WorldWideScience

Sample records for methods derived include

  1. Inferring time derivatives including cell growth rates using Gaussian processes

    Science.gov (United States)

    Swain, Peter S.; Stevenson, Keiran; Leary, Allen; Montano-Gutierrez, Luis F.; Clark, Ivan B. N.; Vogel, Jackie; Pilizota, Teuta

    2016-12-01

    Often the time derivative of a measured variable is of as much interest as the variable itself. For a growing population of biological cells, for example, the population's growth rate is typically more important than its size. Here we introduce a non-parametric method to infer first and second time derivatives as a function of time from time-series data. Our approach is based on Gaussian processes and applies to a wide range of data. In tests, the method is at least as accurate as others, but has several advantages: it estimates errors both in the inference and in any summary statistics, such as lag times, and allows interpolation with the corresponding error estimation. As illustrations, we infer growth rates of microbial cells, the rate of assembly of an amyloid fibril and both the speed and acceleration of two separating spindle pole bodies. Our algorithm should thus be broadly applicable.

  2. Catalyst support structure, catalyst including the structure, reactor including a catalyst, and methods of forming same

    Science.gov (United States)

    Van Norman, Staci A.; Aston, Victoria J.; Weimer, Alan W.

    2017-05-09

    Structures, catalysts, and reactors suitable for use for a variety of applications, including gas-to-liquid and coal-to-liquid processes and methods of forming the structures, catalysts, and reactors are disclosed. The catalyst material can be deposited onto an inner wall of a microtubular reactor and/or onto porous tungsten support structures using atomic layer deposition techniques.

  3. Microfluidic devices and methods including porous polymer monoliths

    Science.gov (United States)

    Hatch, Anson V; Sommer, Gregory J; Singh, Anup K; Wang, Ying-Chih; Abhyankar, Vinay V

    2014-04-22

    Microfluidic devices and methods including porous polymer monoliths are described. Polymerization techniques may be used to generate porous polymer monoliths having pores defined by a liquid component of a fluid mixture. The fluid mixture may contain iniferters and the resulting porous polymer monolith may include surfaces terminated with iniferter species. Capture molecules may then be grafted to the monolith pores.

  4. Methods of producing adsorption media including a metal oxide

    Science.gov (United States)

    Mann, Nicholas R; Tranter, Troy J

    2014-03-04

    Methods of producing a metal oxide are disclosed. The method comprises dissolving a metal salt in a reaction solvent to form a metal salt/reaction solvent solution. The metal salt is converted to a metal oxide and a caustic solution is added to the metal oxide/reaction solvent solution to adjust the pH of the metal oxide/reaction solvent solution to less than approximately 7.0. The metal oxide is precipitated and recovered. A method of producing adsorption media including the metal oxide is also disclosed, as is a precursor of an active component including particles of a metal oxide.

  5. Approximate methods for derivation of covariance data

    International Nuclear Information System (INIS)

    Tagesen, S.

    1992-01-01

    Several approaches for the derivation of covariance information for evaluated nuclear data files (EFF2 and ENDF/B-VI) have been developed and used at IRK and ORNL respectively. Considerations, governing the choice of a distinct method depending on the quantity and quality of available data are presented, advantages/disadvantages are discussed and examples of results are given

  6. Unsteady panel method for complex configurations including wake modeling

    CSIR Research Space (South Africa)

    Van Zyl, Lourens H

    2008-01-01

    Full Text Available implementations of the DLM are however not very versatile in terms of geometries that can be modeled. The ZONA6 code offers a versatile surface panel body model including a separated wake model, but uses a pressure panel method for lifting surfaces. This paper...

  7. Combined chemotherapy including platinum derivatives for medulloblastoma. The usefulness as maintenance chemotherapy

    International Nuclear Information System (INIS)

    Sasaki, Hikaru; Otani, Mitsuhiro; Yoshida, Kazunari; Kagami, Hiroshi; Shimazaki, Kenji; Toya, Shigeo; Kawase, Takeshi

    1997-01-01

    The authors reviewed 24 cerebellar medulloblastoma patients treated at Keio University to determine usefulness of combined chemotherapy including platinum derivatives (cisplatin, carboplatin) as the induction and maintenance treatment. All patients underwent radical surgery and craniospinal irradiation. Ten received adjuvant chemotherapy other than platinum derivatives (mainly with nitrosourea compounds), five were treated by induction and maintenance chemotherapy including platinum derivatives, and nine patients did not undergo chemotherapy. The progression-free survival rate of patients treated with platinum derivatives was better than that of patients treated with other modes of chemotherapy and also that of patients who did not receive chemotherapy. The results were especially good in the case of four patients treated with maintenance chemotherapy consisting of carboplatin and etoposide, two of whom had been free from relapse beyond the risk period of Collins. The occurrences of toxicity in maintenance chemotherapy with carboplatin and etoposide were limited to transient leucopenia. The present study indicates combined chemotherapy including platinum derivatives benefits patients with medulloblastoma, and could be useful, especially as maintenance treatment. (author)

  8. Initiation devices, initiation systems including initiation devices and related methods

    Energy Technology Data Exchange (ETDEWEB)

    Daniels, Michael A.; Condit, Reston A.; Rasmussen, Nikki; Wallace, Ronald S.

    2018-04-10

    Initiation devices may include at least one substrate, an initiation element positioned on a first side of the at least one substrate, and a spark gap electrically coupled to the initiation element and positioned on a second side of the at least one substrate. Initiation devices may include a plurality of substrates where at least one substrate of the plurality of substrates is electrically connected to at least one adjacent substrate of the plurality of substrates with at least one via extending through the at least one substrate. Initiation systems may include such initiation devices. Methods of igniting energetic materials include passing a current through a spark gap formed on at least one substrate of the initiation device, passing the current through at least one via formed through the at least one substrate, and passing the current through an explosive bridge wire of the initiation device.

  9. On the Exploitation of Sensitivity Derivatives for Improving Sampling Methods

    Science.gov (United States)

    Cao, Yanzhao; Hussaini, M. Yousuff; Zang, Thomas A.

    2003-01-01

    Many application codes, such as finite-element structural analyses and computational fluid dynamics codes, are capable of producing many sensitivity derivatives at a small fraction of the cost of the underlying analysis. This paper describes a simple variance reduction method that exploits such inexpensive sensitivity derivatives to increase the accuracy of sampling methods. Three examples, including a finite-element structural analysis of an aircraft wing, are provided that illustrate an order of magnitude improvement in accuracy for both Monte Carlo and stratified sampling schemes.

  10. A topological derivative method for topology optimization

    DEFF Research Database (Denmark)

    Norato, J.; Bendsøe, Martin P.; Haber, RB

    2007-01-01

    resource constraint. A smooth and consistent projection of the region bounded by the level set onto the fictitious analysis domain simplifies the response analysis and enhances the convergence of the optimization algorithm. Moreover, the projection supports the reintroduction of solid material in void......We propose a fictitious domain method for topology optimization in which a level set of the topological derivative field for the cost function identifies the boundary of the optimal design. We describe a fixed-point iteration scheme that implements this optimality criterion subject to a volumetric...... regions, a critical requirement for robust topology optimization. We present several numerical examples that demonstrate compliance minimization of fixed-volume, linearly elastic structures....

  11. A FILTRATION METHOD AND APPARATUS INCLUDING A ROLLER WITH PORES

    DEFF Research Database (Denmark)

    2008-01-01

    The present invention offers a method for separating dry matter from a medium. A separation chamber is at least partly defined by a plurality of rollers (2,7) and is capable of being pressure regulated. At least one of the rollers is a pore roller (7) having a surface with pores allowing permeabi...

  12. Composite material including nanocrystals and methods of making

    Science.gov (United States)

    Bawendi, Moungi G.; Sundar, Vikram C.

    2010-04-06

    Temperature-sensing compositions can include an inorganic material, such as a semiconductor nanocrystal. The nanocrystal can be a dependable and accurate indicator of temperature. The intensity of emission of the nanocrystal varies with temperature and can be highly sensitive to surface temperature. The nanocrystals can be processed with a binder to form a matrix, which can be varied by altering the chemical nature of the surface of the nanocrystal. A nanocrystal with a compatibilizing outer layer can be incorporated into a coating formulation and retain its temperature sensitive emissive properties.

  13. Methods for forming complex oxidation reaction products including superconducting articles

    International Nuclear Information System (INIS)

    Rapp, R.A.; Urquhart, A.W.; Nagelberg, A.S.; Newkirk, M.S.

    1992-01-01

    This patent describes a method for producing a superconducting complex oxidation reaction product of two or more metals in an oxidized state. It comprises positioning at least one parent metal source comprising one of the metals adjacent to a permeable mass comprising at least one metal-containing compound capable of reaction to form the complex oxidation reaction product in step below, the metal component of the at least one metal-containing compound comprising at least a second of the two or more metals, and orienting the parent metal source and the permeable mass relative to each other so that formation of the complex oxidation reaction product will occur in a direction towards and into the permeable mass; and heating the parent metal source in the presence of an oxidant to a temperature region above its melting point to form a body of molten parent metal to permit infiltration and reaction of the molten parent metal into the permeable mass and with the oxidant and the at least one metal-containing compound to form the complex oxidation reaction product, and progressively drawing the molten parent metal source through the complex oxidation reaction product towards the oxidant and towards and into the adjacent permeable mass so that fresh complex oxidation reaction product continues to form within the permeable mass; and recovering the resulting complex oxidation reaction product

  14. Membrane for distillation including nanostructures, methods of making membranes, and methods of desalination and separation

    KAUST Repository

    Lai, Zhiping; Huang, Kuo-Wei; Chen, Wei

    2016-01-01

    In accordance with the purpose(s) of the present disclosure, as embodied and broadly described herein, embodiments of the present disclosure provide membranes, methods of making the membrane, systems including the membrane, methods of separation, methods of desalination, and the like.

  15. Membrane for distillation including nanostructures, methods of making membranes, and methods of desalination and separation

    KAUST Repository

    Lai, Zhiping

    2016-01-21

    In accordance with the purpose(s) of the present disclosure, as embodied and broadly described herein, embodiments of the present disclosure provide membranes, methods of making the membrane, systems including the membrane, methods of separation, methods of desalination, and the like.

  16. Second derivative continuous linear multistep methods for the ...

    African Journals Online (AJOL)

    step methods (LMM), with properties that embed the characteristics of LMM and hybrid methods. This paper gives a continuous reformulation of the Enright [5] second derivative methods. The motivation lies in the fact that the new formulation ...

  17. Upgrading including heteroatom removal from Victorian brown coal-derived liquids

    Energy Technology Data Exchange (ETDEWEB)

    Larkins, F.P.; Youings, J.C.; Jackson, W.R.; Park, D. (University of Tasmania, Hobart, Tasmania (Australia))

    1989-10-01

    It has been shown using model compounds that the hydrodeoxygenation performance of a catalyst is severely inhibited by the presence of nitrogen-containing compounds under conditions of moderate reaction severity. For a low molecular weight coal-derived liquid commercial catalysts were effective for HDO and HDN at 400{degree}C, 10 MPa H{sub 2} for 30 min reaction time. For a coal-derived liquid high in asphaltene commercial catalysts and others prepared and tested in this study were ineffective. Alternative catalysts and hydrotreating conditions of greater severity will be required for such materials to effect acceptable heteroatom removal. 3 refs., 2 figs., 2 tabs.

  18. System and method for deriving a process-based specification

    Science.gov (United States)

    Hinchey, Michael Gerard (Inventor); Rash, James Larry (Inventor); Rouff, Christopher A. (Inventor)

    2009-01-01

    A system and method for deriving a process-based specification for a system is disclosed. The process-based specification is mathematically inferred from a trace-based specification. The trace-based specification is derived from a non-empty set of traces or natural language scenarios. The process-based specification is mathematically equivalent to the trace-based specification. Code is generated, if applicable, from the process-based specification. A process, or phases of a process, using the features disclosed can be reversed and repeated to allow for an interactive development and modification of legacy systems. The process is applicable to any class of system, including, but not limited to, biological and physical systems, electrical and electro-mechanical systems in addition to software, hardware and hybrid hardware-software systems.

  19. Numerical Method for Darcy Flow Derived Using Discrete Exterior Calculus

    Science.gov (United States)

    Hirani, A. N.; Nakshatrala, K. B.; Chaudhry, J. H.

    2015-05-01

    We derive a numerical method for Darcy flow, and also for Poisson's equation in mixed (first order) form, based on discrete exterior calculus (DEC). Exterior calculus is a generalization of vector calculus to smooth manifolds and DEC is one of its discretizations on simplicial complexes such as triangle and tetrahedral meshes. DEC is a coordinate invariant discretization, in that it does not depend on the embedding of the simplices or the whole mesh. We start by rewriting the governing equations of Darcy flow using the language of exterior calculus. This yields a formulation in terms of flux differential form and pressure. The numerical method is then derived by using the framework provided by DEC for discretizing differential forms and operators that act on forms. We also develop a discretization for a spatially dependent Hodge star that varies with the permeability of the medium. This also allows us to address discontinuous permeability. The matrix representation for our discrete non-homogeneous Hodge star is diagonal, with positive diagonal entries. The resulting linear system of equations for flux and pressure are saddle type, with a diagonal matrix as the top left block. The performance of the proposed numerical method is illustrated on many standard test problems. These include patch tests in two and three dimensions, comparison with analytically known solutions in two dimensions, layered medium with alternating permeability values, and a test with a change in permeability along the flow direction. We also show numerical evidence of convergence of the flux and the pressure. A convergence experiment is included for Darcy flow on a surface. A short introduction to the relevant parts of smooth and discrete exterior calculus is included in this article. We also include a discussion of the boundary condition in terms of exterior calculus.

  20. Improved Riccati Transfer Matrix Method for Free Vibration of Non-Cylindrical Helical Springs Including Warping

    Directory of Open Access Journals (Sweden)

    A.M. Yu

    2012-01-01

    Full Text Available Free vibration equations for non-cylindrical (conical, barrel, and hyperboloidal types helical springs with noncircular cross-sections, which consist of 14 first-order ordinary differential equations with variable coefficients, are theoretically derived using spatially curved beam theory. In the formulation, the warping effect upon natural frequencies and vibrating mode shapes is first studied in addition to including the rotary inertia, the shear and axial deformation influences. The natural frequencies of the springs are determined by the use of improved Riccati transfer matrix method. The element transfer matrix used in the solution is calculated using the Scaling and Squaring method and Pad'e approximations. Three examples are presented for three types of springs with different cross-sectional shapes under clamped-clamped boundary condition. The accuracy of the proposed method has been compared with the FEM results using three-dimensional solid elements (Solid 45 in ANSYS code. Numerical results reveal that the warping effect is more pronounced in the case of non-cylindrical helical springs than that of cylindrical helical springs, which should be taken into consideration in the free vibration analysis of such springs.

  1. MHC class II-derived peptides can bind to class II molecules, including self molecules, and prevent antigen presentation

    DEFF Research Database (Denmark)

    Rosloniec, E F; Vitez, L J; Buus, S

    1990-01-01

    the alpha k-3 peptide binds slightly less well. These combined data, suggesting that class II-derived peptides can bind to MHC class II molecules, including the autologous molecule from which they are derived, have important implications for the molecular basis of alloreactivity and autoreactivity. Further...... found in the first and third polymorphic regions (PMR) of the A alpha k chain (alpha k-1 and alpha k-3) were capable of inhibiting the presentation of three different HEL-derived peptide antigens to their appropriate T cells. In addition, the alpha k-1 peptide inhibited the presentation of the OVA(323......-339) immunodominant peptide to the I-Ad-restricted T cell hybridomas specific for it. Prepulsing experiments demonstrated that the PMR peptides were interacting with the APC and not with the T cell hybridomas. These observations were confirmed and extended by the demonstration that the alpha k-1 and alpha k-3...

  2. Deriving average soliton equations with a perturbative method

    International Nuclear Information System (INIS)

    Ballantyne, G.J.; Gough, P.T.; Taylor, D.P.

    1995-01-01

    The method of multiple scales is applied to periodically amplified, lossy media described by either the nonlinear Schroedinger (NLS) equation or the Korteweg--de Vries (KdV) equation. An existing result for the NLS equation, derived in the context of nonlinear optical communications, is confirmed. The method is then applied to the KdV equation and the result is confirmed numerically

  3. A frequency domain linearized Navier-Stokes method including acoustic damping by eddy viscosity using RANS

    Science.gov (United States)

    Holmberg, Andreas; Kierkegaard, Axel; Weng, Chenyang

    2015-06-01

    In this paper, a method for including damping of acoustic energy in regions of strong turbulence is derived for a linearized Navier-Stokes method in the frequency domain. The proposed method is validated and analyzed in 2D only, although the formulation is fully presented in 3D. The result is applied in a study of the linear interaction between the acoustic and the hydrodynamic field in a 2D T-junction, subject to grazing flow at Mach 0.1. Part of the acoustic energy at the upstream edge of the junction is shed as harmonically oscillating disturbances, which are conveyed across the shear layer over the junction, where they interact with the acoustic field. As the acoustic waves travel in regions of strong shear, there is a need to include the interaction between the background turbulence and the acoustic field. For this purpose, the oscillation of the background turbulence Reynold's stress, due to the acoustic field, is modeled using an eddy Newtonian model assumption. The time averaged flow is first solved for using RANS along with a k-ε turbulence model. The spatially varying turbulent eddy viscosity is then added to the spatially invariant kinematic viscosity in the acoustic set of equations. The response of the 2D T-junction to an incident acoustic field is analyzed via a plane wave scattering matrix model, and the result is compared to experimental data for a T-junction of rectangular ducts. A strong improvement in the agreement between calculation and experimental data is found when the modification proposed in this paper is implemented. Discrepancies remaining are likely due to inaccuracies in the selected turbulence model, which is known to produce large errors e.g. for flows with significant rotation, which the grazing flow across the T-junction certainly is. A natural next step is therefore to test the proposed methodology together with more sophisticated turbulence models.

  4. Composite materials and bodies including silicon carbide and titanium diboride and methods of forming same

    Science.gov (United States)

    Lillo, Thomas M.; Chu, Henry S.; Harrison, William M.; Bailey, Derek

    2013-01-22

    Methods of forming composite materials include coating particles of titanium dioxide with a substance including boron (e.g., boron carbide) and a substance including carbon, and reacting the titanium dioxide with the substance including boron and the substance including carbon to form titanium diboride. The methods may be used to form ceramic composite bodies and materials, such as, for example, a ceramic composite body or material including silicon carbide and titanium diboride. Such bodies and materials may be used as armor bodies and armor materials. Such methods may include forming a green body and sintering the green body to a desirable final density. Green bodies formed in accordance with such methods may include particles comprising titanium dioxide and a coating at least partially covering exterior surfaces thereof, the coating comprising a substance including boron (e.g., boron carbide) and a substance including carbon.

  5. Deriving harmonised forest information in Europe using remote sensing methods

    DEFF Research Database (Denmark)

    Seebach, Lucia Maria

    the need for harmonised forest information can be satisfied using remote sensing methods. In conclusion, the study showed that it is possible to derive harmonised forest information of high spatial detail in Europe with remote sensing. The study also highlighted the imperative provision of accuracy...

  6. Receptor binding kinetics equations: Derivation using the Laplace transform method.

    Science.gov (United States)

    Hoare, Sam R J

    Measuring unlabeled ligand receptor binding kinetics is valuable in optimizing and understanding drug action. Unfortunately, deriving equations for estimating kinetic parameters is challenging because it involves calculus; integration can be a frustrating barrier to the pharmacologist seeking to measure simple rate parameters. Here, a well-known tool for simplifying the derivation, the Laplace transform, is applied to models of receptor-ligand interaction. The method transforms differential equations to a form in which simple algebra can be applied to solve for the variable of interest, for example the concentration of ligand-bound receptor. The goal is to provide instruction using familiar examples, to enable investigators familiar with handling equilibrium binding equations to derive kinetic equations for receptor-ligand interaction. First, the Laplace transform is used to derive the equations for association and dissociation of labeled ligand binding. Next, its use for unlabeled ligand kinetic equations is exemplified by a full derivation of the kinetics of competitive binding equation. Finally, new unlabeled ligand equations are derived using the Laplace transform. These equations incorporate a pre-incubation step with unlabeled or labeled ligand. Four equations for measuring unlabeled ligand kinetics were compared and the two new equations verified by comparison with numerical solution. Importantly, the equations have not been verified with experimental data because no such experiments are evident in the literature. Equations were formatted for use in the curve-fitting program GraphPad Prism 6.0 and fitted to simulated data. This description of the Laplace transform method will enable pharmacologists to derive kinetic equations for their model or experimental paradigm under study. Application of the transform will expand the set of equations available for the pharmacologist to measure unlabeled ligand binding kinetics, and for other time

  7. Solar cells, structures including organometallic halide perovskite monocrystalline films, and methods of preparation thereof

    KAUST Repository

    Bakr, Osman; Peng, Wei; Wang, Lingfei

    2017-01-01

    Embodiments of the present disclosure provide for solar cells including an organometallic halide perovskite monocrystalline film (see fig. 1.1B), other devices including the organometallic halide perovskite monocrystalline film, methods of making

  8. Molecular-state close-coupling theory including continuum states. I. Derivation of close-coupled equations

    International Nuclear Information System (INIS)

    Thorson, W.R.; Bandarage, G.

    1988-01-01

    We formulate a close-coupling theory of slow ion-atom collisions based on molecular (adiabatic) electronic states, and including the electronic continuum. The continuum is represented by packet states spanning it locally and constructed explicitly from exact continuum states. Particular attention is given to two fundamental questions: (1) Unbound electrons can escape from the local region spanned by the packet states. We derive close-coupled integral equations correctly including the escape effects; the ''propagator'' generated by these integral equations does not conserve probability within the close-coupled basis. Previous molecular-state formulations including the continuum give no account of escape effects. (2) Nonadiabatic couplings of adiabatic continuum states with the same energy are singular, reflecting the fact that an adiabatic description of continuum behavior is not valid outside a local region. We treat these singularities explicitly and show that an accurate representation of nonadiabatic couplings within the local region spanned by a set of packet states is well behaved. Hence an adiabatic basis-set description can be used to describe close coupling to the continuum in a local ''interaction region,'' provided the effects of escape are included. In principle, the formulation developed here can be extended to a large class of model problems involving many-electron systems and including models for Penning ionization and collisional detachment processes

  9. Determination of gadolinium by the method of derivative spectrophotometry

    International Nuclear Information System (INIS)

    Aleksandrova, N.N.; Mishchenko, V.T.; Poluehktov, N.S.; Mukomel', V.L.

    1988-01-01

    Technique for gadolinium determination at the presence of interfering rare earth elements, which is based on the derivative spectrophotometry method, is suggested. The technique is of increased selectivity and allows to determine gadolinium in the mixtures with elements, which presence in solution makes impossible to determine gadolinium directly. At binary mixtures analysis Sr relative standard deviation does not exceed 0.03, while at the analysis of more complex mixtures Sr increases up to 0.06

  10. METHOD FOR PRODUCING ISOTOPIC METHANES AND PARTIALLY HALOGENATED DERIVATIVES THEROF

    Science.gov (United States)

    Frazer, J.W.

    1959-08-18

    A method is given for producing isotopic methanes and/ or partially halogenated derivatives. Lithium hydride, deuteride, or tritide is reacted with a halogenated methane or with a halogenated methane in combination with free halogen. The process is conveniently carried out by passing a halogenated methane preferably at low pressures or in an admixture with an inert gas through a fixed bed of finely divided lithium hydride heated initially to temperatures of 100 to 200 deg C depending upon the halogenated methane used.

  11. Comparison of different methods to include recycling in LCAs of aluminium cans and disposable polystyrene cups

    NARCIS (Netherlands)

    Harst-Wintraecken, van der Eugenie; Potting, José; Kroeze, Carolien

    2016-01-01

    Many methods have been reported and used to include recycling in life cycle assessments (LCAs). This paper evaluates six widely used methods: three substitution methods (i.e. substitution based on equal quality, a correction factor, and alternative material), allocation based on the number of

  12. WEATHER DERIVATIVES: THE MOST COMMON PRICING AND VALUATION METHODS

    Directory of Open Access Journals (Sweden)

    Botos Horia Mircea

    2013-07-01

    Full Text Available In recent years , weather derivatives have become a common tool in risk management for many sectors. This has its roots in that there is no unique way to determine de value and price solutions that would be generally approved by market-participants, like in the case of the Black-Scholes formula for options on non-dividend-paying stocks is the source for a constant debate between academics and practitioners. One look for fair and truly correct prices, while the others search every-day applicable solutions. To be honest... this is somehow like alchemy. This paper has as purpose the examination of statistical characteristics of weather data, data clearing and filling techniques. The study will be referring to temperatures because that is the best analyzed phenomenon, being the most common. This was also heavily influenced by energy companies and energetic interests, because the degree days were of interest ever before weather derivatives were put for sale. Main ideas are explaining what ways of pricing and valuation are, put into perspective for this financial instrument, taking into consideration that the Black-Scholes Model is not suitable. Also here, we will present the pros and cons that we found for each method. The methods are: the Burn analysis, the index value simulation method (IVSM, the daily simulation method (DSM.On the hole, this paper wants to shed light the weather derivatives pricing methods a mix of insurance pricing and standard financial models. At the end we will prospect the discounting problem, by means of the Consumption based Capital Asset Pricing Model (CCAPM.

  13. OCOPTR, Minimization of Nonlinear Function, Variable Metric Method, Derivative Calculation. DRVOCR, Minimization of Nonlinear Function, Variable Metric Method, Derivative Calculation

    International Nuclear Information System (INIS)

    Nazareth, J. L.

    1979-01-01

    1 - Description of problem or function: OCOPTR and DRVOCR are computer programs designed to find minima of non-linear differentiable functions f: R n →R with n dimensional domains. OCOPTR requires that the user only provide function values (i.e. it is a derivative-free routine). DRVOCR requires the user to supply both function and gradient information. 2 - Method of solution: OCOPTR and DRVOCR use the variable metric (or quasi-Newton) method of Davidon (1975). For OCOPTR, the derivatives are estimated by finite differences along a suitable set of linearly independent directions. For DRVOCR, the derivatives are user- supplied. Some features of the codes are the storage of the approximation to the inverse Hessian matrix in lower trapezoidal factored form and the use of an optimally-conditioned updating method. Linear equality constraints are permitted subject to the initial Hessian factor being chosen correctly. 3 - Restrictions on the complexity of the problem: The functions to which the routine is applied are assumed to be differentiable. The routine also requires (n 2 /2) + 0(n) storage locations where n is the problem dimension

  14. Method of making an aero-derivative gas turbine engine

    Science.gov (United States)

    Wiebe, David J.

    2018-02-06

    A method of making an aero-derivative gas turbine engine (100) is provided. A combustor outer casing (68) is removed from an existing aero gas turbine engine (60). An annular combustor (84) is removed from the existing aero gas turbine engine. A first row of turbine vanes (38) is removed from the existing aero gas turbine engine. A can annular combustor assembly (122) is installed within the existing aero gas turbine engine. The can annular combustor assembly is configured to accelerate and orient combustion gasses directly onto a first row of turbine blades of the existing aero gas turbine engine. A can annular combustor assembly outer casing (108) is installed to produce the aero-derivative gas turbine engine (100). The can annular combustor assembly is installed within an axial span (85) of the existing aero gas turbine engine vacated by the annular combustor and the first row of turbine vanes.

  15. Systems and Methods for Fabricating Structures Including Metallic Glass-Based Materials Using Low Pressure Casting

    Science.gov (United States)

    Hofmann, Douglas C. (Inventor); Kennett, Andrew (Inventor)

    2018-01-01

    Systems and methods to fabricate objects including metallic glass-based materials using low-pressure casting techniques are described. In one embodiment, a method of fabricating an object that includes a metallic glass-based material includes: introducing molten alloy into a mold cavity defined by a mold using a low enough pressure such that the molten alloy does not conform to features of the mold cavity that are smaller than 100 microns; and cooling the molten alloy such that it solidifies, the solid including a metallic glass-based material.

  16. Adipogenic differentiation by adipose-derived stem cells harvested from GFP transgenic mice - including relationship of sex differences

    International Nuclear Information System (INIS)

    Ogawa, Rei; Mizuno, Hiroshi; Watanabe, Atsushi; Migita, Makoto; Hyakusoku, Hiko; Shimada, Takashi

    2004-01-01

    We have previously demonstrated that adipose-derived stromal cells (ASCs) as well as bone marrow-derived stromal cells (BSCs) differentiate into a variety of cell lineages both in vitro and in vivo. Both types are considered to include mesenchymal stem cells. Taking advantage of homogeneously marked cells from green fluorescent protein (GFP) transgenic mice, we have also previously reported the plasticity of BSCs and ASCs. In this study, we focused on adipogenic differentiation in vitro by ASCs harvested from GFP transgenic mice. Moreover, preadipocytes and mature adipocytes were harvested at the same time, and the cells were cultured to compare them with ASCs. Inguinal fat pads from GFP transgenic mice were used for the isolation of ASCs, preadipocytes, and mature adipocytes. After expansion to three passages of ASCs, the cells were incubated in an adipogenic medium for two weeks. Adipogenic differentiation of ASCs was assessed by Oil Red O staining and the expression of the adipocyte specific peroxisome proliferative activated receptor γ2 (PPAR-γ2) gene. These ASCs stained positively, and expression of PPAR-γ2 was detected. Moreover, we also tried to characterize the influence of sex differences on the adipogenic differentiation of ASCs harvested from both male and female mice. This was assessed by the expression levels of the PPAR-γ2 gene using real-time PCR. The results showed that the expression levels of ASCs harvested from female mice were a maximum of 2.89 times greater than those harvested from male mice. This suggests that the adipogenic differentiation of ASCs is closely related to sex differences

  17. A method for the computation of turbulent polymeric liquids including hydrodynamic interactions and chain entanglements

    Energy Technology Data Exchange (ETDEWEB)

    Kivotides, Demosthenes, E-mail: demosthenes.kivotides@strath.ac.uk

    2017-02-12

    An asymptotically exact method for the direct computation of turbulent polymeric liquids that includes (a) fully resolved, creeping microflow fields due to hydrodynamic interactions between chains, (b) exact account of (subfilter) residual stresses, (c) polymer Brownian motion, and (d) direct calculation of chain entanglements, is formulated. Although developed in the context of polymeric fluids, the method is equally applicable to turbulent colloidal dispersions and aerosols. - Highlights: • An asymptotically exact method for the computation of polymer and colloidal fluids is developed. • The method is valid for all flow inertia and all polymer volume fractions. • The method models entanglements and hydrodynamic interactions between polymer chains.

  18. Development of calculation method for one-dimensional kinetic analysis in fission reactors, including feedback effects

    International Nuclear Information System (INIS)

    Paixao, S.B.; Marzo, M.A.S.; Alvim, A.C.M.

    1986-01-01

    The calculation method used in WIGLE code is studied. Because of the non availability of such a praiseworthy solution, expounding the method minutely has been tried. This developed method has been applied for the solution of the one-dimensional, two-group, diffusion equations in slab, axial analysis, including non-boiling heat transfer, accountig for feedback. A steady-state program (CITER-1D), written in FORTRAN 4, has been implemented, providing excellent results, ratifying the developed work quality. (Author) [pt

  19. ECG-derived respiration methods: adapted ICA and PCA.

    Science.gov (United States)

    Tiinanen, Suvi; Noponen, Kai; Tulppo, Mikko; Kiviniemi, Antti; Seppänen, Tapio

    2015-05-01

    Respiration is an important signal in early diagnostics, prediction, and treatment of several diseases. Moreover, a growing trend toward ambulatory measurements outside laboratory environments encourages developing indirect measurement methods such as ECG derived respiration (EDR). Recently, decomposition techniques like principal component analysis (PCA), and its nonlinear version, kernel PCA (KPCA), have been used to derive a surrogate respiration signal from single-channel ECG. In this paper, we propose an adapted independent component analysis (AICA) algorithm to obtain EDR signal, and extend the normal linear PCA technique based on the best principal component (PC) selection (APCA, adapted PCA) to improve its performance further. We also demonstrate that the usage of smoothing spline resampling and bandpass-filtering improve the performance of all EDR methods. Compared with other recent EDR methods using correlation coefficient and magnitude squared coherence, the proposed AICA and APCA yield a statistically significant improvement with correlations 0.84, 0.82, 0.76 and coherences 0.90, 0.91, 0.85 between reference respiration and AICA, APCA and KPCA, respectively. Copyright © 2015 IPEM. Published by Elsevier Ltd. All rights reserved.

  20. Solar cells, structures including organometallic halide perovskite monocrystalline films, and methods of preparation thereof

    KAUST Repository

    Bakr, Osman M.

    2017-03-02

    Embodiments of the present disclosure provide for solar cells including an organometallic halide perovskite monocrystalline film (see fig. 1.1B), other devices including the organometallic halide perovskite monocrystalline film, methods of making organometallic halide perovskite monocrystalline film, and the like.

  1. The derivation of the Doppler broadening function using Frobenius method

    International Nuclear Information System (INIS)

    Palma, Daniel A.P.; Martinez, Aquilino S.; Silva, Fernando C.

    2006-01-01

    An analytical approximation of the Doppler broadening function ψ(ξ,x) is proposed. This approximation is based on the solution of the differential equation for ψ(ξ,x) using the methods of Frobenius and parameters variation. The analytical form derived for ψ(ξ,x) in terms of elementary functions is very simple and precise. It can be useful for applications related to the treatment of nuclear resonances, mainly for calculations of multigroup parameters and resonances self-protection factors, the latter being used to correct microscopic cross section measurements by the activation technique. (author)

  2. Deriving site-specific soil clean-up values for metals and metalloids: rationale for including protection of soil microbial processes.

    Science.gov (United States)

    Kuperman, Roman G; Siciliano, Steven D; Römbke, Jörg; Oorts, Koen

    2014-07-01

    Although it is widely recognized that microorganisms are essential for sustaining soil fertility, structure, nutrient cycling, groundwater purification, and other soil functions, soil microbial toxicity data were excluded from the derivation of Ecological Soil Screening Levels (Eco-SSL) in the United States. Among the reasons for such exclusion were claims that microbial toxicity tests were too difficult to interpret because of the high variability of microbial responses, uncertainty regarding the relevance of the various endpoints, and functional redundancy. Since the release of the first draft of the Eco-SSL Guidance document by the US Environmental Protection Agency in 2003, soil microbial toxicity testing and its use in ecological risk assessments have substantially improved. A wide range of standardized and nonstandardized methods became available for testing chemical toxicity to microbial functions in soil. Regulatory frameworks in the European Union and Australia have successfully incorporated microbial toxicity data into the derivation of soil threshold concentrations for ecological risk assessments. This article provides the 3-part rationale for including soil microbial processes in the development of soil clean-up values (SCVs): 1) presenting a brief overview of relevant test methods for assessing microbial functions in soil, 2) examining data sets for Cu, Ni, Zn, and Mo that incorporated soil microbial toxicity data into regulatory frameworks, and 3) offering recommendations on how to integrate the best available science into the method development for deriving site-specific SCVs that account for bioavailability of metals and metalloids in soil. Although the primary focus of this article is on the development of the approach for deriving SCVs for metals and metalloids in the United States, the recommendations provided in this article may also be applicable in other jurisdictions that aim at developing ecological soil threshold values for protection of

  3. Incompressible spectral-element method: Derivation of equations

    Science.gov (United States)

    Deanna, Russell G.

    1993-01-01

    A fractional-step splitting scheme breaks the full Navier-Stokes equations into explicit and implicit portions amenable to the calculus of variations. Beginning with the functional forms of the Poisson and Helmholtz equations, we substitute finite expansion series for the dependent variables and derive the matrix equations for the unknown expansion coefficients. This method employs a new splitting scheme which differs from conventional three-step (nonlinear, pressure, viscous) schemes. The nonlinear step appears in the conventional, explicit manner, the difference occurs in the pressure step. Instead of solving for the pressure gradient using the nonlinear velocity, we add the viscous portion of the Navier-Stokes equation from the previous time step to the velocity before solving for the pressure gradient. By combining this 'predicted' pressure gradient with the nonlinear velocity in an explicit term, and the Crank-Nicholson method for the viscous terms, we develop a Helmholtz equation for the final velocity.

  4. Force measuring valve assemblies, systems including such valve assemblies and related methods

    Science.gov (United States)

    DeWall, Kevin George [Pocatello, ID; Garcia, Humberto Enrique [Idaho Falls, ID; McKellar, Michael George [Idaho Falls, ID

    2012-04-17

    Methods of evaluating a fluid condition may include stroking a valve member and measuring a force acting on the valve member during the stroke. Methods of evaluating a fluid condition may include measuring a force acting on a valve member in the presence of fluid flow over a period of time and evaluating at least one of the frequency of changes in the measured force over the period of time and the magnitude of the changes in the measured force over the period of time to identify the presence of an anomaly in a fluid flow and, optionally, its estimated location. Methods of evaluating a valve condition may include directing a fluid flow through a valve while stroking a valve member, measuring a force acting on the valve member during the stroke, and comparing the measured force to a reference force. Valve assemblies and related systems are also disclosed.

  5. Electrode assemblies, plasma apparatuses and systems including electrode assemblies, and methods for generating plasma

    Science.gov (United States)

    Kong, Peter C; Grandy, Jon D; Detering, Brent A; Zuck, Larry D

    2013-09-17

    Electrode assemblies for plasma reactors include a structure or device for constraining an arc endpoint to a selected area or region on an electrode. In some embodiments, the structure or device may comprise one or more insulating members covering a portion of an electrode. In additional embodiments, the structure or device may provide a magnetic field configured to control a location of an arc endpoint on the electrode. Plasma generating modules, apparatus, and systems include such electrode assemblies. Methods for generating a plasma include covering at least a portion of a surface of an electrode with an electrically insulating member to constrain a location of an arc endpoint on the electrode. Additional methods for generating a plasma include generating a magnetic field to constrain a location of an arc endpoint on an electrode.

  6. Including mixed methods research in systematic reviews: Examples from qualitative syntheses in TB and malaria control

    Science.gov (United States)

    2012-01-01

    Background Health policy makers now have access to a greater number and variety of systematic reviews to inform different stages in the policy making process, including reviews of qualitative research. The inclusion of mixed methods studies in systematic reviews is increasing, but these studies pose particular challenges to methods of review. This article examines the quality of the reporting of mixed methods and qualitative-only studies. Methods We used two completed systematic reviews to generate a sample of qualitative studies and mixed method studies in order to make an assessment of how the quality of reporting and rigor of qualitative-only studies compares with that of mixed-methods studies. Results Overall, the reporting of qualitative studies in our sample was consistently better when compared with the reporting of mixed methods studies. We found that mixed methods studies are less likely to provide a description of the research conduct or qualitative data analysis procedures and less likely to be judged credible or provide rich data and thick description compared with standalone qualitative studies. Our time-related analysis shows that for both types of study, papers published since 2003 are more likely to report on the study context, describe analysis procedures, and be judged credible and provide rich data. However, the reporting of other aspects of research conduct (i.e. descriptions of the research question, the sampling strategy, and data collection methods) in mixed methods studies does not appear to have improved over time. Conclusions Mixed methods research makes an important contribution to health research in general, and could make a more substantial contribution to systematic reviews. Through our careful analysis of the quality of reporting of mixed methods and qualitative-only research, we have identified areas that deserve more attention in the conduct and reporting of mixed methods research. PMID:22545681

  7. A novel technique for including surface tension in PLIC-VOF methods

    Energy Technology Data Exchange (ETDEWEB)

    Meier, M.; Yadigaroglu, G. [Swiss Federal Institute of Technology, Nuclear Engineering Lab. ETH-Zentrum, CLT, Zurich (Switzerland); Smith, B. [Paul Scherrer Inst. (PSI), Villigen (Switzerland). Lab. for Thermal-Hydraulics

    2002-02-01

    Various versions of Volume-of-Fluid (VOF) methods have been used successfully for the numerical simulation of gas-liquid flows with an explicit tracking of the phase interface. Of these, Piecewise-Linear Interface Construction (PLIC-VOF) appears as a fairly accurate, although somewhat more involved variant. Including effects due to surface tension remains a problem, however. The most prominent methods, Continuum Surface Force (CSF) of Brackbill et al. and the method of Zaleski and co-workers (both referenced later), both induce spurious or 'parasitic' currents, and only moderate accuracy in regards to determining the curvature. We present here a new method to determine curvature accurately using an estimator function, which is tuned with a least-squares-fit against reference data. Furthermore, we show how spurious currents may be drastically reduced using the reconstructed interfaces from the PLIC-VOF method. (authors)

  8. Comparison of different methods to include recycling in LCAs of aluminium cans and disposable polystyrene cups.

    Science.gov (United States)

    van der Harst, Eugenie; Potting, José; Kroeze, Carolien

    2016-02-01

    Many methods have been reported and used to include recycling in life cycle assessments (LCAs). This paper evaluates six widely used methods: three substitution methods (i.e. substitution based on equal quality, a correction factor, and alternative material), allocation based on the number of recycling loops, the recycled-content method, and the equal-share method. These six methods were first compared, with an assumed hypothetical 100% recycling rate, for an aluminium can and a disposable polystyrene (PS) cup. The substitution and recycled-content method were next applied with actual rates for recycling, incineration and landfilling for both product systems in selected countries. The six methods differ in their approaches to credit recycling. The three substitution methods stimulate the recyclability of the product and assign credits for the obtained recycled material. The choice to either apply a correction factor, or to account for alternative substituted material has a considerable influence on the LCA results, and is debatable. Nevertheless, we prefer incorporating quality reduction of the recycled material by either a correction factor or an alternative substituted material over simply ignoring quality loss. The allocation-on-number-of-recycling-loops method focusses on the life expectancy of material itself, rather than on a specific separate product. The recycled-content method stimulates the use of recycled material, i.e. credits the use of recycled material in products and ignores the recyclability of the products. The equal-share method is a compromise between the substitution methods and the recycled-content method. The results for the aluminium can follow the underlying philosophies of the methods. The results for the PS cup are additionally influenced by the correction factor or credits for the alternative material accounting for the drop in PS quality, the waste treatment management (recycling rate, incineration rate, landfilling rate), and the

  9. Methods of using structures including catalytic materials disposed within porous zeolite materials to synthesize hydrocarbons

    Science.gov (United States)

    Rollins, Harry W [Idaho Falls, ID; Petkovic, Lucia M [Idaho Falls, ID; Ginosar, Daniel M [Idaho Falls, ID

    2011-02-01

    Catalytic structures include a catalytic material disposed within a zeolite material. The catalytic material may be capable of catalyzing a formation of methanol from carbon monoxide and/or carbon dioxide, and the zeolite material may be capable of catalyzing a formation of hydrocarbon molecules from methanol. The catalytic material may include copper and zinc oxide. The zeolite material may include a first plurality of pores substantially defined by a crystal structure of the zeolite material and a second plurality of pores dispersed throughout the zeolite material. Systems for synthesizing hydrocarbon molecules also include catalytic structures. Methods for synthesizing hydrocarbon molecules include contacting hydrogen and at least one of carbon monoxide and carbon dioxide with such catalytic structures. Catalytic structures are fabricated by forming a zeolite material at least partially around a template structure, removing the template structure, and introducing a catalytic material into the zeolite material.

  10. Including mixed methods research in systematic reviews: examples from qualitative syntheses in TB and malaria control.

    Science.gov (United States)

    Atkins, Salla; Launiala, Annika; Kagaha, Alexander; Smith, Helen

    2012-04-30

    Health policy makers now have access to a greater number and variety of systematic reviews to inform different stages in the policy making process, including reviews of qualitative research. The inclusion of mixed methods studies in systematic reviews is increasing, but these studies pose particular challenges to methods of review. This article examines the quality of the reporting of mixed methods and qualitative-only studies. We used two completed systematic reviews to generate a sample of qualitative studies and mixed method studies in order to make an assessment of how the quality of reporting and rigor of qualitative-only studies compares with that of mixed-methods studies. Overall, the reporting of qualitative studies in our sample was consistently better when compared with the reporting of mixed methods studies. We found that mixed methods studies are less likely to provide a description of the research conduct or qualitative data analysis procedures and less likely to be judged credible or provide rich data and thick description compared with standalone qualitative studies. Our time-related analysis shows that for both types of study, papers published since 2003 are more likely to report on the study context, describe analysis procedures, and be judged credible and provide rich data. However, the reporting of other aspects of research conduct (i.e. descriptions of the research question, the sampling strategy, and data collection methods) in mixed methods studies does not appear to have improved over time. Mixed methods research makes an important contribution to health research in general, and could make a more substantial contribution to systematic reviews. Through our careful analysis of the quality of reporting of mixed methods and qualitative-only research, we have identified areas that deserve more attention in the conduct and reporting of mixed methods research.

  11. A Derivative Method with Free Radical Oxidation to Predict Resveratrol Metabolites by Tandem Mass Spectrometry.

    Science.gov (United States)

    Liu, Wangta; Shiue, Yow-Ling; Lin, Yi-Reng; Lin, Hugo You-Hsien; Liang, Shih-Shin

    2015-10-01

    In this study, we demonstrated an oxidative method with free radical to generate 3,5,4'-trihydroxy- trans -stilbene ( trans -resveratrol) metabolites and detect sequentially by an autosampler coupling with liquid chromatography electrospray ionization tandem mass spectrometer (LC-ESI-MS/MS). In this oxidative method, the free radical initiator, ammonium persulfate (APS), was placed in a sample bottle containing resveratrol to produce oxidative derivatives, and the reaction progress was tracked by autosampler sequencing. Resveratrol, a natural product with purported cancer preventative qualities, produces metabolites including dihydroresveratrol, 3,4'-dihydroxy- trans -stilbene, lunularin, resveratrol monosulfate, and dihydroresveratrol monosulfate by free radical oxidation. Using APS free radical, the concentrations of resveratrol derivatives differ as a function of time. Besides simple, convenient and time- and labor saving, the advantages of free radical oxidative method of its in situ generation of oxidative derivatives followed by LC-ESI-MS/MS can be utilized to evaluate different metabolites in various conditions.

  12. Complete Tangent Stiffness for eXtended Finite Element Method by including crack growth parameters

    DEFF Research Database (Denmark)

    Mougaard, J.F.; Poulsen, P.N.; Nielsen, L.O.

    2013-01-01

    the crack geometry parameters, such as the crack length and the crack direction directly in the virtual work formulation. For efficiency, it is essential to obtain a complete tangent stiffness. A new method in this work is presented to include an incremental form the crack growth parameters on equal terms......The eXtended Finite Element Method (XFEM) is a useful tool for modeling the growth of discrete cracks in structures made of concrete and other quasi‐brittle and brittle materials. However, in a standard application of XFEM, the tangent stiffness is not complete. This is a result of not including...... with the degrees of freedom in the FEM‐equations. The complete tangential stiffness matrix is based on the virtual work together with the constitutive conditions at the crack tip. Introducing the crack growth parameters as direct unknowns, both equilibrium equations and the crack tip criterion can be handled...

  13. Earthquake analysis of structures including structure-soil interaction by a substructure method

    International Nuclear Information System (INIS)

    Chopra, A.K.; Guttierrez, J.A.

    1977-01-01

    A general substructure method for analysis of response of nuclear power plant structures to earthquake ground motion, including the effects of structure-soil interaction, is summarized. The method is applicable to complex structures idealized as finite element systems and the soil region treated as either a continuum, for example as a viscoelastic halfspace, or idealized as a finite element system. The halfspace idealization permits reliable analysis for sites where essentially similar soils extend to large depths and there is no rigid boundary such as soil-rock interface. For sites where layers of soft soil are underlain by rock at shallow depth, finite element idealization of the soil region is appropriate; in this case, the direct and substructure methods would lead to equivalent results but the latter provides the better alternative. Treating the free field motion directly as the earthquake input in the substructure method eliminates the deconvolution calculations and the related assumption -regarding type and direction of earthquake waves- required in the direct method. The substructure method is computationally efficient because the two substructures-the structure and the soil region- are analyzed separately; and, more important, it permits taking advantage of the important feature that response to earthquake ground motion is essentially contained in the lower few natural modes of vibration of the structure on fixed base. For sites where essentially similar soils extend to large depths and there is no obvious rigid boundary such as a soil-rock interface, numerical results for earthquake response of a nuclear reactor structure are presented to demonstrate that the commonly used finite element method may lead to unacceptable errors; but the substructure method leads to reliable results

  14. Spine surgeon's kinematics during discectomy, part II: operating table height and visualization methods, including microscope.

    Science.gov (United States)

    Park, Jeong Yoon; Kim, Kyung Hyun; Kuh, Sung Uk; Chin, Dong Kyu; Kim, Keun Su; Cho, Yong Eun

    2014-05-01

    Surgeon spine angle during surgery was studied ergonomically and the kinematics of the surgeon's spine was related with musculoskeletal fatigue and pain. Spine angles varied depending on operation table height and visualization method, and in a previous paper we showed that the use of a loupe and a table height at the midpoint between the umbilicus and the sternum are optimal for reducing musculoskeletal loading. However, no studies have previously included a microscope as a possible visualization method. The objective of this study is to assess differences in surgeon spine angles depending on operating table height and visualization method, including microscope. We enrolled 18 experienced spine surgeons for this study, who each performed a discectomy using a spine surgery simulator. Three different methods were used to visualize the surgical field (naked eye, loupe, microscope) and three different operating table heights (anterior superior iliac spine, umbilicus, the midpoint between the umbilicus and the sternum) were studied. Whole spine angles were compared for three different views during the discectomy simulation: midline, ipsilateral, and contralateral. A 16-camera optoelectronic motion analysis system was used, and 16 markers were placed from the head to the pelvis. Lumbar lordosis, thoracic kyphosis, cervical lordosis, and occipital angle were compared between the different operating table heights and visualization methods as well as a natural standing position. Whole spine angles differed significantly depending on visualization method. All parameters were closer to natural standing values when discectomy was performed with a microscope, and there were no differences between the naked eye and the loupe. Whole spine angles were also found to differ from the natural standing position depending on operating table height, and became closer to natural standing position values as the operating table height increased, independent of the visualization method

  15. Earthquake analysis of structures including structure-soil interaction by a substructure method

    International Nuclear Information System (INIS)

    Chopra, A.K.; Guttierrez, J.A.

    1977-01-01

    A general substructure method for analysis of response of nuclear power plant structures to earthquake ground motion, including the effects of structure-soil interaction, is summarized. The method is applicable to complex structures idealized as finite element systems and the soil region treated as either a continuum, for example as a viscoelastic halfspace, or idealized as a finite element system. The halfspace idealization permits reliable analysis for sites where essentially similar soils extend to large depths and there is no rigid boundary such as soil-rock interface. For sites where layers of soft soil are underlain by rock at shallow depth, finite element idealization of the soil region is appropriate; in this case, the direct and substructure methods would lead to equivalent results but the latter provides the better alternative. Treating the free field motion directly as the earthquake input in the substructure eliminates the deconvolution calculations and the related assumption-regarding type and direction of earthquake waves-required in the direct method. (Auth.)

  16. Method and apparatus for controlling a powertrain system including a multi-mode transmission

    Science.gov (United States)

    Hessell, Steven M.; Morris, Robert L.; McGrogan, Sean W.; Heap, Anthony H.; Mendoza, Gil J.

    2015-09-08

    A powertrain including an engine and torque machines is configured to transfer torque through a multi-mode transmission to an output member. A method for controlling the powertrain includes employing a closed-loop speed control system to control torque commands for the torque machines in response to a desired input speed. Upon approaching a power limit of a power storage device transferring power to the torque machines, power limited torque commands are determined for the torque machines in response to the power limit and the closed-loop speed control system is employed to determine an engine torque command in response to the desired input speed and the power limited torque commands for the torque machines.

  17. Field calibration of blowfly-derived DNA against traditional methods for assessing mammal diversity in tropical forests.

    Science.gov (United States)

    Lee, Ping-Shin; Gan, Han Ming; Clements, Gopalasamy Reuben; Wilson, John-James

    2016-11-01

    Mammal diversity assessments based on DNA derived from invertebrates have been suggested as alternatives to assessments based on traditional methods; however, no study has field-tested both approaches simultaneously. In Peninsular Malaysia, we calibrated the performance of mammal DNA derived from blowflies (Diptera: Calliphoridae) against traditional methods used to detect species. We first compared five methods (cage trapping, mist netting, hair trapping, scat collection, and blowfly-derived DNA) in a forest reserve with no recent reports of megafauna. Blowfly-derived DNA and mist netting detected the joint highest number of species (n = 6). Only one species was detected by multiple methods. Compared to the other methods, blowfly-derived DNA detected both volant and non-volant species. In another forest reserve, rich in megafauna, we calibrated blowfly-derived DNA against camera traps. Blowfly-derived DNA detected more species (n = 11) than camera traps (n = 9), with only one species detected by both methods. The rarefaction curve indicated that blowfly-derived DNA would continue to detect more species with greater sampling effort. With further calibration, blowfly-derived DNA may join the list of traditional field methods. Areas for further investigation include blowfly feeding and dispersal biology, primer biases, and the assembly of a comprehensive and taxonomically-consistent DNA barcode reference library.

  18. Discrete variational derivative method a structure-preserving numerical method for partial differential equations

    CERN Document Server

    Furihata, Daisuke

    2010-01-01

    Nonlinear Partial Differential Equations (PDEs) have become increasingly important in the description of physical phenomena. Unlike Ordinary Differential Equations, PDEs can be used to effectively model multidimensional systems. The methods put forward in Discrete Variational Derivative Method concentrate on a new class of ""structure-preserving numerical equations"" which improves the qualitative behaviour of the PDE solutions and allows for stable computing. The authors have also taken care to present their methods in an accessible manner, which means that the book will be useful to engineer

  19. Derivation of effectiveness-NTU method for heat exchangers with heat leak; TOPICAL

    International Nuclear Information System (INIS)

    William M. Soyars

    2001-01-01

    A powerful and useful method for heat exchanger analysis is the effectiveness-NTU method. The equations for this technique presented in textbooks, however, are limited to the case where all of the heat transfer occurs between the two fluid streams. In an application of interest to us, cryogenic heat exchangers, we wish to consider a heat leak term. Thus, we have derived equations for the(var e psilon)-NTU method with heat leak involved. The cases to be studied include evaporators, condensers, and counter-flow, with heat leak both in and out

  20. Reliability and limitation of various diagnostic methods including nuclear medicine in myocardial disease

    International Nuclear Information System (INIS)

    Tokuyasu, Yoshiki; Kusakabe, Kiyoko; Yamazaki, Toshio

    1981-01-01

    Electrocardiography (ECG), echocardiography, nuclear method, cardiac catheterization, left ventriculography and endomyocardial biopsy (biopsy) were performed in 40 cases of cardiomyopathy (CM), 9 of endocardial fibroelastosis and 19 of specific heart muscle disease, and the usefulness and limitation of each method was comparatively estimated. In CM, various methods including biopsy were performed. The 40 patients were classified into 3 groups, i.e., hypertrophic (17), dilated (20) and non-hypertrophic.non-dilated (3) on the basis of left ventricular ejection fraction and hypertrophy of the ventricular wall. The hypertrophic group was divided into 4 subgroups: 9 septal, 4 apical, 2 posterior and 2 anterior. The nuclear study is useful in assessing the site of the abnormal ventricular thickening, perfusion defect and ventricular function. Echocardiography is most useful in detecting asymmetric septal hypertrophy. The biopsy gives the sole diagnostic clue, especially in non-hypertrophic.non-dilated cardiomyopathy. ECG is useful in all cases but correlation with the site of disproportional hypertrophy was not obtained. (J.P.N.)

  1. A method for including external feed in depletion calculations with CRAM and implementation into ORIGEN

    International Nuclear Information System (INIS)

    Isotalo, A.E.; Wieselquist, W.A.

    2015-01-01

    Highlights: • A method for handling external feed in depletion calculations with CRAM. • Source term can have polynomial or exponentially decaying time-dependence. • CRAM with source term and adjoint capability implemented to ORIGEN in SCALE. • The new solver is faster and more accurate than the original solver of ORIGEN. - Abstract: A method for including external feed with polynomial time dependence in depletion calculations with the Chebyshev Rational Approximation Method (CRAM) is presented and the implementation of CRAM to the ORIGEN module of the SCALE suite is described. In addition to being able to handle time-dependent feed rates, the new solver also adds the capability to perform adjoint calculations. Results obtained with the new CRAM solver and the original depletion solver of ORIGEN are compared to high precision reference calculations, which shows the new solver to be orders of magnitude more accurate. Furthermore, in most cases, the new solver is up to several times faster due to not requiring similar substepping as the original one

  2. Additivity methods for prediction of thermochemical properties. The Laidler method revisited. 2. Hydrocarbons including substituted cyclic compounds

    International Nuclear Information System (INIS)

    Santos, Rui C.; Leal, Joao P.; Martinho Simoes, Jose A.

    2009-01-01

    A revised parameterization of the extended Laidler method for predicting standard molar enthalpies of atomization and standard molar enthalpies of formation at T = 298.15 K for several families of hydrocarbons (alkanes, alkenes, alkynes, polyenes, poly-ynes, cycloalkanes, substituted cycloalkanes, cycloalkenes, substituted cycloalkenes, benzene derivatives, and bi and polyphenyls) is presented. Data for a total of 265 gas-phase and 242 liquid-phase compounds were used for the calculation of the parameters. Comparison of the experimental values with those obtained using the additive scheme led to an average absolute difference of 0.73 kJ . mol -1 for the gas-phase standard molar enthalpy of formation and 0.79 kJ . mol -1 for the liquid-phase standard molar enthalpy of formation. The database used to establish the parameters was carefully reviewed by using, whenever possible, the original publications. A worksheet to simplify the calculation of standard molar enthalpies of formation and standard molar enthalpies of atomization at T = 298.15 K based on the extended Laidler parameters defined in this paper is provided as supplementary material.

  3. A review on mathematical methods of conventional and Islamic derivatives

    Science.gov (United States)

    Hisham, Azie Farhani Badrol; Jaffar, Maheran Mohd

    2014-12-01

    Despite the impressive growth of risk management tools in financial institutions, Islamic finance remains miles away behind the conventional institutions. Islamic finance products need to comply with the syariah law and prohibitions, therefore they can use fewer of the available risk management tools compared to conventional. Derivatives have proven to be the effective hedging technique and instrument that broadly being used in the conventional institutions to manage their risks. However, derivatives are not generally accepted as the legitimate products in Islamic finance and they remain controversial issues among the Islamic scholars. This paper reviews the evolution of derivatives such as forwards, futures and options and then explores the mathematical models that being used to solve derivatives such as random walk model, asset pricing model that follows Brownian motion and Black-Scholes model. Other than that, this paper also critically discuss the perspective of derivatives from Islamic point of view. In conclusion, this paper delivers the traditional Islamic products such as salam, urbun and istijrar that can be used to create building blocks of Islamic derivatives.

  4. SU-F-J-86: Method to Include Tissue Dose Response Effect in Deformable Image Registration

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, J; Liang, J; Chen, S; Qin, A; Yan, D [Beaumont Health Systeml, Royal Oak, MI (United States)

    2016-06-15

    Purpose: Organ changes shape and size during radiation treatment due to both mechanical stress and radiation dose response. However, the dose response induced deformation has not been considered in conventional deformable image registration (DIR). A novel DIR approach is proposed to include both tissue elasticity and radiation dose induced organ deformation. Methods: Assuming that organ sub-volume shrinkage was proportional to the radiation dose induced cell killing/absorption, the dose induced organ volume change was simulated applying virtual temperature on each sub-volume. Hence, both stress and heterogeneity temperature induced organ deformation. Thermal stress finite element method with organ surface boundary condition was used to solve deformation. Initial boundary correspondence on organ surface was created from conventional DIR. Boundary condition was updated by an iterative optimization scheme to minimize elastic deformation energy. The registration was validated on a numerical phantom. Treatment dose was constructed applying both the conventional DIR and the proposed method using daily CBCT image obtained from HN treatment. Results: Phantom study showed 2.7% maximal discrepancy with respect to the actual displacement. Compared with conventional DIR, subvolume displacement difference in a right parotid had the mean±SD (Min, Max) to be 1.1±0.9(−0.4∼4.8), −0.1±0.9(−2.9∼2.4) and −0.1±0.9(−3.4∼1.9)mm in RL/PA/SI directions respectively. Mean parotid dose and V30 constructed including the dose response induced shrinkage were 6.3% and 12.0% higher than those from the conventional DIR. Conclusion: Heterogeneous dose distribution in normal organ causes non-uniform sub-volume shrinkage. Sub-volume in high dose region has a larger shrinkage than the one in low dose region, therefore causing more sub-volumes to move into the high dose area during the treatment course. This leads to an unfavorable dose-volume relationship for the normal organ

  5. Sensitivity Analysis of Hydraulic Methods Regarding Hydromorphologic Data Derivation Methods to Determine Environmental Water Requirements

    Directory of Open Access Journals (Sweden)

    Alireza Shokoohi

    2015-07-01

    Full Text Available This paper studies the accuracy of hydraulic methods in determining environmental flow requirements. Despite the vital importance of deriving river cross sectional data for hydraulic methods, few studies have focused on the criteria for deriving this data. The present study shows that the depth of cross section has a meaningful effect on the results obtained from hydraulic methods and that, considering fish as the index species for river habitat analysis, an optimum depth of 1 m should be assumed for deriving information from cross sections. The second important parameter required for extracting the geometric and hydraulic properties of rivers is the selection of an appropriate depth increment; ∆y. In the present research, this parameter was found to be equal to 1 cm. The uncertainty of the environmental discharge evaluation, when allocating water in areas with water scarcity, should be kept as low as possible. The Manning friction coefficient (n is an important factor in river discharge calculation. Using a range of "n" equal to 3 times the standard deviation for the study area, it is shown that the influence of friction coefficient on the estimation of environmental flow is much less than that on the calculation of river discharge.

  6. Engine including hydraulically actuated valvetrain and method of valve overlap control

    Science.gov (United States)

    Cowgill, Joel [White Lake, MI

    2012-05-08

    An exhaust valve control method may include displacing an exhaust valve in communication with the combustion chamber of an engine to an open position using a hydraulic exhaust valve actuation system and returning the exhaust valve to a closed position using the hydraulic exhaust valve actuation assembly. During closing, the exhaust valve may be displaced for a first duration from the open position to an intermediate closing position at a first velocity by operating the hydraulic exhaust valve actuation assembly in a first mode. The exhaust valve may be displaced for a second duration greater than the first duration from the intermediate closing position to a fully closed position at a second velocity at least eighty percent less than the first velocity by operating the hydraulic exhaust valve actuation assembly in a second mode.

  7. Flexible barrier film, method of forming same, and organic electronic device including same

    Science.gov (United States)

    Blizzard, John; Tonge, James Steven; Weidner, William Kenneth

    2013-03-26

    A flexible barrier film has a thickness of from greater than zero to less than 5,000 nanometers and a water vapor transmission rate of no more than 1.times.10.sup.-2 g/m.sup.2/day at 22.degree. C. and 47% relative humidity. The flexible barrier film is formed from a composition, which comprises a multi-functional acrylate. The composition further comprises the reaction product of an alkoxy-functional organometallic compound and an alkoxy-functional organosilicon compound. A method of forming the flexible barrier film includes the steps of disposing the composition on a substrate and curing the composition to form the flexible barrier film. The flexible barrier film may be utilized in organic electronic devices.

  8. A Weight-Loss Diet Including Coffee-Derived Mannooligosaccharides Enhances Adipose Tissue Loss in Overweight Men but Not Women

    Science.gov (United States)

    St-Onge, Marie-Pierre; Salinardi, Taylor; Herron-Rubin, Kristin; Black, Richard M.

    2013-01-01

    Mannooligosaccharides (MOS), extracted from coffee, have been shown to promote a decrease in body fat when consumed as part of free-living, weight-maintaining diets. Our objective was to determine if MOS consumption (4 g/day), in conjunction with a weight-loss diet, would lead to greater reductions in adipose tissue compartments than placebo. We conducted a double-blind, placebo-controlled weight-loss study in which 60 overweight men and women consumed study beverages and received weekly group counseling for 12 weeks. Weight and blood pressure were measured weekly, and adipose tissue distribution was assessed at baseline and at end point using magnetic resonance imaging. A total of 54 subjects completed the study. Men consuming the MOS beverage had greater loss of body weight than men consuming the Placebo beverage (−6.0 ± 0.6% vs. −2.3 ± 0.5%, respectively, P coffee-derived MOS to a weight-loss diet enhanced both weight and adipose tissue losses in men, suggesting a potential functional use of MOS for weight management and improvement in adipose tissue distribution. More studies are needed to investigate the apparent gender difference in response to MOS consumption. PMID:21938072

  9. Zirconium-based alloys, nuclear fuel rods and nuclear reactors including such alloys, and related methods

    Science.gov (United States)

    Mariani, Robert Dominick

    2014-09-09

    Zirconium-based metal alloy compositions comprise zirconium, a first additive in which the permeability of hydrogen decreases with increasing temperatures at least over a temperature range extending from 350.degree. C. to 750.degree. C., and a second additive having a solubility in zirconium over the temperature range extending from 350.degree. C. to 750.degree. C. At least one of a solubility of the first additive in the second additive over the temperature range extending from 350.degree. C. to 750.degree. C. and a solubility of the second additive in the first additive over the temperature range extending from 350.degree. C. to 750.degree. C. is higher than the solubility of the second additive in zirconium over the temperature range extending from 350.degree. C. to 750.degree. C. Nuclear fuel rods include a cladding material comprising such metal alloy compositions, and nuclear reactors include such fuel rods. Methods are used to fabricate such zirconium-based metal alloy compositions.

  10. Applications of the conjugate gradient FFT method in scattering and radiation including simulations with impedance boundary conditions

    Science.gov (United States)

    Barkeshli, Kasra; Volakis, John L.

    1991-01-01

    The theoretical and computational aspects related to the application of the Conjugate Gradient FFT (CGFFT) method in computational electromagnetics are examined. The advantages of applying the CGFFT method to a class of large scale scattering and radiation problems are outlined. The main advantages of the method stem from its iterative nature which eliminates a need to form the system matrix (thus reducing the computer memory allocation requirements) and guarantees convergence to the true solution in a finite number of steps. Results are presented for various radiators and scatterers including thin cylindrical dipole antennas, thin conductive and resistive strips and plates, as well as dielectric cylinders. Solutions of integral equations derived on the basis of generalized impedance boundary conditions (GIBC) are also examined. The boundary conditions can be used to replace the profile of a material coating by an impedance sheet or insert, thus, eliminating the need to introduce unknown polarization currents within the volume of the layer. A general full wave analysis of 2-D and 3-D rectangular grooves and cavities is presented which will also serve as a reference for future work.

  11. Derivation methods for clearance levels applied to reactors

    International Nuclear Information System (INIS)

    Okoshi, Minoru; Seki, Takeo

    2001-01-01

    In order to support the discussion by the Nuclear Safety Commission, JAERI derived the unconditional clearance levels for concrete and metal arising from the operation and dismantling of nuclear reactors. The clearance levels of 20 radionuclides were derived from 10 μSv/y of individual doses by deterministic approach. In this approach, calculation models were established to assess individual doses resulting from 73 exposure pathways related to disposal and recycle/reuse, and realistic parameter values were selected considering Japanese natural and social conditions. The appropriateness of selected parameter values was confirmed by stochastic analyses. (author)

  12. Second-principles method for materials simulations including electron and lattice degrees of freedom

    Science.gov (United States)

    García-Fernández, Pablo; Wojdeł, Jacek C.; Íñiguez, Jorge; Junquera, Javier

    2016-05-01

    We present a first-principles-based (second-principles) scheme that permits large-scale materials simulations including both atomic and electronic degrees of freedom on the same footing. The method is based on a predictive quantum-mechanical theory—e.g., density functional theory—and its accuracy can be systematically improved at a very modest computational cost. Our approach is based on dividing the electron density of the system into a reference part—typically corresponding to the system's neutral, geometry-dependent ground state—and a deformation part—defined as the difference between the actual and reference densities. We then take advantage of the fact that the bulk part of the system's energy depends on the reference density alone; this part can be efficiently and accurately described by a force field, thus avoiding explicit consideration of the electrons. Then, the effects associated to the difference density can be treated perturbatively with good precision by working in a suitably chosen Wannier function basis. Further, the electronic model can be restricted to the bands of interest. All these features combined yield a very flexible and computationally very efficient scheme. Here we present the basic formulation of this approach, as well as a practical strategy to compute model parameters for realistic materials. We illustrate the accuracy and scope of the proposed method with two case studies, namely, the relative stability of various spin arrangements in NiO (featuring complex magnetic interactions in a strongly-correlated oxide) and the formation of a two-dimensional electron gas at the interface between band insulators LaAlO3 and SrTiO3 (featuring subtle electron-lattice couplings and screening effects). We conclude by discussing ways to overcome the limitations of the present approach (most notably, the assumption of a fixed bonding topology), as well as its many envisioned possibilities and future extensions.

  13. Low-derivative operators of the Standard Model effective field theory via Hilbert series methods

    Energy Technology Data Exchange (ETDEWEB)

    Lehman, Landon; Martin, Adam [Department of Physics, University of Notre Dame,Nieuwland Science Hall, Notre Dame, IN 46556 (United States)

    2016-02-12

    In this work, we explore an extension of Hilbert series techniques to count operators that include derivatives. For sufficiently low-derivative operators, we conjecture an algorithm that gives the number of invariant operators, properly accounting for redundancies due to the equations of motion and integration by parts. Specifically, the conjectured technique can be applied whenever there is only one Lorentz invariant for a given partitioning of derivatives among the fields. At higher numbers of derivatives, equation of motion redundancies can be removed, but the increased number of Lorentz contractions spoils the subtraction of integration by parts redundancies. While restricted, this technique is sufficient to automatically recreate the complete set of invariant operators of the Standard Model effective field theory for dimensions 6 and 7 (for arbitrary numbers of flavors). At dimension 8, the algorithm does not automatically generate the complete operator set; however, it suffices for all but five classes of operators. For these remaining classes, there is a well defined procedure to manually determine the number of invariants. Assuming our method is correct, we derive a set of 535 dimension-8 N{sub f}=1 operators.

  14. Low-derivative operators of the Standard Model effective field theory via Hilbert series methods

    International Nuclear Information System (INIS)

    Lehman, Landon; Martin, Adam

    2016-01-01

    In this work, we explore an extension of Hilbert series techniques to count operators that include derivatives. For sufficiently low-derivative operators, we conjecture an algorithm that gives the number of invariant operators, properly accounting for redundancies due to the equations of motion and integration by parts. Specifically, the conjectured technique can be applied whenever there is only one Lorentz invariant for a given partitioning of derivatives among the fields. At higher numbers of derivatives, equation of motion redundancies can be removed, but the increased number of Lorentz contractions spoils the subtraction of integration by parts redundancies. While restricted, this technique is sufficient to automatically recreate the complete set of invariant operators of the Standard Model effective field theory for dimensions 6 and 7 (for arbitrary numbers of flavors). At dimension 8, the algorithm does not automatically generate the complete operator set; however, it suffices for all but five classes of operators. For these remaining classes, there is a well defined procedure to manually determine the number of invariants. Assuming our method is correct, we derive a set of 535 dimension-8 N_f=1 operators.

  15. Applicability of a panel method, which includes nonlinear effects, to a forward-swept-wing aircraft

    Science.gov (United States)

    Ross, J. C.

    1984-01-01

    The ability of a lower order panel method VSAERO, to accurately predict the lift and pitching moment of a complete forward-swept-wing/canard configuration was investigated. The program can simulate nonlinear effects including boundary-layer displacement thickness, wake roll up, and to a limited extent, separated wakes. The predictions were compared with experimental data obtained using a small-scale model in the 7- by 10- Foot Wind Tunnel at NASA Ames Research Center. For the particular configuration under investigation, wake roll up had only a small effect on the force and moment predictions. The effect of the displacement thickness modeling was to reduce the lift curve slope slightly, thus bringing the predicted lift into good agreement with the measured value. Pitching moment predictions were also improved by the boundary-layer simulation. The separation modeling was found to be sensitive to user inputs, but appears to give a reasonable representation of a separated wake. In general, the nonlinear capabilities of the code were found to improve the agreement with experimental data. The usefullness of the code would be enhanced by improving the reliability of the separated wake modeling and by the addition of a leading edge separation model.

  16. Methods of forming aluminum oxynitride-comprising bodies, including methods of forming a sheet of transparent armor

    Science.gov (United States)

    Chu, Henry Shiu-Hung [Idaho Falls, ID; Lillo, Thomas Martin [Idaho Falls, ID

    2008-12-02

    The invention includes methods of forming an aluminum oxynitride-comprising body. For example, a mixture is formed which comprises A:B:C in a respective molar ratio in the range of 9:3.6-6.2:0.1-1.1, where "A" is Al.sub.2O.sub.3, "B" is AlN, and "C" is a total of one or more of B.sub.2O.sub.3, SiO.sub.2, Si--Al--O--N, and TiO.sub.2. The mixture is sintered at a temperature of at least 1,600.degree. C. at a pressure of no greater than 500 psia effective to form an aluminum oxynitride-comprising body which is at least internally transparent and has at least 99% maximum theoretical density.

  17. Development of a rapid HRM genotyping method for detection of dog-derived Giardia lamblia.

    Science.gov (United States)

    Tan, Liping; Yu, Xingang; Abdullahi, Auwalu Yusuf; Wu, Sheng; Zheng, Guochao; Hu, Wei; Song, Meiran; Wang, Zhen; Jiang, Biao; Li, Guoqing

    2015-11-01

    Giardia lamblia is a zoonotic flagellate protozoan in the intestine of human and many mammals including dogs. To assess a threat of dog-derived G. lamblia to humans, the common dog-derived G. lamblia assemblages A, C, and D were genotyped by high-resolution melting (HRM) technology. According to β-giardin gene sequence, the qPCR-HRM primers BG5 and BG7 were designed. A series of experiments on the stability, sensitivity, and accuracy of the HRM method were also tested. Results showed that the primers BG5 and BG7 could distinguish among three assemblages A, C, and D, which Tm value differences were about 1 °C to each other. The melting curves of intra-assay reproducibility were almost coincided, and those of inter-assay reproducibility were much the same shape. The lowest detection concentration was about 5 × 10(-6)-ng/μL sample. The genotyping results from 21 G. lamblia samples by the HRM method were in complete accordance with sequencing results. It is concluded that the HRM genotyping method is rapid, stable, specific, highly sensitive, and suitable for clinical detection and molecular epidemiological survey of dog-derived G. lamblia.

  18. Implementation aspects of the Boundary Element Method including viscous and thermal losses

    DEFF Research Database (Denmark)

    Cutanda Henriquez, Vicente; Juhl, Peter Møller

    2014-01-01

    The implementation of viscous and thermal losses using the Boundary Element Method (BEM) is based on the Kirchhoff’s dispersion relation and has been tested in previous work using analytical test cases and comparison with measurements. Numerical methods that can simulate sound fields in fluids...

  19. Synthetic antigens, radiolabelled derivatives thereof, and methods of analysis using such derivatives

    International Nuclear Information System (INIS)

    Eisenhardt, W.A. Jr.; Hedaya, E.; Theodoropulos, S.

    1981-01-01

    This patent claim on behalf of Union Carbide Corporation, relates to a method of carrying out a competitive binding radioassay of a compound of interest in a clinical sample, using isocyanates labelled with radioiodine as synthetic antigens. (U.K.)

  20. A coupling method for a cardiovascular simulation model which includes the Kalman filter.

    Science.gov (United States)

    Hasegawa, Yuki; Shimayoshi, Takao; Amano, Akira; Matsuda, Tetsuya

    2012-01-01

    Multi-scale models of the cardiovascular system provide new insight that was unavailable with in vivo and in vitro experiments. For the cardiovascular system, multi-scale simulations provide a valuable perspective in analyzing the interaction of three phenomenons occurring at different spatial scales: circulatory hemodynamics, ventricular structural dynamics, and myocardial excitation-contraction. In order to simulate these interactions, multiscale cardiovascular simulation systems couple models that simulate different phenomena. However, coupling methods require a significant amount of calculation, since a system of non-linear equations must be solved for each timestep. Therefore, we proposed a coupling method which decreases the amount of calculation by using the Kalman filter. In our method, the Kalman filter calculates approximations for the solution to the system of non-linear equations at each timestep. The approximations are then used as initial values for solving the system of non-linear equations. The proposed method decreases the number of iterations required by 94.0% compared to the conventional strong coupling method. When compared with a smoothing spline predictor, the proposed method required 49.4% fewer iterations.

  1. Turbomachine combustor nozzle including a monolithic nozzle component and method of forming the same

    Science.gov (United States)

    Stoia, Lucas John; Melton, Patrick Benedict; Johnson, Thomas Edward; Stevenson, Christian Xavier; Vanselow, John Drake; Westmoreland, James Harold

    2016-02-23

    A turbomachine combustor nozzle includes a monolithic nozzle component having a plate element and a plurality of nozzle elements. Each of the plurality of nozzle elements includes a first end extending from the plate element to a second end. The plate element and plurality of nozzle elements are formed as a unitary component. A plate member is joined with the nozzle component. The plate member includes an outer edge that defines first and second surfaces and a plurality of openings extending between the first and second surfaces. The plurality of openings are configured and disposed to register with and receive the second end of corresponding ones of the plurality of nozzle elements.

  2. Development of a quantitative safety assessment method for nuclear I and C systems including human operators

    International Nuclear Information System (INIS)

    Kim, Man Cheol

    2004-02-01

    Conventional PSA (probabilistic safety analysis) is performed in the framework of event tree analysis and fault tree analysis. In conventional PSA, I and C systems and human operators are assumed to be independent for simplicity. But, the dependency of human operators on I and C systems and the dependency of I and C systems on human operators are gradually recognized to be significant. I believe that it is time to consider the interdependency between I and C systems and human operators in the framework of PSA. But, unfortunately it seems that we do not have appropriate methods for incorporating the interdependency between I and C systems and human operators in the framework of Pasa. Conventional human reliability analysis (HRA) methods are not developed to consider the interdependecy, and the modeling of the interdependency using conventional event tree analysis and fault tree analysis seem to be, event though is does not seem to be impossible, quite complex. To incorporate the interdependency between I and C systems and human operators, we need a new method for HRA and a new method for modeling the I and C systems, man-machine interface (MMI), and human operators for quantitative safety assessment. As a new method for modeling the I and C systems, MMI and human operators, I develop a new system reliability analysis method, reliability graph with general gates (RGGG), which can substitute conventional fault tree analysis. RGGG is an intuitive and easy-to-use method for system reliability analysis, while as powerful as conventional fault tree analysis. To demonstrate the usefulness of the RGGG method, it is applied to the reliability analysis of Digital Plant Protection System (DPPS), which is the actual plant protection system of Ulchin 5 and 6 nuclear power plants located in Republic of Korea. The latest version of the fault tree for DPPS, which is developed by the Integrated Safety Assessment team in Korea Atomic Energy Research Institute (KAERI), consists of 64

  3. Using the CAIR-method to derive cognitive error mechanisms

    International Nuclear Information System (INIS)

    Straeter, Oliver

    2000-01-01

    This paper describes an application of the second-generation method CAHR (Connectionism Assessment of Human Reliability; Straeter, 1997) that was developed at the Technical University of Munich and the GRS in the years from 1992 to 1998. The method enables to combine event analysis and assessment and therefore to base human reliability assessment on past experience. The term connectionism' was coined by modeling human cognition on the basis of artificial intelligence models. Connectionism is a term describing methods that represent complex interrelations of various parameters (known for pattern recognition, expert systems, modeling of cognition). The method enables to combine event analysis and assessment on past experience. The paper will demonstrate the application of the method to communication aspects in NPPs (Nuclear Power Plants) and will give some outlooks for further developments. Application of the method to the problem of communication failures, for examples, initial work on communication within the low-power and shut down study for Boiling Water Reactors (BWRs), investigation of communication failures, importance of procedural and verbal communication for different error type and causes for failures in procedural and verbal communication are explained. (S.Y.)

  4. Method of extruding and packaging a thin sample of reactive material including forming the extrusion die

    International Nuclear Information System (INIS)

    Lewandowski, E.F.; Peterson, L.L.

    1985-01-01

    This invention teaches a method of cutting a narrow slot in an extrusion die with an electrical discharge machine by first drilling spaced holes at the ends of where the slot will be, whereby the oil can flow through the holes and slot to flush the material eroded away as the slot is being cut. The invention further teaches a method of extruding a very thin ribbon of solid highly reactive material such as lithium or sodium through the die in an inert atmosphere of nitrogen, argon or the like as in a glovebox. The invention further teaches a method of stamping out sample discs from the ribbon and of packaging each disc by sandwiching it between two aluminum sheets and cold welding the sheets together along an annular seam beyond the outer periphery of the disc. This provides a sample of high purity reactive material that can have a long shelf life

  5. Computational methods in the pricing and risk management of modern financial derivatives

    Science.gov (United States)

    Deutsch, Hans-Peter

    1999-09-01

    In the last 20 years modern finance has developed into a complex mathematically challenging field. Very complicated risks exist in financial markets which need very advanced methods to measure and/or model them. The financial instruments invented by the market participants to trade these risk, the so called derivatives are usually even more complicated than the risks themselves and also sometimes generate new riks. Topics like random walks, stochastic differential equations, martingale measures, time series analysis, implied correlations, etc. are of common use in the field. This is why more and more people with a science background, such as physicists, mathematicians, or computer scientists, are entering the field of finance. The measurement and management of all theses risks is the key to the continuing success of banks. This talk gives insight into today's common methods of modern market risk management such as variance-covariance, historical simulation, Monte Carlo, “Greek” ratios, etc., including the statistical concepts on which they are based. Derivatives are at the same time the main reason for and the most effective means of conducting risk management. As such, they stand at the beginning and end of risk management. The valuation of derivatives and structured financial instruments is therefore the prerequisite, the condition sine qua non, for all risk management. This talk introduces some of the important valuation methods used in modern derivatives pricing such as present value, Black-Scholes, binomial trees, Monte Carlo, etc. In summary this talk highlights an area outside physics where there is a lot of interesting work to do, especially for physicists. Or as one of our consultants said: The fascinating thing about this job is that Arthur Andersen hired me not ALTHOUGH I am a physicist but BECAUSE I am a physicist.

  6. Method for including detailed evaluation of daylight levels in Be06

    DEFF Research Database (Denmark)

    Petersen, Steffen

    2008-01-01

    Good daylight conditions in office buildings have become an important issue due to new European regulatory demands which include energy consumption for electrical lighting in the building energy frame. Good daylight conditions in offices are thus in increased focus as an energy conserving measure....... In order to evaluate whether a certain design is good daylight design or not building designers must perform detailed evaluation of daylight levels, including the daylight performance of dynamic solar shadings, and include these in the energy performance evaluation. However, the mandatory national...... calculation tool in Denmark (Be06) for evaluating the energy performance of buildings is currently using a simple representation of available daylight in a room and simple assumptions regarding the control of shading devices. In a case example, this is leading to an overestimation of the energy consumption...

  7. A novel method of including Landau level mixing in numerical studies of the quantum Hall effect

    International Nuclear Information System (INIS)

    Wooten, Rachel; Quinn, John; Macek, Joseph

    2013-01-01

    Landau level mixing should influence the quantum Hall effect for all except the strongest applied magnetic fields. We propose a simple method for examining the effects of Landau level mixing by incorporating multiple Landau levels into the Haldane pseudopotentials through exact numerical diagonalization. Some of the resulting pseudopotentials for the lowest and first excited Landau levels will be presented

  8. Development of Extended Ray-tracing method including diffraction, polarization and wave decay effects

    Science.gov (United States)

    Yanagihara, Kota; Kubo, Shin; Dodin, Ilya; Nakamura, Hiroaki; Tsujimura, Toru

    2017-10-01

    Geometrical Optics Ray-tracing is a reasonable numerical analytic approach for describing the Electron Cyclotron resonance Wave (ECW) in slowly varying spatially inhomogeneous plasma. It is well known that the result with this conventional method is adequate in most cases. However, in the case of Helical fusion plasma which has complicated magnetic structure, strong magnetic shear with a large scale length of density can cause a mode coupling of waves outside the last closed flux surface, and complicated absorption structure requires a strong focused wave for ECH. Since conventional Ray Equations to describe ECW do not have any terms to describe the diffraction, polarization and wave decay effects, we can not describe accurately a mode coupling of waves, strong focus waves, behavior of waves in inhomogeneous absorption region and so on. For fundamental solution of these problems, we consider the extension of the Ray-tracing method. Specific process is planned as follows. First, calculate the reference ray by conventional method, and define the local ray-base coordinate system along the reference ray. Then, calculate the evolution of the distributions of amplitude and phase on ray-base coordinate step by step. The progress of our extended method will be presented.

  9. Indication of Importance of Including Soil Microbial Characteristics into Biotope Valuation Method.

    Czech Academy of Sciences Publication Activity Database

    Trögl, J.; Pavlorková, Jana; Packová, P.; Seják, J.; Kuráň, P.; Kuráň, J.; Popelka, J.; Pacina, J.

    2016-01-01

    Roč. 8, č. 3 (2016), č. článku 253. ISSN 2071-1050 Institutional support: RVO:67985858 Keywords : biotope assessment * biotope valuation method * soil microbial communities Subject RIV: DJ - Water Pollution ; Quality Impact factor: 1.789, year: 2016

  10. Entrepreneur environment management behavior evaluation method derived from environmental economy.

    Science.gov (United States)

    Zhang, Lili; Hou, Xilin; Xi, Fengru

    2013-12-01

    Evaluation system can encourage and guide entrepreneurs, and impel them to perform well in environment management. An evaluation method based on advantage structure is established. It is used to analyze entrepreneur environment management behavior in China. Entrepreneur environment management behavior evaluation index system is constructed based on empirical research. Evaluation method of entrepreneurs is put forward, from the point of objective programming-theory to alert entrepreneurs concerned to think much of it, which means to take minimized objective function as comprehensive evaluation result and identify disadvantage structure pattern. Application research shows that overall behavior of Chinese entrepreneurs environmental management are good, specially, environment strategic behavior are best, environmental management behavior are second, cultural behavior ranks last. Application results show the efficiency and feasibility of this method. Copyright © 2013 The Research Centre for Eco-Environmental Sciences, Chinese Academy of Sciences. Published by Elsevier B.V. All rights reserved.

  11. Derivation of some formulae in combinatrics by heuristic methods

    Science.gov (United States)

    Kobayashi, Yukio

    2015-04-01

    Heuristic methods are more effective for students inlearning permutations and combinations in mathematics than passive learning such as rote memorization of formulae. Two examples, n! and 2n - 1Cn, of finding new combinatorial formulae are discussed from a pedagogical standpoint. First, the factorial of n can be expressed as ∑n - 1k = 0k . k!, which can be found by a heuristic method. This expression is comparable to representations of powers of r using geometrical series. Second, the number of possible combinations with repetition of n drawings from n elements is denoted 2n - 1Cn, which can be calculated from ∑n - 1k = 0nCk + 1n - 1Ck. The relation ∑n - 1k = 0nCk + 1n - 1Ck = 2n - 1Cn can be found by a heuristic method through a corresponding problem on mapping.

  12. Inactivation of viruses in labile blood derivatives. II. Physical methods

    International Nuclear Information System (INIS)

    Horowitz, B.; Wiebe, M.E.; Lippin, A.; Vandersande, J.; Stryker, M.H.

    1985-01-01

    The thermal inactivation of viruses in labile blood derivatives was evaluated by addition of marker viruses (VSV, Sindbis, Sendai, EMC) to anti-hemophilic factor (AHF) concentrates. The rate of virus inactivation at 60 degrees C was decreased by at least 100- to 700-fold by inclusion of 2.75 M glycine and 50 percent sucrose, or 3.0 M potassium citrate, additives which contribute to retention of protein biologic activity. Nonetheless, at least 10(4) infectious units of each virus was inactivated within 10 hours. Increasing the temperature from 60 to 70 or 80 degrees C caused a 90 percent or greater loss in AHF activity. An even greater decline in the rate of virus inactivation was observed on heating AHF in the lyophilized state, although no loss in AHF activity was observed after 72 hours of heating at 60 degrees C. Several of the proteins present in lyophilized AHF concentrates displayed an altered electrophoretic mobility as a result of exposure to 60 degrees C for 24 hours. Exposure of lyophilized AHF to irradiation from a cobalt 60 source resulted in an acceptable yield of AHF at 1.0, but not at 2.0, megarads. At 1 megarad, greater than or equal to 6.0 logs of VSV and 3.3 logs of Sindbis virus were inactivated

  13. Method of preparing a negative electrode including lithium alloy for use within a secondary electrochemical cell

    Science.gov (United States)

    Tomczuk, Zygmunt; Olszanski, Theodore W.; Battles, James E.

    1977-03-08

    A negative electrode that includes a lithium alloy as active material is prepared by briefly submerging a porous, electrically conductive substrate within a melt of the alloy. Prior to solidification, excess melt can be removed by vibrating or otherwise manipulating the filled substrate to expose interstitial surfaces. Electrodes of such as solid lithium-aluminum filled within a substrate of metal foam are provided.

  14. Thick electrodes including nanoparticles having electroactive materials and methods of making same

    Science.gov (United States)

    Xiao, Jie; Lu, Dongping; Liu, Jun; Zhang, Jiguang; Graff, Gordon L.

    2017-02-21

    Electrodes having nanostructure and/or utilizing nanoparticles of active materials and having high mass loadings of the active materials can be made to be physically robust and free of cracks and pinholes. The electrodes include nanoparticles having electroactive material, which nanoparticles are aggregated with carbon into larger secondary particles. The secondary particles can be bound with a binder to form the electrode.

  15. Variationally derived coarse mesh methods using an alternative flux representation

    International Nuclear Information System (INIS)

    Wojtowicz, G.; Holloway, J.P.

    1995-01-01

    Investigation of a previously reported variational technique for the solution of the 1-D, 1-group neutron transport equation in reactor lattices has inspired the development of a finite element formulation of the method. Compared to conventional homogenization methods in which node homogenized cross sections are used, the coefficients describing this system take on greater spatial dependence. However, the methods employ an alternative flux representation which allows the transport equation to be cast into a form whose solution has only a slow spatial variation and, hence, requires relatively few variables to describe. This alternative flux representation and the stationary property of a variational principle define a class of coarse mesh discretizations of transport theory capable of achieving order of magnitude reductions of eigenvalue and pointwise scalar flux errors as compared with diffusion theory while retaining diffusion theory's relatively low cost. Initial results of a 1-D spectral element approach are reviewed and used to motivate the finite element implementation which is more efficient and almost as accurate; one and two group results of this method are described

  16. Perspective: Ab initio force field methods derived from quantum mechanics

    Science.gov (United States)

    Xu, Peng; Guidez, Emilie B.; Bertoni, Colleen; Gordon, Mark S.

    2018-03-01

    It is often desirable to accurately and efficiently model the behavior of large molecular systems in the condensed phase (thousands to tens of thousands of atoms) over long time scales (from nanoseconds to milliseconds). In these cases, ab initio methods are difficult due to the increasing computational cost with the number of electrons. A more computationally attractive alternative is to perform the simulations at the atomic level using a parameterized function to model the electronic energy. Many empirical force fields have been developed for this purpose. However, the functions that are used to model interatomic and intermolecular interactions contain many fitted parameters obtained from selected model systems, and such classical force fields cannot properly simulate important electronic effects. Furthermore, while such force fields are computationally affordable, they are not reliable when applied to systems that differ significantly from those used in their parameterization. They also cannot provide the information necessary to analyze the interactions that occur in the system, making the systematic improvement of the functional forms that are used difficult. Ab initio force field methods aim to combine the merits of both types of methods. The ideal ab initio force fields are built on first principles and require no fitted parameters. Ab initio force field methods surveyed in this perspective are based on fragmentation approaches and intermolecular perturbation theory. This perspective summarizes their theoretical foundation, key components in their formulation, and discusses key aspects of these methods such as accuracy and formal computational cost. The ab initio force fields considered here were developed for different targets, and this perspective also aims to provide a balanced presentation of their strengths and shortcomings. Finally, this perspective suggests some future directions for this actively developing area.

  17. Method for pulse control in a laser including a stimulated brillouin scattering mirror system

    Science.gov (United States)

    Dane, C. Brent; Hackel, Lloyd; Harris, Fritz B.

    2007-10-23

    A laser system, such as a master oscillator/power amplifier system, comprises a gain medium and a stimulated Brillouin scattering SBS mirror system. The SBS mirror system includes an in situ filtered SBS medium that comprises a compound having a small negative non-linear index of refraction, such as a perfluoro compound. An SBS relay telescope having a telescope focal point includes a baffle at the telescope focal point which blocks off angle beams. A beam splitter is placed between the SBS mirror system and the SBS relay telescope, directing a fraction of the beam to an alternate beam path for an alignment fiducial. The SBS mirror system has a collimated SBS cell and a focused SBS cell. An adjustable attenuator is placed between the collimated SBS cell and the focused SBS cell, by which pulse width of the reflected beam can be adjusted.

  18. Impact of Including Authentic Inquiry Experiences in Methods Courses for Pre-Service Secondary Teachers

    Science.gov (United States)

    Slater, T. F.; Elfring, L.; Novodvorsky, I.; Talanquer, V.; Quintenz, J.

    2007-12-01

    Science education reform documents universally call for students to have authentic and meaningful experiences using real data in the context of their science education. The underlying philosophical position is that students analyzing data can have experiences that mimic actual research. In short, research experiences that reflect the scientific spirit of inquiry potentially can: prepare students to address real world complex problems; develop students' ability to use scientific methods; prepare students to critically evaluate the validity of data or evidence and of the consequent interpretations or conclusions; teach quantitative skills, technical methods, and scientific concepts; increase verbal, written, and graphical communication skills; and train students in the values and ethics of working with scientific data. However, it is unclear what the broader pre-service teacher preparation community is doing in preparing future teachers to promote, manage, and successful facilitate their own students in conducting authentic scientific inquiry. Surveys of undergraduates in secondary science education programs suggests that students have had almost no experiences themselves in conducting open scientific inquiry where they develop researchable questions, design strategies to pursue evidence, and communicate data-based conclusions. In response, the College of Science Teacher Preparation Program at the University of Arizona requires all students enrolled in its various science teaching methods courses to complete an open inquiry research project and defend their findings at a specially designed inquiry science mini-conference at the end of the term. End-of-term surveys show that students enjoy their research experience and believe that this experience enhances their ability to facilitate their own future students in conducting open inquiry.

  19. Comparison of some biased estimation methods (including ordinary subset regression) in the linear model

    Science.gov (United States)

    Sidik, S. M.

    1975-01-01

    Ridge, Marquardt's generalized inverse, shrunken, and principal components estimators are discussed in terms of the objectives of point estimation of parameters, estimation of the predictive regression function, and hypothesis testing. It is found that as the normal equations approach singularity, more consideration must be given to estimable functions of the parameters as opposed to estimation of the full parameter vector; that biased estimators all introduce constraints on the parameter space; that adoption of mean squared error as a criterion of goodness should be independent of the degree of singularity; and that ordinary least-squares subset regression is the best overall method.

  20. Use of the potentiometric titration method to investigate heterogeneous systems including phosphorylated complexones

    International Nuclear Information System (INIS)

    Tereshin, G.S.; Kharitonova, L.K.; Kuznetsova, O.B.

    1979-01-01

    Heterogeneous systems Y(NO 3 ) 3 (YCl 3 )-Hsub(n)L-KNO 3 (KCl)-H 2 O are investigated by potentiometric titration (with coulomb-meter generation of oH - ions). Hsub(n)L is one of the following: oxyethylidendiphosphonic; aminobenzilidendiphosphonic; glycine-bis-methyl-phosphonic; nitrilotrimethylphosphonic (H 6 L) and ethylenediaminetetramethylphosphonic acids. The range of the exsistence of YHsub(nL3)LxyH 2 O has been determined. The possibility of using potentiometric titration for investigating heterogeneous systems is demonstrated by the stUdy of the system Y(NO 3 ) 3 -H 6 L-KOH-H 2 o by the method of residual concentration. The two methods have shown that at pH 3 LxyH 2 O; at pH=6, KYH 2 Lxy'H 2 O, and at pH=7, K 2 YHLxy''H 2 O. The complete solubility products of nitrilotrimethylphosphonates are evaluated

  1. A convolution method for predicting mean treatment dose including organ motion at imaging

    International Nuclear Information System (INIS)

    Booth, J.T.; Zavgorodni, S.F.; Royal Adelaide Hospital, SA

    2000-01-01

    Full text: The random treatment delivery errors (organ motion and set-up error) can be incorporated into the treatment planning software using a convolution method. Mean treatment dose is computed as the convolution of a static dose distribution with a variation kernel. Typically this variation kernel is Gaussian with variance equal to the sum of the organ motion and set-up error variances. We propose a novel variation kernel for the convolution technique that additionally considers the position of the mobile organ in the planning CT image. The systematic error of organ position in the planning CT image can be considered random for each patient over a population. Thus the variance of the variation kernel will equal the sum of treatment delivery variance and organ motion variance at planning for the population of treatments. The kernel is extended to deal with multiple pre-treatment CT scans to improve tumour localisation for planning. Mean treatment doses calculated with the convolution technique are compared to benchmark Monte Carlo (MC) computations. Calculations of mean treatment dose using the convolution technique agreed with MC results for all cases to better than ± 1 Gy in the planning treatment volume for a prescribed 60 Gy treatment. Convolution provides a quick method of incorporating random organ motion (captured in the planning CT image and during treatment delivery) and random set-up errors directly into the dose distribution. Copyright (2000) Australasian College of Physical Scientists and Engineers in Medicine

  2. System and method for detecting components of a mixture including a valving scheme for competition assays

    Energy Technology Data Exchange (ETDEWEB)

    Koh, Chung-Yan; Piccini, Matthew E.; Singh, Anup K.

    2017-09-19

    Examples are described including measurement systems for conducting competition assays. A first chamber of an assay device may be loaded with a sample containing a target antigen. The target antigen in the sample may be allowed to bind to antibody-coated beads in the first chamber. A control layer separating the first chamber from a second chamber may then be opened to allow a labeling agent loaded in a first portion of the second chamber to bind to any unoccupied sites on the antibodies. A centrifugal force may then be applied to transport the beads through a density media to a detection region for measurement by a detection unit.

  3. System and method for detecting components of a mixture including a valving scheme for competition assays

    Science.gov (United States)

    Koh, Chung-Yan; Piccini, Matthew E.; Singh, Anup K.

    2017-07-11

    Examples are described including measurement systems for conducting competition assays. A first chamber of an assay device may be loaded with a sample containing a target antigen. The target antigen in the sample may be allowed to bind to antibody-coated beads in the first chamber. A control layer separating the first chamber from a second chamber may then be opened to allow a labeling agent loaded in a first portion of the second chamber to bind to any unoccupied sites on the antibodies. A centrifugal force may then be applied to transport the beads through a density media to a detection region for measurement by a detection unit.

  4. Electromagnetic Radiation : Variational Methods, Waveguides and Accelerators Including seminal papers of Julian Schwinger

    CERN Document Server

    Milton, Kimball A

    2006-01-01

    This is a graduate level textbook on the theory of electromagnetic radiation and its application to waveguides, transmission lines, accelerator physics and synchrotron radiation. It has grown out of lectures and manuscripts by Julian Schwinger prepared during the war at MIT's Radiation Laboratory, updated with material developed by Schwinger at UCLA in the 1970s and 1980s, and by Milton at the University of Oklahoma since 1994. The book includes a great number of straightforward and challenging exercises and problems. It is addressed to students in physics, electrical engineering, and applied mathematics seeking a thorough introduction to electromagnetism with emphasis on radiation theory and its applications.

  5. Decoding Facial Esthetics to Recreate an Esthetic Hairline: A Method Which Includes Forehead Curvature.

    Science.gov (United States)

    Garg, Anil K; Garg, Seema

    2017-01-01

    The evidence suggests that our perception of physical beauty is based on how closely the features of one's face reflect phi (the golden ratio) in their proportions. By that extension, it must certainly be possible to use a mathematical parameter to design an anterior hairline in all faces. To establish a user-friendly method to design an anterior hairline in cases of male pattern alopecia. We need a flexible measuring tape and skin marker. A reference point A (glabella) is taken in between eyebrows. Mark point E, near the lateral canthus, 8 cm horizontal on either side from the central point A. A mid-frontal point (point B) is marked 8 cm from point A on the forehead in a mid-vertical plane. The frontotemporal points (C and C') are marked on the frontotemporal area, 8 cm in a horizontal plane from point B and 8 cm in a vertical plane from point E. The temporal peak points (D and D') are marked on the line joining the frontotemporal point C to the lateral canthus point E, slightly more than halfway toward lateral canthus, usually 5 cm from the frontotemporal point C. This line makes an anterior border of the temporal triangle. We have conducted a study with 431 cases of male pattern alopecia. The average distance of the mid-frontal point from glabella was 7.9 cm. The patient satisfaction reported was 94.7%. Our method gives a skeletal frame of the anterior hairline with minimal criteria, with no need of visual imagination and experience of the surgeon. It automatically takes care of the curvature of the forehead and is easy to use for a novice surgeon.

  6. q-Derivatives, quantization methods and q-algebras

    International Nuclear Information System (INIS)

    Twarock, Reidun

    1998-01-01

    Using the example of Borel quantization on S 1 , we discuss the relation between quantization methods and q-algebras. In particular, it is shown that a q-deformation of the Witt algebra with generators labeled by Z is realized by q-difference operators. This leads to a discrete quantum mechanics. Because of Z, the discretization is equidistant. As an approach to a non-equidistant discretization of quantum mechanics one can change the Witt algebra using not the number field Z as labels but a quadratic extension of Z characterized by an irrational number τ. This extension is denoted as quasi-crystal Lie algebra, because this is a relation to one-dimensional quasicrystals. The q-deformation of this quasicrystal Lie algebra is discussed. It is pointed out that quasicrystal Lie algebras can be considered also as a 'deformed' Witt algebra with a 'deformation' of the labeling number field. Their application to the theory is discussed

  7. Consensus for nonmelanoma skin cancer treatment: basal cell carcinoma, including a cost analysis of treatment methods.

    Science.gov (United States)

    Kauvar, Arielle N B; Cronin, Terrence; Roenigk, Randall; Hruza, George; Bennett, Richard

    2015-05-01

    Basal cell carcinoma (BCC) is the most common cancer in the US population affecting approximately 2.8 million people per year. Basal cell carcinomas are usually slow-growing and rarely metastasize, but they do cause localized tissue destruction, compromised function, and cosmetic disfigurement. To provide clinicians with guidelines for the management of BCC based on evidence from a comprehensive literature review, and consensus among the authors. An extensive review of the medical literature was conducted to evaluate the optimal treatment methods for cutaneous BCC, taking into consideration cure rates, recurrence rates, aesthetic and functional outcomes, and cost-effectiveness of the procedures. Surgical approaches provide the best outcomes for BCCs. Mohs micrographic surgery provides the highest cure rates while maximizing tissue preservation, maintenance of function, and cosmesis. Mohs micrographic surgery is an efficient and cost-effective procedure and remains the treatment of choice for high-risk BCCs and for those in cosmetically sensitive locations. Nonsurgical modalities may be used for low-risk BCCs when surgery is contraindicated or impractical, but the cure rates are lower.

  8. Development method of Hybrid Energy Storage System, including PEM fuel cell and a battery

    International Nuclear Information System (INIS)

    Ustinov, A; Khayrullina, A; Khmelik, M; Sveshnikova, A; Borzenko, V

    2016-01-01

    Development of fuel cell (FC) and hydrogen metal-hydride storage (MH) technologies continuously demonstrate higher efficiency rates and higher safety, as hydrogen is stored at low pressures of about 2 bar in a bounded state. A combination of a FC/MH system with an electrolyser, powered with a renewable source, allows creation of an almost fully autonomous power system, which could potentially replace a diesel-generator as a back-up power supply. However, the system must be extended with an electro-chemical battery to start-up the FC and compensate the electric load when FC fails to deliver the necessary power. Present paper delivers the results of experimental and theoretical investigation of a hybrid energy system, including a proton exchange membrane (PEM) FC, MH- accumulator and an electro-chemical battery, development methodology for such systems and the modelling of different battery types, using hardware-in-the-loop approach. The economic efficiency of the proposed solution is discussed using an example of power supply of a real town of Batamai in Russia. (paper)

  9. Development method of Hybrid Energy Storage System, including PEM fuel cell and a battery

    Science.gov (United States)

    Ustinov, A.; Khayrullina, A.; Borzenko, V.; Khmelik, M.; Sveshnikova, A.

    2016-09-01

    Development of fuel cell (FC) and hydrogen metal-hydride storage (MH) technologies continuously demonstrate higher efficiency rates and higher safety, as hydrogen is stored at low pressures of about 2 bar in a bounded state. A combination of a FC/MH system with an electrolyser, powered with a renewable source, allows creation of an almost fully autonomous power system, which could potentially replace a diesel-generator as a back-up power supply. However, the system must be extended with an electro-chemical battery to start-up the FC and compensate the electric load when FC fails to deliver the necessary power. Present paper delivers the results of experimental and theoretical investigation of a hybrid energy system, including a proton exchange membrane (PEM) FC, MH- accumulator and an electro-chemical battery, development methodology for such systems and the modelling of different battery types, using hardware-in-the-loop approach. The economic efficiency of the proposed solution is discussed using an example of power supply of a real town of Batamai in Russia.

  10. Uncertainty in Measurement: A Review of Monte Carlo Simulation Using Microsoft Excel for the Calculation of Uncertainties Through Functional Relationships, Including Uncertainties in Empirically Derived Constants

    Science.gov (United States)

    Farrance, Ian; Frenkel, Robert

    2014-01-01

    The Guide to the Expression of Uncertainty in Measurement (usually referred to as the GUM) provides the basic framework for evaluating uncertainty in measurement. The GUM however does not always provide clearly identifiable procedures suitable for medical laboratory applications, particularly when internal quality control (IQC) is used to derive most of the uncertainty estimates. The GUM modelling approach requires advanced mathematical skills for many of its procedures, but Monte Carlo simulation (MCS) can be used as an alternative for many medical laboratory applications. In particular, calculations for determining how uncertainties in the input quantities to a functional relationship propagate through to the output can be accomplished using a readily available spreadsheet such as Microsoft Excel. The MCS procedure uses algorithmically generated pseudo-random numbers which are then forced to follow a prescribed probability distribution. When IQC data provide the uncertainty estimates the normal (Gaussian) distribution is generally considered appropriate, but MCS is by no means restricted to this particular case. With input variations simulated by random numbers, the functional relationship then provides the corresponding variations in the output in a manner which also provides its probability distribution. The MCS procedure thus provides output uncertainty estimates without the need for the differential equations associated with GUM modelling. The aim of this article is to demonstrate the ease with which Microsoft Excel (or a similar spreadsheet) can be used to provide an uncertainty estimate for measurands derived through a functional relationship. In addition, we also consider the relatively common situation where an empirically derived formula includes one or more ‘constants’, each of which has an empirically derived numerical value. Such empirically derived ‘constants’ must also have associated uncertainties which propagate through the functional

  11. Uncertainty in measurement: a review of monte carlo simulation using microsoft excel for the calculation of uncertainties through functional relationships, including uncertainties in empirically derived constants.

    Science.gov (United States)

    Farrance, Ian; Frenkel, Robert

    2014-02-01

    The Guide to the Expression of Uncertainty in Measurement (usually referred to as the GUM) provides the basic framework for evaluating uncertainty in measurement. The GUM however does not always provide clearly identifiable procedures suitable for medical laboratory applications, particularly when internal quality control (IQC) is used to derive most of the uncertainty estimates. The GUM modelling approach requires advanced mathematical skills for many of its procedures, but Monte Carlo simulation (MCS) can be used as an alternative for many medical laboratory applications. In particular, calculations for determining how uncertainties in the input quantities to a functional relationship propagate through to the output can be accomplished using a readily available spreadsheet such as Microsoft Excel. The MCS procedure uses algorithmically generated pseudo-random numbers which are then forced to follow a prescribed probability distribution. When IQC data provide the uncertainty estimates the normal (Gaussian) distribution is generally considered appropriate, but MCS is by no means restricted to this particular case. With input variations simulated by random numbers, the functional relationship then provides the corresponding variations in the output in a manner which also provides its probability distribution. The MCS procedure thus provides output uncertainty estimates without the need for the differential equations associated with GUM modelling. The aim of this article is to demonstrate the ease with which Microsoft Excel (or a similar spreadsheet) can be used to provide an uncertainty estimate for measurands derived through a functional relationship. In addition, we also consider the relatively common situation where an empirically derived formula includes one or more 'constants', each of which has an empirically derived numerical value. Such empirically derived 'constants' must also have associated uncertainties which propagate through the functional relationship

  12. Processing methods, characteristics and adsorption behavior of tire derived carbons: a review.

    Science.gov (United States)

    Saleh, Tawfik A; Gupta, Vinod Kumar

    2014-09-01

    The remarkable increase in the number of vehicles worldwide; and the lack of both technical and economical mechanisms of disposal make waste tires to be a serious source of pollution. One potential recycling process is pyrolysis followed by chemical activation process to produce porous activated carbons. Many researchers have recently proved the capability of such carbons as adsorbents to remove various types of pollutants including organic and inorganic species. This review attempts to compile relevant knowledge about the production methods of carbon from waste rubber tires. The effects of various process parameters including temperature and heating rate, on the pyrolysis stage; activation temperature and time, activation agent and activating gas are reviewed. This review highlights the use of waste-tires derived carbon to remove various types of pollutants like heavy metals, dye, pesticides and others from aqueous media. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. The COS Method : An Efficient Fourier Method for Pricing Financial Derivatives

    NARCIS (Netherlands)

    Fang, F.

    2010-01-01

    When valuing and risk-managing financial derivatives, practitioners demand fast and accurate prices and sensitivities. Aside from the pricing of non-standard exotic financial derivatives, so-called plain vanilla European options form the basis for the calibration of financial models. As any pricing

  14. Method development and validation of potent pyrimidine derivative by UV-VIS spectrophotometer.

    Science.gov (United States)

    Chaudhary, Anshu; Singh, Anoop; Verma, Prabhakar Kumar

    2014-12-01

    A rapid and sensitive ultraviolet-visible (UV-VIS) spectroscopic method was developed for the estimation of pyrimidine derivative 6-Bromo-3-(6-(2,6-dichlorophenyl)-2-(morpolinomethylamino) pyrimidine4-yl) -2H-chromen-2-one (BT10M) in bulk form. Pyrimidine derivative was monitored at 275 nm with UV detection, and there is no interference of diluents at 275 nm. The method was found to be linear in the range of 50 to 150 μg/ml. The accuracy and precision were determined and validated statistically. The method was validated as a guideline. The results showed that the proposed method is suitable for the accurate, precise, and rapid determination of pyrimidine derivative. Graphical Abstract Method development and validation of potent pyrimidine derivative by UV spectroscopy.

  15. Synthesis of Various Polyaniline / Clay Nanocomposites Derived from Aniline and Substituted Aniline Derivatives by Mechanochemical Intercalation Method

    Directory of Open Access Journals (Sweden)

    N. Kalaivasan

    2010-01-01

    Full Text Available Polyaniline clay nanocomposite can be prepared by mechano-chemical method in which intercalation of anilinium ion into the clay lattices accomplished by mechanical grinding of sodium montmorillonite (Na+MMT in presence of anilinium hydrochloride at room temperature using mortar & pestle for about 30 min and subsequent grinding with oxidizing agent, ammonium peroxysulfate. The appearance of green colour indicates the formation of polyaniline/clay nanocomposite (PANI/Clay. Similarly aniline derivatives like o-toludine and o-anisidine in the form of HCl salt can form intercalation into the clay lattices. The intercalated aniline derivatives were ground mechanically in presence of oxidizing agent ammonium peroxysulfate lead to formation of substituted polyaniline/ clay nanocomposites. The characteristics of various polyaniline-clay nanocomposites were investigated using UV-Visible, FT-IR, cyclic voltammetry studies.

  16. A time-dependent neutron transport method of characteristics formulation with time derivative propagation

    International Nuclear Information System (INIS)

    Hoffman, Adam J.; Lee, John C.

    2016-01-01

    A new time-dependent Method of Characteristics (MOC) formulation for nuclear reactor kinetics was developed utilizing angular flux time-derivative propagation. This method avoids the requirement of storing the angular flux at previous points in time to represent a discretized time derivative; instead, an equation for the angular flux time derivative along 1D spatial characteristics is derived and solved concurrently with the 1D transport characteristic equation. This approach allows the angular flux time derivative to be recast principally in terms of the neutron source time derivatives, which are approximated to high-order accuracy using the backward differentiation formula (BDF). This approach, called Source Derivative Propagation (SDP), drastically reduces the memory requirements of time-dependent MOC relative to methods that require storing the angular flux. An SDP method was developed for 2D and 3D applications and implemented in the computer code DeCART in 2D. DeCART was used to model two reactor transient benchmarks: a modified TWIGL problem and a C5G7 transient. The SDP method accurately and efficiently replicated the solution of the conventional time-dependent MOC method using two orders of magnitude less memory.

  17. A time-dependent neutron transport method of characteristics formulation with time derivative propagation

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, Adam J., E-mail: adamhoff@umich.edu; Lee, John C., E-mail: jcl@umich.edu

    2016-02-15

    A new time-dependent Method of Characteristics (MOC) formulation for nuclear reactor kinetics was developed utilizing angular flux time-derivative propagation. This method avoids the requirement of storing the angular flux at previous points in time to represent a discretized time derivative; instead, an equation for the angular flux time derivative along 1D spatial characteristics is derived and solved concurrently with the 1D transport characteristic equation. This approach allows the angular flux time derivative to be recast principally in terms of the neutron source time derivatives, which are approximated to high-order accuracy using the backward differentiation formula (BDF). This approach, called Source Derivative Propagation (SDP), drastically reduces the memory requirements of time-dependent MOC relative to methods that require storing the angular flux. An SDP method was developed for 2D and 3D applications and implemented in the computer code DeCART in 2D. DeCART was used to model two reactor transient benchmarks: a modified TWIGL problem and a C5G7 transient. The SDP method accurately and efficiently replicated the solution of the conventional time-dependent MOC method using two orders of magnitude less memory.

  18. A simple graphical method for deriving kinetics of repair from fractionated and protracted irradiations

    International Nuclear Information System (INIS)

    Scalliet, P.; Schueren, E. van der; Erfmann, R.K.L.; Landuyt, W.

    1988-01-01

    The authors present a method for the derivation of the time constant of repair from fractionated and protracted irradiations, using formulae based on those derived by Dale (1985) and Liversage (1969) establishing the correlation between the biological effects of low dose rate and acute fractionated irradiation. (UK)

  19. Thiourea derivatives, methods of their preparation and their use in neutron capture therapy of malignant melanoma

    Energy Technology Data Exchange (ETDEWEB)

    Gabel, D.

    1991-06-04

    The present invention pertains to boron containing thiouracil derivatives, their method of preparations, and their use in the therapy of malignant melanoma using boron neutron capture therapy. No Drawings

  20. New Systematic CFD Methods to Calculate Static and Single Dynamic Stability Derivatives of Aircraft

    Directory of Open Access Journals (Sweden)

    Bai-gang Mi

    2017-01-01

    Full Text Available Several new systematic methods for high fidelity and reliability calculation of static and single dynamic derivatives are proposed in this paper. Angle of attack step response is used to obtain static derivative directly; then translation acceleration dynamic derivative and rotary dynamic derivative can be calculated by employing the step response motion of rate of the angle of attack and unsteady motion of pitching angular velocity step response, respectively. Longitudinal stability derivative calculations of SACCON UCAV are taken as test cases for validation. Numerical results of all cases achieve good agreement with reference values or experiments data from wind tunnel, which indicate that the proposed methods can be considered as new tools in the process of design and production of advanced aircrafts for their high efficiency and precision.

  1. Derivative spectrophotometric method for simultaneous determination of clindamycin phosphate and tretinoin in pharmaceutical dosage forms.

    Science.gov (United States)

    Barazandeh Tehrani, Maliheh; Namadchian, Melika; Fadaye Vatan, Sedigheh; Souri, Effat

    2013-04-10

    A derivative spectrophotometric method was proposed for the simultaneous determination of clindamycin and tretinoin in pharmaceutical dosage forms. The measurement was achieved using the first and second derivative signals of clindamycin at (1D) 251 nm and (2D) 239 nm and tretinoin at (1D) 364 nm and (2D) 387 nm.The proposed method showed excellent linearity at both first and second derivative order in the range of 60-1200 and 1.25-25 μg/ml for clindamycin phosphate and tretinoin respectively. The within-day and between-day precision and accuracy was in acceptable range (CVpharmaceutical dosage form.

  2. Interatomic methods for the dispersion energy derived from the adiabatic connection fluctuation-dissipation theorem

    Science.gov (United States)

    Tkatchenko, Alexandre; Ambrosetti, Alberto; DiStasio, Robert A.

    2013-02-01

    Interatomic pairwise methods are currently among the most popular and accurate ways to include dispersion energy in density functional theory calculations. However, when applied to more than two atoms, these methods are still frequently perceived to be based on ad hoc assumptions, rather than a rigorous derivation from quantum mechanics. Starting from the adiabatic connection fluctuation-dissipation (ACFD) theorem, an exact expression for the electronic exchange-correlation energy, we demonstrate that the pairwise interatomic dispersion energy for an arbitrary collection of isotropic polarizable dipoles emerges from the second-order expansion of the ACFD formula upon invoking the random-phase approximation (RPA) or the full-potential approximation. Moreover, for a system of quantum harmonic oscillators coupled through a dipole-dipole potential, we prove the equivalence between the full interaction energy obtained from the Hamiltonian diagonalization and the ACFD-RPA correlation energy. This property makes the Hamiltonian diagonalization an efficient method for the calculation of the many-body dispersion energy. In addition, we show that the switching function used to damp the dispersion interaction at short distances arises from a short-range screened Coulomb potential, whose role is to account for the spatial spread of the individual atomic dipole moments. By using the ACFD formula, we gain a deeper understanding of the approximations made in the interatomic pairwise approaches, providing a powerful formalism for further development of accurate and efficient methods for the calculation of the dispersion energy.

  3. Recognition of Core- and Polymerase-derived immunogenic peptides included in novel therapeutic vaccine by T cells from Chinese chronic hepatitis B patients.

    Science.gov (United States)

    Huang, D; Sansas, B; Jiang, J H; Gong, Q M; Jin, G D; Calais, V; Yu, D M; Zhu, M Y; Wei, D; Zhang, D H; Inchauspé, G; Zhang, X X; Zhu, R

    2017-11-01

    Chronic hepatitis B (CHB) is one of the major public health challenges in the world. Due to a strong interplay between specific T-cell immunity and elimination of hepatitis B virus (HBV), efforts to develop novel immunotherapeutics are gaining attention. TG1050, a novel immunotherapy, has shown efficacy in an animal study. To support the clinical development of TG1050 in China, specific immunity to the fusion antigens of TG1050 was assessed in Chinese patients. One hundred and thirty subjects were divided into three groups as CHB patients, HBV spontaneous resolvers, and CHB patients with HBsAg loss after antiviral treatment. HBV-specific T-cell responses to pools of HBV Core or Polymerase genotype D peptides included in TG1050 were evaluated. HBV Core- or Polymerase-specific cells were detected in peripheral blood mononuclear cells (PBMCs) from the different cohorts. The frequencies and intensities of HBV Core-specific immune responses were significantly lower in CHB patients than in HBsAg loss subjects. In CHB patients, a dominant pool derived from Polymerase (Pol1) was the most immunogenic. CHB patients with low viral loads (Core peptide pool. Overall, genotype D-derived peptides included in TG1050 could raise broad and functional T-cell responses in PBMCs from Chinese CHB patients infected with genotype B/C isolates. Core-specific immunogenic domains appeared as "hot spots" with the capacity to differentiate between CHB vs HBsAg loss subjects. These observations support the extended application and associated immune monitoring of TG1050 in China. © 2017 The Authors. Journal of Viral Hepatitis Published by John Wiley & Sons Ltd.

  4. A detailed kinetic mechanism including methanol and nitrogen pollutants relevant to the gas-phase combustion and pyrolysis of biomass-derived fuels

    Energy Technology Data Exchange (ETDEWEB)

    Coda Zabetta, Edgardo; Hupa, Mikko [Aabo Akademi Process Chemistry Centre, Piispankatu 8, FI-20500 Turku (Finland)

    2008-01-15

    A detailed chemical kinetic mechanism for the simulation of the gas-phase combustion and pyrolysis of biomass-derived fuels was compiled by assembling selected reaction subsets from existing mechanisms (parents). The mechanism, here referred to as ''AaA,'' includes reaction subsets for the oxidation of hydrogen (H{sub 2}), carbon monoxide (CO), light hydrocarbons (C{sub 1} and C{sub 2}), and methanol (CH{sub 3}OH). The mechanism also takes into account reaction subsets of nitrogen pollutants, including the reactions relevant to staged combustion, reburning, and selective noncatalytic reduction (SNCR). The AaA mechanism was validated against suitable experimental data from the literature. Overall, the AaA mechanism gave more accurate predictions than three other mechanisms of reference, although the reference mechanisms performed better occasionally. The predictions from AaA were also found to be consistent with the predictions of its parent mechanisms within most of their range of validity, thus transferring the validity of the parents to the inheriting mechanism (AaA). In parametric studies the AaA mechanism predicted that the effect of methanol on combustion and pollutants is often similar to that of light hydrocarbons, but it also showed that there are important exceptions, thus suggesting that methanol should be taken into account when simulating biomass combustion. To our knowledge, the AaA mechanism is currently the only mechanism that accounts for the chemistry of methanol and nitrogen relevant to the gas-phase combustion and pyrolysis of biomass-derived fuels. (author)

  5. Symplectic Integrators to Stochastic Hamiltonian Dynamical Systems Derived from Composition Methods

    Directory of Open Access Journals (Sweden)

    Tetsuya Misawa

    2010-01-01

    Full Text Available “Symplectic” schemes for stochastic Hamiltonian dynamical systems are formulated through “composition methods (or operator splitting methods” proposed by Misawa (2001. In the proposed methods, a symplectic map, which is given by the solution of a stochastic Hamiltonian system, is approximated by composition of the stochastic flows derived from simpler Hamiltonian vector fields. The global error orders of the numerical schemes derived from the stochastic composition methods are provided. To examine the superiority of the new schemes, some illustrative numerical simulations on the basis of the proposed schemes are carried out for a stochastic harmonic oscillator system.

  6. Optimized methods for preparation of 6I-(ω-sulfanyl-alkylene-sulfanyl-β-cyclodextrin derivatives

    Directory of Open Access Journals (Sweden)

    Eva Bednářová

    2016-02-01

    Full Text Available A general high-yielding method for the preparation of monosubstituted β-cyclodextrin derivatives which have attached a thiol group in position 6 is described. The thiol group is attached through linkers of different lengths and repeating units (ethylene glycol or methylene. The target compounds were characterized by IR, MS and NMR spectra. A simple method for their complete conversion to the corresponding disulfides as well as a method for the reduction of the disulfides back to the thiols is presented. Both, thiols and disulfides are derivatives usable for well-defined covalent attachment of cyclodextrin to gold or polydopamine-coated solid surfaces.

  7. Topology optimization based on spline-based meshfree method using topological derivatives

    International Nuclear Information System (INIS)

    Hur, Junyoung; Youn, Sung-Kie; Kang, Pilseong

    2017-01-01

    Spline-based meshfree method (SBMFM) is originated from the Isogeometric analysis (IGA) which integrates design and analysis through Non-uniform rational B-spline (NURBS) basis functions. SBMFM utilizes trimming technique of CAD system by representing the domain using NURBS curves. In this work, an explicit boundary topology optimization using SBMFM is presented with an effective boundary update scheme. There have been similar works in this subject. However unlike the previous works where semi-analytic method for calculating design sensitivities is employed, the design update is done by using topological derivatives. In this research, the topological derivative is used to derive the sensitivity of boundary curves and for the creation of new holes. Based on the values of topological derivatives, the shape of boundary curves is updated. Also, the topological change is achieved by insertion and removal of the inner holes. The presented approach is validated through several compliance minimization problems.

  8. Topology optimization based on spline-based meshfree method using topological derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Hur, Junyoung; Youn, Sung-Kie [KAIST, Daejeon (Korea, Republic of); Kang, Pilseong [Korea Research Institute of Standards and Science, Daejeon (Korea, Republic of)

    2017-05-15

    Spline-based meshfree method (SBMFM) is originated from the Isogeometric analysis (IGA) which integrates design and analysis through Non-uniform rational B-spline (NURBS) basis functions. SBMFM utilizes trimming technique of CAD system by representing the domain using NURBS curves. In this work, an explicit boundary topology optimization using SBMFM is presented with an effective boundary update scheme. There have been similar works in this subject. However unlike the previous works where semi-analytic method for calculating design sensitivities is employed, the design update is done by using topological derivatives. In this research, the topological derivative is used to derive the sensitivity of boundary curves and for the creation of new holes. Based on the values of topological derivatives, the shape of boundary curves is updated. Also, the topological change is achieved by insertion and removal of the inner holes. The presented approach is validated through several compliance minimization problems.

  9. Methods for conversion of lignocellulosic-derived products to transportation fuel precursors

    Science.gov (United States)

    Lilga, Michael A.; Padmaperuma, Asanga B.

    2017-10-03

    Methods are disclosed for converting a biomass-derived product containing levulinic acid and/or gamma-valerolactone to a transportation fuel precursor product containing diesel like hydrocarbons. These methods are expected to produce fuel products at a reduced cost relative to conventional approaches.

  10. Numerical differentiation methods for the logarithmic derivative technique used in dielectric spectroscopy

    Directory of Open Access Journals (Sweden)

    Henrik Haspel

    2010-06-01

    Full Text Available In dielectric relaxation spectroscopy the conduction contribution often hampers the evaluation of dielectric spectra, especially in the low-frequency regime. In order to overcome this the logarithmic derivative technique could be used, where the calculation of the logarithmic derivative of the real part of the complex permittivity function is needed. Since broadband dielectric measurement provides discrete permittivity function, numerical differentiation has to be used. Applicability of the Savitzky-Golay convolution method in the derivative analysis is examined, and a detailed investigation of the influential parameters (frequency, spectrum resolution, peak shape is presented on synthetic dielectric data.

  11. Complex-valued derivative propagation method with approximate Bohmian trajectories: Application to electronic nonadiabatic dynamics

    Science.gov (United States)

    Wang, Yu; Chou, Chia-Chun

    2018-05-01

    The coupled complex quantum Hamilton-Jacobi equations for electronic nonadiabatic transitions are approximately solved by propagating individual quantum trajectories in real space. Equations of motion are derived through use of the derivative propagation method for the complex actions and their spatial derivatives for wave packets moving on each of the coupled electronic potential surfaces. These equations for two surfaces are converted into the moving frame with the same grid point velocities. Excellent wave functions can be obtained by making use of the superposition principle even when nodes develop in wave packet scattering.

  12. Teaching Methods in Biology Education and Sustainability Education Including Outdoor Education for Promoting Sustainability—A Literature Review

    Directory of Open Access Journals (Sweden)

    Eila Jeronen

    2016-12-01

    Full Text Available There are very few studies concerning the importance of teaching methods in biology education and environmental education including outdoor education for promoting sustainability at the levels of primary and secondary schools and pre-service teacher education. The material was selected using special keywords from biology and sustainable education in several scientific databases. The article provides an overview of 24 selected articles published in peer-reviewed scientific journals from 2006–2016. The data was analyzed using qualitative content analysis. Altogether, 16 journals were selected and 24 articles were analyzed in detail. The foci of the analyses were teaching methods, learning environments, knowledge and thinking skills, psychomotor skills, emotions and attitudes, and evaluation methods. Additionally, features of good methods were investigated and their implications for teaching were emphasized. In total, 22 different teaching methods were found to improve sustainability education in different ways. The most emphasized teaching methods were those in which students worked in groups and participated actively in learning processes. Research points toward the value of teaching methods that provide a good introduction and supportive guidelines and include active participation and interactivity.

  13. Benzoic acid derivatives: Evaluation of thermochemical properties with complementary experimental and computational methods

    International Nuclear Information System (INIS)

    Verevkin, Sergey P.; Zaitsau, Dzmitry H.; Emeĺyanenko, Vladimir N.; Stepurko, Elena N.; Zherikova, Kseniya V.

    2015-01-01

    Highlights: • Vapor pressures of benzoic acid derivatives were measured. • Sublimation enthalpies were derived and compared with the literature. • Thermochemical data tested for consistency using additivity rules and computations. • Contradiction between available enthalpies of sublimation was resolved. • Pairwise interactions of substituents on the benzene ring were derived. - Abstract: Molar sublimation enthalpies of the methyl- and methoxybenzoic acids were derived from the transpiration method, static method, and TGA. Thermochemical data available in the literature were collected, evaluated, and combined with own experimental results. This collection together with the new experimental results reported here has helped to resolve contradictions in the available enthalpy data and to recommend sets of sublimation and formation enthalpies for the benzoic acid derivatives. Gas-phase enthalpies of formation calculated with the G4 quantum-chemical method were in agreement with the experiment. Pairwise interactions of the methyl, methoxy, and carboxyl substituents on the benzene ring were derived and used for the development of simple group-additivity procedures for estimation of the vaporization enthalpies, gas-phase, and liquid-phase enthalpies of formation of substituted benzenes.

  14. Benzoic acid derivatives: Evaluation of thermochemical properties with complementary experimental and computational methods

    Energy Technology Data Exchange (ETDEWEB)

    Verevkin, Sergey P., E-mail: sergey.verevkin@uni-rostock.de [Department of Physical Chemistry and Department “Science and Technology of Life, Light and Matter”, University of Rostock, D-18059 Rostock (Germany); Department of Physical Chemistry, Kazan Federal University, 420008 Kazan (Russian Federation); Zaitsau, Dzmitry H. [Department of Physical Chemistry, Kazan Federal University, 420008 Kazan (Russian Federation); Emeĺyanenko, Vladimir N. [Department of Physical Chemistry and Department “Science and Technology of Life, Light and Matter”, University of Rostock, D-18059 Rostock (Germany); Stepurko, Elena N. [Chemistry Faculty and Research Institute for Physical Chemical Problems, Belarusian State University, 220030 Minsk (Belarus); Zherikova, Kseniya V. [Nikolaev Institute of Inorganic Chemistry of Siberian Branch of Russian Academy of Sciences, 630090 Novosibirsk (Russian Federation)

    2015-12-20

    Highlights: • Vapor pressures of benzoic acid derivatives were measured. • Sublimation enthalpies were derived and compared with the literature. • Thermochemical data tested for consistency using additivity rules and computations. • Contradiction between available enthalpies of sublimation was resolved. • Pairwise interactions of substituents on the benzene ring were derived. - Abstract: Molar sublimation enthalpies of the methyl- and methoxybenzoic acids were derived from the transpiration method, static method, and TGA. Thermochemical data available in the literature were collected, evaluated, and combined with own experimental results. This collection together with the new experimental results reported here has helped to resolve contradictions in the available enthalpy data and to recommend sets of sublimation and formation enthalpies for the benzoic acid derivatives. Gas-phase enthalpies of formation calculated with the G4 quantum-chemical method were in agreement with the experiment. Pairwise interactions of the methyl, methoxy, and carboxyl substituents on the benzene ring were derived and used for the development of simple group-additivity procedures for estimation of the vaporization enthalpies, gas-phase, and liquid-phase enthalpies of formation of substituted benzenes.

  15. Teaching Methods in Biology Education and Sustainability Education Including Outdoor Education for Promoting Sustainability--A Literature Review

    Science.gov (United States)

    Jeronen, Eila; Palmberg, Irmeli; Yli-Panula, Eija

    2017-01-01

    There are very few studies concerning the importance of teaching methods in biology education and environmental education including outdoor education for promoting sustainability at the levels of primary and secondary schools and pre-service teacher education. The material was selected using special keywords from biology and sustainable education…

  16. Method for assessment of stormwater treatment facilities - Synthetic road runoff addition including micro-pollutants and tracer.

    Science.gov (United States)

    Cederkvist, Karin; Jensen, Marina B; Holm, Peter E

    2017-08-01

    Stormwater treatment facilities (STFs) are becoming increasingly widespread but knowledge on their performance is limited. This is due to difficulties in obtaining representative samples during storm events and documenting removal of the broad range of contaminants found in stormwater runoff. This paper presents a method to evaluate STFs by addition of synthetic runoff with representative concentrations of contaminant species, including the use of tracer for correction of removal rates for losses not caused by the STF. A list of organic and inorganic contaminant species, including trace elements representative of runoff from roads is suggested, as well as relevant concentration ranges. The method was used for adding contaminants to three different STFs including a curbstone extension with filter soil, a dual porosity filter, and six different permeable pavements. Evaluation of the method showed that it is possible to add a well-defined mixture of contaminants despite different field conditions by having a flexibly system, mixing different stock-solutions on site, and use bromide tracer for correction of outlet concentrations. Bromide recovery ranged from only 12% in one of the permeable pavements to 97% in the dual porosity filter, stressing the importance of including a conservative tracer for correction of contaminant retention values. The method is considered useful in future treatment performance testing of STFs. The observed performance of the STFs is presented in coming papers. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Age correction in monitoring audiometry: method to update OSHA age-correction tables to include older workers.

    Science.gov (United States)

    Dobie, Robert A; Wojcik, Nancy C

    2015-07-13

    The US Occupational Safety and Health Administration (OSHA) Noise Standard provides the option for employers to apply age corrections to employee audiograms to consider the contribution of ageing when determining whether a standard threshold shift has occurred. Current OSHA age-correction tables are based on 40-year-old data, with small samples and an upper age limit of 60 years. By comparison, recent data (1999-2006) show that hearing thresholds in the US population have improved. Because hearing thresholds have improved, and because older people are increasingly represented in noisy occupations, the OSHA tables no longer represent the current US workforce. This paper presents 2 options for updating the age-correction tables and extending values to age 75 years using recent population-based hearing survey data from the US National Health and Nutrition Examination Survey (NHANES). Both options provide scientifically derived age-correction values that can be easily adopted by OSHA to expand their regulatory guidance to include older workers. Regression analysis was used to derive new age-correction values using audiometric data from the 1999-2006 US NHANES. Using the NHANES median, better-ear thresholds fit to simple polynomial equations, new age-correction values were generated for both men and women for ages 20-75 years. The new age-correction values are presented as 2 options. The preferred option is to replace the current OSHA tables with the values derived from the NHANES median better-ear thresholds for ages 20-75 years. The alternative option is to retain the current OSHA age-correction values up to age 60 years and use the NHANES-based values for ages 61-75 years. Recent NHANES data offer a simple solution to the need for updated, population-based, age-correction tables for OSHA. The options presented here provide scientifically valid and relevant age-correction values which can be easily adopted by OSHA to expand their regulatory guidance to

  18. A Fuzzy Group Prioritization Method for Deriving Weights and its Software Implementation

    Directory of Open Access Journals (Sweden)

    Tarifa Almulhim

    2013-09-01

    Full Text Available Several Multi-Criteria Decision Making (MCDM methods involve pairwise comparisons to obtain the preferences of decision makers (DMs. This paper proposes a fuzzy group prioritization method for deriving group priorities/weights from fuzzy pairwise comparison matrices. The proposed method extends the Fuzzy Preferences Programming Method (FPP by considering the different importance weights of multiple DMs . The elements of the group pairwise comparison matrices are presented as fuzzy numbers rather than exact numerical values, in order to model the uncertainty and imprecision in the DMs’ judgments. Unlike the known fuzzy prioritization techniques, the proposed method is able to derive crisp weights from incomplete and fuzzy set of comparison judgments and does not require additional aggregation procedures. A prototype of a decision tool is developed to assist DMs to implement the proposed method for solving fuzzy group prioritization problems in MATLAB. Detailed numerical examples are used to illustrate the proposed approach.

  19. Phase derivative method for reconstruction of slightly off-axis digital holograms.

    Science.gov (United States)

    Guo, Cheng-Shan; Wang, Ben-Yi; Sha, Bei; Lu, Yu-Jie; Xu, Ming-Yuan

    2014-12-15

    A phase derivative (PD) method is proposed for reconstruction of off-axis holograms. In this method, a phase distribution of the tested object wave constrained within 0 to pi radian is firstly worked out by a simple analytical formula; then it is corrected to its right range from -pi to pi according to the sign characteristics of its first-order derivative. A theoretical analysis indicates that this PD method is particularly suitable for reconstruction of slightly off-axis holograms because it only requires the spatial frequency of the reference beam larger than spatial frequency of the tested object wave in principle. In addition, because the PD method belongs to a pure local method with no need of any integral operation or phase shifting algorithm in process of the phase retrieval, it could have some advantages in reducing computer load and memory requirements to the image processing system. Some experimental results are given to demonstrate the feasibility of the method.

  20. A constrained Hartree-Fock-Bogoliubov equation derived from the double variational method

    International Nuclear Information System (INIS)

    Onishi, Naoki; Horibata, Takatoshi.

    1980-01-01

    The double variational method is applied to the intrinsic state of the generalized BCS wave function. A constrained Hartree-Fock-Bogoliubov equation is derived explicitly in the form of an eigenvalue equation. A method of obtaining approximate overlap and energy overlap integrals is proposed. This will help development of numerical calculations of the angular momentum projection method, especially for general intrinsic wave functions without any symmetry restrictions. (author)

  1. Myeloid-derived suppressor cells in murine AIDS inhibit B-cell responses in part via soluble mediators including reactive oxygen and nitrogen species, and TGF-β

    Energy Technology Data Exchange (ETDEWEB)

    Rastad, Jessica L. [Department of Microbiology and Immunology, Geisel School of Medicine at Dartmouth, Lebanon, NH 03756 (United States); Green, William R., E-mail: William.R.Green@dartmouth.edu [Department of Microbiology and Immunology, Geisel School of Medicine at Dartmouth, Lebanon, NH 03756 (United States); Norris Cotton Cancer Center, Geisel School of Medicine at Dartmouth, Lebanon, NH 03756 (United States)

    2016-12-15

    Monocytic myeloid-derived suppressor cells (M-MDSCs) were increased during LP-BM5 retroviral infection, and were capable of suppressing not only T-cell, but also B-cell responses. In addition to previously demonstrating iNOS- and VISTA-dependent M-MDSC mechanisms, in this paper, we detail how M-MDSCs utilized soluble mediators, including the reactive oxygen and nitrogen species superoxide, peroxynitrite, and nitric oxide, and TGF-β, to suppress B cells in a predominantly contact-independent manner. Suppression was independent of cysteine-depletion and hydrogen peroxide production. When two major mechanisms of suppression (iNOS and VISTA) were eliminated in double knockout mice, M-MDSCs from LP-BM5-infected mice were able to compensate using other, soluble mechanisms in order to maintain suppression of B cells. The IL-10 producing regulatory B-cell compartment was among the targets of M-MDSC-mediated suppression. -- Highlights: •LP-BM5-expanded M-MDSCs utilized soluble mediators nitric oxide, superoxide, peroxynitrite, and TGF-β to suppress B cells. •When two major mechanisms of suppression were eliminated through knockouts, M-MDSCs maintained suppression. •M-MDSCs from LP-BM5-infected mice decreased proliferation of IL-10 producing regulatory B cells.

  2. Myeloid-derived suppressor cells in murine AIDS inhibit B-cell responses in part via soluble mediators including reactive oxygen and nitrogen species, and TGF-β

    International Nuclear Information System (INIS)

    Rastad, Jessica L.; Green, William R.

    2016-01-01

    Monocytic myeloid-derived suppressor cells (M-MDSCs) were increased during LP-BM5 retroviral infection, and were capable of suppressing not only T-cell, but also B-cell responses. In addition to previously demonstrating iNOS- and VISTA-dependent M-MDSC mechanisms, in this paper, we detail how M-MDSCs utilized soluble mediators, including the reactive oxygen and nitrogen species superoxide, peroxynitrite, and nitric oxide, and TGF-β, to suppress B cells in a predominantly contact-independent manner. Suppression was independent of cysteine-depletion and hydrogen peroxide production. When two major mechanisms of suppression (iNOS and VISTA) were eliminated in double knockout mice, M-MDSCs from LP-BM5-infected mice were able to compensate using other, soluble mechanisms in order to maintain suppression of B cells. The IL-10 producing regulatory B-cell compartment was among the targets of M-MDSC-mediated suppression. -- Highlights: •LP-BM5-expanded M-MDSCs utilized soluble mediators nitric oxide, superoxide, peroxynitrite, and TGF-β to suppress B cells. •When two major mechanisms of suppression were eliminated through knockouts, M-MDSCs maintained suppression. •M-MDSCs from LP-BM5-infected mice decreased proliferation of IL-10 producing regulatory B cells.

  3. A robust two-node, 13 moment quadrature method of moments for dilute particle flows including wall bouncing

    Science.gov (United States)

    Sun, Dan; Garmory, Andrew; Page, Gary J.

    2017-02-01

    For flows where the particle number density is low and the Stokes number is relatively high, as found when sand or ice is ingested into aircraft gas turbine engines, streams of particles can cross each other's path or bounce from a solid surface without being influenced by inter-particle collisions. The aim of this work is to develop an Eulerian method to simulate these types of flow. To this end, a two-node quadrature-based moment method using 13 moments is proposed. In the proposed algorithm thirteen moments of particle velocity, including cross-moments of second order, are used to determine the weights and abscissas of the two nodes and to set up the association between the velocity components in each node. Previous Quadrature Method of Moments (QMOM) algorithms either use more than two nodes, leading to increased computational expense, or are shown here to give incorrect results under some circumstances. This method gives the computational efficiency advantages of only needing two particle phase velocity fields whilst ensuring that a correct combination of weights and abscissas is returned for any arbitrary combination of particle trajectories without the need for any further assumptions. Particle crossing and wall bouncing with arbitrary combinations of angles are demonstrated using the method in a two-dimensional scheme. The ability of the scheme to include the presence of drag from a carrier phase is also demonstrated, as is bouncing off surfaces with inelastic collisions. The method is also applied to the Taylor-Green vortex flow test case and is found to give results superior to the existing two-node QMOM method and is in good agreement with results from Lagrangian modelling of this case.

  4. Efficient methods for including quantum effects in Monte Carlo calculations of large systems: extension of the displaced points path integral method and other effective potential methods to calculate properties and distributions.

    Science.gov (United States)

    Mielke, Steven L; Dinpajooh, Mohammadhasan; Siepmann, J Ilja; Truhlar, Donald G

    2013-01-07

    We present a procedure to calculate ensemble averages, thermodynamic derivatives, and coordinate distributions by effective classical potential methods. In particular, we consider the displaced-points path integral (DPPI) method, which yields exact quantal partition functions and ensemble averages for a harmonic potential and approximate quantal ones for general potentials, and we discuss the implementation of the new procedure in two Monte Carlo simulation codes, one that uses uncorrelated samples to calculate absolute free energies, and another that employs Metropolis sampling to calculate relative free energies. The results of the new DPPI method are compared to those from accurate path integral calculations as well as to results of two other effective classical potential schemes for the case of an isolated water molecule. In addition to the partition function, we consider the heat capacity and expectation values of the energy, the potential energy, the bond angle, and the OH distance. We also consider coordinate distributions. The DPPI scheme performs best among the three effective potential schemes considered and achieves very good accuracy for all of the properties considered. A key advantage of the effective potential schemes is that they display much lower statistical sampling variances than those for accurate path integral calculations. The method presented here shows great promise for including quantum effects in calculations on large systems.

  5. A New Method for Deriving the Stellar Birth Function of Resolved Stellar Populations.

    Science.gov (United States)

    Gennaro, M.; Tchernyshyov, K.; Brown, T. M.; Gordon, K. D.

    2015-07-01

    We present a new method for deriving the stellar birth function (SBF) of resolved stellar populations. The SBF (stars born per unit mass, time, and metallicity) is the combination of the initial mass function (IMF), the star formation history (SFH), and the metallicity distribution function (MDF). The framework of our analysis is that of Poisson Point Processes (PPPs), a class of statistical models suitable when dealing with points (stars) in a multidimensional space (the measurement space of multiple photometric bands). The theory of PPPs easily accommodates the modeling of measurement errors as well as that of incompleteness. Our method avoids binning stars in the color-magnitude diagram and uses the whole likelihood function for each data point; combining the individual likelihoods allows the computation of the posterior probability for the population's SBF. Within the proposed framework it is possible to include nuisance parameters, such as distance and extinction, by specifying their prior distributions and marginalizing over them. The aim of this paper is to assess the validity of this new approach under a range of assumptions, using only simulated data. Forthcoming work will show applications to real data. Although it has a broad scope of possible applications, we have developed this method to study multi-band Hubble Space Telescope observations of the Milky Way Bulge. Therefore we will focus on simulations with characteristics similar to those of the Galactic Bulge. Based on observations made with the NASA/ESA Hubble Space Telescope, obtained at STScI, which is operated by AURA, Inc., under NASA contract NAS 5-26555.

  6. The way we measure: comparison of methods to derive radial surface brightness profiles

    NARCIS (Netherlands)

    Peters, S. P. C.; van der Kruit, P. C.; de Jong, R. S.

    The breaks and truncations in the luminosity profile of face-on spiral galaxies offer valuable insights in their formation history. The traditional method of deriving the surface photometry profile for face-on galaxies is to use elliptical averaging. In this paper, we explore the question whether

  7. Derivation of equation of quasipotential type using the method of Fock-- Podolsky

    Energy Technology Data Exchange (ETDEWEB)

    Blokhintsev, D I; Rizov, V A; Todorov, I T

    1975-12-31

    A quasipotential equation is derived for the relativistic Coulomb problem from the equations of motion of quantum electrodynamics using the method of Fock-- Podolsky (Tamm-Dancoff). Relation with an inhomogeneous equation for the 4-point retarded function is exhibited. (auth)

  8. Review of the different methods to derive average spacing from resolved resonance parameters sets

    International Nuclear Information System (INIS)

    Fort, E.; Derrien, H.; Lafond, D.

    1979-12-01

    The average spacing of resonances is an important parameter for statistical model calculations, especially concerning non fissile nuclei. The different methods to derive this average value from resonance parameters sets have been reviewed and analyzed in order to tentatively detect their respective weaknesses and propose recommendations. Possible improvements are suggested

  9. General methods for the preparation of α and/or β deuterium labelled 6-hydroxydopamine derivatives

    International Nuclear Information System (INIS)

    Borchardt, R.T.; Simmons, J.E.

    1982-01-01

    A convenient method for the synthesis of 6-hydroxydopamine and its phenethylamine derivatives has been developed. Mono-and di-deuteration has been accomplished using sodium borodeuteride and sodium borohydride in the presence of a deuterium source. (U.K.)

  10. A Generic Topology Derivation Method for Single-phase Converters with Active Capacitive DC-links

    DEFF Research Database (Denmark)

    Wang, Haoran; Wang, Huai; Zhu, Guorong

    2016-01-01

    capacitive DCDC- link solutions, but important aspects of the topology assess-ment, such as the total energy storage, overall capacitive energy buffer ratio, cost, and reliability are still not available. This paper proposes a generic topology derivation method of single-phase power converters...

  11. A novel variational method for deriving Lagrangian and Hamiltonian models of inductor-capacitor circuits

    NARCIS (Netherlands)

    Moreau, L.; Aeyels, D.

    2004-01-01

    We study the dynamical equations of nonlinear inductor-capacitor circuits. We present a novel Lagrangian description of the dynamics and provide a variational interpretation, which is based on the maximum principle of optimal control theory. This gives rise to an alternative method for deriving the

  12. Synthetic Methods and Exploring Biological Potential of Various Substituted Quinoxalin-2-one Derivatives

    OpenAIRE

    Mohammad Asif

    2016-01-01

    Substituted quinoxaline have considerable interest in chemistry, biology and pharmacology. Quinoxaline derivatives are capable with variety of biological activities and possess different biological activities, of which the most potent are anti-microbial, analgesic and anti-inflammatory activities. It facilitated the researchers to develop various methods for their synthesis and their applications. In this review represented different methods of synthesis, reactivity and various biological act...

  13. A pedagogical derivation of the matrix element method in particle physics data analysis

    Science.gov (United States)

    Sumowidagdo, Suharyo

    2018-03-01

    The matrix element method provides a direct connection between the underlying theory of particle physics processes and detector-level physical observables. I am presenting a pedagogically-oriented derivation of the matrix element method, drawing from elementary concepts in probability theory, statistics, and the process of experimental measurements. The level of treatment should be suitable for beginning research student in phenomenology and experimental high energy physics.

  14. Analysis of alternative transportation methods for radioactive materials shipments including the use of special trains for spent fuel and wastes

    International Nuclear Information System (INIS)

    Smith, D.R.; Luna, R.E.; Taylor, J.M.

    1978-01-01

    Two studies were completed which evaluate the environmental impact of radioactive material transport. The first was a generic study which evaluated all radioactive materials and all transportation modes; the second addressed spent fuel and fuel-cycle wastes shipped by truck, rail and barge. A portion of each of those studies dealing with the change in impact resulting from alternative shipping methods is presented in this paper. Alternatives evaluated in each study were mode shifts, operational constraints, and, in generic case, changes in material properties and package capabilities. Data for the analyses were obtained from a shipper survey and from projections of shipments that would occur in an equilibrium fuel cycle supporting one hundred 1000-MW(e) reactors. Population exposures were deduced from point source radiation formulae using separation distances derived for scenarios appropriate to each shipping mode and to each exposed population group. Fourteen alternatives were investigated for the generic impact case. All showed relatively minor changes in the overall radiological impact. Since the radioactive material transport is estimated to be fewer than 3 latent cancer fatalities (LCF) for each shipment year (compared to some 300,000 yearly cancer fatalities or 5000 LCF's calculated for background radiation using the same radiological effects model), a 15% decrease caused by shifting from passenger air to cargo air is a relatively small effect. Eleven alternatives were considered for the fuel cycle/special train study, but only one produced a reduction in total special train baseline LCF's (.047) that was larger than 5%

  15. Quantitative bioanalytical and analytical method development of dibenzazepine derivative, carbamazepine: A review

    Directory of Open Access Journals (Sweden)

    Prasanna A. Datar

    2015-08-01

    Full Text Available Bioanalytical methods are widely used for quantitative estimation of drugs and their metabolites in physiological matrices. These methods could be applied to studies in areas of human clinical pharmacology and toxicology. The major bioanalytical services are method development, method validation and sample analysis (method application. Various methods such as GC, LC–MS/MS, HPLC, HPTLC, micellar electrokinetic chromatography, and UFLC have been used in laboratories for the qualitative and quantitative analysis of carbamazepine in biological samples throughout all phases of clinical research and quality control. The article incorporates various reported methods developed to help analysts in choosing crucial parameters for new method development of carbamazepine and its derivatives and also enumerates metabolites, and impurities reported so far. Keywords: Carbamazepine, HPLC, LC–MS/MS, HPTLC, RP-UFLC, Micellar electrokinetic chromatography

  16. Testing of the derivative method and Kruskal-Wallis technique for sensitivity analysis of SYVAC

    International Nuclear Information System (INIS)

    Prust, J.O.; Edwards, H.H.

    1985-04-01

    The Kruskal-Wallis method of one-way analysis of variance by ranks has proved successful in identifying input parameters which have an important influence on dose. This technique was extended to test for first order interactions between parameters. In view of a number of practical difficulties and the computing resources required to carry out a large number of runs, this test is not recommended for detecting interactions between parameters. The derivative method of sensitivity analysis examines the partial derivative values of each input parameter with dose at various points across the parameter range. Important input parameters are associated with high derivatives and the results agreed well with previous sensitivity studies. The derivative values also provided information on the data generation distributions to be used for the input parameters in order to concentrate sampling in the high dose region of the parameter space to improve the sampling efficiency. Furthermore, the derivative values provided information on parameter interactions, the feasibility of developing a high dose algorithm and formed the basis for developing a regression equation. (author)

  17. A General Method for QTL Mapping in Multiple Related Populations Derived from Multiple Parents

    Directory of Open Access Journals (Sweden)

    Yan AO

    2009-03-01

    Full Text Available It's well known that incorporating some existing populations derived from multiple parents may improve QTL mapping and QTL-based breeding programs. However, no general maximum likelihood method has been available for this strategy. Based on the QTL mapping in multiple related populations derived from two parents, a maximum likelihood estimation method was proposed, which can incorporate several populations derived from three or more parents and also can be used to handle different mating designs. Taking a circle design as an example, we conducted simulation studies to study the effect of QTL heritability and sample size upon the proposed method. The results showed that under the same heritability, enhanced power of QTL detection and more precise and accurate estimation of parameters could be obtained when three F2 populations were jointly analyzed, compared with the joint analysis of any two F2 populations. Higher heritability, especially with larger sample sizes, would increase the ability of QTL detection and improve the estimation of parameters. Potential advantages of the method are as follows: firstly, the existing results of QTL mapping in single population can be compared and integrated with each other with the proposed method, therefore the ability of QTL detection and precision of QTL mapping can be improved. Secondly, owing to multiple alleles in multiple parents, the method can exploit gene resource more adequately, which will lay an important genetic groundwork for plant improvement.

  18. Dual number algebra method for Green's function derivatives in 3D magneto-electro-elasticity

    Science.gov (United States)

    Dziatkiewicz, Grzegorz

    2018-01-01

    The Green functions are the basic elements of the boundary element method. To obtain the boundary integral formulation the Green function and its derivative should be known for the considered differential operator. Today the interesting group of materials are electronic composites. The special case of the electronic composite is the magnetoelectroelastic continuum. The mentioned continuum is a model of the piezoelectric-piezomagnetic composites. The anisotropy of their physical properties makes the problem of Green's function determination very difficult. For that reason Green's functions for the magnetoelectroelastic continuum are not known in the closed form and numerical methods should be applied to determine such Green's functions. These means that the problem of the accurate and simply determination of Green's function derivatives is even harder. Therefore in the present work the dual number algebra method is applied to calculate numerically the derivatives of 3D Green's functions for the magnetoelectroelastic materials. The introduced method is independent on the step size and it can be treated as a special case of the automatic differentiation method. Therefore, the dual number algebra method can be applied as a tool for checking the accuracy of the well-known finite difference schemes.

  19. The Inverse System Method Applied to the Derivation of Power System Non—linear Control Laws

    Institute of Scientific and Technical Information of China (English)

    DonghaiLI; XuezhiJIANG; 等

    1997-01-01

    The differential geometric method has been applied to a series of power system non-linear control problems effectively.However a set of differential equations must be solved for obtaining the required diffeomorphic transformation.Therefore the derivation of control laws is very complicated.In fact because of the specificity of power system models the required diffeomorphic transformation may be obtained directly,so it is unnecessary to solve a set of differential equations.In addition inverse system method is equivalent to differential geometric method in reality and not limited to affine nonlinear systems,Its physical meaning is able to be viewed directly and its deduction needs only algebraic operation and derivation,so control laws can be obtained easily and the application to engineering is very convenient.Authors of this paper take steam valving control of power system as a typical case to be studied.It is demonstrated that the control law deduced by inverse system method is just the same as one by differential geometric method.The conclusion will simplify the control law derivations of steam valving,excitation,converter and static var compensator by differential geometric method and may be suited to similar control problems in other areas.

  20. The G′G-expansion method using modified Riemann–Liouville derivative for some space-time fractional differential equations

    Directory of Open Access Journals (Sweden)

    Ahmet Bekir

    2014-09-01

    Full Text Available In this paper, the fractional partial differential equations are defined by modified Riemann–Liouville fractional derivative. With the help of fractional derivative and traveling wave transformation, these equations can be converted into the nonlinear nonfractional ordinary differential equations. Then G′G-expansion method is applied to obtain exact solutions of the space-time fractional Burgers equation, the space-time fractional KdV-Burgers equation and the space-time fractional coupled Burgers’ equations. As a result, many exact solutions are obtained including hyperbolic function solutions, trigonometric function solutions and rational solutions. These results reveal that the proposed method is very effective and simple in performing a solution to the fractional partial differential equation.

  1. TRANSAT-- method for detecting the conserved helices of functional RNA structures, including transient, pseudo-knotted and alternative structures.

    Science.gov (United States)

    Wiebe, Nicholas J P; Meyer, Irmtraud M

    2010-06-24

    The prediction of functional RNA structures has attracted increased interest, as it allows us to study the potential functional roles of many genes. RNA structure prediction methods, however, assume that there is a unique functional RNA structure and also do not predict functional features required for in vivo folding. In order to understand how functional RNA structures form in vivo, we require sophisticated experiments or reliable prediction methods. So far, there exist only a few, experimentally validated transient RNA structures. On the computational side, there exist several computer programs which aim to predict the co-transcriptional folding pathway in vivo, but these make a range of simplifying assumptions and do not capture all features known to influence RNA folding in vivo. We want to investigate if evolutionarily related RNA genes fold in a similar way in vivo. To this end, we have developed a new computational method, Transat, which detects conserved helices of high statistical significance. We introduce the method, present a comprehensive performance evaluation and show that Transat is able to predict the structural features of known reference structures including pseudo-knotted ones as well as those of known alternative structural configurations. Transat can also identify unstructured sub-sequences bound by other molecules and provides evidence for new helices which may define folding pathways, supporting the notion that homologous RNA sequence not only assume a similar reference RNA structure, but also fold similarly. Finally, we show that the structural features predicted by Transat differ from those assuming thermodynamic equilibrium. Unlike the existing methods for predicting folding pathways, our method works in a comparative way. This has the disadvantage of not being able to predict features as function of time, but has the considerable advantage of highlighting conserved features and of not requiring a detailed knowledge of the cellular

  2. Low oxygen biomass-derived pyrolysis oils and methods for producing the same

    Science.gov (United States)

    Marinangeli, Richard; Brandvold, Timothy A; Kocal, Joseph A

    2013-08-27

    Low oxygen biomass-derived pyrolysis oils and methods for producing them from carbonaceous biomass feedstock are provided. The carbonaceous biomass feedstock is pyrolyzed in the presence of a catalyst comprising base metal-based catalysts, noble metal-based catalysts, treated zeolitic catalysts, or combinations thereof to produce pyrolysis gases. During pyrolysis, the catalyst catalyzes a deoxygenation reaction whereby at least a portion of the oxygenated hydrocarbons in the pyrolysis gases are converted into hydrocarbons. The oxygen is removed as carbon oxides and water. A condensable portion (the vapors) of the pyrolysis gases is condensed to low oxygen biomass-derived pyrolysis oil.

  3. Design of quadrature mirror filter bank using Lagrange multiplier method based on fractional derivative constraints

    Directory of Open Access Journals (Sweden)

    B. Kuldeep

    2015-06-01

    Full Text Available Fractional calculus has recently been identified as a very important mathematical tool in the field of signal processing. Digital filters designed by fractional derivatives give more accurate frequency response in the prescribed frequency region. Digital filters are most important part of multi-rate filter bank systems. In this paper, an improved method based on fractional derivative constraints is presented for the design of two-channel quadrature mirror filter (QMF bank. The design problem is formulated as minimization of L2 error of filter bank transfer function in passband, stopband interval and at quadrature frequency, and then Lagrange multiplier method with fractional derivative constraints is applied to solve it. The proposed method is then successfully applied for the design of two-channel QMF bank with higher order filter taps. Performance of the QMF bank design is then examined through study of various parameters such as passband error, stopband error, transition band error, peak reconstruction error (PRE, stopband attenuation (As. It is found that, the good design can be obtained with the change of number and value of fractional derivative constraint coefficients.

  4. New algorithms derived from the synthesis method. Application to diffusion problems

    International Nuclear Information System (INIS)

    Rouzaud, Philippe.

    1976-05-01

    Two algorithms to compute the neutron distribution in a nuclear reactor are presented. These algorithms, the iterative synthesis method (MSI) and the synthesis method by deflation (MSD), are derived from the classical synthesis method (MSC). They retain the most important advantages of MSC (computing time and memory storage reduced with regard to finite difference methods) and avoid its drawbacks: choice of trial functions; choice of weighting functions; choice of the number of terms (for MSD only). Extensive numerical checks of the three methods (MSC, MSI, MSD) were carried out on two fast reactor configurations described in plane geometry (X,Y). Monoenergetic and multigroup theories were successively used. The use of MSI and MSD allows a significant reduction of the discrepancies between the finite difference method and the synthesis method for the reactivity values and the flux distribution [fr

  5. Method of fabricating electrodes including high-capacity, binder-free anodes for lithium-ion batteries

    Science.gov (United States)

    Ban, Chunmei; Wu, Zhuangchun; Dillon, Anne C.

    2017-01-10

    An electrode (110) is provided that may be used in an electrochemical device (100) such as an energy storage/discharge device, e.g., a lithium-ion battery, or an electrochromic device, e.g., a smart window. Hydrothermal techniques and vacuum filtration methods were applied to fabricate the electrode (110). The electrode (110) includes an active portion (140) that is made up of electrochemically active nanoparticles, with one embodiment utilizing 3d-transition metal oxides to provide the electrochemical capacity of the electrode (110). The active material (140) may include other electrochemical materials, such as silicon, tin, lithium manganese oxide, and lithium iron phosphate. The electrode (110) also includes a matrix or net (170) of electrically conductive nanomaterial that acts to connect and/or bind the active nanoparticles (140) such that no binder material is required in the electrode (110), which allows more active materials (140) to be included to improve energy density and other desirable characteristics of the electrode. The matrix material (170) may take the form of carbon nanotubes, such as single-wall, double-wall, and/or multi-wall nanotubes, and be provided as about 2 to 30 percent weight of the electrode (110) with the rest being the active material (140).

  6. A comparison of different methods to implement higher order derivatives of density functionals

    Energy Technology Data Exchange (ETDEWEB)

    van Dam, Hubertus J.J. [Brookhaven National Lab. (BNL), Upton, NY (United States)

    2016-05-18

    Density functional theory is the dominant approach in electronic structure methods today. To calculate properties higher order derivatives of the density functionals are required. These derivatives might be implemented manually,by automatic differentiation, or by symbolic algebra programs. Different authors have cited different reasons for using the particular method of their choice. This paper presents work where all three approaches were used and the strengths and weaknesses of each approach are considered. It is found that all three methods produce code that is suffficiently performanted for practical applications, despite the fact that our symbolic algebra generated code and our automatic differentiation code still have scope for significant optimization. The automatic differentiation approach is the best option for producing readable and maintainable code.

  7. Estimation of ibuprofen and famotidine in tablets by second order derivative spectrophotometery method

    Directory of Open Access Journals (Sweden)

    Dimal A. Shah

    2017-02-01

    Full Text Available A simple and accurate method for the analysis of ibuprofen (IBU and famotidine (FAM in their combined dosage form was developed using second order derivative spectrophotometery. IBU and FAM were quantified using second derivative responses at 272.8 nm and 290 nm in the spectra of their solutions in methanol. The calibration curves were linear in the concentration range of 100–600 μg/mL for IBU and 5–25 μg/mL for FAM. The method was validated and found to be accurate and precise. Developed method was successfully applied for the estimation of IBU and FAM in their combined dosage form.

  8. HNO3 fluxes to a deciduous forest derived using gradient and REA methods

    DEFF Research Database (Denmark)

    Pryor, S.C.; Barthelmie, R.J.; Jensen, B.

    2002-01-01

    Summertime nitric acid concentrations over a deciduous forest in the midwestern United States are reported, which range between 0.36 and 3.3 mug m(-3). Fluxes to the forest are computed using the relaxed eddy accumulation technique and gradient methods. In accord with previous studies, the results...... indicate substantial uncertainties in the gradient-based calculations. The relaxed eddy accumulation (REA) derived fluxes are physically reasonable and are shown to be of similar magnitude to dry deposition estimates from gradient sampling. The REA derived mean deposition velocity is approximately 3 cm s......(-1), which is also comparable to growing season estimates derived by Meyers et al. for a similar deciduous forest. Occasional inverted concentration gradients and fluxes are observed but most are not statistically significant. Data are also presented that indicate substantial through canopy...

  9. Two non-parametric methods for derivation of constraints from radiotherapy dose–histogram data

    International Nuclear Information System (INIS)

    Ebert, M A; Kennedy, A; Joseph, D J; Gulliford, S L; Buettner, F; Foo, K; Haworth, A; Denham, J W

    2014-01-01

    Dose constraints based on histograms provide a convenient and widely-used method for informing and guiding radiotherapy treatment planning. Methods of derivation of such constraints are often poorly described. Two non-parametric methods for derivation of constraints are described and investigated in the context of determination of dose-specific cut-points—values of the free parameter (e.g., percentage volume of the irradiated organ) which best reflect resulting changes in complication incidence. A method based on receiver operating characteristic (ROC) analysis and one based on a maximally-selected standardized rank sum are described and compared using rectal toxicity data from a prostate radiotherapy trial. Multiple test corrections are applied using a free step-down resampling algorithm, which accounts for the large number of tests undertaken to search for optimal cut-points and the inherent correlation between dose–histogram points. Both methods provide consistent significant cut-point values, with the rank sum method displaying some sensitivity to the underlying data. The ROC method is simple to implement and can utilize a complication atlas, though an advantage of the rank sum method is the ability to incorporate all complication grades without the need for grade dichotomization. (note)

  10. Optimal Control as a method for Diesel engine efficiency assessment including pressure and NO_x constraints

    International Nuclear Information System (INIS)

    Guardiola, Carlos; Climent, Héctor; Pla, Benjamín; Reig, Alberto

    2017-01-01

    Highlights: • Optimal Control is applied for heat release shaping in internal combustion engines. • Optimal Control allows to assess the engine performance with a realistic reference. • The proposed method gives a target heat release law to define control strategies. - Abstract: The present paper studies the optimal heat release law in a Diesel engine to maximise the indicated efficiency subject to different constraints, namely: maximum cylinder pressure, maximum cylinder pressure derivative, and NO_x emission restrictions. With this objective, a simple but also representative model of the combustion process has been implemented. The model consists of a 0D energy balance model aimed to provide the pressure and temperature evolutions in the high pressure loop of the engine thermodynamic cycle from the gas conditions at the intake valve closing and the heat release law. The gas pressure and temperature evolutions allow to compute the engine efficiency and NO_x emissions. The comparison between model and experimental results shows that despite the model simplicity, it is able to reproduce the engine efficiency and NO_x emissions. After the model identification and validation, the optimal control problem is posed and solved by means of Dynamic Programming (DP). Also, if only pressure constraints are considered, the paper proposes a solution that reduces the computation cost of the DP strategy in two orders of magnitude for the case being analysed. The solution provides a target heat release law to define injection strategies but also a more realistic maximum efficiency boundary than the ideal thermodynamic cycles usually employed to estimate the maximum engine efficiency.

  11. Approximate analytical solution of diffusion equation with fractional time derivative using optimal homotopy analysis method

    Directory of Open Access Journals (Sweden)

    S. Das

    2013-12-01

    Full Text Available In this article, optimal homotopy-analysis method is used to obtain approximate analytic solution of the time-fractional diffusion equation with a given initial condition. The fractional derivatives are considered in the Caputo sense. Unlike usual Homotopy analysis method, this method contains at the most three convergence control parameters which describe the faster convergence of the solution. Effects of parameters on the convergence of the approximate series solution by minimizing the averaged residual error with the proper choices of parameters are calculated numerically and presented through graphs and tables for different particular cases.

  12. Evaluation and Comparison of Multiple Test Methods, Including Real-time PCR, for Legionella Detection in Clinical Specimens

    Science.gov (United States)

    Peci, Adriana; Winter, Anne-Luise; Gubbay, Jonathan B.

    2016-01-01

    Legionella is a Gram-negative bacterium that can cause Pontiac fever, a mild upper respiratory infection and Legionnaire’s disease, a more severe illness. We aimed to compare the performance of urine antigen, culture, and polymerase chain reaction (PCR) test methods and to determine if sputum is an acceptable alternative to the use of more invasive bronchoalveolar lavage (BAL). Data for this study included specimens tested for Legionella at Public Health Ontario Laboratories from 1st January, 2010 to 30th April, 2014, as part of routine clinical testing. We found sensitivity of urinary antigen test (UAT) compared to culture to be 87%, specificity 94.7%, positive predictive value (PPV) 63.8%, and negative predictive value (NPV) 98.5%. Sensitivity of UAT compared to PCR was 74.7%, specificity 98.3%, PPV 77.7%, and NPV 98.1%. Out of 146 patients who had a Legionella-positive result by PCR, only 66 (45.2%) also had a positive result by culture. Sensitivity for culture was the same using either sputum or BAL (13.6%); sensitivity for PCR was 10.3% for sputum and 12.8% for BAL. Both sputum and BAL yield similar results regardless testing methods (Fisher Exact p-values = 1.0, for each test). In summary, all test methods have inherent weaknesses in identifying Legionella; therefore, more than one testing method should be used. Obtaining a single specimen type from patients with pneumonia limits the ability to diagnose Legionella, particularly when urine is the specimen type submitted. Given ease of collection and similar sensitivity to BAL, clinicians are encouraged to submit sputum in addition to urine when BAL submission is not practical from patients being tested for Legionella. PMID:27630979

  13. Evaluation and comparison of multiple test methods, including real-time PCR, for Legionella detection in clinical specimens.

    Directory of Open Access Journals (Sweden)

    Adriana Peci

    2016-08-01

    Full Text Available Legionella is a gram-negative bacterium that can cause Pontiac fever, a mild upper respiratory infection and Legionnaire’s disease, a more severe illness. We aimed to compare the performance of urine antigen, culture and PCR test methods and to determine if sputum is an alternative to the use of more invasive bronchoalveolar lavage (BAL. Data for this study included specimens tested for Legionella at PHOL from January 1, 2010 to April 30, 2014, as part of routine clinical testing. We found sensitivity of UAT compared to culture to be 87%, specificity 94.7%, positive predictive value (PPV 63.8% and negative predictive value (NPV 98.5%. Sensitivity of UAT compared to PCR was 74.7%, specificity 98.3%, PPV 77.7% and NPV 98.1%. Of 146 patients who had a Legionella positive result by PCR, only 66(45.2% also had a positive result by culture. Sensitivity for culture was the same using either sputum or BAL (13.6%; sensitivity for PCR was 10.3% for sputum and 12.8% for BAL. Both sputum and BAL yield similar results despite testing methods (Fisher Exact p-values=1.0, for each test. In summary, all test methods have inherent weaknesses in identifying Legionella; thereforemore than one testing method should be used. Obtaining a single specimen type from patients with pneumonia limits the ability to diagnose Legionella, particularly when urine is the specimen type submitted. Given ease of collection, and similar sensitivity to BAL, clinicians are encouraged to submit sputum in addition to urine when BAL submission is not practical, from patients being tested for Legionella.

  14. High-order FDTD methods via derivative matching for Maxwell's equations with material interfaces

    International Nuclear Information System (INIS)

    Zhao Shan; Wei, G.W.

    2004-01-01

    This paper introduces a series of novel hierarchical implicit derivative matching methods to restore the accuracy of high-order finite-difference time-domain (FDTD) schemes of computational electromagnetics (CEM) with material interfaces in one (1D) and two spatial dimensions (2D). By making use of fictitious points, systematic approaches are proposed to locally enforce the physical jump conditions at material interfaces in a preprocessing stage, to arbitrarily high orders of accuracy in principle. While often limited by numerical instability, orders up to 16 and 12 are achieved, respectively, in 1D and 2D. Detailed stability analyses are presented for the present approach to examine the upper limit in constructing embedded FDTD methods. As natural generalizations of the high-order FDTD schemes, the proposed derivative matching methods automatically reduce to the standard FDTD schemes when the material interfaces are absent. An interesting feature of the present approach is that it encompasses a variety of schemes of different orders in a single code. Another feature of the present approach is that it can be robustly implemented with other high accuracy time-domain approaches, such as the multiresolution time-domain method and the local spectral time-domain method, to cope with material interfaces. Numerical experiments on both 1D and 2D problems are carried out to test the convergence, examine the stability, access the efficiency, and explore the limitation of the proposed methods. It is found that operating at their best capacity, the proposed high-order schemes could be over 2000 times more efficient than their fourth-order versions in 2D. In conclusion, the present work indicates that the proposed hierarchical derivative matching methods might lead to practical high-order schemes for numerical solution of time-domain Maxwell's equations with material interfaces

  15. A phantom based method for deriving typical patient doses from measurements of dose-area product on populations of patients

    International Nuclear Information System (INIS)

    Chapple, C.-L.; Broadhead, D.A.

    1995-01-01

    One of the chief sources of uncertainty in the comparison of patient dosimetry data is the influence of patient size on dose. Dose has been shown to relate closely to the equivalent diameter of the patient. This concept has been used to derive a prospective, phantom based method for determining size correction factors for measurements of dose-area product. The derivation of the size correction factor has been demonstrated mathematically, and the appropriate factor determined for a number of different X-ray sets. The use of phantom measurements enables the effect of patient size to be isolated from other factors influencing patient dose. The derived factors agree well with those determined retrospectively from patient dose survey data. Size correction factors have been applied to the results of a large scale patient dose survey, and this approach has been compared with the method of selecting patients according to their weight. For large samples of data, mean dose-area product values are independent of the analysis method used. The chief advantage of using size correction factors is that it allows all patient data to be included in a survey, whereas patient selection has been shown to exclude approximately half of all patients. (author)

  16. A simple method for deriving functional MSCs and applied for osteogenesis in 3D scaffolds

    DEFF Research Database (Denmark)

    Zou, Lijin; Luo, Yonglun; Chen, Muwan

    2013-01-01

    We describe a simple method for bone engineering using biodegradable scaffolds with mesenchymal stem cells derived from human induced-pluripotent stem cells (hiPS-MSCs). The hiPS-MSCs expressed mesenchymal markers (CD90, CD73, and CD105), possessed multipotency characterized by tri......-lineages differentiation: osteogenic, adipogenic, and chondrogenic, and lost pluripotency - as seen with the loss of markers OCT3/4 and TRA-1-81 - and tumorigenicity. However, these iPS-MSCs are still positive for marker NANOG. We further explored the osteogenic potential of the hiPS-MSCs in synthetic polymer......, our results suggest the iPS-MSCs derived by this simple method retain fully osteogenic function and provide a new solution towards personalized orthopedic therapy in the future....

  17. Effective nucleus-nucleus potentials derived from the generator coordinate method

    Energy Technology Data Exchange (ETDEWEB)

    Friedrich, H; Canto, L F [Oxford Univ. (UK). Dept. of Theoretical Physics

    1977-11-07

    The equivalence of the generator coordinate method (GCM) and the resonating group method (RGM) and the formal equivalence of the RGM and the orthogonality condition model (OCM) lead to a relation connecting the effective nucleus-nucleus potentials of the OCM with matrix elements of the GCM. This relation may be used to derive effective nucleus-nucleus potentials directly from GCM matrix elements without explicit reference to the potentials of the RGM. In a first application local and l-independent effective potentials are derived from diagonal GCM matrix elements which represent the energy surfaces of a two-centre shell model. Using these potentials the OCM can reproduce the results of a full RGM calculation very well for the elastic scattering of two ..cap alpha..-particles and fairly well for elastic /sup 16/O-/sup 16/O scattering.

  18. Modified method for zirconium or hafnium gravimetric determination with glycolic acid derivatives

    International Nuclear Information System (INIS)

    Barbieri, R.S.; Rocha, J.C.; Terra, V.R.; Marques Neto, A.

    1989-01-01

    The conditions for gravimetric determination of zirconium or hafnium by glicolic acid derivatives were studied by thermogravimetric analysis. The method utilized shown that after precipitation, washing and drying of precipitates at 150 0 C, the resulting solid was weighed in the form of [M{RCH(OH)COO} 4 ] (M = Zr,Hf;R = C 6 H 5 , β-C 10 H 7 ,p-BrC 6 H 4 ). (author) [pt

  19. Method for contamination control and barrier apparatus with filter for containing waste materials that include dangerous particulate matter

    Science.gov (United States)

    Pinson, Paul A.

    1998-01-01

    A container for hazardous waste materials that includes air or other gas carrying dangerous particulate matter has incorporated in barrier material, preferably in the form of a flexible sheet, one or more filters for the dangerous particulate matter sealably attached to such barrier material. The filter is preferably a HEPA type filter and is preferably chemically bonded to the barrier materials. The filter or filters are preferably flexibly bonded to the barrier material marginally and peripherally of the filter or marginally and peripherally of air or other gas outlet openings in the barrier material, which may be a plastic bag. The filter may be provided with a backing panel of barrier material having an opening or openings for the passage of air or other gas into the filter or filters. Such backing panel is bonded marginally and peripherally thereof to the barrier material or to both it and the filter or filters. A coupling or couplings for deflating and inflating the container may be incorporated. Confining a hazardous waste material in such a container, rapidly deflating the container and disposing of the container, constitutes one aspect of the method of the invention. The chemical bonding procedure for producing the container constitutes another aspect of the method of the invention.

  20. Contributors to Frequent Telehealth Alerts Including False Alerts for Patients with Heart Failure: A Mixed Methods Exploration

    Science.gov (United States)

    Radhakrishna, K.; Bowles, K.; Zettek-Sumner, A.

    2013-01-01

    Summary Background Telehealth data overload through high alert generation is a significant barrier to sustained adoption of telehealth for managing HF patients. Objective To explore the factors contributing to frequent telehealth alerts including false alerts for Medicare heart failure (HF) patients admitted to a home health agency. Materials and Methods A mixed methods design that combined quantitative correlation analysis of patient characteristic data with number of telehealth alerts and qualitative analysis of telehealth and visiting nurses’ notes on follow-up actions to patients’ telehealth alerts was employed. All the quantitative and qualitative data was collected through retrospective review of electronic records of the home heath agency. Results Subjects in the study had a mean age of 83 (SD = 7.6); 56% were female. Patient co-morbidities (ppatient characteristics along with establishing patient-centered telehealth outcome goals may allow meaningful generation of telehealth alerts. Reducing avoidable telehealth alerts could vastly improve the efficiency and sustainability of telehealth programs for HF management. PMID:24454576

  1. Method for contamination control and barrier apparatus with filter for containing waste materials that include dangerous particulate matter

    International Nuclear Information System (INIS)

    Pinson, P.A.

    1998-01-01

    A container for hazardous waste materials that includes air or other gas carrying dangerous particulate matter has incorporated barrier material, preferably in the form of a flexible sheet, and one or more filters for the dangerous particulate matter sealably attached to such barrier material. The filter is preferably a HEPA type filter and is preferably chemically bonded to the barrier materials. The filter or filters are preferably flexibly bonded to the barrier material marginally and peripherally of the filter or marginally and peripherally of air or other gas outlet openings in the barrier material, which may be a plastic bag. The filter may be provided with a backing panel of barrier material having an opening or openings for the passage of air or other gas into the filter or filters. Such backing panel is bonded marginally and peripherally thereof to the barrier material or to both it and the filter or filters. A coupling or couplings for deflating and inflating the container may be incorporated. Confining a hazardous waste material in such a container, rapidly deflating the container and disposing of the container, constitutes one aspect of the method of the invention. The chemical bonding procedure for producing the container constitutes another aspect of the method of the invention. 3 figs

  2. Difference in target definition using three different methods to include respiratory motion in radiotherapy of lung cancer.

    Science.gov (United States)

    Sloth Møller, Ditte; Knap, Marianne Marquard; Nyeng, Tine Bisballe; Khalil, Azza Ahmed; Holt, Marianne Ingerslev; Kandi, Maria; Hoffmann, Lone

    2017-11-01

    Minimizing the planning target volume (PTV) while ensuring sufficient target coverage during the entire respiratory cycle is essential for free-breathing radiotherapy of lung cancer. Different methods are used to incorporate the respiratory motion into the PTV. Fifteen patients were analyzed. Respiration can be included in the target delineation process creating a respiratory GTV, denoted iGTV. Alternatively, the respiratory amplitude (A) can be measured based on the 4D-CT and A can be incorporated in the margin expansion. The GTV expanded by A yielded GTV + resp, which was compared to iGTV in terms of overlap. Three methods for PTV generation were compared. PTV del (delineated iGTV expanded to CTV plus PTV margin), PTV σ (GTV expanded to CTV and A was included as a random uncertainty in the CTV to PTV margin) and PTV ∑ (GTV expanded to CTV, succeeded by CTV linear expansion by A to CTV + resp, which was finally expanded to PTV ∑ ). Deformation of tumor and lymph nodes during respiration resulted in volume changes between the respiratory phases. The overlap between iGTV and GTV + resp showed that on average 7% of iGTV was outside the GTV + resp implying that GTV + resp did not capture the tumor during the full deformable respiration cycle. A comparison of the PTV volumes showed that PTV σ was smallest and PTV Σ largest for all patients. PTV σ was in mean 14% (31 cm 3 ) smaller than PTV del , while PTV del was 7% (20 cm 3 ) smaller than PTV Σ . PTV σ yields the smallest volumes but does not ensure coverage of tumor during the full respiratory motion due to tumor deformation. Incorporating the respiratory motion in the delineation (PTV del ) takes into account the entire respiratory cycle including deformation, but at the cost, however, of larger treatment volumes. PTV Σ should not be used, since it incorporates the disadvantages of both PTV del and PTV σ .

  3. Biological evaluation and simple method for the synthesis of tetrahydrobenzo[a]xanthenes-11-one derivatives

    Directory of Open Access Journals (Sweden)

    Ali Akbari

    2017-01-01

    Full Text Available A simple method for the synthesis of Tetrahydrobenzo[a]xanthenes-11-one derivatives in the presence of BF3.SiO2, and its antibacterial activity was assessed against Pseudomonas syringae, Xanthomonas citi and Pectobacterium carotovorum. The structure of the isolated compounds has been determined by means of 1H/13C NMR and FT-IR spectroscopy. The reactions were carried out in water at room temperature for 5 h. This method has some advantages such as good to excellent yield, mild reaction condition, ease of operation and workup, high product purity and green process.

  4. Calculated Low-Speed Steady and Time-Dependent Aerodynamic Derivatives for Several Different Wings Using a Discrete Vortex Method

    Science.gov (United States)

    Riley, Donald R.

    2016-01-01

    Calculated numerical values for some aerodynamic terms and stability Derivatives for several different wings in unseparated inviscid incompressible flow were made using a discrete vortex method involving a limited number of horseshoe vortices. Both longitudinal and lateral-directional derivatives were calculated for steady conditions as well as for sinusoidal oscillatory motions. Variables included the number of vortices used and the rotation axis/moment center chordwise location. Frequencies considered were limited to the range of interest to vehicle dynamic stability (kb <.24 ). Comparisons of some calculated numerical results with experimental wind-tunnel measurements were in reasonable agreement in the low angle-of-attack range considering the differences existing between the mathematical representation and experimental wind-tunnel models tested. Of particular interest was the presence of induced drag for the oscillatory condition.

  5. Intercomparison of diffusion coefficient derived from the through-diffusion experiment using different numerical methods

    International Nuclear Information System (INIS)

    Chih-Lung Chen; Institute of Nuclear Energy Research, Taoyuan, Taiwan; Tsing-Hai Wang; Shi-Ping Teng; Ching-Hor Lee

    2014-01-01

    Diffusion is a dominant mechanism regulating the transport of released nuclides. The through-diffusion method is typically applied to determine the diffusion coefficients (D). Depending on the design of the experiment, the concentrations in the source term [i.e., inlet reservoir (IR)] or the end term [i.e., outlet reservoir (OR)] can be fixed or vary. The combinations involve four distinct models (i.e., the CC-CC model, CC-VC model, VC-CC model, and the VC-VC model). Studies discussing the VC-CC model are scant. An analytical method considering the decay effect is required to accurately interpret the radioactive nuclide diffusion experiment results. Therefore, we developed a CC-CC model and a CC-VC model with a decay effect and the simplified formulas of these two models to determine the diffusion coefficient (i.e., the CC-CC method and CC-VC method). We also proposed two simplified methods using the VC-VC model to determine the diffusion coefficient straightforwardly based upon the concentration variation in IR and OR. More importantly, the best advantage of proposed method over others is that one can derive three diffusion coefficients based on one run of experiment. In addition, applying our CC-VC method to those data reported from Radiochemica Acta 96:111-117, 2008; and J Contam Hydrol 35:55-65, 1998, derived comparable diffusion coefficient lying in the identical order of magnitude. Furthermore, we proposed a formula to determine the conceptual critical time (Tc), which is particularly beneficial for the selection of using CC-VC or VC-VC method. Based on our proposed method, it becomes possible to calculate diffusion coefficient from a through-diffusion experiment in a shorter period of time. (author)

  6. Cellular Phone Towers, Cell tower locations as derived from various sources including the Department of Licenses and Inspections and the Department of Planning and Zoning., Published in 2010, 1:2400 (1in=200ft) scale, Howard County Government.

    Data.gov (United States)

    NSGIC Local Govt | GIS Inventory — Cellular Phone Towers dataset current as of 2010. Cell tower locations as derived from various sources including the Department of Licenses and Inspections and the...

  7. Upgrade the intervention levels derived for water and foods, to be include in the PERE 607 procedure the external radiological emergency plan in the Laguna Verde nuclear power plant

    International Nuclear Information System (INIS)

    Llado Castillo, R.; Aguilar Pacheco, R.

    1998-01-01

    The work shows the results obtained in the upgrade the intervention levels derived for water and foods, to be include in the PERE 607 procedure the external radiological emergency plan in the Laguna Verde nuclear power plant

  8. Generation and characterisation of human umbilical cord derived mesenchymal stem cells by explant method.

    Science.gov (United States)

    Yusoff, Z; Maqbool, M; George, E; Hassan, R; Ramasamy, R

    2016-06-01

    Mesenchymal stem cells (MSCs) derived from human umbilical cord (UC) have been considered as an important tool for treating various malignancies, tissue repair and organ regeneration. Umbilical cord-derived mesenchymal stem cells (UC-MSCs) are better alternative to MSCs that derived from bone marrow (BM-MSCs) as they are regarded as medical waste with little ethical concern for research and easily culture-expanded. In this present study, the foetal distal end of human UC was utilised to generate MSC by explant method. Upon in vitro culture, adherent cells with fibroblastic morphology were generated with rapid growth kinetics. Under the respective inductive conditions, these cells were capable of differentiating into adipocytes and osteocytes; express an array of standard MSC's surface markers CD29, CD73, CD90, CD106 and MHC-class I. Further assessment of immunosuppression activity revealed that MSCs generated from UC had profoundly inhibited the proliferation of mitogen-activated T lymphocytes in a dosedependent manner. The current laboratory findings have reinforced the application of explant method to generate UCMSCs thus, exploring an ideal platform to fulfil the increasing demand of MSCs for research and potential clinical use.

  9. Application of a Simplified Method for Estimating Perfusion Derived from Diffusion-Weighted MR Imaging in Glioma Grading.

    Science.gov (United States)

    Cao, Mengqiu; Suo, Shiteng; Han, Xu; Jin, Ke; Sun, Yawen; Wang, Yao; Ding, Weina; Qu, Jianxun; Zhang, Xiaohua; Zhou, Yan

    2017-01-01

    Purpose : To evaluate the feasibility of a simplified method based on diffusion-weighted imaging (DWI) acquired with three b -values to measure tissue perfusion linked to microcirculation, to validate it against from perfusion-related parameters derived from intravoxel incoherent motion (IVIM) and dynamic contrast-enhanced (DCE) magnetic resonance (MR) imaging, and to investigate its utility to differentiate low- from high-grade gliomas. Materials and Methods : The prospective study was approved by the local institutional review board and written informed consent was obtained from all patients. From May 2016 and May 2017, 50 patients confirmed with glioma were assessed with multi- b -value DWI and DCE MR imaging at 3.0 T. Besides conventional apparent diffusion coefficient (ADC 0,1000 ) map, perfusion-related parametric maps for IVIM-derived perfusion fraction ( f ) and pseudodiffusion coefficient (D*), DCE MR imaging-derived pharmacokinetic metrics, including K trans , v e and v p , as well as a metric named simplified perfusion fraction (SPF), were generated. Correlation between perfusion-related parameters was analyzed by using the Spearman rank correlation. All imaging parameters were compared between the low-grade ( n = 19) and high-grade ( n = 31) groups by using the Mann-Whitney U test. The diagnostic performance for tumor grading was evaluated with receiver operating characteristic (ROC) analysis. Results : SPF showed strong correlation with IVIM-derived f and D* ( ρ = 0.732 and 0.716, respectively; both P simplified method to measure tissue perfusion based on DWI by using three b -values may be helpful to differentiate low- from high-grade gliomas. SPF may serve as a valuable alternative to measure tumor perfusion in gliomas in a noninvasive, convenient and efficient way.

  10. The Typicality Ranking Task: A New Method to Derive Typicality Judgments from Children

    Science.gov (United States)

    Ameel, Eef; Storms, Gert

    2016-01-01

    An alternative method for deriving typicality judgments, applicable in young children that are not familiar with numerical values yet, is introduced, allowing researchers to study gradedness at younger ages in concept development. Contrary to the long tradition of using rating-based procedures to derive typicality judgments, we propose a method that is based on typicality ranking rather than rating, in which items are gradually sorted according to their typicality, and that requires a minimum of linguistic knowledge. The validity of the method is investigated and the method is compared to the traditional typicality rating measurement in a large empirical study with eight different semantic concepts. The results show that the typicality ranking task can be used to assess children’s category knowledge and to evaluate how this knowledge evolves over time. Contrary to earlier held assumptions in studies on typicality in young children, our results also show that preference is not so much a confounding variable to be avoided, but that both variables are often significantly correlated in older children and even in adults. PMID:27322371

  11. Spectrophotometric determination of chlorthalidone in pharmaceutical formulations using different order derivative methods

    Directory of Open Access Journals (Sweden)

    Narmeen S. Abdullah

    2017-05-01

    Full Text Available Simple, repaid and accurate zero-, first- and second-order derivative spectrophotometric methods have been developed for determination of chlorthalidone (CLT in commercially available tablets. Normal spectrophotometric scan (zero order shows maximum absorbance at 276 nm in methanol solution and a good linearity in the range of 10.0–75.0 μg/mL. Linear relations using first (D1 and second (D2 order derivative methods were obtained at 278 and 288 nm for D1 and 286 and 292 nm for D2.The calibration curves were constructed in the range of 1.0–25.0 μg/mL for D1 (R = 0.998 and D2 (R = 0.999. Different analytical validations were determined (accuracy, precision, specificity, recovery, stability and robustness to demonstrate its suitability for routine quality control labs. All the developed methods were successfully applied to a tablet formulation and the results were compared statistically with each other and with those obtained by the HPLC reference method.

  12. New Multigrid Method Including Elimination Algolithm Based on High-Order Vector Finite Elements in Three Dimensional Magnetostatic Field Analysis

    Science.gov (United States)

    Hano, Mitsuo; Hotta, Masashi

    A new multigrid method based on high-order vector finite elements is proposed in this paper. Low level discretizations in this method are obtained by using low-order vector finite elements for the same mesh. Gauss-Seidel method is used as a smoother, and a linear equation of lowest level is solved by ICCG method. But it is often found that multigrid solutions do not converge into ICCG solutions. An elimination algolithm of constant term using a null space of the coefficient matrix is also described. In three dimensional magnetostatic field analysis, convergence time and number of iteration of this multigrid method are discussed with the convectional ICCG method.

  13. A method to derive corpuscular-optics identities as a consequence of the static character of fields

    International Nuclear Information System (INIS)

    Matyshev, A.A.

    2006-01-01

    A method to derive identities in static corpuscular optics is described. The essence of the method involves consideration of the particle start time as a parameter. As an example, 12 identities have been derived for a single electrostatic lens in the asymptotic case

  14. Sampling for Patient Exit Interviews: Assessment of Methods Using Mathematical Derivation and Computer Simulations.

    Science.gov (United States)

    Geldsetzer, Pascal; Fink, Günther; Vaikath, Maria; Bärnighausen, Till

    2018-02-01

    (1) To evaluate the operational efficiency of various sampling methods for patient exit interviews; (2) to discuss under what circumstances each method yields an unbiased sample; and (3) to propose a new, operationally efficient, and unbiased sampling method. Literature review, mathematical derivation, and Monte Carlo simulations. Our simulations show that in patient exit interviews it is most operationally efficient if the interviewer, after completing an interview, selects the next patient exiting the clinical consultation. We demonstrate mathematically that this method yields a biased sample: patients who spend a longer time with the clinician are overrepresented. This bias can be removed by selecting the next patient who enters, rather than exits, the consultation room. We show that this sampling method is operationally more efficient than alternative methods (systematic and simple random sampling) in most primary health care settings. Under the assumption that the order in which patients enter the consultation room is unrelated to the length of time spent with the clinician and the interviewer, selecting the next patient entering the consultation room tends to be the operationally most efficient unbiased sampling method for patient exit interviews. © 2016 The Authors. Health Services Research published by Wiley Periodicals, Inc. on behalf of Health Research and Educational Trust.

  15. Derivative Spectrophotometric Method for Estimation of Antiretroviral Drugs in Fixed Dose Combinations

    Science.gov (United States)

    P.B., Mohite; R.B., Pandhare; S.G., Khanage

    2012-01-01

    Purpose: Lamivudine is cytosine and zidovudine is cytidine and is used as an antiretroviral agents. Both drugs are available in tablet dosage forms with a dose of 150 mg for LAM and 300 mg ZID respectively. Method: The method employed is based on first order derivative spectroscopy. Wavelengths 279 nm and 300 nm were selected for the estimation of the Lamovudine and Zidovudine respectively by taking the first order derivative spectra. The conc. of both drugs was determined by proposed method. The results of analysis have been validated statistically and by recovery studies as per ICH guidelines. Result: Both the drugs obey Beer’s law in the concentration range 10-50 μg mL-1,for LAM and ZID; with regression 0.9998 and 0.9999, intercept – 0.0677 and – 0.0043 and slope 0.0457 and 0.0391 for LAM and ZID, respectively.The accuracy and reproducibility results are close to 100% with 2% RSD. Conclusion: A simple, accurate, precise, sensitive and economical procedures for simultaneous estimation of Lamovudine and Zidovudine in tablet dosage form have been developed. PMID:24312779

  16. The performance of selected semi-empirical and DFT methods in studying C60 fullerene derivatives

    Science.gov (United States)

    Sikorska, Celina; Puzyn, Tomasz

    2015-11-01

    The capability of reproducing the open circuit voltages (V oc) of 15 representative C60 fullerene derivatives was tested using the selected quantum mechanical methods (B3LYP, PM6, and PM7) together with the two one-electron basis sets. Certain theoretical treatments (e.g. PM6) were found to be satisfactory for preliminary estimates of the open circuit voltages (V oc), whereas the use of the B3LYP/6-31G(d) approach has been proven to assure highly accurate results. We also examined the structural similarity of 19 fullerene derivatives by employing principle component analysis (PCA). In order to express the structural features of the studied compounds we used molecular descriptors calculated with semi-empirical (PM6 and PM7) and density functional (B3LYP/6-31G(d)) methods separately. In performing PCA, we noticed that semi-empirical methods (i.e. PM6 and PM7) seem satisfactory for molecules, in which one can distinguish the aromatic and the aliphatic parts in the cyclopropane ring of PCBM (phenyl-C61-buteric acid methyl ester) and they significantly overestimate the energy of the highest occupied molecular orbital (E HOMO). The use of the B3LYP functional, however, is recommended for studying methanofullerenes, which closely resemble the structure of PCBM, and for their modifications.

  17. The performance of selected semi-empirical and DFT methods in studying C60 fullerene derivatives

    International Nuclear Information System (INIS)

    Sikorska, Celina; Puzyn, Tomasz

    2015-01-01

    The capability of reproducing the open circuit voltages (V oc ) of 15 representative C 60 fullerene derivatives was tested using the selected quantum mechanical methods (B3LYP, PM6, and PM7) together with the two one-electron basis sets. Certain theoretical treatments (e.g. PM6) were found to be satisfactory for preliminary estimates of the open circuit voltages (V oc ), whereas the use of the B3LYP/6-31G(d) approach has been proven to assure highly accurate results. We also examined the structural similarity of 19 fullerene derivatives by employing principle component analysis (PCA). In order to express the structural features of the studied compounds we used molecular descriptors calculated with semi-empirical (PM6 and PM7) and density functional (B3LYP/6-31G(d)) methods separately. In performing PCA, we noticed that semi-empirical methods (i.e. PM6 and PM7) seem satisfactory for molecules, in which one can distinguish the aromatic and the aliphatic parts in the cyclopropane ring of PCBM (phenyl-C 61 -buteric acid methyl ester) and they significantly overestimate the energy of the highest occupied molecular orbital (E HOMO ). The use of the B3LYP functional, however, is recommended for studying methanofullerenes, which closely resemble the structure of PCBM, and for their modifications. (paper)

  18. Derivation of Green's function of a spin Calogero-Sutherland model by Uglov's method

    International Nuclear Information System (INIS)

    Nakai, Ryota; Kato, Yusuke

    2009-01-01

    The hole propagator of a spin 1/2 Calogero-Sutherland model is derived using Uglov's method, which maps the exact eigenfunctions of the model, called the Yangian Gelfand-Zetlin basis, to a limit of Macdonald polynomials (gl 2 -Jack polynomials). To apply this mapping method to the calculation of 1-particle Green's function, we confirm that the sum of the field annihilation operator ψ u + ψ ↓ on a Yangian Gelfand-Zetlin basis is transformed to the field annihilation operator ψ on gl 2 -Jack polynomials by the mapping. The resultant expression for the hole propagator for a finite-size system is written in terms of renormalized momenta and spin of quasi-holes, and the expression in the thermodynamic limit coincides with the earlier result derived by another method. We also discuss the singularity of the spectral function for a specific coupling parameter where the hole propagator of the spin Calogero-Sutherland model becomes equivalent to the dynamical colour correlation function of an SU(3) Haldane-Shastry model

  19. Predicting human splicing branchpoints by combining sequence-derived features and multi-label learning methods.

    Science.gov (United States)

    Zhang, Wen; Zhu, Xiaopeng; Fu, Yu; Tsuji, Junko; Weng, Zhiping

    2017-12-01

    Alternative splicing is the critical process in a single gene coding, which removes introns and joins exons, and splicing branchpoints are indicators for the alternative splicing. Wet experiments have identified a great number of human splicing branchpoints, but many branchpoints are still unknown. In order to guide wet experiments, we develop computational methods to predict human splicing branchpoints. Considering the fact that an intron may have multiple branchpoints, we transform the branchpoint prediction as the multi-label learning problem, and attempt to predict branchpoint sites from intron sequences. First, we investigate a variety of intron sequence-derived features, such as sparse profile, dinucleotide profile, position weight matrix profile, Markov motif profile and polypyrimidine tract profile. Second, we consider several multi-label learning methods: partial least squares regression, canonical correlation analysis and regularized canonical correlation analysis, and use them as the basic classification engines. Third, we propose two ensemble learning schemes which integrate different features and different classifiers to build ensemble learning systems for the branchpoint prediction. One is the genetic algorithm-based weighted average ensemble method; the other is the logistic regression-based ensemble method. In the computational experiments, two ensemble learning methods outperform benchmark branchpoint prediction methods, and can produce high-accuracy results on the benchmark dataset.

  20. Assessing the Applicability of Currently Available Methods for Attributing Foodborne Disease to Sources, Including Food and Food Commodities

    DEFF Research Database (Denmark)

    Pires, Sara Monteiro

    2013-01-01

    on the public health question being addressed, on the data requirements, on advantages and limitations of the method, and on the data availability of the country or region in question. Previous articles have described available methods for source attribution, but have focused only on foodborne microbiological...

  1. A method for stochastic constrained optimization using derivative-free surrogate pattern search and collocation

    International Nuclear Information System (INIS)

    Sankaran, Sethuraman; Audet, Charles; Marsden, Alison L.

    2010-01-01

    Recent advances in coupling novel optimization methods to large-scale computing problems have opened the door to tackling a diverse set of physically realistic engineering design problems. A large computational overhead is associated with computing the cost function for most practical problems involving complex physical phenomena. Such problems are also plagued with uncertainties in a diverse set of parameters. We present a novel stochastic derivative-free optimization approach for tackling such problems. Our method extends the previously developed surrogate management framework (SMF) to allow for uncertainties in both simulation parameters and design variables. The stochastic collocation scheme is employed for stochastic variables whereas Kriging based surrogate functions are employed for the cost function. This approach is tested on four numerical optimization problems and is shown to have significant improvement in efficiency over traditional Monte-Carlo schemes. Problems with multiple probabilistic constraints are also discussed.

  2. Structure and performance of polymer-derived bulk ceramics determined by method of filler incorporation

    Science.gov (United States)

    Konegger, T.; Schneider, P.; Bauer, V.; Amsüss, A.; Liersch, A.

    2013-12-01

    The effect of four distinct methods of incorporating fillers into a preceramic polymer matrix was investigated with respect to the structural and mechanical properties of the resulting materials. Investigations were conducted with a polysiloxane/Al2O3/ZrO2 model system used as a precursor for mullite/ZrO2 composites. A quantitative evaluation of the uniformity of filler distribution was obtained by employing a novel image analysis. While solvent-free mixing led to a heterogeneous distribution of constituents resulting in limited mechanical property values, a strong improvement of material homogeneity and properties was obtained by using solvent-assisted methods. The results demonstrate the importance of the processing route on final characteristics of polymer-derived ceramics.

  3. A domain derivative-based method for solving elastodynamic inverse obstacle scattering problems

    International Nuclear Information System (INIS)

    Le Louër, Frédérique

    2015-01-01

    The present work is concerned with the shape reconstruction problem of isotropic elastic inclusions from far-field data obtained by the scattering of a finite number of time-harmonic incident plane waves. This paper aims at completing the theoretical framework which is necessary for the application of geometric optimization tools to the inverse transmission problem in elastodynamics. The forward problem is reduced to systems of boundary integral equations following the direct and indirect methods initially developed for solving acoustic transmission problems. We establish the Fréchet differentiability of the boundary to far-field operator and give a characterization of the first Fréchet derivative and its adjoint operator. Using these results we propose an inverse scattering algorithm based on the iteratively regularized Gauß–Newton method and show numerical experiments in the special case of star-shaped obstacles. (paper)

  4. Perturbative method for the derivation of quantum kinetic theory based on closed-time-path formalism

    International Nuclear Information System (INIS)

    Koide, Jun

    2002-01-01

    Within the closed-time-path formalism, a perturbative method is presented, which reduces the microscopic field theory to the quantum kinetic theory. In order to make this reduction, the expectation value of a physical quantity must be calculated under the condition that the Wigner distribution function is fixed, because it is the independent dynamical variable in the quantum kinetic theory. It is shown that when a nonequilibrium Green function in the form of the generalized Kadanoff-Baym ansatz is utilized, this condition appears as a cancellation of a certain part of contributions in the diagrammatic expression of the expectation value. Together with the quantum kinetic equation, which can be derived in the closed-time-path formalism, this method provides a basis for the kinetic-theoretical description

  5. A method for generation of bone marrow-derived macrophages from cryopreserved mouse bone marrow cells.

    Directory of Open Access Journals (Sweden)

    Fernanda M Marim

    Full Text Available The broad use of transgenic and gene-targeted mice has established bone marrow-derived macrophages (BMDM as important mammalian host cells for investigation of the macrophages biology. Over the last decade, extensive research has been done to determine how to freeze and store viable hematopoietic human cells; however, there is no information regarding generation of BMDM from frozen murine bone marrow (BM cells. Here, we establish a highly efficient protocol to freeze murine BM cells and further generate BMDM. Cryopreserved murine BM cells maintain their potential for BMDM differentiation for more than 6 years. We compared BMDM obtained from fresh and frozen BM cells and found that both are similarly able to trigger the expression of CD80 and CD86 in response to LPS or infection with the intracellular bacteria Legionella pneumophila. Additionally, BMDM obtained from fresh or frozen BM cells equally restrict or support the intracellular multiplication of pathogens such as L. pneumophila and the protozoan parasite Leishmania (L. amazonensis. Although further investigation are required to support the use of the method for generation of dendritic cells, preliminary experiments indicate that bone marrow-derived dendritic cells can also be generated from cryopreserved BM cells. Overall, the method described and validated herein represents a technical advance as it allows ready and easy generation of BMDM from a stock of frozen BM cells.

  6. Study Modules for Calculus-Based General Physics. [Includes Modules 15-17: Gravitation; Simple Harmonic Motion; and Traveling Waves; plus a Partial Derivatives Review].

    Science.gov (United States)

    Fuller, Robert G., Ed.; And Others

    This is part of a series of 42 Calculus Based Physics (CBP) modules totaling about 1,000 pages. The modules include study guides, practice tests, and mastery tests for a full-year individualized course in calculus-based physics based on the Personalized System of Instruction (PSI). The units are not intended to be used without outside materials;…

  7. How can the co-ordinate transformation method of beam matching be extended to include separately labelled collimators?

    Science.gov (United States)

    Morgan-Fletcher, S; McKenzie, A L

    1996-03-01

    The problem of matching radiation beams was tackled by Siddon in 1980 using co-ordinate transformations. Since then, the need to distinguish between individual collimators in prescriptions of treatment set-up, brought about by the widespread use of 3-D treatment planning systems and asymmetric fields, as well as a reversal of the rotation sense in the turntable co-ordinate system proposed by the International Electrotechnical Commission, have made it necessary to revisit this particular problem. This paper builds upon Siddon's general equations for the particular case of matching beams, and derives expressions for calculating treatment-unit settings which may be used in a computer program without the need to perform matrix manipulation. The expression treat the individual collimator jaws separately.

  8. A stochastic post-processing method for solar irradiance forecasts derived from NWPs models

    Science.gov (United States)

    Lara-Fanego, V.; Pozo-Vazquez, D.; Ruiz-Arias, J. A.; Santos-Alamillos, F. J.; Tovar-Pescador, J.

    2010-09-01

    Solar irradiance forecast is an important area of research for the future of the solar-based renewable energy systems. Numerical Weather Prediction models (NWPs) have proved to be a valuable tool for solar irradiance forecasting with lead time up to a few days. Nevertheless, these models show low skill in forecasting the solar irradiance under cloudy conditions. Additionally, climatic (averaged over seasons) aerosol loading are usually considered in these models, leading to considerable errors for the Direct Normal Irradiance (DNI) forecasts during high aerosols load conditions. In this work we propose a post-processing method for the Global Irradiance (GHI) and DNI forecasts derived from NWPs. Particularly, the methods is based on the use of Autoregressive Moving Average with External Explanatory Variables (ARMAX) stochastic models. These models are applied to the residuals of the NWPs forecasts and uses as external variables the measured cloud fraction and aerosol loading of the day previous to the forecast. The method is evaluated for a set one-moth length three-days-ahead forecast of the GHI and DNI, obtained based on the WRF mesoscale atmospheric model, for several locations in Andalusia (Southern Spain). The Cloud fraction is derived from MSG satellite estimates and the aerosol loading from the MODIS platform estimates. Both sources of information are readily available at the time of the forecast. Results showed a considerable improvement of the forecasting skill of the WRF model using the proposed post-processing method. Particularly, relative improvement (in terms of the RMSE) for the DNI during summer is about 20%. A similar value is obtained for the GHI during the winter.

  9. Derivative spectrophotometric method for simultaneous determination of zofenopril and fluvastatin in mixtures and pharmaceutical dosage forms.

    Science.gov (United States)

    Stolarczyk, Mariusz; Maślanka, Anna; Apola, Anna; Rybak, Wojciech; Krzek, Jan

    2015-09-05

    Fast, accurate and precise method for the determination of zofenopril and fluvastatin was developed using spectrophotometry of the first (D1), second (D2), and third (D3) order derivatives in two-component mixtures and in pharmaceutical preparations. It was shown, that the developed method allows for the determination of the tested components in a direct manner, despite the apparent interference of the absorption spectra in the UV range. For quantitative determinations, "zero-crossing" method was chosen, appropriate wavelengths for zofenopril were: D1 λ=270.85 nm, D2 λ=286.38 nm, D3 λ=253.90 nm. Fluvastatin was determined at wavelengths: D1 λ=339.03 nm, D2 λ=252.57 nm, D3 λ=258.50 nm, respectively. The method was characterized by high sensitivity and accuracy, for zofenopril LOD was in the range of 0.19-0.87 μg mL(-1), for fluvastatin 0.51-1.18 μg mL(-1), depending on the class of derivative, and for zofenopril and fluvastatin LOQ was 0.57-2.64 μg mL(-1) and 1.56-3.57 μg mL(-1), respectively. The recovery of individual components was within the range of 100±5%. For zofenopril, the linearity range was estimated between 7.65 μg mL(-1) and 22.94 μg mL(-1), and for fluvastatin between 5.60 μg mL(-1) and 28.00 μg mL(-1). Copyright © 2015 Elsevier B.V. All rights reserved.

  10. A New Method and a New Scaling for Deriving Fermionic Mean-Field Dynamics

    International Nuclear Information System (INIS)

    Petrat, Sören; Pickl, Peter

    2016-01-01

    We introduce a new method for deriving the time-dependent Hartree or Hartree-Fock equations as an effective mean-field dynamics from the microscopic Schrödinger equation for fermionic many-particle systems in quantum mechanics. The method is an adaption of the method used in Pickl (Lett. Math. Phys. 97 (2) 151–164 2011) for bosonic systems to fermionic systems. It is based on a Gronwall type estimate for a suitable measure of distance between the microscopic solution and an antisymmetrized product state. We use this method to treat a new mean-field limit for fermions with long-range interactions in a large volume. Some of our results hold for singular attractive or repulsive interactions. We can also treat Coulomb interaction assuming either a mild singularity cutoff or certain regularity conditions on the solutions to the Hartree(-Fock) equations. In the considered limit, the kinetic and interaction energy are of the same order, while the average force is subleading. For some interactions, we prove that the Hartree(-Fock) dynamics is a more accurate approximation than a simpler dynamics that one would expect from the subleading force. With our method we also treat the mean-field limit coupled to a semiclassical limit, which was discussed in the literature before, and we recover some of the previous results. All results hold for initial data close (but not necessarily equal) to antisymmetrized product states and we always provide explicit rates of convergence.

  11. Development of dissolution test method for a telmisartan/amlodipine besylate combination using synchronous derivative spectrofluorimetry

    Directory of Open Access Journals (Sweden)

    Panikumar Durga Anumolu

    2014-04-01

    Full Text Available The dissolution process is considered an important in vitro tool to evaluate product quality and drug release behavior. Single dissolution methods for the analysis of combined dosage forms are preferred to simplify quality control testing. The objective of the present work was to develop and validate a single dissolution test for a telmisartan (TEL and amlodipine besylate (AML combined tablet dosage form. The sink conditions, stability and specificity of both drugs in different dissolution media were tested to choose a discriminatory dissolution method, which uses an USP type-II apparatus with a paddle rotating at 75 rpm, with 900 mL of simulated gastric fluid (SGF without enzymes as the dissolution medium. This dissolution methodology provided good dissolution profiles for both TEL and AML and was able to discriminate changes in the composition and manufacturing process. To quantify both drugs simultaneously, a synchronous first derivative spectrofluorimetric method was developed and validated. Drug release was analyzed by a fluorimetric method at 458 nm and 675 nm for AML and TEL, respectively. The dissolution method was validated as per ICH guidance.

  12. Application of a Simplified Method for Estimating Perfusion Derived from Diffusion-Weighted MR Imaging in Glioma Grading

    Directory of Open Access Journals (Sweden)

    Mengqiu Cao

    2018-01-01

    Full Text Available Purpose: To evaluate the feasibility of a simplified method based on diffusion-weighted imaging (DWI acquired with three b-values to measure tissue perfusion linked to microcirculation, to validate it against from perfusion-related parameters derived from intravoxel incoherent motion (IVIM and dynamic contrast-enhanced (DCE magnetic resonance (MR imaging, and to investigate its utility to differentiate low- from high-grade gliomas.Materials and Methods: The prospective study was approved by the local institutional review board and written informed consent was obtained from all patients. From May 2016 and May 2017, 50 patients confirmed with glioma were assessed with multi-b-value DWI and DCE MR imaging at 3.0 T. Besides conventional apparent diffusion coefficient (ADC0,1000 map, perfusion-related parametric maps for IVIM-derived perfusion fraction (f and pseudodiffusion coefficient (D*, DCE MR imaging-derived pharmacokinetic metrics, including Ktrans, ve and vp, as well as a metric named simplified perfusion fraction (SPF, were generated. Correlation between perfusion-related parameters was analyzed by using the Spearman rank correlation. All imaging parameters were compared between the low-grade (n = 19 and high-grade (n = 31 groups by using the Mann-Whitney U test. The diagnostic performance for tumor grading was evaluated with receiver operating characteristic (ROC analysis.Results: SPF showed strong correlation with IVIM-derived f and D* (ρ = 0.732 and 0.716, respectively; both P < 0.001. Compared with f, SPF was more correlated with DCE MR imaging-derived Ktrans (ρ = 0.607; P < 0.001 and vp (ρ = 0.397; P = 0.004. Among all parameters, SPF achieved the highest accuracy for differentiating low- from high-grade gliomas, with an area under the ROC curve value of 0.942, which was significantly higher than that of ADC0,1000 (P = 0.004. By using SPF as a discriminative index, the diagnostic sensitivity and specificity were 87.1% and 94

  13. Calculated Low-Speed Steady and Time-Dependent Aerodynamic Derivatives for Some Airfoils Using a Discrete Vortex Method

    Science.gov (United States)

    Riley, Donald R.

    2015-01-01

    This paper contains a collection of some results of four individual studies presenting calculated numerical values for airfoil aerodynamic stability derivatives in unseparated inviscid incompressible flow due separately to angle-of-attack, pitch rate, flap deflection, and airfoil camber using a discrete vortex method. Both steady conditions and oscillatory motion were considered. Variables include the number of vortices representing the airfoil, the pitch axis / moment center chordwise location, flap chord to airfoil chord ratio, and circular or parabolic arc camber. Comparisons with some experimental and other theoretical information are included. The calculated aerodynamic numerical results obtained using a limited number of vortices provided in each study compared favorably with thin airfoil theory predictions. Of particular interest are those aerodynamic results calculated herein (such as induced drag) that are not readily available elsewhere.

  14. Compositions of graphene materials with metal nanostructures and microstructures and methods of making and using including pressure sensors

    KAUST Repository

    Chen, Ye; Khashab, Niveen M.; Tao, Jing

    2017-01-01

    Composition comprising at least one graphene material and at least one metal. The metal can be in the form of nanoparticles as well as microflakes, including single crystal microflakes. The metal can be intercalated in the graphene sheets

  15. A Hamiltonian-based derivation of Scaled Boundary Finite Element Method for elasticity problems

    International Nuclear Information System (INIS)

    Hu Zhiqiang; Lin Gao; Wang Yi; Liu Jun

    2010-01-01

    The Scaled Boundary Finite Method (SBFEM) is a semi-analytical solution approach for solving partial differential equation. For problem in elasticity, the governing equations can be obtained by mechanically based formulation, Scaled-boundary-transformation-based formulation and principle of virtual work. The governing equations are described in the frame of Lagrange system and the unknowns are displacements. But in the solution procedure, the auxiliary variables are introduced and the equations are solved in the state space. Based on the observation that the duality system to solve elastic problem proposed by W.X. Zhong is similar to the above solution approach, the discretization of the SBFEM and the duality system are combined to derive the governing equations in the Hamilton system by introducing the dual variables in this paper. The Precise Integration Method (PIM) used in Duality system is also an efficient method for the solution of the governing equations of SBFEM in displacement and boundary stiffness matrix especially for the case which results some numerical difficulties in the usually uses the eigenvalue method. Numerical examples are used to demonstrate the validity and effectiveness of the PIM for solution of boundary static stiffness.

  16. Evaluation, including effects of storage and repeated freezing and thawing, of a method for measurement of urinary creatinine

    DEFF Research Database (Denmark)

    Garde, A H; Hansen, Åse Marie; Kristiansen, J

    2003-01-01

    The aims of this study were to elucidate to what extent storage and repeated freezing and thawing influenced the concentration of creatinine in urine samples and to evaluate the method for determination of creatinine in urine. The creatinine method was based on the well-known Jaffe's reaction...... and measured on a COBAS Mira autoanalyser from Roche. The main findings were that samples for analysis of creatinine should be kept at a temperature of -20 degrees C or lower and frozen and thawed only once. The limit of detection, determined as 3 x SD of 20 determinations of a sample at a low concentration (6...

  17. Transport methods: general. 6. A Flux-Limited Diffusion Theory Derived from the Maximum Entropy Eddington Factor

    International Nuclear Information System (INIS)

    Yin, Chukai; Su, Bingjing

    2001-01-01

    The Minerbo's maximum entropy Eddington factor (MEEF) method was proposed as a low-order approximation to transport theory, in which the first two moment equations are closed for the scalar flux f and the current F through a statistically derived nonlinear Eddington factor f. This closure has the ability to handle various degrees of anisotropy of angular flux and is well justified both numerically and theoretically. Thus, a lot of efforts have been made to use this approximation in transport computations, especially in the radiative transfer and astrophysics communities. However, the method suffers numerical instability and may lead to anomalous solutions if the equations are solved by certain commonly used (implicit) mesh schemes. Studies on numerical stability in one-dimensional cases show that the MEEF equations can be solved satisfactorily by an implicit scheme (of treating δΦ/δx) if the angular flux is not too anisotropic so that f 32 , the classic diffusion solution P 1 , the MEEF solution f M obtained by Riemann solvers, and the NFLD solution D M for the two problems, respectively. In Fig. 1, NFLD and MEEF quantitatively predict very close results. However, the NFLD solution is qualitatively better because it is continuous while MEEF predicts unphysical jumps near the middle of the slab. In Fig. 2, the NFLD and MEEF solutions are almost identical, except near the material interface. In summary, the flux-limited diffusion theory derived from the MEEF description is quantitatively as accurate as the MEEF method. However, it is more qualitatively correct and user-friendly than the MEEF method and can be applied efficiently to various steady-state problems. Numerical tests show that this method is widely valid and overall predicts better results than other low-order approximations for various kinds of problems, including eigenvalue problems. Thus, it is an appealing approximate solution technique that is fast computationally and yet is accurate enough for a

  18. Feasibility of the Medial Temporal lobe Atrophy index (MTAi and derived methods for measuring atrophy of the medial temporal lobe

    Directory of Open Access Journals (Sweden)

    Francisco eConejo Bayón

    2014-11-01

    Full Text Available Introduction: the Medial Temporal-lobe Atrophy index (MTAi, 2D-Medial Temporal Atrophy (2D-MTA, yearly rate of MTA (yrRMTA and yearly rate of relative MTA (yrRMTA are simple protocols for measuring the relative extent of atrophy in the MTL in relation to the global brain atrophy. Albeit preliminary studies showed interest of these methods in the diagnosis of AD, FTLD and correlation with cognitive impairment in PD, formal feasibility and validity studies remained pending. As a first step, we aimed to assess the feasibility. Mainly, we aimed to assess the reproducibility of measuring the areas needed to compute these indices. We also aimed to assess the efforts needed to start using these methods correctly. Methods: a series of 290 1.5T-MRI studies from 230 subjects ranging 65-85 years old who had been studied for cognitive impairment were used in this study. Six inexperienced tracers (IT plus one experienced tracer (ET traced the three areas needed to compute the indices. Finally, tracers underwent a short survey on their experience learning to compute the MTAi and experience of usage, including items relative to training time needed to understand and apply the MTAi, time to perform a study after training and overall satisfaction. Results: learning to trace the areas needed to compute the MTAi and derived methods is quick and easy. Results indicate very good intrarater ICC for the MTAi, good intrarater ICC for the 2D-MTA, yrMTA and yrRMTA and also good interrater ICC for the MTAi, 2D-MTA, yrMTA and yrRMTA.Conclusion: our data support that MTAi and derived methods (2D-MTA, yrMTA and yrRTMA have good to very good intrarater and interrater reproducibility and may be easily implemented in clinical practice even if new users have no experience tracing the area of regions of interest.

  19. Theory of linear physical systems theory of physical systems from the viewpoint of classical dynamics, including Fourier methods

    CERN Document Server

    Guillemin, Ernst A

    2013-01-01

    An eminent electrical engineer and authority on linear system theory presents this advanced treatise, which approaches the subject from the viewpoint of classical dynamics and covers Fourier methods. This volume will assist upper-level undergraduates and graduate students in moving from introductory courses toward an understanding of advanced network synthesis. 1963 edition.

  20. Sighting optics including an optical element having a first focal length and a second focal length and methods for sighting

    Science.gov (United States)

    Crandall, David Lynn

    2011-08-16

    Sighting optics include a front sight and a rear sight positioned in a spaced-apart relation. The rear sight includes an optical element having a first focal length and a second focal length. The first focal length is selected so that it is about equal to a distance separating the optical element and the front sight and the second focal length is selected so that it is about equal to a target distance. The optical element thus brings into simultaneous focus for a user images of the front sight and the target.

  1. Compositions of graphene materials with metal nanostructures and microstructures and methods of making and using including pressure sensors

    KAUST Repository

    Chen, Ye

    2017-01-26

    Composition comprising at least one graphene material and at least one metal. The metal can be in the form of nanoparticles as well as microflakes, including single crystal microflakes. The metal can be intercalated in the graphene sheets. The composition has high conductivity and flexibility. The composition can be made by a one-pot synthesis in which a graphene material precursor is converted to the graphene material, and the metal precursor is converted to the metal. A reducing solvent or dispersant such as NMP can be used. Devices made from the composition include a pressure sensor which has high sensitivity. Two two- dimension materials can be combined to form a hybrid material.

  2. Spectrophotometric method for the analysis of rare earths by first and second order derivatives

    International Nuclear Information System (INIS)

    Deshpande, S.M.; Singh, H.

    1997-01-01

    Spectrophotometric methods are widely used for the analysis of rare earth elements as they are simple, fast, precise and accurate. Many of the rare earth ions in acidic solutions absorb in ultraviolet and visible region of the electromagnetic spectrum. Because of the restricted transition of the 4f electrons the absorption peaks are very sharp and these peaks are used for the qualitative and quantitative analysis of rare elements. When analysis of one or two minor constituents in the mixture of rare earths is involved, it is a straightforward and simple matter, but the analysis of multiple elements from a complex mixture is very difficult because of the mutual interference of the absorption bands. Simultaneous equations of the type: (OD) 1 = C A X Φ A1 + C B X Φ B1 and (OD) 2 = C A X Φ A2 + C B X Φ B2 are also employed to overcome the mutual interference. In this paper first order and second order derivative spectra are used for the analysis of rare earths. It is a simple and effective technique for accurate analysis of rare earths from a complex mixture. Absorption data in the first derivative mode is also presented. Analysis of Nd-Pr-Sm from their synthetic mixtures is reported. (author). 4 refs., 1 tab., 1 ill

  3. Methods for the calculation of derived working limits for surface contamination by low-toxicity radionuclides

    International Nuclear Information System (INIS)

    Gibson, J.A.B.; Wrixon, A.D.

    1979-01-01

    Surface contamination is often measured as an indication of the general spread of radioactive contamination in a particular place. Derived working limits, (DWLs) for surface contamination provide figures against which to assess the significance of measurements. Derived working limits for surface contamination were first established for use in the nuclear energy industry. They were designed to cope with a wide range of unspecified radionuclides and were therefore based on the assumption that the contamination was due to the presence of the most hazardous radionuclides, e.g. 90 Sr, 210 Pb, 226 Ra and 239 Pu. While this assumption may still be appropriate when the radionuclide mixture is unknown, there are now many specialized uses of particular low-toxicity radionuclides in universities, hospitals and general industry. If it is known that only a particular radionuclide is present, the general DWL can be replaced by a more specific value. The methods for calculating DWLs for some of the more commonly employed low-toxicity radionuclides are described. The exposure pathways considered are (a) external radiation of the skin and inhalation of airborne material from contaminated surfaces in active areas; (b) external irradiation of the skin and ingestion from contaminated skin. Some consideration is given to the effect of the revised dose equivalent limits in the most recent recommendations of ICRP. (author)

  4. Spectrometric methods for the determination of chlorine in crude oil and petroleum derivatives — A review

    International Nuclear Information System (INIS)

    Doyle, Adriana; Saavedra, Alvaro; Tristão, Maria Luiza B.; Mendes, Luiz A.N.; Aucélio, Ricardo Q.

    2013-01-01

    Chlorine determination in crude oil is made in order to guarantee that the oil does not contain levels of this element that might cause damages in the oil processing equipment. In petroleum products, the determination of chlorine is made, for instance, to evaluate if there are proper concentrations of organochloride compounds, which are used as additives. Such determinations are currently performed following official guidelines from the ASTM International and from the United States Environmental Protection Agency as well as protocols indicated by the Universal Oil Products. X-ray fluorescence spectroscopy plays an important role in many of these official methods. In contrast, other spectrometric methods based on optical and mass detection are plagued by limitations related to both the fundamental characteristics of non-metals and to the complex sample matrices, which reflects in the small number of articles devoted to these applications. In this review, the current status of the spectrometric methods, especially the role played by X-ray fluorescence spectrometry, is evaluated in terms of the determination of chlorine in crude oil and petroleum derivatives. Comparison of the performance of the methods, limitations and potential new approaches to ensure proper spectrometric determinations of chlorine is indicated. - Highlights: • Critical evaluation of spectrometric methods for chlorine in petroleum products. • Reviews on element determination in petroleum have not address the case of chlorine. • Peculiarities of the spectrometric determination of Cl in petroleum are discussed. • The spectrometric approaches are detailed and compared to the official methods. • New trends in chlorine determination in petroleum products are indicated

  5. Calculation methods of reactivity using derivatives of nuclear power and Filter fir

    International Nuclear Information System (INIS)

    Diaz, Daniel Suescun

    2007-01-01

    This work presents two new methods for the solution of the inverse point kinetics equation. The first method is based on the integration by parts of the integral of the inverse point kinetics equation, which results in a power series in terms of the nuclear power in time dependence. Applying some conditions to the nuclear power, the reactivity is represented as first and second derivatives of this nuclear power. This new calculation method for reactivity has special characteristics, amongst which the possibility of using different sampling periods, and the possibility of restarting the calculation, after its interruption associated it with a possible equipment malfunction, allowing the calculation of reactivity in a non-continuous way. Apart from this reactivity can be obtained with or without dependency on the nuclear power memory. The second method is based on the Laplace transform of the point kinetics equations, resulting in an expression equivalent to the inverse kinetics equation as a function of the power history. The reactivity can be written in terms of the summation of convolution with response to impulse, characteristic of a linear system. For its digital form the Z-transform is used, which is the discrete version of the Laplace transform. In this method it can be pointed out that the linear part is equivalent to a filter named Finite Impulse Response (Fir). The Fir filter will always be, stable and non-varying in time, and, apart from this, it can be implemented in the non-recursive way. This type of implementation does not require feedback, allowing the calculation of reactivity in a continuous way. The proposed methods were validated using signals with random noise and showing the relationship between the reactivity difference and the degree of the random noise. (author)

  6. Difference in target definition using three different methods to include respiratory motion in radiotherapy of lung cancer

    DEFF Research Database (Denmark)

    Sloth Møller, Ditte; Knap, Marianne Marquard; Nyeng, Tine Bisballe

    2017-01-01

    : PTVσ yields the smallest volumes but does not ensure coverage of tumor during the full respiratory motion due to tumor deformation. Incorporating the respiratory motion in the delineation (PTVdel) takes into account the entire respiratory cycle including deformation, but at the cost, however, of larger...

  7. Shining a light on LAMP assays--a comparison of LAMP visualization methods including the novel use of berberine.

    Science.gov (United States)

    Fischbach, Jens; Xander, Nina Carolin; Frohme, Marcus; Glökler, Jörn Felix

    2015-04-01

    The need for simple and effective assays for detecting nucleic acids by isothermal amplification reactions has led to a great variety of end point and real-time monitoring methods. Here we tested direct and indirect methods to visualize the amplification of potato spindle tuber viroid (PSTVd) by loop-mediated isothermal amplification (LAMP) and compared features important for one-pot in-field applications. We compared the performance of magnesium pyrophosphate, hydroxynaphthol blue (HNB), calcein, SYBR Green I, EvaGreen, and berberine. All assays could be used to distinguish between positive and negative samples in visible or UV light. Precipitation of magnesium-pyrophosphate resulted in a turbid reaction solution. The use of HNB resulted in a color change from violet to blue, whereas calcein induced a change from orange to yellow-green. We also investigated berberine as a nucleic acid-specific dye that emits a fluorescence signal under UV light after a positive LAMP reaction. It has a comparable sensitivity to SYBR Green I and EvaGreen. Based on our results, an optimal detection method can be chosen easily for isothermal real-time or end point screening applications.

  8. Measure Guideline: Summary of Interior Ducts in New Construction, Including an Efficient, Affordable Method to Install Fur-Down Interior Ducts

    Energy Technology Data Exchange (ETDEWEB)

    Beal, D. [BA-PIRC, Cocoa, FL (United States); McIlvaine, J. [BA-PIRC, Cocoa, FL (United States); Fonorow, K. [BA-PIRC, Cocoa, FL (United States); Martin, E. [BA-PIRC, Cocoa, FL (United States)

    2011-11-01

    This document illustrates guidelines for the efficient installation of interior duct systems in new housing, including the fur-up chase method, the fur-down chase method, and interior ducts positioned in sealed attics or sealed crawl spaces.

  9. Utilizing Computational Probabilistic Methods to Derive Shock Specifications in a Nondeterministic Environment

    Energy Technology Data Exchange (ETDEWEB)

    FIELD JR.,RICHARD V.; RED-HORSE,JOHN R.; PAEZ,THOMAS L.

    2000-10-25

    One of the key elements of the Stochastic Finite Element Method, namely the polynomial chaos expansion, has been utilized in a nonlinear shock and vibration application. As a result, the computed response was expressed as a random process, which is an approximation to the true solution process, and can be thought of as a generalization to solutions given as statistics only. This approximation to the response process was then used to derive an analytically-based design specification for component shock response that guarantees a balanced level of marginal reliability. Hence, this analytically-based reference SRS might lead to an improvement over the somewhat ad hoc test-based reference in the sense that it will not exhibit regions of conservativeness. nor lead to overtesting of the design.

  10. A new method for deriving rigorous results on ππ scattering

    International Nuclear Information System (INIS)

    Caprini, I.; Dita, P.

    1979-06-01

    We develop a new approach to the problem of constraining the ππ scattering amplitudes by means of the axiomatically proved properties of unitarity, analyticity and crossing symmetry. The method is based on the solution of an extremal problem on a convex set of analytic functions and provides a global description of the domain of values taken by any finite number of partial waves at an arbitrary set of unphysical energies, compatible with unitarity, the bounds at complex energies derived from generalized dispersion relations and the crossing integral relations. From this doma domain we obtain new absolute bounds for the amplitudes as well as rigorous correlations between the values of various partial waves. (author)

  11. Development of a derivative spectrophotometric method for the determination of fungicide zinc ethylenebisdithiocarbamate using sodium molybdate

    International Nuclear Information System (INIS)

    Kaur, Manpreet; Kaur, Varinder; Malik, Ashok K.; Singh, Baldev; Rao, A.L.J.; Verma, Neelam

    2009-01-01

    A derivative spectrophotometric procedure was developed for the determination of zinc(II) ethylenebisdithiocarbamate, Zineb, after formation of its blue colored complex with sodium molybdate in acidic medium. The Beer's law is obeyed up to 40 μg mL -1 of Zineb at 956 nm. The detection limit was 0.006 μg mL -1 for Zineb when S/N ratio is 3 taking into account various parameters, such as the effect of acid concentration. The interference of a large number of ions on the determination of Zineb was evaluated. Most of the alkaline metals and metal salts did not interfere. The procedure presented proper sensitivity and it was applied for determining Zineb in food stuffs and commercial samples of Dithane Z 78 and Hexathane 75% W.P.. Results were compared with earlier reported methods. Zineb was successfully determined without any interferences in the presence of other dithiocarbamates like Ziram, Thiram, Ferbam etc. (author)

  12. Anisotropic surface hole-transport property of triphenylamine-derivative single crystal prepared by solution method

    Energy Technology Data Exchange (ETDEWEB)

    Umeda, Minoru, E-mail: mumeda@vos.nagaokaut.ac.jp [Nagaoka University of Technology, Kamitomioka, Nagaoka, Niigata 940-2188 (Japan); Katagiri, Mitsuhiko; Shironita, Sayoko [Nagaoka University of Technology, Kamitomioka, Nagaoka, Niigata 940-2188 (Japan); Nagayama, Norio [Nagaoka University of Technology, Kamitomioka, Nagaoka, Niigata 940-2188 (Japan); Ricoh Company, Ltd., Nishisawada, Numazu, Shizuoka 410-0007 (Japan)

    2016-12-01

    Highlights: • A hole transport molecule was investigated based on its electrochemical redox characteristics. • The solubility and supersolubility curves of the molecule were measured in order to prepare a large crystal. • The polarization micrograph and XRD results revealed that a single crystal was obtained. • An anisotropic surface conduction, in which the long-axis direction exceeds that of the amorphous layer, was observed. • The anisotropic surface conduction was well explained by the molecular stacked structure. - Abstract: This paper reports the anisotropic hole transport at the triphenylamine-derivative single crystal surface prepared by a solution method. Triphenylamine derivatives are commonly used in a hole-transport material for organic photoconductors of laser-beam printers, in which the materials are used as an amorphous form. For developing organic photovoltaics using the photoconductor’s technology, preparation of a single crystal seems to be a specific way by realizing the high mobility of an organic semiconductor. In this study, a single crystal of 4-(2,2-diphenylethenyl)-N,N-bis(4-methylphenyl)-benzenamine (TPA) was prepared and its anisotropic hole-transport property measured. First, the hole-transport property of the TPA was investigated based on its chemical structure and electrochemical redox characteristics. Next, a large-scale single crystal formation at a high rate was developed by employing a solution method based on its solubility and supersolubility curves. The grown TPA was found to be a single crystal based on the polarization micrograph observation and crystallographic analysis. For the TPA single crystal, an anisotropic surface conduction was found, which was well explained by its molecular stack structure. The measured current in the long-axis direction is one order of magnitude greater than that of amorphous TPA.

  13. Highly Accurate Tree Models Derived from Terrestrial Laser Scan Data: A Method Description

    Directory of Open Access Journals (Sweden)

    Jan Hackenberg

    2014-05-01

    Full Text Available This paper presents a method for fitting cylinders into a point cloud, derived from a terrestrial laser-scanned tree. Utilizing high scan quality data as the input, the resulting models describe the branching structure of the tree, capable of detecting branches with a diameter smaller than a centimeter. The cylinders are stored as a hierarchical tree-like data structure encapsulating parent-child neighbor relations and incorporating the tree’s direction of growth. This structure enables the efficient extraction of tree components, such as the stem or a single branch. The method was validated both by applying a comparison of the resulting cylinder models with ground truth data and by an analysis between the input point clouds and the models. Tree models were accomplished representing more than 99% of the input point cloud, with an average distance from the cylinder model to the point cloud within sub-millimeter accuracy. After validation, the method was applied to build two allometric models based on 24 tree point clouds as an example of the application. Computation terminated successfully within less than 30 min. For the model predicting the total above ground volume, the coefficient of determination was 0.965, showing the high potential of terrestrial laser-scanning for forest inventories.

  14. A Quadrature Method of Moments for Polydisperse Flow in Bubble Columns Including Poly-Celerity, Breakup and Coalescence

    Directory of Open Access Journals (Sweden)

    Thomas Acher

    2014-12-01

    Full Text Available A simulation model for 3D polydisperse bubble column flows in an Eulerian/Eulerian framework is presented. A computationally efficient and numerically stable algorithm is created by making use of quadrature method of moments (QMOM functionalities, in conjunction with appropriate breakup and coalescence models. To account for size dependent bubble motion, the constituent moments of the bubble size distribution function are transported with individual velocities. Validation of the simulation results against experimental and numerical data of Hansen [1] show the capability of the present model to accurately predict complex gas-liquid flows.

  15. Principles of cobalt-60 teletherapy including an introduction to the compendium. Guidelines for the documentation of radiation treatment methods

    International Nuclear Information System (INIS)

    Cohen, M.

    1984-01-01

    A great deal of thought has been given in recent years to the documentation of individual patients and their diseases, especially since the computerization of registry sytems facilitates the storage and retrieval of large amounts of data, but the documentation of radiation treatment methods has received surprisingly little attention. The guidelines which follow are intended for use both internally (within radiotherapy centres) and externally when a treatment method is reported in the literature or transferred from one centre to another. The amount of detail reported externally will, of course, depend on the circumstances: for example, a published paper will usually mention only the most important of the radiation and physical parameters, but it is important for the department of origin to list all parameters in a separate document, available on request. These guidelines apply specifically to the documentation of treatment by external radiation beams, although many of the suggestions would also apply to treatment by small sealed sources (brachytherapy) and by unsealed radionuclides. Treatment techniques which involve a combination of external and internal sources (e.g. Ca. cervix uteri treatd by intracavitary sources plus external beam therapy) require particularly careful documentation to indicate the relationship bwtween dose distribution (in both space and time) achieved by the two modalities

  16. Method to Determine Appropriate Source Models of Large Earthquakes Including Tsunami Earthquakes for Tsunami Early Warning in Central America

    Science.gov (United States)

    Tanioka, Yuichiro; Miranda, Greyving Jose Arguello; Gusman, Aditya Riadi; Fujii, Yushiro

    2017-08-01

    Large earthquakes, such as the Mw 7.7 1992 Nicaragua earthquake, have occurred off the Pacific coasts of El Salvador and Nicaragua in Central America and have generated distractive tsunamis along these coasts. It is necessary to determine appropriate fault models before large tsunamis hit the coast. In this study, first, fault parameters were estimated from the W-phase inversion, and then an appropriate fault model was determined from the fault parameters and scaling relationships with a depth dependent rigidity. The method was tested for four large earthquakes, the 1992 Nicaragua tsunami earthquake (Mw7.7), the 2001 El Salvador earthquake (Mw7.7), the 2004 El Astillero earthquake (Mw7.0), and the 2012 El Salvador-Nicaragua earthquake (Mw7.3), which occurred off El Salvador and Nicaragua in Central America. The tsunami numerical simulations were carried out from the determined fault models. We found that the observed tsunami heights, run-up heights, and inundation areas were reasonably well explained by the computed ones. Therefore, our method for tsunami early warning purpose should work to estimate a fault model which reproduces tsunami heights near the coast of El Salvador and Nicaragua due to large earthquakes in the subduction zone.

  17. Innovative Methods for Estimating Densities and Detection Probabilities of Secretive Reptiles Including Invasive Constrictors and Rare Upland Snakes

    Science.gov (United States)

    2018-01-30

    home range  maintenance  or attraction to or avoidance of  landscape features, including  roads  (Morales et al. 2004, McClintock et al. 2012). For example...radiotelemetry and extensive road survey data are used to generate the first density estimates available for the species. The results show that southern...secretive snakes that combines behavioral observations of snake road crossing speed, systematic road survey data, and simulations of spatial

  18. An Efficient Method for Detection of Outliers in Tracer Curves Derived from Dynamic Contrast-Enhanced Imaging

    Directory of Open Access Journals (Sweden)

    Linning Ye

    2018-01-01

    Full Text Available Presence of outliers in tracer concentration-time curves derived from dynamic contrast-enhanced imaging can adversely affect the analysis of the tracer curves by model-fitting. A computationally efficient method for detecting outliers in tracer concentration-time curves is presented in this study. The proposed method is based on a piecewise linear model and implemented using a robust clustering algorithm. The method is noniterative and all the parameters are automatically estimated. To compare the proposed method with existing Gaussian model based and robust regression-based methods, simulation studies were performed by simulating tracer concentration-time curves using the generalized Tofts model and kinetic parameters derived from different tissue types. Results show that the proposed method and the robust regression-based method achieve better detection performance than the Gaussian model based method. Compared with the robust regression-based method, the proposed method can achieve similar detection performance with much faster computation speed.

  19. Staphylococcus aureus strains associated with food poisoning outbreaks in France: comparison of different molecular typing methods, including MLVA

    Science.gov (United States)

    Roussel, Sophie; Felix, Benjamin; Vingadassalon, Noémie; Grout, Joël; Hennekinne, Jacques-Antoine; Guillier, Laurent; Brisabois, Anne; Auvray, Fréderic

    2015-01-01

    Staphylococcal food poisoning outbreaks (SFPOs) are frequently reported in France. However, most of them remain unconfirmed, highlighting a need for a better characterization of isolated strains. Here we analyzed the genetic diversity of 112 Staphylococcus aureus strains isolated from 76 distinct SFPOs that occurred in France over the last 30 years. We used a recently developed multiple-locus variable-number tandem-repeat analysis (MLVA) protocol and compared this method with pulsed field gel electrophoresis (PFGE), spa-typing and carriage of genes (se genes) coding for 11 staphylococcal enterotoxins (i.e., SEA, SEB, SEC, SED, SEE, SEG, SEH, SEI, SEJ, SEP, SER). The strains known to have an epidemiological association with one another had identical MLVA types, PFGE profiles, spa-types or se gene carriage. MLVA, PFGE and spa-typing divided 103 epidemiologically unrelated strains into 84, 80, and 50 types respectively demonstrating the high genetic diversity of S. aureus strains involved in SFPOs. Each MLVA type shared by more than one strain corresponded to a single spa-type except for one MLVA type represented by four strains that showed two different-but closely related-spa-types. The 87 enterotoxigenic strains were distributed across 68 distinct MLVA types that correlated all with se gene carriage except for four MLVA types. The most frequent se gene detected was sea, followed by seg and sei and the most frequently associated se genes were sea-seh and sea-sed-sej-ser. The discriminatory ability of MLVA was similar to that of PFGE and higher than that of spa-typing. This MLVA protocol was found to be compatible with high throughput analysis, and was also faster and less labor-intensive than PFGE. MLVA holds promise as a suitable method for investigating SFPOs and tracking the source of contamination in food processing facilities in real time. PMID:26441849

  20. Intralesional immunotherapy with tuberculin purified protein derivative (PPD) in recalcitrant wart: A randomized, placebo-controlled, double-blind clinical trial including an extra group of candidates for cryotherapy.

    Science.gov (United States)

    Amirnia, Mehdi; Khodaeiani, Effat; Fouladi, Daniel F; Masoudnia, Sima

    2016-01-01

    Due to paucity of randomized clinical trials, intralesional immunotherapy has not been yet accepted as a standard therapeutic method. To examine the efficacy and safety of intralesional immunotherapy with tuberculin purified protein derivative (PPD) for treating recalcitrant wart. In this randomized, placebo-controlled, double-blind clinical trial, a total of 69 patients with recalcitrant warts received either intralesional PPD antigen (n = 35) or intralesional saline (n = 34) for six times at 2-week intervals. A third group of candidates for cryotherapy (n = 33) was also included. The decrease in lesion size (good: complete response, intermediate: 50-99% improvement, poor: PPD patients; 0%, 14.7% and 85.3% of the placebo patients and 18.2%, 33.3% and 48.5% of the cryotherapy patients, respectively (PPD versus placebo: p PPD versus cryotherapy: p PPD group. The recurrence rate was 8.6%, 5.9% and 24.2% in the PPD, placebo and cryotherapy groups, respectively (p > 0.05). Intralesional immunotherapy with PPD antigen is highly effective and safe for treating recalcitrant warts. IRCT201407089844N3 in the Iranian Registry of Clinical Trials (IRCT).

  1. Use of spectrophotometric readout method for free radical dosimetry in radiation processing including low energy electrons and bremsstrahlung

    International Nuclear Information System (INIS)

    Gupta, B.L.

    2000-01-01

    Our laboratory maintains standards for high doses in India. The glutamine powder dosimeter (spectrophotometric readout) is used for this purpose. Present studies show that 20 mg of unirradiated/irradiated glutamine dissolved in freshly prepared 10 ml of aerated aqueous acidic FX solution containing 2 x 10 -3 mol dm -3 ferrous ammonium sulphate and 10 -4 mol dm -3 xylenol orange in 0.033 mol dm -3 sulphuric acid is suitable for the dosimetry in the dose range of 0.1-100 kGy. Normally no corrections are required for the post-irradiation fading of the irradiated glutamine. The response of glutamine dosimeter is independent of irradiation temperature in the range of about 23-30 deg. C and at other temperatures, a correction is necessary. The dose intercomparison results for photon, electron and bremsstrahlung radiations show that glutamine can be used as a reference standard dosimeter. The use of flat polyethylene bags containing glutamine powder has proved very successful for electron dosimetry of wide energies. Several other amino acids like alanine, valine and threonine can also be used to cover wide range of doses using spectrophotometric readout method. (author)

  2. State Token Petri Net modeling method for formal verification of computerized procedure including operator's interruptions of procedure execution flow

    International Nuclear Information System (INIS)

    Kim, Yun Goo; Seong, Poong Hyun

    2012-01-01

    The Computerized Procedure System (CPS) is one of the primary operating support systems in the digital Main Control Room. The CPS displays procedure on the computer screen in the form of a flow chart, and displays plant operating information along with procedure instructions. It also supports operator decision making by providing a system decision. A procedure flow should be correct and reliable, as an error would lead to operator misjudgement and inadequate control. In this paper we present a modeling for the CPS that enables formal verification based on Petri nets. The proposed State Token Petri Nets (STPN) also support modeling of a procedure flow that has various interruptions by the operator, according to the plant condition. STPN modeling is compared with Coloured Petri net when they are applied to Emergency Operating Computerized Procedure. A converting program for Computerized Procedure (CP) to STPN has been also developed. The formal verification and validation methods of CP with STPN increase the safety of a nuclear power plant and provide digital quality assurance means that are needed when the role and function of the CPS is increasing.

  3. IBM parameters derived from realistic shell-model Hamiltonian via Hn-cooling method

    International Nuclear Information System (INIS)

    Nakada, Hitoshi

    1997-01-01

    There is a certain influence of non-collective degrees-of-freedom even in lowest-lying states of medium-heavy nuclei. This influence seems to be significant for some of the IBM parameters. In order to take it into account, several renormalization approaches have been applied. It has been shown in the previous studies that the influence of the G-pairs is important, but does not fully account for the fitted values. The influence of the non-collective components may be more serious when we take a realistic effective nucleonic interaction. To incorporate this influence into the IBM parameters, we employ the recently developed H n -cooling method. This method is applied to renormalize the wave functions of the states consisting of the SD-pairs, for the Cr-Fe nuclei. On this ground, the IBM Hamiltonian and transition operators are derived from corresponding realistic shell-model operators, for the Cr-Fe nuclei. Together with some features of the realistic interaction, the effects of the non-SD degrees-of-freedom are presented. (author)

  4. Multiscale approach including microfibril scale to assess elastic constants of cortical bone based on neural network computation and homogenization method.

    Science.gov (United States)

    Barkaoui, Abdelwahed; Chamekh, Abdessalem; Merzouki, Tarek; Hambli, Ridha; Mkaddem, Ali

    2014-03-01

    The complexity and heterogeneity of bone tissue require a multiscale modeling to understand its mechanical behavior and its remodeling mechanisms. In this paper, a novel multiscale hierarchical approach including microfibril scale based on hybrid neural network (NN) computation and homogenization equations was developed to link nanoscopic and macroscopic scales to estimate the elastic properties of human cortical bone. The multiscale model is divided into three main phases: (i) in step 0, the elastic constants of collagen-water and mineral-water composites are calculated by averaging the upper and lower Hill bounds; (ii) in step 1, the elastic properties of the collagen microfibril are computed using a trained NN simulation. Finite element calculation is performed at nanoscopic levels to provide a database to train an in-house NN program; and (iii) in steps 2-10 from fibril to continuum cortical bone tissue, homogenization equations are used to perform the computation at the higher scales. The NN outputs (elastic properties of the microfibril) are used as inputs for the homogenization computation to determine the properties of mineralized collagen fibril. The mechanical and geometrical properties of bone constituents (mineral, collagen, and cross-links) as well as the porosity were taken in consideration. This paper aims to predict analytically the effective elastic constants of cortical bone by modeling its elastic response at these different scales, ranging from the nanostructural to mesostructural levels. Our findings of the lowest scale's output were well integrated with the other higher levels and serve as inputs for the next higher scale modeling. Good agreement was obtained between our predicted results and literature data. Copyright © 2013 John Wiley & Sons, Ltd.

  5. Method and apparatus for enhanced sensitivity filmless medical x-ray imaging, including three-dimensional imaging

    Science.gov (United States)

    Parker, Sherwood

    1995-01-01

    A filmless X-ray imaging system includes at least one X-ray source, upper and lower collimators, and a solid-state detector array, and can provide three-dimensional imaging capability. The X-ray source plane is distance z.sub.1 above upper collimator plane, distance z.sub.2 above the lower collimator plane, and distance z.sub.3 above the plane of the detector array. The object to be X-rayed is located between the upper and lower collimator planes. The upper and lower collimators and the detector array are moved horizontally with scanning velocities v.sub.1, v.sub.2, v.sub.3 proportional to z.sub.1, z.sub.2 and z.sub.3, respectively. The pattern and size of openings in the collimators, and between detector positions is proportional such that similar triangles are always defined relative to the location of the X-ray source. X-rays that pass through openings in the upper collimator will always pass through corresponding and similar openings in the lower collimator, and thence to a corresponding detector in the underlying detector array. Substantially 100% of the X-rays irradiating the object (and neither absorbed nor scattered) pass through the lower collimator openings and are detected, which promotes enhanced sensitivity. A computer system coordinates repositioning of the collimators and detector array, and X-ray source locations. The computer system can store detector array output, and can associate a known X-ray source location with detector array output data, to provide three-dimensional imaging. Detector output may be viewed instantly, stored digitally, and/or transmitted electronically for image viewing at a remote site.

  6. A Method to Culture GABAergic Interneurons Derived from the Medial Ganglionic Eminence

    Directory of Open Access Journals (Sweden)

    Sira A. Franchi

    2018-01-01

    Full Text Available Understanding the mechanisms guiding interneuron development is a central aspect of the current research on cortical/hippocampal interneurons, which is highly relevant to brain function and pathology. In this methodological study we have addressed the setup of protocols for the reproducible culture of dissociated cells from murine medial ganglionic eminences (MGEs, to provide a culture system for the analysis of interneurons in vitro. This study includes the detailed protocols for the preparation of the dissociated cells, and for their culture on optimal substrates for cell migration or differentiation. These cultures enriched in interneurons may allow the investigation of the migratory behavior of interneuron precursors and their differentiation in vitro, up to the formation of morphologically identifiable GABAergic synapses. Live imaging of MGE–derived cells plated on proper substrates shows that they are useful to study the migratory behavior of the precursors, as well as the behavior of growth cones during the development of neurites. Most MGE-derived precursors develop into polarized GABAergic interneurons as determined by axonal, dendritic, and GABAergic markers. We present also a comparison of cells from WT and mutant mice as a proof of principle for the use of these cultures for the analysis of the migration and differentiation of GABAergic cells with different genetic backgrounds. The culture enriched in interneurons described here represents a useful experimental system to examine in a relatively easy and fast way the morpho-functional properties of these cells under physiological or pathological conditions, providing a powerful tool to complement the studies in vivo.

  7. Development of an object oriented nodal code using the refined AFEN derived from the method of component decomposition

    International Nuclear Information System (INIS)

    Noh, J. M.; Yoo, J. W.; Joo, H. K.

    2004-01-01

    In this study, we invented a method of component decomposition to derive the systematic inter-nodal coupled equations of the refined AFEN method and developed an object oriented nodal code to solve the derived coupled equations. The method of component decomposition decomposes the intra-nodal flux expansion of a nodal method into even and odd components in three dimensions to reduce the large coupled linear system equation into several small single equations. This method requires no additional technique to accelerate the iteration process to solve the inter-nodal coupled equations, since the derived equations can automatically act as the coarse mesh re-balance equations. By utilizing the object oriented programming concepts such as abstraction, encapsulation, inheritance and polymorphism, dynamic memory allocation, and operator overloading, we developed an object oriented nodal code that can facilitate the input/output and the dynamic control of the memories, and can make the maintenance easy. (authors)

  8. A complex linear least-squares method to derive relative and absolute orientations of seismic sensors

    OpenAIRE

    F. Grigoli; Simone Cesca; Torsten Dahm; L. Krieger

    2012-01-01

    Determining the relative orientation of the horizontal components of seismic sensors is a common problem that limits data analysis and interpretation for several acquisition setups, including linear arrays of geophones deployed in borehole installations or ocean bottom seismometers deployed at the seafloor. To solve this problem we propose a new inversion method based on a complex linear algebra approach. Relative orientation angles are retrieved by minimizing, in a least-squares sense, the l...

  9. Development and validation of a method for the determination of folic acid in different pharmaceutical formulations using derivative spectrophotometry

    Directory of Open Access Journals (Sweden)

    Marcos Vinícius de Moura Ribeiro

    Full Text Available ABSTRACT Folic acid is a B complex water-soluble vitamin that is essential to humans, and its deficiency can cause problems including congenital malformations in the fetus as well as heart disease. Most countries affected by diseases associated with a lack of folic acid now supplement foods with the vitamin. There is therefore a need for the development of new analytical procedures able to determine folic acid present in different matrices. This work describes the development of zero order and first order derivative spectrophotometric methods for the determination of folic acid in different pharmaceutical formulations, using 0.1 mol L-1 NaOH as solvent. The methods are shown to be simple, selective, and robust. Good linearity was achieved, with correction coefficients ≥0.9996 and limits of detection and quantification ranging from 0.64 to 0.75 and from 1.80 to 2.85 mg L-1, respectively. Recoveries of 98-104% were obtained in accuracy tests, and precision (as RSD was between 0.2 and 4.8%. The methods can be used in routine analyses for quality control purposes, offering an alternative to the procedures already reported in the literature.

  10. NetMHCIIpan-3.0, a common pan-specific MHC class II prediction method including all three human MHC class II isotypes, HLA-DR, HLA-DP and HLA-DQ

    DEFF Research Database (Denmark)

    Karosiene, Edita; Rasmussen, Michael; Blicher, Thomas

    2013-01-01

    Major histocompatibility complex class II (MHCII) molecules play an important role in cell-mediated immunity. They present specific peptides derived from endosomal proteins for recognition by T helper cells. The identification of peptides that bind to MHCII molecules is therefore of great importa......MHCIIpan-3.0 method is the first pan-specific predictor covering all HLA class II molecules with known sequences including HLA-DR, HLA-DP, and HLA-DQ. The NetMHCpan-3.0 method is available at http://www.cbs.dtu.dk/services/NetMHCIIpan-3.0....

  11. Synthesis and characterization of eggshell-derived hydroxyapatite via mechanochemical method: A comparative study

    Science.gov (United States)

    Hamidi, A. A.; Salimi, M. N.; Yusoff, A. H. M.

    2017-04-01

    The focus of bone graft properties has developed through generations, from the ability to withstand mechanical stress to the ability to integrate with the biological structure. In recent years, the use of hydroxyapatite (HA) as bone graft material in orthopedic and dental applications has been increasing. HA is a natural occuring mineral with excellent bioactivity but relatively poor mechanical properties. It constitutes 96% portion of enamel in teeth and 67% portion of bone. HA can be extracted from animal bones or fabricated from synthetic or biologic sources. In this study, eggshells were used as raw material to synthesize eggshell-derived HA (EHA) via mechanochemical method. The synthesis of EHA involved CaO, which was obtained from the calcination of eggshells, and reaction with dicalcium hydrogen phosphate dihydrous (DCPD) or phosphoric acid (H3PO4). The effects of rotational speed and heat treatment temperature on EHA's characteristics were investigated. The characterization studies were carried out by using the Fourier Transform Infrared Spectroscopy (FTIR), X-Ray Diffraction (XRD) analysis and Scanning Electron Microscopy (SEM). HA powder was successfully synthesized with crystallite and particle sizes in the range of 8-47 nm and 250-550 nm respectively. It was observed from this study that the increase of milling rotational speed had increased the phase purity of EHA samples. Furthermore, the higher heating temperature of HA samples resulted in higher degree of crystallinity of HA and the appearance of β-tricalcium phosphate (β-TCP) as secondary phase.

  12. In vitro methods of assessing ocular biocompatibility using THP-1-derived macrophages.

    Science.gov (United States)

    McCanna, David Joseph; Barthod-Malat, Aurore V; Gorbet, Maud B

    2015-01-01

    Macrophages play an important role in the elimination of infections, the removal of debris and in tissue repair after infection and trauma. In vitro models that assess ocular biomaterials for toxicity typically focus on the effects of these materials on epithelial or fibroblast cells. This investigation evaluated known ocular toxins deposited on model materials for their effects on the viability and activation of macrophages. THP-1-derived macrophages were cultured onto silicone films (used as a base biomaterial) deposited with chemical toxins (benzalkonium chloride (BAK), zinc diethyldithiocarbamate (ZDEC) and lipopolysaccharide (LPS)). Utilizing three fluorescent dyes calcein, ethidium homodimer-1 (EthD-1) and annexin V, the viability of macrophages attached to the biomaterial was determined using confocal microscopy. Propidium iodide (PI) staining and alamarBlue® (resazurin) reduction were used to assess cell death and metabolic activity. CD14, CD16, CD33, CD45, and CD54 expression of adherent macrophages, were also evaluated to detect LPS activation of macrophages using flow cytometry. The sensitivity of this test battery was demonstrated as significant toxicity from treated surfaces with ZDEC (0.001-0.01%), and BAK (0.001%-0.1%) was detected. Also, macrophage activation could be detected by measuring CD54 expression after exposure to adsorbed LPS. These in vitro methods will be helpful in determining the toxicity potential of new ocular biomaterials.

  13. A modified method of insulin producing cells' generation from bone marrow-derived mesenchymal stem cells.

    Science.gov (United States)

    Czubak, Paweł; Bojarska-Junak, Agnieszka; Tabarkiewicz, Jacek; Putowski, Lechosław

    2014-01-01

    Type 1 diabetes mellitus is a result of autoimmune destruction of pancreatic insulin producing β-cells and so far it can be cured only by insulin injection, by pancreas transplantation, or by pancreatic islet cells' transplantation. The methods are, however, imperfect and have a lot of disadvantages. Therefore new solutions are needed. The best one would be the use of differentiated mesenchymal stem cells (MSCs). In the present study, we investigated the potential of the bone marrow-derived MSCs line for in vitro differentiation into insulin producing cells (IPSs). We applied an 18-day protocol to differentiate MSCs. Differentiating cells formed cell clusters some of which resembled pancreatic islet-like cells. Using dithizone we confirmed the presence of insulin in the cells. What is more, the expression of proinsulin C-peptide in differentiated IPCs was analyzed by flow cytometry. For the first time, we investigated the influence of growth factors' concentration on IPCs differentiation efficiency. We have found that an increase in the concentration of growth factors up to 60 ng/mL of β-FGF/EGF and 30 ng/mL of activin A/β-cellulin increases the percentage of IPCs. Further increase of growth factors does not show any increase of the percentage of differentiated cells. Our findings suggest that the presented protocol can be adapted for differentiation of insulin producing cells from stem cells.

  14. ROS evaluation for a series of CNTs and their derivatives using an ESR method with DMPO

    International Nuclear Information System (INIS)

    Tsuruoka, S; Noguchi, T; Endo, M; Tristan, F; Terrones, M; Takeuchi, K; Koyama, K; Usui, Y; Matsumoto, H; Saito, N; Porter, D W; Castranova, V

    2013-01-01

    Carbon nanotubes (CNTs) are important materials in advanced industries. It is a concern that pulmonary exposure to CNTs may induce carcinogenic responses. It has been recently reported that CNTs scavenge ROS though non-carbon fibers generate ROS. A comprehensive evaluation of ROS scavenging using various kinds of CNTs has not been demonstrated well. The present work specifically investigates ROS scavenging capabilities with a series of CNTs and their derivatives that were physically treated, and with the number of commercially available CNTs. CNT concentrations were controlled at 0.2 through 0.6 wt%. The ROS scavenging rate was measured by ESR with DMPO. Interestingly, the ROS scavenging rate was not only influenced by physical treatments, but was also dependent on individual manufacturing methods. Ratio of CNTs to DMPO/ hydrogen peroxide is a key parameter to obtain appropriate ROS quenching results for comparison of CNTs. The present results suggest that dangling bonds are not a sole factor for scavenging, and electron transfer on the CNT surface is not clearly determined to be the sole mechanism to explain ROS scavenging.

  15. A simple finite element method for boundary value problems with a Riemann–Liouville derivative

    KAUST Repository

    Jin, Bangti; Lazarov, Raytcho; Lu, Xiliang; Zhou, Zhi

    2016-01-01

    © 2015 Elsevier B.V. All rights reserved. We consider a boundary value problem involving a Riemann-Liouville fractional derivative of order α∈(3/2,2) on the unit interval (0,1). The standard Galerkin finite element approximation converges slowly due to the presence of singularity term xα-1 in the solution representation. In this work, we develop a simple technique, by transforming it into a second-order two-point boundary value problem with nonlocal low order terms, whose solution can reconstruct directly the solution to the original problem. The stability of the variational formulation, and the optimal regularity pickup of the solution are analyzed. A novel Galerkin finite element method with piecewise linear or quadratic finite elements is developed, and L2(D) error estimates are provided. The approach is then applied to the corresponding fractional Sturm-Liouville problem, and error estimates of the eigenvalue approximations are given. Extensive numerical results fully confirm our theoretical study.

  16. ROS evaluation for a series of CNTs and their derivatives using an ESR method with DMPO.

    Science.gov (United States)

    Tsuruoka, S; Takeuchi, K; Koyama, K; Noguchi, T; Endo, M; Tristan, F; Terrones, M; Matsumoto, H; Saito, N; Usui, Y; Porter, D W; Castranova, V

    Carbon nanotubes (CNTs) are important materials in advanced industries. It is a concern that pulmonary exposure to CNTs may induce carcinogenic responses. It has been recently reported that CNTs scavenge ROS though non-carbon fibers generate ROS. A comprehensive evaluation of ROS scavenging using various kinds of CNTs has not been demonstrated well. The present work specifically investigates ROS scavenging capabilities with a series of CNTs and their derivatives that were physically treated, and with the number of commercially available CNTs. CNT concentrations were controlled at 0.2 through 0.6 wt%. The ROS scavenging rate was measured by ESR with DMPO. Interestingly, the ROS scavenging rate was not only influenced by physical treatments, but was also dependent on individual manufacturing methods. Ratio of CNTs to DMPO/ hydrogen peroxide is a key parameter to obtain appropriate ROS quenching results for comparison of CNTs. The present results suggest that dangling bonds are not a sole factor for scavenging, and electron transfer on the CNT surface is not clearly determined to be the sole mechanism to explain ROS scavenging.

  17. A simple finite element method for boundary value problems with a Riemann–Liouville derivative

    KAUST Repository

    Jin, Bangti

    2016-02-01

    © 2015 Elsevier B.V. All rights reserved. We consider a boundary value problem involving a Riemann-Liouville fractional derivative of order α∈(3/2,2) on the unit interval (0,1). The standard Galerkin finite element approximation converges slowly due to the presence of singularity term xα-1 in the solution representation. In this work, we develop a simple technique, by transforming it into a second-order two-point boundary value problem with nonlocal low order terms, whose solution can reconstruct directly the solution to the original problem. The stability of the variational formulation, and the optimal regularity pickup of the solution are analyzed. A novel Galerkin finite element method with piecewise linear or quadratic finite elements is developed, and L2(D) error estimates are provided. The approach is then applied to the corresponding fractional Sturm-Liouville problem, and error estimates of the eigenvalue approximations are given. Extensive numerical results fully confirm our theoretical study.

  18. Stakeholders' perception on including broader economic impact of vaccines in economic evaluations in low and middle income countries: a mixed methods study.

    Science.gov (United States)

    van der Putten, Ingeborg M; Evers, Silvia M A A; Deogaonkar, Rohan; Jit, Mark; Hutubessy, Raymond C W

    2015-04-10

    Current health economic evaluation guidelines mainly concentrate on immediate health gains and cost savings for the individual involved in the intervention. However, it has been argued that these guidelines are too narrow to capture the full impact of vaccination in low and middle income countries. The inclusion of broader economic impact of vaccines (BEIV) has therefore been proposed. Some examples of these are productivity-related gains, macro-economic impact, and different externalities. Despite their potency, the extent to which such benefits can and should be incorporated into economic evaluations of vaccination is still unclear. This mixed methods study aims to assess the relevance of BEIV to different stakeholders involved in the vaccine introduction decision making process. In this mixed method study an internet based survey was sent to attendees of the New and Underutilized Vaccines Initiative meeting in Montreux, Switzerland in 2011. Additionally, semi-structured interviews of 15 minutes each were conducted during the meeting. Study participants included decision makers, experts and funders of vaccines and immunization programs in low and middle income countries. Descriptive analysis of the survey, along with identification of common themes and factors extracted from the interviews and open survey questions was undertaken. Evidence on macro-economic impact, burden of disease and ecological effects were perceived as being most valuable towards aiding decision making for vaccine introduction by the 26 survey respondents. The 14 interviewees highlighted the importance of burden of disease and different types of indirect effects. Furthermore, some new interpretations of BEIVs were discussed, such as the potential negative impact of wastage during immunization programs and the idea of using vaccines as a platform for delivering other types of health interventions. Interviewees also highlighted the importance of using a broader perspective in connection to

  19. A novel broadband impedance method for detection of cell-derived microparticles.

    Science.gov (United States)

    Lvovich, Vadim; Srikanthan, Sowmya; Silverstein, Roy L

    2010-10-15

    A novel label-free method is presented to detect and quantify cell-derived microparticles (MPs) by the electrochemical potential-modulated electrochemical impedance spectroscopy (EIS). MPs are present in elevated concentrations during pathological conditions and play a major role in the establishment and pathogenesis of many diseases. Considering this, accurate detection and quantification of MPs is very important in clinical diagnostics and therapeutics. A combination of bulk solution electrokinetic sorting and interfacial impedance responses allows achieving detection limits as low as several MPs per μL. By fitting resulting EIS spectra with an equivalent electrical circuit, the bulk solution electrokinetic and interfacial impedance responses were characterized. In the bulk solution two major relaxations were prominent-β-relaxation in low MHz region due to the MP capacitive membrane bridging, and α-relaxation at ∼10 kHz due to counter ions diffusion. At low frequencies (10-0.1 Hz) at electrochemical potentials exceeding -100 mV, a facile interfacial Faradaic process of oxidation in MPs coupled with diffusion and non-Faradaic double layer charging dominate, probably due to oxidation of phospholipids and/or proteins on the MP surface and MP lysis. Buffer influence on the MP detection demonstrated that a relatively low conductivity Tyrode's buffer background solution is preferential for the MP electrokinetic separation and characterization. This study also demonstrated that standard laboratory methods such as flow cytometry underestimate MP concentrations, especially those with smaller average sizes, by as much as a factor of 2-40. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. Optimization of in vitro cell labeling methods for human umbilical cord-derived mesenchymal stem cells.

    Science.gov (United States)

    Tao, R; Sun, T-J; Han, Y-Q; Xu, G; Liu, J; Han, Y-F

    2014-01-01

    Human umbilical cord-derived mesenchymal stem cells (hUCMSCs) are a novel source of seed cells for cell therapy and tissue engineering. However, in vitro labeling methods for hUCMSCs need to be optimized for better detection of transplanted cells. To identify the most stable and efficient method for labeling hUCMSCs in vitro. hUCMSCs were isolated using a modified enzymatic digestion procedure and cultured. hUCMSCs of passage three (P3) were then labeled with BrdU, PKH26, or lentivirus-GFP and passaged further. Cells from the first labeled passage (LP1), the fourth labeled passage (LP4) and later passages were observed using a fluorescence microscope. The differentiation potential of LP4 cells was assessed by induction with adipogenic and osteogenic medium. Flow cytometry was used to measure the percentage of labeled cells and the percentage of apoptotic or dead cells. The labeling efficiencies of the three hUCMSC-labeling methods were compared in vitro. BrdU, PKH26, and lentivirus-GFP all labeled LP1 cells with high intensity and clarity. However, the BrdU labeling of the LP4 cells was vague and not localized to the cell nuclei; LP9 cells were not detected under a fluorescence microscope. There was also a significant decrease in the fluorescence intensity of PKH26-labeled LP4 cells, and LP11 cells were not detected under a fluorescence microscope. However, the fluorescence of LP4 cells labeled with lentivirus-GFP remained strong, and cells labeled with lentivirus-GFP were detected up to LP14 under a fluorescence microscope. Statistical analyses indicated that percentages of LP1 cells labeled with PKH26 and lentivirus-GFP were significantly higher than that of cells labeled with BrdU (p 0.05) was observed between the death rates of labeled and unlabeled cells. Lentivirus-GFP is a valid method for long-term in vitro labeling, and it may be used as a long-term hUCMSC tracker following transplantation in vivo.

  1. Deriving the ultrastructure of α-crustacyanin using lower-resolution structural and biophysical methods

    International Nuclear Information System (INIS)

    Rhys, Natasha H.; Wang, Ming-Chuan; Jowitt, Thomas A.; Helliwell, John R.; Grossmann, J. Günter; Baldock, Clair

    2011-01-01

    The structure of α-crustacyanin has been determined to 30 Å resolution using negative-stain electron microscopy (EM) single-particle averaging and modelling with the β-crustacyanin dimer from the crystal structure (Protein Data Bank code), guided by PISA protein subunit interface calculations, and compared with the protein arrangements observed in the crystal lattice. This α-crustacyanin EM model has been checked against SAXS experimental data, including comparison with rigid-body models calculated from the SAXS data, and finally with analytical ultracentrifugation measurements. The low-resolution structure of α-crustacyanin has been determined to 30 Å resolution using negative-stain electron microscopy (EM) with single-particle averaging. The protein, which is an assembly of eight β-crustacyanin dimers, appears asymmetrical and rather open in layout. A model was built to the EM map using the X-ray crystallographic structure of β-crustacyanin guided by PISA interface analyses. The model has a theoretical sedimentation coefficient that matches well with the experimentally derived value from sedimentation velocity analytical ultracentrifugation. Additionally, the EM model has similarities to models calculated independently by rigid-body modelling to small-angle X-ray scattering (SAXS) data and extracted in silico from the β-crustacyanin crystal lattice. Theoretical X-ray scattering from each of these models is in reasonable agreement with the experimental SAXS data and together suggest an overall design for the α-crustacyanin assembly

  2. An improved corrective smoothed particle method approximation for second‐order derivatives

    NARCIS (Netherlands)

    Korzilius, S.P.; Schilders, W.H.A.; Anthonissen, M.J.H.

    2013-01-01

    To solve (partial) differential equations it is necessary to have good numerical approximations. In SPH, most approximations suffer from the presence of boundaries. In this work a new approximation for the second-order derivative is derived and numerically compared with two other approximation

  3. A Thin Plate Spline-Based Feature-Preserving Method for Reducing Elevation Points Derived from LiDAR

    Directory of Open Access Journals (Sweden)

    Chuanfa Chen

    2015-09-01

    Full Text Available Light detection and ranging (LiDAR technique is currently one of the most important tools for collecting elevation points with a high density in the context of digital elevation model (DEM construction. However, the high density data always leads to serious time and memory consumption problems in data processing. In this paper, we have developed a thin plate spline (TPS-based feature-preserving (TPS-F method for LiDAR-derived ground data reduction by selecting a certain amount of significant terrain points and by extracting geomorphological features from the raw dataset to maintain the accuracy of constructed DEMs as high as possible, while maximally keeping terrain features. We employed four study sites with different topographies (i.e., flat, undulating, hilly and mountainous terrains to analyze the performance of TPS-F for LiDAR data reduction in the context of DEM construction. These results were compared with those of the TPS-based algorithm without features (TPS-W and two classical data selection methods including maximum z-tolerance (Max-Z and the random method. Results show that irrespective of terrain characteristic, the two versions of TPS-based approaches (i.e., TPS-F and TPS-W are always more accurate than the classical methods in terms of error range and root means square error. Moreover, in terms of streamline matching rate (SMR, TPS-F has a better ability of preserving geomorphological features, especially for the mountainous terrain. For example, the average SMR of TPS-F is 89.2% in the mountainous area, while those of TPS-W, max-Z and the random method are 56.6%, 34.7% and 35.3%, respectively.

  4. Macroalgae-Derived Biofuel: A Review of Methods of Energy Extraction from Seaweed Biomass

    Directory of Open Access Journals (Sweden)

    John J. Milledge

    2014-11-01

    Full Text Available The potential of algal biomass as a source of liquid and gaseous biofuels is a highly topical theme, but as yet there is no successful economically viable commercial system producing biofuel. However, the majority of the research has focused on producing fuels from microalgae rather than from macroalgae. This article briefly reviews the methods by which useful energy may be extracted from macroalgae biomass including: direct combustion, pyrolysis, gasification, trans-esterification to biodiesel, hydrothermal liquefaction, fermentation to bioethanol, fermentation to biobutanol and anaerobic digestion, and explores technical and engineering difficulties that remain to be resolved.

  5. Some observations concerning blade-element-momentum (BEM) methods and vortex wake methods, including numerical experiments with a simple vortex model

    Energy Technology Data Exchange (ETDEWEB)

    Snel, H. [Netherlands Energy Research Foundation ECN, Renewable Energy, Wind Energy (Netherlands)

    1997-08-01

    Recently the Blade Element Momentum (BEM) method has been made more versatile. Inclusion of rotational effects on time averaged profile coefficients have improved its achievements for performance calculations in stalled flow. Time dependence as a result of turbulent inflow, pitching actions and yawed operation is now treated more correctly (although more improvement is needed) than before. It is of interest to note that adaptations in modelling of unsteady or periodic induction stem from qualitative and quantitative insights obtained from free vortex models. Free vortex methods and further into the future Navier Stokes (NS) calculations, together with wind tunnel and field experiments, can be very useful in enhancing the potential of BEM for aero-elastic response calculations. It must be kept in mind however that extreme caution must be used with free vortex methods, as will be discussed in the following chapters. A discussion of the shortcomings and the strength of BEM and of vortex wake models is given. Some ideas are presented on how BEM might be improved without too much loss of efficiency. (EG)

  6. Derivation and experimental demonstration of the perturbed reactivity method for the determination of subcriticality

    International Nuclear Information System (INIS)

    Kwok, K.S.; Bernard, J.A.; Lanning, D.D.

    1992-01-01

    The perturbed reactivity method is a general technique for the estimation of reactivity. It is particularly suited to the determination of a reactor's initial degree of subcriticality and was developed to facilitate the automated startup of both spacecraft and multi-modular reactors using model-based control laws. It entails perturbing a shutdown reactor by the insertion of reactivity at a known rate and then estimating the initial degree of subcriticality from observation of the resulting reactor period. While similar to inverse kinetics, the perturbed reactivity method differs in that the net reactivity present in the core is treated as two separate entities. The first is that associated with the known perturbation. This quantity, together with the observed period and the reactor's describing parameters, are the inputs to the method's implementing algorithm. The second entity, which is the algorithm;s output, is the sum of all other reactivities including those resulting from inherent feedback and the initial degree of subcriticality. During an automated startup, feedback effects will be minimal. Hence, when applied to a shutdown reactor, the output of the perturbed reactivity method will be a constant that is equal to the initial degree of subcriticality. This is a major advantage because repeated estimates can be made of this one quantity and signal smoothing techniques can be applied to enhance accuracy. In addition to describing the theoretical basis for the perturbed reactivity method, factors involved in its implementation such as the movement of control devices other than those used to create the perturbation, source estimation, and techniques for data smoothing are presented

  7. 4SM: A Novel Self-Calibrated Algebraic Ratio Method for Satellite-Derived Bathymetry and Water Column Correction.

    Science.gov (United States)

    Morel, Yann G; Favoretto, Fabio

    2017-07-21

    All empirical water column correction methods have consistently been reported to require existing depth sounding data for the purpose of calibrating a simple depth retrieval model; they yield poor results over very bright or very dark bottoms. In contrast, we set out to (i) use only the relative radiance data in the image along with published data, and several new assumptions; (ii) in order to specify and operate the simplified radiative transfer equation (RTE); (iii) for the purpose of retrieving both the satellite derived bathymetry (SDB) and the water column corrected spectral reflectance over shallow seabeds. Sea truth regressions show that SDB depths retrieved by the method only need tide correction. Therefore it shall be demonstrated that, under such new assumptions, there is no need for (i) formal atmospheric correction; (ii) conversion of relative radiance into calibrated reflectance; or (iii) existing depth sounding data, to specify the simplified RTE and produce both SDB and spectral water column corrected radiance ready for bottom typing. Moreover, the use of the panchromatic band for that purpose is introduced. Altogether, we named this process the Self-Calibrated Supervised Spectral Shallow-sea Modeler (4SM). This approach requires a trained practitioner, though, to produce its results within hours of downloading the raw image. The ideal raw image should be a "near-nadir" view, exhibit homogeneous atmosphere and water column, include some coverage of optically deep waters and bare land, and lend itself to quality removal of haze, atmospheric adjacency effect, and sun/sky glint.

  8. Navier-Stokes Predictions of Dynamic Stability Derivatives: Evaluation of Steady-State Methods

    National Research Council Canada - National Science Library

    DeSpirito, James; Silton, Sidra I; Weinacht, Paul

    2008-01-01

    The prediction of the dynamic stability derivatives-roll-damping, Magnus, and pitch-damping moments-were evaluated for three spin-stabilized projectiles using steady-state computational fluid dynamic (CFD) calculations...

  9. Efficient synthesis of sulfonamide derivatives on solid supports catalyzed using solvent-free and microwave-assisted methods

    Energy Technology Data Exchange (ETDEWEB)

    Camargo-Ordonez, Argelia; Moreno-Reyes, Christian; Olazaran-Santibanez, Fabian; Martinez-Hernandez, Sheila; Bocanegra-Garcia, Virgilio; Rivera, Gildardo [Universidad Autonoma de Tamaulipas, Reynosa (Mexico). Dep. de Farmacia y Quimica Medicinal

    2011-07-01

    In this work we report the synthesis of sulfonamide derivatives using a conventional procedure and with solid supports, such as silica gel, florisil, alumina, 4A molecular sieves, montmorillonite KSF, and montmorillonite K10 using solvent-free and microwave-assisted methods. Our results show that solid supports have a catalytic activity in the formation of sulfonamide derivatives. We found that florisil, montmorillonite KSF, and K10 could be used as inexpensive alternative catalysts that are easily separated from the reaction media. Additionally, solvent-free and microwave-assisted methods were more efficient in reducing reaction time and in increasing yield. (author)

  10. Efficient synthesis of sulfonamide derivatives on solid supports catalyzed using solvent-free and microwave-assisted methods

    International Nuclear Information System (INIS)

    Camargo-Ordonez, Argelia; Moreno-Reyes, Christian; Olazaran-Santibanez, Fabian; Martinez-Hernandez, Sheila; Bocanegra-Garcia, Virgilio; Rivera, Gildardo

    2011-01-01

    In this work we report the synthesis of sulfonamide derivatives using a conventional procedure and with solid supports, such as silica gel, florisil, alumina, 4A molecular sieves, montmorillonite KSF, and montmorillonite K10 using solvent-free and microwave-assisted methods. Our results show that solid supports have a catalytic activity in the formation of sulfonamide derivatives. We found that florisil, montmorillonite KSF, and K10 could be used as inexpensive alternative catalysts that are easily separated from the reaction media. Additionally, solvent-free and microwave-assisted methods were more efficient in reducing reaction time and in increasing yield. (author)

  11. Kriging and local polynomial methods for blending satellite-derived and gauge precipitation estimates to support hydrologic early warning systems

    Science.gov (United States)

    Verdin, Andrew; Funk, Christopher C.; Rajagopalan, Balaji; Kleiber, William

    2016-01-01

    Robust estimates of precipitation in space and time are important for efficient natural resource management and for mitigating natural hazards. This is particularly true in regions with developing infrastructure and regions that are frequently exposed to extreme events. Gauge observations of rainfall are sparse but capture the precipitation process with high fidelity. Due to its high resolution and complete spatial coverage, satellite-derived rainfall data are an attractive alternative in data-sparse regions and are often used to support hydrometeorological early warning systems. Satellite-derived precipitation data, however, tend to underrepresent extreme precipitation events. Thus, it is often desirable to blend spatially extensive satellite-derived rainfall estimates with high-fidelity rain gauge observations to obtain more accurate precipitation estimates. In this research, we use two different methods, namely, ordinary kriging and κ-nearest neighbor local polynomials, to blend rain gauge observations with the Climate Hazards Group Infrared Precipitation satellite-derived precipitation estimates in data-sparse Central America and Colombia. The utility of these methods in producing blended precipitation estimates at pentadal (five-day) and monthly time scales is demonstrated. We find that these blending methods significantly improve the satellite-derived estimates and are competitive in their ability to capture extreme precipitation.

  12. Human-Derived Disturbance Estimation and Compensation (DEC) Method Lends Itself to a Modular Sensorimotor Control in a Humanoid Robot.

    Science.gov (United States)

    Lippi, Vittorio; Mergner, Thomas

    2017-01-01

    The high complexity of the human posture and movement control system represents challenges for diagnosis, therapy, and rehabilitation of neurological patients. We envisage that engineering-inspired, model-based approaches will help to deal with the high complexity of the human posture control system. Since the methods of system identification and parameter estimation are limited to systems with only a few DoF, our laboratory proposes a heuristic approach that step-by-step increases complexity when creating a hypothetical human-derived control systems in humanoid robots. This system is then compared with the human control in the same test bed, a posture control laboratory. The human-derived control builds upon the identified disturbance estimation and compensation (DEC) mechanism, whose main principle is to support execution of commanded poses or movements by compensating for external or self-produced disturbances such as gravity effects. In previous robotic implementation, up to 3 interconnected DEC control modules were used in modular control architectures separately for the sagittal plane or the frontal body plane and successfully passed balancing and movement tests. In this study we hypothesized that conflict-free movement coordination between the robot's sagittal and frontal body planes emerges simply from the physical embodiment, not necessarily requiring a full body control. Experiments were performed in the 14 DoF robot Lucy Posturob (i) demonstrating that the mechanical coupling from the robot's body suffices to coordinate the controls in the two planes when the robot produces movements and balancing responses in the intermediate plane, (ii) providing quantitative characterization of the interaction dynamics between body planes including frequency response functions (FRFs), as they are used in human postural control analysis, and (iii) witnessing postural and control stability when all DoFs are challenged together with the emergence of inter

  13. A New Method to Find Fuzzy Nth Order Derivation and Applications to Fuzzy Nth Order Arithmetic Based on Generalized H-Derivation

    Directory of Open Access Journals (Sweden)

    Laleh Hooshangian

    2014-07-01

    Full Text Available In this paper, fuzzy nth-order derivative for n in N is introduced. To do this, nth-order derivation under generalized Hukuhara derivative here in discussed. Calculations on the fuzzy nth-order derivative on fuzzy functions and their relationships, in general, are introduced. Then, the fuzzy nth-order differential equations is solved, for n in N.

  14. QSAR Study of Insecticides of Phthalamide Derivatives Using Multiple Linear Regression and Artificial Neural Network Methods

    Directory of Open Access Journals (Sweden)

    Adi Syahputra

    2014-03-01

    Full Text Available Quantitative structure activity relationship (QSAR for 21 insecticides of phthalamides containing hydrazone (PCH was studied using multiple linear regression (MLR, principle component regression (PCR and artificial neural network (ANN. Five descriptors were included in the model for MLR and ANN analysis, and five latent variables obtained from principle component analysis (PCA were used in PCR analysis. Calculation of descriptors was performed using semi-empirical PM6 method. ANN analysis was found to be superior statistical technique compared to the other methods and gave a good correlation between descriptors and activity (r2 = 0.84. Based on the obtained model, we have successfully designed some new insecticides with higher predicted activity than those of previously synthesized compounds, e.g.2-(decalinecarbamoyl-5-chloro-N’-((5-methylthiophen-2-ylmethylene benzohydrazide, 2-(decalinecarbamoyl-5-chloro-N’-((thiophen-2-yl-methylene benzohydrazide and 2-(decaline carbamoyl-N’-(4-fluorobenzylidene-5-chlorobenzohydrazide with predicted log LC50 of 1.640, 1.672, and 1.769 respectively.

  15. A fast and simple method for quantitative determination of fat-derived medium and low-volatile compounds in cheese

    NARCIS (Netherlands)

    Alewijn, M.; Sliwinski, E.L.; Wouters, J.T.M.

    2003-01-01

    Cheese flavour is a mixture of many (volatile) compounds, mostly formed during ripening. The current method was developed to qualify and quantify fat-derived compounds in cheese. Cheese samples were extracted with acetonitrile, which led to a concentrated solution of potential favour compounds,

  16. LIGNIN, STRUCTURE AND APPLICATIONS: DEPOLYMERIZATION METHODS FOR OBTAINING AROMATIC DERIVATIVES OF INDUSTRIAL INTEREST

    Directory of Open Access Journals (Sweden)

    Marvin Chávez-Sifontes

    2013-12-01

    Full Text Available In this article significant data related to the structural characteristics of lignin, the extraction and isolation processes from biomass, and also the characteristics of different types of commercial lignins are presented. The review focuses on the different depolymerization processes (hydrolysis, hydrogenolysis, hydrodeoxygenation, pyrolysis, among others up to now developed and investigated analyzing the different aromatic derivatives obtained in each case, as well as the interesting reactions some of them may undergo. Application possibilities for lignin and its derivatives in new industrial processes integrated into the bio-refinery of the future are finally assessed

  17. Double isotope method for the determination of catecholamines, serotonin, and other amines in the picomole range as their dansyl derivatives

    International Nuclear Information System (INIS)

    Recasens, M.; Zwiller, J.; Mack, G.; Zanetta, J.P.; Mandel, P.

    1977-01-01

    A method based on thin-layer chromatographic separation of radioactive products is described for the determination and the quantification of dopamine (DA), noradrenaline (NA), adrenaline (A), normetanephrine (NMN), and serotonin (5HT) in small samples of brain tissue. In this method the amines are converted to [ 14 C]dansyl derivatives by reaction with [ 14 C]dansyl chloride [ 14 C]Dans-Cl) and 3 H-labeled amines are used as internal standards to determine variations in yield

  18. Variance analysis of the Monte Carlo perturbation source method in inhomogeneous linear particle transport problems. Derivation of formulae

    International Nuclear Information System (INIS)

    Noack, K.

    1981-01-01

    The perturbation source method is used in the Monte Carlo method in calculating small effects in a particle field. It offers primising possibilities for introducing positive correlation between subtracting estimates even in the cases where other methods fail, in the case of geometrical variations of a given arrangement. The perturbation source method is formulated on the basis of integral equations for the particle fields. The formulae for the second moment of the difference of events are derived. Explicity a certain class of transport games and different procedures for generating the so-called perturbation particles are considered [ru

  19. Quantitative bioanalytical and analytical method development of dibenzazepine derivative, carbamazepine: A review ☆

    OpenAIRE

    Datar, Prasanna A.

    2015-01-01

    Bioanalytical methods are widely used for quantitative estimation of drugs and their metabolites in physiological matrices. These methods could be applied to studies in areas of human clinical pharmacology and toxicology. The major bioanalytical services are method development, method validation and sample analysis (method application). Various methods such as GC, LC–MS/MS, HPLC, HPTLC, micellar electrokinetic chromatography, and UFLC have been used in laboratories for the qualitative and qua...

  20. New improved method for evaluation of growth by food related fungi on biologically derived materials

    DEFF Research Database (Denmark)

    Bergenholtz, Karina P.; Nielsen, Per Væggemose

    2002-01-01

    Biologically derived materials, obtained as commercial and raw materials (Polylactate (PLA), Polyhydroxybutyrate (PHB), potato, wheat and corn starch) were tested for their ability to support fungal growth using a modified ASTM G21-96 (American Society for Testing and Materials) standard as well...

  1. Method of cleansing and refining of liquid hydrocarbons and derivatives of hydrocarbons

    Energy Technology Data Exchange (ETDEWEB)

    Hahn, C A; Nielsen, H

    1934-10-11

    A process is described for cleaning and refining liquid hydrocarbons and derivatives by utilization of acids, followed by washing partly with a basic solution, partly with clean water. The process is characterized by using, in connection with the acid solutions mentioned, a strong solution of a mixture of sulfuric acid and phosphoric acid.

  2. Using Einstein's method to derive both the Planck and Fermi--Dirac distributions

    International Nuclear Information System (INIS)

    Crawford, F.S.

    1988-01-01

    Many quantum mechanics textbooks give the remarkable argument of Einstein wherein he introduces his famous ''A and B coefficients'' and uses detailed balancing to derive the Planck distribution for thermal photons. But it seems to be not widely known that the same approach can yield the Fermi--Dirac distribution for thermal electrons

  3. A Mixed Methods Analysis of Students' Understanding of Slope and Derivative Concepts and Students' Mathematical Dispositions

    Science.gov (United States)

    Patel, Rita Manubhai

    2013-01-01

    This dissertation examined understanding of slope and derivative concepts and mathematical dispositions of first-semester college calculus students, who are recent high school graduates, transitioning to university mathematics. The present investigation extends existing research in the following ways. First, based on this investigation, the…

  4. Two-step method for curing Escherichia coli of ColE1-derived plasmids

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    2008-01-01

    To cure Escherichia coli for plasmids derived from the ColE1 replicon advantage is taken of the fact that maintenance of this replicon requires a wild-type allele of polA, encoding DNA polymerase I. Curing is achieved by cotransduction of a mutant polA allele with metE::Tn10, fadAB::Tn10 or other...

  5. Newer methods for the characterization of higher molecular mass coal derivatives

    International Nuclear Information System (INIS)

    Bartle, K.D.

    1983-01-01

    Recent developments in a number of areas in the analytical chemistry of higher molecular mass coal derivatives are critically reviewed, viz. supercritical fluid chromatography, size-exclusion chromatography, charge-transfer fractionation, nmr spectroscopy, mass spectrometry and electrochemical analysis. (orig.) [de

  6. Analysis of Cell-Derived Microparticles with Highly Precise Nanotechnological Methods

    DEFF Research Database (Denmark)

    Cherré, Solène; Østergaard, Ole; Heegaard, Niels H.H.

    2014-01-01

    Cell-derived microparticles have gained a broad interest in the past years. Being released by blood cells upon activation or induction of apoptosis, they have a great potential as novel diagnostic markers and their investigation can bring new knowledge into the pathogenesis of various diseases. H...

  7. Association of Empirically Derived Dietary Patterns with Cardiovascular Risk Factors: A Comparison of PCA and RRR Methods.

    Directory of Open Access Journals (Sweden)

    Nicolas Sauvageot

    Full Text Available Principal component analysis is used to determine dietary behaviors of a population whereas reduced rank regression is used to construct disease-related dietary patterns. This study aimed to compare both types of DP and theirs associations with cardiovascular risk factors (CVRF.Data were derived from the cross sectional NESCAV (Nutrition, Environment and Cardiovascular Health study, aiming to describe the cardiovascular health of the Greater region's population (Grand duchy of Luxembourg, Wallonia (Belgium, Lorraine (France. 2298 individuals were included for this study and dietary intake was assessed using a 134-item food frequency questionnaire.We found that CVRF-related patterns also reflect eating behaviours of the population. Comparing concordant food groups between both dietary pattern methods, a diet high in fruits, oleaginous and dried fruits, vegetables, olive oil, fats rich in omega 6 and tea and low in fried foods, lean and fatty meat, processed meat, ready meal, soft drink and beer was associated with lower prevalence of CVRF. In the opposite, a pattern characterized by high intakes of fried foods, meat, offal, beer, wine and aperitifs and spirits, and low intakes of cereals, sugar and sweets and soft drinks was associated with higher prevalence of CVRF.In sum, we found that a "Prudent" and "Animal protein and alcohol" patterns were both associated with CVRF and behaviourally meaningful. Moreover, the relationships of those dietary patterns with lifestyle characteristics support the theory that food choices are part of a larger pattern of healthy lifestyle.

  8. Evaluation on ultrasonic examination methods applied to Ni-base alloy weld including cracks due to stress corrosion cracking found in BWR reactor internal

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Kobayashi, Hiroyuki; Higuchi, Shinichi; Shimizu, Sadato

    2005-01-01

    A Ni-base alloy weld, including cracks due to stress corrosion cracking found in the reactor internal of the oldest BWR in Japan, Tsuruga unit 1, in 1999, was examined by three (3) types of UT method. After this examination, a depth of each crack was confirmed by carrying out a little excavation with a grinder and PT examination by turns until each crack disappeared. Then, the depth measured by the former method was compared with the one measured by the latter method. In this fashion, performances of the UT methods were verified. As a result, a combination of the three types of UT method was found to meet the acceptance criteria given by ASME Sec.XI Appendix VIII, Performance Demonstration for Ultrasonic Examination Systems-Supplement 6. In this paper, the results of the UT examination described above and their evaluation are discussed. (author)

  9. Hierarchical porous carbon derived from Allium cepa for supercapacitors through direct carbonization method with the assist of calcium acetate

    KAUST Repository

    Xu, Jinhui; Zhang, Wenli; Hou, Dianxun; Huang, Weimin; Lin, Haibo

    2017-01-01

    In this paper, a direction carbonization method was used to prepare porous carbon from Allium cepa for supercapacitor applications. In this method, calcium acetate was used to assist carbonization process. Scanning electron microscope (SEM) and N2 adsorption/desorption method were used to characterize the morphology, Brunauer-Emmett-Teller (BET) specific surface area and pore size distribution of porous carbon derived from Allium cepa (onion derived porous carbon, OPC). OPC is of hierarchical porous structure with high specific surface area and relatively high specific capacitance. OPC possesses relatively high specific surface area of 533.5 m2/g. What’s more, OPC possesses a specific capacitance of 133.5 F/g at scan rate of 5 mV/s.

  10. Hierarchical porous carbon derived from Allium cepa for supercapacitors through direct carbonization method with the assist of calcium acetate

    KAUST Repository

    Xu, Jinhui

    2017-11-02

    In this paper, a direction carbonization method was used to prepare porous carbon from Allium cepa for supercapacitor applications. In this method, calcium acetate was used to assist carbonization process. Scanning electron microscope (SEM) and N2 adsorption/desorption method were used to characterize the morphology, Brunauer-Emmett-Teller (BET) specific surface area and pore size distribution of porous carbon derived from Allium cepa (onion derived porous carbon, OPC). OPC is of hierarchical porous structure with high specific surface area and relatively high specific capacitance. OPC possesses relatively high specific surface area of 533.5 m2/g. What’s more, OPC possesses a specific capacitance of 133.5 F/g at scan rate of 5 mV/s.

  11. Rapid Automatic Lighting Control of a Mixed Light Source for Image Acquisition using Derivative Optimum Search Methods

    Directory of Open Access Journals (Sweden)

    Kim HyungTae

    2015-01-01

    Full Text Available Automatic lighting (auto-lighting is a function that maximizes the image quality of a vision inspection system by adjusting the light intensity and color.In most inspection systems, a single color light source is used, and an equal step search is employed to determine the maximum image quality. However, when a mixed light source is used, the number of iterations becomes large, and therefore, a rapid search method must be applied to reduce their number. Derivative optimum search methods follow the tangential direction of a function and are usually faster than other methods. In this study, multi-dimensional forms of derivative optimum search methods are applied to obtain the maximum image quality considering a mixed-light source. The auto-lighting algorithms were derived from the steepest descent and conjugate gradient methods, which have N-size inputs of driving voltage and one output of image quality. Experiments in which the proposed algorithm was applied to semiconductor patterns showed that a reduced number of iterations is required to determine the locally maximized image quality.

  12. 4SM: A Novel Self-Calibrated Algebraic Ratio Method for Satellite-Derived Bathymetry and Water Column Correction

    Directory of Open Access Journals (Sweden)

    Yann G. Morel

    2017-07-01

    Full Text Available All empirical water column correction methods have consistently been reported to require existing depth sounding data for the purpose of calibrating a simple depth retrieval model; they yield poor results over very bright or very dark bottoms. In contrast, we set out to (i use only the relative radiance data in the image along with published data, and several new assumptions; (ii in order to specify and operate the simplified radiative transfer equation (RTE; (iii for the purpose of retrieving both the satellite derived bathymetry (SDB and the water column corrected spectral reflectance over shallow seabeds. Sea truth regressions show that SDB depths retrieved by the method only need tide correction. Therefore it shall be demonstrated that, under such new assumptions, there is no need for (i formal atmospheric correction; (ii conversion of relative radiance into calibrated reflectance; or (iii existing depth sounding data, to specify the simplified RTE and produce both SDB and spectral water column corrected radiance ready for bottom typing. Moreover, the use of the panchromatic band for that purpose is introduced. Altogether, we named this process the Self-Calibrated Supervised Spectral Shallow-sea Modeler (4SM. This approach requires a trained practitioner, though, to produce its results within hours of downloading the raw image. The ideal raw image should be a “near-nadir” view, exhibit homogeneous atmosphere and water column, include some coverage of optically deep waters and bare land, and lend itself to quality removal of haze, atmospheric adjacency effect, and sun/sky glint.

  13. Selected nutrient contents, fatty acid composition, including conjugated linoleic acid, and retention values in separable lean from lamb rib loins as affected by external fat and cooking method.

    Science.gov (United States)

    Badiani, Anna; Montellato, Lara; Bochicchio, Davide; Anfossi, Paola; Zanardi, Emanuela; Maranesi, Magda

    2004-08-11

    Proximate composition and fatty acid profile, conjugated linoleic acid (CLA) isomers included, were determined in separable lean of raw and cooked lamb rib loins. The cooking methods compared, which were also investigated for cooking yields and true nutrient retention values, were dry heating of fat-on cuts and moist heating of fat-off cuts; the latter method was tested as a sort of dietetic approach against the more traditional former type. With significantly (P cooking losses, dry heating of fat-on rib-loins produced slightly (although only rarely significantly) higher retention values for all of the nutrients considered, including CLA isomers. On the basis of the retention values obtained, both techniques led to a minimum migration of lipids into the separable lean, which was higher (P cooking of the class of CLA isomers (including that of the nutritionally most important isomer cis-9,trans-11) was more similar to that of the monounsaturated than the polyunsaturated fatty acids.

  14. Variational method for the derivative nonlinear Schroedinger equation with computational applications

    Energy Technology Data Exchange (ETDEWEB)

    Helal, M A [Mathematics Department, Faculty of Science, Cairo University (Egypt); Seadawy, A R [Mathematics Department, Faculty of Science, Beni-Suef University (Egypt)], E-mail: mahelal@yahoo.com, E-mail: aly742001@yahoo.com

    2009-09-15

    The derivative nonlinear Schroedinger equation (DNLSE) arises as a physical model for ultra-short pulse propagation. In this paper, the existence of a Lagrangian and the invariant variational principle (i.e. in the sense of the inverse problem of calculus of variations through deriving the functional integral corresponding to a given coupled nonlinear partial differential equations) for two-coupled equations describing the nonlinear evolution of the Alfven wave with magnetosonic waves at a much larger scale are given and the functional integral corresponding to those equations is derived. We found the solutions of DNLSE by choice of a trial function in a region of a rectangular box in two cases, and using this trial function, we find the functional integral and the Lagrangian of the system without loss. Solution of the general case for the two-box potential can be obtained on the basis of a different ansatz where we approximate the Jost function using polynomials of order n instead of the piecewise linear function. An example for the third order is given for illustrating the general case.

  15. Analytical methods for the determination of mixtures of bisphenols and derivatives in human and environmental exposure sources and biological fluids. A review

    International Nuclear Information System (INIS)

    Caballero-Casero, N.; Lunar, L.; Rubio, S.

    2016-01-01

    Bisphenol A (BPA) is ubiquitous in humans and the environment. Its potential adverse effects through genomic and non-genomic pathways have fostered BPA replacement by bisphenol analogs that, unfortunately, exert similar adverse effects. Many of these analogs, as well as their derivatives, have already found in humans and the environment and major concerns have arisen over their low dose- and mixture-related effects. This review aims to discuss the characteristics of the main analytical methods reported so far for the determination of mixtures of bisphenol analogs and/or derivatives in human and environmental exposure sources and biological fluids. Approaches followed for removal of background contamination, sample preparation and separation and detection of mixtures of bisphenols and derivatives are critically discussed. Sample treatment is matrix-dependent and common steps include analyte isolation, removal of interferences, evaporation of the extracts and solvent reconstitution. Separation and quantification has been almost exclusively carried out by liquid chromatography tandem mass spectrometry (LC-MS/MS) or gas chromatography mass spectrometry (GC–MS), in the last case prior derivatization, but LC-fluorescence detection has also found some applications. Main characteristics, advantages and drawbacks of these methods will be comparatively discussed. Although at an early stage, some approaches for the assessment of the risk to mixtures of bisphenols, mainly based on the combination of chemical target analysis and toxicity evaluation, have been already applied and they will be here presented. Current knowledge gaps hindering a reliable assessment of human and environmental risk to mixtures of bisphenols and derivatives will be outlined. - Highlights: • Analytical methods for the (bio)monitoring of mixtures of bisphenols are reviewed. • LC and CG coupled to MS are the preferred techniques. • Method-dependent sample treatments are required to remove matrix

  16. Analytical methods for the determination of mixtures of bisphenols and derivatives in human and environmental exposure sources and biological fluids. A review

    Energy Technology Data Exchange (ETDEWEB)

    Caballero-Casero, N.; Lunar, L.; Rubio, S., E-mail: qa1rubrs@uco.es

    2016-02-18

    Bisphenol A (BPA) is ubiquitous in humans and the environment. Its potential adverse effects through genomic and non-genomic pathways have fostered BPA replacement by bisphenol analogs that, unfortunately, exert similar adverse effects. Many of these analogs, as well as their derivatives, have already found in humans and the environment and major concerns have arisen over their low dose- and mixture-related effects. This review aims to discuss the characteristics of the main analytical methods reported so far for the determination of mixtures of bisphenol analogs and/or derivatives in human and environmental exposure sources and biological fluids. Approaches followed for removal of background contamination, sample preparation and separation and detection of mixtures of bisphenols and derivatives are critically discussed. Sample treatment is matrix-dependent and common steps include analyte isolation, removal of interferences, evaporation of the extracts and solvent reconstitution. Separation and quantification has been almost exclusively carried out by liquid chromatography tandem mass spectrometry (LC-MS/MS) or gas chromatography mass spectrometry (GC–MS), in the last case prior derivatization, but LC-fluorescence detection has also found some applications. Main characteristics, advantages and drawbacks of these methods will be comparatively discussed. Although at an early stage, some approaches for the assessment of the risk to mixtures of bisphenols, mainly based on the combination of chemical target analysis and toxicity evaluation, have been already applied and they will be here presented. Current knowledge gaps hindering a reliable assessment of human and environmental risk to mixtures of bisphenols and derivatives will be outlined. - Highlights: • Analytical methods for the (bio)monitoring of mixtures of bisphenols are reviewed. • LC and CG coupled to MS are the preferred techniques. • Method-dependent sample treatments are required to remove matrix

  17. Local Fractional Laplace Variational Iteration Method for Solving Linear Partial Differential Equations with Local Fractional Derivative

    Directory of Open Access Journals (Sweden)

    Ai-Min Yang

    2014-01-01

    Full Text Available The local fractional Laplace variational iteration method was applied to solve the linear local fractional partial differential equations. The local fractional Laplace variational iteration method is coupled by the local fractional variational iteration method and Laplace transform. The nondifferentiable approximate solutions are obtained and their graphs are also shown.

  18. An Iterative Method to Derive the Equivalent Centrifugal Compressor Performance at Various Operating Conditions: Part I: Modelling of Suction Parameters Impact

    Directory of Open Access Journals (Sweden)

    Waleed Albusaidi

    2015-08-01

    Full Text Available This paper introduces a new iterative method to predict the equivalent centrifugal compressor performance at various operating conditions. The presented theoretical analysis and empirical correlations provide a novel approach to derive the entire compressor map corresponding to various suction conditions without a prior knowledge of the detailed geometry. The efficiency model was derived to reflect the impact of physical gas properties, Mach number, and flow and work coefficients. One of the main features of the developed technique is the fact that it considers the variation in the gas properties and stage efficiency which makes it appropriate with hydrocarbons. This method has been tested to predict the performance of two multistage centrifugal compressors and the estimated characteristics are compared with the measured data. The carried comparison revealed a good matching with the actual values, including the stable operation region limits. Furthermore, an optimization study was conducted to investigate the influences of suction conditions on the stage efficiency and surge margin. Moreover, a new sort of presentation has been generated to obtain the equivalent performance characteristics for a constant discharge pressure operation at variable suction pressure and temperature working conditions. A further validation is included in part two of this study in order to evaluate the prediction capability of the derived model at various gas compositions.

  19. Measure Guideline: Summary of Interior Ducts in New Construction, Including an Efficient, Affordable Method to Install Fur-Down Interior Ducts

    Energy Technology Data Exchange (ETDEWEB)

    Beal, D.; McIlvaine , J.; Fonorow, K.; Martin, E.

    2011-11-01

    This document illustrates guidelines for the efficient installation of interior duct systems in new housing, including the fur-up chase method, the fur-down chase method, and interior ducts positioned in sealed attics or sealed crawl spaces. This document illustrates guidelines for the efficient installation of interior duct systems in new housing. Interior ducts result from bringing the duct work inside a home's thermal and air barrier. Architects, designers, builders, and new home buyers should thoroughly investigate any opportunity for energy savings that is as easy to implement during construction, such as the opportunity to construct interior duct work. In addition to enhanced energy efficiency, interior ductwork results in other important advantages, such as improved indoor air quality, increased system durability and increased homeowner comfort. While the advantages of well-designed and constructed interior duct systems are recognized, the implementation of this approach has not gained a significant market acceptance. This guideline describes a variety of methods to create interior ducts including the fur-up chase method, the fur-down chase method, and interior ducts positioned in sealed attics or sealed crawl spaces. As communication of the intent of an interior duct system, and collaboration on its construction are paramount to success, this guideline details the critical design, planning, construction, inspection, and verification steps that must be taken. Involved in this process are individuals from the design team; sales/marketing team; and mechanical, insulation, plumbing, electrical, framing, drywall and solar contractors.

  20. A comparison of contour maps derived from independent methods of measuring lunar magnetic fields

    Science.gov (United States)

    Lichtenstein, B. R.; Coleman, P. J., Jr.; Russell, C. T.

    1978-01-01

    Computer-generated contour maps of strong lunar remanent magnetic fields are presented and discussed. The maps, obtained by previously described (Eliason and Soderblom, 1977) techniques, are derived from a variety of direct and indirect measurements from Apollo 15 and 16 and Explorer 35 magnetometer and electron reflection data. A common display format is used to facilitate comparison of the maps over regions of overlapping coverage. Most large scale features of either weak or strong magnetic field regions are found to correlate fairly well on all the maps considered.

  1. A method to derive maps of ionospheric conductances, currents, and convection from the Swarm multisatellite mission

    DEFF Research Database (Denmark)

    Amm, O.; Vanhamäki, H.; Kauristie, K.

    2015-01-01

    The European Space Agency (ESA) Swarm spacecraft mission is the first multisatellite ionospheric mission with two low-orbiting spacecraft that are flying in parallel at a distance of ~100–140 km, thus allowing derivation of spatial gradients of ionospheric parameters not only along the orbits...... pattern of FAC is recovered, and the magnitudes are valid in an integrated sense. Finally, using an MHD model run, we show how our technique allows estimation of the ionosphere-magnetosphere coupling parameter K, if conjugate observations of the magnetospheric magnetic and electric field are available...

  2. Method Of Bonding A Metal Connection To An Electrode Including A Core Having A Fiber Or Foam Type Structure For An Electrochemical Cell, An

    Science.gov (United States)

    Loustau, Marie-Therese; Verhoog, Roelof; Precigout, Claude

    1996-09-24

    A method of bonding a metal connection to an electrode including a core having a fiber or foam-type structure for an electrochemical cell, in which method at least one metal strip is pressed against one edge of the core and is welded thereto under compression, wherein, at least in line with the region in which said strip is welded to the core, which is referred to as the "main core", a retaining core of a type analogous to that of the main core is disposed prior to the welding.

  3. Models and methods for derivation of in vivo neuroreceptor parameters with PET and SPECT reversible radiotracers

    International Nuclear Information System (INIS)

    Slifstein, Mark; Laruelle, Marc

    2001-01-01

    The science of quantitative analysis of PET and SPECT neuroreceptor imaging studies has grown considerably over the past decade. A number of methods have been proposed in which receptor parameter estimation results from fitting data to a model of the underlying kinetics of ligand uptake in the brain. These approaches have come to be collectively known as model-based methods and several have received widespread use. Here, we briefly review the most frequently used methods and examine their strengths and weaknesses. Kinetic modeling is the most direct implementation of the compartment models, but with some tracers accurate input function measurement and good compartment configuration identification can be difficult to obtain. Other methods were designed to overcome some particular vulnerability to error of classical kinetic modeling, but introduced new vulnerabilities in the process. Reference region methods obviate the need for arterial plasma measurement, but are not as robust to violations of the underlying modeling assumptions as methods using the arterial input function. Graphical methods give estimates of V T without the requirement of compartment model specification, but provide a biased estimator in the presence of statistical noise. True equilibrium methods are quite robust, but their use is limited to experiments with tracers that are suitable for constant infusion. In conclusion, there is no universally 'best' method that is applicable to all neuroreceptor imaging studies, and carefully evaluation of model-based methods is required for each radiotracer

  4. A new method of derived equatorial plasma bubbles motion by tracing OI 630 nm emission all-sky images

    Science.gov (United States)

    Li, M.; Yu, T.; Chunliang, X.; Zuo, X.; Liu, Z.

    2017-12-01

    A new method for estimating the equatorial plasma bubbles (EPBs) motions from airglow emission all-sky images is presented in this paper. This method, which is called 'cloud-derived wind technology' and widely used in satellite observation of wind, could reasonable derive zonal and meridional velocity vectors of EPBs drifts by tracking a series of successive airglow 630.0 nm emission images. Airglow emission images data are available from an all sky airglow camera in Hainan Fuke (19.5°N, 109.2°E) supported by China Meridional Project, which can receive the 630.0nm emission from the ionosphere F region at low-latitudes to observe plasma bubbles. A series of pretreatment technology, e.g. image enhancement, orientation correction, image projection are utilized to preprocess the raw observation. Then the regions of plasma bubble extracted from the images are divided into several small tracing windows and each tracing window can find a target window in the searching area in following image, which is considered as the position tracing window moved to. According to this, velocities in each window are calculated by using the technology of cloud-derived wind. When applying the cloud-derived wind technology, the maximum correlation coefficient (MCC) and the histogram of gradient (HOG) methods to find the target window, which mean to find the maximum correlation and the minimum euclidean distance between two gradient histograms in respectively, are investigated and compared in detail. The maximum correlation method is fianlly adopted in this study to analyze the velocity of plasma bubbles because of its better performance than HOG. All-sky images from Hainan Fuke, between August 2014 and October 2014, are analyzed to investigate the plasma bubble drift velocities using MCC method. The data at different local time at 9 nights are studied and find that zonal drift velocity in different latitude at different local time ranges from 50 m/s to 180 m/s and there is a peak value at

  5. [The development and validation of the methods for the quantitative determination of sibutramine derivatives in dietary supplements].

    Science.gov (United States)

    Stern, K I; Malkova, T L

    The objective of the present study was the development and validation of sibutramine demethylated derivatives, desmethyl sibutramine and didesmethyl sibutramine. Gas-liquid chromatography with the flame ionization detector was used for the quantitative determination of the above substances in dietary supplements. The conditions for the chromatographic determination of the analytes in the presence of the reference standard, methyl stearate, were proposed allowing to achieve the efficient separation. The method has the necessary sensitivity, specificity, linearity, accuracy, and precision (on the intra-day and inter-day basis) which suggests its good validation characteristics. The proposed method can be employed in the analytical laboratories for the quantitative determination of sibutramine derivatives in biologically active dietary supplements.

  6. A rapid method for monitoring the hydrodeoxygenation of coal-derived naphtha

    Energy Technology Data Exchange (ETDEWEB)

    Farnand, B.A.; Coulombe, S.; Smiley, G.T.; Fairbridge, C.

    1988-01-01

    A bonded polar poly(ethylene glycol) capillary column has been used for the identification and quantification of the phenolic components in synthetic crude naphthas. This provides a rapid and routine method for the determination of phenolic oxygen content with results comparable to combustion and neutron activation methods. The method is most useful in monitoring the removal of phenolic oxygen by hydroprocessing. 11 refs., 1 fig. 1 tab.

  7. Toxicological methods for tracing drug abuse: chromatographic, spectroscopic and biological characterisation of ecstasy derivatives.

    Science.gov (United States)

    Belhadj-Tahar, Hafid; Payoux, Pierre; Tafani, Mathieu; Coulais, Yvon; Calet, Serge; Bousseksou, Azzedine

    2010-03-01

    Analysis often reveals variability in the composition of ecstasy pills from pure 3,4-methylenedioxymethamphetamine (MDMA) to mixtures of MDMA derivatives, amphetamine, and other unidentified substances. For a comprehensive toxicological analysis one needs to know all steps to MDMA synthesis which may originate impurities. The aim of this study was to synthesise and determine the chemical-physical and in vitro biological properties of a series of MDMA derivatives.3,4-methylendioxyphenyl-2-nitropropene (MDNP) was obtained by condensation of piperonal with an excess of nitroethane in the presence of ammonium acetate. MDNP was then reduced to methylenedioxyamphetamine (MDA) by LiAlH3. All compounds were analysed using HPLC and spectroscopic technique [Raman, nuclear magnetic resonance (NMR), or infrared (IR)] at all the steps of synthesis. In addition, we assessed the biological potentials of these compounds by measuring in vitro their (i) blood cell/whole blood partition coefficient, (ii) binding to plasmatic proteins (Fbp), and (iii) membrane adsorption. Chemical structure was determined with antibody fluorescence polarisation immunoassay (FPIA). This study showed the presence of solid impurities, particularly of a neurotoxic compound of Al3+ in the final products. FPIA identified the aminoethane group close to the substituted benzene ring, but did not detect the two major precursors of MDMA: MDNP and piperonal. Raman spectroscopy is an attractive alternative technique to characterise ecstasy pills and it can identify stereoisomeric forms such as cis-MDNP and trans-MDNP, which exhibit signals at 1650 cm-1 and 1300 cm-1, respectively.

  8. Europium determination in oxide and oxysulfide luminophors and their wastes by the method of direct and derivative spectrophotometry

    International Nuclear Information System (INIS)

    Mishchenko, V.T.; Aleksandrova, N.N.

    1989-01-01

    Spectrophotometric methods for europium determination in luminophors are proposed. Application of standard and derivative spectrophotometry allows one to determine europium in oxide and oxysulfide luminophors, their wastes and raffinates produced during waste reprocessing quite accurately and reliably. When determining Eu 2 O 3 (Eu 2 O 2 S) mass shares within 4-8 % limits absolute deviation from the mean result makes up to more than ± 0.2 %, relative standard deviation does not exceed 0.02

  9. Shape Reconstruction of Thin Electromagnetic Inclusions via Boundary Measurements: Level-Set Method Combined with the Topological Derivative

    Directory of Open Access Journals (Sweden)

    Won-Kwang Park

    2013-01-01

    Full Text Available An inverse problem for reconstructing arbitrary-shaped thin penetrable electromagnetic inclusions concealed in a homogeneous material is considered in this paper. For this purpose, the level-set evolution method is adopted. The topological derivative concept is incorporated in order to evaluate the evolution speed of the level-set functions. The results of the corresponding numerical simulations with and without noise are presented in this paper.

  10. Involving the Navier-Stokes equations in the derivation of boundary conditions for the lattice Boltzmann method.

    Science.gov (United States)

    Verschaeve, Joris C G

    2011-06-13

    By means of the continuity equation of the incompressible Navier-Stokes equations, additional physical arguments for the derivation of a formulation of the no-slip boundary condition for the lattice Boltzmann method for straight walls at rest are obtained. This leads to a boundary condition that is second-order accurate with respect to the grid spacing and conserves mass. In addition, the boundary condition is stable for relaxation frequencies close to two.

  11. A Fast Implicit Finite Difference Method for Fractional Advection-Dispersion Equations with Fractional Derivative Boundary Conditions

    Directory of Open Access Journals (Sweden)

    Taohua Liu

    2017-01-01

    Full Text Available Fractional advection-dispersion equations, as generalizations of classical integer-order advection-dispersion equations, are used to model the transport of passive tracers carried by fluid flow in a porous medium. In this paper, we develop an implicit finite difference method for fractional advection-dispersion equations with fractional derivative boundary conditions. First-order consistency, solvability, unconditional stability, and first-order convergence of the method are proven. Then, we present a fast iterative method for the implicit finite difference scheme, which only requires storage of O(K and computational cost of O(Klog⁡K. Traditionally, the Gaussian elimination method requires storage of O(K2 and computational cost of O(K3. Finally, the accuracy and efficiency of the method are checked with a numerical example.

  12. A sensitive multi-residue method for the determination of 35 micropollutants including pharmaceuticals, iodinated contrast media and pesticides in water.

    Science.gov (United States)

    Valls-Cantenys, Carme; Scheurer, Marco; Iglesias, Mònica; Sacher, Frank; Brauch, Heinz-Jürgen; Salvadó, Victoria

    2016-09-01

    A sensitive, multi-residue method using solid-phase extraction followed by liquid chromatography-tandem mass spectrometry (LC-MS/MS) was developed to determine a representative group of 35 analytes, including corrosion inhibitors, pesticides and pharmaceuticals such as analgesic and anti-inflammatory drugs, five iodinated contrast media, β-blockers and some of their metabolites and transformation products in water samples. Few other methods are capable of determining such a broad range of contrast media together with other analytes. We studied the parameters affecting the extraction of the target analytes, including sorbent selection and extraction conditions, their chromatographic separation (mobile phase composition and column) and detection conditions using two ionisation sources: electrospray ionisation (ESI) and atmospheric pressure chemical ionisation (APCI). In order to correct matrix effects, a total of 20 surrogate/internal standards were used. ESI was found to have better sensitivity than APCI. Recoveries ranging from 79 to 134 % for tap water and 66 to 144 % for surface water were obtained. Intra-day precision, calculated as relative standard deviation, was below 34 % for tap water and below 21 % for surface water, groundwater and effluent wastewater. Method quantification limits (MQL) were in the low ng L(-1) range, except for the contrast agents iomeprol, amidotrizoic acid and iohexol (22, 25.5 and 17.9 ng L(-1), respectively). Finally, the method was applied to the analysis of 56 real water samples as part of the validation procedure. All of the compounds were detected in at least some of the water samples analysed. Graphical Abstract Multi-residue method for the determination of micropollutants including pharmaceuticals, iodinated contrast media and pesticides in waters by LC-MS/MS.

  13. A Method for Derivation of Areas for Assessment in Marital Relationships.

    Science.gov (United States)

    Broderick, Joan E.

    1981-01-01

    Expands upon factor-analytic and rational methods and introduces a third method for determining content areas to be assessed in marital relationships. Definitions of a "good marriage" were content analyzed, and a number of areas were added. Demographic subgroup differences were found not to be influential factors. (Author)

  14. Dietary patterns derived with multiple methods from food diaries and breast cancer risk in the UK Dietary Cohort Consortium

    Science.gov (United States)

    Pot, Gerda K; Stephen, Alison M; Dahm, Christina C; Key, Timothy J; Cairns, Benjamin J; Burley, Victoria J; Cade, Janet E; Greenwood, Darren C; Keogh, Ruth H; Bhaniani, Amit; McTaggart, Alison; Lentjes, Marleen AH; Mishra, Gita; Brunner, Eric J; Khaw, Kay Tee

    2015-01-01

    Background/ Objectives In spite of several studies relating dietary patterns to breast cancer risk, evidence so far remains inconsistent. This study aimed to investigate associations of dietary patterns derived with three different methods with breast cancer risk. Subjects/ Methods The Mediterranean Diet Score (MDS), principal components analyses (PCA) and reduced rank regression (RRR) were used to derive dietary patterns in a case-control study of 610 breast cancer cases and 1891 matched controls within 4 UK cohort studies. Dietary intakes were collected prospectively using 4-to 7-day food diaries and resulting food consumption data were grouped into 42 food groups. Conditional logistic regression models were used to estimate odds ratios (ORs) for associations between pattern scores and breast cancer risk adjusting for relevant covariates. A separate model was fitted for post-menopausal women only. Results The MDS was not associated with breast cancer risk (OR comparing 1st tertile with 3rd 1.20 (95% CI 0.92; 1.56)), nor the first PCA-derived dietary pattern, explaining 2.7% of variation of diet and characterized by cheese, crisps and savoury snacks, legumes, nuts and seeds (OR 1.18 (95% CI 0.91; 1.53)). The first RRR-derived pattern, a ‘high-alcohol’ pattern, was associated with a higher risk of breast cancer (OR 1.27; 95% CI 1.00; 1.62), which was most pronounced in post-menopausal women (OR 1.46 (95% CI 1.08; 1.98). Conclusions A ‘high-alcohol’ dietary pattern derived with RRR was associated with an increased breast cancer risk; no evidence of associations of other dietary patterns with breast cancer risk was observed in this study. PMID:25052230

  15. Mono-N-acyl-2,6-diaminopimelic acid derivatives: analysis by electromigration and spectroscopic methods and examination of enzyme inhibitory activity.

    Science.gov (United States)

    Hlaváček, Jan; Vítovcová, Miloslava; Sázelová, Petra; Pícha, Jan; Vaněk, Václav; Buděšínský, Miloš; Jiráček, Jiří; Gillner, Danuta M; Holz, Richard C; Mikšík, Ivan; Kašička, Václav

    2014-12-15

    Thirteen mono-N-acyl derivatives of 2,6-diaminopimelic acid (DAP)-new potential inhibitors of the dapE-encoded N-succinyl-l,l-diaminopimelic acid desuccinylase (DapE; EC 3.5.1.18)-were analyzed and characterized by infrared (IR) and nuclear magnetic resonance (NMR) spectroscopies and two capillary electromigration methods: capillary zone electrophoresis (CZE) and micellar electrokinetic chromatography (MEKC). Structural features of DAP derivatives were characterized by IR and NMR spectroscopies, whereas CZE and MEKC were applied to evaluate their purity and to investigate their electromigration properties. Effective electrophoretic mobilities of these compounds were determined by CZE in acidic and alkaline background electrolytes (BGEs) and by MEKC in acidic and alkaline BGEs containing a pseudostationary phase of anionic detergent sodium dodecyl sulfate (SDS) or cationic detergent cetyltrimethylammonium bromide (CTAB). The best separation of DAP derivatives, including diastereomers of some of them, was achieved by MEKC in an acidic BGE (500 mM acetic acid [pH 2.54] and 60mM SDS). All DAP derivatives were examined for their ability to inhibit catalytic activity of DapE from Haemophilus influenzae (HiDapE) and ArgE from Escherichia coli (EcArgE). None of these DAP derivatives worked as an effective inhibitor of HiDapE, but one derivative-N-fumaryl, Me-ester-DAP-was found to be a moderate inhibitor of EcArgE, thereby providing a promising lead structure for further studies on ArgE inhibitors. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Preface of "The Second Symposium on Border Zones Between Experimental and Numerical Application Including Solution Approaches By Extensions of Standard Numerical Methods"

    Science.gov (United States)

    Ortleb, Sigrun; Seidel, Christian

    2017-07-01

    In this second symposium at the limits of experimental and numerical methods, recent research is presented on practically relevant problems. Presentations discuss experimental investigation as well as numerical methods with a strong focus on application. In addition, problems are identified which require a hybrid experimental-numerical approach. Topics include fast explicit diffusion applied to a geothermal energy storage tank, noise in experimental measurements of electrical quantities, thermal fluid structure interaction, tensegrity structures, experimental and numerical methods for Chladni figures, optimized construction of hydroelectric power stations, experimental and numerical limits in the investigation of rain-wind induced vibrations as well as the application of exponential integrators in a domain-based IMEX setting.

  17. A novel method to generate and culture human mast cells: Peripheral CD34+ stem cell-derived mast cells (PSCMCs).

    Science.gov (United States)

    Schmetzer, Oliver; Valentin, Patricia; Smorodchenko, Anna; Domenis, Rossana; Gri, Giorgia; Siebenhaar, Frank; Metz, Martin; Maurer, Marcus

    2014-11-01

    The identification and characterization of human mast cell (MC) functions are hindered by the shortage of MC populations suitable for investigation. Here, we present a novel technique for generating large numbers of well differentiated and functional human MCs from peripheral stem cells (=peripheral stem cell-derived MCs, PSCMCs). Innovative and key features of this technique include 1) the use of stem cell concentrates, which are routinely discarded by blood banks, as the source of CD34+ stem cells, 2) cell culture in serum-free medium and 3) the addition of LDL as well as selected cytokines. In contrast to established and published protocols that use CD34+ or CD133+ progenitor cells from full blood, we used a pre-enriched cell population obtained from stem cell concentrates, which yielded up to 10(8) differentiated human MCs per batch after only three weeks of culture starting with 10(6) total CD34+ cells. The total purity on MCs (CD117+, FcεR1+) generated by this method varied between 55 and 90%, of which 4-20% were mature MCs that contain tryptase and chymase and show expression of FcεRI and CD117 in immunohistochemistry. PSCMCs showed robust histamine release in response to stimulation with anti-FcεR1 or IgE/anti-IgE, and increased proliferation and differentiation in response to IL-1β or IFN-γ. Taken together, this new protocol of the generation of large numbers of human MCs provides for an innovative and suitable option to investigate the biology of human MCs. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Chromatographic methods and techniques used in studies of coals, their progenitors and coal-derived materials

    Energy Technology Data Exchange (ETDEWEB)

    Zubkova, Valentina [Jan Kochanowski University of Humanities and Sciences, Institute of Chemistry, Kielce (Poland)

    2011-03-15

    The use of chromatography in studies of coals, their progenitors and coal-related products was reviewed. The specificity of the coal structure was discussed. The use of extraction in preparing study samples was discussed paying special attention to the occurrence of undesirable phenomena such as aggregation of coal derivate molecules, resulting from the formation of their dimers and trimers, and degradation of polar solvents at temperatures above 350 C. The following ways of fractionating samples of coal materials were considered: thermal, solvent, column with the use of preparative size exclusive chromatography and preparative thin layer chromatography as well as membrane separation. The use of chromatography coupled with experimental techniques such as mass spectrometry, infrared spectroscopy, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and pyrolysis was analysed. (orig.)

  19. Derivation of a Performance Checklist for Ultrasound-Guided Arthrocentesis Using the Modified Delphi Method.

    Science.gov (United States)

    Kunz, Derek; Pariyadath, Manoj; Wittler, Mary; Askew, Kim; Manthey, David; Hartman, Nicholas

    2017-06-01

    Arthrocentesis is an important skill for physicians in multiple specialties. Recent studies indicate a superior safety and performance profile for this procedure using ultrasound guidance for needle placement, and improving quality of care requires a valid measurement of competency using this modality. We endeavored to create a validated tool to assess the performance of this procedure using the modified Delphi technique and experts in multiple disciplines across the United States. We derived a 22-item checklist designed to assess competency for the completion of ultrasound-guided arthrocentesis, which demonstrated a Cronbach's alpha of 0.89, indicating an excellent degree of internal consistency. Although we were able to demonstrate content validity for this tool, further validity evidence should be acquired after the tool is used and studied in clinical and simulated contexts. © 2017 by the American Institute of Ultrasound in Medicine.

  20. Method to produce biomass-derived compounds using a co-solvent system containing gamma-valerolactone

    Science.gov (United States)

    Dumesic, James A.; Motagamwala, Ali Hussain

    2017-06-27

    A method to produce an aqueous solution of carbohydrates containing C5- and/or C6-sugar-containing oligomers and/or C5- and/or C6-sugar monomers in which biomass or a biomass-derived reactant is reacted with a solvent system having an organic solvent, and organic co-solvent, and water, in the presence of an acid. The method produces the desired product, while a substantial portion of any lignin present in the reactant appears as a precipitate in the product mixture.

  1. The development and standardization of testing methods for genetically modified organisms and their derived products.

    Science.gov (United States)

    Zhang, Dabing; Guo, Jinchao

    2011-07-01

    As the worldwide commercialization of genetically modified organisms (GMOs) increases and consumers concern the safety of GMOs, many countries and regions are issuing labeling regulations on GMOs and their products. Analytical methods and their standardization for GM ingredients in foods and feed are essential for the implementation of labeling regulations. To date, the GMO testing methods are mainly based on the inserted DNA sequences and newly produced proteins in GMOs. This paper presents an overview of GMO testing methods as well as their standardization. © 2011 Institute of Botany, Chinese Academy of Sciences.

  2. Efficient improvement of virtual crack extension method by a derivative of the finite element stiffness matrix

    International Nuclear Information System (INIS)

    Ishikawa, H.; Nakano, S.; Yuuki, R.; Chung, N.Y.

    1991-01-01

    In the virtual crack extension method, the stress intensity factor, K, is obtained from the converged value of the energy release rate by the difference of the finite element stiffness matrix when some crack extension are taken. Instead of the numerical difference of the finite element stiffness, a new method to use a direct dirivative of the finite element stiffness matrix with respect to crack length is proposed. By the present method, the results of some example problems, such as uniform tension problems of a square plate with a center crack and a rectangular plate with an internal slant crack, are obtained with high accuracy and good efficiency. Comparing with analytical results, the present values of the stress intensity factors of the problems are obtained with the error that is less than 0.6%. This shows the numerical assurance of the usefulness of the present method. A personal computer program for the analysis is developed

  3. Conjugate gradient method for phase retrieval based on the Wirtinger derivative.

    Science.gov (United States)

    Wei, Zhun; Chen, Wen; Qiu, Cheng-Wei; Chen, Xudong

    2017-05-01

    A conjugate gradient Wirtinger flow (CG-WF) algorithm for phase retrieval is proposed in this paper. It is shown that, compared with recently reported Wirtinger flow and its modified methods, the proposed CG-WF algorithm is able to dramatically accelerate the convergence rate while keeping the dominant computational cost of each iteration unchanged. We numerically illustrate the effectiveness of our method in recovering 1D Gaussian signals and 2D natural color images under both Gaussian and coded diffraction pattern models.

  4. Global Derivatives

    DEFF Research Database (Denmark)

    Andersen, Torben Juul

    approaches to dealing in the global business environment." - Sharon Brown-Hruska, Commissioner, Commodity Futures Trading Commission, USA. "This comprehensive survey of modern risk management using derivative securities is a fine demonstration of the practical relevance of modern derivatives theory to risk......" provides comprehensive coverage of different types of derivatives, including exchange traded contracts and over-the-counter instruments as well as real options. There is an equal emphasis on the practical application of derivatives and their actual uses in business transactions and corporate risk...... management situations. Its key features include: derivatives are introduced in a global market perspective; describes major derivative pricing models for practical use, extending these principles to valuation of real options; practical applications of derivative instruments are richly illustrated...

  5. A global multicenter study on reference values: 1. Assessment of methods for derivation and comparison of reference intervals.

    Science.gov (United States)

    Ichihara, Kiyoshi; Ozarda, Yesim; Barth, Julian H; Klee, George; Qiu, Ling; Erasmus, Rajiv; Borai, Anwar; Evgina, Svetlana; Ashavaid, Tester; Khan, Dilshad; Schreier, Laura; Rolle, Reynan; Shimizu, Yoshihisa; Kimura, Shogo; Kawano, Reo; Armbruster, David; Mori, Kazuo; Yadav, Binod K

    2017-04-01

    The IFCC Committee on Reference Intervals and Decision Limits coordinated a global multicenter study on reference values (RVs) to explore rational and harmonizable procedures for derivation of reference intervals (RIs) and investigate the feasibility of sharing RIs through evaluation of sources of variation of RVs on a global scale. For the common protocol, rather lenient criteria for reference individuals were adopted to facilitate harmonized recruitment with planned use of the latent abnormal values exclusion (LAVE) method. As of July 2015, 12 countries had completed their study with total recruitment of 13,386 healthy adults. 25 analytes were measured chemically and 25 immunologically. A serum panel with assigned values was measured by all laboratories. RIs were derived by parametric and nonparametric methods. The effect of LAVE methods is prominent in analytes which reflect nutritional status, inflammation and muscular exertion, indicating that inappropriate results are frequent in any country. The validity of the parametric method was confirmed by the presence of analyte-specific distribution patterns and successful Gaussian transformation using the modified Box-Cox formula in all countries. After successful alignment of RVs based on the panel test results, nearly half the analytes showed variable degrees of between-country differences. This finding, however, requires confirmation after adjusting for BMI and other sources of variation. The results are reported in the second part of this paper. The collaborative study enabled us to evaluate rational methods for deriving RIs and comparing the RVs based on real-world datasets obtained in a harmonized manner. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Body burden of pesticides and wastewater-derived pollutants on freshwater invertebrates: Method development and application in the Danube River

    International Nuclear Information System (INIS)

    Inostroza, Pedro A.; Wicht, Anna-Jorina; Huber, Thomas; Nagy, Claudia; Brack, Werner; Krauss, Martin

    2016-01-01

    While environmental risk assessment is typically based on toxicant concentrations in water and/or sediment, awareness is increasing that internal concentrations or body burdens are the key to understand adverse effects in organisms. In order to link environmental micropollutants as causes of observed effects, there is an increasing demand for methods to analyse these chemicals in organisms. Here, a multi-target screening method based on pulverised liquid extraction (PuLE) and a modified QuEChERS approach with an additional hexane phase was developed. It is capable to extract and quantify organic micropollutants of diverse chemical classes in freshwater invertebrates. The method was tested on gammarids from the Danube River (within the Joint Danube Survey 3) and target compounds were analysed by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Furthermore, a non-target screening using high resolution-tandem mass spectrometry (LC-HRMS/MS) was conducted. A total of 17 pollutants were detected and/or quantified in gammarids at low concentrations. Pesticide concentrations ranged from 0.1 to 6.52 ng g −1 (wet weight), those of wastewater-derived pollutants from 0.1 to 2.83 ng g −1 (wet weight). The presence of wastewater-derived pollutants was prominent at all spots sampled. Using non-target screening, we could successfully identify several chlorinated compounds. These results demonstrate for the first time the presence of pesticides and wastewater-derived pollutants in invertebrates of the Danube River. - Highlights: • A method based on pulverised liquid extraction/QuEChERS for organic micropollutants in invertebrates was developed. • The method is applicable in assessing target environmental pollutants in invertebrates by LC-MS/MS. • The method allows for a nontarget screening of extracts by LC-HRMS. • First body burden analysis of pesticides and wastewater-derived pollutants in invertebrates in the Danube River is reported. - Capsule: A multi

  7. A reverse Monte Carlo method for deriving optical constants of solids from reflection electron energy-loss spectroscopy spectra

    International Nuclear Information System (INIS)

    Da, B.; Sun, Y.; Ding, Z. J.; Mao, S. F.; Zhang, Z. M.; Jin, H.; Yoshikawa, H.; Tanuma, S.

    2013-01-01

    A reverse Monte Carlo (RMC) method is developed to obtain the energy loss function (ELF) and optical constants from a measured reflection electron energy-loss spectroscopy (REELS) spectrum by an iterative Monte Carlo (MC) simulation procedure. The method combines the simulated annealing method, i.e., a Markov chain Monte Carlo (MCMC) sampling of oscillator parameters, surface and bulk excitation weighting factors, and band gap energy, with a conventional MC simulation of electron interaction with solids, which acts as a single step of MCMC sampling in this RMC method. To examine the reliability of this method, we have verified that the output data of the dielectric function are essentially independent of the initial values of the trial parameters, which is a basic property of a MCMC method. The optical constants derived for SiO 2 in the energy loss range of 8-90 eV are in good agreement with other available data, and relevant bulk ELFs are checked by oscillator strength-sum and perfect-screening-sum rules. Our results show that the dielectric function can be obtained by the RMC method even with a wide range of initial trial parameters. The RMC method is thus a general and effective method for determining the optical properties of solids from REELS measurements.

  8. Validation of GOES-Derived Surface Radiation Using NOAA's Physical Retrieval Method

    Energy Technology Data Exchange (ETDEWEB)

    Habte, A.; Sengupta, M.; Wilcox, S.

    2013-01-01

    This report was part of a multiyear collaboration with the University of Wisconsin and the National Oceanic and Atmospheric Administration (NOAA) to produce high-quality, satellite-based, solar resource datasets for the United States. High-quality, solar resource assessment accelerates technology deployment by making a positive impact on decision making and reducing uncertainty in investment decisions. Satellite-based solar resource datasets are used as a primary source in solar resource assessment. This is mainly because satellites provide larger areal coverage and longer periods of record than ground-based measurements. With the advent of newer satellites with increased information content and faster computers that can process increasingly higher data volumes, methods that were considered too computationally intensive are now feasible. One class of sophisticated methods for retrieving solar resource information from satellites is a two-step, physics-based method that computes cloud properties and uses the information in a radiative transfer model to compute solar radiation. This method has the advantage of adding additional information as satellites with newer channels come on board. This report evaluates the two-step method developed at NOAA and adapted for solar resource assessment for renewable energy with the goal of identifying areas that can be improved in the future.

  9. Manipulation-free cultures of human iPSC-derived cardiomyocytes offer a novel screening method for cardiotoxicity.

    Science.gov (United States)

    Rajasingh, Sheeja; Isai, Dona Greta; Samanta, Saheli; Zhou, Zhi-Gang; Dawn, Buddhadeb; Kinsey, William H; Czirok, Andras; Rajasingh, Johnson

    2018-04-05

    Induced pluripotent stem cell (iPSC)-based cardiac regenerative medicine requires the efficient generation, structural soundness and proper functioning of mature cardiomyocytes, derived from the patient's somatic cells. The most important functional property of cardiomyocytes is the ability to contract. Currently available methods routinely used to test and quantify cardiomyocyte function involve techniques that are labor-intensive, invasive, require sophisticated instruments or can adversely affect cell vitality. We recently developed optical flow imaging method analyses and quantified cardiomyocyte contractile kinetics from video microscopic recordings without compromising cell quality. Specifically, our automated particle image velocimetry (PIV) analysis of phase-contrast video images captured at a high frame rate yields statistical measures characterizing the beating frequency, amplitude, average waveform and beat-to-beat variations. Thus, it can be a powerful assessment tool to monitor cardiomyocyte quality and maturity. Here we demonstrate the ability of our analysis to characterize the chronotropic responses of human iPSC-derived cardiomyocytes to a panel of ion channel modulators and also to doxorubicin, a chemotherapy agent with known cardiotoxic side effects. We conclude that the PIV-derived beat patterns can identify the elongation or shortening of specific phases in the contractility cycle, and the obtained chronotropic responses are in accord with known clinical outcomes. Hence, this system can serve as a powerful tool to screen the new and currently available pharmacological compounds for cardiotoxic effects.

  10. Conservation laws derived by the Neutral-Action Method. A simple application to the Schroedinger equation

    International Nuclear Information System (INIS)

    Nordbrock, U.; Kienzler, R.

    2007-01-01

    Conservation laws are a recognized tool in physical and engineering sciences. The classical procedure to construct conservation laws is to apply Noether's Theorem. It requires the existence of a Lagrange-function for the system under consideration. Two unknown sets of functions have to be found. A broader class of such laws is obtainable, if Noether's Theorem is used together with the Bessel-Hagen extension, raising the number of sets of unknown functions to three. By using the recently developed Neutral-Action Method, the same conservation laws can be obtained by calculating only one unknown set of functions. Moreover the Neutral Action Method can also be applied in the absence of a Lagrangian, since only the governing differential equations are required for this procedure. In the paper, an application of this method to the Schroedinger equation is presented. (authors)

  11. In vitro characterization of polyvinyl alcohol assisted hydroxyapatite derived by sol–gel method

    Energy Technology Data Exchange (ETDEWEB)

    Kaygili, Omer, E-mail: okaygili@firat.edu.tr [Department of Physics, Faculty of Science, Firat University, 23119 Elazig (Turkey); Keser, Serhat [Department of Chemistry, Faculty of Science, Firat University, 23119 Elazig (Turkey); Al Orainy, R.H. [Physics Department, Sciences of Faculty for Girls, King Abdulaziz University, Jeddah (Saudi Arabia); Ates, Tankut [Department of Physics, Faculty of Science, Firat University, 23119 Elazig (Turkey); Yakuphanoglu, Fahrettin [Department of Physics, Faculty of Science, Firat University, 23119 Elazig (Turkey); Physics Department, Sciences of Faculty for Girls, King Abdulaziz University, Jeddah (Saudi Arabia)

    2014-02-01

    The synthesis and characterization of sol–gel derived hydroxyapatite (HAp) were investigated with the effects of the addition of polyvinyl alcohol (PVA) to the structural and material in vitro behavior. All samples were soaked in simulated body fluid (SBF) for 14 and 28 days. The characterization of bioceramics before and after immersing in SBF was carried out by X-ray diffraction (XRD), Fourier transform infrared (FTIR) spectroscopy, differential thermal analysis (DTA), thermogravimetric analysis (TGA) and scanning electron microscopy (SEM) techniques. After the simulated body fluid period, the crystal structure and phase of HAp samples did not change significantly. The characteristic bands of hydroxyl, phosphate and carbonate groups were detected. HAp exhibited a thermal stability of room temperature to 1000 °C. The surface morphologies of the samples show an evident change with the soaking period in SBF. - Highlights: • The soaking period in SBF affects the surface morphology. • The Ca/P molar ratios change with the immersion time. • The as-prepared samples thermally stable from ∼ 25 to 1000 °C.

  12. In vitro characterization of polyvinyl alcohol assisted hydroxyapatite derived by sol–gel method

    International Nuclear Information System (INIS)

    Kaygili, Omer; Keser, Serhat; Al Orainy, R.H.; Ates, Tankut; Yakuphanoglu, Fahrettin

    2014-01-01

    The synthesis and characterization of sol–gel derived hydroxyapatite (HAp) were investigated with the effects of the addition of polyvinyl alcohol (PVA) to the structural and material in vitro behavior. All samples were soaked in simulated body fluid (SBF) for 14 and 28 days. The characterization of bioceramics before and after immersing in SBF was carried out by X-ray diffraction (XRD), Fourier transform infrared (FTIR) spectroscopy, differential thermal analysis (DTA), thermogravimetric analysis (TGA) and scanning electron microscopy (SEM) techniques. After the simulated body fluid period, the crystal structure and phase of HAp samples did not change significantly. The characteristic bands of hydroxyl, phosphate and carbonate groups were detected. HAp exhibited a thermal stability of room temperature to 1000 °C. The surface morphologies of the samples show an evident change with the soaking period in SBF. - Highlights: • The soaking period in SBF affects the surface morphology. • The Ca/P molar ratios change with the immersion time. • The as-prepared samples thermally stable from ∼ 25 to 1000 °C

  13. Cantor-type cylindrical-coordinate method for differential equations with local fractional derivatives

    International Nuclear Information System (INIS)

    Yang, Xiao-Jun; Srivastava, H.M.; He, Ji-Huan; Baleanu, Dumitru

    2013-01-01

    In this Letter, we propose to use the Cantor-type cylindrical-coordinate method in order to investigate a family of local fractional differential operators on Cantor sets. Some testing examples are given to illustrate the capability of the proposed method for the heat-conduction equation on a Cantor set and the damped wave equation in fractal strings. It is seen to be a powerful tool to convert differential equations on Cantor sets from Cantorian-coordinate systems to Cantor-type cylindrical-coordinate systems.

  14. A simple and efficient method for deriving neurospheres from bone marrow stromal cells

    International Nuclear Information System (INIS)

    Yang Qin; Mu Jun; Li Qi; Li Ao; Zeng Zhilei; Yang Jun; Zhang Xiaodong; Tang Jin; Xie Peng

    2008-01-01

    Bone marrow stromal cells (MSCs) can be differentiated into neuronal and glial-like cell types under appropriate experimental conditions. However, previously reported methods are complicated and involve the use of toxic reagents. Here, we present a simplified and nontoxic method for efficient conversion of rat MSCs into neurospheres that express the neuroectodermal marker nestin. These neurospheres can proliferate and differentiate into neuron, astrocyte, and oligodendrocyte phenotypes. We thus propose that MSCs are an emerging model cell for the treatment of a variety of neurological diseases

  15. A Method to Derive Monitoring Variables for a Cyber Security Test-bed of I and C System

    International Nuclear Information System (INIS)

    Han, Kyung Soo; Song, Jae Gu; Lee, Joung Woon; Lee, Cheol Kwon

    2013-01-01

    In the IT field, monitoring techniques have been developed to protect the systems connected by networks from cyber attacks and incidents. For the development of monitoring systems for I and C cyber security, it is necessary to review the monitoring systems in the IT field and derive cyber security-related monitoring variables among the proprietary operating information about the I and C systems. Tests for the development and application of these monitoring systems may cause adverse effects on the I and C systems. To analyze influences on the system and safely intended variables, the construction of an I and C system Test-bed should be preceded. This article proposes a method of deriving variables that should be monitored through a monitoring system for cyber security as a part of I and C Test-bed. The surveillance features and the monitored variables of NMS(Network Management System), a monitoring technique in the IT field, were reviewed in section 2. In Section 3, the monitoring variables for an I and C cyber security were derived by the of NMS and the investigation for information used for hacking techniques that can be practiced against I and C systems. The monitoring variables of NMS in the IT field and the information about the malicious behaviors used for hacking were derived as expected variables to be monitored for an I and C cyber security research. The derived monitoring variables were classified into the five functions of NMS for efficient management. For the cyber security of I and C systems, the vulnerabilities should be understood through a penetration test etc. and an assessment of influences on the actual system should be carried out. Thus, constructing a test-bed of I and C systems is necessary for the safety system in operation. In the future, it will be necessary to develop a logging and monitoring system for studies on the vulnerabilities of I and C systems with test-beds

  16. A Method to Derive Monitoring Variables for a Cyber Security Test-bed of I and C System

    Energy Technology Data Exchange (ETDEWEB)

    Han, Kyung Soo; Song, Jae Gu; Lee, Joung Woon; Lee, Cheol Kwon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2013-10-15

    In the IT field, monitoring techniques have been developed to protect the systems connected by networks from cyber attacks and incidents. For the development of monitoring systems for I and C cyber security, it is necessary to review the monitoring systems in the IT field and derive cyber security-related monitoring variables among the proprietary operating information about the I and C systems. Tests for the development and application of these monitoring systems may cause adverse effects on the I and C systems. To analyze influences on the system and safely intended variables, the construction of an I and C system Test-bed should be preceded. This article proposes a method of deriving variables that should be monitored through a monitoring system for cyber security as a part of I and C Test-bed. The surveillance features and the monitored variables of NMS(Network Management System), a monitoring technique in the IT field, were reviewed in section 2. In Section 3, the monitoring variables for an I and C cyber security were derived by the of NMS and the investigation for information used for hacking techniques that can be practiced against I and C systems. The monitoring variables of NMS in the IT field and the information about the malicious behaviors used for hacking were derived as expected variables to be monitored for an I and C cyber security research. The derived monitoring variables were classified into the five functions of NMS for efficient management. For the cyber security of I and C systems, the vulnerabilities should be understood through a penetration test etc. and an assessment of influences on the actual system should be carried out. Thus, constructing a test-bed of I and C systems is necessary for the safety system in operation. In the future, it will be necessary to develop a logging and monitoring system for studies on the vulnerabilities of I and C systems with test-beds.

  17. A rapid and simple screening method for methamphetamine in urine by radioimmunoassay using a 125I-labeled metahmphetamine derivative

    International Nuclear Information System (INIS)

    Inayama, Seiichi; Tokunaga, Yukiko; Hosoya, Eikichi; Nakadate, Teruo; Niwaguchi, Tetsukichi.

    1980-01-01

    N-Carboxymethylmethamphetamine, a derivative of methamphetamine, was prepared through a new synthetic pathway from ephedrine. Specific antiserum was obtained by immunization of rabbits with the conjugate of N-carboxymethylmethamphetamine with bovine serum albumin. A radioimmunoassay procedure was established using this antibody (specific for methamphetamine) and a 125 I-methamphetamine derivative. A high degree of specificity of the antibody was confirmed by testing for cross-reaction with several methamphetamine analogs, and the sensitivity was found to be 1 ng/tube. The present micro method using radioimmunoassay is highly sensitive, rapid, simple and may be useful as a micro-scale primary screening test for methamphetamine excreted in human urine, for forensic and medical purposes. (author)

  18. QSAR Modeling of COX -2 Inhibitory Activity of Some Dihydropyridine and Hydroquinoline Derivatives Using Multiple Linear Regression (MLR) Method.

    Science.gov (United States)

    Akbari, Somaye; Zebardast, Tannaz; Zarghi, Afshin; Hajimahdi, Zahra

    2017-01-01

    COX-2 inhibitory activities of some 1,4-dihydropyridine and 5-oxo-1,4,5,6,7,8-hexahydroquinoline derivatives were modeled by quantitative structure-activity relationship (QSAR) using stepwise-multiple linear regression (SW-MLR) method. The built model was robust and predictive with correlation coefficient (R 2 ) of 0.972 and 0.531 for training and test groups, respectively. The quality of the model was evaluated by leave-one-out (LOO) cross validation (LOO correlation coefficient (Q 2 ) of 0.943) and Y-randomization. We also employed a leverage approach for the defining of applicability domain of model. Based on QSAR models results, COX-2 inhibitory activity of selected data set had correlation with BEHm6 (highest eigenvalue n. 6 of Burden matrix/weighted by atomic masses), Mor03u (signal 03/unweighted) and IVDE (Mean information content on the vertex degree equality) descriptors which derived from their structures.

  19. Inter-laboratory verification of European pharmacopoeia monograph on derivative spectrophotometry method and its application for chitosan hydrochloride.

    Science.gov (United States)

    Marković, Bojan; Ignjatović, Janko; Vujadinović, Mirjana; Savić, Vedrana; Vladimirov, Sote; Karljiković-Rajić, Katarina

    2015-01-01

    Inter-laboratory verification of European pharmacopoeia (EP) monograph on derivative spectrophotometry (DS) method and its application for chitosan hydrochloride was carried out on two generation of instruments (earlier GBC Cintra 20 and current technology TS Evolution 300). Instruments operate with different versions of Savitzky-Golay algorithm and modes of generating digital derivative spectra. For resolution power parameter, defined as the amplitude ratio A/B in DS method EP monograph, comparable results were obtained only with algorithm's parameters smoothing points (SP) 7 and the 2nd degree polynomial and those provided corresponding data with other two modes on TS Evolution 300 Medium digital indirect and Medium digital direct. Using quoted algorithm's parameters, the differences in percentages between the amplitude ratio A/B averages, were within accepted criteria (±3%) for assay of drug product for method transfer. The deviation of 1.76% for the degree of deacetylation assessment of chitosan hydrochloride, determined on two instruments, (amplitude (1)D202; the 2nd degree polynomial and SP 9 in Savitzky-Golay algorithm), was acceptable, since it was within allowed criteria (±2%) for assay deviation of drug substance, for method transfer in pharmaceutical analyses. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Correction for dispersion and Coulombic interactions in molecular clusters with density functional derived methods: Application to polycyclic aromatic hydrocarbon clusters

    Science.gov (United States)

    Rapacioli, Mathias; Spiegelman, Fernand; Talbi, Dahbia; Mineva, Tzonka; Goursot, Annick; Heine, Thomas; Seifert, Gotthard

    2009-06-01

    The density functional based tight binding (DFTB) is a semiempirical method derived from the density functional theory (DFT). It inherits therefore its problems in treating van der Waals clusters. A major error comes from dispersion forces, which are poorly described by commonly used DFT functionals, but which can be accounted for by an a posteriori treatment DFT-D. This correction is used for DFTB. The self-consistent charge (SCC) DFTB is built on Mulliken charges which are known to give a poor representation of Coulombic intermolecular potential. We propose to calculate this potential using the class IV/charge model 3 definition of atomic charges. The self-consistent calculation of these charges is introduced in the SCC procedure and corresponding nuclear forces are derived. Benzene dimer is then studied as a benchmark system with this corrected DFTB (c-DFTB-D) method, but also, for comparison, with the DFT-D. Both methods give similar results and are in agreement with references calculations (CCSD(T) and symmetry adapted perturbation theory) calculations. As a first application, pyrene dimer is studied with the c-DFTB-D and DFT-D methods. For coronene clusters, only the c-DFTB-D approach is used, which finds the sandwich configurations to be more stable than the T-shaped ones.

  1. Derivation of a Monte Carlo method for modeling heterodyne detection in optical coherence tomography systems

    DEFF Research Database (Denmark)

    Tycho, Andreas; Jørgensen, Thomas Martini; Andersen, Peter E.

    2002-01-01

    A Monte Carlo (MC) method for modeling optical coherence tomography (OCT) measurements of a diffusely reflecting discontinuity emb edded in a scattering medium is presented. For the first time to the authors' knowledge it is shown analytically that the applicability of an MC approach to this opti...

  2. The prior-derived F constraints in the maximum-entropy method

    Czech Academy of Sciences Publication Activity Database

    Palatinus, Lukáš; van Smaalen, S.

    2005-01-01

    Roč. 61, - (2005), s. 363-372 ISSN 0108-7673 Institutional research plan: CEZ:AV0Z10100521 Keywords : charge density * maximum-entropy method * sodium nitrite Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.791, year: 2005

  3. Reduced differential transform method for partial differential equations within local fractional derivative operators

    Directory of Open Access Journals (Sweden)

    Hossein Jafari

    2016-04-01

    Full Text Available The non-differentiable solution of the linear and non-linear partial differential equations on Cantor sets is implemented in this article. The reduced differential transform method is considered in the local fractional operator sense. The four illustrative examples are given to show the efficiency and accuracy features of the presented technique to solve local fractional partial differential equations.

  4. An AHP-derived method for mapping the physical vulnerability of coastal areas at regional scales

    Directory of Open Access Journals (Sweden)

    G. Le Cozannet

    2013-05-01

    Full Text Available Assessing coastal vulnerability to climate change at regional scales is now mandatory in France since the adoption of recent laws to support adaptation to climate change. However, there is presently no commonly recognised method to assess accurately how sea level rise will modify coastal processes in the coming decades. Therefore, many assessments of the physical component of coastal vulnerability are presently based on a combined use of data (e.g. digital elevation models, historical shoreline and coastal geomorphology datasets, simple models and expert opinion. In this study, we assess the applicability and usefulness of a multi-criteria decision-mapping method (the analytical hierarchy process, AHP to map physical coastal vulnerability to erosion and flooding in a structured way. We apply the method in two regions of France: the coastal zones of Languedoc-Roussillon (north-western Mediterranean, France and the island of La Réunion (south-western Indian Ocean, notably using the regional geological maps. As expected, the results show not only the greater vulnerability of sand spits, estuaries and low-lying areas near to coastal lagoons in both regions, but also that of a thin strip of erodible cliffs exposed to waves in La Réunion. Despite gaps in knowledge and data, the method is found to provide a flexible and transportable framework to represent and aggregate existing knowledge and to support long-term coastal zone planning through the integration of such studies into existing adaptation schemes.

  5. A flow cytometric method for characterization of circulating cell-derived microparticles in plasma

    DEFF Research Database (Denmark)

    Nielsen, Morten Hjuler; Beck-Nielsen, Henning; Andersen, Morten Nørgaard

    2014-01-01

    BACKGROUND AND AIM: Previous studies on circulating microparticles (MPs) indicate that the majority of MPs are of a size below the detection limit of most standard flow cytometers. The objective of the present study was to establish a method to analyze MP subpopulations above the threshold...

  6. A Study on the quantification of hydration and the strength development mechanism of cementitious materials including amorphous phases by using XRD/Rietveld method

    International Nuclear Information System (INIS)

    Yamada, Kazuo; Hoshino, Seiichi; Hirao, Hiroshi; Yamashita, Hiroki

    2008-01-01

    X-ray diffraction (XRD)/Rietveld method was applied to measure the phase composition of cement. The quantative analysis concerning the progress of hydration was accomplished in an error of about the maximum 2-3% in spite of including amorphous materials such as blast furnace slag, fly ash, silica fume and C-S-H. The influence of the compressive strength on the lime stone fine powder mixture material was studied from the hydration analysis by Rietveld method. The two stages were observed in the strength development mechanism of cement; the hydration promotion of C 3 S in the early stage and the filling of cavities by carbonate hydrate for the longer term. It is useful to use various mixture materials for the formation of the resource recycling society and the durability improvement of concrete. (author)

  7. An optimized method for fatty acid analysis, including quantification of trans fatty acids, in human adipose tissue by gas-liquid chromatography

    DEFF Research Database (Denmark)

    Bysted, Anette; Cold, S; Hølmer, Gunhild Kofoed

    1999-01-01

    Considering the need for a quick direct method for measurement of the fatty acid composition including trans isomers ofhuman adipose tissue we have developed a procedure using gas-liquid chromatography (GLC) alone, which is thussuitable for validation of fatty acid status in epidemiological studies...... for 25 min, and finally raised at 25 degrees C/min to 225 degrees C. The trans and cis isomers of18:1 were well separated from each other, as shown by silver-ion thin-layer chromatography. Verification by standardsshowed that the trans 18:1 isomers with a double bond in position 12 or lower were...

  8. Comparing Methods for Cardiac Output: Intraoperatively Doppler-Derived Cardiac Output Measured With 3-Dimensional Echocardiography Is Not Interchangeable With Cardiac Output by Pulmonary Catheter Thermodilution.

    Science.gov (United States)

    Graeser, Karin; Zemtsovski, Mikhail; Kofoed, Klaus F; Winther-Jensen, Matilde; Nilsson, Jens C; Kjaergaard, Jesper; Møller-Sørensen, Hasse

    2018-01-09

    Estimation of cardiac output (CO) is essential in the treatment of circulatory unstable patients. CO measured by pulmonary artery catheter thermodilution is considered the gold standard but carries a small risk of severe complications. Stroke volume and CO can be measured by transesophageal echocardiography (TEE), which is widely used during cardiac surgery. We hypothesized that Doppler-derived CO by 3-dimensional (3D) TEE would agree well with CO measured with pulmonary artery catheter thermodilution as a reference method based on accurate measurements of the cross-sectional area of the left ventricular outflow tract. The primary aim was a systematic comparison of CO with Doppler-derived 3D TEE and CO by thermodilution in a broad population of patients undergoing cardiac surgery. A subanalysis was performed comparing cross-sectional area by TEE with cardiac computed tomography (CT) angiography. Sixty-two patients, scheduled for elective heart surgery, were included; 1 was subsequently excluded for logistic reasons. Inclusion criteria were coronary artery bypass surgery (N = 42) and aortic valve replacement (N = 19). Exclusion criteria were chronic atrial fibrillation, left ventricular ejection fraction below 0.40 and intracardiac shunts. Nineteen randomly selected patients had a cardiac CT the day before surgery. All images were stored for blinded post hoc analyses, and Bland-Altman plots were used to assess agreement between measurement methods, defined as the bias (mean difference between methods), limits of agreement (equal to bias ± 2 standard deviations of the bias), and percentage error (limits of agreement divided by the mean of the 2 methods). Precision was determined for the individual methods (equal to 2 standard deviations of the bias between replicate measurements) to determine the acceptable limits of agreement. We found a good precision for Doppler-derived CO measured by 3D TEE, but although the bias for Doppler-derived CO by 3D compared to

  9. Deriving the probability of a linear opinion pooling method being superior to a set of alternatives

    International Nuclear Information System (INIS)

    Bolger, Donnacha; Houlding, Brett

    2017-01-01

    Linear opinion pools are a common method for combining a set of distinct opinions into a single succinct opinion, often to be used in a decision making task. In this paper we consider a method, termed the Plug-in approach, for determining the weights to be assigned in this linear pool, in a manner that can be deemed as rational in some sense, while incorporating multiple forms of learning over time into its process. The environment that we consider is one in which every source in the pool is herself a decision maker (DM), in contrast to the more common setting in which expert judgments are amalgamated for use by a single DM. We discuss a simulation study that was conducted to show the merits of our technique, and demonstrate how theoretical probabilistic arguments can be used to exactly quantify the probability of this technique being superior (in terms of a probability density metric) to a set of alternatives. Illustrations are given of simulated proportions converging to these true probabilities in a range of commonly used distributional cases. - Highlights: • A novel context for combination of expert opinion is provided. • A dynamic reliability assessment method is stated, justified by properties and a data study. • The theoretical grounding underlying the data-driven justification is explored. • We conclude with areas for expansion and further relevant research.

  10. Matrigel Mattress: A Method for the Generation of Single Contracting Human-Induced Pluripotent Stem Cell-Derived Cardiomyocytes.

    Science.gov (United States)

    Feaster, Tromondae K; Cadar, Adrian G; Wang, Lili; Williams, Charles H; Chun, Young Wook; Hempel, Jonathan E; Bloodworth, Nathaniel; Merryman, W David; Lim, Chee Chew; Wu, Joseph C; Knollmann, Björn C; Hong, Charles C

    2015-12-04

    The lack of measurable single-cell contractility of human-induced pluripotent stem cell-derived cardiac myocytes (hiPSC-CMs) currently limits the utility of hiPSC-CMs for evaluating contractile performance for both basic research and drug discovery. To develop a culture method that rapidly generates contracting single hiPSC-CMs and allows quantification of cell shortening with standard equipment used for studying adult CMs. Single hiPSC-CMs were cultured for 5 to 7 days on a 0.4- to 0.8-mm thick mattress of undiluted Matrigel (mattress hiPSC-CMs) and compared with hiPSC-CMs maintained on a control substrate (method enables the rapid generation of robustly contracting hiPSC-CMs and enhances maturation. This new method allows quantification of contractile performance at the single-cell level, which should be valuable to disease modeling, drug discovery, and preclinical cardiotoxicity testing. © 2015 American Heart Association, Inc.

  11. Projection-reduction method applied to deriving non-linear optical conductivity for an electron-impurity system

    Directory of Open Access Journals (Sweden)

    Nam Lyong Kang

    2013-07-01

    Full Text Available The projection-reduction method introduced by the present authors is known to give a validated theory for optical transitions in the systems of electrons interacting with phonons. In this work, using this method, we derive the linear and first order nonlinear optical conductivites for an electron-impurity system and examine whether the expressions faithfully satisfy the quantum mechanical philosophy, in the same way as for the electron-phonon systems. The result shows that the Fermi distribution function for electrons, energy denominators, and electron-impurity coupling factors are contained properly in organized manners along with absorption of photons for each electron transition process in the final expressions. Furthermore, the result is shown to be represented properly by schematic diagrams, as in the formulation of electron-phonon interaction. Therefore, in conclusion, we claim that this method can be applied in modeling optical transitions of electrons interacting with both impurities and phonons.

  12. A method for energy window optimization for quantitative tasks that includes the effects of model-mismatch on bias: application to Y-90 bremsstrahlung SPECT imaging

    International Nuclear Information System (INIS)

    Rong Xing; Du Yong; Frey, Eric C

    2012-01-01

    Quantitative Yttrium-90 ( 90 Y) bremsstrahlung single photon emission computed tomography (SPECT) imaging has shown great potential to provide reliable estimates of 90 Y activity distribution for targeted radionuclide therapy dosimetry applications. One factor that potentially affects the reliability of the activity estimates is the choice of the acquisition energy window. In contrast to imaging conventional gamma photon emitters where the acquisition energy windows are usually placed around photopeaks, there has been great variation in the choice of the acquisition energy window for 90 Y imaging due to the continuous and broad energy distribution of the bremsstrahlung photons. In quantitative imaging of conventional gamma photon emitters, previous methods for optimizing the acquisition energy window assumed unbiased estimators and used the variance in the estimates as a figure of merit (FOM). However, for situations, such as 90 Y imaging, where there are errors in the modeling of the image formation process used in the reconstruction there will be bias in the activity estimates. In 90 Y bremsstrahlung imaging this will be especially important due to the high levels of scatter, multiple scatter, and collimator septal penetration and scatter. Thus variance will not be a complete measure of reliability of the estimates and thus is not a complete FOM. To address this, we first aimed to develop a new method to optimize the energy window that accounts for both the bias due to model-mismatch and the variance of the activity estimates. We applied this method to optimize the acquisition energy window for quantitative 90 Y bremsstrahlung SPECT imaging in microsphere brachytherapy. Since absorbed dose is defined as the absorbed energy from the radiation per unit mass of tissues in this new method we proposed a mass-weighted root mean squared error of the volume of interest (VOI) activity estimates as the FOM. To calculate this FOM, two analytical expressions were derived for

  13. A method for energy window optimization for quantitative tasks that includes the effects of model-mismatch on bias: application to Y-90 bremsstrahlung SPECT imaging.

    Science.gov (United States)

    Rong, Xing; Du, Yong; Frey, Eric C

    2012-06-21

    derived for calculating the bias due to model-mismatch and the variance of the VOI activity estimates, respectively. To obtain the optimal acquisition energy window for general situations of interest in clinical (90)Y microsphere imaging, we generated phantoms with multiple tumors of various sizes and various tumor-to-normal activity concentration ratios using a digital phantom that realistically simulates human anatomy, simulated (90)Y microsphere imaging with a clinical SPECT system and typical imaging parameters using a previously validated Monte Carlo simulation code, and used a previously proposed method for modeling the image degrading effects in quantitative SPECT reconstruction. The obtained optimal acquisition energy window was 100-160 keV. The values of the proposed FOM were much larger than the FOM taking into account only the variance of the activity estimates, thus demonstrating in our experiment that the bias of the activity estimates due to model-mismatch was a more important factor than the variance in terms of limiting the reliability of activity estimates.

  14. Study of hafnium (IV) oxide nanoparticles synthesized by polymerized complex and polymer precursor derived sol-gel methods

    KAUST Repository

    Ramos-Gonzá lez, R.; Garcí a-Cerda, L. A.; Alshareef, Husam N.; Gnade, Bruce E.; Quevedo-Ló pez, Manuel Angel Quevedo

    2010-01-01

    This work reports the preparation and characterization of hafnium (IV) oxide (HfO2) nanoparticles grown by derived sol-gel routes that involves the formation of an organic polymeric network. A comparison between polymerized complex (PC) and polymer precursor (PP) methods is presented. For the PC method, citric acid (CA) and ethylene glycol (EG) are used as the chelating and polymerizable reagents, respectively. In the case of PP method, poly(acrylic acid) (PAA) is used as the chelating reagent. In both cases, different precursor gels were prepared and the hafnium (IV) chloride (HfCl4) molar ratio was varied from 0.1 to 1.0 for the PC method and from 0.05 to 0.5 for the PP method. In order to obtain the nanoparticles, the precursors were heat treated at 500 and 800 °C. The thermal characterization of the precursor gels was carried out by thermogravimetric analysis (TGA) and the structural and morphological characterization by X-ray diffraction (XRD) and transmission electron microscopy (TEM). The XRD patterns of the samples obtained by both methods shows the formation of HfO2 at 500 °C with monoclinic crystalline phase. The PC method exhibited also the cubic phase. Finally, the HfO2 nanoparticles size (4 to 11 nm) was determined by TEM and XRD patterns. © (2010) Trans Tech Publications.

  15. Study of hafnium (IV) oxide nanoparticles synthesized by polymerized complex and polymer precursor derived sol-gel methods

    KAUST Repository

    Ramos-González, R.

    2010-03-01

    This work reports the preparation and characterization of hafnium (IV) oxide (HfO2) nanoparticles grown by derived sol-gel routes that involves the formation of an organic polymeric network. A comparison between polymerized complex (PC) and polymer precursor (PP) methods is presented. For the PC method, citric acid (CA) and ethylene glycol (EG) are used as the chelating and polymerizable reagents, respectively. In the case of PP method, poly(acrylic acid) (PAA) is used as the chelating reagent. In both cases, different precursor gels were prepared and the hafnium (IV) chloride (HfCl4) molar ratio was varied from 0.1 to 1.0 for the PC method and from 0.05 to 0.5 for the PP method. In order to obtain the nanoparticles, the precursors were heat treated at 500 and 800 °C. The thermal characterization of the precursor gels was carried out by thermogravimetric analysis (TGA) and the structural and morphological characterization by X-ray diffraction (XRD) and transmission electron microscopy (TEM). The XRD patterns of the samples obtained by both methods shows the formation of HfO2 at 500 °C with monoclinic crystalline phase. The PC method exhibited also the cubic phase. Finally, the HfO2 nanoparticles size (4 to 11 nm) was determined by TEM and XRD patterns. © (2010) Trans Tech Publications.

  16. Preparation of hydrophilic and antifouling polysulfone ultrafiltration membrane derived from phenolphthalin by copolymerization method

    International Nuclear Information System (INIS)

    Liu, Zhixiao; Mi, Zhiming; Chen, Chunhai; Zhou, Hongwei; Zhao, Xiaogang; Wang, Daming

    2017-01-01

    Graphical abstract: The mechanisms fouling and cleaning process of PSF-COOH membranes (A) the content of carboxyl less than 80%. (B) the content of carboxyl at 80%, 100%. - Highlights: • Phenolphthalin (PPL) containing carboxyl was successfully introduced into the molecule backbone of polysulfone (PSF). • A series of PSF-COOH copolymers with different carboxylation degree was synthesized and prepared as ultrafiltration membranes. • The introduction of PPL significantly improved the hydrophilicity, permeation flux and antifouling property of membranes. • This method is valuable for large-scale industrial production of hydrophilic membrane material. - Abstract: In this task, carboxylated polysulfone (PSF-COOH) was achieved by introducing the monomer of phenolphthalin (PPL) containing carboxyl to the molecule backbone of polysulfone (PSF). And a series of PSF-COOH copolymers with different carboxylation degree was synthesized by adjusting the molar (%) of bisphenol A (BPA) and PPL in direct copolymerization method and was prepared as PSF-COOH ultrafiltration membranes via phase separation method. The effect of PPL molar (%) in copolymers on the morphology, hydrophilicity, permeation flux, antifouling and mechanical properties of membranes was investigated by scanning electron microscope (SEM), atomic force microscope (AFM), water contact angle, ultrafiltration experiments and universal testing machine, respectively. The results showed that with the increased carboxyl content in membranes, the hydrophilicity, permeation fluxes and antifouling properties of membranes gradually increased. When the molar (%) of PPL to BPA was 100:0, the membrane exhibited the highest pure water flux (329.6 L/m"2 h) and the maximum flux recovery rate (92.5%). When the content of carboxyl in the membrane was 80% or more, after three cycles of BSA solution (1 g/L) filtration, the flux recovery rate was basically constant or showed a slightly increase. Thus, it can achieve the goal of

  17. Preparation of hydrophilic and antifouling polysulfone ultrafiltration membrane derived from phenolphthalin by copolymerization method

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Zhixiao; Mi, Zhiming; Chen, Chunhai; Zhou, Hongwei; Zhao, Xiaogang; Wang, Daming, E-mail: wangdaming@jlu.edu.cn

    2017-04-15

    Graphical abstract: The mechanisms fouling and cleaning process of PSF-COOH membranes (A) the content of carboxyl less than 80%. (B) the content of carboxyl at 80%, 100%. - Highlights: • Phenolphthalin (PPL) containing carboxyl was successfully introduced into the molecule backbone of polysulfone (PSF). • A series of PSF-COOH copolymers with different carboxylation degree was synthesized and prepared as ultrafiltration membranes. • The introduction of PPL significantly improved the hydrophilicity, permeation flux and antifouling property of membranes. • This method is valuable for large-scale industrial production of hydrophilic membrane material. - Abstract: In this task, carboxylated polysulfone (PSF-COOH) was achieved by introducing the monomer of phenolphthalin (PPL) containing carboxyl to the molecule backbone of polysulfone (PSF). And a series of PSF-COOH copolymers with different carboxylation degree was synthesized by adjusting the molar (%) of bisphenol A (BPA) and PPL in direct copolymerization method and was prepared as PSF-COOH ultrafiltration membranes via phase separation method. The effect of PPL molar (%) in copolymers on the morphology, hydrophilicity, permeation flux, antifouling and mechanical properties of membranes was investigated by scanning electron microscope (SEM), atomic force microscope (AFM), water contact angle, ultrafiltration experiments and universal testing machine, respectively. The results showed that with the increased carboxyl content in membranes, the hydrophilicity, permeation fluxes and antifouling properties of membranes gradually increased. When the molar (%) of PPL to BPA was 100:0, the membrane exhibited the highest pure water flux (329.6 L/m{sup 2} h) and the maximum flux recovery rate (92.5%). When the content of carboxyl in the membrane was 80% or more, after three cycles of BSA solution (1 g/L) filtration, the flux recovery rate was basically constant or showed a slightly increase. Thus, it can achieve the

  18. Determination of losartan potassium, quinapril hydrochloride and hydrochlorothiazide in pharmaceutical preparations using derivative spectrophotometry and chromatographic-densitometric method.

    Science.gov (United States)

    Stolarczyk, Mariusz; Maślanka, Anna; Apola, Anna; Krzek, Jan

    2013-01-01

    Two methods, spectrophotometric and chromatographic-densitometric ones, were developed for determination of losartan potassium, quinapril hydrochloride and hydrochlorothiazide in pharmaceutical preparations. Spectrophotometric method involved derivative spectrophotometry and zero order spectrophotometry. The measurements were carried out at lambda = 224.0 nm for quinapril, lambda = 261.0 nm for hydrochlorothiazide and lambda = 270.0 nm for losartan when the derivative spectrophotometry was applied and lambda = 317.0 nm when zero order spectrophotometry was applied for the determination of hydrochlorothiazide. In chromatographic-densitometric studies high performance thin layer chromatography (HPTLC) plates were used as stationary phase and a mixture of solvents n-butanol : acetic acid : water (15 : 5 : 1, v/v/v) as mobile phase. Under the established conditions good resolution of examined constituents was obtained. Retardation factor for quinapril hydrochloride was R(f) - 0.70, for losartan potassium R(f) - 0.85 and for hydrochlorothiazide R(f) - 0.78. The developed methods are characterized by high sensitivity and accuracy. For quantitative analysis, densitometric measurements were carried out at lambda = 218.0 nm for quinapril, lambda = 275.0 nm for hydrochlorothiazide and = 232.0 nm for losartan.

  19. The performance of selected semi-empirical and DFT methods in studying C₆₀ fullerene derivatives.

    Science.gov (United States)

    Sikorska, Celina; Puzyn, Tomasz

    2015-11-13

    The capability of reproducing the open circuit voltages (V(oc)) of 15 representative C60 fullerene derivatives was tested using the selected quantum mechanical methods (B3LYP, PM6, and PM7) together with the two one-electron basis sets. Certain theoretical treatments (e.g. PM6) were found to be satisfactory for preliminary estimates of the open circuit voltages (V(oc)), whereas the use of the B3LYP/6-31G(d) approach has been proven to assure highly accurate results. We also examined the structural similarity of 19 fullerene derivatives by employing principle component analysis (PCA). In order to express the structural features of the studied compounds we used molecular descriptors calculated with semi-empirical (PM6 and PM7) and density functional (B3LYP/6-31G(d)) methods separately. In performing PCA, we noticed that semi-empirical methods (i.e. PM6 and PM7) seem satisfactory for molecules, in which one can distinguish the aromatic and the aliphatic parts in the cyclopropane ring of PCBM (phenyl-C61-buteric acid methyl ester) and they significantly overestimate the energy of the highest occupied molecular orbital (E(HOMO)). The use of the B3LYP functional, however, is recommended for studying methanofullerenes, which closely resemble the structure of PCBM, and for their modifications.

  20. Development of a rapid culture method to induce adipocyte differentiation of human bone marrow-derived mesenchymal stem cells

    International Nuclear Information System (INIS)

    Ninomiya, Yuichi; Sugahara-Yamashita, Yzumi; Nakachi, Yutaka; Tokuzawa, Yoshimi; Okazaki, Yasushi; Nishiyama, Masahiko

    2010-01-01

    Human mesenchymal stem cells (hMSCs) derived from bone marrow are multipotent stem cells that can regenerate mesenchymal tissues such as adipose, bone or muscle. It is thought that hMSCs can be utilized as a cell resource for tissue engineering and as human models to study cell differentiation mechanisms, such as adipogenesis, osteoblastogenesis and so on. Since it takes 2-3 weeks for hMSCs to differentiate into adipocytes using conventional culture methods, the development of methods to induce faster differentiation into adipocytes is required. In this study we optimized the culture conditions for adipocyte induction to achieve a shorter cultivation time for the induction of adipocyte differentiation in bone marrow-derived hMSCs. Briefly, we used a cocktail of dexamethasone, insulin, methylisobutylxanthine (DIM) plus a peroxisome proliferator-activated receptor γ agonist, rosiglitazone (DIMRo) as a new adipogenic differentiation medium. We successfully shortened the period of cultivation to 7-8 days from 2-3 weeks. We also found that rosiglitazone alone was unable to induce adipocyte differentiation from hMSCs in vitro. However, rosiglitazone appears to enhance hMSC adipogenesis in the presence of other hormones and/or compounds, such as DIM. Furthermore, the inhibitory activity of TGF-β1 on adipogenesis could be investigated using DIMRo-treated hMSCs. We conclude that our rapid new culture method is very useful in measuring the effect of molecules that affect adipogenesis in hMSCs.

  1. Body burden of pesticides and wastewater-derived pollutants on freshwater invertebrates: Method development and application in the Danube River.

    Science.gov (United States)

    Inostroza, Pedro A; Wicht, Anna-Jorina; Huber, Thomas; Nagy, Claudia; Brack, Werner; Krauss, Martin

    2016-07-01

    While environmental risk assessment is typically based on toxicant concentrations in water and/or sediment, awareness is increasing that internal concentrations or body burdens are the key to understand adverse effects in organisms. In order to link environmental micropollutants as causes of observed effects, there is an increasing demand for methods to analyse these chemicals in organisms. Here, a multi-target screening method based on pulverised liquid extraction (PuLE) and a modified QuEChERS approach with an additional hexane phase was developed. It is capable to extract and quantify organic micropollutants of diverse chemical classes in freshwater invertebrates. The method was tested on gammarids from the Danube River (within the Joint Danube Survey 3) and target compounds were analysed by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Furthermore, a non-target screening using high resolution-tandem mass spectrometry (LC-HRMS/MS) was conducted. A total of 17 pollutants were detected and/or quantified in gammarids at low concentrations. Pesticide concentrations ranged from 0.1 to 6.52 ng g(-1) (wet weight), those of wastewater-derived pollutants from 0.1 to 2.83 ng g(-1) (wet weight). The presence of wastewater-derived pollutants was prominent at all spots sampled. Using non-target screening, we could successfully identify several chlorinated compounds. These results demonstrate for the first time the presence of pesticides and wastewater-derived pollutants in invertebrates of the Danube River. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Effects of the curing methods on the fabrication of polycarbosilane derived SiCf/SiC composite

    International Nuclear Information System (INIS)

    Park, Ji Yeon; Kim, Weon Ju; Ryu, Woo Seog; Woo, Chang Hyun; Han, Bum Soo

    2005-01-01

    Silicon carbide has potential advantages for structural applications in the next generation energy system- VHTR, GFR and the fusion reactor due to its unique properties such as a good irradiation resistance and thermo-mechanical properties, less severe waste generation due to neutron activation and improved plant conversion efficiencies by higher operating temperatures. Among the several fabrication processes for SiC f /SiC composites, the polymer impregnation and pyrolysis (PIP) process is the only method derived from polymeric precursors. In the PIP process, the careful control of the oxygen content is important to avoid the property degradation at a high temperature because polymeric precursors are used as source materials of SiC ceramics. During the polymer precursor conversion process, unintended oxygen may be introduced for a cross-linking with producing the Si-O-Si bonds at the curing step. High oxygen content affects the degradation of the high temperature stability in SiC ceramics. Therefore, a decrease of the oxygen content is desirable to obtain SiC ceramics with the high temperature stability. One of the methods to reduce the oxygen content of polymer derived SiC ceramics is the irradiation curing process by gamma ray or electron beam. Polymer derived SiC ceramics with the low oxygen content prepared by the electron beam curing showed the improved thermal stability at a higher temperature. In this study, the electron beam (EB) and the thermal oxidation curing methods were applied to make SiC f /SiC composite using a polymer precursor, polycarbosilane (PCS) by the PIP process. And the evaluations of the curing effects, the pyrolysis behaviors and a high temperature stability were performed

  3. Reference Values for Spirometry Derived Using Lambda, Mu, Sigma (LMS) Method in Korean Adults: in Comparison with Previous References.

    Science.gov (United States)

    Jo, Bum Seak; Myong, Jun Pyo; Rhee, Chin Kook; Yoon, Hyoung Kyu; Koo, Jung Wan; Kim, Hyoung Ryoul

    2018-01-15

    The present study aimed to update the prediction equations for spirometry and their lower limits of normal (LLN) by using the lambda, mu, sigma (LMS) method and to compare the outcomes with the values of previous spirometric reference equations. Spirometric data of 10,249 healthy non-smokers (8,776 females) were extracted from the fourth and fifth versions of the Korea National Health and Nutrition Examination Survey (KNHANES IV, 2007-2009; V, 2010-2012). Reference equations were derived using the LMS method which allows modeling skewness (lambda [L]), mean (mu [M]), and coefficient of variation (sigma [S]). The outcome equations were compared with previous reference values. Prediction equations were presented in the following form: predicted value = e{a + b × ln(height) + c × ln(age) + M - spline}. The new predicted values for spirometry and their LLN derived using the LMS method were shown to more accurately reflect transitions in pulmonary function in young adults than previous prediction equations derived using conventional regression analysis in 2013. There were partial discrepancies between the new reference values and the reference values from the Global Lung Function Initiative in 2012. The results should be interpreted with caution for young adults and elderly males, particularly in terms of the LLN for forced expiratory volume in one second/forced vital capacity in elderly males. Serial spirometry follow-up, together with correlations with other clinical findings, should be emphasized in evaluating the pulmonary function of individuals. Future studies are needed to improve the accuracy of reference data and to develop continuous reference values for spirometry across all ages. © 2018 The Korean Academy of Medical Sciences.

  4. Micellar HPLC and derivative spectrophotometric methods for the simultaneous determination of fluconazole and tinidazole in pharmaceuticals and biological fluids.

    Science.gov (United States)

    Belal, F; Sharaf El-Din, M K; Eid, M I; El-Gamal, R M

    2014-04-01

    Micellar high-performance liquid chromatography (HPLC) and first-derivative ultraviolet spectrophotometry were used to simultaneously determine fluconazole (FLZ) and tinidazole (TNZ) in combined pharmaceutical dosage forms. The derivative procedure is based on the linear relationship between the drug concentration and the first derivative amplitudes at 220 and 288 nm for FLZ and TNZ, respectively. The calibration graphs were linear in the range of 1.5-9.0 µg/mL for FLZ and 10.0-60.0 µg/mL for TNZ. Furthermore, an HPLC procedure with ultraviolet detection at 210 nm was developed. For the HPLC procedure, good chromatographic separation was achieved using an ODS C18 column (250 × 4.6 mm i.d.). The mobile phase containing 0.15M sodium dodecyl sulphate, 0.3% triethylamine and 12% n-propanol in 0.02M orthophosphoric acid at pH 5.5 was pumped at a flow rate of 1 mL/min. Indapamide was used as an internal standard. The method showed good linearity over the concentration ranges of 1.5-30.0 and 10.0-200.0 µg/mL, with limits of detection of 0.36 and 2.70 µg/mL and limits of quantification of 1.1 and 8.2 µg/mL for FLZ and TNZ, respectively. The suggested methods were successfully applied for the simultaneous analysis of the drugs in their laboratory prepared mixture, co-formulated tablet and single dosage forms. Moreover the second method was also extended to the determination of the drugs in biological fluids.

  5. CHF predictor derived from a 3D thermal-hydraulic code and an advanced statistical method

    International Nuclear Information System (INIS)

    Banner, D.; Aubry, S.

    2004-01-01

    A rod bundle CHF predictor has been determined by using a 3D code (THYC) to compute local thermal-hydraulic conditions at the boiling crisis location. These local parameters have been correlated to the critical heat flux by using an advanced statistical method based on spline functions. The main characteristics of the predictor are presented in conjunction with a detailed analysis of predictions (P/M ratio) in order to prove that the usual safety methodology can be applied with such a predictor. A thermal-hydraulic design criterion is obtained (1.13) and the predictor is compared with the WRB-1 correlation. (author)

  6. Influence of DNA extraction methods, PCR inhibitors and quantification methods on real-time PCR assay of biotechnology-derived traits.

    Science.gov (United States)

    Demeke, Tigst; Jenkins, G Ronald

    2010-03-01

    Biotechnology-derived varieties of canola, cotton, corn and soybean are being grown in the USA, Canada and other predominantly grain exporting countries. Although the amount of farmland devoted to production of biotechnology-derived crops continues to increase, lingering concerns that unintended consequences may occur provide the EU and most grain-importing countries with justification to regulate these crops. Legislation in the EU requires traceability of grains/oilseeds, food and feed products, and labelling, when a threshold level of 0.9% w/w of genetically engineered trait is demonstrated to be present in an analytical sample. The GE content is routinely determined by quantitative PCR (qPCR) and plant genomic DNA provides the template for the initial steps in this process. A plethora of DNA extraction methods exist for qPCR applications. Implementing standardized methods for detection of genetically engineered traits is necessary to facilitate grain marketing. The International Organization for Standardization draft standard 21571 identifies detergent-based methods and commercially available kits that are widely used for DNA extraction, but also indicates that adaptations may be necessary depending upon the sample matrix. This review assesses advantages and disadvantages of various commercially available DNA extraction kits, as well as modifications to published cetyltrimethylammonium bromide methods. Inhibitors are a major obstacle for efficient amplification in qPCR. The types of PCR inhibitors and techniques to minimize inhibition are discussed. Finally, accurate quantification of DNA for applications in qPCR is not trivial. Many confounders contribute to differences in analytical measurements when a particular DNA quantification method is applied and different methods do not always provide concordant results on the same DNA sample. How these differences impact measurement uncertainty in qPCR is considered.

  7. Synthesis of novel chalcone derivatives by conventional and microwave irradiation methods and their pharmacological activities

    Directory of Open Access Journals (Sweden)

    Mohammed Rayees Ahmad

    2016-09-01

    Full Text Available Chalcones are abundant in edible plants and are considered to be the precursors of flavonoids and isoflavonoids. Chalcones belong to an important class of flavonoids, which may be prepared by Claisen–Schmidt condensation. They possess a wide range of biological activities and industrial applications. The cytotoxicity against tumour cell lines may be the result of disruption of the cell cycle, inhibition of angiogenesis, interference with p53-MDM2 interaction, mitochondrial uncoupling or induction of apoptosis. Chalcones are synthesized by conventional and microwave assisted synthesis methods. By microwave assisted synthesis, a considerable increase in the reaction rate has been observed and that too, with better yields. The compounds have been screened for cytotoxic activity and antioxidant activity.

  8. A method to assess the migration properties of cell-derived microparticles within a living tissue.

    Science.gov (United States)

    Hoang, Thang Q; Rampon, Christine; Freyssinet, Jean-Marie; Vriz, Sophie; Kerbiriou-Nabias, Danièle

    2011-09-01

    Cells undergoing activation or apoptosis exhibit plasma membrane changes, leading to the formation of shed vesicles (microparticles, MP). Although their effects on recipient cells in vitro, and their ability to support inflammatory or thrombotic events in the circulation have been studied, the spreading of such vesicles in tissues is still elusive. Our aim was to set up a method to examine the behavior of these vesicles in vivo. We examined the persistence of green-fluorescent microparticles (fMP), prepared after Ca2+ ionophore activation (iono-fMP) or apoptogenic treatment (eto-fMP) of human Jurkat T lymphoblastic or non-hematopoietic embryonic kidney (HEK) cell lines, following injection in zebrafish embryos 2h after egg fertilization. One hour post-injection, iono-fMP issued from both cell types formed a fluorescent dispersal in the intercellular space of embryos. In contrast, eto-fMP or MP deprived of sialic acid at their membrane, gathered together at the site of injection. We propose a method characterizing the abilities of MP to spread in the intercellular space. We showed that MP produced by apoptosis of T cells and those deprived of sialic acid at their membrane do not diffuse within the living cells. On the contrary, MP shed upon calcium induced activation of T and HEK cells, diffuse at a distance and spread in the intercellular space. The fate of injected MP relies on the type of induction rather than the cell species and results provide a model to test the ability of vesicles to interact locally or to spread outside of the site of production. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. The Method of Analysis Derived Coefficients of Database as a New Method of Historical Research (for Example, a Database of Ballistic Parameters of Naval Artillery

    Directory of Open Access Journals (Sweden)

    Nicholas W. Mitiukov

    2015-12-01

    Full Text Available In paper there is proposed a new method of historical research, based on analysis of derivatives coefficients of database (for example, the form factor in the database of ballistic data. This method has a much greater protection from subjectivism and direct falsification, compared with the analysis obtained directly from the source of the numerical series, as any intentional or unintentional distortion of the raw data provides a significant contrast ratio derived from the average sample values. Application of this method to the analysis of ballistic data base of naval artillery allowed to find the facts, forcing a new look at some of the events in the history data on the German naval artillery before World War I, probably overpriced for disinformation opponents of the Entente; during the First World War, Spain, apparently held secret talks with the firm Bofors ended purchase of Swedish shells; the first Russian naval rifled guns were created obvious based on the project Blackly, not Krupp as traditionally considered.

  10. Government Districts, Other, Sedgwick County Board of County Commissioner district boundaries. Derived from countywide Elections coverage. Primary attributes include District number and respresentative name. Includes district number annotation. Published to scbocc_a.shp., Published in 2008, 1:1200 (1in=100ft) scale, Sedgwick County Government.

    Data.gov (United States)

    NSGIC Local Govt | GIS Inventory — Government Districts, Other dataset current as of 2008. Sedgwick County Board of County Commissioner district boundaries. Derived from countywide Elections coverage....

  11. Simultaneous Estimation of Ibuprofen and Phenylephrine Hydrochloride in Bulk and Combined Dosage Form by First Derivative UV Spectrophotometry Method

    Directory of Open Access Journals (Sweden)

    Mehul Patel

    2013-01-01

    Full Text Available A simple, precise, rapid, and economic method was developed for the simultaneous determination of Ibuprofen and Phenylephrine HCl in bulk and combined dosage form. This method involves first-order derivative spectroscopy using 248 nm and 237 nm as zero crossing points for Ibuprofen and Phenylephrine HCl, respectively. For spectrophotometric method 0.1 N NaOH was used as a solvent. The linearity was established over the concentration range of 12–72 μg/mL and 1.5–22 μg/mL for Ibuprofen and Phenylephrine HCl with correlation coefficient (r2 of 0.9972 and 0.9981, respectively. The mean % recoveries were found to be in the range of 98.88% and 98.54% for Ibuprofen and Phenylephrine HCl, respectively. Interday and intraday studies showed repeatability of the method. The method was found to be specific and robust. The method was successfully applied to pharmaceutical formulation, with no interference from excipients as indicated by the recovery study. Results of analysis were validated statistically and by recovery studies.

  12. Evolution of poor reporting and inadequate methods over time in 20 920 randomised controlled trials included in Cochrane reviews: research on research study.

    Science.gov (United States)

    Dechartres, Agnes; Trinquart, Ludovic; Atal, Ignacio; Moher, David; Dickersin, Kay; Boutron, Isabelle; Perrodeau, Elodie; Altman, Douglas G; Ravaud, Philippe

    2017-06-08

    Objective  To examine how poor reporting and inadequate methods for key methodological features in randomised controlled trials (RCTs) have changed over the past three decades. Design  Mapping of trials included in Cochrane reviews. Data sources  Data from RCTs included in all Cochrane reviews published between March 2011 and September 2014 reporting an evaluation of the Cochrane risk of bias items: sequence generation, allocation concealment, blinding, and incomplete outcome data. Data extraction  For each RCT, we extracted consensus on risk of bias made by the review authors and identified the primary reference to extract publication year and journal. We matched journal names with Journal Citation Reports to get 2014 impact factors. Main outcomes measures  We considered the proportions of trials rated by review authors at unclear and high risk of bias as surrogates for poor reporting and inadequate methods, respectively. Results  We analysed 20 920 RCTs (from 2001 reviews) published in 3136 journals. The proportion of trials with unclear risk of bias was 48.7% for sequence generation and 57.5% for allocation concealment; the proportion of those with high risk of bias was 4.0% and 7.2%, respectively. For blinding and incomplete outcome data, 30.6% and 24.7% of trials were at unclear risk and 33.1% and 17.1% were at high risk, respectively. Higher journal impact factor was associated with a lower proportion of trials at unclear or high risk of bias. The proportion of trials at unclear risk of bias decreased over time, especially for sequence generation, which fell from 69.1% in 1986-1990 to 31.2% in 2011-14 and for allocation concealment (70.1% to 44.6%). After excluding trials at unclear risk of bias, use of inadequate methods also decreased over time: from 14.8% to 4.6% for sequence generation and from 32.7% to 11.6% for allocation concealment. Conclusions  Poor reporting and inadequate methods have decreased over time, especially for sequence generation

  13. Mutagenicity of basic fractions derived from lamb and beef cooked by common household methods.

    Science.gov (United States)

    Barrington, P J; Baker, R S; Truswell, A S; Bonin, A M; Ryan, A J; Paulin, A P

    1990-03-01

    Mutagen production was examined in lamb and beef in relation to certain common household cooking methods. Mutagenicity was assessed, after extraction of the basic fraction of cooked meat samples, using Salmonella typhimurium strain TA1538 with added rat-liver S-9 homogenate. Little or no mutagenicity was found in barbecued lamb chops, in microwave-cooked lamb chops, sirloin steak, leg of lamb, or rolled beef loaf, in roasted leg of lamb or rolled beef loaf, in stewed blade steak or in boiled chuck steak. However, the basic fraction from well-done, edible fried or grilled meat contained mutagenic activity equivalent to approximately 30,000 TA1538 revertants/100 g cooked meat. It was found tht the mutagenic activity of grilled lamb chops, sirloin and rump steaks was directly related to the average surface temperatures attained during cooking. Use of butter as a frying medium was particularly associated with higher mutagenicity in meat samples. Fried meats (rump and fillet steaks) generally yielded higher mutagenic activity than did grilled meats (rump steak, lamb chops) at comparable temperatures of the cooking medium. Using similar cooking procedures, lamb did not differ markedly from beef in mutagenic activity.

  14. A new symmetry-based scoring method for posture assessment: evaluation of the effect of insoles with mineral derivatives.

    Science.gov (United States)

    Masse, M; Gaillardetz, C; Cron, C; Abribat, T

    2000-01-01

    There is a need for a validated rapid procedure for the evaluation of posture, defined as lateral balance/imbalance at the pelvic, shoulder, and neck levels. This would enable clinicians to determine the importance of symmetry in the pathophysiology of musculoskeletal disorders and to assess the efficacy of devices and treatments claiming to normalize or improve posture. In this investigation, the efficacy of such a device, a set of insoles with a hypothesized proprioceptive-like action, was evaluated through use of the described procedure. To develop a new scoring system to evaluate body posture on the basis of symmetry and to use this scoring system to investigate the efficacy of insoles containing a combination of mineral derivatives designed to balance posture through a neurophysiological effect. The posture score was based on the evaluation of 4 postural parameters: pelvic and shoulder lateral balance/imbalance, static shoulder rotation, and amplitude of head rotation. In the placebo-controlled study, 32 patients were tested in a double-blind fashion, either with placebo insoles or with insoles containing mineral derivatives. The same study was repeated in unblind conditions in 137 patients selected from 2 chiropractic clinics in an open-label protocol. A crossover placebo-controlled, double-blind study and a multicenter, large-scale, open-label study in patients selected from chiropractic clinics. A basal postural evaluation in 137 patients revealed that no patient had a perfect symmetry-ie, a perfectly or nearly perfectly balanced posture. The insoles with mineral derivatives induced a highly significant and similar improvement in the postural score in both the crossover double-blind study (32 patients; 56.7% improvement) and the open-label study (137 patients; 60.7% improvement, P postural imbalances according to the newly developed scoring method, and this method was successful in assessing the efficacy of insoles exerting a profound and immediate postural

  15. Metabolism of arachidonic acid derivatives (prostaglandins and related compounds). Radioimmunological methods to measure certain of these compounds

    International Nuclear Information System (INIS)

    Sors, Herve.

    1978-06-01

    The detection of prostaglandins, present in tissues at concentrations of about 10 -7 to 10 -11 g/g and able to induce physiological effects at concentrations of the picomole order, sets the analyst a particularly difficult problem. Owing to the complexity of their metabolism, the existence of many structurally similar compounds and the low concentrations present, it is necessary to develop highly specific and sensitive methods. Suitable techniques are: the biological activity test or biotest; gas-liquid chromatogaphy combined with mass spectrometry; the radioimmunological method. The radioimmunological analysis procedure is developed: preparation of immunogens and immunisation; preparation of tracers; treatment of biological samples. The different radioimmunological systems are presented: determination of antiserum affinity constants; dose-response curves and sensitivities; specificities; applications to biological measurements. Some remarks are called for concerning the RIA of prostaglandins: the difficulty of obtaining antisera seems to depend on the nature of the PG, a good anti-PGB or PGFα is easier to get than an anti-PGA or PGE. The analysis of each compound implies the use of a corresponding immunoserum and it is therefore essential to have a range of immunosera in order to study as large a number of biosynthesis derivatives as possible; too many physiological investigations are still viewed in relation to one PG only (often a primary PG) at the expense of other derivatives [fr

  16. Development of new method and protocol for cryopreservation related to embryo and oocytes freezing in terms of fertilization rate: A comparative study including review of literature.

    Science.gov (United States)

    Barik, Mayadhar; Bajpai, Minu; Patnaik, Santosh; Mishra, Pravash; Behera, Priyamadhaba; Dwivedi, Sada Nanda

    2016-01-01

    Cryopreservation is basically related to meritorious thin samples or small clumps of cells that are cooled quickly without loss. Our main objective is to establish and formulate an innovative method and protocol development for cryopreservation as a gold standard for clinical uses in laboratory practice and treatment. The knowledge regarding usefulness of cryopreservation in clinical practice is essential to carry forward the clinical practice and research. We are trying to compare different methods of cryopreservation (in two dozen of cells) at the same time we compare the embryo and oocyte freezing interms of fertilization rate according to the International standard protocol. The combination of cryoprotectants and regimes of rapid cooling and rinsing during warming often allows successful cryopreservation of biological materials, particularly cell suspensions or thin tissue samples. Examples include semen, blood, tissue samples like tumors, histological cross-sections, human eggs and human embryos. Although presently many studies have reported that the children born from frozen embryos or "frosties," show consistently positive results with no increase in birth defects or development abnormalities is quite good enough and similar to our study (50-85%). We ensure that cryopreservation technology provided useful cell survivability, tissue and organ preservation in a proper way. Although it varies according to different laboratory conditions, it is certainly beneficial for patient's treatment and research. Further studies are needed for standardization and development of new protocol.

  17. On Numerical Methods for Including the Effect of Capillary Pressure Forces on Two-phase, Immiscible Flow in a Layered Porous Medium

    Energy Technology Data Exchange (ETDEWEB)

    Ersland, B.G.

    1996-05-01

    This mathematical doctoral thesis contains the theory, algorithms and numerical simulations for a heterogeneous oil reservoir. It presents the equations, which apply to immiscible and incompressible two-phase fluid flow in the reservoir, including the effect of capillary pressure forces, and emphasises in particular the interior boundary conditions at the interface between two sediments. Two different approaches are discussed. The first approach is to decompose the computational domain along the interior boundary and iterate between the subdomains until mass balance is achieved. The second approach accounts for the interior boundary conditions in the basis in which the solution is expanded, the basis being discontinuous over the interior boundaries. An overview of the construction of iterative solvers for partial differential equations by means of Schwartz methods is given, and the algorithm for local refinement with Schwartz iterations as iterative solver is described. The theory is then applied to a core plug problem in one and two space dimensions and the results of different methods compared. A general description is given of the computer simulation model, which is implemented in C++. 64 refs., 49 figs., 7 tabs.

  18. Derivatization method of free cyanide including cyanogen chloride for the sensitive analysis of cyanide in chlorinated drinking water by liquid chromatography-tandem mass spectrometry.

    Science.gov (United States)

    Kang, Hye-In; Shin, Ho-Sang

    2015-01-20

    A novel derivatization method of free cyanide (HCN + CN(-)) including cyanogen chloride in chlorinated drinking water was developed with d-cysteine and hypochlorite. The optimum conditions (0.5 mM D-cysteine, 0.5 mM hypochlorite, pH 4.5, and a reaction time of 10 min at room temperature) were established by the variation of parameters. Cyanide (C(13)N(15)) was chosen as an internal standard. The formed β-thiocyanoalanine was directly injected into a liquid chromatography-tandem mass spectrometer without any additional extraction or purification procedures. Under the established conditions, the limits of detection and the limits of quantification were 0.07 and 0.2 μg/L, respectively, and the interday relative standard deviation was less than 4% at concentrations of 4.0, 20.0, and 100.0 μg/L. The method was successfully applied to determine CN(-) in chlorinated water samples. The detected concentration range and detection frequency of CN(-) were 0.20-8.42 μg/L (14/24) in source drinking water and 0.21-1.03 μg/L (18/24) in chlorinated drinking water.

  19. Normal mode analysis as a method to derive protein dynamics information from the Protein Data Bank.

    Science.gov (United States)

    Wako, Hiroshi; Endo, Shigeru

    2017-12-01

    Normal mode analysis (NMA) can facilitate quick and systematic investigation of protein dynamics using data from the Protein Data Bank (PDB). We developed an elastic network model-based NMA program using dihedral angles as independent variables. Compared to the NMA programs that use Cartesian coordinates as independent variables, key attributes of the proposed program are as follows: (1) chain connectivity related to the folding pattern of a polypeptide chain is naturally embedded in the model; (2) the full-atom system is acceptable, and owing to a considerably smaller number of independent variables, the PDB data can be used without further manipulation; (3) the number of variables can be easily reduced by some of the rotatable dihedral angles; (4) the PDB data for any molecule besides proteins can be considered without coarse-graining; and (5) individual motions of constituent subunits and ligand molecules can be easily decomposed into external and internal motions to examine their mutual and intrinsic motions. Its performance is illustrated with an example of a DNA-binding allosteric protein, a catabolite activator protein. In particular, the focus is on the conformational change upon cAMP and DNA binding, and on the communication between their binding sites remotely located from each other. In this illustration, NMA creates a vivid picture of the protein dynamics at various levels of the structures, i.e., atoms, residues, secondary structures, domains, subunits, and the complete system, including DNA and cAMP. Comparative studies of the specific protein in different states, e.g., apo- and holo-conformations, and free and complexed configurations, provide useful information for studying structurally and functionally important aspects of the protein.

  20. A Robust Algorithm of Multiquadric Method Based on an Improved Huber Loss Function for Interpolating Remote-Sensing-Derived Elevation Data Sets

    Directory of Open Access Journals (Sweden)

    Chuanfa Chen

    2015-03-01

    Full Text Available Remote-sensing-derived elevation data sets often suffer from noise and outliers due to various reasons, such as the physical limitations of sensors, multiple reflectance, occlusions and low contrast of texture. Outliers generally have a seriously negative effect on DEM construction. Some interpolation methods like ordinary kriging (OK are capable of smoothing noise inherent in sample points, but are sensitive to outliers. In this paper, a robust algorithm of multiquadric method (MQ based on an Improved Huber loss function (MQ-IH has been developed to decrease the impact of outliers on DEM construction. Theoretically, the improved Huber loss function is null for outliers, quadratic for small errors, and linear for others. Simulated data sets drawn from a mathematical surface with different error distributions were employed to analyze the robustness of MQ-IH. Results indicate that MQ-IH obtains a good balance between efficiency and robustness. Namely, the performance of MQ-IH is comparative to those of the classical MQ and MQ based on the Classical Huber loss function (MQ-CH when sample points follow a normal distribution, and the former outperforms the latter two when sample points are subject to outliers. For example, for the Cauchy error distribution with the location parameter of 0 and scale parameter of 1, the root mean square errors (RMSEs of MQ-CH and the classical MQ are 0.3916 and 1.4591, respectively, whereas that of MQ-IH is 0.3698. The performance of MQ-IH is further evaluated by qualitative and quantitative analysis through a real-world example of DEM construction with the stereo-images-derived elevation points. Results demonstrate that compared with the classical interpolation methods, including natural neighbor (NN, OK and ANUDEM (a program that calculates regular grid digital elevation models (DEMs with sensible shape and drainage structure from arbitrarily large topographic data sets, and two versions of MQ, including the

  1. Purification and differentiation of human adipose-derived stem cells by membrane filtration and membrane migration methods

    Science.gov (United States)

    Lin, Hong Reng; Heish, Chao-Wen; Liu, Cheng-Hui; Muduli, Saradaprasan; Li, Hsing-Fen; Higuchi, Akon; Kumar, S. Suresh; Alarfaj, Abdullah A.; Munusamy, Murugan A.; Hsu, Shih-Tien; Chen, Da-Chung; Benelli, Giovanni; Murugan, Kadarkarai; Cheng, Nai-Chen; Wang, Han-Chow; Wu, Gwo-Jang

    2017-01-01

    Human adipose-derived stem cells (hADSCs) are easily isolated from fat tissue without ethical concerns, but differ in purity, pluripotency, differentiation ability, and stem cell marker expression, depending on the isolation method. We isolated hADSCs from a primary fat tissue solution using: (1) conventional culture, (2) a membrane filtration method, (3) a membrane migration method where the primary cell solution was permeated through membranes, adhered hADSCs were cultured, and hADSCs migrated out from the membranes. Expression of mesenchymal stem cell markers and pluripotency genes, and osteogenic differentiation were compared for hADSCs isolated by different methods using nylon mesh filter membranes with pore sizes ranging from 11 to 80 μm. hADSCs isolated by the membrane migration method had the highest MSC surface marker expression and efficient differentiation into osteoblasts. Osteogenic differentiation ability of hADSCs and MSC surface marker expression were correlated, but osteogenic differentiation ability and pluripotent gene expression were not. PMID:28071738

  2. Analysis of eleven phenolic compounds including novel p-coumaroyl derivatives in lettuce (Lactuca sativa L.) by ultra-high-performance liquid chromatography with photodiode array and mass spectrometry detection.

    Science.gov (United States)

    Ribas-Agustí, Albert; Gratacós-Cubarsí, Marta; Sárraga, Carmen; García-Regueiro, José-Antonio; Castellari, Massimo

    2011-01-01

    Lettuce is a widely consumed vegetable and a good source of phenolic compounds. Several factors (genetic, agronomical and environmental) can influence the lettuce composition; their effects are not completely defined and more studies are needed on this topic. To develop an improved ultra-high-performance liquid chromatography (UHPLC) method to quantify the main target intact phenolic compounds in lettuce. UHPLC identification of the compounds was supported by PAD spectra and MS(n) analyses. Quantification was carried out by PAD, by creating matrix-matched calibration curves at the specific wavelength for each compound. Sample pretreatment was simplified, with neither purification nor hydrolysis steps. Chromatographic conditions were chosen to minimise matrix interferences and to give a suitable separation of the major phenolic compounds within 27 min. The method allowed the quantification of 11 intact phenolic compounds in Romaine lettuces, including phenolic acids (caffeoyl and p-coumaroyl esters) and flavonoids (quercetin glycosides). Four p-coumaroyl esters were tentatively identified and quantified for the first time in lettuce. The main intact phenolic compounds, including four novel p-coumaroyl esters, were simultaneously quantified in lettuce with optimal performances and a reduced total time of analysis. These findings make headway in the understanding of the lettuce phytochemicals with potential nutritional relevance. Copyright © 2011 John Wiley & Sons, Ltd.

  3. A novel baseline-correction method for standard addition based derivative spectra and its application to quantitative analysis of benzo(a)pyrene in vegetable oil samples.

    Science.gov (United States)

    Li, Na; Li, Xiu-Ying; Zou, Zhe-Xiang; Lin, Li-Rong; Li, Yao-Qun

    2011-07-07

    In the present work, a baseline-correction method based on peak-to-derivative baseline measurement was proposed for the elimination of complex matrix interference that was mainly caused by unknown components and/or background in the analysis of derivative spectra. This novel method was applicable particularly when the matrix interfering components showed a broad spectral band, which was common in practical analysis. The derivative baseline was established by connecting two crossing points of the spectral curves obtained with a standard addition method (SAM). The applicability and reliability of the proposed method was demonstrated through both theoretical simulation and practical application. Firstly, Gaussian bands were used to simulate 'interfering' and 'analyte' bands to investigate the effect of different parameters of interfering band on the derivative baseline. This simulation analysis verified that the accuracy of the proposed method was remarkably better than other conventional methods such as peak-to-zero, tangent, and peak-to-peak measurements. Then the above proposed baseline-correction method was applied to the determination of benzo(a)pyrene (BaP) in vegetable oil samples by second-derivative synchronous fluorescence spectroscopy. The satisfactory results were obtained by using this new method to analyze a certified reference material (coconut oil, BCR(®)-458) with a relative error of -3.2% from the certified BaP concentration. Potentially, the proposed method can be applied to various types of derivative spectra in different fields such as UV-visible absorption spectroscopy, fluorescence spectroscopy and infrared spectroscopy.

  4. A validated HPLC-UV method for the analysis of galloylquinic acid derivatives and flavonoids in Copaifera langsdorffii leaves.

    Science.gov (United States)

    Motta, Erick Vicente da Silva; da Costa, Juliana de Carvalho; Bastos, Jairo Kenupp

    2017-09-01

    Copaifera langsdorffii Desf. (Fabaceae, Caesalpinioideae), popularly known as "copaiba" or "pau d'óleo", is a species of tree that is found throughout Brazil. The leaves of this tree are used in folk medicine to treat kidney stones. Galloylquinic acid derivatives and flavonoids are the main secondary metabolites found in C. langsdorffii leaves and are likely to be responsible for the effectiveness of this treatment. As an attempt to produce a phytotherapic, we have developed a reliable HPLC-UV method for the quality control of C. langsdorffii leaves. Phenolic compounds were extracted from C. langsdorffii leaves using 70% aqueous ethanol as the extraction solvent. HPLC-UV analyses were carried out on a Synergi Polar-RP column (100×3.0mm, 2.5μm), and the mobile phase was made up of formic acid-water (0.1:99.9, solvent A), and isopropanol-methanol-acetonitrile (5:40:60, solvent B). The elution gradient was A:B (90:10 to 85:15) in 8.0min, followed by A:B (85:15 to 64:36) up to 30.0min, using a flow rate of 0.7mL/min, and UV detection at 280nm. This method was used to quantify nine galloylquinic acid derivatives and two flavonoids, which gave a good detection response and linearity in the range of 1.88-110.0μg/mL. Furthermore, the detection and quantification limits ranged from 0.070 to 0.752μg/mL, and 0.211-2.278μg/mL respectively, with a maximum RSD of 4.18%. The method is reliable for the quality control of C. langsdorffii raw material, its hydroethanolic extract, and could potentially be used to quantify these compounds in other Copaifera species. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Development and application of a selective detection method for genetically modified soy and soy-derived products.

    Science.gov (United States)

    Hoef, A M; Kok, E J; Bouw, E; Kuiper, H A; Keijer, J

    1998-10-01

    A method has been developed to distinguish between traditional soy beans and transgenic Roundup Ready soy beans, i.e. the glyphosate ('Roundup') resistant soy bean variety developed by Monsanto Company. Glyphosate resistance results from the incorporation of an Agrobacterium-derived 5-enol-pyruvyl-shikimate-3-phosphatesynthase (EPSPS) gene. The detection method developed is based on a nested Polymerase Chain Reaction (PCR) procedure. Ten femtograms of soy bean DNA can be detected, while, starting from whole soy beans, Roundup Ready DNA can be detected at a level of 1 Roundup Ready soy bean in 5000 non-GM soy beans (0.02% Roundup Ready soy bean). The method has been applied to samples of soy bean, soy-meal pellets and soy bean flour, as well as a number of processed complex products such as infant formula based on soy, tofu, tempeh, soy-based desserts, bakery products and complex meat and meat-replacing products. The results obtained are discussed with respect to practical application of the detection method developed.

  6. Development of a method to determine the effectiveness of cleaning agents in removal of biofilm derived spores in milking system

    Directory of Open Access Journals (Sweden)

    Ievgeniia Ostrov

    2016-09-01

    Full Text Available Microbial damages caused by biofilm forming bacteria in the dairy industry are a fundamental threat to safety and quality of dairy products. In order to ensure the optimal level of equipment hygiene in the dairy industry, it is necessary to determine the biofilm removal efficiency of cleaning agents used for cleaning-in-place procedures. However, currently there is no standard method available for evaluating and comparing cleaning agents for use in cleaning-in-place procedures in the dairy industry under realistic conditions. The present study aims to establish a cleaning-in-place model system to evaluate the effectiveness of cleaning agents in removal of biofilm derived spores from the surfaces of stainless steel which is the predominant substrate in milking equipment on dairy farms. The system is based on Bacillus subtilis spores surrounded with exopolymeric substances produced by bacteria during biofilm formation. The spores applied on sampling plates were mounted on T-junctions protruding 1.5 – 11-times the milk pipe diameter from the main loop to resemble different levels of cleaning difficulty. The cleaning tests were conducted using commercial alkaline detergents and caustic soda at conditions which are relevant to actual farm environment. The spores removal effect was evaluated by comparing the number of viable spores (attached to sampling plates before and after cleaning. Evaluation of the cleaning and disinfecting effect of cleaning agents towards biofilm derived spores was further performed, which indicates whether spores elimination effect of an agent is due to killing the spores or removing them from the surfaces of dairy equipment. Moreover, it was established that the presence of extracellular matrix is an important factor responsible for high level of cleaning difficulty characteristic for surface attached spores. In overall, the results of this study suggest that the developed model system simulates actual farm conditions for

  7. A deconvolution method for deriving the transit time spectrum for ultrasound propagation through cancellous bone replica models.

    Science.gov (United States)

    Langton, Christian M; Wille, Marie-Luise; Flegg, Mark B

    2014-04-01

    The acceptance of broadband ultrasound attenuation for the assessment of osteoporosis suffers from a limited understanding of ultrasound wave propagation through cancellous bone. It has recently been proposed that the ultrasound wave propagation can be described by a concept of parallel sonic rays. This concept approximates the detected transmission signal to be the superposition of all sonic rays that travel directly from transmitting to receiving transducer. The transit time of each ray is defined by the proportion of bone and marrow propagated. An ultrasound transit time spectrum describes the proportion of sonic rays having a particular transit time, effectively describing lateral inhomogeneity of transit times over the surface of the receiving ultrasound transducer. The aim of this study was to provide a proof of concept that a transit time spectrum may be derived from digital deconvolution of input and output ultrasound signals. We have applied the active-set method deconvolution algorithm to determine the ultrasound transit time spectra in the three orthogonal directions of four cancellous bone replica samples and have compared experimental data with the prediction from the computer simulation. The agreement between experimental and predicted ultrasound transit time spectrum analyses derived from Bland-Altman analysis ranged from 92% to 99%, thereby supporting the concept of parallel sonic rays for ultrasound propagation in cancellous bone. In addition to further validation of the parallel sonic ray concept, this technique offers the opportunity to consider quantitative characterisation of the material and structural properties of cancellous bone, not previously available utilising ultrasound.

  8. DEVELOPMENT OF A HYDRODYNAMIC MODEL OF A HYDROCYCLONE INCLUDING THE SIMULATION OF AIR-CORE EFFECT, USING THE FINITE VOLUME METHOD

    Directory of Open Access Journals (Sweden)

    Gabriel Felipe Aguilera

    2014-07-01

    Full Text Available The hydrocyclone is one of the most used classification equipment in industry, particularly in mineral processing. Maybe its main characteristic is to be a hydrodynamic separation equipment, whereby it has a high production capability and different levels of efficiency are depending on the geometrical configuration, operational parameters and the type of material to be processed. Nevertheless, there are a few successful studies regarding the modelling and simulation of its hydrodynamic principles, because the flow behavior inside is quite complex. Most of the current models are empirical and they are not applicable to all cases and types of minerals. One of the most important problems to be solved, besides the cut size and the effect of the physical properties of the particles, is the distribution of the flow inside the hydrocyclone, because if the work of the equipment is at low slurry densities, very clear for small hydrocyclones, its mechanic behavior is a consequence of the kind of liquid used as continuous phase, being water the most common liquid. This work shows the modelling and simulation of the hydrodynamic behavior of a suspension inside a hydrocyclone, including the air core effect, through the use of finite differences method. For the developing of the model, the Reynolds Stress Model (RSM for the evaluation of turbulence, and the Volume of Fluid (VOF to study the interaction between water and air were used. Finally, the model shows to be significant for experimental data, and for different conditions of an industrial plant.

  9. Technical meeting on lessons learned with respect to SAT implementation, including development of trainers and use of cost effective training methods

    International Nuclear Information System (INIS)

    2002-01-01

    The past years have brought some significant changes in the world energy market, where the nuclear power plants and utilities are operating. Part of NPPs is privatised now; the electricity markets are liberalized and become more and more international. Due to the increase of competition, the power production costs are now monitored more closely than before. The opening of electricity markets has led the nuclear power plants to be under the serious economic pressure with a demand for continuous cost reduction. All these require from NPPs to make their personnel training more cost-effective. In addition, based on modern technology, a great amount of new training tools, aids and technologies have been introduced during the last 2-3 years, these new opportunities can be quite useful for training cost optimization. On the basis of experience gained worldwide in the application of the systematic approach to training (SAT), SAT based training is now a broad integrated approach emphasizing not only technical knowledge and skills but also human factor related knowledge, skills and attitudes. In this way, all competency requirements for attaining and maintaining personnel competence and qualification can be met, thus promoting and strengthening quality culture and safety culture, which should be fostered throughout the initial and continuing training programmes. The subject of the present technical meeting was suggested by the members of the Technical Working Group on Training and Qualification of NPP Personnel (TWG-T and Q) and supported by a number of the IAEA meetings on NPP personnel training. The technical Meeting on 'Lessons Learned with Respect to SAT Implementation, Including Development of Trainers and Use of Cost Effective Training Methods' was organized by the IAEA in co-operation with the Tecnatom A.S. and was held from 21 to 24 October 2002 in San Sebastian de los Reyes/ Madrid, Spain. The main objective of the meeting was to provide an international forum for

  10. Key Determinant Derivations for Information Technology Disaster Recovery Site Selection by the Multi-Criterion Decision Making Method

    Directory of Open Access Journals (Sweden)

    Chia-Lee Yang

    2015-05-01

    Full Text Available Disaster recovery sites are an important mechanism in continuous IT system operations. Such mechanisms can sustain IT availability and reduce business losses during natural or human-made disasters. Concerning the cost and risk aspects, the IT disaster-recovery site selection problems are multi-criterion decision making (MCDM problems in nature. For such problems, the decision aspects include the availability of the service, recovery time requirements, service performance, and more. The importance and complexities of IT disaster recovery sites increases with advances in IT and the categories of possible disasters. The modern IT disaster recovery site selection process requires further investigation. However, very few researchers tried to study related issues during past years based on the authors’ extremely limited knowledge. Thus, this paper aims to derive the aspects and criteria for evaluating and selecting a modern IT disaster recovery site. A hybrid MCDM framework consisting of the Decision Making Trial and Evaluation Laboratory (DEMATEL and the Analytic Network Process (ANP will be proposed to construct the complex influence relations between aspects as well as criteria and further, derive weight associated with each aspect and criteria. The criteria with higher weight can be used for evaluating and selecting the most suitable IT disaster recovery sites. In the future, the proposed analytic framework can be used for evaluating and selecting a disaster recovery site for data centers by public institutes or private firms.

  11. Practical aspects of a maximum likelihood estimation method to extract stability and control derivatives from flight data

    Science.gov (United States)

    Iliff, K. W.; Maine, R. E.

    1976-01-01

    A maximum likelihood estimation method was applied to flight data and procedures to facilitate the routine analysis of a large amount of flight data were described. Techniques that can be used to obtain stability and control derivatives from aircraft maneuvers that are less than ideal for this purpose are described. The techniques involve detecting and correcting the effects of dependent or nearly dependent variables, structural vibration, data drift, inadequate instrumentation, and difficulties with the data acquisition system and the mathematical model. The use of uncertainty levels and multiple maneuver analysis also proved to be useful in improving the quality of the estimated coefficients. The procedures used for editing the data and for overall analysis are also discussed.

  12. Comparing dietary patterns derived by two methods and their associations with obesity in Polish girls aged 13-21 years: the cross-sectional GEBaHealth study.

    Science.gov (United States)

    Wadolowska, Lidia; Kowalkowska, Joanna; Czarnocinska, Jolanta; Jezewska-Zychowicz, Marzena; Babicz-Zielinska, Ewa

    2017-05-01

    To compare dietary patterns (DPs) derived by two methods and their assessment as a factor of obesity in girls aged 13-21 years. Data from a cross-sectional study conducted among the representative sample of Polish females ( n = 1,107) aged 13-21 years were used. Subjects were randomly selected. Dietary information was collected using three short-validated food frequency questionnaires (FFQs) regarding fibre intake, fat intake and overall food intake variety. DPs were identified by two methods: a priori approach (a priori DPs) and cluster analysis (data-driven DPs). The association between obesity and DPs and three single dietary characteristics was examined using multiple logistic regression analysis. Four data-driven DPs were obtained: 'Low-fat-Low-fibre-Low-varied' (21.2%), 'Low-fibre' (29.1%), 'Low-fat' (25.0%) and 'High-fat-Varied' (24.7%). Three a priori DPs were pre-defined: 'Non-healthy' (16.6%), 'Neither-pro-healthy-nor-non-healthy' (79.1%) and 'Pro-healthy' (4.3%). Girls with 'Low-fibre' DP were less likely to have central obesity (adjusted odds ratio (OR) = 0.36; 95% confidence interval (CI): 0.17, 0.75) than girls with 'Low-fat-Low-fibre-Low-varied' DP (reference group, OR = 1.00). No significant associations were found between a priori DPs and overweight including obesity or central obesity. The majority of girls with 'Non-healthy' DP were also classified as 'Low-fibre' DP in the total sample, in girls with overweight including obesity and in girls with central obesity (81.7%, 80.6% and 87.3%, respectively), while most girls with 'Pro-healthy' DP were classified as 'Low-fat' DP (67.8%, 87.6% and 52.1%, respectively). We found that the a priori approach as well as cluster analysis can be used to derive opposite health-oriented DPs in Polish females. Both methods have provided disappointing outcomes in explaining the association between obesity and DPs. The cluster analysis, in comparison with the a priori approach, was more useful for finding any

  13. Satellite-derived land covers for runoff estimation using SCS-CN method in Chen-You-Lan Watershed, Taiwan

    Science.gov (United States)

    Zhang, Wen-Yan; Lin, Chao-Yuan

    2017-04-01

    The Soil Conservation Service Curve Number (SCS-CN) method, which was originally developed by the USDA Natural Resources Conservation Service, is widely used to estimate direct runoff volume from rainfall. The runoff Curve Number (CN) parameter is based on the hydrologic soil group and land use factors. In Taiwan, the national land use maps were interpreted from aerial photos in 1995 and 2008. Rapid updating of post-disaster land use map is limited due to the high cost of production, so the classification of satellite images is the alternative method to obtain the land use map. In this study, Normalized Difference Vegetation Index (NDVI) in Chen-You-Lan Watershed was derived from dry and wet season of Landsat imageries during 2003 - 2008. Land covers were interpreted from mean value and standard deviation of NDVI and were categorized into 4 groups i.e. forest, grassland, agriculture and bare land. Then, the runoff volume of typhoon events during 2005 - 2009 were estimated using SCS-CN method and verified with the measured runoff data. The result showed that the model efficiency coefficient is 90.77%. Therefore, estimating runoff by using the land cover map classified from satellite images is practicable.

  14. Highly Sensitive and High-Throughput Method for the Analysis of Bisphenol Analogues and Their Halogenated Derivatives in Breast Milk.

    Science.gov (United States)

    Niu, Yumin; Wang, Bin; Zhao, Yunfeng; Zhang, Jing; Shao, Bing

    2017-12-06

    The structural analogs of bisphenol A (BPA) and their halogenated derivatives (together termed BPs) have been found in the environment, food, and even the human body. Limited research showed that some of them exhibited toxicities that were similar to or even greater than that of BPA. Therefore, adverse health effects for BPs were expected for humans with low-dose exposure in early life. Breast milk is an excellent matrix and could reflect fetuses' and babies' exposure to contaminants. Some of the emerging BPs may present with trace or ultratrace levels in humans. However, existing analytical methods for breast milk cannot quantify these BPs simultaneously with high sensitivity using a small sampling weight, which is important for human biomonitoring studies. In this paper, a method based on Bond Elut Enhanced Matrix Removal-Lipid purification, pyridine-3-sulfonyl chloride derivatization, and liquid chromatography electrospray tandem mass spectrometry was developed. The method requires only a small quantity of sample (200 μL) and allowed for the simultaneous determination of 24 BPs in breast milk with ultrahigh sensitivity. The limits of quantitation of the proposed method were 0.001-0.200 μg L -1 , which were 1-6.7 times lower than the only study for the simultaneous analysis of bisphenol analogs in breast milk based on a 3 g sample weight. The mean recoveries ranged from 86.11% to 119.05% with relative standard deviation (RSD) ≤ 19.5% (n = 6). Matrix effects were within 20% with RSD bisphenol F (BPF), bisphenol S (BPS), and bisphenol AF (BPAF) were detected. BPA was still the dominant BP, followed by BPF. This is the first report describing the occurrence of BPF and BPAF in breast milk.

  15. A structure-preserving method for a class of nonlinear dissipative wave equations with Riesz space-fractional derivatives

    Science.gov (United States)

    Macías-Díaz, J. E.

    2017-12-01

    In this manuscript, we consider an initial-boundary-value problem governed by a (1 + 1)-dimensional hyperbolic partial differential equation with constant damping that generalizes many nonlinear wave equations from mathematical physics. The model considers the presence of a spatial Laplacian of fractional order which is defined in terms of Riesz fractional derivatives, as well as the inclusion of a generic continuously differentiable potential. It is known that the undamped regime has an associated positive energy functional, and we show here that it is preserved throughout time under suitable boundary conditions. To approximate the solutions of this model, we propose a finite-difference discretization based on fractional centered differences. Some discrete quantities are proposed in this work to estimate the energy functional, and we show that the numerical method is capable of conserving the discrete energy under the same boundary conditions for which the continuous model is conservative. Moreover, we establish suitable computational constraints under which the discrete energy of the system is positive. The method is consistent of second order, and is both stable and convergent. The numerical simulations shown here illustrate the most important features of our numerical methodology.

  16. Electron mobilities of n-type organic semiconductors from time-dependent wavepacket diffusion method: pentacenequinone derivatives.

    Science.gov (United States)

    Zhang, WeiWei; Zhong, XinXin; Zhao, Yi

    2012-11-26

    The electron mobilities of two n-type pentacenequinone derivative organic semiconductors, 5,7,12,14-tetraaza-6,13-pentacenequinone (TAPQ5) and 1,4,8,11-tetraaza-6,13-pentacenequinone (TAPQ7), are investigated with use of the methods of electronic structure and quantum dynamics. The electronic structure calculations reveal that the two key parameters for the control of electron transfer, reorganization energy and electronic coupling, are similar for these two isomerization systems, and the charge carriers essentially display one-dimensional transport properties. The mobilities are then calculated by using the time-dependent wavepacket diffusion approach in which the dynamic fluctuations of the electronic couplings are incorporated via their correlation functions obtained from molecular dynamics simulations. The predicted mobility of TAPQ7 crystal is about six times larger than that of TAPQ5 crystal. Most interestingly, Fermi's golden rule predicts the mobilities very close to those from the time-dependent wavepacket diffusion method, even though the electronic couplings are explicitly large enough to make the perturbation theory invalid. The possible reason is analyzed from the dynamic fluctuations.

  17. Derivation Method for the Foundation Boundaries of Hydraulic Numerical Simulation Models Based on the Elastic Boussinesq Solution

    Directory of Open Access Journals (Sweden)

    Jintao Song

    2015-01-01

    Full Text Available The foundation boundaries of numerical simulation models of hydraulic structures dominated by a vertical load are investigated. The method used is based on the stress formula for fundamental solutions to semi-infinite space body elastic mechanics under a vertical concentrated force. The limit method is introduced into the original formula, which is then partitioned and analyzed according to the direction of the depth extension of the foundation. The point load will be changed to a linear load with a length of 2a. Inverse proportion function assumptions are proposed at parameter a and depth l of the calculation points to solve the singularity questions of elastic stress in a semi-infinite space near the ground. Compared with the original formula, changing the point load to a linear load with a length of 2a is more reasonable. Finally, the boundary depth criterion of a hydraulic numerical simulation model is derived and applied to determine the depth boundary formula for gravity dam numerical simulations.

  18. A new and efficient culture method for porcine bone marrow-derived M1- and M2-polarized macrophages.

    Science.gov (United States)

    Gao, Jiye; Scheenstra, Maaike R; van Dijk, Albert; Veldhuizen, Edwin J A; Haagsman, Henk P

    2018-06-01

    Macrophages play an important role in the innate immune system as part of the mononuclear phagocyte system (MPS). They have a pro-inflammatory signature (M1-polarized macrophages) or anti-inflammatory signature (M2-polarized macrophages) based on expression of surface receptors and secretion of cytokines. However, very little is known about the culture of macrophages from pigs and more specific about the M1 and M2 polarization in vitro. Porcine monocytes or mononuclear bone marrow cells were used to culture M1- and M2-polarized macrophages in the presence of GM-CSF and M-CSF, respectively. Surface receptor expression was measured with flow cytometry and ELISA was used to quantify cytokine secretion in response to LPS and PAM 3 CSK 4 stimulation. Human monocyte-derived macrophages were used as control. Porcine M1- and M2-polarized macrophages were cultured best using porcine GM-CSF and murine M-CSF, respectively. Cultures from bone marrow cells resulted in a higher yield M1- and M2-polarized macrophages which were better comparable to human monocyte-derived macrophages than cultures from porcine monocytes. Porcine M1-polarized macrophages displayed the characteristic fried egg shape morphology, lower CD163 expression and low IL-10 production. Porcine M2-polarized macrophages contained the spindle-like morphology, higher CD163 expression and high IL-10 production. Porcine M1- and M2-polarized macrophages can be most efficiently cultured from mononuclear bone marrow cells using porcine GM-CSF and murine M-CSF. The new culture method facilitates more refined studies of porcine macrophages in vitro, important for both porcine and human health since pigs are increasingly used as model for translational research. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  19. Electrolyte for a lithium/thionyl chloride electric cell, a method of preparing said electrolyte and an electric cell which includes said electrolyte

    Energy Technology Data Exchange (ETDEWEB)

    Gabano, J.

    1983-03-01

    An electrolyte for an electric cell whose negative active material is constituted by lithium and whose positive active material is constituted by thionyl chloride. The electrolyte contains at least one solvent and at least one solute, said solvent being thionyl chloride and said solute being chosen from the group which includes lithium tetrachloroaluminate and lithium hexachloroantimonate. According to the invention said electrolyte further includes a complex chosen from the group which includes AlCl/sub 3/,SO/sub 2/ and SbCl/sub 5/,SO/sub 2/. The voltage rise of electric cells which include such an electrolyte takes negligible time.

  20. Proposed method to calculate FRMAC intervention levels for the assessment of radiologically contaminated food and comparison of the proposed method to the U.S. FDA's method to calculate derived intervention levels

    Energy Technology Data Exchange (ETDEWEB)

    Kraus, Terrence D.; Hunt, Brian D.

    2014-02-01

    This report reviews the method recommended by the U.S. Food and Drug Administration for calculating Derived Intervention Levels (DILs) and identifies potential improvements to the DIL calculation method to support more accurate ingestion pathway analyses and protective action decisions. Further, this report proposes an alternate method for use by the Federal Emergency Radiological Assessment Center (FRMAC) to calculate FRMAC Intervention Levels (FILs). The default approach of the FRMAC during an emergency response is to use the FDA recommended methods. However, FRMAC recommends implementing the FIL method because we believe it to be more technically accurate. FRMAC will only implement the FIL method when approved by the FDA representative on the Federal Advisory Team for Environment, Food, and Health.

  1. An Efficient Power Regeneration and Drive Method of an Induction Motor by Means of an Optimal Torque Derived by Variational Method

    Science.gov (United States)

    Inoue, Kaoru; Ogata, Kenji; Kato, Toshiji

    When the motor speed is reduced by using a regenerative brake, the mechanical energy of rotation is converted to the electrical energy. When the regenerative torque is large, the corresponding current increases so that the copper loss also becomes large. On the other hand, the damping effect of rotation increases according to the time elapse when the regenerative torque is small. In order to use the limited energy effectively, an optimal regenerative torque should be discussed in order to regenerate electrical energy as much as possible. This paper proposes a design methodology of a regenerative torque for an induction motor to maximize the regenerative electric energy by means of the variational method. Similarly, an optimal torque for acceleration is derived in order to minimize the energy to drive. Finally, an efficient motor drive system with the proposed optimal torque and the power storage system stabilizing the DC link voltage will be proposed. The effectiveness of the proposed methods are illustrated by both simulations and experiments.

  2. Comparative study of analytical methods by direct and first-derivative UV spectrophotometry for evaluation of losartan potassium in capsules

    Directory of Open Access Journals (Sweden)

    Rudy Bonfilio

    2010-03-01

    Full Text Available Losartan potassium is an antihypertensive non-peptide agent, which exerts its action by specific blockade of angiotensin II receptors. The aim of the present study was the validation and application of analytical methods for the quality control of losartan potassium 50 mg in pharmaceutical capsules, using direct and first-derivative UV spectrophotometry. Based on losartan potassium spectrophotometric characteristics, a signal at 205 nm of the zero-order spectrum and a signal at 234 nm of the first-derivative spectrum, were found adequate for quantification. The results were used to compare these instrumental techniques. The linearity between the signals and concentrations of losartan potassium in the ranges of 3.0-7.0 mg L-1 and 6.0-14.0 mg L-1 for direct and first-derivative spectrophotometry in aqueous solutions, respectively, presented a correlation coefficient (r of 0.9999 in both cases. The methods were applied for losartan potassium in capsule dosage obtained from local pharmacies, and were shown to be efficient, easy to apply and low cost. These methods do not use polluting reagents and require relatively inexpensive equipment.O losartano potássico é um agente anti-hipertensivo não peptídico, que exerce sua ação por bloqueio específico dos receptores da angiotensina II. Este trabalho propôs a validação e aplicação de métodos analíticos orientados ao controle de qualidade de losartano potássico 50 mg na forma farmacêutica cápsula, utilizando a espectrofotometria direta e derivada de primeira ordem na região do UV. Baseado nas características espectrofotométricas de losartano potássico, um sinal a 205 nm do espectro de ordem zero e um sinal a 234 nm do espectro de primeira derivada foram adequados para a quantificação. Os resultados foram usados para comparar essas duas técnicas instrumentais. O coeficiente de correlação entre as respostas e as concentrações de losartano potássico na faixa de 3,0-7,0 mg L-1 e 6

  3. Parcels and Land Ownership, Derived from countywide parcel cover (scparcel) and CAMA.dat info table. Primary attributes include Parcel IDS (Control, Key, and PIN), calculated acreage, Appraiser's most recent landcover assessment year, and Appraiser's property ownership and value., Published in 2008, 1:1200 (1in=100ft) scale, Sedgwick County Government.

    Data.gov (United States)

    NSGIC Local Govt | GIS Inventory — Parcels and Land Ownership dataset current as of 2008. Derived from countywide parcel cover (scparcel) and CAMA.dat info table. Primary attributes include Parcel IDS...

  4. Particle size distribution in soils and marine sediments by laser diffraction using Malvern Mastersizer 2000—method uncertainty including the effect of hydrogen peroxide pretreatment

    DEFF Research Database (Denmark)

    Callesen, Ingeborg; Keck, Hannes; Andersen, Thorbjørn Joest

    2018-01-01

    with less than 1% C and some marine sediments. Materials and methods: The method uncertainty for particle size analysis by the laser diffraction method using or not using H2O2 pretreatment followed by 2 min ultrasound and 1-mm sieving was determined for two soil samples and two aquatic sediments......Purpose: Methods for particle size distribution (PSD) determination by laser diffraction are not standardized and differ between disciplines and sectors. The effect of H2O2 pretreatment before a sonication treatment in laser diffraction analysis of soils and marine sediments was examined on soils...... pretreatment on the PSD was small and not significant. The standard deviation (std) in particle size fractions increased with particle size. PSDs and std for some samples were presented for future reference. Similar to other studies, the content of clay and silt (by sieving/hydrometer, SHM) was lower...

  5. Quinazoline derivatives: synthesis and bioactivities

    OpenAIRE

    Wang, Dan; Gao, Feng

    2013-01-01

    Owing to the significant biological activities, quinazoline derivatives have drawn more and more attention in the synthesis and bioactivities research. This review summarizes the recent advances in the synthesis and biological activities investigations of quinazoline derivatives. According to the main method the authors adopted in their research design, those synthetic methods were divided into five main classifications, including Aza-reaction, Microwave-assisted reaction, Metal-mediated reac...

  6. Novel Exponentially Fitted Two-Derivative Runge-Kutta Methods with Equation-Dependent Coefficients for First-Order Differential Equations

    Directory of Open Access Journals (Sweden)

    Yanping Yang

    2016-01-01

    Full Text Available The construction of exponentially fitted two-derivative Runge-Kutta (EFTDRK methods for the numerical solution of first-order differential equations is investigated. The revised EFTDRK methods proposed, with equation-dependent coefficients, take into consideration the errors produced in the internal stages to the update. The local truncation errors and stability of the new methods are analyzed. The numerical results are reported to show the accuracy of the new methods.

  7. Prescription for natural cures: a self-care guide for treating health problems with natural remedies including diet, nutrition, supplements, and other holistic methods

    National Research Council Canada - National Science Library

    Balch, James F; Stengler, Mark; Young-Balch, Robin

    2011-01-01

    .... You'll find easy-to-understand discussions of the symptoms and root causes of each health problem along with a proven, natural, customized prescription that may include supplements, herbal medicine...

  8. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Science.gov (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  9. A derivation and scalable implementation of the synchronous parallel kinetic Monte Carlo method for simulating long-time dynamics

    Science.gov (United States)

    Byun, Hye Suk; El-Naggar, Mohamed Y.; Kalia, Rajiv K.; Nakano, Aiichiro; Vashishta, Priya

    2017-10-01

    Kinetic Monte Carlo (KMC) simulations are used to study long-time dynamics of a wide variety of systems. Unfortunately, the conventional KMC algorithm is not scalable to larger systems, since its time scale is inversely proportional to the simulated system size. A promising approach to resolving this issue is the synchronous parallel KMC (SPKMC) algorithm, which makes the time scale size-independent. This paper introduces a formal derivation of the SPKMC algorithm based on local transition-state and time-dependent Hartree approximations, as well as its scalable parallel implementation based on a dual linked-list cell method. The resulting algorithm has achieved a weak-scaling parallel efficiency of 0.935 on 1024 Intel Xeon processors for simulating biological electron transfer dynamics in a 4.2 billion-heme system, as well as decent strong-scaling parallel efficiency. The parallel code has been used to simulate a lattice of cytochrome complexes on a bacterial-membrane nanowire, and it is broadly applicable to other problems such as computational synthesis of new materials.

  10. Study on pharmacokinetics and tissue distribution of the isocorydine derivative (AICD) in rats by HPLC-DAD method

    Institute of Scientific and Technical Information of China (English)

    Yali Chen; Qian Yan; Mei Zhong; Quanyi Zhao; Junxi Liu; Duolong Di; Jinxia Liu

    2015-01-01

    A simple and effective high-performance liquid chromatography with diode-array detection method coupled with a liquid-liquid extraction pretreatment has been developed for determining the pharmacokinetics and tissue distribution of a novel structurally modified derivative(8-acetaminoisocorydine) of isocorydine.According to the in vivo experiments data calculations by DAS 2.0 software,a two-compartment metabolic model was suitable for describing the pharmacokinetic of 8-acetaminoisocorydine in rats.8-Acetamino-isocorydine was absorbed well after oral administration,and the absolute bioavailability was 76.5%.The half-life of 8-acetamino-isocorydine after intravenous and oral administration was 2.2 h and 2.0 h,respectively.In vivo,8-acetamino-isocorydine was highly distributed in the lungs,kidney and liver;however,relatively little entered the brain,suggesting that 8-acetaminoisocorydine could not easily pass through the blood brain barrier.Our work describes the first characterization of the pharmacokinetic parameters and tissue distribution of 8-acetamino-isocorydine.The acquired data will provide useful information for the in vivo pharmacology of 8-acetaminoisocorydine,and can be applied to new drug research.

  11. INEL cold test pit demonstration of improvements in information derived from non-intrusive geophysical methods over buried waste sites

    International Nuclear Information System (INIS)

    1993-01-01

    The objectives of this research project were to lay the foundation for further improvement in the use of geophysical methods for detection of buried wastes, and to increase the information content derived from surveys. Also, an important goal was to move from mere detection to characterization of buried wastes. The technical approach to achieve these objectives consisted of: (1) Collect a data set of high spatial density; (2) Acquire data with multiple sensors and integrate the interpretations inferred from the various sensors; (3) Test a simplified time domain electromagnetic system; and (4) Develop imaging and display formats of geophysical data readily understood by environmental scientists and engineers. The breadth of application of this work is far reaching. Not only are uncontrolled waste pits and trenches, abandoned underground storage tanks, and pipelines found throughout most US DOE facilities, but also at military installations and industrial facilities. Moreover, controlled land disposal sites may contain ''hot spots'' where drums and hazardous material may have been buried. The technologies addressed by the R ampersand D will benefit all of these activities

  12. 4D-Qsar Study of Some Pyrazole Pyridine Carboxylic Acid Derivatives by Electron Conformational-Genetic Algorithm Method.

    Science.gov (United States)

    Tuzun, Burak; Yavuz, Sevtap Caglar; Sabanci, Nazmiye; Saripinar, Emin

    2018-05-13

    In the present work, pharmacophore identification and biological activity prediction for 86 pyrazole pyridine carboxylic acid derivatives were made using the electron conformational genetic algorithm approach which was introduced as a 4D-QSAR analysis by us in recent years. In the light of the data obtained from quantum chemical calculations at HF/6-311 G** level, the electron conformational matrices of congruity (ECMC) were constructed by EMRE software. Comparing the matrices, electron conformational submatrix of activity (ECSA, Pha) was revealed that are common for these compounds within a minimum tolerance. A parameter pool was generated considering the obtained pharmacophore. To determine the theoretical biological activity of molecules and identify the best subset of variables affecting bioactivities, we used the nonlinear least square regression method and genetic algorithm. The results obtained in this study are in good agreement with the experimental data presented in the literature. The model for training and test sets attained by the optimum 12 parameters gave highly satisfactory results with R2training= 0.889, q2=0.839 and SEtraining=0.066, q2ext1 = 0.770, q2ext2 = 0.750, q2ext3=0.824, ccctr = 0.941, ccctest = 0.869 and cccall = 0.927. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  13. Estimation of an image derived input function with MR-defined carotid arteries in FDG-PET human studies using a novel partial volume correction method

    DEFF Research Database (Denmark)

    Sari, Hasan; Erlandsson, Kjell; Law, Ian

    2017-01-01

    Kinetic analysis of18F-fluorodeoxyglucose positron emission tomography data requires an accurate knowledge the arterial input function. The gold standard method to measure the arterial input function requires collection of arterial blood samples and is an invasive method. Measuring an image deriv...... input function (p > 0.12 for grey matter and white matter). Hence, the presented image derived input function extraction method can be a practical alternative to noninvasively analyze dynamic18F-fluorodeoxyglucose data without the need for blood sampling....

  14. A Method for Deriving All-Sky Evapotranspiration From the Synergistic Use of Remotely Sensed Images and Meteorological Data

    Science.gov (United States)

    Leng, Pei; Li, Zhao-Liang; Duan, Si-Bo; Tang, Ronglin; Gao, Mao-Fang

    2017-12-01

    Evapotranspiration (ET) is an important component of the water and energy cycle. The present study develops a practical approach for generating all-sky ET with the synergistic use of satellite images and meteorological data. In this approach, the ET over clear-sky pixels is estimated from a two-stage land surface temperature (LST)/fractional vegetation cover feature space method where the dry/wet edges are determined from theoretical calculations. For cloudy pixels, the Penman-Monteith equation is used to calculate the ET where no valid remotely sensed LST is available. An evaluation of the method with ET collected at ground-based large aperture scintillometer measurements at the Yucheng Comprehensive Experimental Station (YCES) in China is performed over a growth period from April to October 2010. The results show that the root-mean-square error (RMSE) and bias over clear-sky pixels are 57.3 W/m2 and 18.2 W/m2, respectively, whereas an RMSE of 69.3 W/m2 with a bias of 12.3 W/m2 can be found over cloudy pixels. Moreover, a reasonable overall RMSE of 65.3 W/m2 with a bias of 14.4 W/m2 at the YCES can be obtained under all-sky conditions, indicating a promising prospect for the derivation of all-sky ET using currently available satellite and meteorological data at a regional or global scale in future developments.

  15. Analysis of the impact of climate change on groundwater related hydrological fluxes: a multi-model approach including different downscaling methods

    Directory of Open Access Journals (Sweden)

    S. Stoll

    2011-01-01

    Full Text Available Climate change related modifications in the spatio-temporal distribution of precipitation and evapotranspiration will have an impact on groundwater resources. This study presents a modelling approach exploiting the advantages of integrated hydrological modelling and a broad climate model basis. We applied the integrated MIKE SHE model on a perialpine, small catchment in northern Switzerland near Zurich. To examine the impact of climate change we forced the hydrological model with data from eight GCM-RCM combinations showing systematic biases which are corrected by three different statistical downscaling methods, not only for precipitation but also for the variables that govern potential evapotranspiration. The downscaling methods are evaluated in a split sample test and the sensitivity of the downscaling procedure on the hydrological fluxes is analyzed. The RCMs resulted in very different projections of potential evapotranspiration and, especially, precipitation. All three downscaling methods reduced the differences between the predictions of the RCMs and all corrected predictions showed no future groundwater stress which can be related to an expected increase in precipitation during winter. It turned out that especially the timing of the precipitation and thus recharge is very important for the future development of the groundwater levels. However, the simulation experiments revealed the weaknesses of the downscaling methods which directly influence the predicted hydrological fluxes, and thus also the predicted groundwater levels. The downscaling process is identified as an important source of uncertainty in hydrological impact studies, which has to be accounted for. Therefore it is strongly recommended to test different downscaling methods by using verification data before applying them to climate model data.

  16. An Analytical Method for Deriving Reservoir Operation Curves to Maximize Social Benefits from Multiple Uses of Water in the Willamette River Basin

    Science.gov (United States)

    Moore, K. M.; Jaeger, W. K.; Jones, J. A.

    2013-12-01

    uncertainty and risk daily, and 3) require complex computer programming. The proposed research addresses these critiques by pursuing a novel approach - the development of an analytical method to demonstrate how reservoir management could adapt to anticipated changes in water supply and demand, which incorporates some of the complexity of the hydrologic system, includes stochasticity, and can be readily implemented. Employing a normative economic framework of social welfare maximization, the research will 1) estimate the social benefits associated with reservoir uses, 2) analytically derive conditions for maximizing the benefits of reservoir operation, and 3) estimate the resulting optimal operating rules under future trajectories of climate, land cover, and population. The findings of this analysis will be used to address the following research questions: 1) How do the derived optimal operating rules compare to the existing rule curves? 2) How does the shape of the derived rule curves change under different scenarios of global change? 3) What is the change in net social benefits resulting from the use of these derived rule curves as compared to existing rule curves? 4) To the extent possible, what are the distributional and social justice implications of the derived changes in the rule curves?

  17. Beginning German in Grade Three: MLA Teacher's Guide. A Course of Study Including Methods, Materials, and Aids for Teaching Conversational German to Third-Grade Children.

    Science.gov (United States)

    Wittman, Nora E.; And Others

    This guide is planned to help the FLES teacher develop pleasurable language learning experiences in spoken German for children at the third-grade level. Experiences included in this guide present German in life situations, as well as insight into German culture. The guide offers suggestions for classroom procedures, and detailed directions are…

  18. A combined DFT and restricted open-shell configuration interaction method including spin-orbit coupling: Application to transition metal L-edge X-ray absorption spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Roemelt, Michael; Maganas, Dimitrios; Neese, Frank [Max-Planck Institute for Chemical Energy Conversion, Stiftstrasse 34-36, D-45470 Muelheim an der Ruhr (Germany); DeBeer, Serena [Max-Planck Institute for Chemical Energy Conversion, Stiftstrasse 34-36, D-45470 Muelheim an der Ruhr (Germany); Department of Chemistry and Chemical Biology, Cornell University, Ithaca, New York 14853 (United States)

    2013-05-28

    A novel restricted-open-shell configuration interaction with singles (ROCIS) approach for the calculation of transition metal L-edge X-ray absorption spectra is introduced. In this method, one first calculates the ground state and a number of excited states of the non-relativistic Hamiltonian. By construction, the total spin is a good quantum number in each of these states. For a ground state with total spin S excited states with spin S Prime = S, S - 1, and S + 1 are constructed. Using Wigner-Eckart algebra, all magnetic sublevels with M{sub S}= S, Horizontal-Ellipsis , -S for each multiplet of spin S are obtained. The spin-orbit operator is represented by a mean-field approximation to the full Breit-Pauli spin-orbit operator and is diagonalized over this N-particle basis. This is equivalent to a quasi-degenerate treatment of the spin-orbit interaction to all orders. Importantly, the excitation space spans all of the molecular multiplets that arise from the atomic Russell-Saunders terms. Hence, the method represents a rigorous first-principles approach to the complicated low-symmetry molecular multiplet problem met in L-edge X-ray absorption spectroscopy. In order to gain computational efficiency, as well as additional accuracy, the excitation space is restricted to single excitations and the configuration interaction matrix is slightly parameterized in order to account for dynamic correlation effects in an average way. To this end, it is advantageous to employ Kohn-Sham rather than Hartree-Fock orbitals thus defining the density functional theory/ROCIS method. However, the method can also be used in an entirely non-empirical fashion. Only three global empirical parameters are introduced and have been determined here for future application of the method to any system containing any transition metal. The three parameters were carefully calibrated using the L-edge X-ray absorption spectroscopy spectra of a test set of coordination complexes containing first row

  19. A simple method to evaluate the fission gas release at fuel grain boundary including the grain growth both at constant and at transient power histories

    International Nuclear Information System (INIS)

    Paraschiv, M.; Paraschiv, A.

    1991-01-01

    A method to rewrite Fick's second law for a region with a moving boundary when the moving law in time of this boundary is known, has been proposed. This method was applied to Booth's sphere model for radioactive and stable fission product diffusion from the oxide fuel grain in order to take into account the grain growth. The solution of this new equation was presented in the mathematical formulation for power histories from ANS 5.4 model for the stable species. It is very simple to apply and very accurate. The results obtained with this solution for constant and transient temperatures show that the fission gas release (FGR) at grain boundary is strongly dependent on kinetics of grain growth. The utilization of two semiempirical grain growth laws, from published information, shows that the fuel microstructural properties need to be multicitly considered in the fission gas release for every manufacturer of fuel. (orig.)

  20. Method of data mining including determining multidimensional coordinates of each item using a predetermined scalar similarity value for each item pair

    Science.gov (United States)

    Meyers, Charles E.; Davidson, George S.; Johnson, David K.; Hendrickson, Bruce A.; Wylie, Brian N.

    1999-01-01

    A method of data mining represents related items in a multidimensional space. Distance between items in the multidimensional space corresponds to the extent of relationship between the items. The user can select portions of the space to perceive. The user also can interact with and control the communication of the space, focusing attention on aspects of the space of most interest. The multidimensional spatial representation allows more ready comprehension of the structure of the relationships among the items.

  1. Simplifying sample pretreatment: application of dried blood spot (DBS) method to blood samples, including postmortem, for UHPLC-MS/MS analysis of drugs of abuse.

    Science.gov (United States)

    Odoardi, Sara; Anzillotti, Luca; Strano-Rossi, Sabina

    2014-10-01

    The complexity of biological matrices, such as blood, requires the development of suitably selective and reliable sample pretreatment procedures prior to their instrumental analysis. A method has been developed for the analysis of drugs of abuse and their metabolites from different chemical classes (opiates, methadone, fentanyl and analogues, cocaine, amphetamines and amphetamine-like substances, ketamine, LSD) in human blood using dried blood spot (DBS) and subsequent UHPLC-MS/MS analysis. DBS extraction required only 100μL of sample, added with the internal standards and then three droplets (30μL each) of this solution were spotted on the card, let dry for 1h, punched and extracted with methanol with 0.1% of formic acid. The supernatant was evaporated and the residue was then reconstituted in 100μL of water with 0.1% of formic acid and injected in the UHPLC-MS/MS system. The method was validated considering the following parameters: LOD and LOQ, linearity, precision, accuracy, matrix effect and dilution integrity. LODs were 0.05-1ng/mL and LOQs were 0.2-2ng/mL. The method showed satisfactory linearity for all substances, with determination coefficients always higher than 0.99. Intra and inter day precision, accuracy, matrix effect and dilution integrity were acceptable for all the studied substances. The addition of internal standards before DBS extraction and the deposition of a fixed volume of blood on the filter cards ensured the accurate quantification of the analytes. The validated method was then applied to authentic postmortem blood samples. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  2. Novel Method To Identify Source-Associated Phylogenetic Clustering Shows that Listeria monocytogenes Includes Niche-Adapted Clonal Groups with Distinct Ecological Preferences

    DEFF Research Database (Denmark)

    Nightingale, K. K.; Lyles, K.; Ayodele, M.

    2006-01-01

    population are identified (TreeStats test). Analysis of sequence data for 120 L. monocytogenes isolates revealed evidence of clustering between isolates from the same source, based on the phylogenies inferred from actA and inlA (P = 0.02 and P = 0.07, respectively; SourceCluster test). Overall, the Tree...... are biologically valid. Overall, our data show that (i) the SourceCluster and TreeStats tests can identify biologically meaningful source-associated phylogenetic clusters and (ii) L. monocytogenes includes clonal groups that have adapted to infect specific host species or colonize nonhost environments......., including humans, animals, and food. If the null hypothesis that the genetic distances for isolates within and between source populations are identical can be rejected (SourceCluster test), then particular clades in the phylogenetic tree with significant overrepresentation of sequences from a given source...

  3. Determination of point isotropic buildup factors of gamma rays including incoherent and coherent scattering for aluminum, iron, lead, and water by discrete ordinates method

    International Nuclear Information System (INIS)

    Kitsos, S.; Assad, A.; Diop, C.M.; Nimal, J.C.

    1994-01-01

    Exposure and energy absorption buildup factors for aluminum, iron, lead, and water are calculated by the SNID discrete ordinates code for an isotropic point source in a homogeneous medium. The calculation of the buildup factors takes into account the effects of both bound-electron Compton (incoherent) and coherent (Rayleigh) scattering. A comparison with buildup factors from the literature shows that these two effects greatly increase the buildup factors for energies below a few hundred kilo-electron-volts, and thus the new results are improved relative to the experiment. This greater accuracy is due to the increase in the linear attenuation coefficient, which leads to the calculation of the buildup factors for a mean free path with a smaller shield thickness. On the other hand, for the same shield thickness, exposure increases when only incoherent scattering is included and decreases when only coherent scattering is included, so that the exposure finally decreases when both effects are included. Great care must also be taken when checking the approximations for gamma-ray deep-penetration transport calculations, as well as for the cross-section treatment and origin

  4. Method and device for detecting impact events on a security barrier which includes a hollow rebar allowing insertion and removal of an optical fiber

    Science.gov (United States)

    Pies, Ross E.

    2016-03-29

    A method and device for the detection of impact events on a security barrier. A hollow rebar is farmed within a security barrier, whereby the hollow rebar is completely surrounded by the security barrier. An optical fiber passes through the interior of the hollow rebar. An optical transmitter and an optical receiver are both optically connected to the optical fiber and connected to optical electronics. The optical electronics are configured to provide notification upon the detection of an impact event at the security barrier based on the detection of disturbances within the optical fiber.

  5. Efficacy and prospects for cryopreserved thyroid gland transplantation as a method for treatment of different forms of primary hypothyroidism including postradiation

    International Nuclear Information System (INIS)

    Karachentsev, Yu.I.; Lyakh, I.A.; Khasiev, V.V.

    1999-01-01

    It was established that auto-and allo transplantation of cryopreserved thyroid is a physiologically well grounded technique of treatment and can be an alternative to substitution hormonotherapy of hypothyroidism and can be a main method of treatment in cases when hormone treatment is not effective or is contraindicated.Talking into account the efficiency of cryopreserved thyroid transplantation in patients with primary hypothyroidism,it is possible to predict its positive effect for c postradiation hypothyroidism treatment,if substitution hormonotherapy is not effective

  6. Multicritical phase diagrams of the Blume-Emery-Griffiths model with repulsive biquadratic coupling including metastable phases: the pair approximation and the path probability method with pair distribution

    International Nuclear Information System (INIS)

    Keskin, Mustafa; Erdinc, Ahmet

    2004-01-01

    As a continuation of the previously published work, the pair approximation of the cluster variation method is applied to study the temperature dependences of the order parameters of the Blume-Emery-Griffiths model with repulsive biquadratic coupling on a body centered cubic lattice. We obtain metastable and unstable branches of the order parameters besides the stable branches and phase transitions of these branches are investigated extensively. We study the dynamics of the model by the path probability method with pair distribution in order to make sure that we find and define the metastable and unstable branches of the order parameters completely and correctly. We present the metastable phase diagram in addition to the equilibrium phase diagram and also the first-order phase transition line for the unstable branches of the quadrupole order parameter is superimposed on the phase diagrams. It is found that the metastable phase diagram and the first-order phase boundary for the unstable quadrupole order parameter always exist at the low temperatures which are consistent with experimental and theoretical works

  7. Evaluation of data discretization methods to derive platform independent isoform expression signatures for multi-class tumor subtyping.

    Science.gov (United States)

    Jung, Segun; Bi, Yingtao; Davuluri, Ramana V

    2015-01-01

    Many supervised learning algorithms have been applied in deriving gene signatures for patient stratification from gene expression data. However, transferring the multi-gene signatures from one analytical platform to another without loss of classification accuracy is a major challenge. Here, we compared three unsupervised data discretization methods--Equal-width binning, Equal-frequency binning, and k-means clustering--in accurately classifying the four known subtypes of glioblastoma multiforme (GBM) when the classification algorithms were trained on the isoform-level gene expression profiles from exon-array platform and tested on the corresponding profiles from RNA-seq data. We applied an integrated machine learning framework that involves three sequential steps; feature selection, data discretization, and classification. For models trained and tested on exon-array data, the addition of data discretization step led to robust and accurate predictive models with fewer number of variables in the final models. For models trained on exon-array data and tested on RNA-seq data, the addition of data discretization step dramatically improved the classification accuracies with Equal-frequency binning showing the highest improvement with more than 90% accuracies for all the models with features chosen by Random Forest based feature selection. Overall, SVM classifier coupled with Equal-frequency binning achieved the best accuracy (> 95%). Without data discretization, however, only 73.6% accuracy was achieved at most. The classification algorithms, trained and tested on data from the same platform, yielded similar accuracies in predicting the four GBM subgroups. However, when dealing with cross-platform data, from exon-array to RNA-seq, the classifiers yielded stable models with highest classification accuracies on data transformed by Equal frequency binning. The approach presented here is generally applicable to other cancer types for classification and identification of

  8. Generation of human-induced pluripotent stem cells from burn patient-derived skin fibroblasts using a non-integrative method.

    Science.gov (United States)

    Fu, Shangfeng; Ding, Jianwu; Liu, Dewu; Huang, Heping; Li, Min; Liu, Yang; Tu, Longxiang; Liu, Deming

    2018-01-01

    Patient specific induced pluripotent stem cells (iPSCs) have been recognized as a possible source of cells for skin tissue engineering. They have the potential to greatly benefit patients with large areas of burned skin or skin defects. However, the integration virus-based reprogramming method is associated with a high risk of genetic mutation and mouse embryonic fibroblast feeder-cells may be a pollutant. In the present study, human skin fibroblasts (HSFs) were successfully harvested from patients with burns and patient-specific iPSCs were generated using a non-integration method with a feeder-free approach. The octamer-binding transcription factor 4 (OCT4), sex-determining region Y box 2 (SOX2) and NANOG transcription factors were delivered using Sendai virus vectors. iPSCs exhibited representative human embryonic stem cell-like morphology and proliferation characteristics. They also expressed pluripotent markers, including OCT4, NANOG, SOX2, TRA181, stage-specific embryonic antigen 4 and TRA-160, and exhibited a normal karyotype. Teratoma and embryoid body formation revealed that iPSCs were able to differentiate into cells of all three germ layers in vitro and in vivo. The results of the present study demonstrate that HSFs derived from patients with burns, may be reprogrammed into stem cells with pluripotency, which provides a basis for cell‑based skin tissue engineering in the future.

  9. Environmental externalities: Applying the concept to Asian coal-based power generation. [Includes external environmental and societal costs and methods of evaluating them

    Energy Technology Data Exchange (ETDEWEB)

    Szpunar, C.B.; Gillette, J.L.

    1993-03-01

    This report examines the concept of environmental externality. It discusses various factors -- the atmospheric transformations, relationship of point-source emissions to ambient air quality, dose-response relationships, applicable cause-and-effect principles, and risk and valuation research -- that are considered by a number of state utilities when they apply the environmental externality concept to energy resource planning. It describes a methodology developed by Argonne National Laboratory for general use in resource planning, in combination with traditional methods that consider the cost of electricity production. Finally, it shows how the methodology can be applied in Indonesia, Thailand, and Taiwan to potential coal-fired power plant projects that will make use of clean coal technologies.

  10. Material equations for rock salt under mechanical and thermal load including treatment of boundary value problems by the finite element method

    International Nuclear Information System (INIS)

    Olschewski, J.; Stein, E.; Wagner, W.; Wetjen, D.

    1981-01-01

    This paper is a first step in the development of thermodynamically consistent material equations for inelastic materials, such as polycrystalline rock salt. In this context it is of particular importance to reduce the number and the structure of the internal variables, in order to allow for a fit with available experimental data. As an example this is demonstrated in detail in the case of the so-called dislocation model. As physical non-linearities and in addition also geometrical non-linearities lead to an inhomogeneous deformation - and stress state even in the case of simple samples, boundary value problems have to be studied, in order to test the material equations. For this purpose the finite element method has been used. (orig./HP) [de

  11. Large A.C. machines theory and investigation methods of currents and losses in stator and rotor meshes including operation with nonlinear loads

    CERN Document Server

    Boguslawsky, Iliya; Hayakawa, Masashi

    2017-01-01

    In this monograph the authors solve the modern scientific problems connected with A.C. motors and generators, based first on the detailed consideration of their physical phenomena. The authors describe the theory and investigative methods they developed and applied in practice, which are considered to be of essential interest for specialists in the field of the electrical engineering industry in European countries, the USA, Argentina, and Brazil, as well as in such countries as India, China, and Iran. This book will be of interest to engineers specialized in the field of the manufacture, operation, and repair of A.C. machines (motors and generators) as well as electric drives; to professors, lecturers, and post-graduate students of technical universities, who are specializing in the field of electric machine engineering and electric drives; and to students who are engaged in the field of high current techniques, electric drives, and electric machine engineering.

  12. Method for the determination of the dominant eigenvalue of the neutron transport equation in a slab using fractional derivative

    International Nuclear Information System (INIS)

    Sperotto, Fabiola Aiub; Segatto, Cynthia Feijo; Zabadal, Jorge

    2002-01-01

    In this work, we determine the dominant eigenvalue of the one-dimensional neutron transport equation in a slab constructing an integral form for the neutron transport equation which is the expressed in terms of fractional derivative of the angular flux. Equating the fractional derivative of the angular flux to the integrate equation, we determine the unknown order of the fractional derivative comparing the kernel of the integral equation with the one of Riemann-Liouville definition of fractional derivative. Once known the angular flux the dominant eigenvalue is calculated solving a transcendental equation resulting from the application of the boundary conditions. We report the methodology applied, for comparison with available results in literature. (author)

  13. Derivation of weighting factors for cost and radiological impact for use in comparison of waste management methods

    International Nuclear Information System (INIS)

    Allen, P.T.; Lee, T.R.

    1991-01-01

    Nuclear waste management decisions are complex, and must include considerations of cost and social factors in addition to dose limitation. Decision-aiding techniques, such as multi-attribute analysis, can assist in structuring the problem and can icorporate as many factors, or attributes, as required. However, the relative weights of such attributes need to be established. Methods were devised which could be compared with one another. These were questionnaire-based but, in order to examine the possible influence of the measurement procedures on the results, two of the methods were combined in an experimental design. The two direct methods for obtaining weights (the conventional rating scales and the direct rating task) showed good agreement and yielded different values for separate social groups, such as industrial employees and lay public. The main conclusion is that the elicitation of weighting factors from the public is possible and that the resulting weights are meaningful and could have significant effects on the choice of waste management options

  14. A new 100-m Digital Elevation Model of the Antarctic Peninsula derived from ASTER Global DEM: methods and accuracy assessment

    Directory of Open Access Journals (Sweden)

    A. J. Cook

    2012-10-01

    Full Text Available A high resolution surface topography Digital Elevation Model (DEM is required to underpin studies of the complex glacier system on the Antarctic Peninsula. A complete DEM with better than 200 m pixel size and high positional and vertical accuracy would enable mapping of all significant glacial basins and provide a dataset for glacier morphology analyses. No currently available DEM meets these specifications. We present a new 100-m DEM of the Antarctic Peninsula (63–70° S, based on ASTER Global Digital Elevation Model (GDEM data. The raw GDEM products are of high-quality on the rugged terrain and coastal-regions of the Antarctic Peninsula and have good geospatial accuracy, but they also contain large errors on ice-covered terrain and we seek to minimise these artefacts. Conventional data correction techniques do not work so we have developed a method that significantly improves the dataset, smoothing the erroneous regions and hence creating a DEM with a pixel size of 100 m that will be suitable for many glaciological applications. We evaluate the new DEM using ICESat-derived elevations, and perform horizontal and vertical accuracy assessments based on GPS positions, SPOT-5 DEMs and the Landsat Image Mosaic of Antarctica (LIMA imagery. The new DEM has a mean elevation difference of −4 m (± 25 m RMSE from ICESat (compared to −13 m mean and ±97 m RMSE for the original ASTER GDEM, and a horizontal error of less than 2 pixels, although elevation accuracies are lower on mountain peaks and steep-sided slopes. The correction method significantly reduces errors on low relief slopes and therefore the DEM can be regarded as suitable for topographical studies such as measuring the geometry and ice flow properties of glaciers on the Antarctic Peninsula. The DEM is available for download from the NSIDC website: http://nsidc.org/data/nsidc-0516.html (Asymmetric free vibrations of laminated annular cross-ply circular plates including the effects of shear deformation and rotary inertia. Spline method

    Energy Technology Data Exchange (ETDEWEB)

    Viswanathan, K.K.; Kim, Kyung Su; Lee, Jang Hyun [Inha Univ., Incheon (Korea). Dept. of Naval Architecture and Ocean Engineering

    2009-12-15

    Asymmetric free vibrations of annular cross-ply circular plates are studied using spline function approximation. The governing equations are formulated including the effects of shear deformation and rotary inertia. Assumptions are made to study the cross-ply layered plates. A system of coupled differential equations are obtained in terms of displacement functions and rotational functions. These functions are approximated using Bickley- type spline functions of suitable order. Then the system is converted into the eigenvalue problem by applying the point collocation technique and suitable boundary conditions. Parametric studies have been made to investigate the effect of transverse shear deformation and rotary inertia on frequency parameter with respect to the circumferential node number, radii ratio and thickness to radius ratio for both symmetric and anti-symmetric cross-ply plates using various types of material properties. (orig.)

  15. RD and D-Programme 2004. Programme for research, development and demonstration of methods for the management and disposal of nuclear waste, including social science research

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2004-09-01

    SKB (the Swedish Nuclear Fuel and Waste Management Co), which is owned by the companies that operate the Swedish nuclear power plants, has been assigned the task of managing and disposing of the spent nuclear fuel from the reactors. The Nuclear Activities Act requires a programme of comprehensive research and development and other measures that are needed to manage and dispose of nuclear waste in a safe manner and to decommission and dismantle the nuclear power plants. SKB is now presenting RD and D-Programme 2004 in fulfilment of this requirement. The programme describes SKB's plans for the period 2005-2010. The period of immediate concern is 2005-2007. The level of detail for the three subsequent years is naturally lower.The programme provides a basis for designing systems for safe management and disposal of the radioactive waste from the nuclear power plants. SKB's plan is to implement deep disposal of the spent fuel in accordance with the KBS-3 method. In the RD and D-Programme we describe our activities and planning for this line of action and the work that is being conducted on alternative methods. Review of the programme can contribute valuable outside viewpoints. The regulatory authorities and the Government can clarify how they look upon different parts of the programme and stipulate guidelines for the future. Municipalities and other stakeholders can, after studying the programme, offer their viewpoints to SKB, the regulatory authorities or the Government.The goal for the period up to the end of 2008 is to be able to submit permit applications for the encapsulation plant and the deep repository. This RD and D-Programme therefore differs from the preceding ones in that it concentrates on questions relating to technology development for these facilities. The programmes for safety assessment and research on the long-term processes that take place in the deep repository are then linked together with the programmes for technology development. Another new

  16. RD and D-Programme 2004. Programme for research, development and demonstration of methods for the management and disposal of nuclear waste, including social science research

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2004-09-01

    SKB (the Swedish Nuclear Fuel and Waste Management Co), which is owned by the companies that operate the Swedish nuclear power plants, has been assigned the task of managing and disposing of the spent nuclear fuel from the reactors. The Nuclear Activities Act requires a programme of comprehensive research and development and other measures that are needed to manage and dispose of nuclear waste in a safe manner and to decommission and dismantle the nuclear power plants. SKB is now presenting RD and D-Programme 2004 in fulfilment of this requirement. The programme describes SKB's plans for the period 2005-2010. The period of immediate concern is 2005-2007. The level of detail for the three subsequent years is naturally lower.The programme provides a basis for designing systems for safe management and disposal of the radioactive waste from the nuclear power plants. SKB's plan is to implement deep disposal of the spent fuel in accordance with the KBS-3 method. In the RD and D-Programme we describe our activities and planning for this line of action and the work that is being conducted on alternative methods. Review of the programme can contribute valuable outside viewpoints. The regulatory authorities and the Government can clarify how they look upon different parts of the programme and stipulate guidelines for the future. Municipalities and other stakeholders can, after studying the programme, offer their viewpoints to SKB, the regulatory authorities or the Government.The goal for the period up to the end of 2008 is to be able to submit permit applications for the encapsulation plant and the deep repository. This RD and D-Programme therefore differs from the preceding ones in that it concentrates on questions relating to technology development for these facilities. The programmes for safety assessment and research on the long-term processes that take place in the deep repository are then linked together with the programmes for technology development. Another

  17. RD and D-Programme 2004. Programme for research, development and demonstration of methods for the management and disposal of nuclear waste, including social science research

    International Nuclear Information System (INIS)

    2004-09-01

    SKB (the Swedish Nuclear Fuel and Waste Management Co), which is owned by the companies that operate the Swedish nuclear power plants, has been assigned the task of managing and disposing of the spent nuclear fuel from the reactors. The Nuclear Activities Act requires a programme of comprehensive research and development and other measures that are needed to manage and dispose of nuclear waste in a safe manner and to decommission and dismantle the nuclear power plants. SKB is now presenting RD and D-Programme 2004 in fulfilment of this requirement. The programme describes SKB's plans for the period 2005-2010. The period of immediate concern is 2005-2007. The level of detail for the three subsequent years is naturally lower.The programme provides a basis for designing systems for safe management and disposal of the radioactive waste from the nuclear power plants. SKB's plan is to implement deep disposal of the spent fuel in accordance with the KBS-3 method. In the RD and D-Programme we describe our activities and planning for this line of action and the work that is being conducted on alternative methods. Review of the programme can contribute valuable outside viewpoints. The regulatory authorities and the Government can clarify how they look upon different parts of the programme and stipulate guidelines for the future. Municipalities and other stakeholders can, after studying the programme, offer their viewpoints to SKB, the regulatory authorities or the Government.The goal for the period up to the end of 2008 is to be able to submit permit applications for the encapsulation plant and the deep repository. This RD and D-Programme therefore differs from the preceding ones in that it concentrates on questions relating to technology development for these facilities. The programmes for safety assessment and research on the long-term processes that take place in the deep repository are then linked together with the programmes for technology development. Another new

  18. Evaluation of elemental profiling methods, including laser-induced breakdown spectroscopy (LIBS), for the differentiation of Cannabis plant material grown in different nutrient solutions.

    Science.gov (United States)

    El-Deftar, Moteaa M; Robertson, James; Foster, Simon; Lennard, Chris

    2015-06-01

    Laser-induced breakdown spectroscopy (LIBS) is an emerging atomic emission based solid sampling technique that has many potential forensic applications. In this study, the analytical performance of LIBS, as well as that of inductively coupled plasma mass spectrometry (ICP-MS), laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) and X-ray microfluorescence (μXRF), was evaluated for the ability to conduct elemental analyses on Cannabis plant material, with a specific investigation of the possible links between hydroponic nutrients and elemental profiles from associated plant material. No such study has been previously published in the literature. Good correlation among the four techniques was observed when the concentrations or peak areas of the elements of interest were monitored. For Cannabis samples collected at the same growth time, the elemental profiles could be related to the use of particular commercial nutrients. In addition, the study demonstrated that ICP-MS, LA-ICP-MS and LIBS are suitable techniques for the comparison of Cannabis samples from different sources, with high discriminating powers being achieved. On the other hand, μXRF method was not suitable for the discrimination of Cannabis samples originating from different growth nutrients. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  19. Solving the competitive facility location problem considering the reactions of competitor with a hybrid algorithm including Tabu Search and exact method

    Science.gov (United States)

    Bagherinejad, Jafar; Niknam, Azar

    2018-03-01

    In this paper, a leader-follower competitive facility location problem considering the reactions of the competitors is studied. A model for locating new facilities and determining levels of quality for the facilities of the leader firm is proposed. Moreover, changes in the location and quality of existing facilities in a competitive market where a competitor offers the same goods or services are taken into account. The competitor could react by opening new facilities, closing existing ones, and adjusting the quality levels of its existing facilities. The market share, captured by each facility, depends on its distance to customer and its quality that is calculated based on the probabilistic Huff's model. Each firm aims to maximize its profit subject to constraints on quality levels and budget of setting up new facilities. This problem is formulated as a bi-level mixed integer non-linear model. The model is solved using a combination of Tabu Search with an exact method. The performance of the proposed algorithm is compared with an upper bound that is achieved by applying Karush-Kuhn-Tucker conditions. Computational results show that our algorithm finds near the upper bound solutions in a reasonable time.

  1. More Than Just Accuracy: A Novel Method to Incorporate Multiple Test Attributes in Evaluating Diagnostic Tests Including Point of Care Tests.

    Science.gov (United States)

    Thompson, Matthew; Weigl, Bernhard; Fitzpatrick, Annette; Ide, Nicole

    2016-01-01

    Current frameworks for evaluating diagnostic tests are constrained by a focus on diagnostic accuracy, and assume that all aspects of the testing process and test attributes are discrete and equally important. Determining the balance between the benefits and harms associated with new or existing tests has been overlooked. Yet, this is critically important information for stakeholders involved in developing, testing, and implementing tests. This is particularly important for point of care tests (POCTs) where tradeoffs exist between numerous aspects of the testing process and test attributes. We developed a new model that multiple stakeholders (e.g., clinicians, patients, researchers, test developers, industry, regulators, and health care funders) can use to visualize the multiple attributes of tests, the interactions that occur between these attributes, and their impacts on health outcomes. We use multiple examples to illustrate interactions between test attributes (test availability, test experience, and test results) and outcomes, including several POCTs. The model could be used to prioritize research and development efforts, and inform regulatory submissions for new diagnostics. It could potentially provide a way to incorporate the relative weights that various subgroups or clinical settings might place on different test attributes. Our model provides a novel way that multiple stakeholders can use to visualize test attributes, their interactions, and impacts on individual and population outcomes. We anticipate that this will facilitate more informed decision making around diagnostic tests.

  2. Simultaneous determination of naphthalene and anthraquinone derivatives in Rumex nepalensis Spreng. roots by HPLC: comparison of different extraction methods and validation.

    Science.gov (United States)

    Gautam, Raju; Srivastava, Amit; Jachak, Sanjay M

    2011-01-01

    Rumex nepalensis contains mainly anthraquinone and naphthalene derivatives. Although HPLC methods have been reported for the analysis of anthraquinones, neither a phytochemical analysis of Rumex species nor the simultaneous determination of anthraquinone and naphthalene derivatives in other samples has been reported so far. To develop and validate a HPLC method for the simultaneous determination of anthraquinone and naphthalene derivatives in R. nepalensis roots. Anthraquinones and naphthalenes were extracted from R. nepalensis roots by three methods (reflux, ultrasonication and pressurized liquid extraction) using methanol. Separation was achieved on an RP C₁₈ column with a gradient mobile phase consisting of 0.05% orthophosphoric acid in water (solvent A) and methanol (solvent B) using a UV detector (254 nm). Small differences were observed in the contents of anthraquinone and naphthalene derivatives extracted by the three methods. Chrysophanol-8-O-β-D-glucopyranoside and nepodin were detected as major constituents. The method showed a good linearity (r² > 0.9992), high precision (RSD anthraquinones and naphthalenes in R. nepalensis and other Rumex species for both quality control as well as routine analytical purposes. Copyright © 2010 John Wiley & Sons, Ltd.

  3. A simple, generalizable method for measuring individual research productivity and its use in the long-term analysis of departmental performance, including between-country comparisons.

    Science.gov (United States)

    Wootton, Richard

    2013-01-14

    A simple, generalizable method for measuring research output would be useful in attempts to build research capacity, and in other contexts. A simple indicator of individual research output was developed, based on grant income, publications and numbers of PhD students supervised. The feasibility and utility of the indicator was examined by using it to calculate research output from two similarly-sized research groups in different countries. The same indicator can be used to assess the balance in the research "portfolio" of an individual researcher. Research output scores of 41 staff in Research Department A had a wide range, from zero to 8; the distribution of these scores was highly skewed. Only about 20% of the researchers had well-balanced research outputs, with approximately equal contributions from grants, papers and supervision. Over a five-year period, Department A's total research output rose, while the number of research staff decreased slightly, in other words research productivity (output per head) rose. Total research output from Research Department B, of approximately the same size as A, was similar, but slightly higher than Department A. The proposed indicator is feasible. The output score is dimensionless and can be used for comparisons within and between countries. Modeling can be used to explore the effect on research output of changing the size and composition of a research department. A sensitivity analysis shows that small increases in individual productivity result in relatively greater increases in overall departmental research output. The indicator appears to be potentially useful for capacity building, once the initial step of research priority setting has been completed.

  4. Electricity derivatives

    CERN Document Server

    Aïd, René

    2015-01-01

    Offering a concise but complete survey of the common features of the microstructure of electricity markets, this book describes the state of the art in the different proposed electricity price models for pricing derivatives and in the numerical methods used to price and hedge the most prominent derivatives in electricity markets, namely power plants and swings. The mathematical content of the book has intentionally been made light in order to concentrate on the main subject matter, avoiding fastidious computations. Wherever possible, the models are illustrated by diagrams. The book should allow prospective researchers in the field of electricity derivatives to focus on the actual difficulties associated with the subject. It should also offer a brief but exhaustive overview of the latest techniques used by financial engineers in energy utilities and energy trading desks.

  5. Cost-Effective Method for Producing Self Supported Palladium Alloy Membranes for Use in Efficient Production of Coal Derived Hydrogen

    Energy Technology Data Exchange (ETDEWEB)

    K. Coulter

    2008-03-31

    Southwest Research Institute{reg_sign} (SwRI{reg_sign}) has utilized its expertise in large-area vacuum deposition methods to conduct research into the fabrication of dense, freestanding Pd-alloy membranes that are 3-5 microns thick and over 100 in{sup 2} in area. The membranes were deposited onto flexible and rigid supports that were subsequently removed and separated using novel techniques developed over the course of the project. Using these methods, the production of novel alloy compositions centered around the Pd-Cu system were developed with the objective of producing a thermally stable, nano-crystalline grain structure with the highest flux recorded as 242 SCFH/ft{sup 2} for a 2 {micro}m thick Pd{sub 53}Cu{sub 47} at 400 C and 20 psig feed pressure which when extrapolated is over twice the 2010 Department of Energy pure H{sub 2} flux target. Several membranes were made with the same permeability, but with different thicknesses and these membranes were highly selective. Researchers at the Colorado School of Mines supported the effort with extensive testing of experimental membranes as well as design and modeling of novel alloy composite structures. IdaTech provided commercial bench testing and analysis of SwRI-manufactured membranes. The completed deliverables for the project include test data on the performance of experimental membranes fabricated by vacuum deposition and several Pd-alloy membranes that were supplied to IdaTech for testing.

  6. THE DETERMINATION OF BUPROPION HYDROCHLORIDE IN PHARMACEUTICAL DOSAGE FORMS BY ORIGINAL UV- AND SECOND DERIVATIVE UV SPECTROPHOTOMETRY, POTENTIOMETRIC AND CONDUCTOMETRIC METHODS

    Directory of Open Access Journals (Sweden)

    Duygu YENİCELİ

    2010-08-01

    Full Text Available Spectrophotometric, potentiometric and conductometric methods are developed for the determination of bupropion hydrochloride (BLIP in pharmaceutical tablets. For the first method, original UV-spectrophotometry, 252 nm was determined as the optimum wavelength and used for the determinations. For the other method, second derivative UV spectrophotometry, the absorbances were measured at 217.4 and 221.8 nm and the distance between these extremum values was determined according to peak to peak method. Two spectrophotometric methods were validated over the concentration range of 5.72 - 20.03 ug/mL. The limit of detection and limit of quantitation values of original UV-spectrophotometry were 0.75 ug/mL and 2.28 jug/mL. Also, these parameters were determined as 0.23 ug/mL and 0.68 ug/mL respectively, for the second derivative UV spectrophotometry. Developed methods were fully validated and the applicability of the methods for the determination of BUP in pharmaceuticals were demonstrated. Also, simple potentiometric and conductometric methods were developed and the applicability of these methods were demonstrated. The results of four analytical methods were compared with ANOVA test and no significant difference was found statistically. As a result, the developed methods could be proposed to the rutin content analysis to be simple, cheap, accurate, and precise

  7. Generic method for deriving the general shaking force balance conditions of parallel manipulators with application to a redundant planar 4-RRR parallel manipulator

    NARCIS (Netherlands)

    van der Wijk, V.; Krut, S.; Pierrot, F.; Herder, Justus Laurens

    2011-01-01

    This paper proposes a generic method for deriving the general shaking force balance conditions of parallel manipulators. Instead of considering the balancing of a parallel manipulator link-by-link or leg-by-leg, the architecture is considered altogether. The first step is to write the linear

  8. [Application of precursor ion scanning method in rapid screening of illegally added phosphodiesterase-5 inhibitors and their unknown derivatives in Chinese traditional patent medicines and health foods].

    Science.gov (United States)

    Sun, Jing; Cao, Ling; Feng, Youlong; Tan, Li

    2014-11-01

    The compounds with similar structure often have similar pharmacological activities. So it is a trend for illegal addition that new derivatives of effective drugs are synthesized to avoid the statutory test. This bring challenges to crack down on illegal addition behavior, however, modified derivatives usually have similar product ions, which allow for precursor ion scanning. In this work, precursor ion scanning mode of a triple quadrupole mass spectrometer was first applied to screen illegally added drugs in complex matrix such as Chinese traditional patent medicines and healthy foods. Phosphodiesterase-5 inhibitors were used as experimental examples. Through the analysis of the structure and mass spectrum characteristics of the compounds, phosphodiesterase-5 inhibitors were classified, and their common product ions were screened by full scan of product ions of typical compounds. Then high performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS) method with precursor ion scanning mode was established based on the optimization of MS parameters. The effect of mass parameters and the choice of fragment ions were also studied. The method was applied to determine actual samples and further refined. The results demonstrated that this method can meet the need of rapid screening of unknown derivatives of phosphodiesterase-5 inhibitors in complex matrix, and prevent unknown derivatives undetected. This method shows advantages in sensitivity, specificity and efficiency, and is worth to be further investigated.

  9. 76 FR 10591 - Notice of Availability; Recommended Use of Body Weight3∕4 as the Default Method in Derivation of...

    Science.gov (United States)

    2011-02-25

    ... Use of Body Weight[bds3][bdsol][bds4] as the Default Method in Derivation of the Oral Reference Dose... the Oral Reference Dose'' (referred to hereafter as BW 3/4 ). This document was developed as part of... exposure. The reader is encouraged to read the document carefully, however, in order to fully understand...

  10. Isolation of Three Triterpene Saponins, Including Two New Oleanane Derivatives, from Soldanella alpina and Hydrophilic Interaction Liquid Chromatography-Evaporative Light Scattering Detection of these Three Saponins in Four Soldenella Species.

    Science.gov (United States)

    Haller, Julia; Schwaiger, Stefan; Stuppner, Hermann; Gafner, Frank; Ganzera, Markus

    2017-11-01

    The genus Soldanella is one of the few endemic to Europe. Some of its species have relevance in local traditional medicine. Earlier work has indicated the possible presence of saponins in S. alpina. To investigate S. alpina and other related species for the occurrence of saponins. Following sequential extraction with n-hexane, dichloromethane and ethyl acetate the subsequent methanolic extract of S. alpina roots was fractionated after solvent precipitation using fast centrifugal partition chromatography and column chromatography. Structures were elucidated by LC-MS n , high-resolution MS, hydrolysis experiments and one-dimensional (1D)- and two-dimensional (2D)-NMR. A hydrophilic interaction liquid chromatography method was developed to quantitate saponins in the leaves and roots of four Soldanella species. Three triterpene saponins, two of them new natural products, were isolated from S. alpina. Based on an epoxyoleanal aglycone substituted with four sugar units, they were analytically quantitated using a Kinetex 2.6 μm hydrophilic interaction liquid chromatography (HILIC) column together with a mobile phase comprising of ammonium acetate, water and acetonitrile. Method validation confirmed that the assay meets all requirements in respect to linearity, accuracy, sensitivity and precision. All four Soldanella species investigated contained the three saponins. The lowest total level of the three saponins (1.09%) was observed in S. montana leaves while the highest saponin content (5.14%) was determined in S. alpina roots. The detection of saponins within the genus Soldanella is an indication that further phytochemical examination of this genus may reveal more secondary metabolites of interest. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  11. Synthetic saponite-derivatives, a method for preparing such saponites and their use in catalytic (hydro) conversions

    NARCIS (Netherlands)

    1990-01-01

    The invention relates to saponite derivatives according to the general formula An+_x/n[(Mg3-yMy)(Si4-xAlx)O10(OH2-z)Fz ] wherein A represents an (alkyl-substituted) ammonium ion and/or any metal having basic or amphoteric properties, M represents a bivalent metal ion having an ionic radius between

  12. Liposomal solubilization of new 3-hydroxy-quinolinone derivatives with promising anticancer activity: a screening method to identify maximum incorporation capacity

    DEFF Research Database (Denmark)

    Di Cagno, Massimiliano; Styskala, Jakub; Hlaváč, Jan

    2011-01-01

    Four new 3-hydroxy-quinolinone derivatives with promising anticancer activity could be solubilized using liposomes as vehicle to an extent that allows their in vitro and in vivo testing without use of toxic solvent(s). A screening method to identify the maximum incorporation capacity of hydrophobic......, resulting in a 200-500-fold increase in apparent solubility. Drug-to-lipid ratios in the range of 2-5 µg/mg were obtained. Interestingly, the four quinolinone derivatives have shown different association tendencies with liposomes, probably due to the physicochemical properties of the different group bonded...

  13. Nano Cu interaction with single amino acid tyrosine derived self-assemblies; study through XRD, AFM, confocal Raman microscopy, SERS and DFT methods

    Science.gov (United States)

    Govindhan, Raman; Karthikeyan, Balakrishnan

    2017-12-01

    3,5-Bis(trifluoromethyl)benzylamine derivatives of single amino acid tyrosine produced self-assembled nanotubes (BTTNTs) as simple Phe-Phe. It has been observed that tyrosine derivative gives exclusively micro and nano tubes irrespective of the concentration of the precursor monomer. However, the introduced xenobiotic trifluoromethyl group (TFM) present in key backbone positionsof the self assembly gives the specific therapeutic function has been highlighted. Herein this work study of such self assembled nanotubes were studied through experimental and theoretical methods. The interaction of nanocopper cluster with the nanotubes (Cu@BTTNTs) were extensively studied by various methods like XRD, AFM, confocal Raman microscopy, SERS and theoretical methods like Mulliken's atomic charge analysis. SERS reveals that the interactions of Cu cluster with NH2, OH, NH and phenyl ring π-electrons system of BTTNTs. DFT studies gave the total dipole moment values of Cu@BTTNTs and explained the nature of interaction.

  14. INEL cold test pit demonstration of improvements in information derived from non-intrusive geophysical methods over buried waste sites

    International Nuclear Information System (INIS)

    1994-01-01

    Under contract between US DOE Idaho National Engineering Laboratory (INEL) and the Blackhawk Geosciences Division of Coleman Research Corporation (BGD-CRC), geophysical investigations were conducted to improve the detection of buried wastes. Over the Cold Test Pit (CTP) at INEL, data were acquired with multiple sensors on a dense grid. Over the CTP the interpretations inferred from geophysical data are compared with the known placement of various waste forms in the pit. The geophysical sensors employed were magnetics, frequency and time domain electromagnetics, and ground penetrating radar. Also, because of the high data density acquired, filtering and other data processing and imaging techniques were tested. After completion and analysis of the survey and interpretation over the CTP, the second phase of investigation consisted of testing geophysical methods over the Idaho Chemical Processing Plant (ICPP). The sections of the ICPP surveyed are underlain by a complex network of buried utility lines of different dimensions and composition, and with placement at various depths up to 13 ft. Further complications included many metallic objects at the surface, such as buildings, reinforced concrete pads, and debris. Although the multiple geophysical sensor approach mapped many buried utilities, they mapped far from all utilities shown on the facility drawings. This report consists of data collected from these geophysical surveys over the ICPP

  15. Characteristics of genomic signatures derived using univariate methods and mechanistically anchored functional descriptors for predicting drug- and xenobiotic-induced nephrotoxicity.

    Science.gov (United States)

    Shi, Weiwei; Bugrim, Andrej; Nikolsky, Yuri; Nikolskya, Tatiana; Brennan, Richard J

    2008-01-01

    ABSTRACT The ideal toxicity biomarker is composed of the properties of prediction (is detected prior to traditional pathological signs of injury), accuracy (high sensitivity and specificity), and mechanistic relationships to the endpoint measured (biological relevance). Gene expression-based toxicity biomarkers ("signatures") have shown good predictive power and accuracy, but are difficult to interpret biologically. We have compared different statistical methods of feature selection with knowledge-based approaches, using GeneGo's database of canonical pathway maps, to generate gene sets for the classification of renal tubule toxicity. The gene set selection algorithms include four univariate analyses: t-statistics, fold-change, B-statistics, and RankProd, and their combination and overlap for the identification of differentially expressed probes. Enrichment analysis following the results of the four univariate analyses, Hotelling T-square test, and, finally out-of-bag selection, a variant of cross-validation, were used to identify canonical pathway maps-sets of genes coordinately involved in key biological processes-with classification power. Differentially expressed genes identified by the different statistical univariate analyses all generated reasonably performing classifiers of tubule toxicity. Maps identified by enrichment analysis or Hotelling T-square had lower classification power, but highlighted perturbed lipid homeostasis as a common discriminator of nephrotoxic treatments. The out-of-bag method yielded the best functionally integrated classifier. The map "ephrins signaling" performed comparably to a classifier derived using sparse linear programming, a machine learning algorithm, and represents a signaling network specifically involved in renal tubule development and integrity. Such functional descriptors of toxicity promise to better integrate predictive toxicogenomics with mechanistic analysis, facilitating the interpretation and risk assessment of

  16. Pharmacological Classification and Activity Evaluation of Furan and Thiophene Amide Derivatives Applying Semi-Empirical ab initio Molecular Modeling Methods

    Directory of Open Access Journals (Sweden)

    Leszek Bober

    2012-05-01

    Full Text Available Pharmacological and physicochemical classification of the furan and thiophene amide derivatives by multiple regression analysis and partial least square (PLS based on semi-empirical ab initio molecular modeling studies and high-performance liquid chromatography (HPLC retention data is proposed. Structural parameters obtained from the PCM (Polarizable Continuum Model method and the literature values of biological activity (antiproliferative for the A431 cells expressed as LD50 of the examined furan and thiophene derivatives was used to search for relationships. It was tested how variable molecular modeling conditions considered together, with or without HPLC retention data, allow evaluation of the structural recognition of furan and thiophene derivatives with respect to their pharmacological properties.

  17. Continuous-flow retro-Diels-Alder reaction: an efficient method for the preparation of pyrimidinone derivatives.

    Science.gov (United States)

    Nekkaa, Imane; Palkó, Márta; Mándity, István M; Fülöp, Ferenc

    2018-01-01

    The syntheses of various pyrimidinones as potentially bioactive products by means of the highly controlled continuous-flow retro-Diels-Alder reaction of condensed pyrimidinone derivatives are presented. Noteworthy, the use of this approach allowed us to rapidly screen a selection of conditions and quickly confirm the viability of preparing the desired pyrimidinones in short reaction times. Yields typically higher than those published earlier using conventional batch or microwave processes were achieved.

  18. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparisons with Other Methods

    International Nuclear Information System (INIS)

    Wu, Liyou; Yi, T.Y.; Van Nostrand, Joy; Zhou, Jizhong

    2010-01-01

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site (Hanford Reach of the Columbia River (HRCR), 11 strains), Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.

  19. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparison with Other Methods

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy; Zhou, Jizhong

    2010-05-17

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.

  20. Operational Linescan System (OLS) - Derived Products (including posters and slides)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Visible and infrared imagery from DMSP Operational Linescan System (OLS) instruments are used to monitor the global distribution of clouds and cloud top temperatures...

  1. Mean centering of ratio spectra and successive derivative ratio spectrophotometric methods for determination of isopropamide iodide, trifluoperazine hydrochloride and trifluoperazine oxidative degradate

    Directory of Open Access Journals (Sweden)

    Maha M. Abdelrahman

    2016-09-01

    Full Text Available Two sensitive, selective and precise stability indicating methods for the determination of isopropamide iodide (ISO, trifluoperazine hydrochloride (TPZ and trifluoperazine oxidative degradate (DEG were developed and validated. Method A is a successive derivative ratio spectrophotometric one, which depends on the successive derivative of ratio spectra in two steps using 0.1 N HCl as a solvent and measuring TPZ at 250.4 and 257.2 nm, ISO at 223 and 228 nm and DEG at 210.6, 213 and 270.2 nm. Method B is mean centering of ratio spectra which depends on using the mean centered ratio spectra in two successive steps and measuring the mean centered values of the second ratio spectra at 322, 355 and 339 nm for TPZ, ISO and DEG, respectively. Factors affecting the developed methods were studied and optimized, moreover, they have been validated as per ICH guidelines and the results demonstrated that the suggested methods are reliable, reproducible and suitable for routine use with short analysis time. Statistical analysis of the two developed methods with the reported one using F- and Student’s t-test showed no significant difference regarding accuracy and precision.

  2. Methods of analysis by the U.S. Geological Survey National Water Quality Laboratory; determination of the total phosphorus by a Kjeldahl digestion method and an automated colorimetric finish that includes dialysis

    Science.gov (United States)

    Patton, Charles J.; Truitt, Earl P.

    1992-01-01

    A method to determine total phosphorus (TP) in the same digests prepared for total Kjeldahl nitrogen (TKN) determinations is desribed. The batch, high-temperature (block digester), HG(II)-catalyzed digestion step is similar to U.S. Geological Survey methods I-2552-85/I-4552-85 and U.S. Environmental Protection Agency method 365.4 except that sample and reagent volumes are halved. Prepared digests are desolvated at 220 degrees Celsius and digested at 370 degrees Celsius in separate block digesters set at these temperatures, rather than in a single, temperature-programmed block digester. This approach is used in the method escribed here, which permits 40 calibrants, reference waters, and smaples to be digested and resolvated in about an hour. Orthophosphate ions originally present in samples, along with those released during the digestion step, are determined colorimetrically at a rate of 90 tests per hour by an automated version of the phosphoantimonylmolybdenum blue procedure. About 100 microliters of digest are required per determination. The upper concentration limit is 2 milligrams per liter (mg/L) with a method detection limt of 0.01 mg/L. Repeatability for a sample containing approximately 1.6 mg/L of TP in a high suspended-solids matrix is 0.7 percent. Between-day precision for the same sample is 5.0 percent. A dialyzer in the air-segmented continuous flow analyzer provides on-line digest cleanup, eliminated particulates that otherwise would interfere in the colorimetric finish. An single-channel analyzer can process the resolvated digests from two pairs of block digesters each hour. Paired t-test analysis of TP concentrations for approximately 1,600 samples determined by the new method (U.S. Geologial Survey methods I-2610-91 and I-4610-91) and the old method (U.S. Geological Survey methods I-2600-85 and I-4600-85) revealed positive bias in the former of 0.02 to 0.04 mg/L for surface-water samples in agreement with previous studies. Concentrations of total

  3. On deriving the Maxwell stress tensor method for calculating the optical force and torque on an object in harmonic electromagnetic fields

    Science.gov (United States)

    Ye, Qian; Lin, Haoze

    2017-07-01

    Though extensively used in calculating optical force and torque acting on a material object illuminated by laser, the Maxwell stress tensor (MST) method follows the electromagnetic linear and angular momentum balance that is usually derived in most textbooks for a continuous volume charge distribution in free space, if not resorting to the application of Noether’s theorem in electrodynamics. To cast the conservation laws into a physically appealing form involving the current densities of linear and angular momentum, on which the MST method is based, the divergence theorem is employed to transform a volume integral into a surface integral. When a material object of finite volume is put into the field, it brings about a discontinuity of field across its surface, due to the presence of induced surface charge and surface current. Ambiguity arises among students in whether the divergence theorem can still be directly used without any justification. By taking into account the effect of the induced surface charge and current, we present a simple pedagogical derivation for the MST method for calculating the optical force and torque on an object immersed in monochromatic optical field, without resorting to Noether’s theorem. Although the results turn out to be identical to those given in the standard textbooks, our derivation avoids the direct use of the divergence theorem on a discontinuous function.

  4. On deriving the Maxwell stress tensor method for calculating the optical force and torque on an object in harmonic electromagnetic fields

    International Nuclear Information System (INIS)

    Ye, Qian; Lin, Haoze

    2017-01-01

    Though extensively used in calculating optical force and torque acting on a material object illuminated by laser, the Maxwell stress tensor (MST) method follows the electromagnetic linear and angular momentum balance that is usually derived in most textbooks for a continuous volume charge distribution in free space , if not resorting to the application of Noether’s theorem in electrodynamics. To cast the conservation laws into a physically appealing form involving the current densities of linear and angular momentum, on which the MST method is based, the divergence theorem is employed to transform a volume integral into a surface integral. When a material object of finite volume is put into the field, it brings about a discontinuity of field across its surface, due to the presence of induced surface charge and surface current. Ambiguity arises among students in whether the divergence theorem can still be directly used without any justification. By taking into account the effect of the induced surface charge and current, we present a simple pedagogical derivation for the MST method for calculating the optical force and torque on an object immersed in monochromatic optical field, without resorting to Noether’s theorem. Although the results turn out to be identical to those given in the standard textbooks, our derivation avoids the direct use of the divergence theorem on a discontinuous function. (paper)

  5. Evaluation of Derivative Ultraviolet Spectrometry for Determining Saccharin in Cola and Other Matrices: An Instrumental Methods Experiment.

    Science.gov (United States)

    Stolzberg, Richard J.

    1986-01-01

    Background information and experimental procedures are provided for an experiment in which three samples of saccharin (a nickel plating solution, a dilute cola drink, and a more concentrated cola drink) are analyzed and the data interpreted using five methods. Precision and accuracy are evaluated and the best method is selected. (JN)

  6. A systematic evaluation of integration free reprogramming methods for deriving clinically relevant patient specific induced pluripotent stem (iPS cells.

    Directory of Open Access Journals (Sweden)

    Pollyanna A Goh

    Full Text Available A systematic evaluation of three different methods for generating induced pluripotent stem (iPS cells was performed using the same set of parental cells in our quest to develop a feeder independent and xeno-free method for somatic cell reprogramming that could be transferred into a GMP environment. When using the BJ fibroblast cell line, the highest reprogramming efficiency (1.89% of starting cells was observed with the mRNA based method which was almost 20 fold higher than that observed with the retrovirus (0.2% and episomal plasmid (0.10% methods. Standard characterisation tests did not reveal any differences in an array of pluripotency markers between the iPS lines derived using the various methods. However, when the same methods were used to reprogram three different primary fibroblasts lines, two derived from patients with rapid onset parkinsonism dystonia and one from an elderly healthy volunteer, we consistently observed higher reprogramming efficiencies with the episomal plasmid method, which was 4 fold higher when compared to the retroviral method and over 50 fold higher than the mRNA method. Additionally, with the plasmid reprogramming protocol, recombinant vitronectin and synthemax® could be used together with commercially available, fully defined, xeno-free essential 8 medium without significantly impacting the reprogramming efficiency. To demonstrate the robustness of this protocol, we reprogrammed a further 2 primary patient cell lines, one with retinosa pigmentosa and the other with Parkinsons disease. We believe that we have optimised a simple and reproducible method which could be used as a starting point for developing GMP protocols, a prerequisite for generating clinically relevant patient specific iPS cells.

  7. Optimization of Ex Vivo Murine Bone Marrow Derived Immature Dendritic Cells: A Comparative Analysis of Flask Culture Method and Mouse CD11c Positive Selection Kit Method

    Directory of Open Access Journals (Sweden)

    Rahul Ashok Gosavi

    2018-01-01

    Full Text Available 12–14 days of culturing of bone marrow (BM cells containing various growth factors is widely used method for generating dendritic cells (DCs from suspended cell population. Here we compared flask culture method and commercially available CD11c Positive Selection kit method. Immature BMDCs’ purity of adherent as well as suspended cell population was generated in the decreasing concentration of recombinant-murine granulocyte-macrophage colony-stimulating factor (rmGM-CSF in nontreated tissue culture flasks. The expression of CD11c, MHCII, CD40, and CD86 was measured by flow cytometry. We found significant difference (P<0.05 between the two methods in the adherent cells population but no significant difference was observed between the suspended cell populations with respect to CD11c+ count. However, CD11c+ was significantly higher in both adhered and suspended cell population by culture method but kit method gave more CD11c+ from suspended cells population only. On the other hand, using both methods, immature DC expressed moderate level of MHC class II molecules as well as low levels of CD40 and CD86. Our findings suggest that widely used culture method gives the best results in terms of yield, viability, and purity of BMDCs from both adherent and suspended cell population whereas kit method works well for suspended cell population.

  8. Application of experimental design and derivative spectrophotometry methods in optimization and analysis of biosorption of binary mixtures of basic dyes from aqueous solutions.

    Science.gov (United States)

    Asfaram, Arash; Ghaedi, Mehrorang; Ghezelbash, Gholam Reza; Pepe, Francesco

    2017-05-01

    Simultaneous biosorption of malachite green (MG) and crystal violet (CV) on biosorbent Yarrowia lipolytica ISF7 was studied. An appropriate derivative spectrophotometry technique was used to evaluate the concentration of each dye in binary solutions, despite significant interferences in visible light absorbances. The effects of pH, temperature, growth time, initial MG and CV concentration in batch experiments were assessed using Design of Experiment (DOE) according to central composite second order response surface methodology (RSM). The analysis showed that the greatest biosorption efficiency (>99% for both dyes) can be obtained at pH 7.0, T=28°C, 24h mixing and 20mgL -1 initial concentrations for both MG and CV dyes. The quadratic constructed equation ability for fitting experimental data is judged based on criterions like R 2 values, significant p and lack-of-fit value strongly confirm its high adequacy and applicability for prediction of revel behavior of the system under study. The proposed model showed very high correlation coefficients (R 2 =0.9997 for CV and R 2 =0.9989 for MG), while supported by closeness of predicted and experimental value. A kinetic analysis was carried out, showing that for both dyes a pseudo-second order kinetic model adequately describes the available data. The Langmuir isotherm model in single and binary components has better performance for description of dyes biosorption with maximum monolayer biosorption capacity of 59.4 and 62.7mgg -1 in single component and 46.4 and 50.0mgg -1 for CV and MB in binary components, respectively. The surface structure of biosorbents and the possible biosorbents-dyes interactions between were also evaluated by Fourier transform infrared (FT-IR) spectroscopy and scanning electron microscopy (SEM). The values of thermodynamic parameters including ΔG° and ΔH° strongly confirm which method is spontaneous and endothermic. Copyright © 2017. Published by Elsevier Inc.

  9. Building up a QSAR model for toxicity toward Tetrahymena pyriformis by the Monte Carlo method: A case of benzene derivatives.

    Science.gov (United States)

    Toropova, Alla P; Schultz, Terry W; Toropov, Andrey A

    2016-03-01

    Data on toxicity toward Tetrahymena pyriformis is indicator of applicability of a substance in ecologic and pharmaceutical aspects. Quantitative structure-activity relationships (QSARs) between the molecular structure of benzene derivatives and toxicity toward T. pyriformis (expressed as the negative logarithms of the population growth inhibition dose, mmol/L) are established. The available data were randomly distributed three times into the visible training and calibration sets, and invisible validation sets. The statistical characteristics for the validation set are the following: r(2)=0.8179 and s=0.338 (first distribution); r(2)=0.8682 and s=0.341 (second distribution); r(2)=0.8435 and s=0.323 (third distribution). These models are built up using only information on the molecular structure: no data on physicochemical parameters, 3D features of the molecular structure and quantum mechanics descriptors are involved in the modeling process. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Derivation and application of an analytical rock displacement solution on rectangular cavern wall using the inverse mapping method.

    Directory of Open Access Journals (Sweden)

    Mingzhong Gao

    Full Text Available Rectangular caverns are increasingly used in underground engineering projects, the failure mechanism of rectangular cavern wall rock is significantly different as a result of the cross-sectional shape and variations in wall stress distributions. However, the conventional computational method always results in a long-winded computational process and multiple displacement solutions of internal rectangular wall rock. This paper uses a Laurent series complex method to obtain a mapping function expression based on complex variable function theory and conformal transformation. This method is combined with the Schwarz-Christoffel method to calculate the mapping function coefficient and to determine the rectangular cavern wall rock deformation. With regard to the inverse mapping concept, the mapping relation between the polar coordinate system within plane ς and a corresponding unique plane coordinate point inside the cavern wall rock is discussed. The disadvantage of multiple solutions when mapping from the plane to the polar coordinate system is addressed. This theoretical formula is used to calculate wall rock boundary deformation and displacement field nephograms inside the wall rock for a given cavern height and width. A comparison with ANSYS numerical software results suggests that the theoretical solution and numerical solution exhibit identical trends, thereby demonstrating the method's validity. This method greatly improves the computing accuracy and reduces the difficulty in solving for cavern boundary and internal wall rock displacements. The proposed method provides a theoretical guide for controlling cavern wall rock deformation failure.

  11. Derivation of the stellar luminosity function in the direction of the south galactic pole by a statistical method

    Energy Technology Data Exchange (ETDEWEB)

    Kipp, S L

    1981-12-01

    A method is developed to calculate absolute magnitude probability distributions for stars from a proper motion survey. This method uses ellipsoidal velocity distributions to predict tangential velocity distributions. The tangential velocity distributions are transformed into absolute magnitude distributions. The absolute magnitude distributions for the stars in a proper motion survey may be summed to produce a luminosity function. This method was applied to stars in the region of the south galactic pole and the resulting luminosity function is statistically identical to Luyten's 1968 luminosity function.

  12. Without derivatives or limits: from visual and geometrical points of view to algebraic methods for identifying tangent lines

    Science.gov (United States)

    Vivier, L.

    2013-07-01

    Usually, the tangent line is considered to be a calculus notion. However, it is also a graphical and an algebraic notion. The graphical frame, where our primary conceptions are conceived, could give rise to algebraic methods to obtain the tangent line to a curve. In this pre-calculus perspective, two methods are described and discussed according to their potential for secondary students and teacher training.

  13. A family of four stages embedded explicit six-step methods with eliminated phase-lag and its derivatives for the numerical solution of the second order problems

    Science.gov (United States)

    Simos, T. E.

    2017-11-01

    A family of four stages high algebraic order embedded explicit six-step methods, for the numerical solution of second order initial or boundary-value problems with periodical and/or oscillating solutions, are studied in this paper. The free parameters of the new proposed methods are calculated solving the linear system of equations which is produced by requesting the vanishing of the phase-lag of the methods and the vanishing of the phase-lag's derivatives of the schemes. For the new obtained methods we investigate: • Its local truncation error (LTE) of the methods.• The asymptotic form of the LTE obtained using as model problem the radial Schrödinger equation.• The comparison of the asymptotic forms of LTEs for several methods of the same family. This comparison leads to conclusions on the efficiency of each method of the family.• The stability and the interval of periodicity of the obtained methods of the new family of embedded finite difference pairs.• The applications of the new obtained family of embedded finite difference pairs to the numerical solution of several second order problems like the radial Schrödinger equation, astronomical problems etc. The above applications lead to conclusion on the efficiency of the methods of the new family of embedded finite difference pairs.

  14. Carbon-embedded Ni nanocatalysts derived from MOFs by a sacrificial template method for efficient hydrogenation of furfural to tetrahydrofurfuryl alcohol.

    Science.gov (United States)

    Su, Yanping; Chen, Chun; Zhu, Xiaoguang; Zhang, Yong; Gong, Wanbing; Zhang, Haimin; Zhao, Huijun; Wang, Guozhong

    2017-05-16

    We report a fast and simple method for the synthesis of Ni-based metal-organic-frameworks (Ni-MOFs). Due to the existence of nickel ions and an organic ligand, the MOFs are employed as a sacrificial template for the facile preparation of carbon-embedded Ni (Ni/C) catalysts by a direct thermal decomposition method. The obtained Ni/C catalysts exhibit excellent catalytic activity for selectively transforming furfural (FAL) to tetrahydrofurfuryl alcohol (THFOL) due to the Ni nanoparticles (NPs) embedded uniformly in the ligand-derived carbon. The exemplified results illustrate that the catalytic performance of the Ni/C catalyst is greatly affected by the calcination conditions (temperature and time), composition of the Ni-MOF precursor and the catalysis conditions. The conversion of FAL and selectivity of THFOL both reached 100% under the conditions of 120 °C, 1 MPa H 2 pressure and 120 min of hydrogenation over the Ni/C-500 catalyst, derived from the pyrolysis of Ni-MOFs (Ni : BTC mole ratio of 1.0) at 500 °C for 120 min, which exhibits an average nanoparticle size of ∼14 nm and uniform dispersion, and the highest BET surface area (∼92 m 2 g -1 ) among all investigated Ni/C catalysts. This facilely prepared heterogeneous catalyst would be very promising for the replacement of noble metal catalysts for the efficient catalytic conversion of biomass-derived feedstocks into value-added chemicals.

  15. A solvent-dependent fluorescent detection method for Fe(3+) and Hg(2+) based on a rhodamine B derivative.

    Science.gov (United States)

    Li, Xutian; Yin, Yue; Deng, Junjie; Zhong, Huixian; Tang, Jian; Chen, Zhi; Yang, Liting; Ma, Li-Jun

    2016-07-01

    A new rhodamine B-benzofurazan based fluorescent probe (1) for Fe(3+) and Hg(2+) was synthesized. In aqueous solution containing 30% (v/v) ethanol, probe 1 shows a high selective fluorescent enhancement recognition to Fe(3+) with a binding ratio of 1:1 (probe 1: Fe(3+)), when the concentration of Fe(3+) is less than that of the probe. When the concentration of Fe(3+) is higher than that of the probe, it shows fluorescent "turn-on" response to Fe(3+) by opening the rhodamine spirolactam with a binding ratio of 1:2 (probe 1: Fe(3+)). Furthermore, probe 1 displays a high selectivity and a hypersensitivity (detection limit is 4.4nM) to Hg(2+) with a binding ratio of 1:1 in ethanol. NMR and UV-vis experiments indicate that the different fluorescent recognition signals to Fe(3+) and Hg(2+) are derived from different binding modes of 1-Fe(3+) and 1-Hg(2+). Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Comparison of active-set method deconvolution and matched-filtering for derivation of an ultrasound transit time spectrum

    International Nuclear Information System (INIS)

    Wille, M-L; Langton, C M; Zapf, M; Ruiter, N V; Gemmeke, H

    2015-01-01

    The quality of ultrasound computed tomography imaging is primarily determined by the accuracy of ultrasound transit time measurement. A major problem in analysis is the overlap of signals making it difficult to detect the correct transit time. The current standard is to apply a matched-filtering approach to the input and output signals. This study compares the matched-filtering technique with active set deconvolution to derive a transit time spectrum from a coded excitation chirp signal and the measured output signal. The ultrasound wave travels in a direct and a reflected path to the receiver, resulting in an overlap in the recorded output signal. The matched-filtering and deconvolution techniques were applied to determine the transit times associated with the two signal paths. Both techniques were able to detect the two different transit times; while matched-filtering has a better accuracy (0.13 μs versus 0.18 μs standard deviations), deconvolution has a 3.5 times improved side-lobe to main-lobe ratio. A higher side-lobe suppression is important to further improve image fidelity. These results suggest that a future combination of both techniques would provide improved signal detection and hence improved image fidelity. (note)

  17. Profiling the Interaction Mechanism of Quinoline/Quinazoline Derivatives as MCHR1 Antagonists: An in Silico Method

    Directory of Open Access Journals (Sweden)

    Mingwei Wu

    2014-09-01

    Full Text Available Melanin concentrating hormone receptor 1 (MCHR1, a crucial regulator of energy homeostasis involved in the control of feeding and energy metabolism, is a promising target for treatment of obesity. In the present work, the up-to-date largest set of 181 quinoline/quinazoline derivatives as MCHR1 antagonists was subjected to both ligand- and receptor-based three-dimensional quantitative structure–activity (3D-QSAR analysis applying comparative molecular field analysis (CoMFA and comparative molecular similarity indices analysis (CoMSIA. The optimal predictable CoMSIA model exhibited significant validity with the cross-validated correlation coefficient (Q2 = 0.509, non-cross-validated correlation coefficient (R2ncv = 0.841 and the predicted correlation coefficient (R2pred = 0.745. In addition, docking studies and molecular dynamics (MD simulations were carried out for further elucidation of the binding modes of MCHR1 antagonists. MD simulations in both water and lipid bilayer systems were performed. We hope that the obtained models and information may help to provide an insight into the interaction mechanism of MCHR1 antagonists and facilitate the design and optimization of novel antagonists as anti-obesity agents.

  18. First derivative emission spectrofluorimetric method for the determination of LCZ696, a newly approved FDA supramolecular complex of valsartan and sacubitril in tablets.

    Science.gov (United States)

    Ragab, Marwa A A; Galal, Shereen M; Korany, Mohamed A; Ahmed, Aya R

    2017-12-01

    LCZ696 (sacubitril/valsartan, Entresto™) is a therapy lately approved by United States Food and Drug Administration (US FDA) as a heart failure therapy. It is claimed to decrease the mortality rate and hospitalization for patients with chronic heart failure. This study is considered as the first report to investigate the fluorimetric behavior of sacubitril in addition to pursuing all the different conditions that may affect its fluorescence. Various conditions were studied, for example studying the effects of organized media, solvents and pH, which may affect the fluorescence behavior of sacubitril. For the simultaneous determination of the newly approved supramolecular complex of valsartan (VAL) and sacubitril (SAC) in their tablets, a sensitive and simple first derivative spectrofluorimetric method was developed. The method involved the measurement of native fluorescence at 416 nm and 314 nm (λ ex 249 nm) for VAL and SAC, respectively. The first (D1) derivative technique was applied to the emission data to resolve a partial overlap that appeared in their emission spectra. The proposed method was successfully applied for the assay of the two drugs in their supramolecular complex LCZ696 with no interference from common pharmaceutical additives. International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH) guidelines were followed in order to validate the proposed method. Copyright © 2017 John Wiley & Sons, Ltd.

  19. Application of EOF/PCA-based methods in the post-processing of GRACE derived water variations

    Science.gov (United States)

    Forootan, Ehsan; Kusche, Jürgen

    2010-05-01

    Two problems that users of monthly GRACE gravity field solutions face are 1) the presence of correlated noise in the Stokes coefficients that increases with harmonic degree and causes ‘striping', and 2) the fact that different physical signals are overlaid and difficult to separate from each other in the data. These problems are termed the signal-noise separation problem and the signal-signal separation problem. Methods that are based on principal component analysis and empirical orthogonal functions (PCA/EOF) have been frequently proposed to deal with these problems for GRACE. However, different strategies have been applied to different (spatial: global/regional, spectral: global/order-wise, geoid/equivalent water height) representations of the GRACE level 2 data products, leading to differing results and a general feeling that PCA/EOF-based methods are to be applied ‘with care'. In addition, it is known that conventional EOF/PCA methods force separated modes to be orthogonal, and that, on the other hand, to either EOFs or PCs an arbitrary orthogonal rotation can be applied. The aim of this paper is to provide a common theoretical framework and to study the application of PCA/EOF-based methods as a signal separation tool due to post-process GRACE data products. In order to investigate and illustrate the applicability of PCA/EOF-based methods, we have employed them on GRACE level 2 monthly solutions based on the Center for Space Research, University of Texas (CSR/UT) RL04 products and on the ITG-GRACE03 solutions from the University of Bonn, and on various representations of them. Our results show that EOF modes do reveal the dominating annual, semiannual and also long-periodic signals in the global water storage variations, but they also show how choosing different strategies changes the outcome and may lead to unexpected results.

  20. Multicritical phase diagrams of the ferromagnetic spin-3/2 Blume-Emery-Griffiths model with repulsive biquadratic coupling including metastable phases: The cluster variation method and the path probability method with the point distribution

    Energy Technology Data Exchange (ETDEWEB)

    Keskin, Mustafa [Department of Physics, Erciyes University, 38039 Kayseri (Turkey)], E-mail: keskin@erciyes.edu.tr; Canko, Osman [Department of Physics, Erciyes University, 38039 Kayseri (Turkey)

    2008-01-15

    We study the thermal variations of the ferromagnetic spin-3/2 Blume-Emery-Griffiths (BEG) model with repulsive biquadratic coupling by using the lowest approximation of the cluster variation method (LACVM) in the absence and presence of the external magnetic field. We obtain metastable and unstable branches of the order parameters besides the stable branches and phase transitions of these branches are investigated extensively. The classification of the stable, metastable and unstable states is made by comparing the free energy values of these states. We also study the dynamics of the model by using the path probability method (PPM) with the point distribution in order to make sure that we find and define the metastable and unstable branches of the order parameters completely and correctly. We present the metastable phase diagrams in addition to the equilibrium phase diagrams in the (kT/J, K/J) and (kT/J, D/J) planes. It is found that the metastable phase diagrams always exist at the low temperatures, which are consistent with experimental and theoretical works.

  1. Multicritical phase diagrams of the ferromagnetic spin-3/2 Blume-Emery-Griffiths model with repulsive biquadratic coupling including metastable phases: The cluster variation method and the path probability method with the point distribution

    International Nuclear Information System (INIS)

    Keskin, Mustafa; Canko, Osman

    2008-01-01

    We study the thermal variations of the ferromagnetic spin-3/2 Blume-Emery-Griffiths (BEG) model with repulsive biquadratic coupling by using the lowest approximation of the cluster variation method (LACVM) in the absence and presence of the external magnetic field. We obtain metastable and unstable branches of the order parameters besides the stable branches and phase transitions of these branches are investigated extensively. The classification of the stable, metastable and unstable states is made by comparing the free energy values of these states. We also study the dynamics of the model by using the path probability method (PPM) with the point distribution in order to make sure that we find and define the metastable and unstable branches of the order parameters completely and correctly. We present the metastable phase diagrams in addition to the equilibrium phase diagrams in the (kT/J, K/J) and (kT/J, D/J) planes. It is found that the metastable phase diagrams always exist at the low temperatures, which are consistent with experimental and theoretical works

  2. INEL cold test pit demonstration of improvements in information derived from non-intrusive geophysical methods over buried waste sites

    International Nuclear Information System (INIS)

    1994-01-01

    Under Contract between US DOE Idaho National Engineering Laboratory (INEL) and the Blackhawk Geosciences Division of Coleman Research Corporation (BGD-CRC), geophysical investigations were conducted to improve the detection of buried wastes. Site characterization is a costly and time consuming process with the most costly components being drilling, sampling, and chemical analysis of samples. There is a focused effort at US DOE and other agencies to investigate methodologies that reduce costs and shorten the time between characterization and clean-up. These methodologies take the form of employing non-invasive (geophysical) and minimal invasive (e.g., cone penetrometer driving) techniques of characterization, and implementing a near real-time, rational decision-making process (Expedited Site Characterization). Over the Cold Test Pit (CTP) at INEL, data were acquired with multiple sensors on a dense grid. Over the CTP the interpretations inferred from geophysical data are compared with the known placement of various waste forms in the pit. The geophysical sensors employed were magnetics, frequency and time domain electromagnetics, and ground penetrating radar. Also, because of the high data density acquired, filtering and other data processing and imaging techniques were tested. The conclusions derived from the geophysical surveys were that pit boundaries, berms between cells within the pit, and individual objects placed in the pit were best mapped by the new Geonics EM61 time domain EM metal detector. Part of the reason for the effectiveness of the time domain metal detector is that objects buried in the pit are dominantly metallic. Also, the utility of geophysical data is significantly enhanced by dimensional and 3-dimensional imaging formats. These images will particularly assist remediation engineers in visualizing buried wastes

  3. Probabilistic Requirements (Partial) Verification Methods Best Practices Improvement. Variables Acceptance Sampling Calculators: Derivations and Verification of Plans. Volume 1

    Science.gov (United States)

    Johnson, Kenneth L.; White, K, Preston, Jr.

    2012-01-01

    The NASA Engineering and Safety Center was requested to improve on the Best Practices document produced for the NESC assessment, Verification of Probabilistic Requirements for the Constellation Program, by giving a recommended procedure for using acceptance sampling by variables techniques. This recommended procedure would be used as an alternative to the potentially resource-intensive acceptance sampling by attributes method given in the document. This document contains the outcome of the assessment.

  4. The analysis of quantitative methods for renewable fuel processes and lubricant of materials derived from plastic waste

    Science.gov (United States)

    Rajagukguk, J. R.

    2018-01-01

    Plastic has become an important component in modern life today. Its role has replaced wood and metal, given its advantages such as light and strong, corrosion resistant, transparent and easy to color and good insulation properties. The research method is used with quantitative and engineering research methods. Research objective is to convert plastic waste into something more economical and to preserve the environment surrounding. Renewable fuel and lubricant variables are simultaneously influenced significantly to the sustainable environment. This is based on Fh> Ft of 62.101> 4.737) and its significance is 0.000 sustainable, the value of correlation coefficient 0.941 or 94.1% which means there is a very strong relationship between renewable fuel variables and lubricants to the sustainable environment. And utilizing plastic waste after being processed by pyrolysis method produces liquid hydrocarbons having elements of compounds such as crude oil and renewable fuels obtained from calculations are CO2 + H2O + C1-C4 + Residual substances. Then the plastic waste can be processed by isomerization process + catalyst to lubricating oil and the result of chemical calculation obtained is CO2, H2O, C18H21 and the rest.

  5. A liquid chromatography – tandem mass spectrometry method to measure a selected panel of uremic retention solutes derived from endogenous and colonic microbial metabolism

    Energy Technology Data Exchange (ETDEWEB)

    Loor, Henriette de; Poesen, Ruben [KU Leuven – University of Leuven, Department of Microbiology and Immunology, Laboratory of Nephrology, B-3000 Leuven (Belgium); De Leger, Wout; Dehaen, Wim [KU Leuven – University of Leuven, Department of Chemistry, Division of Molecular Design and Synthesis, B-3000 Leuven (Belgium); Augustijns, Patrick [KU Leuven – University of Leuven, Department of Pharmaceutical and Pharmacological Sciences, Drug Delivery and Disposition, B-3000 Leuven (Belgium); Evenepoel, Pieter [KU Leuven – University of Leuven, Department of Microbiology and Immunology, Laboratory of Nephrology, B-3000 Leuven (Belgium); University Hospitals Leuven, Department of Nephrology and Renal Transplantation, B-3000 Leuven (Belgium); Meijers, Björn, E-mail: bjorn.meijers@uzleuven.be [KU Leuven – University of Leuven, Department of Microbiology and Immunology, Laboratory of Nephrology, B-3000 Leuven (Belgium); University Hospitals Leuven, Department of Nephrology and Renal Transplantation, B-3000 Leuven (Belgium)

    2016-09-14

    Chronic kidney disease (CKD) is associated with an increased risk of mortality and cardiovascular disease, which is, at least partly, mediated by the accumulation of so-called uremic retention solutes. Although there has been an increasing interest in the behavior of these solutes, derived from both the endogenous and colonic microbial metabolism, methods to simultaneously and accurately measure a broad panel of relevant uremic retention solutes remain scarce. We developed a highly sensitive ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) method. A high throughput sample preparation was used with extraction of analytes from 50 μl serum using Ostro plate technology. For most solutes, stable isotopes labelled metabolites were used as internal standards. Chromatography was achieved using an Acquity UPLC CSH Fluoro Phenyl column. The total run time was 8 min, the mobile phase was a gradient of 0.1% formic acid in Milli-Q water and pure methanol at a flow rate of 0.5 ml min{sup −1}. Detection was performed using a tandem mass spectrometer with alternated positive and negative electrospray ionization. Calibration curves were linear for all solutes. Precision was assessed according to the NCCLS EP5-T guideline, being below 15% for all metabolites. Mean recoveries were between 83 and 104% for all metabolites. The validated method was successfully applied in a cohort of 488 patients with CKD. We developed and validated a sensitive and robust UPLC-MS/MS method for quantification of 15 uremic retention solutes derived from endogenous and colonic microbial metabolism. This method allows for studying the behavior and relevance of these solutes in patients with CKD. - Highlights: • Simultaneous quantification of fifteen relevant uremic retention solutes. • Comprehensive validation, highly sensitive and high through-put LC-MSMS method. • Comparison of different blood tubes. • Freeze-thaw stability. • Successful implementation in a

  6. A Numerical Method for Calculating the Wave Drag of a Configuration from the Second Derivative of the Area Distribution of a Series of Equivalent Bodies of Revolution

    Science.gov (United States)

    Levy, Lionel L., Jr.; Yoshikawa, Kenneth K.

    1959-01-01

    A method based on linearized and slender-body theories, which is easily adapted to electronic-machine computing equipment, is developed for calculating the zero-lift wave drag of single- and multiple-component configurations from a knowledge of the second derivative of the area distribution of a series of equivalent bodies of revolution. The accuracy and computational time required of the method to calculate zero-lift wave drag is evaluated relative to another numerical method which employs the Tchebichef form of harmonic analysis of the area distribution of a series of equivalent bodies of revolution. The results of the evaluation indicate that the total zero-lift wave drag of a multiple-component configuration can generally be calculated most accurately as the sum of the zero-lift wave drag of each component alone plus the zero-lift interference wave drag between all pairs of components. The accuracy and computational time required of both methods to calculate total zero-lift wave drag at supersonic Mach numbers is comparable for airplane-type configurations. For systems of bodies of revolution both methods yield similar results with comparable accuracy; however, the present method only requires up to 60 percent of the computing time required of the harmonic-analysis method for two bodies of revolution and less time for a larger number of bodies.

  7. Development and validation of alternative methods by non-aqueous acid-base titration and derivative ultraviolet spectrophotometry for quantification of sildenafil in raw material and tablets

    Directory of Open Access Journals (Sweden)

    Taízia Dutra Silva

    2017-04-01

    Full Text Available Sildenafil citrate (SILC is a potent phosphodiesterase-5 inhibitor used for erectile dysfunction and pulmonary hypertension. This study shows two simple, fast and alternative analytical methods for SILC determination by non-aqueous titration and by derivative ultraviolet spectrophotometry (DUS in active pharmaceutical ingredient and/or dosage forms. The quantitation method of SILC active pharmaceutical ingredient by non-aqueous acid-base titration was developed using methanol as solvent and 0.1 mol/L of perchloric acid in acetic acid as titrant. The endpoint was potentiometrically detected. The non-aqueous titration method shows satisfactory repeatability and intermediate precision (RSD 0.70-1.09%. The neutralization reaction occurred in the stoichiometric ratio 1:1 in methanol. The determination of SILC active pharmaceutical ingredient or dosage forms by DUS was developed in the linear range from 10 to 40 µg/mL, in 0.01 mol/L HCl, using the first order zero-peak method at λ 256 nm. The DUS method shows selectivity toward tablets excipients, appropriate linearity (R2 0.9996, trueness (recovery range 98.86-99.30%, repeatability and intermediate precision in three concentration levels (RSD 1.17-1.28%; 1.29-1.71%, respectively. Therefore, the methods developed are excellent alternatives to sophisticated instrumental methods and can be easily applied in any pharmaceutical laboratory routine due to simple and fast executions.

  8. Four points function fitted and first derivative procedure for determining the end points in potentiometric titration curves: statistical analysis and method comparison.

    Science.gov (United States)

    Kholeif, S A

    2001-06-01

    A new method that belongs to the differential category for determining the end points from potentiometric titration curves is presented. It uses a preprocess to find first derivative values by fitting four data points in and around the region of inflection to a non-linear function, and then locate the end point, usually as a maximum or minimum, using an inverse parabolic interpolation procedure that has an analytical solution. The behavior and accuracy of the sigmoid and cumulative non-linear functions used are investigated against three factors. A statistical evaluation of the new method using linear least-squares method validation and multifactor data analysis are covered. The new method is generally applied to symmetrical and unsymmetrical potentiometric titration curves, and the end point is calculated using numerical procedures only. It outperforms the "parent" regular differential method in almost all factors levels and gives accurate results comparable to the true or estimated true end points. Calculated end points from selected experimental titration curves compatible with the equivalence point category of methods, such as Gran or Fortuin, are also compared with the new method.

  9. Carrier element-free coprecipitation (CEFC) method for the separation, preconcentration and speciation of chromium using an isatin derivative

    Energy Technology Data Exchange (ETDEWEB)

    Bulut, Volkan Numan; Ozdes, Duygu; Bekircan, Olcay; Gundogdu, Ali; Duran, Celal [Department of Chemistry, Karadeniz Technical University, Faculty of Arts and Sciences, 61080 Trabzon (Turkey); Soylak, Mustafa [Department of Chemistry, Erciyes University, Faculty of Arts and Sciences, 38039 Kayseri (Turkey)], E-mail: soylak@erciyes.edu.tr

    2009-01-19

    A new, simple, rapid and sensitive separation, preconcentration and speciation procedure for chromium in environmental liquid and solid samples has been established. The present speciation procedure for Cr(III) and Cr(VI) is based on combination of carrier element-free coprecipitation (CEFC) and flame atomic absorption spectrometric (FAAS) determinations. In this method a newly synthesized organic coprecipitant, 5-chloro-3-[4-(trifluoromethoxy) phenylimino]indolin-2-one (CFMEPI), was used without adding any carrier element for coprecipitation of chromium(III). After reduction of chromium(VI) by concentrated H{sub 2}SO{sub 4} and ethanol, the procedure was applied for the determination of total chromium. Chromium(VI) was calculated as the difference between the amount of total chromium and chromium(III). The optimum conditions for coprecipitation and speciation processes were investigated on several commonly tested experimental parameters, such as pH of the solution, amount of coprecipitant, sample volume, etc. No considerable interference was observed from the other investigated anions and cations, which may be found in natural water samples. The preconcentration factor was found to be 40. The detection limit for chromium(III) corresponding to three times the standard deviation of the blank (N = 10) was found 0.7 {mu}g L{sup -1}. The present procedure was successfully applied for speciation of chromium in several liquid and solid environmental samples. In order to support the accuracy of the method, the certified reference materials (CRM-TMDW-500 Drinking Water and CRM-SA-C Sandy Soil C) were analyzed, and standard APDC-MIBK liquid-liquid extraction method was performed. The results obtained were in good agreement with the certified values.

  10. Carrier element-free coprecipitation (CEFC) method for the separation, preconcentration and speciation of chromium using an isatin derivative

    International Nuclear Information System (INIS)

    Bulut, Volkan Numan; Ozdes, Duygu; Bekircan, Olcay; Gundogdu, Ali; Duran, Celal; Soylak, Mustafa

    2009-01-01

    A new, simple, rapid and sensitive separation, preconcentration and speciation procedure for chromium in environmental liquid and solid samples has been established. The present speciation procedure for Cr(III) and Cr(VI) is based on combination of carrier element-free coprecipitation (CEFC) and flame atomic absorption spectrometric (FAAS) determinations. In this method a newly synthesized organic coprecipitant, 5-chloro-3-[4-(trifluoromethoxy) phenylimino]indolin-2-one (CFMEPI), was used without adding any carrier element for coprecipitation of chromium(III). After reduction of chromium(VI) by concentrated H 2 SO 4 and ethanol, the procedure was applied for the determination of total chromium. Chromium(VI) was calculated as the difference between the amount of total chromium and chromium(III). The optimum conditions for coprecipitation and speciation processes were investigated on several commonly tested experimental parameters, such as pH of the solution, amount of coprecipitant, sample volume, etc. No considerable interference was observed from the other investigated anions and cations, which may be found in natural water samples. The preconcentration factor was found to be 40. The detection limit for chromium(III) corresponding to three times the standard deviation of the blank (N = 10) was found 0.7 μg L -1 . The present procedure was successfully applied for speciation of chromium in several liquid and solid environmental samples. In order to support the accuracy of the method, the certified reference materials (CRM-TMDW-500 Drinking Water and CRM-SA-C Sandy Soil C) were analyzed, and standard APDC-MIBK liquid-liquid extraction method was performed. The results obtained were in good agreement with the certified values

  11. Derivative spectrum chromatographic method for the determination of trimethoprim in honey samples using an on-line solid-phase extraction technique.

    Science.gov (United States)

    Uchiyama, Kazuhisa; Kondo, Mari; Yokochi, Rika; Takeuchi, Yuri; Yamamoto, Atsushi; Inoue, Yoshinori

    2011-07-01

    A simple, selective and rapid analytical method for determination of trimethoprim (TMP) in honey samples was developed and validated. This method is based on a SPE technique followed by HPLC with photodiode array detection. After dilution and filtration, aliquots of 500 μL honey samples were directly injected to an on-line SPE HPLC system. TMP was extracted on an RP SPE column, and separated on a hydrophilic interaction chromatography column during HPLC analysis. At the first detection step, the noise level of the photodiode array data was reduced with two-dimensional equalizer filtering, and then the smoothed data were subjected to derivative spectrum chromatography. On the second-derivative chromatogram at 254 nm, the limit of detection and the limit of quantification of TMP in a honey sample were 5 and 10 ng/g, respectively. The proposed method showed high accuracy (60-103%) with adequate sensitivity for TMP monitoring in honey samples. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. An improved and facile method for the synthesis of 1,1-bis(4-hydroxyphenyl)-2-phenylethylene and its derivatives

    International Nuclear Information System (INIS)

    Shafii, B.; Atcher, R.W.

    1994-01-01

    The synthesis of 1,1-bis(4-hydroxyphenyl)-2-phenylethylene, which is of biological interest, has been reported by several authors in the past. In this article an improved method is introduced. Different (and commercially available) starting materials are adopted. Also a protective group which is easily attached and removed is used. This procedure provides milder reaction conditions and better yields while the number of steps involved in the synthesis of the compound are reduced. Furthermore, the reactions are clean and formation of byproducts which lead to poorer yields are avoided

  13. Derivation of centers and axes of rotation for wrist and fingers in a hand kinematic model: methods and reliability results.

    Science.gov (United States)

    Cerveri, P; Lopomo, N; Pedotti, A; Ferrigno, G

    2005-03-01

    In the field of 3D reconstruction of human motion from video, model-based techniques have been proposed to increase the estimation accuracy and the degree of automation. The feasibility of this approach is strictly connected with the adopted biomechanical model. Particularly, the representation of the kinematic chain and the assessment of the corresponding parameters play a relevant role for the success of the motion assessment. In this paper, the focus is on the determination of the kinematic parameters of a general hand skeleton model using surface measurements. A novel method that integrates nonrigid sphere fitting and evolutionary optimization is proposed to estimate the centers and the functional axes of rotation of the skeletal joints. The reliability of the technique is tested using real movement data and simulated motions with known ground truth 3D measurement noise and different ranges of motion (RoM). With respect to standard nonrigid sphere fitting techniques, the proposed method performs 10-50% better in the best condition (very low noise and wide RoM) and over 100% better with physiological artifacts and RoM. Repeatability in the range of a couple of millimeters, on the localization of the centers of rotation, and in the range of one degree, on the axis directions is obtained from real data experiments.

  14. Optical and morphological properties of ZnO- and TiO2-derived nanostructures synthesized via a microwave-assisted hydrothermal method

    CSIR Research Space (South Africa)

    Moloto, N

    2012-01-01

    Full Text Available Corporation International Journal of Photoenergy Volume 2012, Article ID 189069, 6 pages doi:10.1155/2012/189069 Research Article Optical and Morphological Properties of ZnO- and TiO2-Derived Nanostructures Synthesized via a Microwave... International Journal of Photoenergy the sol-gel, hydrothermal process, and pulse laser deposition [22?24]. Although the sol-gel method is widely accepted for the preparation of both ZnO and TiO2 nanostructures, the calcinations process is essential and can...

  15. Application of numerical methods, derivatives theory and Monte Carlo simulation in evaluating BM&F BOVESPA's POP (Protected and Participative Investment

    Directory of Open Access Journals (Sweden)

    Giuliano Carrozza Uzêda Iorio de Souza

    2011-08-01

    Full Text Available This article presents a practical case in which two of the most efficient numerical procedures developed for derivative analysis are applied to evaluate the POP (Investment Protection with Participation, a structured operation created by São Paulo Stock Exchange - BM&FBOVESPA. The first procedure solves the differential equation through the use of implicit finite differences method. Due to its characteristics, the approach makes it possible to run sensitivity analysis as well as price estimation. In the second, the problem is solved by Monte Carlo simulation, which facilitates the identification of the probability related to the exercise of the embedded options.

  16. Radical-Scavenging Activity of Thiols, Thiobarbituric Acid Derivatives and Phenolic Antioxidants Determined Using the Induction Period Method for Radical Polymerization of Methyl Methacrylate

    Directory of Open Access Journals (Sweden)

    Seiichiro Fujisawa

    2012-04-01

    Full Text Available The radical-scavenging activities of two thiols, eight (thiobarbituric acid derivatives and six chain-breaking phenolic antioxidants were investigated using the induction period method for polymerization of methyl methacrylate (MMA initiated by thermal decomposition of 2,2’-azobisisobutyronitrile (AIBN and monitored by differential scanning calorimetry (DSC. The induction period (IP for the thiols 2-mercaptoethanol (ME and 2-mercapto-1-methylimidazole (MMI was about half that for phenolic antioxidants. Except for the potent inhibitor 5,5-dimethyl-2-thiobarbituric acid (3, the IP for thiobarbituric acid derivatives was about one tenth of that for phenolic antioxidants. The IP for 1,3,5-trimethyl-2-thiobarbituric acid (1 and 5-allyl-1, 3-dimethyl-2-thiobarbituric acid (7 was less than that of the control, possibly due to inhibition by a small amount of atmospheric oxygen in the DSC container. The ratio of the chain inhibition to that of chain propagation (CI/CP for the thiols and thiobarbituric acid compounds except for 1, 3 and 7 was about 10 times greater or greater than that for phenolic compounds. A kinetic chain length (KCL about 10% greater than that of the control was observed for 1, suggesting that 1 had chain transfer reactivity in the polymerization of MMA. The average molecular weight of polymers formed from thiobarbituric acid derivatives is discussed.

  17. New seismograph includes filters

    Energy Technology Data Exchange (ETDEWEB)

    1979-11-02

    The new Nimbus ES-1210 multichannel signal enhancement seismograph from EG and G geometrics has recently been redesigned to include multimode signal fillers on each amplifier. The ES-1210F is a shallow exploration seismograph for near subsurface exploration such as in depth-to-bedrock, geological hazard location, mineral exploration, and landslide investigations.

  18. Minimal methylation classifier (MIMIC): A novel method for derivation and rapid diagnostic detection of disease-associated DNA methylation signatures.

    Science.gov (United States)

    Schwalbe, E C; Hicks, D; Rafiee, G; Bashton, M; Gohlke, H; Enshaei, A; Potluri, S; Matthiesen, J; Mather, M; Taleongpong, P; Chaston, R; Silmon, A; Curtis, A; Lindsey, J C; Crosier, S; Smith, A J; Goschzik, T; Doz, F; Rutkowski, S; Lannering, B; Pietsch, T; Bailey, S; Williamson, D; Clifford, S C

    2017-10-18

    Rapid and reliable detection of disease-associated DNA methylation patterns has major potential to advance molecular diagnostics and underpin research investigations. We describe the development and validation of minimal methylation classifier (MIMIC), combining CpG signature design from genome-wide datasets, multiplex-PCR and detection by single-base extension and MALDI-TOF mass spectrometry, in a novel method to assess multi-locus DNA methylation profiles within routine clinically-applicable assays. We illustrate the application of MIMIC to successfully identify the methylation-dependent diagnostic molecular subgroups of medulloblastoma (the most common malignant childhood brain tumour), using scant/low-quality samples remaining from the most recently completed pan-European medulloblastoma clinical trial, refractory to analysis by conventional genome-wide DNA methylation analysis. Using this approach, we identify critical DNA methylation patterns from previously inaccessible cohorts, and reveal novel survival differences between the medulloblastoma disease subgroups with significant potential for clinical exploitation.

  19. Projection of future runoff change using climate elasticity method derived from Budyko framework in major basins across China

    Science.gov (United States)

    Xing, Wanqiu; Wang, Weiguang; Zou, Shan; Deng, Chao

    2018-03-01

    This study established a climate elasticity method based on Budyko hypothesis and enhanced it by selecting the most effective Budyko-type formula to strengthen the runoff change prediction reliability. The spatiotemporal variations in hydrologic variables (i.e., runoff, precipitation and potential evaporation) during historical period were revealed first and the climate elasticities of runoff were investigated. The proposed climate elasticity method was also applied to project the spatiotemporal variations in future runoff and its key influencing factors in 35 watersheds across China. Wherein, the future climate series were retrieved by consulting the historical series, informed by four global climate models (GCMs) under representative concentration pathways from phase five of the Coupled Model Intercomparison Project. Wang-Tang equation was selected as the optimal Budyko-type equation for its best ability in reproducing the runoff change (with a coefficient of determination and mean absolute error of 0.998 and 1.36 mm, respectively). Observed runoff presents significant decreasing trends in the northern and increasing trends in the southern regions of China, and generally its change is identified to be more sensitive to climatic variables in Hai River Basin and lower Yellow River Basin. Compared to the runoff during the reference period, positive change rates in the north and negative change rates in the south of China in the mid-21st century can be practically generalized from the majority of GCMs projections. This maybe resulted from the increasing precipitation, especially in parts of northern basins. Meanwhile, GCMs project a consistently upward trend in potential evaporation although significant decreasing trends occur in the majority of catchments for the historical period. The results indicate that climate change will possibly bring some changes to the water resources over China in the mid-21st century and some countermeasures of water resources planning

  20. High heterogeneity in methods used for the laboratory confirmation of pertussis diagnosis among European countries, 2010: integration of epidemiological and laboratory surveillance must include standardisation of methodologies and quality assurance.

    Science.gov (United States)

    He, Q; Barkoff, A M; Mertsola, J; Glismann, S; Bacci, S

    2012-08-09

    Despite extensive childhood immunisation, pertussis remains one of the world’s leading causes of vaccine preventable deaths. The current methods used for laboratory diagnosis of pertussis include bacterial culture, polymerase chain reaction (PCR) and enzyme linked immunosorbent assay (ELISA) serology. We conducted a questionnaire survey to identify variations in the laboratory methods and protocols used among participating countries included in the European surveillance network for vaccine-preventable diseases(EUVAC.NET). In February 2010, we performed the survey using a web-based questionnaire and sent it to the country experts of 25 European Union countries,and two European Economic Area (EEA) countries,Norway and Iceland. The questionnaire consisted of 37 questions which covered both general information on surveillance methods and detailed laboratory methods used. A descriptive analysis was performed.Questionnaires were answered by all 27 contacted countries. Nineteen countries had pertussis reference laboratories at the national level; their functions varied from performing diagnosis to providing technical advice for routine microbiology laboratories. Culture,PCR and serology were used in 17, 18 and 20 countries,respectively. For PCR, nine laboratories used insertion sequence IS481 as the target gene, which is present in multiple copies in the Bordetella pertussis genome and thus has a greater sensitivity over single copy targets, but has been proved not to be specific for B.pertussis. Antibodies directed against pertussis toxin(PT) are specific for B. pertussis infections. For ELISA serology, only 13 countries’ laboratories used purified PT as coating antigen and 10 included World Health Organization (WHO) or Food and Drug Administration (FDA) reference sera in their tests. This present survey shows that methods used for laboratory confirmation of pertussis differ widely among European countries and that there is a great heterogeneity of the reference