jai; Singh, R G; Dole, P K; Pant, Pragya

    2015-10-01

    To evaluate the incidence of mechanical and infectious complications of conventional straight catheter (SC) versus swan-neck straight catheter (SNSC) implanted by percutaneous method. We retrospectively analyzed 45 catheter insertions being done by percutaneous method from January 1, 2011, to May 31, 2014. SC was inserted in 24 patients, and SNSC was inserted in 21 patients. Baseline characteristics for the two groups were similar with respect to age, sex and diabetic nephropathy as the cause for end-stage renal disease. Incidence of mechanical and infectious complications in SNSC group was found to be low as compared to the SC group and was statistically significant (1 in 11.6 patient months vs. 1 in 14.4 patient months, p = 0.02). Catheter migration was found to be the most common mechanical complication (20 %), and peritonitis was found to be the most common infectious complication in conventional SC group (27 episodes in 420 patient months vs. 11 episodes in 333 patient months, p = 0.03). The incidence of exit site and tunnel infection rates revealed no difference between the groups. SNSC insertion by percutaneous method is associated with low mechanical and infectious complications.

  6. Analysis of reverse heat transfer for conventional and optimized lubri-cooling methods during tangential surface grinding of ABNT 1020 steel

    Directory of Open Access Journals (Sweden)

    Henrique Cotait Razuk

    Full Text Available Abstract A numerical thermal model was developed to evaluate the heat flux which is conducted to a rectangular workpiece of steel plate ABNT 1020, thus making it possible to compute the maximum temperature in the grinding surface, taking into account the rectangular distribution of heat flux, the thermal properties of the grinding wheel conventional Al2O3, the piece to be machined and the lubri-refrigerating fluid. The finite volume method was employed for the discretization of the direct thermal problem from the heat diffusion equation associated with the two-dimensional problem of heat conduction in transient regime. The inverse thermal problem was solved by the Golden Section technique. The thermal flux, when compared to the conventional technique of method of application fluid, was reduced by 84.0% in the practices performed with cutting depth of 30µm, at 74.0% in practices with cutting depth of 45µm and 61.2% in the aggressive practices of 60µm, thus demonstrating the applicability of the optimized method for fluid application.

  7. Compositions of graphene materials with metal nanostructures and microstructures and methods of making and using including pressure sensors

    KAUST Repository

    Chen, Ye; Khashab, Niveen M.; Tao, Jing

    2017-01-01

    Composition comprising at least one graphene material and at least one metal. The metal can be in the form of nanoparticles as well as microflakes, including single crystal microflakes. The metal can be intercalated in the graphene sheets

  8. Assessment of adiposity in psoriatic patients by dual energy X-ray absorptiometry compared to conventional methods*

    Science.gov (United States)

    Diniz, Michelle dos Santos; Bavoso, Nádia Couto; Kakehasi, Adriana Maria; Lauria, Márcio Weissheimer; Soares, Maria Marta Sarquis; Machado-Pinto, Jackson

    2016-01-01

    BACKGROUND Obesity is considered a chronic low-grade inflammatory disease that shares mediators of inflammation with psoriasis, such as TNF-α and IL-6. The relationship between these two conditions involves factors such as predisposition and response to therapy, in addition to an association with cardiovascular disease. OBJECTIVES The aim of the present study was to investigate the prevalence of adiposity as determined by body mass index (BMI), waist circumference (WC), and dual energy X-ray absorptiometry (DXA) evaluation in patients with psoriasis. METHODS BMI, WC and body composition by DXA were measured in 42 psoriatic patients without joint complaints and in 41 control patients using standard procedures. In the comparison between cases and controls, we used Pearson’s Χ2 test or Fisher’s exact test, and the nonparametric Mann-Whitney test. The difference between the diverse classification methods for obesity was evaluated using McNemar’s test. To test the level of agreement between those variables, we used the weighted kappa coefficient. RESULTS There was no difference in the prevalence of obesity among cases and controls. Both BMI and WC had low agreement with measures of body fat evaluated by DXA. With the use of DXA scanning, prevalence of overweight and obesity in patients with psoriasis was 83.3%, which constitutes a strong evidence of the need for intervention on this metabolic parameter. CONCLUSION Dual energy X-ray absorptiometry was more capable of identifying obesity compared with BMI and WC both in psoriatic and control patients. PMID:27192512

  9. A study on evaluating validity of SNR calculation using a conventional two region method in MR images applied a multichannel coil and parallel imaging technique

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Kwan Woo; Son, Soon Yong [Dept. of Radiology, Asan Medical Center, Seoul (Korea, Republic of); Min, Jung Whan [Dept. of Radiological Technology, Shingu University, Sungnam (Korea, Republic of); Kwon, Kyung Tae [Dept. of Radiological Technology, Dongnam Health University, Suwon (Korea, Republic of); Yoo, Beong Gyu; Lee, Jong Seok [Dept. of Radiotechnology, Wonkwang Health Science University, Iksan (Korea, Republic of)

    2015-12-15

    The purpose of this study was to investigate the problems of a signal to noise ratio measurement using a two region measurement method that is conventionally used when using a multi-channel coil and a parallel imaging technique. As a research method, after calculating the standard SNR using a single channel head coil of which coil satisfies three preconditions when using a two region measurement method, we made comparisons and evaluations after calculating an SNR by using a two region measurement method of which method is problematic because it is used without considering the methods recommended by reputable organizations and the preconditions at the time of using a multi-channel coil and a parallel imaging technique. We found that a two region measurement method using a multi-channel coil and a parallel imaging technique shows the highest relative standard deviation, and thus shows a low degree of precision. In addition, we found out that the difference of SNR according to ROI location was very high, and thus a spatial noise distribution was not uniform. Also, 95% confidence interval through Blend-Altman plot is the widest, and thus the conformity degree with a two region measurement method using the standard single channel head coil is low. By directly comparing an AAPM method, which serves as a standard of a performance evaluation test of a magnetic resonance imaging device under the same image acquisition conditions, an NEMA method which can accurately determine the noise level in a signal region and the methods recommended by manufacturers of a magnetic resonance imaging device, there is a significance in that we quantitatively verified the inaccurate problems of a signal to noise ratio using a two region measurement method when using a multi-channel coil and a parallel imaging technique of which method does not satisfy the preconditions that researchers could overlook.

  10. Evaluation, including effects of storage and repeated freezing and thawing, of a method for measurement of urinary creatinine

    DEFF Research Database (Denmark)

    Garde, A H; Hansen, Åse Marie; Kristiansen, J

    2003-01-01

    The aims of this study were to elucidate to what extent storage and repeated freezing and thawing influenced the concentration of creatinine in urine samples and to evaluate the method for determination of creatinine in urine. The creatinine method was based on the well-known Jaffe's reaction...... and measured on a COBAS Mira autoanalyser from Roche. The main findings were that samples for analysis of creatinine should be kept at a temperature of -20 degrees C or lower and frozen and thawed only once. The limit of detection, determined as 3 x SD of 20 determinations of a sample at a low concentration (6...

  11. Comparison of in-situ gamma ray spectrometry measurements with conventional methods in determination natural and artificial nuclides in soil

    International Nuclear Information System (INIS)

    Al-Masri, M. S.; Doubal, A. W.

    2010-12-01

    Two nuclear analytical techniques (In-Situ Gamma ray spectrometry and laboratory gamma ray spectrometry) for determination of natural and artificial radionuclides in soil have been validated. The first technique depends on determination of radioactivity content of representative samples of the studied soil after laboratory preparation, while the second technique is based on direct determination of radioactivity content of soil using in-situ gamma-ray spectrometer. Analytical validation parameter such as detection limits, repeatability, reproducibility in addition to measurement uncertainties were estimated and compared for both techniques. Comparison results have shown that the determination of radioactivity in soil should apply the two techniques together where each of techniques is characterized by its low detection limit and uncertainty suitable for defined application of measurement. Radioactive isotopes in various locations were determined using the two methods by measuring 40 k, 238 U,and 137 Cs. The results showed that there are differences in attenuation factors due to soil moisture content differences; wet weight corrections should be applied when the two techniques are compared. (author)

  12. Preparation and study of tramadol imprinted micro-and nanoparticles by precipitation polymerization: microwave irradiation and conventional heating method.

    Science.gov (United States)

    Seifi, Mahmoud; Hassanpour Moghadam, Maryam; Hadizadeh, Farzin; Ali-Asgari, Safa; Aboli, Jafar; Mohajeri, Seyed Ahmad

    2014-08-25

    In the present work a series of tramadole imprinted micro- and nanoparticles were prepared and study their recognition properties. Methacrylic acid (MAA), as a functional monomer, ethylene glycol dimethacrylate (EGDMA) as a cross-linker and different solvents (chloroform, toluene and acetonitrile (ACN)) were used for the preparation of molecularly imprinted polymers (MIPs) and non-imprinted polymers (NIPs). Several factors such as template/monomer molar ratio, volume of polymerization solvent, total monomers/solvent volume ratio, polymerization condition (heating or microwave irradiation) were also investigated. Particle size of the polymers, transmission electron microscopy (TEM), Fourier transform infrared spectroscopy (FT-IR), rebinding, selectivity tests and release study were applied for evaluation of the polymers. The optimized polymers with smaller particle size and superior binding properties were obtained in acetonitrile under heating method. MIPA4 with a size of 42.6 nm and a binding factor (BF) of 6.79 was selected for selectivity and release tests. The polymerization was not successful in acetonitrile and toluene under microwave irradiation. The MIPA4 could selectively adsorb tramadol, compared to imipramine, naltrexone and gabapentin. The data showed that tramadol release from MIPA4 was significantly slower than that of its non-imprinted polymer. Therefore, MIP nanoparticles with high selectivity, binding capacity and ability to control tramadol release could be obtained in precipitation polymerization with optimized condition. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Clinical and anatomic pathology effects of serial blood sampling in rat toxicology studies, using conventional or microsampling methods.

    Science.gov (United States)

    Caron, Alexis; Lelong, Christine; Bartels, T; Dorchies, O; Gury, T; Chalier, Catherine; Benning, Véronique

    2015-08-01

    As a general practice in rodent toxicology studies, satellite animals are used for toxicokinetic determinations, because of the potential impact of serial blood sampling on toxicological endpoints. Besides toxicological and toxicokinetic determinations, blood samples obtained longitudinally from a same animal may be used for the assessment of additional parameters (e.g., metabolism, pharmacodynamics, safety biomarkers) to maximize information that can be deduced from rodents. We investigated whether removal of up to 6 × 200 μL of blood over 24h can be applied in GLP rat toxicology studies without affecting the scientific outcome. 8 week-old female rats (200-300 g) were dosed for up to 1 month with a standard vehicle and subjected or not (controls) to serial blood sampling for sham toxicokinetic/ancillary determinations, using miniaturized methods allowing collection of 6 × 50, 100 or 200 μL over 24h. In-life endpoints, clinical pathology parameters and histopathology of organs sensitive to blood volume reduction were evaluated at several time points after completion of sampling. In sampled rats, minimal and reversible changes in red blood cell mass (maximally 15%) and subtle variations in liver enzymes, fibrinogen and neutrophils were not associated with any organ/tissue macroscopic or microscopic correlate. Serial blood sampling (up to 6 × 200 μL over 24h) is compatible with the assessment of standard toxicity endpoints in adult rats. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Theory of linear physical systems theory of physical systems from the viewpoint of classical dynamics, including Fourier methods

    CERN Document Server

    Guillemin, Ernst A

    2013-01-01

    An eminent electrical engineer and authority on linear system theory presents this advanced treatise, which approaches the subject from the viewpoint of classical dynamics and covers Fourier methods. This volume will assist upper-level undergraduates and graduate students in moving from introductory courses toward an understanding of advanced network synthesis. 1963 edition.

  15. Identification of genus Acinetobacter: Standardization of in-house PCR and its comparison with conventional phenotypic methods.

    Science.gov (United States)

    Kulkarni, Sughosh S; Madalgi, Radhika; Ajantha, Ganavalli S; Kulkarni, Raghavendra D

    2017-01-01

    Acinetobacter is grouped under nonfermenting Gram-negative bacilli. It is increasingly isolated from pathological samples. The ability of this genus to acquire drug resistance and spread in the hospital settings is posing a grave problem in healthcare. Specific treatment protocols are advocated for Acinetobacter infections. Hence, rapid identification and drug susceptibility profiling are critical in the management of these infections. To standardize an in-house polymerase chain reaction (PCR) for identification of genus Acinetobacter and to compare PCR with two protocols for its phenotypic identification. A total of 96 clinical isolates of Acinetobacter were included in the study. An in-house PCR for genus level identification of Acinetobacter was standardized. All the isolates were phenotypically identified by two protocols. The results of PCR and phenotypic identification protocols were compared. The in-house PCR standardized was highly sensitive and specific for the genus Acinetobacter . There was 100% agreement between the phenotypic and molecular identification of the genus. The preliminary identification tests routinely used in clinical laboratories were also in complete agreement with phenotypic and molecular identification. The in-house PCR for genus level identification is specific and sensitive. However, it may not be essential for routine identification as the preliminary phenotypic identification tests used in the clinical laboratory reliably identify the genus Acinetobacter .

  16. Sighting optics including an optical element having a first focal length and a second focal length and methods for sighting

    Science.gov (United States)

    Crandall, David Lynn

    2011-08-16

    Sighting optics include a front sight and a rear sight positioned in a spaced-apart relation. The rear sight includes an optical element having a first focal length and a second focal length. The first focal length is selected so that it is about equal to a distance separating the optical element and the front sight and the second focal length is selected so that it is about equal to a target distance. The optical element thus brings into simultaneous focus for a user images of the front sight and the target.

  17. Compositions of graphene materials with metal nanostructures and microstructures and methods of making and using including pressure sensors

    KAUST Repository

    Chen, Ye

    2017-01-26

    Composition comprising at least one graphene material and at least one metal. The metal can be in the form of nanoparticles as well as microflakes, including single crystal microflakes. The metal can be intercalated in the graphene sheets. The composition has high conductivity and flexibility. The composition can be made by a one-pot synthesis in which a graphene material precursor is converted to the graphene material, and the metal precursor is converted to the metal. A reducing solvent or dispersant such as NMP can be used. Devices made from the composition include a pressure sensor which has high sensitivity. Two two- dimension materials can be combined to form a hybrid material.

  18. New Zealand's Fourth National Communication under the United Nations Framework Convention on Climate Change. Including the Report on the Global Climate Observing System and the Report on Demonstrable Progress under the Kyoto Protocol

    International Nuclear Information System (INIS)

    2006-03-01

    The New Zealand Government is committed to playing its part in the global response to climate change. This Fourth National Communication provides a snapshot of New Zealand's progress with implementing the United Nations Framework Convention on Climate Change (UNFCCC). This document covers the period from the submission of the Third National Communication in January 2002 through to the end of December 2005. This document also contains New Zealand's Report on the Global Climate Observing System and the Report on Demonstrable Progress under the Kyoto Protocol. New Zealand's response to climate change has evolved substantially since the Third National Communication was submitted. On 19 December 2002, New Zealand became the 101st nation to ratify the Kyoto Protocol. In 2002, the New Zealand Parliament passed the Climate Change Response Act. This Act established a New Zealand climate change registry and corresponding institutional arrangements in accordance with Kyoto Protocol requirements. Other achievements are detailed throughout this Fourth National Communication. When the Government introduced its climate change policy package in 2002, it anticipated there would be three reviews of the package not later than 2005, 2007 and 2010. The reviews would be necessary to monitor progress with emissions reductions, assess the effectiveness of policies, and confirm that New Zealand was positioned to meet its commitments. The first of these reviews was commissioned by the Government in mid-2005 and completed by November 2005. The review concluded that some elements of the Government's 2002 climate change policy package should be modified to better position New Zealand to respond to the longer-term challenges of climate change. A key outcome of the policy review was the announcement by the newly elected Government in December 2005 that the previously announced carbon tax would not proceed. In addition, a suite of future work programmes would be required to inform Government

  19. Comparative evaluation of optical methods and conventional isotope techniques for the detection of insulin receptors in heterogenous cell systems

    International Nuclear Information System (INIS)

    Thun, C.

    1984-01-01

    The findings of studies using radioactively labelled (I-125) insulin to characterise its binding to various heterogenous cell systems had led to a classification of the relevant receptors with those of high affinity and low capacity or vice versa. This, in turn, raised questions as to the binding properties of each individual cell or cell material of a heterogenous nature. Apparently homogenous (lymphocytes) and heterogenous (blood and islet cells) cell populations were investigated on the basis of various techniques for the separate evaluation of individual cells, which were cytofluorometry using FITC insulin and the analysis of gold insulin under the electron microscope. For the association kinetics and equilibration analysis or affinity and receptor quantity a radioactive tracer and light microscope were used. Insulin was shown to bind to erythrocytes, reticulocytes, monocytes and lymphocytes and this result finds confirmation in the relevant literature. Furthermore, binding parameters could be determined for isolated islet cells. Cytofluorometry pointed to the fact that the insulin receptors of an apparently homogenous cell system differed in affinity and number and permitted the use of a multiple parameter procedure. Thus, it holds out promise as a method to be routinely used in the clinical diagnosis of binding parameters, without requiring previous separation procedures that are complicated or involve a loss of material. Transmission electron microscopy permitted conclusions to be drawn as to the type of cell to which insulin is attached. Owing to the use of gold insulin it was possible to throw some light on the factors determining the fate of membrane-bound insulin during its uptake into the cell. (TRV) [de

  20. Difference in target definition using three different methods to include respiratory motion in radiotherapy of lung cancer

    DEFF Research Database (Denmark)

    Sloth Møller, Ditte; Knap, Marianne Marquard; Nyeng, Tine Bisballe

    2017-01-01

    : PTVσ yields the smallest volumes but does not ensure coverage of tumor during the full respiratory motion due to tumor deformation. Incorporating the respiratory motion in the delineation (PTVdel) takes into account the entire respiratory cycle including deformation, but at the cost, however, of larger...

  1. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  2. A new quantitative index of lobar air trapping in chronic obstructive pulmonary disease (COPD): Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Nagatani, Yukihiro, E-mail: yatsushi@belle.shiga-med.ac.jp [Department of Radiology, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Murata, Kiyoshi; Takahashi, Masashi; Nitta, Norihisa [Department of Radiology, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Nakano, Yasutaka [Division of Respiratory Medicine, Department of Internal Medicine, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Sonoda, Akinaga; Otani, Hideji [Department of Radiology, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Okabe, Hidetoshi [Department of Clinical Laboratory, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Ogawa, Emiko [Health Administration Center, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan)

    2015-05-15

    Highlights: • In the total lung field, AVI had excellent correlation with FEV{sub 1}/FVC. • AVI showed differences between three groups classified by the COPD severity. • In a lobe-based analysis, AVI did not mostly correlated with volume decrease ratio. • In a lobe-based analysis, coefficient of variation was relatively small in AVI. • In some lobes, AVI associated with the COPD severity despite respiratory level. - Abstract: Purpose: To determine the usefulness of newly-proposed index (attenuation–volume index, AVI: increase in mean value of lung attenuation (MVLA) divided by volume decrease ratio (VDR)) for quantitative assessment of lobar air trapping (LAT) using expiratory/inspiratory (E/I) computed tomography (CT) by minimizing influence of respiratory level. Materials and methods: Institutional review board approved study protocol. Twenty-one moderate or severe COPD (group A), 16 mild COPD (group B) and 26 normal volunteers (group C) underwent both E/I scans via 320-row CT and pulmonary functional test (PFT). Volume image data were automatically segmented into six lung lobes with minimal manual intervention. AVI, pixel index (PI), air trapping ratio (ATR) and relative volume change (RVC{sub 860–950}) were calculated in total lung (TL) and each lobe. Four indices in TL were correlated with both PFT result and VDR and those in TL and each lobe were compared between three groups. Results: Similar to ATR, AVI correlated with both FEV{sub 1}/FVC (r = 0.772, p < 0.01) and RV/TLC (r = −0.726, p < 0.01) and demonstrated a significant difference between three groups in both TL (group A: 1.69 ± 0.45, group B: 2.21 ± 0.45 and group C: 2.80 ± 0.44) and five lobes except for left lingular segment. In a lobe-based analysis regarding relationship with VDR, AVI was much less dependent than ATR, although regression lines of groups A and C were separated for AVI as well as ATR. Coefficient of variation of either PI or RVC{sub 860–950} was significantly

  3. Climate change convention

    International Nuclear Information System (INIS)

    Russell, D.

    1992-01-01

    Principles that guide Canada's Green Plan with respect to global warming are outlined. These include respect for nature, meeting environmental goals in an economically beneficial manner, efficient use of resources, shared responsibilities, federal leadership, and informed decision making. The policy side of the international Framework Convention on Climate Change is then discussed and related to the Green Plan. The Convention has been signed by 154 nations and has the long-term objective of stabilizing anthropogenic greenhouse gas concentrations in the atmosphere at levels that prevent dangerous interference with the climate system. Some of the Convention's commitments toward achieving that objective are only applicable to the developed countries. Five general areas of commitment are emissions reductions, assistance to developing countries, reporting requirements, scientific and socioeconomic research, and education. The most controversial area is that of limiting emissions. The Convention has strong measures for public accountability and is open to future revisions. Canada's Green Plan represents one country's response to the Convention commitments, including a national goal to stabilize greenhouse gas emissions at the 1990 level by the year 2000

  4. Method for automatic localization of MR-visible markers using morphological image processing and conventional pulse sequences: feasibility for image-guided procedures.

    Science.gov (United States)

    Busse, Harald; Trampel, Robert; Gründer, Wilfried; Moche, Michael; Kahn, Thomas

    2007-10-01

    To evaluate the feasibility and accuracy of an automated method to determine the 3D position of MR-visible markers. Inductively coupled RF coils were imaged in a whole-body 1.5T scanner using the body coil and two conventional gradient echo sequences (FLASH and TrueFISP) and large imaging volumes up to (300 mm(3)). To minimize background signals, a flip angle of approximately 1 degrees was used. Morphological 2D image processing in orthogonal scan planes was used to determine the 3D positions of a configuration of three fiducial markers (FMC). The accuracies of the marker positions and of the orientation of the plane defined by the FMC were evaluated at various distances r(M) from the isocenter. Fiducial marker detection with conventional equipment (pulse sequences, imaging coils) was very reliable and highly reproducible over a wide range of experimental conditions. For r(M) method is found to be useful for image-guided procedures. (c) 2007 Wiley-Liss, Inc.

  5. Mercury Distribution in the Deûle River (Northern France) Measured by the Diffusive Gradients in Thin Films Technique and Conventional Methods.

    Science.gov (United States)

    Diviš, Pavel; Kadlecová, Milada; Ouddane, Baghdad

    2016-05-01

    The distribution of mercury in surface water and in sediment from Deûle River in Northern France was studied by application of conventional sampling methods and by diffusive gradients in thin films technique (DGT). Concentration of total dissolved mercury in surface water was 20.8 ± 0.8 ng l(-1). The particulate mercury concentration was 6.2 ± 0.6 µg g(-1). The particulate mercury was accumulated in sediment (9.9 ± 2.3 mg kg(-1)), and it was transformed by methylating bacteria to methylmercury, mainly in the first 2-cm layer of the sediment. Total dissolved concentration of mercury in sediment pore water obtained by application of centrifugation extraction was 17.6 ± 4.1 ng l(-1), and it was comparable with total dissolved pore water mercury concentration measured by DGT probe containing Duolite GT-73 resin gel (18.2 ± 4.3 ng l(-1)), taking the sediment heterogeneity and different principles of the applied methods into account. By application of two DGT probes with different resin gels specific for mercury, it was found that approximately 30% of total dissolved mercury in sediment pore water was present in labile forms easy available for biota. The resolution of mercury DGT depth profiles was 0.5 cm, which allows, unlike conventional techniques, to study the connection of the geochemical cycle of mercury with geochemical cycles of iron and manganese.

  6. Comparison of conventional full spine radiographs and fluoroscopic scanning method in young patients with idiopathic scoliosis; Vergleich von konventioneller Wirbelsaeulenganzaufnahme und fluoroskopischer Scan-Methode bei jungen Patienten mit idiopathischer Skoliose

    Energy Technology Data Exchange (ETDEWEB)

    Schaefer, J.; Kottke, R.; Claussen, C. [Abt. fuer Radiologische Diagnostik, Universitaetsklinikum Tuebingen (Germany); Kluba, T.; Niemeyer, T.; Hahnfeldt, T. [Klinik und Poliklinik fuer Orthopaedie, Universitaetsklinikum Tuebingen (Germany); Vonthein, R. [Inst. fuer Medizinische Biometrie, Universitaetsklinikum Tuebingen (Germany); Kamm, K.F. [Philips Medizin Systeme GmbH, Hamburg (Germany)

    2005-08-01

    Purpose: evaluation of low-dose full spine radiographs using fluoroscopic images for the assessment of the Cobb angle measurement in patients with scoliosis. Material and methods: twenty-one consecutive patients (aged 10-27 years, mean age 14 years) with a conventional full spine examination (film speed class 800) underwent a follow-up exam using digital pulsed fluoroscopy (Multi Diagnost 4, Philips Medical Systems, Eindhoven, The Netherlands). The mean follow-up was 9 months. During a synchronized scan with a C-arm speed of 4 cm/sec fluoroscopic images were stored with a pulsed frequency of 3 images per second. The single images were merged and reconstructed to one image with the software easy spine (Philips medical Systems, Eindhoven, The Netherlands). The corresponding dose-area product values (DAP) of both methods were compared. Three independent observers assessed Cobb angles and image quality for each technique. Results: the mean DAP values for conventional imaging was 94.9 cGy x cm{sup 2} and for fluoroscopy 7.8 cGy x cm{sup 2}, respectively. A significant dose reduction of 91.8% (CI 91% to 95%) was calculated. The average absolute angle difference between the observers was found to be 2.7 for conventional imaging and 2.4 for the fluoroscopic method. Interobserver standard deviation of 2.9 was lower than the 5.3 for conventional images. Image quality was better in the conventional images. Conclusion: using the scanning method, we could achieve a mean reduction of the radiation dose of 92%, while the accuracy of the Cobb angle measurements was comparable for both techniques despite of reduced image quality of digital fluoroscopy. (orig.)

  7. Shining a light on LAMP assays--a comparison of LAMP visualization methods including the novel use of berberine.

    Science.gov (United States)

    Fischbach, Jens; Xander, Nina Carolin; Frohme, Marcus; Glökler, Jörn Felix

    2015-04-01

    The need for simple and effective assays for detecting nucleic acids by isothermal amplification reactions has led to a great variety of end point and real-time monitoring methods. Here we tested direct and indirect methods to visualize the amplification of potato spindle tuber viroid (PSTVd) by loop-mediated isothermal amplification (LAMP) and compared features important for one-pot in-field applications. We compared the performance of magnesium pyrophosphate, hydroxynaphthol blue (HNB), calcein, SYBR Green I, EvaGreen, and berberine. All assays could be used to distinguish between positive and negative samples in visible or UV light. Precipitation of magnesium-pyrophosphate resulted in a turbid reaction solution. The use of HNB resulted in a color change from violet to blue, whereas calcein induced a change from orange to yellow-green. We also investigated berberine as a nucleic acid-specific dye that emits a fluorescence signal under UV light after a positive LAMP reaction. It has a comparable sensitivity to SYBR Green I and EvaGreen. Based on our results, an optimal detection method can be chosen easily for isothermal real-time or end point screening applications.

  8. Measure Guideline: Summary of Interior Ducts in New Construction, Including an Efficient, Affordable Method to Install Fur-Down Interior Ducts

    Energy Technology Data Exchange (ETDEWEB)

    Beal, D. [BA-PIRC, Cocoa, FL (United States); McIlvaine, J. [BA-PIRC, Cocoa, FL (United States); Fonorow, K. [BA-PIRC, Cocoa, FL (United States); Martin, E. [BA-PIRC, Cocoa, FL (United States)

    2011-11-01

    This document illustrates guidelines for the efficient installation of interior duct systems in new housing, including the fur-up chase method, the fur-down chase method, and interior ducts positioned in sealed attics or sealed crawl spaces.

  9. PSA methodology including new design, operational and safety factors, 'Level of recognition of phenomena with a presumed dominant influence upon operational safety' (failures of conventional as well as non-conventional passive components, dependent failures, influence of operator, fires and external threats, digital control, organizational factors)

    International Nuclear Information System (INIS)

    Jirsa, P.

    2001-10-01

    The document represents a specific type of discussion of existing methodologies for the creation and application of probabilistic safety assessment (PSA) in light of the EUR document summarizing requirements placed by Western European NPP operators on the future design of nuclear power plants. A partial goal of this discussion consists in mapping, from the PSA point of view, those selected design, operational and/or safety factors of future NPPs that may be entirely new or, at least, newly addressed. Therefore, the terms of reference for this stage were formulated as follows: Assess current level of knowledge and procedures in the analysis of factors and phenomena with a dominant influence upon operational safety of new generation reactors, especially in the following areas: (1) Phenomenology of failure types and mechanisms and reliability of conventional passive safety system components; (2) Phenomenology of failure types and mechanisms and reliability of non-conventional passive components of newly designed safety systems; (3) Phenomenology of types and mechanisms of dependent failures; (4) Human factor role in new generation reactors and its effect upon safety; (5) Fire safety and other external threats to new nuclear installations; (6) Reliability of the digital systems of the I and C system and their effect upon safety; and (7) Organizational factors in new nuclear installations. (P.A.)

  10. Precision Fit of Screw-Retained Implant-Supported Fixed Dental Prostheses Fabricated by CAD/CAM, Copy-Milling, and Conventional Methods.

    Science.gov (United States)

    de França, Danilo Gonzaga; Morais, Maria Helena; das Neves, Flávio D; Carreiro, Adriana Fonte; Barbosa, Gustavo As

    The aim of this study was to evaluate the effectiveness of fabrication methods (computer-aided design/computer-aided manufacture [CAD/CAM], copy-milling, and conventional casting) in the fit accuracy of three-unit, screw-retained fixed dental prostheses. Sixteen three-unit implant-supported screw-retained frameworks were fabricated to fit an in vitro model. Eight frameworks were fabricated using the CAD/CAM system, four in zirconia and four in cobalt-chromium. Four zirconia frameworks were fabricated using the copy-milled system, and four were cast in cobalt-chromium using conventional casting with premachined abutments. The vertical and horizontal misfit at the implant-framework interface was measured using scanning electron microscopy at ×250. The results for vertical misfit were analyzed using Kruskal-Wallis and Mann-Whitney tests. The horizontal misfits were categorized as underextended, equally extended, or overextended. Statistical analysis established differences between groups according to the chi-square test (α = .05). The mean vertical misfit was 5.9 ± 3.6 μm for CAD/CAM-fabricated zirconia, 1.2 ± 2.2 μm for CAD/CAM-fabricated cobalt-chromium frameworks, 7.6 ± 9.2 μm for copy-milling-fabricated zirconia frameworks, and 11.8 (9.8) μm for conventionally fabricated frameworks. The Mann-Whitney test revealed significant differences between all but the zirconia-fabricated frameworks. A significant association was observed between the horizontal misfits and the fabrication method. The percentage of horizontal misfits that were underextended and overextended was higher in milled zirconia (83.3%), CAD/CAM cobaltchromium (66.7%), cast cobalt-chromium (58.3%), and CAD/CAM zirconia (33.3%) frameworks. CAD/CAM-fabricated frameworks exhibit better vertical misfit and low variability compared with copy-milled and conventionally fabricated frameworks. The percentage of interfaces equally extended was higher when CAD/CAM and zirconia were used.

  11. Comparison of revegetation of a gas pipeline right-of-way in two forested wetland crossings involving conventional methods of pipeline installation and horizontal drilling, Nassau County, Florida

    Energy Technology Data Exchange (ETDEWEB)

    Van Dyke, G.D. [Trinity Christian Coll., Palos Heights, IL (United States). Dept. of Biology; Shem, L.M.; Zimmerman, R.E. [Argonne National Lab., IL (United States)

    1993-10-01

    One year after pipeline installation, vegetation in the right-of-way (ROW) was inventoried at two stream floodplain crossings in Nassau County, Florida. Both sites were forested wetlands composed of Acer rubrum, Fraxinus caroliniana, Liquidamber styraciflua, Nyssa ogecho, Quercus laurifolia, and Taxodium distichum, together with other wetland trees. Pipeline installation across the Brandy Branch floodplain was by conventional ditching and backfill methods. Installation across the Deep Creek floodplain was by horizontal drilling after clearcutting the ROW. The latter method left tree stumps, understory vegetation, and soil layers intact, except for disruptions caused by logging. According to the inventory, vegetation at the drilled site was more diverse (nearly twice as many species occurring in the ROW as at the trenched site) and more robust (no unvegetated exposed soil compared to 15% at the trenched site). Differences between the ROW vegetation at the two sites can be attributed to both site differences and installation technologies used.

  12. A Quadrature Method of Moments for Polydisperse Flow in Bubble Columns Including Poly-Celerity, Breakup and Coalescence

    Directory of Open Access Journals (Sweden)

    Thomas Acher

    2014-12-01

    Full Text Available A simulation model for 3D polydisperse bubble column flows in an Eulerian/Eulerian framework is presented. A computationally efficient and numerically stable algorithm is created by making use of quadrature method of moments (QMOM functionalities, in conjunction with appropriate breakup and coalescence models. To account for size dependent bubble motion, the constituent moments of the bubble size distribution function are transported with individual velocities. Validation of the simulation results against experimental and numerical data of Hansen [1] show the capability of the present model to accurately predict complex gas-liquid flows.

  13. Infliximab, adalimumab and golimumab for treating moderately to severely active ulcerative colitis after the failure of conventional therapy (including a review of TA140 and TA262): clinical effectiveness systematic review and economic model.

    OpenAIRE

    Archer, R.; Tappenden, P.; Ren, S.; Martyn-St James, M.; Harvey, R.; Basarir, H.; Stevens, J.; Carroll, C.; Cantrell, A.; Lobo, A.; Hoque, S.

    2016-01-01

    BACKGROUND: Ulcerative colitis (UC) is the most common form of inflammatory bowel disease in the UK. UC can have a considerable impact on patients' quality of life. The burden for the NHS is substantial. OBJECTIVES: To evaluate the clinical effectiveness and safety of interventions, to evaluate the incremental cost-effectiveness of all interventions and comparators (including medical and surgical options), to estimate the expected net budget impact of each intervention, and to identify key re...

  14. Comparison of the method of diffusive gels in thin films with conventional extraction techniques for evaluating zinc accumulation in plants and isopods

    International Nuclear Information System (INIS)

    Koster, Marijke; Reijnders, Lucas; Oost, Nathalie R. van; Peijnenburg, Willie J.G.M.

    2005-01-01

    The measurement of diffusive gels in thin films (DGT) has recently been developed to assess metal bioavailability in soils. The DGT-method is based on diffusion in a porous matrix. To test the predictive capabilities of the method with regard to metal bioavailability, a study was set up with 28 soils having a variety of textures and amounts of zinc salts added. Correlation and regression analyses were performed to compare DGT-extracted zinc levels to zinc concentrations obtained by extraction with 0.01 M CaCl 2 and 0.43 M HNO 3 , digestion with aqua regia and the zinc concentration in pore water. The amount of zinc extracted with CaCl 2 correlated well with DGT-extracted zinc levels in all soils spiked with different amounts of ZnCl 2 . A similar correlation was not found for zinc concentrations in soil samples collected in the field. Experiments were performed to compare zinc content in organisms and in soils. The organisms tested were plants (grass, lettuce and lupine) and the hard bodied soil dwelling isopod Oniscus asellus. Good correlations were found between zinc accumulation in grass and lettuce and the C E (effective concentration) measured by a DGT-device, CaCl 2 extracted zinc and the zinc content in the pore water of all soils. The correlation with C E was not significant for lupine, neither for spiked soils, nor for field soils (p ≤ 0.001). Zinc levels in the isopods were not significantly related to any set of zinc measurements. From a synthesis of all results obtained it is concluded that the DGT-methodology does not have an additional value in predicting bioavailability of zinc in terrestrial ecosystems as compared to conventional extraction methods. - Capsule: The newly developed method of diffusive gels in Thin films (DGT) does not have an added value over conventional extraction techniques in predicting zinc uptake by plants and isopods

  15. Principles of cobalt-60 teletherapy including an introduction to the compendium. Guidelines for the documentation of radiation treatment methods

    International Nuclear Information System (INIS)

    Cohen, M.

    1984-01-01

    A great deal of thought has been given in recent years to the documentation of individual patients and their diseases, especially since the computerization of registry sytems facilitates the storage and retrieval of large amounts of data, but the documentation of radiation treatment methods has received surprisingly little attention. The guidelines which follow are intended for use both internally (within radiotherapy centres) and externally when a treatment method is reported in the literature or transferred from one centre to another. The amount of detail reported externally will, of course, depend on the circumstances: for example, a published paper will usually mention only the most important of the radiation and physical parameters, but it is important for the department of origin to list all parameters in a separate document, available on request. These guidelines apply specifically to the documentation of treatment by external radiation beams, although many of the suggestions would also apply to treatment by small sealed sources (brachytherapy) and by unsealed radionuclides. Treatment techniques which involve a combination of external and internal sources (e.g. Ca. cervix uteri treatd by intracavitary sources plus external beam therapy) require particularly careful documentation to indicate the relationship bwtween dose distribution (in both space and time) achieved by the two modalities

  16. Method to Determine Appropriate Source Models of Large Earthquakes Including Tsunami Earthquakes for Tsunami Early Warning in Central America

    Science.gov (United States)

    Tanioka, Yuichiro; Miranda, Greyving Jose Arguello; Gusman, Aditya Riadi; Fujii, Yushiro

    2017-08-01

    Large earthquakes, such as the Mw 7.7 1992 Nicaragua earthquake, have occurred off the Pacific coasts of El Salvador and Nicaragua in Central America and have generated distractive tsunamis along these coasts. It is necessary to determine appropriate fault models before large tsunamis hit the coast. In this study, first, fault parameters were estimated from the W-phase inversion, and then an appropriate fault model was determined from the fault parameters and scaling relationships with a depth dependent rigidity. The method was tested for four large earthquakes, the 1992 Nicaragua tsunami earthquake (Mw7.7), the 2001 El Salvador earthquake (Mw7.7), the 2004 El Astillero earthquake (Mw7.0), and the 2012 El Salvador-Nicaragua earthquake (Mw7.3), which occurred off El Salvador and Nicaragua in Central America. The tsunami numerical simulations were carried out from the determined fault models. We found that the observed tsunami heights, run-up heights, and inundation areas were reasonably well explained by the computed ones. Therefore, our method for tsunami early warning purpose should work to estimate a fault model which reproduces tsunami heights near the coast of El Salvador and Nicaragua due to large earthquakes in the subduction zone.

  17. Application of the gyroscopic method in subterranean orientation. Comparison with conventional methods. Aplicacion del metodo gyroscopic en la orientacion subterranea. Comparacion con los metodos convencionales

    Energy Technology Data Exchange (ETDEWEB)

    Saez Garcia, E.; Fuente Martin, P.L. (HUNOSA, Madrid (Spain))

    1988-01-01

    This entry tries to revise the most used method for the direction transition what with exterior and interior using plumbs in connected with vertical shaft coalmines. A technical and economic cooperation was also realized between the indicated method and the gyroscope.

  18. Innovative Methods for Estimating Densities and Detection Probabilities of Secretive Reptiles Including Invasive Constrictors and Rare Upland Snakes

    Science.gov (United States)

    2018-01-30

    home range  maintenance  or attraction to or avoidance of  landscape features, including  roads  (Morales et al. 2004, McClintock et al. 2012). For example...radiotelemetry and extensive road survey data are used to generate the first density estimates available for the species. The results show that southern...secretive snakes that combines behavioral observations of snake road crossing speed, systematic road survey data, and simulations of spatial

  19. Staphylococcus aureus strains associated with food poisoning outbreaks in France: comparison of different molecular typing methods, including MLVA

    Science.gov (United States)

    Roussel, Sophie; Felix, Benjamin; Vingadassalon, Noémie; Grout, Joël; Hennekinne, Jacques-Antoine; Guillier, Laurent; Brisabois, Anne; Auvray, Fréderic

    2015-01-01

    Staphylococcal food poisoning outbreaks (SFPOs) are frequently reported in France. However, most of them remain unconfirmed, highlighting a need for a better characterization of isolated strains. Here we analyzed the genetic diversity of 112 Staphylococcus aureus strains isolated from 76 distinct SFPOs that occurred in France over the last 30 years. We used a recently developed multiple-locus variable-number tandem-repeat analysis (MLVA) protocol and compared this method with pulsed field gel electrophoresis (PFGE), spa-typing and carriage of genes (se genes) coding for 11 staphylococcal enterotoxins (i.e., SEA, SEB, SEC, SED, SEE, SEG, SEH, SEI, SEJ, SEP, SER). The strains known to have an epidemiological association with one another had identical MLVA types, PFGE profiles, spa-types or se gene carriage. MLVA, PFGE and spa-typing divided 103 epidemiologically unrelated strains into 84, 80, and 50 types respectively demonstrating the high genetic diversity of S. aureus strains involved in SFPOs. Each MLVA type shared by more than one strain corresponded to a single spa-type except for one MLVA type represented by four strains that showed two different-but closely related-spa-types. The 87 enterotoxigenic strains were distributed across 68 distinct MLVA types that correlated all with se gene carriage except for four MLVA types. The most frequent se gene detected was sea, followed by seg and sei and the most frequently associated se genes were sea-seh and sea-sed-sej-ser. The discriminatory ability of MLVA was similar to that of PFGE and higher than that of spa-typing. This MLVA protocol was found to be compatible with high throughput analysis, and was also faster and less labor-intensive than PFGE. MLVA holds promise as a suitable method for investigating SFPOs and tracking the source of contamination in food processing facilities in real time. PMID:26441849

  20. The effect of different conventional methods of extraction on Marantodes pumila var. pumila leaves in relation to free radical scavenging activity

    Science.gov (United States)

    Hamid, Noor Huda Abd; Latip, Jalifah; Markom, Masturah

    2018-04-01

    Marantodes pumila is one of the important herbs used in traditional medicine. However, there is no report on the optimum method for the preparation of M. pumila extract enriched with bioactive compounds. Therefore, this study aim to establish the suitable method in the preparation of M. pumila extracts enriched with antioxidative compounds. Different conventional extraction methods such as maceration, reflux and Soxhlet in solvents of different polarities i.e. ethanol, 50 % aqueous ethanol and water were employed to prepare extracts. Constituents of each extract were profiled using RP-HPLC followed by the free radical scavenging assay using 2,2 diphenyl-1-picrylhydrazyl (DPPH) to determine the antioxidant activity. Among all extraction methods, maceration in 50 % aqueous ethanol gave the highest total percentage yield (22.41 %) while all extraction methods were able to extract the marker compounds, gallic acid (GA) and methyl gallate (MGA). The free radical scavenging activity of extracts varied from IC50 11.93 µg/mL (50 % aqueous ethanol via reflux) to 64.15 µg/mL (water via maceration). All extracts showed better scavenging activity as compared to synthetic antioxidant, BHT. The variation in the IC50 values is expected due to the presence of different types and/or concentration of bioactive compounds in each extract. This study may provide a preliminary insight for the preparation of standardized extracts of M. pumila enriched with bioactive compounds.

  1. Use of spectrophotometric readout method for free radical dosimetry in radiation processing including low energy electrons and bremsstrahlung

    International Nuclear Information System (INIS)

    Gupta, B.L.

    2000-01-01

    Our laboratory maintains standards for high doses in India. The glutamine powder dosimeter (spectrophotometric readout) is used for this purpose. Present studies show that 20 mg of unirradiated/irradiated glutamine dissolved in freshly prepared 10 ml of aerated aqueous acidic FX solution containing 2 x 10 -3 mol dm -3 ferrous ammonium sulphate and 10 -4 mol dm -3 xylenol orange in 0.033 mol dm -3 sulphuric acid is suitable for the dosimetry in the dose range of 0.1-100 kGy. Normally no corrections are required for the post-irradiation fading of the irradiated glutamine. The response of glutamine dosimeter is independent of irradiation temperature in the range of about 23-30 deg. C and at other temperatures, a correction is necessary. The dose intercomparison results for photon, electron and bremsstrahlung radiations show that glutamine can be used as a reference standard dosimeter. The use of flat polyethylene bags containing glutamine powder has proved very successful for electron dosimetry of wide energies. Several other amino acids like alanine, valine and threonine can also be used to cover wide range of doses using spectrophotometric readout method. (author)

  2. Analysis of alternative transportation methods for radioactive materials shipments including the use of special trains for spent fuel and wastes

    International Nuclear Information System (INIS)

    Smith, D.R.; Luna, R.E.; Taylor, J.M.

    1978-01-01

    Two studies were completed which evaluate the environmental impact of radioactive material transport. The first was a generic study which evaluated all radioactive materials and all transportation modes; the second addressed spent fuel and fuel-cycle wastes shipped by truck, rail and barge. A portion of each of those studies dealing with the change in impact resulting from alternative shipping methods is presented in this paper. Alternatives evaluated in each study were mode shifts, operational constraints, and, in generic case, changes in material properties and package capabilities. Data for the analyses were obtained from a shipper survey and from projections of shipments that would occur in an equilibrium fuel cycle supporting one hundred 1000-MW(e) reactors. Population exposures were deduced from point source radiation formulae using separation distances derived for scenarios appropriate to each shipping mode and to each exposed population group. Fourteen alternatives were investigated for the generic impact case. All showed relatively minor changes in the overall radiological impact. Since the radioactive material transport is estimated to be fewer than 3 latent cancer fatalities (LCF) for each shipment year (compared to some 300,000 yearly cancer fatalities or 5000 LCF's calculated for background radiation using the same radiological effects model), a 15% decrease caused by shifting from passenger air to cargo air is a relatively small effect. Eleven alternatives were considered for the fuel cycle/special train study, but only one produced a reduction in total special train baseline LCF's (.047) that was larger than 5%

  3. State Token Petri Net modeling method for formal verification of computerized procedure including operator's interruptions of procedure execution flow

    International Nuclear Information System (INIS)

    Kim, Yun Goo; Seong, Poong Hyun

    2012-01-01

    The Computerized Procedure System (CPS) is one of the primary operating support systems in the digital Main Control Room. The CPS displays procedure on the computer screen in the form of a flow chart, and displays plant operating information along with procedure instructions. It also supports operator decision making by providing a system decision. A procedure flow should be correct and reliable, as an error would lead to operator misjudgement and inadequate control. In this paper we present a modeling for the CPS that enables formal verification based on Petri nets. The proposed State Token Petri Nets (STPN) also support modeling of a procedure flow that has various interruptions by the operator, according to the plant condition. STPN modeling is compared with Coloured Petri net when they are applied to Emergency Operating Computerized Procedure. A converting program for Computerized Procedure (CP) to STPN has been also developed. The formal verification and validation methods of CP with STPN increase the safety of a nuclear power plant and provide digital quality assurance means that are needed when the role and function of the CPS is increasing.

  4. Age correction in monitoring audiometry: method to update OSHA age-correction tables to include older workers.

    Science.gov (United States)

    Dobie, Robert A; Wojcik, Nancy C

    2015-07-13

    The US Occupational Safety and Health Administration (OSHA) Noise Standard provides the option for employers to apply age corrections to employee audiograms to consider the contribution of ageing when determining whether a standard threshold shift has occurred. Current OSHA age-correction tables are based on 40-year-old data, with small samples and an upper age limit of 60 years. By comparison, recent data (1999-2006) show that hearing thresholds in the US population have improved. Because hearing thresholds have improved, and because older people are increasingly represented in noisy occupations, the OSHA tables no longer represent the current US workforce. This paper presents 2 options for updating the age-correction tables and extending values to age 75 years using recent population-based hearing survey data from the US National Health and Nutrition Examination Survey (NHANES). Both options provide scientifically derived age-correction values that can be easily adopted by OSHA to expand their regulatory guidance to include older workers. Regression analysis was used to derive new age-correction values using audiometric data from the 1999-2006 US NHANES. Using the NHANES median, better-ear thresholds fit to simple polynomial equations, new age-correction values were generated for both men and women for ages 20-75 years. The new age-correction values are presented as 2 options. The preferred option is to replace the current OSHA tables with the values derived from the NHANES median better-ear thresholds for ages 20-75 years. The alternative option is to retain the current OSHA age-correction values up to age 60 years and use the NHANES-based values for ages 61-75 years. Recent NHANES data offer a simple solution to the need for updated, population-based, age-correction tables for OSHA. The options presented here provide scientifically valid and relevant age-correction values which can be easily adopted by OSHA to expand their regulatory guidance to

  5. Comparison of oxygen saturation levels in patients receiving Technegas by the conventional unassisted method vs. the positive ventilation delivery system (PVDS)

    International Nuclear Information System (INIS)

    Dobson, M.P.; Leiper, C.A.; Lee, K.; Dixson, H.

    2000-01-01

    Full text: The purpose of this study is to compare oxygen saturation levels (SaO 2 ) in 289 patients undergoing conventional lung ventilation scintigraphy (control group) and 27 patients undergoing Positive Ventilation Delivery System (PVDS). The 27 patients where selected as their conventional method of inhalation proved to be inadequate or non-diagnostic. The patients underwent a second ventilation using PVDS, which improved the diagnostic quality of the ventilation image and assisted in clinical management decisions. Some patients in both the PVDS and the control group experienced a transient lowering in their SaO 2 . The mean initial SaO 2 in the control group did not fall below 94.9% and in the PVDS group measured 90.6%. 93% (25/27) of patients in the PVDS group were assessed as non CO 2 retaining, and received oxygen at 10L/min during Technegas inhalation. The mean trough saturation in the PVDS group was 91.7% which was significantly higher than that of the control group (86.9%). No patient in either group experienced any significant complication attributed to the transient tall in SaO 2 during technegas administration. We conclude that oxygen supplied as part of the PVDS system ameliorates the transient reduction in SaO 2 seen during standard Technegas administration. Copyright (2000) The Australian and New Zealand Society of Nuclear Medicine Inc

  6. Optimal Control as a method for Diesel engine efficiency assessment including pressure and NO_x constraints

    International Nuclear Information System (INIS)

    Guardiola, Carlos; Climent, Héctor; Pla, Benjamín; Reig, Alberto

    2017-01-01

    Highlights: • Optimal Control is applied for heat release shaping in internal combustion engines. • Optimal Control allows to assess the engine performance with a realistic reference. • The proposed method gives a target heat release law to define control strategies. - Abstract: The present paper studies the optimal heat release law in a Diesel engine to maximise the indicated efficiency subject to different constraints, namely: maximum cylinder pressure, maximum cylinder pressure derivative, and NO_x emission restrictions. With this objective, a simple but also representative model of the combustion process has been implemented. The model consists of a 0D energy balance model aimed to provide the pressure and temperature evolutions in the high pressure loop of the engine thermodynamic cycle from the gas conditions at the intake valve closing and the heat release law. The gas pressure and temperature evolutions allow to compute the engine efficiency and NO_x emissions. The comparison between model and experimental results shows that despite the model simplicity, it is able to reproduce the engine efficiency and NO_x emissions. After the model identification and validation, the optimal control problem is posed and solved by means of Dynamic Programming (DP). Also, if only pressure constraints are considered, the paper proposes a solution that reduces the computation cost of the DP strategy in two orders of magnitude for the case being analysed. The solution provides a target heat release law to define injection strategies but also a more realistic maximum efficiency boundary than the ideal thermodynamic cycles usually employed to estimate the maximum engine efficiency.

  7. Study of the magnetic microstructure of high-coercivity sintered SmCo5 permanent magnets with the conventional Bitter pattern technique and the colloid-SEM method

    International Nuclear Information System (INIS)

    Szmaja, Witold

    2007-01-01

    The magnetic microstructure of high-coercivity sintered SmCo 5 permanent magnets was studied with the conventional Bitter pattern technique, and also for the first time with the colloid-scanning electron microscopy (colloid-SEM) method. Both techniques were supported by digital image acquisition, enhancement and analysis. Thanks to this, it was possible to obtain high-contrast and clear images of the magnetic microstructure and to analyze them in detail, and consequently also to achieve improvements over earlier results. In the thermally demagnetized state the grains were composed of magnetic domains. On the surface perpendicular to the alignment axis, the main domains forming a maze pattern and surface reverse spikes were observed. Investigations on the surface parallel to the alignment axis, especially by the colloid-SEM technique, provided a detailed insight into the orientation of grains. The alignment of grains was good, but certainly not perfect; there were also strongly misaligned grains, although generally very rare. In most cases the domain structures within grains were independent of their neighbors, but in some cases (not so rare) the domain walls were observed to continue through the grain boundaries, indicating significant magnetostatic interaction between neighboring grains. Studies of the behavior of the magnetic microstructure under the influence of an external magnetic field, performed for the first time on the surface parallel to the alignment axis (with the conventional Bitter pattern method), showed that the domain walls move easily within the grains and that the magnetization reversal mechanism is mainly related to the nucleation and growth of reverse domains, i.e. that sintered SmCo 5 magnets are nucleation-dominated systems. Groupwise magnetization reversal of adjacent magnetically coupled grains was observed, an unfavorable effect for high-coercivity magnets. Images obtained by the colloid-SEM technique and the conventional Bitter pattern

  8. Conventional method for the calculation of the global energy cost of buildings; Methode conventionnelle de calcul du cout global energetique des batiments

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-05-01

    A working group driven by Electricite de France (EdF), Chauffage Fioul and Gaz de France (GdF) companies has been built with the sustain of several building engineering companies in order to clarify the use of the method of calculation of the global energy cost of buildings. This global cost is an economical decision help criterion among others. This press kit presents, first, the content of the method (input data, calculation of annual expenses, calculation of the global energy cost, display of results and limitations of the method). Then it fully describes the method and its appendixes necessary for its implementation: economical and financial context, general data of the project in progress, environmental data, occupation and comfort level, variants, investment cost of energy systems, investment cost for the structure linked with the energy system, investment cost for other invariant elements of the structure, calculation of consumptions (space heating, hot water, ventilation), maintenance costs (energy systems, structure), operation and exploitation costs, tariffs and consumption costs and taxes, actualized global cost, annualized global cost, comparison between variants. The method is applied to a council building of 23 flats taken as an example. (J.S.)

  9. Multiscale approach including microfibril scale to assess elastic constants of cortical bone based on neural network computation and homogenization method.

    Science.gov (United States)

    Barkaoui, Abdelwahed; Chamekh, Abdessalem; Merzouki, Tarek; Hambli, Ridha; Mkaddem, Ali

    2014-03-01

    The complexity and heterogeneity of bone tissue require a multiscale modeling to understand its mechanical behavior and its remodeling mechanisms. In this paper, a novel multiscale hierarchical approach including microfibril scale based on hybrid neural network (NN) computation and homogenization equations was developed to link nanoscopic and macroscopic scales to estimate the elastic properties of human cortical bone. The multiscale model is divided into three main phases: (i) in step 0, the elastic constants of collagen-water and mineral-water composites are calculated by averaging the upper and lower Hill bounds; (ii) in step 1, the elastic properties of the collagen microfibril are computed using a trained NN simulation. Finite element calculation is performed at nanoscopic levels to provide a database to train an in-house NN program; and (iii) in steps 2-10 from fibril to continuum cortical bone tissue, homogenization equations are used to perform the computation at the higher scales. The NN outputs (elastic properties of the microfibril) are used as inputs for the homogenization computation to determine the properties of mineralized collagen fibril. The mechanical and geometrical properties of bone constituents (mineral, collagen, and cross-links) as well as the porosity were taken in consideration. This paper aims to predict analytically the effective elastic constants of cortical bone by modeling its elastic response at these different scales, ranging from the nanostructural to mesostructural levels. Our findings of the lowest scale's output were well integrated with the other higher levels and serve as inputs for the next higher scale modeling. Good agreement was obtained between our predicted results and literature data. Copyright © 2013 John Wiley & Sons, Ltd.

  10. Method and apparatus for enhanced sensitivity filmless medical x-ray imaging, including three-dimensional imaging

    Science.gov (United States)

    Parker, Sherwood

    1995-01-01

    A filmless X-ray imaging system includes at least one X-ray source, upper and lower collimators, and a solid-state detector array, and can provide three-dimensional imaging capability. The X-ray source plane is distance z.sub.1 above upper collimator plane, distance z.sub.2 above the lower collimator plane, and distance z.sub.3 above the plane of the detector array. The object to be X-rayed is located between the upper and lower collimator planes. The upper and lower collimators and the detector array are moved horizontally with scanning velocities v.sub.1, v.sub.2, v.sub.3 proportional to z.sub.1, z.sub.2 and z.sub.3, respectively. The pattern and size of openings in the collimators, and between detector positions is proportional such that similar triangles are always defined relative to the location of the X-ray source. X-rays that pass through openings in the upper collimator will always pass through corresponding and similar openings in the lower collimator, and thence to a corresponding detector in the underlying detector array. Substantially 100% of the X-rays irradiating the object (and neither absorbed nor scattered) pass through the lower collimator openings and are detected, which promotes enhanced sensitivity. A computer system coordinates repositioning of the collimators and detector array, and X-ray source locations. The computer system can store detector array output, and can associate a known X-ray source location with detector array output data, to provide three-dimensional imaging. Detector output may be viewed instantly, stored digitally, and/or transmitted electronically for image viewing at a remote site.

  11. Ascertaining year of birth/age at death in forensic cases: A review of conventional methods and methods allowing for absolute chronology

    DEFF Research Database (Denmark)

    Lynnerup, Niels; Kjeldsen, H; Zweihoff, R

    2010-01-01

    Based on an actual case, where we were able to ascertain the year of birth of three dead babies found in a deep-freezer to within 1–2 years (1986, 1988 and 2004, respectively), we review the current state of forensic age determination/year of birth determination. The age of an individual (year...... of birth) is often a fundamental piece of data in connection with forensic identification of unidentified bodies. The methods most often used are based on determining various morphological, age-related, changes on the skeleton (or teeth, although odontological methods are not reviewed in this paper...

  12. 'Augmented reality' in conventional simulation by projection of 3-D structures into 2-D images. A comparison with virtual methods

    Energy Technology Data Exchange (ETDEWEB)

    Deutschmann, H.; Nairz, O.; Zehentmayr, F.; Fastner, G.; Sedlmayer, F. [Univ. Clinic for Radiotherapy and Radio-Oncology, Salzburg (Austria); radART - Inst. for research and development on Advanced Radiation Technologies at the Paracelsus Medical Univ., Salzburg (Austria); Steininger, P. [radART - Inst. for research and development on Advanced Radiation Technologies at the Paracelsus Medical Univ., Salzburg (Austria); Dept. of Medical Computer Science and Technology, Univ. for Health Sciences, Hall i. T. (Austria); Kopp, P.; Merz, F.; Wurstbauer, K.; Kranzinger, M.; Kametriser, G.; Kopp, M. [Univ. Clinic for Radiotherapy and Radio-Oncology, Salzburg (Austria)

    2008-02-15

    Background and purpose: in this study, a new method is introduced, which allows the overlay of three-dimensional structures, that have been delineated on transverse slices, onto the fluoroscopy from conventional simulators in real time. Patients and methods: setup deviations between volumetric imaging and simulation were visualized, measured and corrected for 701 patient isocenters. Results: comparing the accuracy to mere virtual simulation lacking additional X-ray imaging, a clear benefit of the new method could be shown. On average, virtual prostate simulations had to be corrected by 0.48 cm (standard deviation [SD] 0.38), and those of the breast by 0.67 cm (SD 0.66). Conclusion: the presented method provides an easy way to determine entity-specific safety margins related to patient setup errors upon registration of bony anatomy (prostate 0.9 cm for 90% of cases, breast 1.3 cm). The important role of planar X-ray imaging was clearly demonstrated. The innovation can also be applied to adaptive image-guided radiotherapy (IGRT) protocols. (orig.)

  13. Storage stability study for margarines produced by enzymatically interesterified fats compared to the margarines by the conventional methods I. Physical properties

    DEFF Research Database (Denmark)

    Zhang, Hong; Jacobsen, Charlotte; Adler-Nissen, Jens

    2005-01-01

    was more similar to that of the physically mixed fat than that of the margarine from the chemically randomized fat, which had less color. Crystal transformation was accelerated at high storage temperature. Crystal size was not only related to the types of crystals, but also to the driving force......In this study, margarine hardstocks were produced from two enzymatically interesterified fats at conversion degrees of 80 and 100%, a chemically randomized fat and a physically mixed fat, respectively. These four hardstocks blended with 50% of sunflower oil were mainly used for the production...... of table margarines in a pilot plant. Storage stability studies were carried out at storage temperatures of 5 and 25 7C during 12 wk. Margarines from the enzymatically interesterified fats were compared to the margarines produced by conventional methods and to selected commercial products. The changes...

  14. Influence of abutment tooth geometry on the accuracy of conventional and digital methods of obtaining dental impressions.

    Science.gov (United States)

    Carbajal Mejía, Jeison B; Wakabayashi, Kazumichi; Nakamura, Takashi; Yatani, Hirofumi

    2017-09-01

    Direct (intraoral) and indirect (desktop) digital scanning can record abutment tooth preparations despite their geometry. However, little peer-reviewed information is available regarding the influence of abutment tooth geometry on the accuracy of digital methods of obtaining dental impressions. The purpose of this in vitro study was to evaluate the influence of abutment tooth geometry on the accuracy of conventional and digital methods of obtaining dental impressions in terms of trueness and precision. Crown preparations with known total occlusal convergence (TOC) angles (-8, -6, -4, 0, 4, 8, 12, 16, and 22 degrees) were digitally created from a maxillary left central incisor and printed in acrylic resin. Each of these 9 reference models was scanned with a highly accurate reference scanner and saved in standard tessellation language (STL) format. Then, 5 conventional polyvinyl siloxane (PVS) impressions were made from each reference model, which was poured with Type IV dental stone scanned using both the reference scanner (group PVS) and the desktop scanner and exported as STL files. Additionally, direct digital impressions (intraoral group) of the reference models were made, and the STL files were exported. The STL files from the impressions obtained were compared with the original geometry of the reference model (trueness) and within each test group (precision). Data were analyzed using 2-way ANOVA with the post hoc least significant difference test (α=.05). Overall trueness values were 19.1 μm (intraoral scanner group), 23.5 μm (desktop group), and 26.2 μm (PVS group), whereas overall precision values were 11.9 μm (intraoral), 18.0 μm (PVS), and 20.7 μm (desktop). Simple main effects analysis showed that impressions made with the intraoral scanner were significantly more accurate than those of the PVS and desktop groups when the TOC angle was less than 8 degrees (Pimpression and the TOC angle on the precision of single-tooth dental impressions (F=2

  15. Development of next generation code system as an engineering modeling language (5). Investigation on restructuring method of conventional codes into two-layer system

    International Nuclear Information System (INIS)

    Yokoyama, Kenji

    2006-10-01

    A proposed method for gradually restructuring to the two-level system of next generation analysis system by reusing the conventional analysis system, called 'incremental method', was applied and evaluated. The following functions were selected for the evaluation: Neutron diffusion calculation for the three-dimensional XYZ system based on finite differential method, and input utilities of the cross-section data file used in the conventional system. In order to evaluate the effect of the restructuring, 'Module Coupling Index (MCI)' and 'McCabe's Cyclomatic Complexity (MCC)' were used for quantifying the quality of the modular design and the complexity of the program sequence of each module. Although MCIs of each module before restructuring were mainly 6 - 7 degrees, it was possible to reduce them to under 4 degrees in most module by restructuring with the incremental method. And, it is found that the modules under 4 degrees of MCI can be easily combined with different programming languages, which are necessary for building the two-layer system. In the meantime, MCCs in most module before restructuring were over 20 and some were over 50. The incremental method could reduce them to under 10 when C++ was used, and reduce them to under 20 when FORTRAN was used. It is correspondent to reduction of the error frequency occurred in its modification from 20 - 40% to 5 - 10%. The total number of MCC could be reduced to 1/3 when C++ was used, and to 1/2 when FORTRAN was used. By using the restructured functions in the present study and some previously developed functions, a reactor analysis tool was systematized and applied to criticality analysis of the Experimental Fast Reactor 'JOYO' MR-I. In addition, the following two functionality expansion tests were performed: To add cross section direct perturbation functionality, and to add control rod criticality position search functionality. In the tests, both the functionality expansions were carried out satisfying the condition

  16. Game-based e-learning is more effective than a conventional instructional method: a randomized controlled trial with third-year medical students.

    Directory of Open Access Journals (Sweden)

    Martin Boeker

    Full Text Available BACKGROUND: When compared with more traditional instructional methods, Game-based e-learning (GbEl promises a higher motivation of learners by presenting contents in an interactive, rule-based and competitive way. Most recent systematic reviews and meta-analysis of studies on Game-based learning and GbEl in the medical professions have shown limited effects of these instructional methods. OBJECTIVES: To compare the effectiveness on the learning outcome of a Game-based e-learning (GbEl instruction with a conventional script-based instruction in the teaching of phase contrast microscopy urinalysis under routine training conditions of undergraduate medical students. METHODS: A randomized controlled trial was conducted with 145 medical students in their third year of training in the Department of Urology at the University Medical Center Freiburg, Germany. 82 subjects where allocated for training with an educational adventure-game (GbEl group and 69 subjects for conventional training with a written script-based approach (script group. Learning outcome was measured with a 34 item single choice test. Students' attitudes were collected by a questionnaire regarding fun with the training, motivation to continue the training and self-assessment of acquired knowledge. RESULTS: The students in the GbEl group achieved significantly better results in the cognitive knowledge test than the students in the script group: the mean score was 28.6 for the GbEl group and 26.0 for the script group of a total of 34.0 points with a Cohen's d effect size of 0.71 (ITT analysis. Attitudes towards the recent learning experience were significantly more positive with GbEl. Students reported to have more fun while learning with the game when compared to the script-based approach. CONCLUSIONS: Game-based e-learning is more effective than a script-based approach for the training of urinalysis in regard to cognitive learning outcome and has a high positive motivational impact on

  17. Comparison of the method of diffusive gels in thin films with conventional extraction techniques for evaluating zinc accumulation in plants and isopods

    Energy Technology Data Exchange (ETDEWEB)

    Koster, Marijke [National Institute of Public Health and the Environment, Laboratory for Ecological Risk Assessment, P.O. Box 1, 3720 BA Bilthoven (Netherlands); Open University Netherlands, Heerlen (Netherlands); Reijnders, Lucas [Open University Netherlands, Heerlen (Netherlands); Oost, Nathalie R. van [National Institute of Public Health and the Environment, Laboratory for Ecological Risk Assessment, P.O. Box 1, 3720 BA Bilthoven (Netherlands); Peijnenburg, Willie J.G.M. [National Institute of Public Health and the Environment, Laboratory for Ecological Risk Assessment, P.O. Box 1, 3720 BA Bilthoven (Netherlands)]. E-mail: wjgm.peijnenburg@rivm.nl

    2005-01-01

    The measurement of diffusive gels in thin films (DGT) has recently been developed to assess metal bioavailability in soils. The DGT-method is based on diffusion in a porous matrix. To test the predictive capabilities of the method with regard to metal bioavailability, a study was set up with 28 soils having a variety of textures and amounts of zinc salts added. Correlation and regression analyses were performed to compare DGT-extracted zinc levels to zinc concentrations obtained by extraction with 0.01 M CaCl{sub 2} and 0.43 M HNO{sub 3}, digestion with aqua regia and the zinc concentration in pore water. The amount of zinc extracted with CaCl{sub 2} correlated well with DGT-extracted zinc levels in all soils spiked with different amounts of ZnCl{sub 2}. A similar correlation was not found for zinc concentrations in soil samples collected in the field. Experiments were performed to compare zinc content in organisms and in soils. The organisms tested were plants (grass, lettuce and lupine) and the hard bodied soil dwelling isopod Oniscus asellus. Good correlations were found between zinc accumulation in grass and lettuce and the C{sub E} (effective concentration) measured by a DGT-device, CaCl{sub 2} extracted zinc and the zinc content in the pore water of all soils. The correlation with C{sub E} was not significant for lupine, neither for spiked soils, nor for field soils (p {<=} 0.001). Zinc levels in the isopods were not significantly related to any set of zinc measurements. From a synthesis of all results obtained it is concluded that the DGT-methodology does not have an additional value in predicting bioavailability of zinc in terrestrial ecosystems as compared to conventional extraction methods. - Capsule: The newly developed method of diffusive gels in Thin films (DGT) does not have an added value over conventional extraction techniques in predicting zinc uptake by plants and isopods.

  18. The effect of restricted milk feeding through conventional or step-down methods with or without forage provision in starter feed on performance of Holstein bull calves.

    Science.gov (United States)

    Daneshvar, D; Khorvash, M; Ghasemi, E; Mahdavi, A H; Moshiri, B; Mirzaei, M; Pezeshki, A; Ghaffari, M H

    2015-08-01

    The objective of the current study was to examine whether step-down (STP) milk feeding method together with forage provision would improve performance, rumen fermentation, nutrient digestibility, blood metabolites, and structural growth of calves. Holstein bull calves ( = 40) were randomly assigned to 1 of 4 treatments in a completely randomized design with a 2 × 2 factorial arrangement. Treatments were 1) conventional (COV) milk feeding without forage provision (COV-NF), 2) COV milk feeding with forage provision, 3) STP milk feeding without forage provision, and 4) STP milk feeding with forage provision. Calves in the COV method ( = 20) received 5.5 L/d milk until d 56 of age followed by 2 L/d milk from d 56 to 59 of age. Calves in the STP method ( = 20) received 7 L/d milk until d 35, 4 L/d milk from d 35 to 48, and 2 L/d milk from d 50 to 59 of age. All the calves received the starter ration from d 3 of the study until d 74 of age. Forage-supplemented calves ( = 10/milk feeding method) received 15% alfalfa hay mixed with finely ground starter as a total mixed ration. All calves were weaned on d 60 of age and remained in the study until d 74. Regardless of the milk feeding method, the final BW (92.54 vs. 83.14 kg/d), starter intake (0.90 vs. 0.65 kg/d), total DMI (1.43 vs. 1.17 kg/d), and ADG (0.73 vs. 0.60 kg/d) were greater ( calves than those that received no forage during the preweaning, postweaning, and overall periods. Milk feeding method had no effect on ruminal pH, total VFA, acetate, or acetate:propionate ratio as well as body measurements. Ruminal pH and the molar proportions of acetate were greater ( calves than those that received no forage during the pre- and postweaning periods. Regardless of forage provision, STP methods increased ( feeding methods and forage provision with respect to BW, DMI, G:F, apparent nutrient digestibility (DM, OM, and CP), and body measurements. The interaction of milk feeding method and forage provision was significant

  19. Effect of irradiation and storage post-irradiation of black pepper (Piper nigrum L.) on counts of microorganisms hygienic indicator using methods of conventional analysis and PETRIFILMTM plates

    International Nuclear Information System (INIS)

    Jaimes, Marcial Ibo Silva

    1988-01-01

    Fifteen samples of ground black pepper (Piper nigrum L.) purchased in Sao Paulo local stores, were submitted to irradiation in doses of 3, 6 and 10 kGy. All irradiated samples, including non-irradiated controls, were submitted to counts of yeasts and molds, aerobes (APC), coliforms and mesophilic aerobic spore formers (MASC), using conventional plate count methods and PETRIFILM TM plates. For yeasts and molds count, acidified potato dextrose agar (PDA) an PETRIFILM TM PFYM plates were used. For aerobes, plate count agar (PCA) and PETRIFILM TM PFAC plates were used. Violet red bile agar (VRBA) and PETRIFILM TM PFEC plates were employed for enumeration of coliforms. Counts of these groups of microorganisms obtained through the traditional plating procedures did not differ significantly from those using the corresponding PETRIFILM TM plates. In samples submitted to irradiation, a dose of 10 kGy caused a decrease of the yeasts and molds count from 10 4 -10 5 to less than 10 cfu/g. The same dose caused a decrease of the aerobic counts from 10 7 -10 8 to 10 2 -10 3 cfu/g, of coliforms from 10 4 -10 5 to less than 10 cfu/g and MASC from 10 6 -10 7 cfu/g to 10-10 2 cfu/g. The introduction of a injury repair step in the counting procedure resulted in a 32 to 89% increase in the number of coliforms. However, this additional step did not improve significantly the counts of MASC. After 270 days of storage of samples irradiated with 3 kGy, a decrease in the yeasts and molds population from 10 3 to 20 cfu/g was observed. The APC population in these samples was reduced from 5,0x10 6 to 2,4x10 4 cfu/g; in those irradiated with 6 kGy the reduction was from 4,0x10 4 to 5,0x10 3 cfu/g and in those irradiated with 10 kGy the counts were reduced from 30 to less than 10 cfu/g. After the same time of storage, the coliform population in non irradiated samples decreased from 2,8x10 5 to 1,5x10 4 cfu/g and from 9,1x10 3 to 20 cfu/g in those irradiated with 3 kGy. Similarly, the MASC

  20. Quantification of incisal tooth wear in upper anterior teeth: conventional vs new method using toolmakers microscope and a three-dimensional measuring technique.

    Science.gov (United States)

    Al-Omiri, Mahmoud K; Sghaireen, Mohd G; Alzarea, Bader K; Lynch, Edward

    2013-12-01

    This study aimed to quantify tooth wear in upper anterior teeth using a new CAD-CAM Laser scanning machine, tool maker microscope and conventional tooth wear index. Fifty participants (25 males and 25 females, mean age = 25 ± 4 years) were assessed for incisal tooth wear of upper anterior teeth using Smith and Knight clinical tooth wear index (TWI) on two occasions, the study baseline and 1 year later. Stone dies for each tooth were prepared and scanned using the CAD-CAM Laser Cercon System. Scanned images were printed and examined under a toolmaker microscope to quantify tooth wear and then the dies were directly assessed under the microscope to measure tooth wear. The Wilcoxon Signed Ranks Test was used to analyze the data. TWI scores for incisal edges were 0-3 and were similar at both occasions. Score 4 was not detected. Wear values measured by directly assessing the dies under the toolmaker microscope (range = 113 - 150 μm, mean = 130 ± 20 μm) were significantly more than those measured from Cercon Digital Machine images (range=52-80 μm, mean = 68 ± 23 μm) and both showed significant differences between the two occasions. Wear progression in upper anterior teeth was effectively detected by directly measuring the dies or the images of dies under toolmaker microscope. Measuring the dies of worn dentition directly under tool maker microscope enabled detection of wear progression more accurately than measuring die images obtained with Cercon Digital Machine. Conventional method was the least sensitive for tooth wear quantification and was unable to identify wear progression in most cases. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Game-based e-learning is more effective than a conventional instructional method: a randomized controlled trial with third-year medical students.

    Science.gov (United States)

    Boeker, Martin; Andel, Peter; Vach, Werner; Frankenschmidt, Alexander

    2013-01-01

    When compared with more traditional instructional methods, Game-based e-learning (GbEl) promises a higher motivation of learners by presenting contents in an interactive, rule-based and competitive way. Most recent systematic reviews and meta-analysis of studies on Game-based learning and GbEl in the medical professions have shown limited effects of these instructional methods. To compare the effectiveness on the learning outcome of a Game-based e-learning (GbEl) instruction with a conventional script-based instruction in the teaching of phase contrast microscopy urinalysis under routine training conditions of undergraduate medical students. A randomized controlled trial was conducted with 145 medical students in their third year of training in the Department of Urology at the University Medical Center Freiburg, Germany. 82 subjects where allocated for training with an educational adventure-game (GbEl group) and 69 subjects for conventional training with a written script-based approach (script group). Learning outcome was measured with a 34 item single choice test. Students' attitudes were collected by a questionnaire regarding fun with the training, motivation to continue the training and self-assessment of acquired knowledge. The students in the GbEl group achieved significantly better results in the cognitive knowledge test than the students in the script group: the mean score was 28.6 for the GbEl group and 26.0 for the script group of a total of 34.0 points with a Cohen's d effect size of 0.71 (ITT analysis). Attitudes towards the recent learning experience were significantly more positive with GbEl. Students reported to have more fun while learning with the game when compared to the script-based approach. Game-based e-learning is more effective than a script-based approach for the training of urinalysis in regard to cognitive learning outcome and has a high positive motivational impact on learning. Game-based e-learning can be used as an effective teaching

  2. Some observations concerning blade-element-momentum (BEM) methods and vortex wake methods, including numerical experiments with a simple vortex model

    Energy Technology Data Exchange (ETDEWEB)

    Snel, H. [Netherlands Energy Research Foundation ECN, Renewable Energy, Wind Energy (Netherlands)

    1997-08-01

    Recently the Blade Element Momentum (BEM) method has been made more versatile. Inclusion of rotational effects on time averaged profile coefficients have improved its achievements for performance calculations in stalled flow. Time dependence as a result of turbulent inflow, pitching actions and yawed operation is now treated more correctly (although more improvement is needed) than before. It is of interest to note that adaptations in modelling of unsteady or periodic induction stem from qualitative and quantitative insights obtained from free vortex models. Free vortex methods and further into the future Navier Stokes (NS) calculations, together with wind tunnel and field experiments, can be very useful in enhancing the potential of BEM for aero-elastic response calculations. It must be kept in mind however that extreme caution must be used with free vortex methods, as will be discussed in the following chapters. A discussion of the shortcomings and the strength of BEM and of vortex wake models is given. Some ideas are presented on how BEM might be improved without too much loss of efficiency. (EG)

  3. Determination of Optimal Imaging Mode for Ultrasonographic Detection of Subdermal Contraceptive Rods: Comparison of Spatial Compound, Conventional, and Tissue Harmonic Imaging Methods

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sung Jin; Seo, Kyung; Song, Ho Taek; Park, Ah Young; Kim, Yaena; Yoon, Choon Sik [Gangnam Severance Hospital, Yonsei University College of Medicine, Seoul (Korea, Republic of); Suh, Jin Suck; Kim, Ah Hyun [Dept. of Radiology and Research Institute of Radiological Science, Severance Hospital, Yonsei University College of Medicine, Seoul (Korea, Republic of); Ryu, Jeong Ah [Dept. of Radiology, Guri Hospital, Hanyang University College of Medicine, Guri (Korea, Republic of); Park, Jeong Seon [Dept. of Radiology, Hanyang University Hospital, Hanyang University College of Medicine, Seoul (Korea, Republic of)

    2012-09-15

    To determine which mode of ultrasonography (US), among the conventional, spatial compound, and tissue-harmonic methods, exhibits the best performance for the detection of Implanon with respect to generation of posterior acoustic shadowing (PAS). A total of 21 patients, referred for localization of impalpable Implanon, underwent US, using the three modes with default settings (i.e., wide focal zone). Representative transverse images of the rods, according to each mode for all patients, were obtained. The resulting 63 images were reviewed by four observers. The observers provided a confidence score for the presence of PAS, using a five-point scale ranging from 1 (definitely absent) to 5 (definitely present), with scores of 4 or 5 for PAS being considered as detection. The average scores of PAS, obtained from the three different modes for each observer, were compared using one-way repeated measure ANOVA. The detection rates were compared using a weighted least square method. Statistically, the tissue harmonic mode was significantly superior to the other two modes, when comparing the average scores of PAS for all observers (p < 0.00-1). The detection rate was also highest for the tissue harmonic mode (p < 0.001). Tissue harmonic mode in US appears to be the most suitable in detecting subdermal contraceptive implant rods.

  4. Determination of Optimal Imaging Mode for Ultrasonographic Detection of Subdermal Contraceptive Rods: Comparison of Spatial Compound, Conventional, and Tissue Harmonic Imaging Methods

    International Nuclear Information System (INIS)

    Kim, Sung Jin; Seo, Kyung; Song, Ho Taek; Park, Ah Young; Kim, Yaena; Yoon, Choon Sik; Suh, Jin Suck; Kim, Ah Hyun; Ryu, Jeong Ah; Park, Jeong Seon

    2012-01-01

    To determine which mode of ultrasonography (US), among the conventional, spatial compound, and tissue-harmonic methods, exhibits the best performance for the detection of Implanon with respect to generation of posterior acoustic shadowing (PAS). A total of 21 patients, referred for localization of impalpable Implanon, underwent US, using the three modes with default settings (i.e., wide focal zone). Representative transverse images of the rods, according to each mode for all patients, were obtained. The resulting 63 images were reviewed by four observers. The observers provided a confidence score for the presence of PAS, using a five-point scale ranging from 1 (definitely absent) to 5 (definitely present), with scores of 4 or 5 for PAS being considered as detection. The average scores of PAS, obtained from the three different modes for each observer, were compared using one-way repeated measure ANOVA. The detection rates were compared using a weighted least square method. Statistically, the tissue harmonic mode was significantly superior to the other two modes, when comparing the average scores of PAS for all observers (p < 0.00-1). The detection rate was also highest for the tissue harmonic mode (p < 0.001). Tissue harmonic mode in US appears to be the most suitable in detecting subdermal contraceptive implant rods.

  5. Comparisons between conventional, ultrasound-assisted and microwave-assisted methods for extraction of anthraquinones from Heterophyllaea pustulata Hook f. (Rubiaceae).

    Science.gov (United States)

    Barrera Vázquez, M F; Comini, L R; Martini, R E; Núñez Montoya, S C; Bottini, S; Cabrera, J L

    2014-03-01

    This work reports a comparative study about extraction methods used to obtain anthraquinones (AQs) from stems and leaves of Heterophyllae pustulata Hook (Rubiáceae). One of the conventional procedures used to extract these metabolites from a vegetable matrix is by successive Soxhlet extractions with solvents of increasing polarity: starting with hexane to eliminate chlorophylls and fatty components, following by benzene and finally ethyl acetate. However, this technique shows a low extraction yield of total AQs, and consumes large quantities of solvent and time. Ultrasound-assisted extraction (UAE) and microwave-assisted extraction (MAE) have been investigated as alternative methods to extract these compounds, using the same sequence of solvents. It was found that UAE increases the extraction yield of total AQs and reduces the time and amount of solvent used. Nevertheless, the combination UAE with benzene, plus MAE with ethyl acetate at a constant power of 900 W showed the best results. A higher yield of total AQs was obtained in less time and using the same amount of solvent that UAE. The optimal conditions for this latter procedure were UAE with benzene at 50 °C during 60 min, followed by MAE at 900 W during 15 min using ethyl acetate as extraction solvent. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Comparative analysis of the toxic effects of natural toxins and harmful substances produced by conventional processing methods or by irradiation and of toxicity tests

    International Nuclear Information System (INIS)

    Dahlhelm, H.; Arndt, K.; Groeger, G.; Schreiber, G.A.; Boegl, K.W.

    1994-01-01

    In this review, tasks and methods of food toxicology as well as the application of the different toxicity tests for the risk assessment of food ingredients are described. Particular reference is made to short-term genotoxicity tests. Enzymatic digestion and extraction methods for complex foodstuffs which are used in the toxicological testing of foods in in vitro systems are described. Radiolytic products which result from irradiation of foods or components of foodstuffs and corresponding results of toxicity testing are reviewed. Foodstuffs irradiated with doses of up to 10 kGy are regarded as toxicologically safe. A survey of the toxicologically tested irradiated foodstuffs as well as the applied maximum doses are given in tables at the end of chapter 8. Among the great number of toxicological studies of irradiated foods those are especially mentioned which have given rise to discussions on the health risks involved. In addition, the difficulties associated with the testing of toxicity of irradiated foodstuffs in feeding experiments are discussed. Short-term tests used to establish the benotoxicity of irradiated foods and essential results of toxicological testing are also presented in tables. An overview is given of the occurrence, frequency and health risks of natural toxins in foods and harmful substances produced by conventional methods of cooking and preservation, in order to enable a comparison with the health risks of irradiated foods. The relevance of animal experiments and in vitro investigations for the prediction of toxic effects of harmful substances of foodstuffs in man is discussed in the final chapter. (VHE) [de

  7. A Comparative Study of Two Methods of Instruction in a University Animal Biology Course: Audio-Tutorial with Conventional Lecture-Laboratory.

    Science.gov (United States)

    Rowsey, Robert Ellis

    In this comparative study of instructional methods involving university students, pre- and posttest data were collected from achievement and attitude instruments as well as from opinion questionnaires. The major findings included: (1) students taught via audio-tutorial instruction demonstrated significantly greater achievement gain; (2) the number…

  8. The use of hogdahl convention k0 neutron activation analysis (NAA) standardization method and atomic absortion spectroscopy (ASS) for determination of toxic elements in foodstuffs

    International Nuclear Information System (INIS)

    Ahiamadie, H.

    2008-06-01

    Copper, cadmium, tin, chromium, arsenic, antimony, vanadium and mercury contents were determined in various foodstuffs (Mussa paradisiaca (plantains), Manihot esculentus (cassavas), Vantosoma sagittifolium (cocoyam). Vantosoma sagittifolium leaves (kontomire), Lycopersicum esculentus (tomatoes), Capsicum species (peppers), Solanum melongena (garden eggs), Nbelmoschus esculentus (okro), and Colocasia esculenta (kooko or taro)) produced in the Wassa West District, Ghana. These plants are the basis of human nutrition in the study area. These elements were determined using Hogdahl convention k 0 Instrumental Neutron Activation Analysis (NAA) Standardization Method and Atomic Absorption Spectroscopy (AAS). The elements in the various foodstuffs and their concentration ranges were Cu (16.87-180.06) mg/kg, As (2.68-9.84) µg/g, Cd (0.63-5.64) µg/g, Hg (0.01-67) ng/g, Cr (0.03-3.66) µg/g, Sb (1.1- 18.6) ng/g, Sn (3.4-58.4) ng/g, and V (12-99) ng/g. The study showed that there are high levels of toxic elements in the foodstuffs grown in the mining areas as compared to that of the non-mining area (i.e., control area). This could be attributed to gold mines pollution. Compared to the World Health Organization (WHO) permissible levels of toxic elements in foods, Cu, Cr and Hg were above the permissible levels whereas the concentrations of As, Cd. Sb, Sn and V fall within the permissible levels. (au)

  9. Discerning Silk Produced by Bombyx mori from Those Produced by Wild Species Using an Enzyme-Linked Immunosorbent Assay Combined with Conventional Methods.

    Science.gov (United States)

    You, Qiushi; Li, Qingqing; Zheng, Hailing; Hu, Zhiwen; Zhou, Yang; Wang, Bing

    2017-09-06

    Recently, much interest has been paid to the separation of silk produced by Bombyx mori from silk produced by other species and tracing the beginnings of silk cultivation from wild silk exploitation. In this paper, significant differences between silks from Bombyx mori and other species were found by microscopy and spectroscopy, such as morphology, secondary structure, and amino acid composition. For further accurate identification, a diagnostic antibody was designed by comparing the peptide sequences of silks produced by Bombyx mori and other species. The results of the noncompetitive indirect enzyme-linked immunosorbent assay (ELISA) indicated that the antibody that showed good sensitivity and high specificity can definitely discern silk produced by Bombyx mori from silk produced by wild species. Thus, the antibody-based immunoassay has the potential to be a powerful tool for tracing the beginnings of silk cultivation. In addition, combining the sensitive, specific, and convenient ELISA technology with other conventional methods can provide more in-depth and accurate information for species identification.

  10. A novel treatment modality in patients with premature ejaculation resistant to conventional methods: the neuromodulation of dorsal penile nerves by pulsed radiofrequency.

    Science.gov (United States)

    Basal, Seref; Goktas, Serdar; Ergin, Atilla; Yildirim, Ibrahim; Atim, Abdulkadir; Tahmaz, Lutfi; Dayanc, Murat

    2010-01-01

    Premature ejaculation (PE) is the most common sexual problem experienced by men, and it affects 20%-30% of them. Pulsed radiofrequency (PRF) neuromodulation has been shown to be an effective treatment for a wide range of pain conditions. We used PRF to treat PE by desensitizing dorsal penile nerves in patients resistant to conventional treatments. Fifteen patients with a lifelong history of PE, defined as an intravaginal ejaculatory latency time (IELT) of IELT and sexual satisfaction score (SSS; for patients and their partners) were obtained. The mean IELTs before and 3 weeks after procedure were 18.5 +/- 17.9 and 139.9 +/- 55.1 seconds, respectively. Side effects did not occur. Mean SSSs of patients before and after treatment were 1.3 +/- 0.3 and 4.6 +/- 0.5, and mean SSSs of partners before and after treatment were 1.3 +/- 0.4 and 4.4 +/- 0.5, respectively. In all cases, IELT and SSS were significantly increased (P < .05). None of the patients or their wives reported any treatment failure during the follow-up period. The mean follow-up time was 8.3 +/- 1.9 months. It is early to conclude that this new treatment modality might be used widely for the treatment of PE; however, because it is an innovative modality, placebo-controlled studies (eg, sham procedure), with larger numbers of patients and including assessment of penile sensitivity (eg, biothesiometry), are needed.

  11. Comparison of conventional DCE-MRI and a novel golden-angle radial multicoil compressed sensing method for the evaluation of breast lesion conspicuity.

    Science.gov (United States)

    Heacock, Laura; Gao, Yiming; Heller, Samantha L; Melsaether, Amy N; Babb, James S; Block, Tobias K; Otazo, Ricardo; Kim, Sungheon G; Moy, Linda

    2017-06-01

    To compare a novel multicoil compressed sensing technique with flexible temporal resolution, golden-angle radial sparse parallel (GRASP), to conventional fat-suppressed spoiled three-dimensional (3D) gradient-echo (volumetric interpolated breath-hold examination, VIBE) MRI in evaluating the conspicuity of benign and malignant breast lesions. Between March and August 2015, 121 women (24-84 years; mean, 49.7 years) with 180 biopsy-proven benign and malignant lesions were imaged consecutively at 3.0 Tesla in a dynamic contrast-enhanced (DCE) MRI exam using sagittal T1-weighted fat-suppressed 3D VIBE in this Health Insurance Portability and Accountability Act-compliant, retrospective study. Subjects underwent MRI-guided breast biopsy (mean, 13 days [1-95 days]) using GRASP DCE-MRI, a fat-suppressed radial "stack-of-stars" 3D FLASH sequence with golden-angle ordering. Three readers independently evaluated breast lesions on both sequences. Statistical analysis included mixed models with generalized estimating equations, kappa-weighted coefficients and Fisher's exact test. All lesions demonstrated good conspicuity on VIBE and GRASP sequences (4.28 ± 0.81 versus 3.65 ± 1.22), with no significant difference in lesion detection (P = 0.248). VIBE had slightly higher lesion conspicuity than GRASP for all lesions, with VIBE 12.6% (0.63/5.0) more conspicuous (P < 0.001). Masses and nonmass enhancement (NME) were more conspicuous on VIBE (P < 0.001), with a larger difference for NME (14.2% versus 9.4% more conspicuous). Malignant lesions were more conspicuous than benign lesions (P < 0.001) on both sequences. GRASP DCE-MRI, a multicoil compressed sensing technique with high spatial resolution and flexible temporal resolution, has near-comparable performance to conventional VIBE imaging for breast lesion evaluation. 3 Technical Efficacy: Stage 3 J. MAGN. RESON. IMAGING 2017;45:1746-1752. © 2016 International Society for Magnetic Resonance in Medicine.

  12. Evaluation on ultrasonic examination methods applied to Ni-base alloy weld including cracks due to stress corrosion cracking found in BWR reactor internal

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Kobayashi, Hiroyuki; Higuchi, Shinichi; Shimizu, Sadato

    2005-01-01

    A Ni-base alloy weld, including cracks due to stress corrosion cracking found in the reactor internal of the oldest BWR in Japan, Tsuruga unit 1, in 1999, was examined by three (3) types of UT method. After this examination, a depth of each crack was confirmed by carrying out a little excavation with a grinder and PT examination by turns until each crack disappeared. Then, the depth measured by the former method was compared with the one measured by the latter method. In this fashion, performances of the UT methods were verified. As a result, a combination of the three types of UT method was found to meet the acceptance criteria given by ASME Sec.XI Appendix VIII, Performance Demonstration for Ultrasonic Examination Systems-Supplement 6. In this paper, the results of the UT examination described above and their evaluation are discussed. (author)

  13. A method for energy window optimization for quantitative tasks that includes the effects of model-mismatch on bias: application to Y-90 bremsstrahlung SPECT imaging

    International Nuclear Information System (INIS)

    Rong Xing; Du Yong; Frey, Eric C

    2012-01-01

    Quantitative Yttrium-90 ( 90 Y) bremsstrahlung single photon emission computed tomography (SPECT) imaging has shown great potential to provide reliable estimates of 90 Y activity distribution for targeted radionuclide therapy dosimetry applications. One factor that potentially affects the reliability of the activity estimates is the choice of the acquisition energy window. In contrast to imaging conventional gamma photon emitters where the acquisition energy windows are usually placed around photopeaks, there has been great variation in the choice of the acquisition energy window for 90 Y imaging due to the continuous and broad energy distribution of the bremsstrahlung photons. In quantitative imaging of conventional gamma photon emitters, previous methods for optimizing the acquisition energy window assumed unbiased estimators and used the variance in the estimates as a figure of merit (FOM). However, for situations, such as 90 Y imaging, where there are errors in the modeling of the image formation process used in the reconstruction there will be bias in the activity estimates. In 90 Y bremsstrahlung imaging this will be especially important due to the high levels of scatter, multiple scatter, and collimator septal penetration and scatter. Thus variance will not be a complete measure of reliability of the estimates and thus is not a complete FOM. To address this, we first aimed to develop a new method to optimize the energy window that accounts for both the bias due to model-mismatch and the variance of the activity estimates. We applied this method to optimize the acquisition energy window for quantitative 90 Y bremsstrahlung SPECT imaging in microsphere brachytherapy. Since absorbed dose is defined as the absorbed energy from the radiation per unit mass of tissues in this new method we proposed a mass-weighted root mean squared error of the volume of interest (VOI) activity estimates as the FOM. To calculate this FOM, two analytical expressions were derived for

  14. A method for energy window optimization for quantitative tasks that includes the effects of model-mismatch on bias: application to Y-90 bremsstrahlung SPECT imaging.

    Science.gov (United States)

    Rong, Xing; Du, Yong; Frey, Eric C

    2012-06-21

    Quantitative Yttrium-90 ((90)Y) bremsstrahlung single photon emission computed tomography (SPECT) imaging has shown great potential to provide reliable estimates of (90)Y activity distribution for targeted radionuclide therapy dosimetry applications. One factor that potentially affects the reliability of the activity estimates is the choice of the acquisition energy window. In contrast to imaging conventional gamma photon emitters where the acquisition energy windows are usually placed around photopeaks, there has been great variation in the choice of the acquisition energy window for (90)Y imaging due to the continuous and broad energy distribution of the bremsstrahlung photons. In quantitative imaging of conventional gamma photon emitters, previous methods for optimizing the acquisition energy window assumed unbiased estimators and used the variance in the estimates as a figure of merit (FOM). However, for situations, such as (90)Y imaging, where there are errors in the modeling of the image formation process used in the reconstruction there will be bias in the activity estimates. In (90)Y bremsstrahlung imaging this will be especially important due to the high levels of scatter, multiple scatter, and collimator septal penetration and scatter. Thus variance will not be a complete measure of reliability of the estimates and thus is not a complete FOM. To address this, we first aimed to develop a new method to optimize the energy window that accounts for both the bias due to model-mismatch and the variance of the activity estimates. We applied this method to optimize the acquisition energy window for quantitative (90)Y bremsstrahlung SPECT imaging in microsphere brachytherapy. Since absorbed dose is defined as the absorbed energy from the radiation per unit mass of tissues in this new method we proposed a mass-weighted root mean squared error of the volume of interest (VOI) activity estimates as the FOM. To calculate this FOM, two analytical expressions were

  15. Digitization of conventional radiographs

    International Nuclear Information System (INIS)

    Wenz, W.; Buitrago-Tellez, C.; Blum, U.; Hauenstein, K.H.; Gufler, H.; Meyer, E.; Ruediger, K.

    1992-01-01

    The diagnostic value of a digitization system for analogue films based on a charge-coupled-device (CCD) scanner with adjustable resolution of 2.5 or 5 lp/mm was assessed. Some 110 skeletal radiographs, 50 contrast studies, including 25 of patients with Crohn's disease, and 70 abdominal plain films before and after successful lithotripsy for renal stones were digitized. Receiver operating characteristic (ROC) studies showed improved detection of cortical and trabecular defects with contrast-optimized digitized films. Edge enhancement algorithms yielded no additional information. Inflammatory lesions of Crohn's disease were detected equally well by conventional films and digitized images. A statistically significant improvement (p [de

  16. Conventional RF system design

    International Nuclear Information System (INIS)

    Puglisi, M.

    1994-01-01

    The design of a conventional RF system is always complex and must fit the needs of the particular machine for which it is planned. It follows that many different design criteria should be considered and analyzed, thus exceeding the narrow limits of a lecture. For this reason only the fundamental components of an RF system, including the generators, are considered in this short seminar. The most common formulas are simply presented in the text, while their derivations are shown in the appendices to facilitate, if desired, a more advanced level of understanding. (orig.)

  17. Conventional magnets. Pt. 1

    International Nuclear Information System (INIS)

    Marks, N.

    1994-01-01

    The design and construction of conventional, steel-cored, direct-current magnets are discussed. Laplace's equation and the associated cylindrical harmonic solutions in two dimensions are established. The equations are used to define the ideal pole shapes and required excitation for dipole, quadrupole and sextupole magnets. Standard magnet geometries are then considered and criteria determining the coil design are presented. The use of codes for predicting flux density distributions and the iterative techniques used for pole face design are then discussed. This includes a description of the use of two-dimensional codes to generate suitable magnet end geometries. Finally, standard constructional techniques for cores and coils are described. (orig.)

  18. All-Optical Method to Assess Stromal Concentration of Riboflavin in Conventional and Accelerated UV-A Irradiation of the Human Cornea.

    Science.gov (United States)

    Lombardo, Giuseppe; Micali, Norberto Liborio; Villari, Valentina; Serrao, Sebastiano; Lombardo, Marco

    2016-02-01

    We investigated the concentration of riboflavin in human donor corneas during corneal cross-linking using two-photon optical microscopy and spectrophotometry. Eight corneal tissues were de-epithelialized and soaked with 20% dextran-enriched 0.1% riboflavin solution for 30 minutes. After stromal soaking, three tissues were irradiated using a 3 mW/cm2 UV-A device for 30 minutes and three tissues irradiated using a 10 mW/cm2 device for 9 minutes. Two additional tissues were used as positive controls. A Ti:sapphire laser at 810 nm was used to perform two-photon emission fluorescence (TPEF) and second harmonic generation axial scanning measurements in all specimens before and after stromal soaking and after UV-A irradiation. In addition, spectrophotometry was used to collect the absorbance spectra of each tissue at the same time intervals. Analysis of the absorbance spectra and TPEF signals provided measures of the concentration depth profile of riboflavin in corneal stroma. After stromal soaking, the average peak concentration of riboflavin (0.020% ± 0.001%) was found between a stromal depth of 100 and 250 μm; the concentration of riboflavin was almost constant up to 320 ± 53 μm depth, then decreased toward the endothelium, though riboflavin was still enriched in the posterior stroma (0.016%% ± 0.001%). After conventional and accelerated UV-A irradiation, the concentration of riboflavin decreased uniformly 87% ± 2% and 67% ± 3% (P riboflavin in corneal stroma. The method can assist with the assessment of novel riboflavin formulations and different UV-A irradiation protocols.

  19. Selected nutrient contents, fatty acid composition, including conjugated linoleic acid, and retention values in separable lean from lamb rib loins as affected by external fat and cooking method.

    Science.gov (United States)

    Badiani, Anna; Montellato, Lara; Bochicchio, Davide; Anfossi, Paola; Zanardi, Emanuela; Maranesi, Magda

    2004-08-11

    Proximate composition and fatty acid profile, conjugated linoleic acid (CLA) isomers included, were determined in separable lean of raw and cooked lamb rib loins. The cooking methods compared, which were also investigated for cooking yields and true nutrient retention values, were dry heating of fat-on cuts and moist heating of fat-off cuts; the latter method was tested as a sort of dietetic approach against the more traditional former type. With significantly (P cooking losses, dry heating of fat-on rib-loins produced slightly (although only rarely significantly) higher retention values for all of the nutrients considered, including CLA isomers. On the basis of the retention values obtained, both techniques led to a minimum migration of lipids into the separable lean, which was higher (P cooking of the class of CLA isomers (including that of the nutritionally most important isomer cis-9,trans-11) was more similar to that of the monounsaturated than the polyunsaturated fatty acids.

  20. Efficient methods for including quantum effects in Monte Carlo calculations of large systems: extension of the displaced points path integral method and other effective potential methods to calculate properties and distributions.

    Science.gov (United States)

    Mielke, Steven L; Dinpajooh, Mohammadhasan; Siepmann, J Ilja; Truhlar, Donald G

    2013-01-07

    We present a procedure to calculate ensemble averages, thermodynamic derivatives, and coordinate distributions by effective classical potential methods. In particular, we consider the displaced-points path integral (DPPI) method, which yields exact quantal partition functions and ensemble averages for a harmonic potential and approximate quantal ones for general potentials, and we discuss the implementation of the new procedure in two Monte Carlo simulation codes, one that uses uncorrelated samples to calculate absolute free energies, and another that employs Metropolis sampling to calculate relative free energies. The results of the new DPPI method are compared to those from accurate path integral calculations as well as to results of two other effective classical potential schemes for the case of an isolated water molecule. In addition to the partition function, we consider the heat capacity and expectation values of the energy, the potential energy, the bond angle, and the OH distance. We also consider coordinate distributions. The DPPI scheme performs best among the three effective potential schemes considered and achieves very good accuracy for all of the properties considered. A key advantage of the effective potential schemes is that they display much lower statistical sampling variances than those for accurate path integral calculations. The method presented here shows great promise for including quantum effects in calculations on large systems.

  1. Measure Guideline: Summary of Interior Ducts in New Construction, Including an Efficient, Affordable Method to Install Fur-Down Interior Ducts

    Energy Technology Data Exchange (ETDEWEB)

    Beal, D.; McIlvaine , J.; Fonorow, K.; Martin, E.

    2011-11-01

    This document illustrates guidelines for the efficient installation of interior duct systems in new housing, including the fur-up chase method, the fur-down chase method, and interior ducts positioned in sealed attics or sealed crawl spaces. This document illustrates guidelines for the efficient installation of interior duct systems in new housing. Interior ducts result from bringing the duct work inside a home's thermal and air barrier. Architects, designers, builders, and new home buyers should thoroughly investigate any opportunity for energy savings that is as easy to implement during construction, such as the opportunity to construct interior duct work. In addition to enhanced energy efficiency, interior ductwork results in other important advantages, such as improved indoor air quality, increased system durability and increased homeowner comfort. While the advantages of well-designed and constructed interior duct systems are recognized, the implementation of this approach has not gained a significant market acceptance. This guideline describes a variety of methods to create interior ducts including the fur-up chase method, the fur-down chase method, and interior ducts positioned in sealed attics or sealed crawl spaces. As communication of the intent of an interior duct system, and collaboration on its construction are paramount to success, this guideline details the critical design, planning, construction, inspection, and verification steps that must be taken. Involved in this process are individuals from the design team; sales/marketing team; and mechanical, insulation, plumbing, electrical, framing, drywall and solar contractors.

  2. Quantitative proteomics by 2DE and MALDI MS/MS uncover the effects of organic and conventional cropping methods on vegetable products

    DEFF Research Database (Denmark)

    Nawrocki, Arkadiusz; Thorup-Kristensen, Kristian; Jensen, Ole Nørregaard

    2011-01-01

    overexpressed in conventionally grown cabbage. Proteins involved in metabolism of carbohydrates, polypeptides and secondary metabolites were affected by different cropping regimes in carrots. The proteomes of conventionally grown vegetables varied from organically grown vegetables to a larger extent than...... of slurry, in accordance to regulations of organic farming and O2, in which nutrient supply was based mainly on autumn green manures. Proteins were extracted from lyophilized plant tissues into a buffer containing high concentrations of urea/thiourea, two detergents and reducing agent. This approach allowed...... short handling times of fresh plant materials. In the case of cabbage samples, the abundance levels of 58 out of more than 1300 quantified protein spots varied significantly between conventional farming and any of the organic cropping systems. Proteome profiles were also very similar between carrot root...

  3. Method Of Bonding A Metal Connection To An Electrode Including A Core Having A Fiber Or Foam Type Structure For An Electrochemical Cell, An

    Science.gov (United States)

    Loustau, Marie-Therese; Verhoog, Roelof; Precigout, Claude

    1996-09-24

    A method of bonding a metal connection to an electrode including a core having a fiber or foam-type structure for an electrochemical cell, in which method at least one metal strip is pressed against one edge of the core and is welded thereto under compression, wherein, at least in line with the region in which said strip is welded to the core, which is referred to as the "main core", a retaining core of a type analogous to that of the main core is disposed prior to the welding.

  4. Study of two novel large-field-of-view image intensifiers versus conventional chest radiography with use of FROC methods and simulated pulmonary nodules

    International Nuclear Information System (INIS)

    Winter, L.H.L.; Chakraborty, D.P.; Van Waes, P.F.G.M.; Puylaert, C.B.A.J.

    1989-01-01

    Two novel large-field-of-view image intensifier (LFOV 1.1) tubes have been introduced whose image area makes them suitable for chest imaging. Both modalities present a 100-mm hard-copy image to the radiologist. A pulmonary nodule performance experiment was done to compare the diagnostic accuracy of these tubes with conventional full-size chest images. The data were analyzed with the maximum-likelihood FROCFIT program. The relative ranking in terms of decreasing A1 values was TLX, Siemens 43-cm mode, conventional radiography, and Siemens 57-cm mode

  5. Efficacy of low-pressure foam cleaning compared to conventional cleaning methods in the removal of bacteria from surfaces associated with convenience food.

    Science.gov (United States)

    Lambrechts, A A; Human, I S; Doughari, J H; Lues, J F R

    2014-09-01

    Food borne illnesses and food poisoning are cause for concern globally. The diseases are often caused by food contamination with pathogenic bacteria due largely to poor sanitary habits or storage conditions. Prevalence of some bacteria on cleaned and sanitised food contact surfaces from eight convenience food plants in Gauteng (South Africa) was investigated with the view to evaluate the efficacy of the cleaning methods used with such food contact surfaces. The microbial load of eight convenience food manufacturing plants was determined by sampling stainless steel food contact surfaces after they had been cleaned and sanitised at the end of a day's shift. Samples were analysed for Total Plate Count (TPC), Escherichia coli, Salmonella species, Staphylococcus aureus and Listeria species. Results showed that 59 % of the total areas sampled for TPC failed to comply with the legal requirements for surfaces, according to the Foodstuffs, Cosmetics and Disinfectants Act ( 0.05) in terms of Listeria species isolates obtained from both cleaning methods. The LPF method proved to be the superior cleaning option for lowering TPC counts. Regardless of cleaning method used, pathogens continued to flourish on various surfaces, including dry stainless steel, posing a contamination hazard for a considerable period depending on the contamination level and type of pathogen. Intensive training for proper chemical usage and strict procedural compliance among workers for efficient cleaning procedures is recommended.

  6. A sensitive multi-residue method for the determination of 35 micropollutants including pharmaceuticals, iodinated contrast media and pesticides in water.

    Science.gov (United States)

    Valls-Cantenys, Carme; Scheurer, Marco; Iglesias, Mònica; Sacher, Frank; Brauch, Heinz-Jürgen; Salvadó, Victoria

    2016-09-01

    A sensitive, multi-residue method using solid-phase extraction followed by liquid chromatography-tandem mass spectrometry (LC-MS/MS) was developed to determine a representative group of 35 analytes, including corrosion inhibitors, pesticides and pharmaceuticals such as analgesic and anti-inflammatory drugs, five iodinated contrast media, β-blockers and some of their metabolites and transformation products in water samples. Few other methods are capable of determining such a broad range of contrast media together with other analytes. We studied the parameters affecting the extraction of the target analytes, including sorbent selection and extraction conditions, their chromatographic separation (mobile phase composition and column) and detection conditions using two ionisation sources: electrospray ionisation (ESI) and atmospheric pressure chemical ionisation (APCI). In order to correct matrix effects, a total of 20 surrogate/internal standards were used. ESI was found to have better sensitivity than APCI. Recoveries ranging from 79 to 134 % for tap water and 66 to 144 % for surface water were obtained. Intra-day precision, calculated as relative standard deviation, was below 34 % for tap water and below 21 % for surface water, groundwater and effluent wastewater. Method quantification limits (MQL) were in the low ng L(-1) range, except for the contrast agents iomeprol, amidotrizoic acid and iohexol (22, 25.5 and 17.9 ng L(-1), respectively). Finally, the method was applied to the analysis of 56 real water samples as part of the validation procedure. All of the compounds were detected in at least some of the water samples analysed. Graphical Abstract Multi-residue method for the determination of micropollutants including pharmaceuticals, iodinated contrast media and pesticides in waters by LC-MS/MS.

  7. Preface of "The Second Symposium on Border Zones Between Experimental and Numerical Application Including Solution Approaches By Extensions of Standard Numerical Methods"

    Science.gov (United States)

    Ortleb, Sigrun; Seidel, Christian

    2017-07-01

    In this second symposium at the limits of experimental and numerical methods, recent research is presented on practically relevant problems. Presentations discuss experimental investigation as well as numerical methods with a strong focus on application. In addition, problems are identified which require a hybrid experimental-numerical approach. Topics include fast explicit diffusion applied to a geothermal energy storage tank, noise in experimental measurements of electrical quantities, thermal fluid structure interaction, tensegrity structures, experimental and numerical methods for Chladni figures, optimized construction of hydroelectric power stations, experimental and numerical limits in the investigation of rain-wind induced vibrations as well as the application of exponential integrators in a domain-based IMEX setting.

  8. The efficiency of conventional microscopic selection is comparable to the hyaluronic acid binding method in selecting spermatozoa for male infertility patients

    Directory of Open Access Journals (Sweden)

    Meng-Ting Huang

    2015-02-01

    Conclusion: The percentages of DNA intact spermatozoa between the PVP-sperm and HA-sperm groups were not significantly different. In an ICSI procedure, a well-trained embryologist will have the same ability to choose sperm with intact DNA by conventional microscopic selection as with HA-bound spermatozoa selection.

  9. Multi-method comparison of carrot quality from a conventional and three organic cropping systems with increasing levels of nutrient recycling

    DEFF Research Database (Denmark)

    Paoletti, Flavio; Raffo´, Antonio; Kristensen, Hanne Lakkenborg

    2012-01-01

    BACKGROUND: There is a need to advance the study of the effects of organic and conventional systems on product quality. In particular, little is known about the importance of different farming practices concerning nutrient cycling and the use of external inputs within organic farming for the qual...

  10. Chemical Weapons Convention

    National Research Council Canada - National Science Library

    1997-01-01

    On April 29, 1997, the Convention on the Prohibition of the Development, Production, Stockpiling, and Use of Chemical Weapons and on Their Destruction, known as the Chemical Weapons Convention (CWC...

  11. Measurement of regional cerebral blood flow using one-point venous blood sampling and causality model. Evaluation by comparing with conventional continuous arterial blood sampling method

    International Nuclear Information System (INIS)

    Mimura, Hiroaki; Sone, Teruki; Takahashi, Yoshitake

    2008-01-01

    Optimal setting of the input function is essential for the measurement of regional cerebral blood flow (rCBF) based on the microsphere model using N-isopropyl-4-[ 123 I]iodoamphetamine ( 123 I-IMP), and usually the arterial 123 I-IMP concentration (integral value) in the initial 5 min is used for this purpose. We have developed a new convenient method in which 123 I-IMP concentration in arterial blood sample is estimated from that in venous blood sample. Brain perfusion single photon emission computed tomography (SPECT) with 123 I-IMP was performed in 110 cases of central nervous system disorders. The causality was analyzed between the various parameters of SPECT data and the ratio of octanol-extracted arterial radioactivity concentration during the first 5 min (Caoct) to octanol-extracted venous radioactivity concentration at 27 min after intravenous injection of 123 I-IMP (Cvoct). A high correlation was observed between the measured and estimated values of Caoct/Cvoct (r=0.856) when the following five parameters were included in the regression formula: radioactivity concentration in venous blood sampled at 27 min (Cv), Cvoct, Cvoct/Cv, and total brain radioactivity counts that were measured by a four-head gamma camera 5 min and 28 min after 123 I-IMP injection. Furthermore, the rCBF values obtained using the input parameters estimated by this method were also highly correlated with the rCBF values measured using the continuous arterial blood sampling method (r=0.912). These results suggest that this method would serve as the new, convenient and less invasive method of rCBF measurement in clinical setting. (author)

  12. Guidelines for the verification and validation of expert system software and conventional software: Volume 4, Evaluation of knowledge base certification methods. Final report

    International Nuclear Information System (INIS)

    Miller, L.A.; Hayes, J.E.; Mirsky, S.M.

    1995-05-01

    Objective is the formulation of guidelines for the V ampersand V of expert systems for use in nuclear power applications. This activity is concerned with the development and testing of various methods for assuring the quality of knowledge bases. The testing procedure used was that of behavioral experiment, the first known such evaluation of any of V ampersand V activity; the value lies in the capability to provide empirical evidence for or against the effectiveness of plausible methods in helping people find problems in knowledge bases. The three-day experiment included 20 participants from three nuclear utilities, the Nuclear Regulatory Commission's Technical training Center, University of Maryland, EG ampersand G Idaho, and SAIC. The study used two real nuclear expert systems: a boiling water reactor emergency operating procedures tracking system and a pressurized water reactor safety assessment systems. Ten participants were assigned to each of the expert systems. All participants were trained in and then used a sequence of four different V ampersand V methods selected as being the best and most appropriate. These methods either involved the analysis and tracing of requirements to elements in the knowledge base or direct inspection of the knowledge base for various kinds of errors. Half of the subjects within each system group used the best annual variant of the V ampersand V methods (the control group), while the other half were supported by the results of applying real or simulated automated tools to the knowledge bases (the experimental group). The four groups of participants were similar in nuclear engineering and software experience characteristics. It is concluded that the use of tools in static knowledge base certification results in significant improvement in detecting all types of defects, avoiding false alarms, and completing the effort in less time. The simulated knowledge-checking tool, based on supplemental engineering information about the systems

  13. Guidelines for the verification and validation of expert system software and conventional software: Evaluation of knowledge base certification methods. Volume 4

    International Nuclear Information System (INIS)

    Miller, L.A.; Hayes, J.E.; Mirsky, S.M.

    1995-03-01

    This report presents the results of the Knowledge Base Certification activity of the expert systems verification and validation (V ampersand V) guideline development project which is jointly funded by the US Nuclear Regulatory Commission and the Electric Power Research Institute. The ultimate objective is the formulation of guidelines for the V ampersand V of expert systems for use in nuclear power applications. This activity is concerned with the development and testing of various methods for assuring the quality of knowledge bases. The testing procedure used was that of behavioral experiment, the first known such evaluation of any type of V ampersand V activity. The value of such experimentation is its capability to provide empirical evidence for -- or against -- the effectiveness of plausible methods in helping people find problems in knowledge bases. The three-day experiment included 20 participants from three nuclear utilities, the Nuclear Regulatory Commission's Technical training Center, the University of Maryland, EG ampersand G Idaho, and SAIC. The study used two real nuclear expert systems: a boiling water reactor emergency operating procedures tracking system and a pressurized water reactor safety assessment systems. Ten participants were assigned to each of the expert systems. All participants were trained in and then used a sequence of four different V ampersand V methods selected as being the best and most appropriate for study on the basis of prior evaluation activities. These methods either involved the analysis and tracing of requirements to elements in the knowledge base (requirements grouping and requirements tracing) or else involved direct inspection of the knowledge base for various kinds of errors. Half of the subjects within each system group used the best manual variant of the V ampersand V methods (the control group), while the other half were supported by the results of applying real or simulated automated tools to the knowledge bases

  14. The Hague Judgments Convention

    DEFF Research Database (Denmark)

    Nielsen, Peter Arnt

    2011-01-01

    The Hague Judgments Convention of 2005 is the first global convention on international jurisdiction and recognition and enforcement of judgments in civil and commercial matters. The author explains the political and legal background of the Convention, its content and certain crucial issues during...

  15. Ultrasound-assisted phase-transfer catalysis method in an aqueous medium to promote the Knoevenagel reaction: advantages over the conventional and microwave-assisted solvent-free/catalyst-free method.

    Science.gov (United States)

    De-la-Torre, Pedro; Osorio, Edison; Alzate-Morales, Jans H; Caballero, Julio; Trilleras, Jorge; Astudillo-Saavedra, Luis; Brito, Iván; Cárdenas, Alejandro; Quiroga, Jairo; Gutiérrez, Margarita

    2014-09-01

    Given the broad spectrum of uses of acrylonitrile derivatives as fluorescent probes, AChE inhibitors, and others, it is necessary to find easy, efficient and simple methods to synthesize and diversify these compounds. We report the results of a comparative study of the effects of three techniques on the reactions between heterocyclic aldehydes and 2-(benzo[d]thiazol-2-yl)acetonitrile: stirring; ultrasound coupled to PTC conditions (US-PTC); and MW irradiation (MWI) under solvent and catalyst-free conditions. The effects of conditions on reaction parameters were evaluated and compared in terms of reaction time, yield, purity and outcomes. The US-PTC method is more efficient than the MWI and conventional methods. The reaction times were considerably shorter, with high yields (>90%) and good levels of purity. In addition, X-ray diffraction analysis and quantum mechanical calculations, at the level of density functional theory (DFT), ratify obtaining acrylonitrile isomers with E configurations. The crystal structure of 3c is stabilized by weak C-Ho⋯N intermolecular interactions (Ho⋯NC=2.45 Å, Co⋯NC=3.348(3) Å, Ho⋯NC=162°), forming centrosymmetric ring R2(2) (20) along the crystallographic a axis. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Paris Convention on third party liability in the field of nuclear energy and Brussels Convention Supplementary to the Paris Convention

    International Nuclear Information System (INIS)

    1989-01-01

    This new bilingual (English and French) edition of the 1960 Paris Convention and 1963 Brussels Supplementary Convention incorporates the provisions of the Protocols which amended each of them on two occasions, in 1964 and 1982. The Expose des motifs to the Paris Convention, as revised in 1982 is also included in this pubication. (NEA) [fr

  17. Preliminary report: prescription of prism-glasses by the Measurement and Correction Method of H.-J. Haase or by conventional orthoptic examination: a multicenter, randomized, double-blind, cross-over study

    NARCIS (Netherlands)

    Simonsz, H. J.; van Els, J.; Ruijter, J. M.; Bakker, D.; Spekreijse, H.

    2001-01-01

    In a multicenter, randomized, double-blind, cross-over study in the Netherlands, the effectiveness of (prism-)glasses prescribed by the Measurement and Correction Method of H.-J. Haase (MKH) was compared to that of glasses prescribed by conventional orthoptic examination. Nine pairs of

  18. A Study on the quantification of hydration and the strength development mechanism of cementitious materials including amorphous phases by using XRD/Rietveld method

    International Nuclear Information System (INIS)

    Yamada, Kazuo; Hoshino, Seiichi; Hirao, Hiroshi; Yamashita, Hiroki

    2008-01-01

    X-ray diffraction (XRD)/Rietveld method was applied to measure the phase composition of cement. The quantative analysis concerning the progress of hydration was accomplished in an error of about the maximum 2-3% in spite of including amorphous materials such as blast furnace slag, fly ash, silica fume and C-S-H. The influence of the compressive strength on the lime stone fine powder mixture material was studied from the hydration analysis by Rietveld method. The two stages were observed in the strength development mechanism of cement; the hydration promotion of C 3 S in the early stage and the filling of cavities by carbonate hydrate for the longer term. It is useful to use various mixture materials for the formation of the resource recycling society and the durability improvement of concrete. (author)

  19. An optimized method for fatty acid analysis, including quantification of trans fatty acids, in human adipose tissue by gas-liquid chromatography

    DEFF Research Database (Denmark)

    Bysted, Anette; Cold, S; Hølmer, Gunhild Kofoed

    1999-01-01

    Considering the need for a quick direct method for measurement of the fatty acid composition including trans isomers ofhuman adipose tissue we have developed a procedure using gas-liquid chromatography (GLC) alone, which is thussuitable for validation of fatty acid status in epidemiological studies...... for 25 min, and finally raised at 25 degrees C/min to 225 degrees C. The trans and cis isomers of18:1 were well separated from each other, as shown by silver-ion thin-layer chromatography. Verification by standardsshowed that the trans 18:1 isomers with a double bond in position 12 or lower were...

  20. Bacteriemia por Campylobacter fetus aislado mediante métodos convencionales de una paciente inmunocomprometida Bacteremia due to Campylobacter fetus isolated by conventional methods from an immunocompromised patient

    Directory of Open Access Journals (Sweden)

    G. Epifane

    2007-03-01

    Full Text Available Las bacterias del género Campylobacter son bacilos gram-negativos móviles, helicoidales, que presentan morfologías características. Estos microorganismos requieren una baja tensión de oxígeno y un nivel aumentado de CO2 para su desarrollo. Se presenta un caso de bacteriemia por Campylobacter fetus en una paciente con diagnóstico previo de cáncer de mama, metástasis en columna dorso-lumbar y leucemia promielocítica aguda M3 variante de la clasificación FAB. La paciente ingresó al Hospital Italiano de Córdoba por pérdida de conocimiento y proctorragia de 48 h de evolución. Debido a su pancitopenia severa se le realizaron sucesivas transfusiones de sangre. A los 13 días de internación presentó fiebre permanente. Se tomaron muestras para hemocultivo y urocultivo y se comenzó el tratamiento antibiótico con clindamicina y ciprofloxacina. Los hemocultivos se subcultivaron a las 48 h en agar chocolate. A las 24 h de incubación a 35 °C en atmósfera con 5% de CO2 desarrollaron colonias diminutas. La coloración de Gram reveló en ambas muestras bacilos gram-negativos espirilados, posteriormente identificados como Campylobacter fetus por medio de pruebas bioquímicas convencionales. El esquema antibiótico fue rotado a gentamicina más clindamicina. La paciente evolucionó favorablemente y los hemocultivos resultaron negativos luego de 5 días de tratamiento.The genus Campylobacter includes gram-negative, motile, curved rods that can evidence characteristic morphologies. These microorganisms require low oxygen tension and an increased level of CO2 for growing. A case of bacteremia due to Campylobacter fetus in a patient with a previous diagnosis of breast cancer with metastases in dorso-lumbar column and acute promyelocytic leukemia (FAB-M3 variant is presented. The patient was admitted to our institution due to loss of consciousness and a 2 day - history of bloody diarrhea. She received successive blood transfusions on account of

  1. Prenatal prediction of postnatal large-for-date neonates using a simplified method at MR imaging: comparison with conventional 2D ultrasound estimates.

    Science.gov (United States)

    Kadji, Caroline; Cannie, Mieke M; De Angelis, Ricardo; Camus, Margaux; Klass, Magdalena; Fellas, Stéphanie; Cecotti, Vera; Dütemeyer, Vivien; Jani, Jacques C

    2017-05-15

    To evaluate the performance of a simple method of estimating fetal weight (EFW) using MR imaging as compared with 2D US in the prediction of large-for-date neonates. Written informed consent was obtained for this EC-approved study. Between March 2011 and May 2016, 2 groups of women with singleton pregnancies were evaluated: women that underwent US-EFW and MR-EFW within 48 h before delivery and those undergoing these evaluations between 35 + 0 weeks and 37 + 6 weeks of gestation. US-EFW was based on Hadlock et al. and MR-EFW on the formula described by Backer et al. Planimetric measurement of the fetal body volume (FBV) needed for MR-EFW was performed using a semi-automated method and the time required for measurement was noted. Our outcome measure was performance in prediction of large-for-date neonates by MR imaging versus US-EFW using receiver-operating characteristic (ROC) curves. 270 women were included in the first part of the study with 48 newborns (17.8%) of birthweight ≥90 th centile and 30 (11.1%) ≥95 th centile. Eighty-three women were included in the second part with 9 newborns (10.8%) of birthweight ≥95 th centile. The median time needed for FBV planimetric measurements in all 353 fetuses was 3.5 (range; 1.5-5.5) min. The area under the ROC curve for prediction of postnatal large-for-date neonates by prenatal MR imaging performed within 48 h before delivery was significantly better than by US (difference between the AUROC = 0.085, P < 0.001; standard error = 0.020 for birthweight ≥90 th centile and 0.036, P = 0.01; standard error = 0.014 for birthweight ≥95 th centile). Similarly, MR-EFW was better than US-EFW, with both performed remote from delivery, in predicting birthweight ≥ 95 th centile (difference between the AUROC = 0.077, P = 0.045; standard error = 0.039). MR planimetry using our purpose-designed semi-automated method is not time-consuming. MR-EFW performed immediately prior to

  2. Laparoscopic splenectomy using conventional instruments

    Directory of Open Access Journals (Sweden)

    Dalvi A

    2005-01-01

    Full Text Available INTRODUCTION : Laparoscopic splenectomy (LS is an accepted procedure for elective splenectomy. Advancement in technology has extended the possibility of LS in massive splenomegaly [Choy et al., J Laparoendosc Adv Surg Tech A 14(4, 197-200 (2004], trauma [Ren et al., Surg Endosc 15(3, 324 (2001; Mostafa et al., Surg Laparosc Endosc Percutan Tech 12(4, 283-286 (2002], and cirrhosis with portal hypertension [Hashizume et al., Hepatogastroenterology 49(45, 847-852 (2002]. In a developing country, these advanced gadgets may not be always available. We performed LS using conventional and reusable instruments in a public teaching the hospital without the use of the advanced technology. The technique of LS and the outcome in these patients is reported. MATERIALS AND METHODS : Patients undergoing LS for various hematological disorders from 1998 to 2004 were included. Electrocoagulation, clips, and intracorporeal knotting were the techniques used for tackling short-gastric vessels and splenic pedicle. Specimen was delivered through a Pfannensteil incision. RESULTS : A total of 26 patients underwent LS. Twenty-two (85% of patients had spleen size more than 500 g (average weight being 942.55 g. Mean operative time was 214 min (45-390 min. The conversion rate was 11.5% ( n = 3. Average duration of stay was 5.65 days (3-30 days. Accessory spleen was detected and successfully removed in two patients. One patient developed subphrenic abscess. There was no mortality. There was no recurrence of hematological disease. CONCLUSION : Laparoscopic splenectomy using conventional equipment and instruments is safe and effective. Advanced technology has a definite advantage but is not a deterrent to the practice of LS.

  3. Novel versus conventional antipsychotic drugs.

    Science.gov (United States)

    Love, R C

    1996-01-01

    Novel antipsychotic agents differ from conventional ones in several key characteristics, including effectiveness, adverse reactions, and receptor-binding profile. Most of the newer agents have an affinity for the serotonin 5HT2 receptor that is at least 10 times greater than that for the dopamine D2 receptor. This increased affinity for the serotonin receptor may be responsible for another distinguishing characteristic of novel antipsychotic agents--decreased frequency of extrapyramidal side effects. These side effects, which include pseudoparkinsonism, acute dystonias, and akathisia, frequently are the reason for noncompliance with conventional drug therapy. The newer drugs are often effective in patients resistant to treatment with conventional agents. They also appear to reduce the negative symptoms of schizophrenia in many patients.

  4. Evolution of poor reporting and inadequate methods over time in 20 920 randomised controlled trials included in Cochrane reviews: research on research study.

    Science.gov (United States)

    Dechartres, Agnes; Trinquart, Ludovic; Atal, Ignacio; Moher, David; Dickersin, Kay; Boutron, Isabelle; Perrodeau, Elodie; Altman, Douglas G; Ravaud, Philippe

    2017-06-08

    Objective  To examine how poor reporting and inadequate methods for key methodological features in randomised controlled trials (RCTs) have changed over the past three decades. Design  Mapping of trials included in Cochrane reviews. Data sources  Data from RCTs included in all Cochrane reviews published between March 2011 and September 2014 reporting an evaluation of the Cochrane risk of bias items: sequence generation, allocation concealment, blinding, and incomplete outcome data. Data extraction  For each RCT, we extracted consensus on risk of bias made by the review authors and identified the primary reference to extract publication year and journal. We matched journal names with Journal Citation Reports to get 2014 impact factors. Main outcomes measures  We considered the proportions of trials rated by review authors at unclear and high risk of bias as surrogates for poor reporting and inadequate methods, respectively. Results  We analysed 20 920 RCTs (from 2001 reviews) published in 3136 journals. The proportion of trials with unclear risk of bias was 48.7% for sequence generation and 57.5% for allocation concealment; the proportion of those with high risk of bias was 4.0% and 7.2%, respectively. For blinding and incomplete outcome data, 30.6% and 24.7% of trials were at unclear risk and 33.1% and 17.1% were at high risk, respectively. Higher journal impact factor was associated with a lower proportion of trials at unclear or high risk of bias. The proportion of trials at unclear risk of bias decreased over time, especially for sequence generation, which fell from 69.1% in 1986-1990 to 31.2% in 2011-14 and for allocation concealment (70.1% to 44.6%). After excluding trials at unclear risk of bias, use of inadequate methods also decreased over time: from 14.8% to 4.6% for sequence generation and from 32.7% to 11.6% for allocation concealment. Conclusions  Poor reporting and inadequate methods have decreased over time, especially for sequence generation

  5. Implementing the chemical weapons convention

    Energy Technology Data Exchange (ETDEWEB)

    Kellman, B.; Tanzman, E. A.

    1999-12-07

    In 1993, as the CWC ratification process was beginning, concerns arose that the complexity of integrating the CWC with national law could cause each nation to implement the Convention without regard to what other nations were doing, thereby causing inconsistencies among States as to how the CWC would be carried out. As a result, the author's colleagues and the author prepared the Manual for National Implementation of the Chemical Weapons Convention and presented it to each national delegation at the December 1993 meeting of the Preparatory Commission in The Hague. During its preparation, the Committee of CWC Legal Experts, a group of distinguished international jurists, law professors, legally-trained diplomats, government officials, and Parliamentarians from every region of the world, including Central Europe, reviewed the Manual. In February 1998, they finished the second edition of the Manual in order to update it in light of developments since the CWC entered into force on 29 April 1997. The Manual tries to increase understanding of the Convention by identifying its obligations and suggesting methods of meeting them. Education about CWC obligations and available alternatives to comply with these requirements can facilitate national response that are consistent among States Parties. Thus, the Manual offers options that can strengthen international realization of the Convention's goals if States Parties act compatibly in implementing them. Equally important, it is intended to build confidence that the legal issues raised by the Convention are finite and addressable. They are now nearing competition of an internet version of this document so that interested persons can access it electronically and can view the full text of all of the national implementing legislation it cites. The internet address, or URL, for the internet version of the Manual is http: //www.cwc.ard.gov. This paper draws from the Manual. It comparatively addresses approximately thirty

  6. Implementing the chemical weapons convention

    International Nuclear Information System (INIS)

    Kellman, B.; Tanzman, E. A.

    1999-01-01

    In 1993, as the CWC ratification process was beginning, concerns arose that the complexity of integrating the CWC with national law could cause each nation to implement the Convention without regard to what other nations were doing, thereby causing inconsistencies among States as to how the CWC would be carried out. As a result, the author's colleagues and the author prepared the Manual for National Implementation of the Chemical Weapons Convention and presented it to each national delegation at the December 1993 meeting of the Preparatory Commission in The Hague. During its preparation, the Committee of CWC Legal Experts, a group of distinguished international jurists, law professors, legally-trained diplomats, government officials, and Parliamentarians from every region of the world, including Central Europe, reviewed the Manual. In February 1998, they finished the second edition of the Manual in order to update it in light of developments since the CWC entered into force on 29 April 1997. The Manual tries to increase understanding of the Convention by identifying its obligations and suggesting methods of meeting them. Education about CWC obligations and available alternatives to comply with these requirements can facilitate national response that are consistent among States Parties. Thus, the Manual offers options that can strengthen international realization of the Convention's goals if States Parties act compatibly in implementing them. Equally important, it is intended to build confidence that the legal issues raised by the Convention are finite and addressable. They are now nearing competition of an internet version of this document so that interested persons can access it electronically and can view the full text of all of the national implementing legislation it cites. The internet address, or URL, for the internet version of the Manual is http: //www.cwc.ard.gov. This paper draws from the Manual. It comparatively addresses approximately thirty

  7. Development of new method and protocol for cryopreservation related to embryo and oocytes freezing in terms of fertilization rate: A comparative study including review of literature.

    Science.gov (United States)

    Barik, Mayadhar; Bajpai, Minu; Patnaik, Santosh; Mishra, Pravash; Behera, Priyamadhaba; Dwivedi, Sada Nanda

    2016-01-01

    Cryopreservation is basically related to meritorious thin samples or small clumps of cells that are cooled quickly without loss. Our main objective is to establish and formulate an innovative method and protocol development for cryopreservation as a gold standard for clinical uses in laboratory practice and treatment. The knowledge regarding usefulness of cryopreservation in clinical practice is essential to carry forward the clinical practice and research. We are trying to compare different methods of cryopreservation (in two dozen of cells) at the same time we compare the embryo and oocyte freezing interms of fertilization rate according to the International standard protocol. The combination of cryoprotectants and regimes of rapid cooling and rinsing during warming often allows successful cryopreservation of biological materials, particularly cell suspensions or thin tissue samples. Examples include semen, blood, tissue samples like tumors, histological cross-sections, human eggs and human embryos. Although presently many studies have reported that the children born from frozen embryos or "frosties," show consistently positive results with no increase in birth defects or development abnormalities is quite good enough and similar to our study (50-85%). We ensure that cryopreservation technology provided useful cell survivability, tissue and organ preservation in a proper way. Although it varies according to different laboratory conditions, it is certainly beneficial for patient's treatment and research. Further studies are needed for standardization and development of new protocol.

  8. On Numerical Methods for Including the Effect of Capillary Pressure Forces on Two-phase, Immiscible Flow in a Layered Porous Medium

    Energy Technology Data Exchange (ETDEWEB)

    Ersland, B.G.

    1996-05-01

    This mathematical doctoral thesis contains the theory, algorithms and numerical simulations for a heterogeneous oil reservoir. It presents the equations, which apply to immiscible and incompressible two-phase fluid flow in the reservoir, including the effect of capillary pressure forces, and emphasises in particular the interior boundary conditions at the interface between two sediments. Two different approaches are discussed. The first approach is to decompose the computational domain along the interior boundary and iterate between the subdomains until mass balance is achieved. The second approach accounts for the interior boundary conditions in the basis in which the solution is expanded, the basis being discontinuous over the interior boundaries. An overview of the construction of iterative solvers for partial differential equations by means of Schwartz methods is given, and the algorithm for local refinement with Schwartz iterations as iterative solver is described. The theory is then applied to a core plug problem in one and two space dimensions and the results of different methods compared. A general description is given of the computer simulation model, which is implemented in C++. 64 refs., 49 figs., 7 tabs.

  9. Derivatization method of free cyanide including cyanogen chloride for the sensitive analysis of cyanide in chlorinated drinking water by liquid chromatography-tandem mass spectrometry.

    Science.gov (United States)

    Kang, Hye-In; Shin, Ho-Sang

    2015-01-20

    A novel derivatization method of free cyanide (HCN + CN(-)) including cyanogen chloride in chlorinated drinking water was developed with d-cysteine and hypochlorite. The optimum conditions (0.5 mM D-cysteine, 0.5 mM hypochlorite, pH 4.5, and a reaction time of 10 min at room temperature) were established by the variation of parameters. Cyanide (C(13)N(15)) was chosen as an internal standard. The formed β-thiocyanoalanine was directly injected into a liquid chromatography-tandem mass spectrometer without any additional extraction or purification procedures. Under the established conditions, the limits of detection and the limits of quantification were 0.07 and 0.2 μg/L, respectively, and the interday relative standard deviation was less than 4% at concentrations of 4.0, 20.0, and 100.0 μg/L. The method was successfully applied to determine CN(-) in chlorinated water samples. The detected concentration range and detection frequency of CN(-) were 0.20-8.42 μg/L (14/24) in source drinking water and 0.21-1.03 μg/L (18/24) in chlorinated drinking water.

  10. First cytogenetic analysis of Ichthyoelephas humeralis (Günther, 1860 by conventional and molecular methods with comments on the karyotypic evolution in Prochilodontidae

    Directory of Open Access Journals (Sweden)

    Mauro Nirchio Tursellino

    2016-11-01

    Full Text Available We used conventional cytogenetic techniques (Giemsa, C-banding, Ag-NOR, and fluorescent in situ hybridization (FISH with 5S and 18S rDNA probes to investigate the karyotype and cytogenetic characteristics of Ichthyoelephas humeralis (Günther, 1860 from Ecuador. The specimens studied have a karyotype with 2n=54 biarmed chromosomes (32 M + 22 SM and C-positive heterochromatin located on the centromeric, pericentromeric, interstitial, and terminal regions of some chromosomes. The nucleolus organizer regions occurred terminally on the long arm of chromosome pair 2. FISH confirmed the presence of only one 18S rDNA cluster with nonsyntenic localization with the 5S rDNA. Cytogenetic data allow us to refute the earlier morphological hypothesis of a sister relationship between Semaprochilodus Fowler, 1941 and Ichthyoelephas Posada Arango, 1909 and support the molecular proposal that Ichthyoelephas is a sister group to the monophyletic clade containing Prochilodus Agassiz, 1829 and Semaprochilodus.

  11. The efficiency of conventional microscopic selection is comparable to the hyaluronic acid binding method in selecting spermatozoa for male infertility patients.

    Science.gov (United States)

    Huang, Meng-Ting; Kuo-Kuang Lee, Robert; Lu, Chung-Hao; Chen, Ying-Jie; Li, Sheng-Hsiang; Hwu, Yuh-Ming

    2015-02-01

    To evaluate if hyaluronic acid (HA)-bound spermatozoa surpassed conventional microscopy-selected spermatozoa in the status of sperm DNA integrity by acridine orange (AO) fluorescence staining. Spermatozoa obtained from couples with indication for the intracytoplasmic sperm injection (ICSI) procedure due to male infertility (n = 34) and control males with normal sperm parameters (n = 12) were analyzed using AO fluorescence staining after density-gradient centrifugation (DGC), polyvinylpyrrolidone (PVP)-microscopic selection, and HA-binding selection to determine sperm DNA integrity. Percentages of DNA intact spermatozoa with green fluorescence were significantly higher in both PVP-microscopic selected spermatozoa (82.1 ± 24.0%) and HA-bound spermatozoa (83.9 ± 21.1%) than in spermatozoa prepared by DGC (66.8 ± 24.0%). However, there was no significant difference between the PVP-sperm and HA-sperm groups. When the percentage of green fluorescent spermatozoa prepared by DGC fell initially below 68%, both PVP-microscopic and HA-binding selection failed to select over 90% spermatozoa with intact DNA for ICSI in the male infertility group. Compared to control males with normal sperm parameters (99.3 ± 1.8%), the proportion of green fluorescence sperm after HA-binding selection from couples with male infertility (83.9 ± 21.1%) did not reach the range of > 99% reported by Yagci et al. The percentages of DNA intact spermatozoa between the PVP-sperm and HA-sperm groups were not significantly different. In an ICSI procedure, a well-trained embryologist will have the same ability to choose sperm with intact DNA by conventional microscopic selection as with HA-bound spermatozoa selection. Copyright © 2014. Published by Elsevier B.V.

  12. Spray-combustion process characterization in a common rail diesel engine fuelled with butanol-diesel blends by conventional methods and optical diagnostics

    Directory of Open Access Journals (Sweden)

    Simona Silvia Merola

    2014-04-01

    Full Text Available The target of a sustainable mobility has led to investigate advanced combustion modes and fuels technologies. On the other side, the increasing global energy demand and the decreasing fossil-energy resources are enhancing the interest in the use of renewable alternative fuels for compression ignition engines with the target of near-zero emission levels. Although performance and emissions of alternative-fuel within light-duty diesel engines have been extensively investigated, results of fuel chemical composition impact on combustion by integrated optical methodologies are lacking. In order to meet this challenge, one of the main objectives of the research efforts is to characterize the combustion and species evolution. In this investigation, conventional tests and optical diagnostics were employed to enhance the comprehension of the combustion process and chemical markers in a common rail compression ignition engine powered by butanol-diesel blends. The investigation was focused on the effect of the injection strategy and blend composition on in-cylinder spray combustion and soot formation, through UV-visible digital imaging and natural emission spectroscopy. Experiments were performed in an optically accessible single cylinder high swirl compression ignition engine, equipped with a common rail multi-jets injection system. UV-visible emission spectroscopy was used to follow the evolution of the combustion process chemical markers. Spectral features of OH were identified and followed during the spray combustion process examining different pilot-main dwell timings. Soot spectral evidence in the visible wavelength range was correlated to soot engine out emissions. In this work, conventional and optical data related to diesel fuel blended with 40 % of n-butanol will be presented.

  13. Influence of Kosher (Shechita) and conventional slaughter ...

    African Journals Online (AJOL)

    Influence of Kosher (Shechita) and conventional slaughter techniques on shear force, drip and cooking loss of beef. ... South African Journal of Animal Science ... force values for meat samples from cattle slaughtered by the Kosher method compared to those from cattle slaughtered by the conventional slaughter method.

  14. DEVELOPMENT OF A HYDRODYNAMIC MODEL OF A HYDROCYCLONE INCLUDING THE SIMULATION OF AIR-CORE EFFECT, USING THE FINITE VOLUME METHOD

    Directory of Open Access Journals (Sweden)

    Gabriel Felipe Aguilera

    2014-07-01

    Full Text Available The hydrocyclone is one of the most used classification equipment in industry, particularly in mineral processing. Maybe its main characteristic is to be a hydrodynamic separation equipment, whereby it has a high production capability and different levels of efficiency are depending on the geometrical configuration, operational parameters and the type of material to be processed. Nevertheless, there are a few successful studies regarding the modelling and simulation of its hydrodynamic principles, because the flow behavior inside is quite complex. Most of the current models are empirical and they are not applicable to all cases and types of minerals. One of the most important problems to be solved, besides the cut size and the effect of the physical properties of the particles, is the distribution of the flow inside the hydrocyclone, because if the work of the equipment is at low slurry densities, very clear for small hydrocyclones, its mechanic behavior is a consequence of the kind of liquid used as continuous phase, being water the most common liquid. This work shows the modelling and simulation of the hydrodynamic behavior of a suspension inside a hydrocyclone, including the air core effect, through the use of finite differences method. For the developing of the model, the Reynolds Stress Model (RSM for the evaluation of turbulence, and the Volume of Fluid (VOF to study the interaction between water and air were used. Finally, the model shows to be significant for experimental data, and for different conditions of an industrial plant.

  15. 9th Structural Engineering Convention 2014

    CERN Document Server

    2015-01-01

    The book presents research papers presented by academicians, researchers, and practicing structural engineers from India and abroad in the recently held Structural Engineering Convention (SEC) 2014 at Indian Institute of Technology Delhi during 22 – 24 December 2014. The book is divided into three volumes and encompasses multidisciplinary areas within structural engineering, such as earthquake engineering and structural dynamics, structural mechanics, finite element methods, structural vibration control, advanced cementitious and composite materials, bridge engineering, and soil-structure interaction. Advances in Structural Engineering is a useful reference material for structural engineering fraternity including undergraduate and postgraduate students, academicians, researchers and practicing engineers.

  16. Technical meeting on lessons learned with respect to SAT implementation, including development of trainers and use of cost effective training methods

    International Nuclear Information System (INIS)

    2002-01-01

    The past years have brought some significant changes in the world energy market, where the nuclear power plants and utilities are operating. Part of NPPs is privatised now; the electricity markets are liberalized and become more and more international. Due to the increase of competition, the power production costs are now monitored more closely than before. The opening of electricity markets has led the nuclear power plants to be under the serious economic pressure with a demand for continuous cost reduction. All these require from NPPs to make their personnel training more cost-effective. In addition, based on modern technology, a great amount of new training tools, aids and technologies have been introduced during the last 2-3 years, these new opportunities can be quite useful for training cost optimization. On the basis of experience gained worldwide in the application of the systematic approach to training (SAT), SAT based training is now a broad integrated approach emphasizing not only technical knowledge and skills but also human factor related knowledge, skills and attitudes. In this way, all competency requirements for attaining and maintaining personnel competence and qualification can be met, thus promoting and strengthening quality culture and safety culture, which should be fostered throughout the initial and continuing training programmes. The subject of the present technical meeting was suggested by the members of the Technical Working Group on Training and Qualification of NPP Personnel (TWG-T and Q) and supported by a number of the IAEA meetings on NPP personnel training. The technical Meeting on 'Lessons Learned with Respect to SAT Implementation, Including Development of Trainers and Use of Cost Effective Training Methods' was organized by the IAEA in co-operation with the Tecnatom A.S. and was held from 21 to 24 October 2002 in San Sebastian de los Reyes/ Madrid, Spain. The main objective of the meeting was to provide an international forum for

  17. A novel method of placing right ventricular leads in patients with persistent left superior vena cava using a conventional j stylet.

    Science.gov (United States)

    Mora, Guillermo

    2014-03-01

    Locating pacemaker electrodes can become complicated by congenital abnormalities such as persistent left superior vena cava (LSVC). To evaluate a technique for the implanting of ventricular electrode in patients with persistent LSVC. The study was carried out from June 2001 to June 2010 involving all patients who were admitted to the Hospital Universitario Mayor, Instituto de Corazon de Bogota and Hospital Universitario Clinica San Rafael (Bogota-Colombia) for implanting pacemakers or cardiac defibrillators. LSVC was diagnosed by fluoroscopic observation (anterior-posterior view) of the course of the stylet. Four steps were followed: 1) Move the electrode with a straight stylet to the right atrium. 2) Change the straight stylet by a conventional J stylet and push the electrode to the lateral or anterolateral wall of the right atrium. 3) Remove the guide 3-5 cm and 4) Push the electrode which crosses the tricuspid valve into the right ventricle and finally deploy the active fixation mechanism. A total of 1198 patients were admitted for pacemaker or cardiac defibrillator implant during the 9-year study period, 1114 received a left subclavian venous approach. There were 573 males and 541 females. Persistent LSVC was found in five patients (0.45%) Fluoroscopy time for implanting the ventricular electrode ranged from 60 to 250 seconds, 40 to 92 minutes being taken to complete the whole procedure. We present a simple and rapid technique for electrode placement in patients with LSVC using usual J guide and active fixation electrodes with high success.

  18. Lack of concordance between a rapid bedside and conventional laboratory method of cardiac troponin testing: impact on risk stratification of patients suspected of acute coronary syndrome.

    NARCIS (Netherlands)

    Cramer, G.E.; Kievit, P.C.; Brouwer, M.A.; Keijzer, M.H. de; Luijten, H.E.; Verheugt, F.W.A.

    2007-01-01

    OBJECTIVES: This study was designed to test the usefulness of a bedside assay as compared to a laboratory method of troponin testing to predict adverse cardiac outcome of chest pain patients. METHODS: We studied 358 ER visits of patients suspected of a non ST-elevation acute coronary syndrome. cTnI

  19. Minamata Convention on Mercury

    Science.gov (United States)

    On November 6, 2013 the United States signed the Minamata Convention on Mercury, a new multilateral environmental agreement that addresses specific human activities which are contributing to widespread mercury pollution

  20. Stakeholders' perception on including broader economic impact of vaccines in economic evaluations in low and middle income countries: a mixed methods study.

    Science.gov (United States)

    van der Putten, Ingeborg M; Evers, Silvia M A A; Deogaonkar, Rohan; Jit, Mark; Hutubessy, Raymond C W

    2015-04-10

    Current health economic evaluation guidelines mainly concentrate on immediate health gains and cost savings for the individual involved in the intervention. However, it has been argued that these guidelines are too narrow to capture the full impact of vaccination in low and middle income countries. The inclusion of broader economic impact of vaccines (BEIV) has therefore been proposed. Some examples of these are productivity-related gains, macro-economic impact, and different externalities. Despite their potency, the extent to which such benefits can and should be incorporated into economic evaluations of vaccination is still unclear. This mixed methods study aims to assess the relevance of BEIV to different stakeholders involved in the vaccine introduction decision making process. In this mixed method study an internet based survey was sent to attendees of the New and Underutilized Vaccines Initiative meeting in Montreux, Switzerland in 2011. Additionally, semi-structured interviews of 15 minutes each were conducted during the meeting. Study participants included decision makers, experts and funders of vaccines and immunization programs in low and middle income countries. Descriptive analysis of the survey, along with identification of common themes and factors extracted from the interviews and open survey questions was undertaken. Evidence on macro-economic impact, burden of disease and ecological effects were perceived as being most valuable towards aiding decision making for vaccine introduction by the 26 survey respondents. The 14 interviewees highlighted the importance of burden of disease and different types of indirect effects. Furthermore, some new interpretations of BEIVs were discussed, such as the potential negative impact of wastage during immunization programs and the idea of using vaccines as a platform for delivering other types of health interventions. Interviewees also highlighted the importance of using a broader perspective in connection to

  1. Comparative evaluation of matrix-assisted laser desorption ionisation-time of flight mass spectrometry and conventional phenotypic-based methods for identification of clinically important yeasts in a UK-based medical microbiology laboratory.

    Science.gov (United States)

    Fatania, Nita; Fraser, Mark; Savage, Mike; Hart, Jason; Abdolrasouli, Alireza

    2015-12-01

    Performance of matrix-assisted laser desorption ionisation-time of flight mass spectrometry (MALDI-TOF MS) was compared in a side-by side-analysis with conventional phenotypic methods currently in use in our laboratory for identification of yeasts in a routine diagnostic setting. A diverse collection of 200 clinically important yeasts (19 species, five genera) were identified by both methods using standard protocols. Discordant or unreliable identifications were resolved by sequencing of the internal transcribed spacer region of the rRNA gene. MALDI-TOF and conventional methods were in agreement for 182 isolates (91%) with correct identification to species level. Eighteen discordant results (9%) were due to rarely encountered species, hence the difficulty in their identification using traditional phenotypic methods. MALDI-TOF MS enabled rapid, reliable and accurate identification of clinically important yeasts in a routine diagnostic microbiology laboratory. Isolates with rare, unusual or low probability identifications should be confirmed using robust molecular methods. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  2. Choledochal cyst: Comparison of MR and conventional cholangiography

    International Nuclear Information System (INIS)

    Kim, S.H.; Lim, J.H.; Yoon, H.-K.; Han, B.K.; Lee, S.K.; Kim, Y.I.

    2000-01-01

    AIMS: To assess the diagnostic value of magnetic resonance (MR) cholangiography versus conventional cholangiography in patients with choledochal cyst and to determine whether MR cholangiography can be considered an alternative to conventional cholangiography. MATERIALS AND METHODS: Thirteen patients with choledochal cyst were examined by MR cholangiography and conventional cholangiograms. Magnetic resonance cholangiography employed T2-weighted axial and coronal fast spin-echo, single and multislab single-shot fast spin-echo sequences, including source images with maximum intensity projections. The diagnostic value of MR cholangiography and conventional cholangiograms was assessed and compared using the criteria of depiction of morphology, anomalous pancreaticobiliary duct union and demonstration of complications such as stones. A four-point diagnostic scale was applied to the delineation of the ductal anatomy with the Wilcoxon signed-ranks test and McNemar's test used for statistical analysis. RESULTS: The depiction of the choledochal cyst was significantly better with MR cholangiography than with conventional cholangiography (P 0.03). The detection rate of an anomalous pancreaticobiliary duct union was not significantly different with either method (P = 0.641), nor was the detection rate of bile duct stones (P = 0.375). CONCLUSION: Magnetic resonance cholangiography provides data equivalent to or superior to those from conventional cholangiography in evaluating choledochal cyst. Magnetic resonance cholangiography is recommended as a non-invasive examination of choice for the evaluation of choledochal cyst. Kim, S.H. (2000). Clinical Radiology 55, 378-383

  3. Comparison of the CoaguChek XS handheld coagulation analyzer and conventional laboratory methods measuring international normalised ratio (INR) values during the time to therapeutic range after mechanical valve surgery.

    Science.gov (United States)

    Bardakci, Hasmet; Altıntaş, Garip; Çiçek, Omer Faruk; Kervan, Umit; Yilmaz, Sevinc; Kaplan, Sadi; Birincioglu, Cemal Levent

    2013-05-01

    To compare the international normalised ratio (INR) value of patients evaluated using the CoaguChek XS versus conventional laboratory methods, in the period after open-heart surgery for mechanical valve replacement until a therapeutic range is achieved using vitamin K antagonists (VKA) together with low molecular weight heparin (LMWH). One hundred and five patients undergoing open-heart surgery for mechanical valve replacement were enrolled. Blood samples were collected from patients before surgery, and on the second and fifth postoperative days, simultaneously for both the point of care device and conventional laboratory techniques. Patients were administered VKA together with LMWH at therapeutic doses (enoxaparin 100 IU/kg twice daily) subcutaneously, until an effective range was achieved on approximately the fifth day after surgery. The mean INR values using the CoaguChek XS preoperatively and on the second and fifth days postoperatively were 1.20 (SD ± 0.09), 1.82 (SD ± 0.45), and 2.55 (SD ± 0.55), respectively. Corresponding results obtained using conventional laboratory techniques were 1.18 (SD ± 0.1), 1.81 (SD ± 0.43), and 2.51 (SD ± 0.58). The correlation coefficient was r = 0.77 preoperatively, r = 0.981 on postoperative day 2, and r = 0.983 on postoperative day 5. Results using the CoaguChek XS Handheld Coagulation Analyzer correlated strongly with conventional laboratory methods, in the bridging period between open-heart surgery for mechanical valve replacement and the achievement of a therapeutic range on warfarin and LMWH. © 2013 Wiley Periodicals, Inc.

  4. Characteristic comparison of triglyceride-rich remnant lipoprotein measurement between a new homogenous assay (RemL-C and a conventional immunoseparation method (RLP-C

    Directory of Open Access Journals (Sweden)

    Saikawa Shinichi

    2008-05-01

    Full Text Available Abstract Background Increased serum remnant lipoproteins are supposed to predict cardiovascular disease in addition to increased LDL. A new homogenous assay for remnant lipoprotein-cholesterol (RemL-C has been developed as an alternative to remnant-like particle-cholesterol (RLP-C, an immunoseparation assay, widely used for the measurement of remnant lipoprotein cholesterol. Methods We evaluated the correlations and data validation between the 2 assays in 83 subjects (49 men and 34 women without diabetes, hypertension and medications for hyperlipidemia, diabetes, and hypertension, and investigated the characteristics of remnant lipoproteins obtained by the two methods (RLP-C and RemL-C and their relationships with IDL-cholesterol determined by our developed HPLC method. Results A positive correlation was significantly found between the two methods (r = 0.853, 95%CI 0.781–0.903, p RLP-C level. RemL-C (r = 0.339, 95%CI 0.152–0.903; p = 0.0005 significantly correlated with IDL-cholesterol, but not RLP-C (r = 0.17, 95%CI -0.047–0.372; p = 0.1237 in all the samples (n = 83. Conclusion These results suggest that there is generally a significant correlation between RemL-C and RLP-C. However, RemL-C assay is likely to reflect IDL more closely than RLP-C.

  5. "La Palabra Es Salud" (The Word Is Health): Combining Mixed Methods and CBPR to Understand the Comparative Effectiveness of Popular and Conventional Education

    Science.gov (United States)

    Wiggins, Noelle; Hughes, Adele; Rodriguez, Adriana; Potter, Catherine; Rios-Campos, Teresa

    2014-01-01

    Increasing recognition of the role of social conditions in health has led to calls for methods that can be used to change social conditions. Popular education has demonstrated great promise as a methodology that can be used to address the underlying social and structural determinants of health. To date, most studies of popular education have used…

  6. Electrolyte for a lithium/thionyl chloride electric cell, a method of preparing said electrolyte and an electric cell which includes said electrolyte

    Energy Technology Data Exchange (ETDEWEB)

    Gabano, J.

    1983-03-01

    An electrolyte for an electric cell whose negative active material is constituted by lithium and whose positive active material is constituted by thionyl chloride. The electrolyte contains at least one solvent and at least one solute, said solvent being thionyl chloride and said solute being chosen from the group which includes lithium tetrachloroaluminate and lithium hexachloroantimonate. According to the invention said electrolyte further includes a complex chosen from the group which includes AlCl/sub 3/,SO/sub 2/ and SbCl/sub 5/,SO/sub 2/. The voltage rise of electric cells which include such an electrolyte takes negligible time.

  7. Determination of boron in graphite, boron carbide and glass by ICP-MS, ICP-OES and conventional wet chemical methods

    International Nuclear Information System (INIS)

    Venkatesh, K.; Kamble, Granthali S.; Venkatesh, Manisha; Kumar, Sanjukta A.; Reddy, A.V.R.

    2014-01-01

    Boron is an important element of interest in nuclear reactor materials due to its high neutron absorption cross section (σ 0 =3837 barns for 10 B). In the present paper, R and D work and routinely used methods have been described for the analysis of case samples (1) Graphite where boron is present at trace levels, (2) Boron Carbide having boron concentration of about 80% and (3) Glass containing 4-6 % boron. (author)

  8. The use of microbead-based spoligotyping for Mycobacterium tuberculosis complex to evaluate the quality of the conventional method: Providing guidelines for Quality Assurance when working on membranes

    Directory of Open Access Journals (Sweden)

    Garzelli Carlo

    2011-04-01

    Full Text Available Abstract Background The classical spoligotyping technique, relying on membrane reverse line-blot hybridization of the spacers of the Mycobacterium tuberculosis CRISPR locus, is used world-wide (598 references in Pubmed on April 8th, 2011. However, until now no inter-laboratory quality control study had been undertaken to validate this technique. We analyzed the quality of membrane-based spoligotyping by comparing it to the recently introduced and highly robust microbead-based spoligotyping. Nine hundred and twenty-seven isolates were analyzed totaling 39,861 data points. Samples were received from 11 international laboratories with a worldwide distribution. Methods The high-throughput microbead-based Spoligotyping was performed on CTAB and thermolyzate DNA extracted from isolated Mycobacterium tuberculosis complex (MTC strains coming from the genotyping participating centers. Information regarding how the classical Spoligotyping method was performed by center was available. Genotype discriminatory analyses were carried out by comparing the spoligotypes obtained by both methods. The non parametric U-Mann Whitney homogeneity test and the Spearman rank correlation test were performed to validate the observed results. Results Seven out of the 11 laboratories (63 %, perfectly typed more than 90% of isolates, 3 scored between 80-90% and a single center was under 80% reaching 51% concordance only. However, this was mainly due to discordance in a single spacer, likely having a non-functional probe on the membrane used. The centers using thermolyzate DNA performed as well as centers using the more extended CTAB extraction procedure. Few centers shared the same problematic spacers and these problematic spacers were scattered over the whole CRISPR locus (Mostly spacers 15, 14, 18, 37, 39, 40. Conclusions We confirm that classical spoligotyping is a robust method with generally a high reliability in most centers. The applied DNA extraction procedure (CTAB

  9. Ultrasonic-energy enhance the ionic liquid-based dual microextraction to preconcentrate the lead in ground and stored rain water samples as compared to conventional shaking method.

    Science.gov (United States)

    Nizamani, Sooraj; Kazi, Tasneem G; Afridi, Hassan I

    2018-01-01

    An efficient preconcentration technique based on ultrasonic-assisted ionic liquid-based dual microextraction (UA-ILDµE) method has been developed to preconcentrate the lead (Pb +2 ) in ground and stored rain water. In the current proposed method, Pb +2 was complexed with a chelating agent (dithizone), whereas an ionic liquid (1-butyl-3-methylimidazolium hexafluorophosphate) was used for extraction purpose. The ultrasonic irradiation and electrical shaking system were applied to enhance the dispersion and extraction of Pb +2 complex in aqueous samples. For second phase, dual microextraction (DµE phase), the enriched Pb +2 complex in ionic liquid, extracted back into the acidic aqueous solution and finally determined by flame atomic absorption spectrometry. Some major analytical parameters that influenced the extraction efficiency of developed method, such as pH, concentration of ligand, volume of ionic liquid and samples, time of shaking in thermostatic electrical shaker and ultrasonic bath, effect of back extracting HNO 3 volume, matrix effect, centrifugation time and rate were optimized. At the sample volume of 25mL, the calculated preconcentration factor was 62.2. The limit of detection of proposed procedure for Pb +2 ions was found to be 0.54μgL -1 . The validation of developed method was performed by the analysis of certified sample of water SRM 1643e and standard addition method in a real water sample. The extraction recovery of Pb +2 was enhanced≥2% with shaking time of 80s in ultrasonic bath as compared to used thermostatic electrical shaker, where for optimum recovery up to 10min was required. The developed procedure was successfully used for the enrichment of Pb +2 in ground and stored rain water (surface water) samples of an endemic region of Pakistan. The resulted data indicated that the ground water samples were highly contaminated with Pb +2 , while some of the surface water samples were also have higher values of Pb +2 than permissible limit of