Directory of Open Access Journals (Sweden)
Roberto Viau
2017-02-01
Full Text Available Molecular typing using repetitive sequenced-based PCR (rep-PCR and hsp60 sequencing were applied to a collection of diverse Enterobacter cloacae complex isolates. To determine the most practical method for reference laboratories, we analyzed 71 E. cloacae complex isolates from sporadic and outbreak occurrences originating from 4 geographic areas. While rep-PCR was more discriminating, hsp60 sequencing provided a broader and a more objective geographical tracking method similar to multilocus sequence typing (MLST. In addition, we suggest that MLST may have higher discriminative power compared to hsp60 sequencing, although rep-PCR remains the most discriminative method for local outbreak investigations. In addition, rep-PCR can be an effective and inexpensive method for local outbreak investigation.
Molecular characterization of Salmonella isolates by REP-PCR and RAPD analysis.
Albufera, U; Bhugaloo-Vial, P; Issack, M I; Jaufeerally-Fakim, Y
2009-05-01
Eighteen Salmonella isolates from both human and food (non-human) sources (fish, meat, and poultry) were characterized using conventional culture methods, biochemical, serological, and molecular analyses. REP-PCR and RAPD produced DNA profiles for differentiation purposes. Enterobacterial repetitive intergenic consensus (ERIC), repetitive extragenic palindronic (REP) and BOXAIR primers were selected for REP-PCR and two arbitrary primers, namely OPP-16 and OPS-11 were used for RAPD to generate DNA fingerprints from the Salmonella isolates. REP-PCR method showed greater discriminatory power in differentiating closely related strains of the related strains of Salmonella and produced more complex banding patterns as compared with RAPD. A dendogram was constructed with both sets of profiles using SPSS Version 13.0 computer software and showed that most human isolates were separately clustered from the non-human isolates. Two of the human isolates were closely related to some of the non-human isolates. A good correlation was also observed between the serogrouping of the O antigen and the molecular profiles obtained from REP-PCR and RAPD data of the Salmonella isolates. The results of a principal coordinate analysis (PCA) corresponded to the clustering in the dendrogram.
Directory of Open Access Journals (Sweden)
Marcelo Brocchi
2006-06-01
Full Text Available In the present study the repetitive extragenic palindromic (REP polymerase chain reaction (PCR technique was used to establish the clonal variability of 49 avian Escherichia coli (APEC strains isolated from different outbreak cases of septicemia (n=24, swollen head syndrome (n=14 and omphalitis (n=11. Thirty commensal strains isolated from poultry with no signs of these illnesses were used as control strains. The purified DNA of these strains produced electrophoretic profiles ranging from 0 to 15 bands with molecular sizes varying from 100 bp to 6.1 kb, allowing the grouping of the 79 strains into a dendrogram containing 49 REP-types. Although REP-PCR showed good discriminating power it was not able to group the strains either into specific pathogenic classes or to differentiate between pathogenic and non-pathogenic strains. On the contrary, we recently demonstrated that other techniques such as ERIC-PCR and isoenzyme profiles are appropriate to discriminate between commensal and APEC strains and also to group these strains into specific pathogenic classes. In conclusion, REP-PCR seems to be a technique neither efficient nor universal for APEC strains discrimination. However, the population clonal structure obtained with the use of REP-PCR must not be ignored particularly if one takes into account that the APEC pathogenic mechanisms are not completely understood yet.A técnica de REP (Repetitive extragenic palindrome-PCR foi utilizada para avaliar a variabilidade genética de 49 amostras de Escherichia coli patogênicas para aves (APEC, isoladas de aves de corte (frangos em diferentes surtos de septicemia (n=24, síndrome da cabeça inchada (n=14 e onfalite (n=11. Trinta amostras comensais, isoladas de frangos sem sinais de doença, foram utilizadas como controle. A análise do perfil eletroforético obtido por reação de REP-PCR utilizando DNA purificado das amostras evidenciou a amplificação de 0 a 15 bandas de DNA com pesos moleculares
Ishii, Satoshi; Sadowsky, Michael J
2009-04-01
A large number of repetitive DNA sequences are found in multiple sites in the genomes of numerous bacteria, archaea and eukarya. While the functions of many of these repetitive sequence elements are unknown, they have proven to be useful as the basis of several powerful tools for use in molecular diagnostics, medical microbiology, epidemiological analyses and environmental microbiology. The repetitive sequence-based PCR or rep-PCR DNA fingerprint technique uses primers targeting several of these repetitive elements and PCR to generate unique DNA profiles or 'fingerprints' of individual microbial strains. Although this technique has been extensively used to examine diversity among variety of prokaryotic microorganisms, rep-PCR DNA fingerprinting can also be applied to microbial ecology and microbial evolution studies since it has the power to distinguish microbes at the strain or isolate level. Recent advancement in rep-PCR methodology has resulted in increased accuracy, reproducibility and throughput. In this minireview, we summarize recent improvements in rep-PCR DNA fingerprinting methodology, and discuss its applications to address fundamentally important questions in microbial ecology and evolution.
Higgins, Paul G; Hujer, Andrea M; Hujer, Kristine M; Bonomo, Robert A; Seifert, Harald
2012-01-01
We have investigated the reproducibility of DiversiLab rep-PCR fingerprints between two laboratories with the aim of determining if the fingerprints and clustering are laboratory-specific or portable. One-hundred non-duplicate Acinetobacter baumannii isolates were used in this study. DNA isolation and rep-PCR were each performed separately in two laboratories and rep-PCR patterns generated in laboratory A were compared with those from laboratory B. Twelve A. baumannii isolates processed in laboratory A showed ≥98 % pattern similarity with the corresponding 12 isolates tested in laboratory B and were considered identical. Sixty-four isolates showed 95-97.9 % similarity with their corresponding isolates. Twenty-three isolates showed 90-94 % similarity with the corresponding isolates, while one isolate showed only 87.4 % similarity. However, intra-laboratory clustering was conserved: isolates that clustered in laboratory A also clustered in laboratory B. While clustering was conserved and reproducible at two different laboratories, demonstrating the robustness of rep-PCR, interlaboratory comparison of individual isolate fingerprints showed more variability. This comparison allows conclusions regarding clonality to be reached independent of the laboratory where the analysis is performed.
Genetic Diversity and Evidence for Transmission of Streptococcus mutans by DiversiLab rep-PCR.
Momeni, Stephanie S; Whiddon, Jennifer; Cheon, Kyounga; Ghazal, Tariq; Moser, Stephen A; Childers, Noel K
2016-09-01
This two-part study investigated the genetic diversity and transmission of Streptococcus mutans using the DiversiLab repetitive extragenic palindromic PCR (rep-PCR) approach. For children with S. mutans and participating household members, analysis for evidence of unrelated child-to-child as well as intra-familial transmission was evaluated based on commonality of genotypes. A total of 169 index children and 425 household family members from Uniontown, Alabama were evaluated for genetic diversity using rep-PCR. Thirty-four unique rep-PCR genotypes were observed for 13,906 S. mutans isolates. For transmission, 117 child and household isolates were evaluated for shared genotype (by child and by genotype cases, multiple matches possible for each child). Overall, children had 1-9 genotypes and those with multiple genotypes were 2.3 times more likely to have caries experience (decayed, missing and filled teeth/surfaces>0). Only 28% of children shared all genotypes within the household, while 72% had at least 1 genotype not shared with anyone in the household. Children had genotype(s) not shared with any household members in 157 cases. In 158 cases children and household members shared a genotype in which 55% (87/158 cases) were shared with more than one family member. Children most frequently shared genotypes with their mothers (54%; 85/158), siblings (46%; 72/158) and cousins (23%; 37/158). A reference library for S. mutans for epidemiological surveillance using the DiversiLab rep-PCR approach is detailed. The genetic diversity of S. mutans in this population demonstrated frequent commonality of genotypes. Evidence for both child-to-child and intra-familial transmission of S. mutans was observed by rep-PCR. Copyright © 2016 Elsevier B.V. All rights reserved.
Identification of Tilletia species using rep-PCR fingerprinting technique
Directory of Open Access Journals (Sweden)
Župunski Vesna
2011-01-01
Full Text Available Analyzing 167 non-processed seed samples of wheat, it was found that 145 samples (86.8 % were contaminated with Tilletia species, while 22 (13.2 % samples were not contaminated. By using rep-PCR fingerprinting technique, it was found that DNA isolates of T. tritici originated from Serbian wheat samples had 80 % similarity with positive control for T. tritici. One isolate shared similarity of 60% with T. tritici, T. controversa and T. laevis. It was supposed that this isolate belongs to T. bromi. Isolate of T. laevis shared a similarity of 70 % with isolates of T. tritici and T. controversa, while T. walkeri was more than 10 % similar with T. tritici, T. controversa and T. laevis. Although T. controversa and T. tritici had high percent of genetic similarity, they were clustered separately. Our results suggest that rep-PCR fingerprinting could be a useful tool for monitoring presence of morphologically similar Tilletia species in wheat production areas.
Use of a rep-PCR system to predict species in the Aspergillus section Nigri
The Aspergillus niger aggregate within the A. section Nigri, is a group of black-spored aspergilli which taxonomy has been elusive. REP-PCR has become a rapid and cost-effective method for genotyping fungi and bacteria. In the present study, we evaluated the discriminatory power of a semi-automate...
Directory of Open Access Journals (Sweden)
Iliana Alcocer
2006-06-01
each serovar tested. ERIC-PCR showed patterns of 4 to 5 fragments between 180 and 1000 pb and less discriminatory power than REP-PCR. The results confirmed that phage typing is a useful tool to differentiate into sorovar Enteriditis. Although it is recognized that only a limited number of strains was tested in this study, the results suggest that REP-PCR could be an attractive choice to be used in the future as a preliminary method of Salmonella sorovar discrimination.
Yeast identification by sequencing, biochemical kits, MALDI-TOF MS and rep-PCR DNA fingerprinting.
Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Chan, Jasper F W; Lau, Susanna K P; Kong, Fanrong; Xu, Yingchun; Woo, Patrick C Y
2017-12-08
No study has comprehensively evaluated the performance of 28S nrDNA and ITS sequencing, commercial biochemical test kits, MALDI-TOF MS platforms, and the emerging rep-PCR DNA fingerprinting technology using a cohort of yeast strains collected from a clinical microbiology laboratory. In this study, using 71 clinically important yeast isolates (excluding Candida albicans) collected from a single centre, we determined the concordance of 28S nrDNA and ITS sequencing and evaluated the performance of two commercial test kits, two MALDI-TOF MS platforms, and rep-PCR DNA fingerprinting. 28S nrDNA and ITS sequencing showed complete agreement on the identities of the 71 isolates. Using sequencing results as the standard, 78.9% and 71.8% isolates were correctly identified using the API 20C AUX and Vitek 2 YST ID Card systems, respectively; and 90.1% and 80.3% isolates were correctly identified using the Bruker and Vitek MALDI-TOF MS platforms, respectively. Of the 18 strains belonging to the Candida parapsilosis species complex tested by DiversiLab automated rep-PCR DNA fingerprinting, all were identified only as Candida parapsilosis with similarities ≥93.2%, indicating the misidentification of Candida metapsilosis and Candida orthopsilosis. However, hierarchical cluster analysis of the rep-PCR DNA fingerprints of these three species within this species complex formed three different discrete clusters, indicating that this technology can potentially differentiate the three species. To achieve higher accuracies of identification, the databases of commercial biochemical test kits, MALDI-TOF MS platforms, and DiversiLab automated rep-PCR DNA fingerprinting needs further enrichment, particularly for uncommonly encountered yeast species. © The Author 2017. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
A.S.G. Lima
2002-01-01
Full Text Available PCR has been used to analyze the distribution of REP (Repetitive Extragenic Palindromic and ERIC (Enterobacterial Repetitive Intergenic Consensus sequences (rep-PCR found within the genome of the bacterium Bacillus thuringiensis, with the purpose to analyze the genetic similarities among 56 subspecies samples and 95 field isolates. The PCR products were analyzed by EB-AGE (ethidium bromide-agarose electrophoresis and then submitted to banding comparisons, based on the Phyllip software algorithm. When the banding similarities were considered for comparison purposes among all the strains, the phylogenic tree patterns varied according to the rep-PCR primers considered, but, from a broader point of view, the ERIC sequences produced better results, which, together with electron microscopy analysis of the released parasporal bodies and colony morphology characteristics, allowed to detect two possible new subspecies of B. thuringiensis.
Directory of Open Access Journals (Sweden)
Ivan Manga
2015-05-01
Full Text Available A meat paste production line and its microbial parameters have been evaluated in single Czech company. The raw meat paste samples before heat treatment were tested positively for the presence of three staphylococci species: Staphylococcus aureus, Staphylococcus haemolyticus and Staphylococcus epidermidis. Subsequent microbial analysis of meat paste components and ingredients (fresh meat, water, spices, equipment identified only the spices used as positive for S. aureus (coriander, cinnamon, badian, mustard – (10 - 40 cfu/g and S. haemolyticus strains (juniper, ginger. The collection of sixteen collected strains (S. aureus (n = 4, S. haemolyticus (n = 4, S. epidermidis (n = 8 has been typed with the rep-PCR method utilising (GTG5 primer. Analysis of the fingerprints using the unweighted pair-group method using arithmetic averages (UPGMA clustering method revealed presence of eleven strain clusters with similarity lower than 90%: two fingerprint clusters of S. aureus, three individual clusters characteristic for S. haemolyticus and six different S. epidermidis specific clusters. The S. aureus strains from different types of spice were identical, resp. very similar. Molecular tracking composed from the rep-PCR analysis of acquired isolates and comparison among all collected fingerprints confirmed the spices to be the source of both S. aureus and S. haemolyticus strains identified in raw meat paste. The additional rep-PCR analysis of the S. epidermidis collection confirmed usability and performance of this method. The antibiotic susceptibility to fourteen individual antibiotics has been examined among the collected staphylococci strains. The predominant erythromycin resistance (68.8% was followed with the resistance to amoxicillin/clavulanic acid (56.2%. Other resistances observed were less frequent (clindamycin – 12.5%, oxacillin – 6.3%, tetracycline – 6.3%, sulphamethoxazole-trimethoprim – 6.3%, chloramphenicol – 6.3%, novobiocin – 6
Eckert, C.; Van Broeck, J.; Spigaglia, P.; Burghoffer, B.; Delmée, M.; Mastrantonio, P.; Barbut, F.
2011-01-01
This study compared a repetitive-element PCR (rep-PCR) method (DiversiLab system) to PCR ribotyping. The discriminatory power of rep-PCR was 0.997. Among the PCR ribotype 027 isolates tested, different rep types could be distinguished. rep-PCR showed a higher discriminatory power than PCR ribotyping. Nevertheless, this method requires technical skill, and visual interpretation of rep-PCR fingerprint patterns may be difficult.
Directory of Open Access Journals (Sweden)
Carlos Padilla R
2003-07-01
Full Text Available Objetivos: Genotipificar los aislamientos de Bartonella bacilliformis a través de la amplificación de elementos repetitivos mediante el uso de ERIC-PCR y REP-PCR, y determinar si existe variabilidad genética entre aislamientos de varias zonas endémicas. Materiales y Métodos: Se evaluaron mediante el uso del ERIC-PCR y REP-PCR 17 aislamientos de B. bacilliformis de Lima, Cusco y Ancash. Los aislamientos fueron realizados durante los años 1998 y 1999. Para el análisis de los patrones de bandas se usó el software GelCompar 4,0. Resultados: Fueron identificados en los 17 aislamientos 10 genotipos. Los genotipos D, E y H fueron detectados en Cusco; mientras que los genotipos B, C, G, J e I en Lima; y el genotipo F en Ancash. Conclusiones: Nuestros resultados sugieren que REP-PCR y ERIC-PCR son métodos útiles para genotipificar aislamientos de B. bacilliformis. La variabilidad genética debe ser tomada en cuenta en estudios epidemiológicos y clínicos de Bartonelosis; así como el desarrollo de nuevas técnicas diagnósticas y de vacunas.
Armas, Federica; Camperio, Cristina; Coltella, Luana; Selvaggini, Serena; Boniotti, Maria Beatrice; Pacciarini, Maria Lodovica; Di Marco Lo Presti, Vincenzo; Marianelli, Cinzia
2017-08-04
Highly discriminatory genotyping strategies are essential in molecular epidemiological studies of tuberculosis. In this study we evaluated, for the first time, the efficacy of the repetitive sequence-based PCR (rep-PCR) DiversiLab Mycobacterium typing kit over spoligotyping, 12-locus mycobacterial interspersed repetitive unit-variable number tandem repeat (MIRU-VNTR) typing and embB single nucleotide polymorphism (SNP) analysis for Mycobacterium bovis typing. A total of 49 M. bovis animal isolates were used. DNA was extracted and genomic DNA was amplified using the DiversiLab Mycobacterium typing kit. The amplified fragments were separated and detected using a microfluidics chip with Agilent 2100. The resulting rep-PCR-based DNA fingerprints were uploaded to and analysed using web-based DiversiLab software through Pearson's correlation coefficient. Rep-PCR DiversiLab grouped M. bovis isolates into ten different clusters. Most isolates sharing identical spoligotype, MIRU-VNTR profile or embB gene polymorphism were grouped into different rep-PCR clusters. Rep-PCR DiversiLab displayed greater discriminatory power than spoligotyping and embB SNP analysis but a lower resolution power than the 12-locus MIRU-VNTR analysis. MIRU-VNTR confirmed that it is superior to the other PCR-based methods tested here. In combination with spoligotyping and 12-locus MIRU-VNTR analysis, rep-PCR improved the discriminatory power for M. bovis typing.
Atalay, Altay; Koc, Ayse Nedret; Suel, Ahmet; Sav, Hafize; Demir, Gonca; Elmali, Ferhan; Cakir, Nuri; Seyedmousavi, Seyedmojtaba
2016-09-01
Aspergillus species cause a wide range of diseases in humans, including allergies, localized infections, or fatal disseminated diseases. Rapid detection and identification of Aspergillus spp. facilitate effective patient management. In the current study we compared conventional morphological methods with PCR sequencing, rep-PCR, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) for the identification of Aspergillus strains. A total of 24 consecutive clinical isolates of Aspergillus were collected during 2012-2014. Conventional morphology and rep-PCR were performed in our Mycology Laboratory. The identification, evaluation, and reporting of strains using MALDI-TOF-MS were performed by BioMérieux Diagnostic, Inc. in Istanbul. DNA sequence analysis of the clinical isolates was performed by the BMLabosis laboratory in Ankara. Samples consisted of 18 (75%) lower respiratory tract specimens, 3 otomycosis (12.5%) ear tissues, 1 sample from keratitis, and 1 sample from a cutaneous wound. According to DNA sequence analysis, 12 (50%) specimens were identified as A. fumigatus, 8 (33.3%) as A. flavus, 3 (12.5%) as A. niger, and 1 (4.2%) as A. terreus. Statistically, there was good agreement between the conventional morphology and rep-PCR and MALDI-TOF methods; kappa values were κ = 0.869, 0.871, and 0.916, respectively (P < 0.001). The good level of agreement between the methods included in the present study and sequence method could be due to the identification of Aspergillus strains that were commonly encountered. Therefore, it was concluded that studies conducted with a higher number of isolates, which include other Aspergillus strains, are required. © 2016 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
R. Barazandeh Aq Kariz
2017-08-01
Full Text Available Introduction: Shot hole disease of stone fruit trees resulted from Wilsonomyces carpophilus can weaken the trees and reduce the quantity and quality of the crops worldwide particularly in semi-arid regions. Coryneum blight or shot hole disease infects all the stone fruit trees including peach, nectarine, apricot, sour cherry, plum, cherry, and almond. One of the most important strategies to manage any plant disease is to use resistant cultivars. In this way, it is very important to have knowledge about the status of genetic diversity and to determine the relationship between isolates of the causal agent fungus. The main objective of the present research was to study the genetic diversity of W. carpophilus in Khorasan Razavi province using the rep-PCR molecular fingerprinting method. Materials and Methods: Sampling was performed from peach, nectarine, plum, apricot and cherry orchards of Quchan, Torqabeh, Shandiz, Chenaran, Neishabur, Kalat, Torbat Heidarieh and Mashhad during spring and summer of 2012 and 2013. Mono-conidial isolates were recovered from infected leaves, fruits, and twigs of different parts of orchards. Infected collected leaves, twigs, and fruits were transferred to the laboratory. By using techniques of Klimesova and Prasil (1989 and Mehta (1998 from the cut parts between infected and healthy tissues of each isolate, cuts of 2-3 mm from leaf, fruit and twig were prepared by the scalpel. These pieces were surface sterilized with 1% sodium hypochlorite liquid about 1 to 3 minutes based on the thickness of tissue. Then, the samples were cultured on PDA, MEA, and WA media and incubated at 18, 20, and 25 °C. The isolated fungi were purified and identified. The research was performed on 20 fungal isolates collected from different stone fruit trees. Genomic DNA was amplified using BOX A1R, ERIC2, ERIC1R, REP2-I, and REP1R-I primers. Thirty-eight of 39 fragments amplified were polymorphic for 100 to 5000 base pairs. Similarity matrix
Munday, Chris I; O'Loingsigh, Tadhg; Tapper, Nigel J; De Deckker, Patrick; Allison, Gwen E
2013-04-15
Dust storms are a major source of aerosolized bacteria, especially in the drought conditions experienced in Australia in the decade to 2009. The major aims of this project were to identify the culturable bacteria in environmental samples and to genetically fingerprint all isolates using repetitive element PCR (Rep-PCR) to investigate the possibility of tracking isolates from their source into the atmosphere. Four field trips were conducted to a dry lake in western Victoria, Australia to sample aerosols and sediments. Aerosols were collected at heights up to 150 m using vacuum pumps with filters attached to a tethered helium balloon, while corresponding sediments were collected in sterile polypropylene tubes. Isolates were cultivated on Tryptic Soy Agar, R2 Agar and Marine Agar, and grown in dark conditions at ambient temperature. By sequencing the 16S rRNA gene of 270 isolates, fifteen different bacterial families were identified, with both the aerosols and sediments dominated by the Bacillaceae family. Four sets of Rep-PCR primers were tested, with the ERIC and (GTG)5 primers proving to be the most suitable for fingerprinting the cultured taxa. Rep-PCR revealed very high strain diversity in the samples collected, however some strains were still able to be tracked from sediments up to 150 m in height. This shows the potential of Rep-PCR, however very large reference databases would be required for the technique to be more useful. Copyright © 2013 Elsevier B.V. All rights reserved.
Demeke, Tigst; Jenkins, G Ronald
2010-03-01
Biotechnology-derived varieties of canola, cotton, corn and soybean are being grown in the USA, Canada and other predominantly grain exporting countries. Although the amount of farmland devoted to production of biotechnology-derived crops continues to increase, lingering concerns that unintended consequences may occur provide the EU and most grain-importing countries with justification to regulate these crops. Legislation in the EU requires traceability of grains/oilseeds, food and feed products, and labelling, when a threshold level of 0.9% w/w of genetically engineered trait is demonstrated to be present in an analytical sample. The GE content is routinely determined by quantitative PCR (qPCR) and plant genomic DNA provides the template for the initial steps in this process. A plethora of DNA extraction methods exist for qPCR applications. Implementing standardized methods for detection of genetically engineered traits is necessary to facilitate grain marketing. The International Organization for Standardization draft standard 21571 identifies detergent-based methods and commercially available kits that are widely used for DNA extraction, but also indicates that adaptations may be necessary depending upon the sample matrix. This review assesses advantages and disadvantages of various commercially available DNA extraction kits, as well as modifications to published cetyltrimethylammonium bromide methods. Inhibitors are a major obstacle for efficient amplification in qPCR. The types of PCR inhibitors and techniques to minimize inhibition are discussed. Finally, accurate quantification of DNA for applications in qPCR is not trivial. Many confounders contribute to differences in analytical measurements when a particular DNA quantification method is applied and different methods do not always provide concordant results on the same DNA sample. How these differences impact measurement uncertainty in qPCR is considered.
Duster, Megan; Warrack, Simone; Maki, Dennis; Safdar, Nasia
2014-01-01
Pulsed-field gel electrophoresis (PFGE) is a common method used to type methicillin-resistant Staphylococcus aureus (MRSA) in nosocomial investigations and epidemiological studies but is time-consuming and methodologically challenging. We compared typing results obtained using a commercial repetitive-element PCR (rep-PCR) system with PFGE in a sample of 86 unique MRSA isolates recovered from subjects in an academic referral hospital and two nursing homes in the same geographic region. Both methods reliably assigned isolates to the same Centers for Disease Control and Prevention (CDC) pulsotype. PFGE was significantly more discriminatory (Simpson's index of diversity, 0.92 at the 95% strain similarity threshold) than the commercial rep-PCR system (Simpson's index of diversity, 0.58). The global (adjusted Rand coefficient, 0.10) and directional congruence (adjusted Wallace coefficientrepPCR→PFGE = 0.06; adjusted Wallace coefficientPFGE→repPCR = 0.52) between the two methods was low. MRSA strains recovered from study nursing homes that were clonal when typed by the commercial rep-PCR method were frequently noted to be genetically distinct when typed using PFGE. These data suggest that the commercial rep-PCR has less utility than PFGE in small-scale epidemiological assessments of MRSA in health care settings. PMID:24671801
Dolci, Paola; Cocolin, Luca
2017-08-01
This study describes the optimization and application of repetitive element-PCR (rep-PCR) technique directly on microbial DNA extracted from type I sourdoughs for fast monitoring of a Lb. plantarum starter strain (P1FMC) throughout daily back-slopping. The challenge was to follow and study the performance of a starter culture directly in sourdoughs without cultivation on selective media. The extraction of good quality microbial DNA suitable for amplification from a complex matrix such as dough was the first target. In addition, the objective to obtain a clear rep-PCR profile referable to a specific starter strain among a microbial community was pursued. Co-inoculum trials, in flour matrix, with Lb. plantarum P1FMC and L. lactis LC71 strains and, subsequently, type I sourdough back-slopping trials were performed. The rep-PCR amplification profiles obtained were clearly referable to that of Lb. plantarum P1FMC starter in both co-inoculum trials (also when it was present with one order of magnitude less with respect to L. lactis LC71) and back-slopping trials where it dominated the fermentation process with loads of 10 8 cfu g -1 and prevailed on the autochthonous microbiota. Thus, the approach proposed in this paper could be considered a methodological advancement, based on a culture-independent one-step rep-PCR, suitable for fast monitoring of starter performance. © 2017 Institute of Food Technologists®.
Goldberg, Tony L; Gillespie, Thomas R; Singer, Randall S
2006-09-01
Repetitive-element PCR (rep-PCR) is a method for genotyping bacteria based on the selective amplification of repetitive genetic elements dispersed throughout bacterial chromosomes. The method has great potential for large-scale epidemiological studies because of its speed and simplicity; however, objective guidelines for inferring relationships among bacterial isolates from rep-PCR data are lacking. We used multilocus sequence typing (MLST) as a "gold standard" to optimize the analytical parameters for inferring relationships among Escherichia coli isolates from rep-PCR data. We chose 12 isolates from a large database to represent a wide range of pairwise genetic distances, based on the initial evaluation of their rep-PCR fingerprints. We conducted MLST with these same isolates and systematically varied the analytical parameters to maximize the correspondence between the relationships inferred from rep-PCR and those inferred from MLST. Methods that compared the shapes of densitometric profiles ("curve-based" methods) yielded consistently higher correspondence values between data types than did methods that calculated indices of similarity based on shared and different bands (maximum correspondences of 84.5% and 80.3%, respectively). Curve-based methods were also markedly more robust in accommodating variations in user-specified analytical parameter values than were "band-sharing coefficient" methods, and they enhanced the reproducibility of rep-PCR. Phylogenetic analyses of rep-PCR data yielded trees with high topological correspondence to trees based on MLST and high statistical support for major clades. These results indicate that rep-PCR yields accurate information for inferring relationships among E. coli isolates and that accuracy can be enhanced with the use of analytical methods that consider the shapes of densitometric profiles.
Koc, A Nedret; Atalay, Mustafa A; Inci, Melek; Sariguzel, Fatma M; Sav, Hafize
2017-05-01
Dermatophyte species, isolation and identification in clinical samples are still difficult and take a long time. The identification and molecular epidemiology of dermatophytes commonly isolated in a clinical laboratory in Turkey by repetitive sequence-based PCR (rep-PCR) were assessed by comparing the results with those of reference identification. A total of 44 dermatophytes isolated from various clinical specimens of 20 patients with superficial mycoses in Kayseri and 24 patients in Hatay were studied. The identification of dermatophyte isolates was based on the reference identification and rep-PCR using the DiversiLab System (BioMerieux). The genotyping of dermatophyte isolates from different patients was determined by rep-PCR. In the identification of dermatophyte isolates, agreement between rep-PCR and conventional methods was 87.8 % ( 36 of 41). The dermatophyte strains belonged to four clones (A -D) which were determined by the use of rep-PCR. The dermatophyte strains in Clone B, D showed identical patterns with respect to the region. In conclusion, rep-PCR appears to be useful for evaluation of the identification and clonal relationships between Trichophyton rubrum species complex and Trichophyton mentagrophytes species complex isolates. The similarity and diversity of these isolates may be assessed according to different regions by rep-PCR. © 2017 Blackwell Verlag GmbH.
RepA and RepB exert plasmid incompatibility repressing the transcription of the repABC operon.
Pérez-Oseguera, Angeles; Cevallos, Miguel A
2013-11-01
Rhizobium etli CFN42 has a multipartite genome composed of one chromosome and six large plasmids with low copy numbers, all belonging to the repABC plasmid family. All elements essential for replication and segregation of these plasmids are encoded within the repABC operon. RepA and RepB direct plasmid segregation and are involved in the transcriptional regulation of the operon, and RepC is the initiator protein of the plasmid. Here we show that in addition to RepA (repressor) and RepB (corepressor), full transcriptional repression of the operon located in the symbiotic plasmid (pRetCFN42d) of this strain requires parS, the centromere-like sequence, and the operator sequence. However, the co-expression of RepA and RepB is sufficient to induce the displacement of the parental plasmid. RepA is a Walker-type ATPase that self associates in vivo and in vitro and binds specifically to the operator region in its RepA-ADP form. In contrast, RepA-ATP is capable of binding to non-specific DNA. RepA and RepB form high molecular weight DNA-protein complexes in the presence of ATP and ADP. RepA carrying ATP-pocket motif mutations induce full repression of the repABC operon without the participation of RepB and parS. These mutants specifically bind the operator sequence in their ATP or ADP bound forms. In addition, their expression in trans exerts plasmid incompatibility against the parental plasmid. RepA and RepB expressed in trans induce plasmid incompatibility because of their ability to repress the repABC operon and not only by their capacity to distort the plasmid segregation process. Copyright © 2013 Elsevier Inc. All rights reserved.
Tendency for interlaboratory precision in the GMO analysis method based on real-time PCR.
Kodama, Takashi; Kurosawa, Yasunori; Kitta, Kazumi; Naito, Shigehiro
2010-01-01
The Horwitz curve estimates interlaboratory precision as a function only of concentration, and is frequently used as a method performance criterion in food analysis with chemical methods. The quantitative biochemical methods based on real-time PCR require an analogous criterion to progressively promote method validation. We analyzed the tendency of precision using a simplex real-time PCR technique in 53 collaborative studies of seven genetically modified (GM) crops. Reproducibility standard deviation (SR) and repeatability standard deviation (Sr) of the genetically modified organism (GMO) amount (%) was more or less independent of GM crops (i.e., maize, soybean, cotton, oilseed rape, potato, sugar beet, and rice) and evaluation procedure steps. Some studies evaluated whole steps consisting of DNA extraction and PCR quantitation, whereas others focused only on the PCR quantitation step by using DNA extraction solutions. Therefore, SR and Sr for GMO amount (%) are functions only of concentration similar to the Horwitz curve. We proposed S(R) = 0.1971C 0.8685 and S(r) = 0.1478C 0.8424, where C is the GMO amount (%). We also proposed a method performance index in GMO quantitative methods that is analogous to the Horwitz Ratio.
DEFF Research Database (Denmark)
Nielsen, J B; Skov, M N; Jørgensen, R L
2011-01-01
pneumoniae (K. pneumoniae) producing extended spectrum β-lactamases (ESBLs) and their relation to recognized Danish outbreak strains. PFGE and Rep-PCR produced similar clustering among isolates. Individual isolates from each cluster were further characterized by PCR amplification and sequencing of bla (TEM......), bla (SHV), and bla (CTX-M), and multilocus sequence typing (MLST). Thirty-five out of 52 ESBL-producing K. pneumoniae isolates were ST15 and bla (CTX-M15), bla (SHV-28), and bla (TEM-1) positive by PCR. Ten out of 52 were ST16 and tested positive for bla (CTX-M15), bla (SHV-1), and bla (TEM-1...
Das, Shubhagata; Sarker, Subir; Ghorashi, Seyed Ali; Forwood, Jade K; Raidal, Shane R
2016-11-01
Beak and feather disease virus (BFDV) threatens a wide range of endangered psittacine birds worldwide. In this study, we assessed a novel PCR assay and genetic screening method using high-resolution melt (HRM) curve analysis for BFDV targeting the capsid (Cap) gene (HRM-Cap) alongside conventional PCR detection as well as a PCR method that targets a much smaller fragment of the virus genome in the replicase initiator protein (Rep) gene (HRM-Rep). Limits of detection, sensitivity, specificity and discriminatory power for differentiating BFDV sequences were compared. HRM-Cap had a high positive predictive value and could readily differentiate between a reference genotype and 17 other diverse BFDV genomes with more discriminatory power (genotype confidence percentage) than HRM-Rep. Melt curve profiles generated by HRM-Cap correlated with unique DNA sequence profiles for each individual test genome. The limit of detection of HRM-Cap was lower (2×10 -5 ng/reaction or 48 viral copies) than that for both HRM-Rep and conventional BFDV PCR which had similar sensitivity (2×10 -6 ng or 13 viral copies/reaction). However, when used in a diagnostic setting with 348 clinical samples there was strong agreement between HRM-Cap and conventional PCR (kappa=0.87, PHRM-Cap demonstrated higher specificity (99.9%) than HRM-Rep (80.3%). Copyright © 2016 Elsevier B.V. All rights reserved.
Sato, Jun; Nakayama, Motokazu; Tomita, Ayumi; Sonoda, Takumi; Hasumi, Motomitsu; Miyamoto, Takahisa
2017-01-01
In order to establish rapid and accurate typing method for Bacillus coagulans strains which is important for controlling in some canned foods and tea-based beverages manufacturing because of the high-heat resistance of the spores and high tolerance of the vegetative cells to catechins and chemicals, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) and repetitive-PCR (rep-PCR) were evaluated. For this purpose, 28 strains of B. coagulans obtained from various culture collections were tested. DNA sequence analyses of the genes encoding 16S rRNA and DNA gyrase classified the test strains into two and three groups, respectively, regardless of their phenotypes. Both MALDI-TOF MS and rep-PCR methods classified the test strains in great detail. Strains classified in each group showed similar phenotypes, such as carbohydrate utilization determined using API 50CH. In particular, the respective two pairs of strains which showed the same metabolic characteristic were classified into the same group by both MALDI-TOF MS and rep-PCR methods separating from the other strains. On the other hand, the other strains which have the different profiles of carbohydrate utilization were separated into different groups by these methods. These results suggested that the combination of MALDI-TOF MS and rep-PCR analyses was advantageous for the rapid and detailed typing of bacterial strains in respect to both phenotype and genotype.
Rodriguez, Marcela; Hogan, Patrick G; Satola, Sarah W; Crispell, Emily; Wylie, Todd; Gao, Hongyu; Sodergren, Erica; Weinstock, George M; Burnham, Carey-Ann D; Fritz, Stephanie A
2015-09-01
Historically, a number of typing methods have been evaluated for Staphylococcus aureus strain characterization. The emergence of contemporary strains of community-associated S. aureus, and the ensuing epidemic with a predominant strain type (USA300), necessitates re-evaluation of the discriminatory power of these typing methods for discerning molecular epidemiology and transmission dynamics, essential to investigations of hospital and community outbreaks. We compared the discriminatory index of 5 typing methods for contemporary S. aureus strain characterization. Children presenting to St. Louis Children's Hospital and community pediatric practices in St. Louis, Missouri (MO), with community-associated S. aureus infections were enrolled. Repetitive sequence-based PCR (repPCR), pulsed-field gel electrophoresis (PFGE), multilocus sequence typing (MLST), staphylococcal protein A (spa), and staphylococcal cassette chromosome (SCC) mec typing were performed on 200 S. aureus isolates. The discriminatory index of each method was calculated using the standard formula for this metric, where a value of 1 is highly discriminatory and a value of 0 is not discriminatory. Overall, we identified 26 distinct strain types by repPCR, 17 strain types by PFGE, 30 strain types by MLST, 68 strain types by spa typing, and 5 strain types by SCCmec typing. RepPCR had the highest discriminatory index (D) of all methods (D = 0.88), followed by spa typing (D = 0.87), MLST (D = 0.84), PFGE (D = 0.76), and SCCmec typing (D = 0.60). The method with the highest D among MRSA isolates was repPCR (D = 0.64) followed by spa typing (D = 0.45) and MLST (D = 0.44). The method with the highest D among MSSA isolates was spa typing (D = 0.98), followed by MLST (D = 0.93), repPCR (D = 0.92), and PFGE (D = 0.89). Among isolates designated USA300 by PFGE, repPCR was most discriminatory, with 10 distinct strain types identified (D = 0.63). We identified 45
Preparation of tritium- or deuterium-labeled vitamin D analogs by a convenient general method
International Nuclear Information System (INIS)
Paaren, H.E.; Fivizzani, M.A.; Schnoes, H.K.; DeLuca, H.F.
1981-01-01
The three-step conversion of vitamin D analogs to 6-oxo-3,5-cyclovitamin D derivatives followed by reduction with a tritide or deuteride reagent and subsequent cycloreversion gives 6-tritio(deutero)vitamin D derivatives and corresponding 5,6-trans-analogs. The method is general and affords the 6-labeled-vitamin D analogs in approx. =20% overall yield
Gogoi, Purnima; Borah, Probodh; Hussain, Iftikar; Das, Leena; Hazarika, Girin; Tamuly, Shantanu; Barkalita, Luit Moni
2018-05-01
A total of 12 Salmonella isolates belonging to different serovars, viz , Salmonella enterica serovar Enteritidis ( n = 4), Salmonella enterica serovar Weltevreden ( n = 4), Salmonella enterica serovar Newport ( n = 1), Salmonella enterica serovar Litchifield ( n = 1), and untypeable strains ( n = 2) were isolated from 332 diarrheic fecal samples collected from animals, birds, and humans. Of the two molecular typing methods applied, viz , repetitive element sequence-based PCR (REP-PCR) and pulsed-field gel electrophoresis (PFGE), PFGE could clearly differentiate the strains belonging to different serovars as well as differentiate between strains of the same serovar with respect to their source of isolation, whereas REP-PCR could not differentiate between strains of the same serovar. Thus, it can be suggested that PFGE is more useful and appropriate for molecular typing of Salmonella isolates during epidemiological investigations than REP-PCR. Copyright © 2018 American Society for Microbiology.
Directory of Open Access Journals (Sweden)
Jun Sato
Full Text Available In order to establish rapid and accurate typing method for Bacillus coagulans strains which is important for controlling in some canned foods and tea-based beverages manufacturing because of the high-heat resistance of the spores and high tolerance of the vegetative cells to catechins and chemicals, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS and repetitive-PCR (rep-PCR were evaluated. For this purpose, 28 strains of B. coagulans obtained from various culture collections were tested. DNA sequence analyses of the genes encoding 16S rRNA and DNA gyrase classified the test strains into two and three groups, respectively, regardless of their phenotypes. Both MALDI-TOF MS and rep-PCR methods classified the test strains in great detail. Strains classified in each group showed similar phenotypes, such as carbohydrate utilization determined using API 50CH. In particular, the respective two pairs of strains which showed the same metabolic characteristic were classified into the same group by both MALDI-TOF MS and rep-PCR methods separating from the other strains. On the other hand, the other strains which have the different profiles of carbohydrate utilization were separated into different groups by these methods. These results suggested that the combination of MALDI-TOF MS and rep-PCR analyses was advantageous for the rapid and detailed typing of bacterial strains in respect to both phenotype and genotype.
Transformational and derivational strategies in analogical problem solving.
Schelhorn, Sven-Eric; Griego, Jacqueline; Schmid, Ute
2007-03-01
Analogical problem solving is mostly described as transfer of a source solution to a target problem based on the structural correspondences (mapping) between source and target. Derivational analogy (Carbonell, Machine learning: an artificial intelligence approach Los Altos. Morgan Kaufmann, 1986) proposes an alternative view: a target problem is solved by replaying a remembered problem-solving episode. Thus, the experience with the source problem is used to guide the search for the target solution by applying the same solution technique rather than by transferring the complete solution. We report an empirical study using the path finding problems presented in Novick and Hmelo (J Exp Psychol Learn Mem Cogn 20:1296-1321, 1994) as material. We show that both transformational and derivational analogy are problem-solving strategies realized by human problem solvers. Which strategy is evoked in a given problem-solving context depends on the constraints guiding object-to-object mapping between source and target problem. Specifically, if constraints facilitating mapping are available, subjects are more likely to employ a transformational strategy, otherwise they are more likely to use a derivational strategy.
Directory of Open Access Journals (Sweden)
Elif Çepni
2012-01-01
Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.
Wu, Qingqing; Xiang, Shengnan; Wang, Wenjun; Zhao, Jinyan; Xia, Jinhua; Zhen, Yueran; Liu, Bang
2018-05-01
Various detection methods have been developed to date for identification of animal species. New techniques based on PCR approach have raised the hope of developing better identification methods, which can overcome the limitations of the existing methods. PCR-based methods used the mitochondrial DNA (mtDNA) as well as nuclear DNA sequences. In this study, by targeting nuclear DNA, multiplex PCR and real-time PCR methods were developed to assist with qualitative and quantitative analysis. The multiplex PCR was found to simultaneously and effectively distinguish four species (fox, dog, mink, and rabbit) ingredients by the different sizes of electrophoretic bands: 480, 317, 220, and 209 bp. Real-time fluorescent PCR's amplification profiles and standard curves showed good quantitative measurement responses and linearity, as indicated by good repeatability and coefficient of determination R 2 > 0.99. The quantitative results of quaternary DNA mixtures including mink, fox, dog, and rabbit DNA are in line with our expectations: R.D. (relative deviation) varied between 1.98 and 12.23% and R.S.D. (relative standard deviation) varied between 3.06 and 11.51%, both of which are well within the acceptance criterion of ≤ 25%. Combining the two methods is suitable for the rapid identification and accurate quantification of fox-, dog-, mink-, and rabbit-derived ingredients in the animal products.
Srůtková, Dagmar; Spanova, Alena; Spano, Miroslav; Dráb, Vladimír; Schwarzer, Martin; Kozaková, Hana; Rittich, Bohuslav
2011-10-01
Bifidobacterium longum is considered to play an important role in health maintenance of the human gastrointestinal tract. Probiotic properties of bifidobacterial isolates are strictly strain-dependent and reliable methods for the identification and discrimination of this species at both subspecies and strain levels are thus required. Differentiation between B. longum ssp. longum and B. longum ssp. infantis is difficult due to high genomic similarities. In this study, four molecular-biological methods (species- and subspecies-specific PCRs, random amplified polymorphic DNA (RAPD) method using 5 primers, repetitive sequence-based (rep)-PCR with BOXA1R and (GTG)(5) primers and amplified ribosomal DNA restriction analysis (ARDRA)) and biochemical analysis, were compared for the classification of 30 B. longum strains (28 isolates and 2 collection strains) on subspecies level. Strains originally isolated from the faeces of breast-fed healthy infants (25) and healthy adults (3) showed a high degree of genetic homogeneity by PCR with subspecies-specific primers and rep-PCR. When analysed by RAPD, the strains formed many separate clusters without any potential for subspecies discrimination. These methods together with arabionose/melezitose fermentation analysis clearly differentiated only the collection strains into B. longum ssp. longum and B. longum ssp. infantis at the subspecies level. On the other hand, ARDRA analysis differentiated the strains into the B. longum/infantis subspecies using the cleavage analysis of genus-specific amplicon with just one enzyme, Sau3AI. According to our results the majority of the strains belong to the B. longum ssp. infantis (75%). Therefore we suggest ARDRA using Sau3AI restriction enzyme as the first method of choice for distinguishing between B. longum ssp. longum and B. longum ssp. infantis. Copyright © 2011 Elsevier B.V. All rights reserved.
Wang, Jing-Yu; Wu, Ning; Liu, Wan-Hua; Ren, Juan-Juan; Tang, Pan; Qiu, Yuan-Hao; Wang, Chi-Young; Chang, Ching-Dong; Liu, Hung-Jen
2014-01-01
The commonest ways of diagnosing brucellosis in animals include the Rose-Bengal plate agglutination test, the buffered plate agglutination test (BPA), the slide agglutination test, the complement fixation test, and the indirect enzyme linked immunosorbent assay (I-ELISA). However, these methods cannot discriminate the Brucella vaccine strain (Brucella suis strain 2; B. suis S2) from naturally acquired virulent strains. Of the six common Brucella species, Brucella melitensis, Brucella abortus, and B. suis are the commonest species occurring in China. To develop an ELISA assay that can differentiate between cows inoculated with B. suis S2 and naturally infected with B. abortus and B. melitensis, genomic sequences from six Brucella spp. (B. melitensis, B. abortus, B. suis, Brucella canis, Brucella neotomae and Brucella ovis) were compared using Basic Local Alignment Search Tool software. One particular gene, the repA-related gene, was found to be a marker that can differentiate B. suis from B. abortus and B. melitensis. The repA-related gene of B. suis was PCR amplified and subcloned into the pET-32a vector. Expressed repA-related protein was purified and used as an antigen. The repA-based ELISA was optimized and used as specific tests. In the present study, serum from animals inoculated with the B. suis S2 vaccine strain had positive repA-based ELISA results. In contrast, the test-positive reference sera against B. abortus and B. melitensis had negative repA-based ELISA results. The concordance rate between B. abortus antibody-negative (based on the repA-based ELISA) and the Brucella gene-positive (based on the 'Bruce ladder' multiplex PCR) was 100%. Therefore, the findings suggest that the repA-based ELISA is a useful tool for differentiating cows vaccinated with the B. suis S2 and naturally infected with B. abortus and B. melitensis. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Brooke K Decker
Full Text Available Genotyping methods are essential to understand the transmission dynamics of Acinetobacter baumannii. We examined the representative genotypes of A. baumannii at different time periods in select locations in Ohio, using two rapid automated typing methods: PCR coupled with electrospray ionization mass spectrometry (PCR/ESI-MS, a form of multi-locus sequence typing (MLST, and repetitive-sequence-based-PCR (rep-PCR. Our analysis included 122 isolates from 4 referral hospital systems, in 2 urban areas of Ohio. These isolates were associated with outbreaks at 3 different time periods (1996, 2000 and 2005-2007. Type assignments of PCR/ESI-MS and rep-PCR were compared to each other and to worldwide (WW clone types. The discriminatory power of each method was determined using the Simpson's index of diversity (DI. We observed that PCR/ESI-MS sequence type (ST 14, corresponding to WW clone 3, predominated in 1996, whereas ST 12 and 14 co-existed in the intermediate period (2000 and ST 10 and 12, belonging to WW clone 2, predominated more recently in 2007. The shift from WW clone 3 to WW clone 2 was accompanied by an increase in carbapenem resistance. The DI was approximately 0.74 for PCR/ESI-MS, 0.88 for rep-PCR and 0.90 for the combination of both typing methods. We conclude that combining rapid automated typing methods such as PCR/ESI-MS and rep-PCR serves to optimally characterize the regional molecular epidemiology of A. baumannii. Our data also sheds light on the changing sequence types in an 11 year period in Northeast Ohio.
International Nuclear Information System (INIS)
Finsterbusch, T.; Steinfeldt, T.; Caliskan, R.; Mankertz, A.
2005-01-01
Porcine circovirus type 1 (PCV1) encodes two major ORFs. The cap gene comprises the major structural protein of PCV, the rep gene specifies Rep and Rep', which are both essential for initiating the replication of the viral DNA. Rep corresponds to the full-length protein, whereas Rep' is a truncated splice product that is frame-shifted in its C-terminal sequence. In this study, the cellular localization of PCV1-encoded proteins was investigated by immune fluorescence techniques using antibodies against Rep, Rep' and Cap and by expression of viral proteins fused to green and red fluorescence proteins. Rep and Rep' protein co-localized in the nucleus of infected cells as well as in cells transfected with plasmids expressing Rep and Rep' fused to fluorescence proteins, but no signal was seen in the nucleoli. Rep and Rep' carry three potential nuclear localization signals in their identical N-termini, and the contribution of these motifs to nuclear import was experimentally dissected. In contrast to the rep gene products, the localization of the Cap protein varied. While the Cap protein was restricted to the nucleoli in plasmid-transfected cells and was also localized in the nucleoli at an early stage of PCV1 infection, it was seen in the nucleoplasm and the cytoplasm later in infection, suggesting that a shuttling between distinct cellular compartments occurs
Directory of Open Access Journals (Sweden)
Fabián Galvis
2014-01-01
Full Text Available Bacillus thuringiensis es una bacteria Gram-positiva formadora de esporas, que produ - ce cristales parasporales de naturaleza proteica, tóxicos contra diferentes órdenes de insectos y biodegradables e inocuos para otras especies. Esta investigación empleó el modelo experimen - tal, que mediante técnicas de observación permi - tió, la identificación microbiológica y bioquímica de B. thuringiensis a partir de muestras de suelo de los municipios de Cúcuta, El Zulia, Los Patios, San Cayetano y Villa del Rosario, Norte de Santander, Colombia, y su posterior caracteri - zación con los marcadores moleculares Bc-Rep y MB1. Se identificaron microbiológica y bioquí - micamente 10 aislados como B. thuringiensis ; los resultados del análisis filogenético mostraron diferencias significativas en los agrupamientos obtenidos con los marcadores Bc-Rep y MB1. Con Bc-Rep se registró un índice de similaridad bajo (18%, mientras que con el marcador MB1 se obtuvo un índice mayor de similitud, 58%. En este trabajo se evidenció una gran variabilidad genética entre los aislados, que mostraron a los marcadores Bc-Rep y MB1 como altamente efectivos para diferenciar cepas estrechamente relacionadas, convirtiéndose en una herramienta genética de gran valor para estudios de identifi-cación y diversidad en B. thuringiensis.
Absolute quantification by droplet digital PCR versus analog real-time PCR
Hindson, Christopher M; Chevillet, John R; Briggs, Hilary A; Gallichotte, Emily N; Ruf, Ingrid K; Hindson, Benjamin J; Vessella, Robert L; Tewari, Muneesh
2014-01-01
Nanoliter-sized droplet technology paired with digital PCR (ddPCR) holds promise for highly precise, absolute nucleic acid quantification. Our comparison of microRNA quantification by ddPCR and real-time PCR revealed greater precision (coefficients of variation decreased by 37–86%) and improved day-to-day reproducibility (by a factor of seven) of ddPCR but with comparable sensitivity. When we applied ddPCR to serum microRNA biomarker analysis, this translated to superior diagnostic performance for identifying individuals with cancer. PMID:23995387
A standard curve based method for relative real time PCR data processing
Directory of Open Access Journals (Sweden)
Krause Andreas
2005-03-01
Full Text Available Abstract Background Currently real time PCR is the most precise method by which to measure gene expression. The method generates a large amount of raw numerical data and processing may notably influence final results. The data processing is based either on standard curves or on PCR efficiency assessment. At the moment, the PCR efficiency approach is preferred in relative PCR whilst the standard curve is often used for absolute PCR. However, there are no barriers to employ standard curves for relative PCR. This article provides an implementation of the standard curve method and discusses its advantages and limitations in relative real time PCR. Results We designed a procedure for data processing in relative real time PCR. The procedure completely avoids PCR efficiency assessment, minimizes operator involvement and provides a statistical assessment of intra-assay variation. The procedure includes the following steps. (I Noise is filtered from raw fluorescence readings by smoothing, baseline subtraction and amplitude normalization. (II The optimal threshold is selected automatically from regression parameters of the standard curve. (III Crossing points (CPs are derived directly from coordinates of points where the threshold line crosses fluorescence plots obtained after the noise filtering. (IV The means and their variances are calculated for CPs in PCR replicas. (V The final results are derived from the CPs' means. The CPs' variances are traced to results by the law of error propagation. A detailed description and analysis of this data processing is provided. The limitations associated with the use of parametric statistical methods and amplitude normalization are specifically analyzed and found fit to the routine laboratory practice. Different options are discussed for aggregation of data obtained from multiple reference genes. Conclusion A standard curve based procedure for PCR data processing has been compiled and validated. It illustrates that
Mwakaboko, Alinanuswe S; Zwanenburg, Binne
2011-04-01
Strigolactones are important signaling compounds in the plant kingdom. Here we focus on their germination stimulatory effect on seeds of the parasitic weeds Striga and Orobanche spp. and more particularly on the design and synthesis of new active strigolactone analogs derived from simple cyclic ketones. New analogs derived from 1-indanone, 1-tetralone, cyclopentanone, cyclohexanone and a series of substituted cyclohexanones (including carvone and pulegone) are prepared by formylation of the ketones with ethyl formate followed by coupling with a halo butenolide. Both enantiomers of the analog derived from 1-tetralone have been prepared by employing a homochiral synthon for the coupling reaction. For three other strigolactone analogs the antipodes have been obtained by chromatography on a chiral column. All analogs have an appreciable germinating activity towards seeds of Striga hermomonthica and Orobanche crenata and O. cernua. Stereoisomers having the same configuration at the D-ring as in naturally occurring strigol have a higher stimulatory effect than the corresponding antipodes. The analogs obtained from 1-indanone and 1-tetralone have an activity comparable with that of the well known stimulant GR 24. Analogs derived from 2-phenyl-cylohexanone, carvone and pulegone also have a good germinating response. The results show that the working model for designing new bioactive strigolactones is applicable.
Adeno-associated virus rep protein synthesis during productive infection
International Nuclear Information System (INIS)
Redemann, B.E.; Mendelson, E.; Carter, B.J.
1989-01-01
Adeno-associated virus (AAV) Rep proteins mediate viral DNA replication and can regulate expression from AAV genes. The authors studied the kinetics of synthesis of the four Rep proteins, Rep78, Rep68, Rep52, and Rep40, during infection of human 293 or KB cells with AAV and helper adenovirus by in vivo labeling with [ 35 S]methionine, immunoprecipitation, and immunoblotting analyses. Rep78 and Rep52 were readily detected concomitantly with detection of viral monomer duplex DNA replicating about 10 to 12 h after infection, and Rep68 and Rep40 were detected 2 h later. Rep78 and Rep52 were more abundant than Rep68 and Rep40 owing to a higher synthesis rate throughout the infectious cycle. In some experiments, very low levels of Rep78 could be detected as early as 4 h after infection. The synthesis rates of Rep proteins were maximal between 14 and 24 h and then decreased later after infection. Isotopic pulse-chase experiments showed that each of the Rep proteins was synthesized independently and was stable for at least 15 h. A slower-migrating, modified form of Rep78 was identified late after infection. AAV capsid protein synthesis was detected at 10 to 12 h after infection and also exhibited synthesis kinetics similar to those of the Rep proteins. AAV DNA replication showed at least two clearly defined stages. Bulk duplex replicating DNA accumulation began around 10 to 12 h and reached a maximum level at about 20 h when Rep and capsid protein synthesis was maximal. Progeny single-stranded DNA accumulation began about 12 to 13 h, but most of this DNA accumulated after 24 h when Rep and capsid protein synthesis had decreased
International Nuclear Information System (INIS)
Awedikian, Rafi; Francois, Achille; Guilbaud, Mickael; Moullier, Philippe; Salvetti, Anna
2005-01-01
The two large Rep proteins, Rep78 and Rep68, from the adeno-associated virus type 2 (AAV-2) are required for AAV-2 DNA replication, site-specific integration, and for the regulation of viral gene expression. The study of their activities is dependent on the ability to deliver these proteins to the cells in a time and dose-dependent manner. We evaluated the ability of a protein transduction domain (PTD) derived from the human immunodeficiency virus 1 (HIV-1) TAT protein to drive the cellular internalization of exogenously delivered PTD-fused Rep68 proteins. This analysis unexpectedly revealed that recombinant Rep68 alone, in the absence of any PTD, could be endocytosed by the cells. Rep68 as the chimeric TAT-Rep68 proteins were internalized through endocytosis in clathrin-coated vesicles and retained in late endosomes/lysosomes with no detectable nuclear localization. In the presence of adenovirus, the Rep proteins could translocate into the nucleus where they displayed a biological activity. These findings support recent reports on the mechanism of entry of TAT-fused proteins and also revealed a new property of Rep68
International Nuclear Information System (INIS)
Peng Changhai; Wu Zhishen
2008-01-01
Simple and effective computation methods are needed to calculate energy efficiency in buildings for building thermal comfort and HVAC system simulations. This paper, which is based upon the theory of thermoelectricity analogy, develops a new harmonic method, the thermoelectricity analogy method (TEAM), to compute the periodic heat transfer in external building envelopes (EBE). It presents, in detail, the principles and specific techniques of TEAM to calculate both the decay rates and time lags of EBE. First, a set of linear equations is established using the theory of thermoelectricity analogy. Second, the temperature of each node is calculated by solving the linear equations set. Finally, decay rates and time lags are found by solving simple mathematical expressions. Comparisons show that this method is highly accurate and efficient. Moreover, relative to the existing harmonic methods, which are based on the classical control theory and the method of separation of variables, TEAM does not require complicated derivation and is amenable to hand computation and programming
Cross-Domain Analogies as Relating Derived Relations among Two Separate Relational Networks
Ruiz, Francisco J; Luciano, Carmen
2011-01-01
Contemporary behavior analytic research is making headway in analyzing analogy as the establishment of a relation of coordination among common types of trained or derived relations. Previous studies have been focused on within-domain analogy. The current study expands previous research by analyzing cross-domain analogy as relating relations among separate relational networks and by correlating participants' performance with a standard measure of analogical reasoning. In two experiments, adult participants first completed general intelligence and analogical reasoning tests. Subsequently, they were exposed to a computerized conditional discrimination training procedure designed to create two relational networks, each consisting of two 3-member equivalence classes. The critical test was a two-part analogical test in which participants had to relate combinatorial relations of coordination and distinction between the two relational networks. In Experiment 1, combinatorial relations for each network were individually tested prior to analogical testing, but in Experiment 2 they were not. Across both experiments, 65% of participants passed the analogical test on the first attempt. Moreover, results from the training procedure were strongly correlated with the standard measure of analogical reasoning. PMID:21547072
Cheung, Andrew K
2015-07-01
The roles of two porcine circovirus replication initiator proteins, Rep and Rep׳, in generating copy-release and rolling-circle DNA replication intermediates were determined. Rep uses the supercoiled closed-circular genome (ccc) to initiate leading-strand synthesis (identical to copy-release replication) and generates the single-stranded circular (ssc) genome from the displaced DNA strand. In the process, a minus-genome primer (MGP) necessary for complementary-strand synthesis, from ssc to ccc, is synthesized. Rep׳ cleaves the growing nascent-strand to regenerate the parent ccc molecule. In the process, a Rep׳-DNA hybrid containing the right palindromic sequence (at the origin of DNA replication) is generated. Analysis of the virus particle showed that it is composed of four components: ssc, MGP, capsid protein and a novel Rep-related protein (designated Protein-3). Copyright © 2015. Published by Elsevier Inc.
Barnes-Holmes, Dermot; Regan, Donal; Barnes-Holmes, Yvonne; Commins, Sean; Walsh, Derek; Stewart, Ian; Smeets, Paul M; Whelan, Robert; Dymond, Simon
2005-11-01
The current study aimed to test a Relational Frame Theory (RFT) model of analogical reasoning based on the relating of derived same and derived difference relations. Experiment 1 recorded reaction time measures of similar-similar (e.g., "apple is to orange as dog is to cat") versus different-different (e.g., "he is to his brother as chalk is to cheese") derived relational responding, in both speed-contingent and speed-noncontingent conditions. Experiment 2 examined the event-related potentials (ERPs) associated with these two response patterns. Both experiments showed similar-similar responding to be significantly faster than different-different responding. Experiment 2 revealed significant differences between the waveforms of the two response patterns in the left-hemispheric prefrontal regions; different-different waveforms were significantly more negative than similar-similar waveforms. The behavioral and neurophysiological data support the RFT prediction that, all things being equal, similar-similar responding is relationally "simpler" than, and functionally distinct from, different-different analogical responding. The ERP data were fully consistent with findings in the neurocognitive literature on analogy. These findings strengthen the validity of the RFT model of analogical reasoning and supplement the behavior-analytic approach to analogy based on the relating of derived relations.
DEFF Research Database (Denmark)
Madsen, Louise; Kriegenburg, Franziska; Lages Lino Vala, Andrea
2011-01-01
is a transmembrane protein that localizes to the ER membrane with its UBX domain facing the cytoplasm. Knock-down of Rep8 expression in human cells leads to a decreased association of p97 with the ER membrane and concomitantly a retarded degradation of misfolded ER-derived proteasome substrates. Thus, Rep8 tethers p......The protein known as p97 or VCP in mammals and Cdc48 in yeast is a versatile ATPase complex involved in several biological functions including membrane fusion, protein folding, and activation of membrane-bound transcription factors. In addition, p97 plays a central role in degradation of misfolded...... protein named Rep8 or Ubxd6 as a new cofactor of p97. Mouse Rep8 is highly tissue-specific and abundant in gonads. In testes, Rep8 is expressed in post-meiotic round spermatids, whereas in ovaries Rep8 is expressed in granulosa cells. Rep8 associates directly with p97 via its UBX domain. We show that Rep8...
The roles of two porcine circovirus replication initiator proteins, Rep and Rep', in generating copy-release and rolling-circle DNA replication intermediates were determined. Rep uses the supercoiled closed-circular genome (ccc) to initiate leading-strand synthesis (identical to copy-release replica...
Simulation of Rossi-α method with analog Monte-Carlo method
International Nuclear Information System (INIS)
Lu Yuzhao; Xie Qilin; Song Lingli; Liu Hangang
2012-01-01
The analog Monte-Carlo code for simulating Rossi-α method based on Geant4 was developed. The prompt neutron decay constant α of six metal uranium configurations in Oak Ridge National Laboratory were calculated. α was also calculated by Burst-Neutron method and the result was consistent with the result of Rossi-α method. There is the difference between results of analog Monte-Carlo simulation and experiment, and the reasons for the difference is the gaps between uranium layers. The influence of gaps decrease as the sub-criticality deepens. The relative difference between results of analog Monte-Carlo simulation and experiment changes from 19% to 0.19%. (authors)
A method and software for segmentation of anatomic object ensembles by deformable m-reps
International Nuclear Information System (INIS)
Pizer, Stephen M.; Fletcher, P. Thomas; Joshi, Sarang; Gash, A. Graham; Stough, Joshua; Thall, Andrew; Tracton, Gregg; Chaney, Edward L.
2005-01-01
Deformable shape models (DSMs) comprise a general approach that shows great promise for automatic image segmentation. Published studies by others and our own research results strongly suggest that segmentation of a normal or near-normal object from 3D medical images will be most successful when the DSM approach uses (1) knowledge of the geometry of not only the target anatomic object but also the ensemble of objects providing context for the target object and (2) knowledge of the image intensities to be expected relative to the geometry of the target and contextual objects. The segmentation will be most efficient when the deformation operates at multiple object-related scales and uses deformations that include not just local translations but the biologically important transformations of bending and twisting, i.e., local rotation, and local magnification. In computer vision an important class of DSM methods uses explicit geometric models in a Bayesian statistical framework to provide a priori information used in posterior optimization to match the DSM against a target image. In this approach a DSM of the object to be segmented is placed in the target image data and undergoes a series of rigid and nonrigid transformations that deform the model to closely match the target object. The deformation process is driven by optimizing an objective function that has terms for the geometric typicality and model-to-image match for each instance of the deformed model. The success of this approach depends strongly on the object representation, i.e., the structural details and parameter set for the DSM, which in turn determines the analytic form of the objective function. This paper describes a form of DSM called m-reps that has or allows these properties, and a method of segmentation consisting of large to small scale posterior optimization of m-reps. Segmentation by deformable m-reps, together with the appropriate data representations, visualizations, and user interface, has been
Pazos, Gonzalo; Rivadulla, Marcos L; Pérez-García, Xenxo; Gandara, Zoila; Pérez, Manuel
2014-01-01
The Gemini analogs are the last significant contribution to the family of vitamin D derivatives in medicine, for the treatment of cancer. The first Gemini analog was characterized by two symmetric side chains at C-20. Following numerous modifications, the most active analog bears a C-23-triple bond, C-26, 27- hexafluoro substituents on one side chain and a terminal trideuteromethylhydroxy group on the other side chain. This progression was possible due to improvements in the synthetic methods for the preparation of these derivatives, which allowed for increasing molecular complexity and complete diastereoselective control at C-20 and the substituted sidechains.
Gârbacea, C.; Tsagkias, M.; de Rijke, M.
2014-01-01
We report on our participation in the reputation dimension task of the CLEF RepLab 2014 evaluation initiative, i.e., to classify social media updates into eight predefined categories. We address the task by using corpus-based methods to extract textual features from the labeled training data to
Ni República parlamentaria ni presidencialista
Álvarez Tardío, Manuel
2004-01-01
Revista de Estudios Políticos (Nueva Época), Núm. 123. Enero-Marzo 2004 Este trabajo está dedicado al estudio de un aspecto básico del sistema político de la II República española (1931-1936): el modelo de presidencia de la República y de relaciones de la misma con el parlamento y el gobierno. Aquí se sostiene que la Segunda República, de acuerdo con su Constitución, no fue un régimen parlamentario ni presidencial. Combinó de forma extraña y ambigua elementos de ambos modelos. Probablement...
Directory of Open Access Journals (Sweden)
Vinay G. Joshi
2013-12-01
Full Text Available Aim: This study was designed to develop peptide analogs of Infectious Bursal Disease (IBD virus VP5 protein segment having cell penetrating ability to improve their interaction with cargo molecule (Nucleic acid without affecting the backbone conformation. Materials and Methods: IBDV VP5 protein segment designated as RATH peptide were synthesized using solid phase peptide synthesis and their solution conformation was elucidated using CD spectroscopy in polar (water and apolar (TFE solvents. Cell penetrating ability of RATH-CONH2 was observed using FITC labeled peptide internalization in to HeLa cells under fluorescent microscopy. The efficacy of RATH analog interactions with nucleic acids was evaluated using FITC labeled oligonucleotides by fluorescence spectroscopy and plasmid constructs in gel retardation assay. Results: CD spectra of RATH analogs in water and apolar trifluroethanol (TFE helped to compare their secondary structures which were almost similar with dominant beta conformations suggesting successful induction of positive charge in the analogs without affecting back bone conformation of CPP designed. Cell penetrating ability of RATH CONH2 in HeLa cell was more than 90%. The fluorescence spectroscopy and plasmid constructs in gel retardation assay demonstrated successful interaction of amide analogs with nucleic acid. Conclusion: Intentional changes made in IBDV derived peptide RATH COOH to RATH CONH2 did not showed major changes in backbone conformation and such modifications may help to improve the cationic charge in most CPPs to interact with nucleic acid. [Vet World 2013; 6(6.000: 307-312
Application of rep-PCR as a molecular tool for the genetic diversity ...
African Journals Online (AJOL)
admin
2016-02-17
Feb 17, 2016 ... leaf tissues were ground with a mortar and pestle to a fine powder using liquid nitrogen. Five grams of the leaves ... Amplification was performed in a thermal cycler (Eppendorf, Germany) PCR machine. ... extraction kit (Qiagen, Hilden, Germany) and cloned into the PCR cloning vector, pMiniT Vector (NEB ...
Radiological emergency preparedness (REP) program
International Nuclear Information System (INIS)
Kwiatkowski, D.H.
1995-01-01
This talk focuses on the accomplishments of Radiological Emergency Preparedness Program. Major topics include the following: strengthening the partnership between FEMA, the States, and the Industry; the Standard Exercise Report Format (SERF); Multi-year performance partnership agreement (MYPPA); new REP Program guidance; comprehensive exercise program; federal radiological emergency response plan (FRERP); international interest; REP user fee; implementation EPA PAGs and Dose Limits; Contamination monitoring standard for portal monitors; guidance documents and training
RepExplore: addressing technical replicate variance in proteomics and metabolomics data analysis.
Glaab, Enrico; Schneider, Reinhard
2015-07-01
High-throughput omics datasets often contain technical replicates included to account for technical sources of noise in the measurement process. Although summarizing these replicate measurements by using robust averages may help to reduce the influence of noise on downstream data analysis, the information on the variance across the replicate measurements is lost in the averaging process and therefore typically disregarded in subsequent statistical analyses.We introduce RepExplore, a web-service dedicated to exploit the information captured in the technical replicate variance to provide more reliable and informative differential expression and abundance statistics for omics datasets. The software builds on previously published statistical methods, which have been applied successfully to biomedical omics data but are difficult to use without prior experience in programming or scripting. RepExplore facilitates the analysis by providing a fully automated data processing and interactive ranking tables, whisker plot, heat map and principal component analysis visualizations to interpret omics data and derived statistics. Freely available at http://www.repexplore.tk enrico.glaab@uni.lu Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.
Energy Technology Data Exchange (ETDEWEB)
Pilatti, Marcia M.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: marciapilatti@yahoo.com.br, e-mail: antero@cdtn.br; Ferreira, Sidney A. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia], e-mail: saninoalmeida@gmail.com
2009-07-01
The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with {sup 32}P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)
International Nuclear Information System (INIS)
Pilatti, Marcia M.; Andrade, Antero S.R.; Ferreira, Sidney A.
2009-01-01
The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with 32 P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)
Inverse PCR-based method for isolating novel SINEs from genome.
Han, Yawei; Chen, Liping; Guan, Lihong; He, Shunping
2014-04-01
Short interspersed elements (SINEs) are moderately repetitive DNA sequences in eukaryotic genomes. Although eukaryotic genomes contain numerous SINEs copy, it is very difficult and laborious to isolate and identify them by the reported methods. In this study, the inverse PCR was successfully applied to isolate SINEs from Opsariichthys bidens genome in Eastern Asian Cyprinid. A group of SINEs derived from tRNA(Ala) molecular had been identified, which were named Opsar according to Opsariichthys. SINEs characteristics were exhibited in Opsar, which contained a tRNA(Ala)-derived region at the 5' end, a tRNA-unrelated region, and AT-rich region at the 3' end. The tRNA-derived region of Opsar shared 76 % sequence similarity with tRNA(Ala) gene. This result indicated that Opsar could derive from the inactive or pseudogene of tRNA(Ala). The reliability of method was tested by obtaining C-SINE, Ct-SINE, and M-SINEs from Ctenopharyngodon idellus, Megalobrama amblycephala, and Cyprinus carpio genomes. This method is simpler than the previously reported, which successfully omitted many steps, such as preparation of probes, construction of genomic libraries, and hybridization.
Direct method gas-phase oxygen abundances of four Lyman break analogs
Energy Technology Data Exchange (ETDEWEB)
Brown, Jonathan S.; Croxall, Kevin V.; Pogge, Richard W. [Department of Astronomy, The Ohio State University, Columbus, OH 43201 (United States)
2014-09-10
We measure the gas-phase oxygen abundances in four Lyman break analogs using auroral emission lines to derive direct abundances. The direct method oxygen abundances of these objects are generally consistent with the empirically derived strong-line method values, confirming that these objects are low oxygen abundance outliers from the mass-metallicity (MZ) relation defined by star forming Sloan Digital Sky Survey galaxies. We find slightly anomalous excitation conditions (Wolf-Rayet features) that could potentially bias the empirical estimates toward high values if caution is not exercised in the selection of the strong-line calibration. The high rate of star formation and low oxygen abundance of these objects is consistent with the predictions of the fundamental metallicity relation, in which the infall of relatively unenriched gas simultaneously triggers an episode of star formation and dilutes the interstellar medium of the host galaxy.
Sensing Methods for Detecting Analog Television Signals
Rahman, Mohammad Azizur; Song, Chunyi; Harada, Hiroshi
This paper introduces a unified method of spectrum sensing for all existing analog television (TV) signals including NTSC, PAL and SECAM. We propose a correlation based method (CBM) with a single reference signal for sensing any analog TV signals. In addition we also propose an improved energy detection method. The CBM approach has been implemented in a hardware prototype specially designed for participating in Singapore TV white space (WS) test trial conducted by Infocomm Development Authority (IDA) of the Singapore government. Analytical and simulation results of the CBM method will be presented in the paper, as well as hardware testing results for sensing various analog TV signals. Both AWGN and fading channels will be considered. It is shown that the theoretical results closely match with those from simulations. Sensing performance of the hardware prototype will also be presented in fading environment by using a fading simulator. We present performance of the proposed techniques in terms of probability of false alarm, probability of detection, sensing time etc. We also present a comparative study of the various techniques.
Directory of Open Access Journals (Sweden)
Louise Madsen
Full Text Available The protein known as p97 or VCP in mammals and Cdc48 in yeast is a versatile ATPase complex involved in several biological functions including membrane fusion, protein folding, and activation of membrane-bound transcription factors. In addition, p97 plays a central role in degradation of misfolded secretory proteins via the ER-associated degradation pathway. This functional diversity of p97 depends on its association with various cofactors, and to further our understanding of p97 function it is important that these cofactors are identified and analyzed. Here, we isolate and characterize the human protein named Rep8 or Ubxd6 as a new cofactor of p97. Mouse Rep8 is highly tissue-specific and abundant in gonads. In testes, Rep8 is expressed in post-meiotic round spermatids, whereas in ovaries Rep8 is expressed in granulosa cells. Rep8 associates directly with p97 via its UBX domain. We show that Rep8 is a transmembrane protein that localizes to the ER membrane with its UBX domain facing the cytoplasm. Knock-down of Rep8 expression in human cells leads to a decreased association of p97 with the ER membrane and concomitantly a retarded degradation of misfolded ER-derived proteasome substrates. Thus, Rep8 tethers p97 to the ER membrane for efficient ER-associated degradation.
Chen, Zongyan; Li, Chuanfeng; Peng, Gaojing; Liu, Guangqing
2013-07-01
The goose parvovirus (GPV) Rep1 protein is both essential for viral replication and a potential target for GPV diagnosis, but its protein characterization and intracellular localization is not clear. We constructed a recombinant plasmid, pET28a/GPV-Rep1, and expressed the Rep1 gene in BL21 (DE3) Escherichia coli. A protein approximately 75 kDa in size was obtained from lysates of E. coli cells expressing the recombinant plasmid. SDS-PAGE analysis showed that after induction with 0.6 mM isopropyl β-D-thiogalactosidase (IPTG) at 30°C for 5 h, the Rep1 protein was highly overexpressed. Two methods used to purify proteins, a salinity-gradient elution and Ni-NTA affinity chromatography, were performed. The amount of Rep1 protein obtained by Ni-NTA affinity chromatography was 41.23 mg, while 119.9 mg of Rep1 protein was obtained by a salinity-gradient elution from a 1 L E. coli BL21 (DE3) culture. An immunogenicity analysis showed that the protein could significantly elicit a specific antibody response in immunized goslings compared to control groups. Antibody titers peaked to 1:5120 (optical density (OD) 450 = 3.9) on day 28 after immunization but had mean titers of 1:10,240 (OD450 = 4.2) in gosling groups immunized with a commercially available GPV-attenuated vaccine strain. Experiments examining subcellular localization showed that the Rep1 protein appeared to associate predominantly with the nuclear membrane, especially during later times of infection. This work provides a basis for biochemical and structural studies on the GPV Rep1 protein.
Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich
1998-01-01
We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820
Overview of RepLab 2012: Evaluating Online Reputation Management Systems
Amigó, E.; Corujo, A.; Gonzalo, J.; Meij, E.; de Rijke, M.
2012-01-01
This paper summarizes the goals, organization and results of the first RepLab competitive evaluation campaign for Online Reputation Management Systems (RepLab 2012). RepLab focused on the reputation of companies, and asked participant systems to annotate different types of information on tweets
Interlaboratory diagnostic accuracy of a Salmonella specific PCR-based method
DEFF Research Database (Denmark)
Malorny, B.; Hoorfar, Jeffrey; Hugas, M.
2003-01-01
A collaborative study involving four European laboratories was conducted to investigate the diagnostic accuracy of a Salmonella specific PCR-based method, which was evaluated within the European FOOD-PCR project (http://www.pcr.dk). Each laboratory analysed by the PCR a set of independent obtained...... presumably naturally contaminated samples and compared the results with the microbiological culture method. The PCR-based method comprised a preenrichment step in buffered peptone water followed by a thermal cell lysis using a closed tube resin-based method. Artificially contaminated minced beef and whole......-based diagnostic methods and is currently proposed as international standard document....
Takabatake, Reona; Akiyama, Hiroshi; Sakata, Kozue; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Teshima, Reiko; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi
2011-01-01
A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event; A2704-12. During the plant transformation, DNA fragments derived from pUC19 plasmid were integrated in A2704-12, and the region was found to be A2704-12 specific. The pUC19-derived DNA sequences were used as primers for the specific detection of A2704-12. We first tried to construct a standard plasmid for A2704-12 quantification using pUC19. However, non-specific signals appeared with both qualitative and quantitative PCR analyses using the specific primers with pUC19 as a template, and we then constructed a plasmid using pBR322. The conversion factor (C(f)), which is required to calculate the amount of the genetically modified organism (GMO), was experimentally determined with two real-time PCR instruments, the Applied Biosystems 7900HT and the Applied Biosystems 7500. The determined C(f) values were both 0.98. The quantitative method was evaluated by means of blind tests in multi-laboratory trials using the two real-time PCR instruments. The limit of quantitation for the method was estimated to be 0.1%. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSD(R)), and the determined bias and RSD(R) values for the method were each less than 20%. These results suggest that the developed method would be suitable for practical analyses for the detection and quantification of A2704-12.
Nonlinear analysis and analog simulation of a piezoelectric buckled beam with fractional derivative
Mokem Fokou, I. S.; Buckjohn, C. Nono Dueyou; Siewe Siewe, M.; Tchawoua, C.
2017-08-01
In this article, an analog circuit for implementing fractional-order derivative and a harmonic balance method for a vibration energy harvesting system under pure sinusoidal vibration source is proposed in order to predict the system response. The objective of this paper is to discuss the performance of the system with fractional derivative and nonlinear damping (μb). Bifurcation diagram, phase portrait and power spectral density (PSD) are provided to deeply characterize the dynamics of the system. These results are corroborated by the 0-1 test. The appearance of the chaotic vibrations reduces the instantaneous voltage. The pre-experimental investigation is carried out through appropriate software electronic circuit (Multisim). The corresponding electronic circuit is designed, exhibiting periodic and chaotic behavior, in accord with numerical simulations. The impact of fractional derivative and nonlinear damping is presented with detail on the output voltage and power of the system. The agreement between numerical and analytical results justifies the efficiency of the analytical technique used. In addition, by combining the harmonic excitation with the random force, the stochastic resonance phenomenon occurs and improves the harvested energy. It emerges from these results that the order of fractional derivative μ and nonlinear damping μb play an important role in the response of the system.
Directory of Open Access Journals (Sweden)
Lea Chapaval
2006-06-01
Full Text Available A identificação e classificação bacteriana são de suma importância no ambiente, na indústria, na medicina veterinária, na microbiologia e na ecologia microbiana. Um número de diferentes métodos genotípicos e fenotípicos estão sendo empregados para identificação e classificação microbiana. A técnica de REP-PCR é baseada no uso de primers sintetizados a partir de sequências repetidas de DNA, chamadas de palindrômicas extragênicas repetidas (REP, e têm sido descrita como um método o qual gera impressões digitais (fingerprints de DNA que podem diferenciar bactérias entre gêneros e espécies. Neste estudo, o método de fingerprint foi usado para Staphylococcus aureus com o objetivo de avaliar a higiene de ordenha em duas fazendas leiteiras. Foram obtidos vários fingerprints de todos os isolados coletados das diferentes fontes estudadas (mãos de ordenhadores, tetos das vacas, leite e ordenhadeira, e foram obtidos comportamentos muito similares das bandas indicando que os isolados podem ser relatados como clones epidemiológicos. Em nosso estudo, a técnica mostrou ser eficiente para a análise da similaridade entre indivíduos da mesma espécie, no caso, o Staphylococcus aureus, mostrando ser uma ferramenta útil para investigação de falhas no manejo e, em um controle mais eficiente para evitar e/ou diminuir a disseminação de microrganismos causadores de sérias enfermidades em humanos e em animais, que podem ser transmitidas através de produtos como o leite e seus derivados.
COMPARISON OF 16S rRNA-PCR-RFLP, LipL32-PCR AND OmpL1-PCR METHODS IN THE DIAGNOSIS OF LEPTOSPIROSIS
Directory of Open Access Journals (Sweden)
Tülin GÜVEN GÖKMEN
Full Text Available SUMMARY Leptospirosis is still one of the most important health problems in developing countries located in humid tropical and subtropical regions. Human infections are generally caused by exposure to water, soil or food contaminated with the urine of infected wild and domestic animals such as rodents and dogs. The clinical course of leptospirosis is variable and may be difficult to distinguish from many other infectious diseases. The dark-field microscopy (DFM, serology and nucleic acid amplification techniques are used to diagnose leptospirosis, however, a distinctive standard reference method is still lacking. Therefore, in this study, we aimed to determine the presence of Leptospira spp., to differentiate the pathogenic L. interrogans and the non-pathogenic L. biflexa, and also to determine the sensitivity and specificity values of molecular methods as an alternative to conventional ones. A total of 133 serum samples, from 47 humans and 86 cattle were evaluated by two conventional tests: the Microagglutination Test (MAT and the DFM, as well as three molecular methods, the 16S rRNA-PCR followed by Restriction Fragment Lenght Polymorphism (RFLP of the amplification products 16S rRNA-PCR-RFLP, LipL32-PCR and OmpL1-PCR. In this study, for L. interrogans, the specificity and sensitivity rates of the 16S rRNA-PCR and the LipL32-PCR were considered similar (100% versus 98.25% and 100% versus 98.68%, respectively. The OmpL1-PCR was able to classify L. interrogans into two intergroups, but this PCR was less sensitive (87.01% than the other two PCR methods. The 16S rRNA-PCR-RFLP could detect L. biflexa DNA, but LipL32-PCR and OmpL1-PCR could not. The 16S rRNA-PCR-RFLP provided an early and accurate diagnosis and was able to distinguish pathogenic and non-pathogenic Leptospira species, hence it may be used as an alternative method to the conventional gold standard techniques for the rapid disgnosis of leptospirosis.
A methodology for extending domain coverage in SemRep.
Rosemblat, Graciela; Shin, Dongwook; Kilicoglu, Halil; Sneiderman, Charles; Rindflesch, Thomas C
2013-12-01
We describe a domain-independent methodology to extend SemRep coverage beyond the biomedical domain. SemRep, a natural language processing application originally designed for biomedical texts, uses the knowledge sources provided by the Unified Medical Language System (UMLS©). Ontological and terminological extensions to the system are needed in order to support other areas of knowledge. We extended SemRep's application by developing a semantic representation of a previously unsupported domain. This was achieved by adapting well-known ontology engineering phases and integrating them with the UMLS knowledge sources on which SemRep crucially depends. While the process to extend SemRep coverage has been successfully applied in earlier projects, this paper presents in detail the step-wise approach we followed and the mechanisms implemented. A case study in the field of medical informatics illustrates how the ontology engineering phases have been adapted for optimal integration with the UMLS. We provide qualitative and quantitative results, which indicate the validity and usefulness of our methodology. Published by Elsevier Inc.
Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang
2017-04-01
Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for
[Interpretative method as a synthesis of explicative, teleologic and analogic models].
Yáñez Cortés, R
1980-06-01
To establish the basis of the interpretative method is congruous with finding a solid basis--epistemologically speaking--to the analytic theory. This basis would be the means to transform this theory into a real science with its necessary adecuation among method, act and object of knowledge. It is only from a scientific stand that the psychoanalytic theory will be able to face successfully the reductionisms that menace it, be it the biologist-naturalism with its explanations of the psychic phenomena by means of mechanisms and biologic models or be it the speculative ideologies with their nucleus of technical praxis which make it impossible for the social-factic sciences to become real sciences. We propose as interpretative method the union of two models: the teleologic one which makes possible the appearance of intelligible, contingent and variable explanations between an antecedent and a consequent on one side, and on the other, the analogic model with its two moments: the comparative and the symbolic one. These moments makes possible the comparison and the union between antecedent and consequent baring in mind the "natural" ambiguity of the subject-object in question. The principal objective of the method--as a regulative idea in the Kantian sense--would be the search of univocity as regards the choice of one and only one sense from all the possible senses that "explain" the motive relationship or motive-end relationship in order to make the interpretation scientific. This status of scientificity should obey the rules of explanation: that the interpretations be derived effectively from the presupposed theory, that they really explain what they claim to explain, that they are not contradictory or contrary in the same ontologic level. We postulate that the synthesis of the two mentioned models, the teleologic-explanative and the analogic one allows us to find a possibility to make clear the "dark" sense of the noun interpretation and in this way the factibility of
Evaluation of PCR methods for detection of Brucella strains from culture and tissues.
Çiftci, Alper; İça, Tuba; Savaşan, Serap; Sareyyüpoğlu, Barış; Akan, Mehmet; Diker, Kadir Serdar
2017-04-01
The genus Brucella causes significant economic losses due to infertility, abortion, stillbirth or weak calves, and neonatal mortality in livestock. Brucellosis is still a zoonosis of public health importance worldwide. The study was aimed to optimize and evaluate PCR assays used for the diagnosis of Brucella infections. For this aim, several primers and PCR protocols were performed and compared with Brucella cultures and biological material inoculated with Brucella. In PCR assays, genus- or species-specific oligonucleotide primers derived from 16S rRNA sequences (F4/R2, Ba148/928, IS711, BruP6-P7) and OMPs (JPF/JPR, 31ter/sd) of Brucella were used. All primers except for BruP6-P7 detected the DNA from reference Brucella strains and field isolates. In spiked blood, milk, and semen samples, F4-R2 primer-oriented PCR assays detected minimal numbers of Brucella. In spiked serum and fetal stomach content, Ba148/928 primer-oriented PCR assays detected minimal numbers of Brucella. Field samples collected from sheep and cattle were examined by bacteriological methods and optimized PCR assays. Overall, sensitivity of PCR assays was found superior to conventional bacteriological isolation. Brucella DNA was detected in 35.1, 1.1, 24.8, 5.0, and 8.0% of aborted fetus, blood, milk, semen, and serum samples by PCR assays, respectively. In conclusion, PCR assay in optimized conditions was found to be valuable in sensitive and specific detection of Brucella infections of animals.
Barnes-Holmes, Dermot; Regan, Donal; Barnes-Holmes, Yvonne; Commins, Sean; Walsh, Derek; Stewart, Ian; Smeets, Paul M.; Whelan, Robert; Dymond, Simon
2005-01-01
The current study aimed to test a Relational Frame Theory (RFT) model of analogical reasoning based on the relating of derived same and derived difference relations. Experiment 1 recorded reaction time measures of similar-similar (e.g., "apple is to orange as dog is to cat") versus different-different (e.g., "he is to his brother as…
[Optimized application of nested PCR method for detection of malaria].
Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C
2017-04-28
Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.
High resolution tomography using analog coding
International Nuclear Information System (INIS)
Brownell, G.L.; Burnham, C.A.; Chesler, D.A.
1985-01-01
As part of a 30-year program in the development of positron instrumentation, the authors have developed a high resolution bismuth germanate (BGO) ring tomography (PCR) employing 360 detectors and 90 photomultiplier tubes for one plane. The detectors are shaped as trapezoid and are 4 mm wide at the front end. When assembled, they form an essentially continuous cylindrical detector. Light from a scintillation in the detector is viewed through a cylindrical light pipe by the photomultiplier tubes. By use of an analog coding scheme, the detector emitting light is identified from the phototube signals. In effect, each phototube can identify four crystals. PCR is designed as a static device and does not use interpolative motion. This results in considerable advantage when performing dynamic studies. PCR is the positron tomography analog of the γ-camera widely used in nuclear medicine
Altınel, Ahmet
2017-01-01
Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256
[A new method of processing quantitative PCR data].
Ke, Bing-Shen; Li, Guang-Yun; Chen, Shi-Min; Huang, Xiang-Yan; Chen, Ying-Jian; Xu, Jun
2003-05-01
Today standard PCR can't satisfy the need of biotechnique development and clinical research any more. After numerous dynamic research, PE company found there is a linear relation between initial template number and cycling time when the accumulating fluorescent product is detectable.Therefore,they developed a quantitative PCR technique to be used in PE7700 and PE5700. But the error of this technique is too great to satisfy the need of biotechnique development and clinical research. A better quantitative PCR technique is needed. The mathematical model submitted here is combined with the achievement of relative science,and based on the PCR principle and careful analysis of molecular relationship of main members in PCR reaction system. This model describes the function relation between product quantity or fluorescence intensity and initial template number and other reaction conditions, and can reflect the accumulating rule of PCR product molecule accurately. Accurate quantitative PCR analysis can be made use this function relation. Accumulated PCR product quantity can be obtained from initial template number. Using this model to do quantitative PCR analysis,result error is only related to the accuracy of fluorescence intensity or the instrument used. For an example, when the fluorescence intensity is accurate to 6 digits and the template size is between 100 to 1,000,000, the quantitative result accuracy will be more than 99%. The difference of result error is distinct using same condition,same instrument but different analysis method. Moreover,if the PCR quantitative analysis system is used to process data, it will get result 80 times of accuracy than using CT method.
International Nuclear Information System (INIS)
Sudrajat, Dadang; R, Maria Lina; Suhadi, F.
2000-01-01
A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment
DNA extraction method for PCR in mycorrhizal fungi.
Manian, S; Sreenivasaprasad, S; Mills, P R
2001-10-01
To develop a simple and rapid DNA extraction protocol for PCR in mycorrhizal fungi. The protocol combines the application of rapid freezing and boiling cycles and passage of the extracts through DNA purification columns. PCR amplifiable DNA was obtained from a number of endo- and ecto-mycorrhizal fungi using minute quantities of spores and mycelium, respectively. DNA extracted following the method, was used to successfully amplify regions of interest from high as well as low copy number genes. The amplicons were suitable for further downstream applications such as sequencing and PCR-RFLPs. The protocol described is simple, short and facilitates rapid isolation of PCR amplifiable genomic DNA from a large number of fungal isolates in a single day. The method requires only minute quantities of starting material and is suitable for mycorrhizal fungi as well as a range of other fungi.
DNA structure modulates the oligomerization properties of the AAV initiator protein Rep68.
Directory of Open Access Journals (Sweden)
Jorge Mansilla-Soto
2009-07-01
Full Text Available Rep68 is a multifunctional protein of the adeno-associated virus (AAV, a parvovirus that is mostly known for its promise as a gene therapy vector. In addition to its role as initiator in viral DNA replication, Rep68 is essential for site-specific integration of the AAV genome into human chromosome 19. Rep68 is a member of the superfamily 3 (SF3 helicases, along with the well-studied initiator proteins simian virus 40 large T antigen (SV40-LTag and bovine papillomavirus (BPV E1. Structurally, SF3 helicases share two domains, a DNA origin interaction domain (OID and an AAA(+ motor domain. The AAA(+ motor domain is also a structural feature of cellular initiators and it functions as a platform for initiator oligomerization. Here, we studied Rep68 oligomerization in vitro in the presence of different DNA substrates using a variety of biophysical techniques and cryo-EM. We found that a dsDNA region of the AAV origin promotes the formation of a complex containing five Rep68 subunits. Interestingly, non-specific ssDNA promotes the formation of a double-ring Rep68, a known structure formed by the LTag and E1 initiator proteins. The Rep68 ring symmetry is 8-fold, thus differing from the hexameric rings formed by the other SF3 helicases. However, similiar to LTag and E1, Rep68 rings are oriented head-to-head, suggesting that DNA unwinding by the complex proceeds bidirectionally. This novel Rep68 quaternary structure requires both the DNA binding and AAA(+ domains, indicating cooperativity between these regions during oligomerization in vitro. Our study clearly demonstrates that Rep68 can oligomerize through two distinct oligomerization pathways, which depend on both the DNA structure and cooperativity of Rep68 domains. These findings provide insight into the dynamics and oligomeric adaptability of Rep68 and serve as a step towards understanding the role of this multifunctional protein during AAV DNA replication and site-specific integration.
PCR IN TRAUMATOLOGY AND ORTHOPAEDICS: METHOD DESCRIPTION AND APPLICABILITY
Directory of Open Access Journals (Sweden)
E. M. Polyakova
2014-01-01
Full Text Available Review brief presents description of polymerase chain reaction method (PCR and its most common variants. Three PCR-based lines of research, carried out in the traumatology and orthopaedics, include identifying a causative agents of the implant-associated infection after orthopaedic surgery; detection of antibiotic resistance genes and biofilm forming genes. It was shown that PCR can be used as additional method for detection of genetic disorders, significant for traumatology and orthopaedics, and for investigation of cartilage and bone regeneration.
Utshitsja drug u druga / Mailis Reps
Reps, Mailis, 1975-
2005-01-01
Haridus- ja teadusminister Mailis Reps uuendustest koolide õppekavades, õpetajate täienduskoolituse tähtsusest, kutsehariduse arengust, tasuta toitlustamisest põhi- ja kutsekoolides, õpetajate palkadest
Dukic, Maja; Todorov, Vencislav; Andany, Santiago; Nievergelt, Adrian P.; Yang, Chen; Hosseini, Nahid; Fantner, Georg E.
2017-12-01
Nearly all scanning probe microscopes (SPMs) contain a feedback controller, which is used to move the scanner in the direction of the z-axis in order to maintain a constant setpoint based on the tip-sample interaction. The most frequently used feedback controller in SPMs is the proportional-integral (PI) controller. The bandwidth of the PI controller presents one of the speed limiting factors in high-speed SPMs, where higher bandwidths enable faster scanning speeds and higher imaging resolution. Most SPM systems use digital signal processor-based PI feedback controllers, which require analog-to-digital and digital-to-analog converters. These converters introduce additional feedback delays which limit the achievable imaging speed and resolution. In this paper, we present a digitally controlled analog proportional-integral-derivative (PID) controller. The controller implementation allows tunability of the PID gains over a large amplification and frequency range, while also providing precise control of the system and reproducibility of the gain parameters. By using the analog PID controller, we were able to perform successful atomic force microscopy imaging of a standard silicon calibration grating at line rates up to several kHz.
RiskREP: Risk-Based Security Requirements Elicitation and Prioritization
Herrmann, Andrea; Morali, A.; Etalle, Sandro; Wieringa, Roelf J.; Niedrite, Laila; Strazdina, Renate; Wangler, Benkt
2011-01-01
Companies are under pressure to be in control of their assets but at the same time they must operate as efficiently as possible. This means that they aim to implement “good-enough security‿ but need to be able to justify their security investment plans. In this paper, we present a Risk-Based Requirements Prioritization method (RiskREP) that extends misuse case-based methods with IT architecture based risk assessment and countermeasure definition and prioritization. Countermeasure prioritizati...
LENUS (Irish Health Repository)
Solomon, K
2011-08-01
A repetitive-extragenic palindromic PCR (rep-PCR) subtyping method (DiversiLab) in conjunction with ribotyping, toxinotyping and antimicrobial-susceptibility testing was used to detect subtypes within Clostridium difficile ribotypes 027 and 078. Clinical isolates of ribotypes 027 (toxinotype III) (n = 30) and 078 (toxinotype V) (n = 23) were provided by health-care facilities across the Republic of Ireland over 2 months in 2006 and 1 month in 2009. Ribotype 027 isolates were significantly more related to each other (9 different subtype profiles) when compared to ribotype 078 isolates (14 different profiles) (P = 0.001; cut-off >90 % similarity). Almost half of ribotype 078 isolates (45.5 %) showed no relationship to each other. The clonality of ribotype 027 isolates suggests effective adaptation to the human niche, whereas the considerable genetic diversity within ribotype 078 isolates suggests that they may have originated from a variety of sources. Subtyping correlated well with antimicrobial susceptibility, in particular clindamycin susceptibility for ribotype 027, but diverse antimicrobial-susceptibility profiles were seen in ribotype 078 isolates, even within a single health-care facility. Between 2006 and 2009, a change in the predominant subtype of ribotype 027 was seen, with the recent clone representing half of all ribotype 027 isolates studied. This strain exhibited 89 % similarity to a rep-PCR profile of the North American NAP-1 strain.
McMahon, Tanis C; Blais, Burton W; Wong, Alex; Carrillo, Catherine D
2017-01-01
Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin ( stx ) and intimin ( eae )]. However, false positives arise when complex food matrices, such as beef, contain mixtures of eae -negative STEC and eae -positive E. coli , but no EHEC with both markers in a single cell. To reduce false-positive detection of EHEC in food enrichment samples, a Multiplexed, Single Intact Cell droplet digital PCR (MuSIC ddPCR) assay capable of detecting the co-occurrence of the stx and eae genes in a single bacterial cell was developed. This method requires: (1) dispersal of intact bacteria into droplets; (2) release of genomic DNA (gDNA) by heat lysis; and (3) amplification and detection of genetic targets ( stx and eae ) using standard TaqMan chemistries with ddPCR. Performance of the method was tested with panels of EHEC and non-target E. coli . By determining the linkage (i.e., the proportion of droplets in which stx and eae targets were both amplified), samples containing EHEC (typically greater than 20% linkage) could be distinguished from samples containing mixtures of eae -negative STEC and eae -positive E. coli (0-2% linkage). The use of intact cells was necessary as this linkage was not observed with gDNA extracts. EHEC could be accurately identified in enrichment broth cultures containing excess amounts of background E. coli and in enrichment cultures derived from ground beef/pork and leafy-green produce samples. To our knowledge, this is the first report of dual-target detection in single bacterial cells using ddPCR. The application of MuSIC ddPCR to enrichment-culture screening would reduce false-positives, thereby improving the cost, speed, and
RiskREP: Risk-Based Security Requirements Elicitation and Prioritization (extended version)
Herrmann, Andrea; Morali, A.
2010-01-01
Today, companies are required to be in control of the security of their IT assets. This is especially challenging in the presence of limited budgets and conflicting requirements. Here, we present Risk-Based Requirements Elicitation and Prioritization (RiskREP), a method for managing IT security
International Nuclear Information System (INIS)
Pavelic, J.
1996-07-01
Testing for the presence of hepatitis C virus (HCV) in blood derivatives used in clinical medicine is important to ensure the safety of such preparations. A reliable and reproducible method is described for the isolation of HCV RNA, subsequent reverse transcription and nested polymerase chain reaction (PCR) from blood derivatives. Of 17 batches of blood derivatives (14 negative for anti-HCV and 3 of unknown anti-HCV status) five were found to be positive in the nested PCR. (author). 4 refs, 3 figs, 1 tab
International Nuclear Information System (INIS)
Li Zengi; Brister, J. Rodney; Im, Dong-Soo; Muzyczka, Nicholas
2003-01-01
Interaction between the adenoassociated virus (AAV) replication proteins, Rep68 and 78, and the viral terminal repeats (TRs) is mediated by a DNA sequence termed the Rep-binding element (RBE). This element is necessary for Rep-mediated unwinding of duplex DNA substrates, directs Rep catalyzed cleavage of the AAV origin of DNA replication, and is required for viral transcription and proviral integration. Six discrete Rep complexes with the AAV TR substrates have been observed in vitro, and cross-linking studies suggest these complexes contain one to six molecules of Rep. However, the functional relationship between Rep oligomerization and biochemical activity is unclear. Here we have characterized Rep complexes that form on the AAV TR. Both Rep68 and Rep78 appear to form the same six complexes with the AAV TR, and ATP seems to stimulate formation of specific, higher order complexes. When the sizes of these Rep complexes were estimated on native polyacrylamide gels, the four slower migrating complexes were larger than predicted by an amount equivalent to one or two TRs. To resolve this discrepancy, the molar ratio of protein and DNA was calculated for the three largest complexes. Data from these experiments indicated that the larger complexes included multiple TRs in addition to multiple Rep molecules and that the Rep-to-TR ratio was approximately 2. The two largest complexes were also associated with increased Rep-mediated, origin cleavage activity. Finally, we characterized a second, Rep-mediated cleavage event that occurs adjacent to the normal nicking site, but on the opposite strand. This second site nicking event effectively results in double-stranded DNA cleavage at the normal nicking site
Greenspoon, S A; Sykes, K L V; Ban, J D; Pollard, A; Baisden, M; Farr, M; Graham, N; Collins, B L; Green, M M; Christenson, C C
2006-12-20
Human genome, pharmaceutical and research laboratories have long enjoyed the application of robotics to performing repetitive laboratory tasks. However, the utilization of robotics in forensic laboratories for processing casework samples is relatively new and poses particular challenges. Since the quantity and quality (a mixture versus a single source sample, the level of degradation, the presence of PCR inhibitors) of the DNA contained within a casework sample is unknown, particular attention must be paid to procedural susceptibility to contamination, as well as DNA yield, especially as it pertains to samples with little biological material. The Virginia Department of Forensic Science (VDFS) has successfully automated forensic casework DNA extraction utilizing the DNA IQ(trade mark) System in conjunction with the Biomek 2000 Automation Workstation. Human DNA quantitation is also performed in a near complete automated fashion utilizing the AluQuant Human DNA Quantitation System and the Biomek 2000 Automation Workstation. Recently, the PCR setup for casework samples has been automated, employing the Biomek 2000 Automation Workstation and Normalization Wizard, Genetic Identity version, which utilizes the quantitation data, imported into the software, to create a customized automated method for DNA dilution, unique to that plate of DNA samples. The PCR Setup software method, used in conjunction with the Normalization Wizard method and written for the Biomek 2000, functions to mix the diluted DNA samples, transfer the PCR master mix, and transfer the diluted DNA samples to PCR amplification tubes. Once the process is complete, the DNA extracts, still on the deck of the robot in PCR amplification strip tubes, are transferred to pre-labeled 1.5 mL tubes for long-term storage using an automated method. The automation of these steps in the process of forensic DNA casework analysis has been accomplished by performing extensive optimization, validation and testing of the
Reynolds analogy for subcooled surface boiling under forced convection
International Nuclear Information System (INIS)
Avdeev, A.A.
1982-01-01
For the case of subcooled surface boiling under forced convection the analytic expression of analogy between the heat transfer and carry pulse (Reynolds analogy) is derived. It is concluded that the obtained dependence creates the basis for solution of a series of problems of surface boiling physics. On the basis of the performed analysis the method of coordinate calculation of the origin of intensive vapour generation is developed and the formula for calculation of the broken-off-bubble radius under forced convection is derived [ru
Identification and Characterization of the Novel p97 co-factors, Rep8 and ASPL
DEFF Research Database (Denmark)
Klausen, Louise Kjær
to the ER membrane with the UBX domain situated in the cytosol. Mouse Rep8 is highly tissue-specific and abundant in gonads. In tests, Rep8 is expressed in post-meiotic round spermatids, whereas in ovaries Rep8 is expressed in granulosa cells. Additional precipitation experiments revealed that Rep8......The highly conserved and ubiquitin-specific AAA ATPase p97 acts on ubiquitylated substrates in diverse cellular mechanisms such as chromatin-associated degradation, fusion of homotypic membranes and ER-associated degradation. Different p97 cofactors associate with the ATPase, thereby constituting...... that ASPL localizes to the ER membrane and in vitro ASPL leads to disassembly of the p97 hexameric ATPase. Rep8 was found to interact with p97 both in vitro and in vivo, and the binding was mediated through the N-domain of p97 and the UBX domain of Rep8. Localization studies showed that Rep8 localizes...
Yamada, Kazuhiro; Ibata, Ami; Suzuki, Masahiro; Matsumoto, Masakado; Yamashita, Teruo; Minagawa, Hiroko; Kurane, Ryuichiro
2015-01-01
Campylobacter jejuni is responsible for the majority of Campylobacter infections. As the molecular epidemiological study of outbreaks, pulsed-field gel electrophoresis (PFGE) is performed in general. But PFGE has several problems. PCR binary typing (P-BIT) method is a typing method for Campylobacter spp. that was recently developed, and was reported to have a similar discriminatory power and stability to those of PFGE. We modified the P-BIT method from 18 monoplex PCRs to two multiplex PCR systems (mP-BIT). The same results were obtained from monoplex PCRs using original primers and multiplex PCR in the representative isolates. The mP-BIT can analyze 48 strains at a time by using 96-well PCR systems and can identify C. jejuni because mP-BIT includes C. jejuni marker. The typing of the isolates by the mP-BIT and PFGE demonstrated generally concordant results and the mP-BIT method (D = 0.980) has a similar discriminatory power to that of PFGE with SmaI digest (D = 0.975) or KpnI digest (D = 0.987) as with original article. The mP-BIT method is quick, simple and easy, and comes to be able to perform it at low cost by having become a multiplex PCR system. Therefore, the mP-BIT method with two multiplex PCR systems has high potential for a rapid first-line surveillance typing assay of C. jejuni and can be used for routine surveillance and outbreak investigations of C. jejuni in the future. Copyright © 2014 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Blood grouping based on PCR methods and agarose gel electrophoresis.
Sell, Ana Maria; Visentainer, Jeane Eliete Laguila
2015-01-01
The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.
Comparison of Nested-PCR technique and culture method in ...
African Journals Online (AJOL)
USER
2010-04-05
Apr 5, 2010 ... Full Length Research Paper. Comparison of ... The aim of the present study was to evaluate the diagnostic value of nested PCR in genitourinary ... method. Based on obtained results, the positivity rate of urine samples in this study was 5.0% by using culture and PCR methods and 2.5% for acid fast staining.
3D printing with RepRap cookbook
Salinas, Richard
2014-01-01
A systematic guide consisting of over 100 recipes which focus on helping you understand the process of 3D printing using RepRap machines. The book aims at providing professionals with a series of working recipes to help make their fuzzy notions into real, saleable projects/objects using 3D printing technology. This book is for novice designers and artists who own a RepRap-based 3D printer, have fundamental knowledge of its working, and who desire to gain better mastery of the printing process. For the more experienced user, it will provide a handy visual resource, with side-by-side comparisons
Regulation and drive system for high rep-rate magnetic-pulse compressors
International Nuclear Information System (INIS)
Birx, D.L.; Cook, E.G.; Hawkins, S.; Meyers, A.; Reginato, L.L.; Schmidt, J.A.; Smith, M.W.
1982-01-01
The essentially unlimited rep-rate capability of non-linear magnetic systems has imposed strict requirements on the drive system which initiates the pulse compression. An order of magnitude increase in the rep-rates achieved by the Advanced Test Accelerator (ATA) gas blown system is not difficult to achieve in the magnetic compressor. The added requirement of having a high degree of regulation at the higher rep-rates places strict requirements on the triggerable switch for charging and de-Queing. A novel feedback technique which applies the proper bias to a magnetic core by comparing a reference voltage to the charging voltage eases considerably the regulation required to achieve low jitter in magnetic compression. The performance of the high rep-rate charging and regulation systems will be described in the following pages
Deformable M-Reps for 3D Medical Image Segmentation
Pizer, Stephen M.; Fletcher, P. Thomas; Joshi, Sarang; Thall, Andrew; Chen, James Z.; Fridman, Yonatan; Fritsch, Daniel S.; Gash, Graham; Glotzer, John M.; Jiroutek, Michael R.; Lu, Conglin; Muller, Keith E.; Tracton, Gregg; Yushkevich, Paul; Chaney, Edward L.
2013-01-01
M-reps (formerly called DSLs) are a multiscale medial means for modeling and rendering 3D solid geometry. They are particularly well suited to model anatomic objects and in particular to capture prior geometric information effectively in deformable models segmentation approaches. The representation is based on figural models, which define objects at coarse scale by a hierarchy of figures – each figure generally a slab representing a solid region and its boundary simultaneously. This paper focuses on the use of single figure models to segment objects of relatively simple structure. A single figure is a sheet of medial atoms, which is interpolated from the model formed by a net, i.e., a mesh or chain, of medial atoms (hence the name m-reps), each atom modeling a solid region via not only a position and a width but also a local figural frame giving figural directions and an object angle between opposing, corresponding positions on the boundary implied by the m-rep. The special capability of an m-rep is to provide spatial and orientational correspondence between an object in two different states of deformation. This ability is central to effective measurement of both geometric typicality and geometry to image match, the two terms of the objective function optimized in segmentation by deformable models. The other ability of m-reps central to effective segmentation is their ability to support segmentation at multiple levels of scale, with successively finer precision. Objects modeled by single figures are segmented first by a similarity transform augmented by object elongation, then by adjustment of each medial atom, and finally by displacing a dense sampling of the m-rep implied boundary. While these models and approaches also exist in 2D, we focus on 3D objects. The segmentation of the kidney from CT and the hippocampus from MRI serve as the major examples in this paper. The accuracy of segmentation as compared to manual, slice-by-slice segmentation is reported. PMID
A simple method of digitizing analog scintigrams for quantification and digital archiving
International Nuclear Information System (INIS)
Schramm, M.; Kaempfer, B.; Wolf, H.; Clausen, M.; Wendhausen, H.; Henze, E.
1993-01-01
This study was undertaken to evaluate a quick, reliable and cheap method of digitizing analog scintigrams. 40 whole-body bone scintigrams were obtained simultaneously in analog and genuine digital format. The analog scans on X-ray film were then digitized seecondarily by three different methods: 300 dpi flatbed scanning, high-resolution camera scanning and camcorder recording. A simple exposure approach using a light box, a cheap camcorder, a PC and image grabber hard- and software proved to be optimal. Visual interpretation showed no differences in clinical findings when comparing the analog images with their secondarily digitized counterparts. To test the possibility of quantification, 126 equivalent ROIs were drawn both in the genuine digital and the secondarily digitized images. Comparing the ROI count to whole-body count percentage of the corresponding ROIs showed the correlation to be linear. The evaluation of phantom studies showed the linear correlation to be true within a wide activity range. Thus, secondary digitalization of analog scintigrams is an easy, cheap and reliable method of archiving images and allows secondary digital quantification. (orig.) [de
[A simple method of digitizing analog scintigrams for quantification and digital archiving].
Schramm, M; Kämpfer, B; Wolf, H; Clausen, M; Wendhausen, H; Henze, E
1993-02-01
This study was undertaken to evaluate a quick, reliable and cheap method of digitizing analog scintigrams. 40 whole-body bone scintigrams were obtained simultaneously in analog and genuine digital format. The analog scans on x-ray film were then digitized secondarily by three different methods: 300 dpi flat-bed scanning, high-resolution camera scanning and camcorder recording. A simple exposure approach using a light box, a cheap camcorder, a PC and image grabber hard- and software proved to be optimal. Visual interpretation showed no differences in clinical findings when comparing the analog images with their secondarily digitized counterparts. To test the possibility of quantification, 126 equivalent ROIs were drawn both in the genuine digital and the secondarily digitized images. Comparing the ROI count to whole-body count percentage of the corresponding ROIs showed the correlation to be linear. The evaluation of phantom studies showed the linear correlation to be true within a wide activity range. Thus, secondary digitalization of analog scintigrams is an easy, cheap and reliable method of archiving images and allows secondary digital quantification.
Ramazanzadeh, Rashid; Rouhi, Samaneh; Shakib, Pegah; Shahbazi, Babak; Bidarpour, Farzam; Karimi, Mohammad
2015-05-01
Vibrio cholerae causes diarrhoeal disease that afflicts thousands of people annually. V. cholerae is classified on the basis of somatic antigens into serovars or serogroups and there are at least 200 known serogroup. Two serogroups, O1 and O139 have been associated with epidemic diseases. Virulence genes of these bacteria are OmpW, ctxA and tcpA. Due to the importance of V. cholerae infection and developing molecular diagnostics of this organism in medical and microbiology sciences, this study aimed to describe molecular characterization of V. cholerae isolated from clinical samples using a molecular method. In this study, 48 samples were provided during summer 2013 (late August and early September) by reference laboratory. Samples were assessed using biochemical tests initially. The primer of OmpW, ctxA and tcpA genes was used in Polymerase Chain Reaction (PCR) protocols. Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR and Repetitive Extragenic Palindromic (REP)-PCR methods were used to subtype V. cholerae. In this study, from a total of 48 clinical stool samples 39 (81.2 %) were positive for V. cholerae in biochemical tests and bacteria culture tests. The PCR results showed that of 39 positive isolates 35 (89.7%), 34 (87.1%) and 37 (94.8%) were positive for ctxA, tcpA and OmpW gene, respectively. Also, in the REP-PCR method with ERIC primer strains were divided into 10 groups. In the REP-PCR method with REP primer, strains were divided into 13 groups. Polymerase chain reaction has specificity and accuracy for identification of the organism and is able to differentiate biotypes. Enterobacterial repetitive intergenic consensus sequence is one of the informative and discriminative methods for the analysis of V. cholerae diversity. The REP-PCR is a less informative and discriminative method compared to other methods for the analysis of V. cholerae diversity.
Producing and Recognizing Analogical Relations
Lipkens, Regina; Hayes, Steven C
2009-01-01
Analogical reasoning is an important component of intelligent behavior, and a key test of any approach to human language and cognition. Only a limited amount of empirical work has been conducted from a behavior analytic point of view, most of that within Relational Frame Theory (RFT), which views analogy as a matter of deriving relations among relations. The present series of four studies expands previous work by exploring the applicability of this model of analogy to topography-based rather than merely selection-based responses and by extending the work into additional relations, including nonsymmetrical ones. In each of the four studies participants pretrained in contextual control over nonarbitrary stimulus relations of sameness and opposition, or of sameness, smaller than, and larger than, learned arbitrary stimulus relations in the presence of these relational cues and derived analogies involving directly trained relations and derived relations of mutual and combinatorial entailment, measured using a variety of productive and selection-based measures. In Experiment 1 participants successfully recognized analogies among stimulus networks containing same and opposite relations; in Experiment 2 analogy was successfully used to extend derived relations to pairs of novel stimuli; in Experiment 3 the procedure used in Experiment 1 was extended to nonsymmetrical comparative relations; in Experiment 4 the procedure used in Experiment 2 was extended to nonsymmetrical comparative relations. Although not every participant showed the effects predicted, overall the procedures occasioned relational responses consistent with an RFT account that have not yet been demonstrated in a behavior-analytic laboratory setting, including productive responding on the basis of analogies. PMID:19230515
Arora, Jasbir S; Oe, Tomoyuki; Blair, Ian A
2011-05-15
Lipid hydroperoxides undergo homolytic decomposition into the bifunctional 4-hydroxy-2( E )-nonenal and 4-oxo-2( E )-nonenal (ONE). These bifunctional electrophiles are highly reactive and can readily modify intracellular molecules including glutathione (GSH), deoxyribonucleic acid (DNA) and proteins. Lipid hydroperoxide-derived bifunctional electrophiles are thought to contribute to the pathogenesis of a number of diseases. ONE is an α , β -unsaturated aldehyde that can react in multiple ways and with glutathione, proteins and DNA. Heavy isotope-labeled analogs of ONE are not readily available for conducting mechanistic studies or for use as internal standards in mass spectrometry (MS)-based assays. An efficient onestep cost-effective method has been developed for the preparation of C-9 deuterium-labeled ONE. In addition, a method for specific deuterium labeling of ONE at C-2, C-3 or both C-2 and C-3 has been developed. This latter method involved the selective reduction of an intermediate alkyne either by lithium aluminum hydride or lithium aluminum deuteride and quenching with water or deuterium oxide. The availability of these heavy isotope analogs will be useful as internal standards for quantitative studies employing MS and for conducting mechanistic studies of complex interactions between ONE and DNA bases as well as between ONE and proximal amino acid residues in peptides and proteins.
Directory of Open Access Journals (Sweden)
Markus Spiliotis
Full Text Available Inverse fusion PCR cloning (IFPC is an easy, PCR based three-step cloning method that allows the seamless and directional insertion of PCR products into virtually all plasmids, this with a free choice of the insertion site. The PCR-derived inserts contain a vector-complementary 5'-end that allows a fusion with the vector by an overlap extension PCR, and the resulting amplified insert-vector fusions are then circularized by ligation prior transformation. A minimal amount of starting material is needed and experimental steps are reduced. Untreated circular plasmid, or alternatively bacteria containing the plasmid, can be used as templates for the insertion, and clean-up of the insert fragment is not urgently required. The whole cloning procedure can be performed within a minimal hands-on time and results in the generation of hundreds to ten-thousands of positive colonies, with a minimal background.
Empirical source strength correlations for rans-based acoustic analogy methods
Kube-McDowell, Matthew Tyndall
JeNo is a jet noise prediction code based on an acoustic analogy method developed by Mani, Gliebe, Balsa, and Khavaran. Using the flow predictions from a standard Reynolds-averaged Navier-Stokes computational fluid dynamics solver, JeNo predicts the overall sound pressure level and angular spectra for high-speed hot jets over a range of observer angles, with a processing time suitable for rapid design purposes. JeNo models the noise from hot jets as a combination of two types of noise sources; quadrupole sources dependent on velocity fluctuations, which represent the major noise of turbulent mixing, and dipole sources dependent on enthalpy fluctuations, which represent the effects of thermal variation. These two sources are modeled by JeNo as propagating independently into the far-field, with no cross-correlation at the observer location. However, high-fidelity computational fluid dynamics solutions demonstrate that this assumption is false. In this thesis, the theory, assumptions, and limitations of the JeNo code are briefly discussed, and a modification to the acoustic analogy method is proposed in which the cross-correlation of the two primary noise sources is allowed to vary with the speed of the jet and the observer location. As a proof-of-concept implementation, an empirical correlation correction function is derived from comparisons between JeNo's noise predictions and a set of experimental measurements taken for the Air Force Aero-Propulsion Laboratory. The empirical correlation correction is then applied to JeNo's predictions of a separate data set of hot jets tested at NASA's Glenn Research Center. Metrics are derived to measure the qualitative and quantitative performance of JeNo's acoustic predictions, and the empirical correction is shown to provide a quantitative improvement in the noise prediction at low observer angles with no freestream flow, and a qualitative improvement in the presence of freestream flow. However, the results also demonstrate
Usefulness of in-house PCR methods for hepatitis B virus DNA detection.
Portilho, Moyra Machado; Baptista, Marcia Leite; da Silva, Messias; de Sousa, Paulo Sérgio Fonseca; Lewis-Ximenez, Lia Laura; Lampe, Elisabeth; Villar, Livia Melo
2015-10-01
The aim of the present study was to evaluate the performance of three in-house PCR techniques for HBV DNA detection and compare it with commercial quantitative methods to evaluate the usefulness of in-house methods for HBV diagnosis. Three panels of HBsAg reactive sera samples were evaluated: (i) 50 samples were examined using three methods for in-house qualitative PCR and the Cobas Amplicor HBV Monitor Assay; (ii) 87 samples were assayed using in-house semi-nested PCR and the Cobas TaqMan HBV test; (iii) 11 serial samples obtained from 2 HBV-infected individuals were assayed using the Cobas Amplicor HBV test and semi-nested PCR. In panel I, HBV DNA was detected in 44 samples using the Cobas Amplicor HBV test, 42 samples using semi-nested PCR (90% concordance with Cobas Amplicor), 22 samples using PCR for the core gene (63.6% concordance) and 29 samples using single-round PCR for the pre-S/S gene (75% concordance). In panel II, HBV DNA was quantified in 78 of the 87 HBsAg reactive samples using Cobas TaqMan but 52 samples using semi-nested PCR (67.8% concordance). HBV DNA was detected in serial samples until the 17th and 26th week after first donation using in-house semi-nested PCR and the Cobas Amplicor HBV test, respectively. In-house semi-nested PCR presented adequate concordance with commercial methods as an alternative method for HBV molecular diagnosis in low-resource settings. Copyright © 2015 Elsevier B.V. All rights reserved.
Method for transmitting analog data over a fiber-optic link
International Nuclear Information System (INIS)
Dyer, G.R.
1981-01-01
The transmission of high-speed analog dat across an insulating break is a common requirement for present fusion experiments, and it will be a necessity for a reactor-like device. Presently available systems tend to be complex, slow, and expensive. A method is described for implementing a fiber-optic link with analog data input and output. Two realizations of the method are given. A medium-speed system using monolithic circuitry is capable of a dc to 20-KHz bandwidth with excellent linearity and a dynamic range of at least 60 dB. A higher-speed system uses some discrete circuitry to attain a 500-KHz bandwidth with at least a 40-dB dynamic range. Both systems use a relatively inexpensive digital optical link kit combined with a duty cycle modulation scheme for data tramsmission. This method achieves accurate reproduction of complex waveforms without introducing the quantization errors inherent in analog-to-digital conversion, offers bipolar response with low offset and drift, and maintains a constant bandwidth regardless of signal level
O ethos do repórter de TV da Rede Globo
Directory of Open Access Journals (Sweden)
Marcia Benetti
2017-05-01
Full Text Available O artigo analisa os elementos instituintes das imagens de si de repórteres de televisão da Rede Globo, maior emissora do Brasil. A partir do conceito de ethos discursivo, discutimos como o discurso autorreferente afirma a identidade do jornalista e certos efeitos de verdade a respeito da reportagem. Por meio da análise do discurso de cinco entrevistas de repórteres da Rede Globo concedidas à também jornalista Fátima Bernardes, propomos que o ethos do repórter constrói-se em três dimensões: os atributos do “bom jornalista”, as características do “bom repórter” e as particularidades de pertencimento ao campo jornalístico. Como articuladores do ethos, os valores morais e os aspectos relacionados às rotinas profissionais convocam a audiência a se conectar com certas definições sobre o jornalismo.
Images en mouvement stockage, repérage, indexation
Turner, James
1998-01-01
L'avènement puis la fusion des nouveaux modes de communication que sont l'informatique, les télécommunications et l'audiovisuel ont mis à la portée de tous une grande quantité d'images fixes et en mouvement dont la conservation et le repérage risquent de prendre des proportions démesurées. Le présent ouvrage veut offrir aux responsables de collection des repères pour aborder la problématique de l'indexation des images et faciliter l'accès des usagers à ces images.
Pourmand, Mohammad Reza; Yousefi, Masoud; Salami, Seyed Alireza; Amini, Mohsen
2014-01-01
Staphylococcus aureus causes a wide variety of infections worldwide. Methicillin-resistant S. aureus is one of most common causes of nosocomial and community acquired infections. The fluoroquinolones are an important class of antibiotics that used to treat infections caused by S. aureus. Today, a significant increase in the rate of ciprofloxacin resistance in methicillin-resistant S. aureus strains is concerning. The norA efflux pump is considered as contributors to antibiotic resistance. Here, we aimed to evaluate the expression of norA efflux pump in the presence of hexahydroquinoline derivative in methicillin and ciprofloxacin resistant S. aureus. We were determined minimum inhibitory concentration of ciprofloxacin and hexahydroquinoline derivative and their combination by broth microdilution method against ciprofloxacin resistant S. aureus. The expression of the norA efflux pump gene was evaluated by quantitative Real-time PCR. This study showed that minimum inhibitory concentrations of ciprofloxacin in the presence of hexahydroquinoline derivative in comparison to ciprofloxacin were decreased. Quantitative Real-time PCR identified the increased expression of norA efflux pump gene in methicillin and ciprofloxacin resistant S. aureus strain. The increased expression of norA efflux pump gene may have resulted in the effort of S. aureus to survive. The results showed that the hexahydroquinoline derivative enhanced the antibacterial effect of ciprofloxacin against methicillin and ciprofloxacin resistant S. aureus. Therefore, the derivatives may be used as inhibitors of antibiotic resistance for combination therapy.
Directory of Open Access Journals (Sweden)
Alam A
2002-01-01
Full Text Available Gonococcal infection remains still a major cause of morbidity among sexually active individuals. Diagnosis of the infection in a female case is more difficult than that in a male. This was a prospective study among 269 female commercial sex workers (CSWs to screen them for gonococcal infection, comparing the rapid method of identification of gonococci by polymerase chain reaction (PCR with the selective culture method. A total of 92 (34.2% CSWs were identified positive for Neisseria gonorrhoeae by combination of the two methods. The PCR method identified 87 of the specimens to harbour cppB gene of N. gonorrhoeae, whereas culture method identified 83 specimens showing colonies of gonococci. Taking into consideration of the total positive cases (92, the PCR method showed a sensitivity of 94.57%, whereas sensitivity of culture method was 90.22%. The selective culture method appears to be the most applicable in the identification of gonococci from clinical specimens, particularly in the less resourceful countries like Bangladesh.
Mailis Reips : Prezhde vsego neobhodimo natshat / Mailis Reps
Reps, Mailis, 1975-
2006-01-01
Haridusminister Mailis Reps kakskeelse hariduse vajalikkusest vene õppekeelega koolides, noorte keeleoskusest, eesti keele õpetamise kvaliteedist, õpetajate eesti keele oskusest, õppetöö kvaliteedist
Halal authenticity of gelatin using species-specific PCR.
Shabani, Hessam; Mehdizadeh, Mehrangiz; Mousavi, Seyed Mohammad; Dezfouli, Ehsan Ansari; Solgi, Tara; Khodaverdi, Mahdi; Rabiei, Maryam; Rastegar, Hossein; Alebouyeh, Mahmoud
2015-10-01
Consumption of food products derived from porcine sources is strictly prohibited in Islam. Gelatin, mostly derived from bovine and porcine sources, has many applications in the food and pharmaceutical industries. To ensure that food products comply with halal regulations, development of valid and reliable analytical methods is very much required. In this study, a species-specific polymerase chain reaction (PCR) assay using conserved regions of mitochondrial DNA (cytochrome b gene) was performed to evaluate the halal authenticity of gelatin. After isolation of DNA from gelatin powders with known origin, conventional PCR using species-specific primers was carried out on the extracted DNA. The amplified expected PCR products of 212 and 271 bp were observed for porcine and bovine gelatin, respectively. The sensitivity of the method was tested on binary gelatin mixtures containing 0.1%, 1%, 10%, and 100% (w/w) of porcine gelatin within bovine gelatin and vice versa. Although most of the DNA is degraded due to the severe processing steps of gelatin production, the minimum level of 0.1% w/w of both porcine and bovine gelatin was detected. Moreover, eight food products labeled as containing bovine gelatin and eight capsule shells were subjected to PCR examination. The results showed that all samples contained bovine gelatin, and the absence of porcine gelatin was verified. This method of species authenticity is very useful to verify whether gelatin and gelatin-containing food products are derived from halal ingredients. Copyright © 2015 Elsevier Ltd. All rights reserved.
Utility of PCR, Culture, and Antigen Detection Methods for Diagnosis of Legionellosis.
Chen, Derrick J; Procop, Gary W; Vogel, Sherilynn; Yen-Lieberman, Belinda; Richter, Sandra S
2015-11-01
The goal of this retrospective study was to evaluate the performance of different diagnostic tests for Legionnaires' disease in a clinical setting where Legionella pneumophila PCR had been introduced. Electronic medical records at the Cleveland Clinic were searched for Legionella urinary antigen (UAG), culture, and PCR tests ordered from March 2010 through December 2013. For cases where two or more test methods were performed and at least one was positive, the medical record was reviewed for relevant clinical and epidemiologic factors. Excluding repeat testing on a given patient, 19,912 tests were ordered (12,569 UAG, 3,747 cultures, and 3,596 PCR) with 378 positive results. The positivity rate for each method was 0.4% for culture, 0.8% for PCR, and 2.7% for UAG. For 37 patients, at least two test methods were performed with at least one positive result: 10 (27%) cases were positive by all three methods, 16 (43%) were positive by two methods, and 11 (30%) were positive by one method only. For the 32 patients with medical records available, clinical presentation was consistent with proven or probable Legionella infection in 84% of the cases. For those cases, the sensitivities of culture, PCR, and UAG were 50%, 92%, and 96%, respectively. The specificities were 100% for culture and 99.9% for PCR and UAG. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Study the Three Extraction Methods for HBV DNA to Use in PCR
Directory of Open Access Journals (Sweden)
N. Sheikh
2004-07-01
Full Text Available Diagnosis of Hepatitis B is important because of the its high prevalence. Recently PCR method , has found greater interest among different diagnostic methods. Several reports emphasis on some false negative results in those laboratories using PCR. The aim of this study was to compare three different procedures for HBV DNA extraction. A total 30 serum samples received from Shariati hospital. Sera was taken from patients having chronic Hepatitis with HBs antigen positive and HBe antigen negative. The sensitivity of guanidium hydrochloride method for extracting the HBV DNA from serum were evaluated and compared with phenol–chloroform and boiling methods. Diagnostic PCR kit was obtained from Cynagene contained taq polymerase, reaction mixture, dNTP, and buffer for reaction. A 353 bp product were amplified by amplification program provided in used PCR protocol. The comparison of results indicated that procedure was successful for amplification of the designed products from Hepatitis B in sera. Number of positive results were 16,19,23 and number of negative result were 14,11,7 for the boiling, phenol-chloroform and guanidium-hydrochloride extraction methods respectively.PCR method is the fastest diagnosis method and the most accurate procedure to identify Hepatitis B. Guanidium hydrochloride method was the most successful procedure studied in this survey for viruses.
Development of low-cost open source 3D gel printer "RepRap SWIM-ER"
Sato, Kei; Basher, Samiul; Ota, Takafumi; Tase, Taishi; Takamatsu, Kyuichiro; Saito, Azusa; Khosla, Ajit; Kawakami, Masaru; Furuawa, Hidemitsu
2017-04-01
Gels are soft and wet materials having low friction, good biocompatibility, and material permeability. It is expected that gel materials will be used as new kinds of industrial materials in the engineering and medical applications. But it cannot build a complicated shape. Soft & Wet Matter Engineering Laboratory developed a 3D gel Printer "SWIM-ER", has enabled modeling of complex shapes of the gel. However, this is expensive. Therefore not all of the gel researchers and the companies have such a device. To solve this problem, we manufacture a low-cost open-source 3D gel printer "RepRap SWIM-ER" from the RepRap. We made the components required to manufacture the "RepRap SWIM-ER" from the 3D printer and chose a light source. In addition, we produced the P-DN gel for RepRap SWIM-ER and conducted the molding test to confirm whether RepRap SWIM-ER can used it.
Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos
2015-10-22
Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.
Directory of Open Access Journals (Sweden)
Alex Galanis
2015-10-01
Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.
A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.
Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh
2015-06-01
Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.
Ganger, Michael T; Dietz, Geoffrey D; Ewing, Sarah J
2017-12-01
qPCR has established itself as the technique of choice for the quantification of gene expression. Procedures for conducting qPCR have received significant attention; however, more rigorous approaches to the statistical analysis of qPCR data are needed. Here we develop a mathematical model, termed the Common Base Method, for analysis of qPCR data based on threshold cycle values (C q ) and efficiencies of reactions (E). The Common Base Method keeps all calculations in the logscale as long as possible by working with log 10 (E) ∙ C q , which we call the efficiency-weighted C q value; subsequent statistical analyses are then applied in the logscale. We show how efficiency-weighted C q values may be analyzed using a simple paired or unpaired experimental design and develop blocking methods to help reduce unexplained variation. The Common Base Method has several advantages. It allows for the incorporation of well-specific efficiencies and multiple reference genes. The method does not necessitate the pairing of samples that must be performed using traditional analysis methods in order to calculate relative expression ratios. Our method is also simple enough to be implemented in any spreadsheet or statistical software without additional scripts or proprietary components.
Antonio, May A. D.; Hillier, Sharon L.
2003-01-01
Lactobacillus crispatus is one of the predominant hydrogen peroxide (H2O2)-producing species found in the vagina and is under development as a probiotic for the treatment of bacterial vaginosis. In this study, we assessed whether DNA fingerprinting by repetitive element sequence-based PCR (rep-PCR) can be used to distinguish the capsule strain of L. crispatus (CTV-05) from other endogenous strains as well as other species of vaginal lactobacilli. Vaginal and rectal lactobacilli were identifie...
DNA decontamination methods for internal quality management in clinical PCR laboratories.
Wu, Yingping; Wu, Jianyong; Zhang, Zhihui; Cheng, Chen
2018-03-01
The polymerase chain reaction (PCR) technique, one of the most commonly applied methods in diagnostic and molecular biology, has a frustrating downside: the occurrence of false-positive signals due to contamination. In previous research, various DNA decontamination methods have been developed to overcome this limitation. Unfortunately, the use of random or poorly focused sampling methods for monitoring air and/or object surfaces leads to the incomplete elimination during decontamination procedures. We herein attempted to develop a novel DNA decontamination method (environmental surveillance, including surface and air sampling) and quality management program for clinical molecular diagnostic laboratories (or clinical PCR laboratories). Here, we performed a step-by-step evaluation of current DNA decontamination methods and developed an effective procedure for assessing the presence of decontaminating DNA via PCR analysis. Performing targeted environmental surveillance by sampling, which reached optimal performance over 2 weeks, and the decontamination process had been verified as reliable. Additionally, the process was validated to not affect PCR amplification efficiency based on a comparative study. In this study, effective guidelines for DNA decontamination were developed. The method employed ensured that surface DNA contamination could be effectively identified and eliminated. Furthermore, our study highlighted the importance of overall quality assurance and good clinical laboratory practices for preventing contamination, which are key factors for compliance with regulatory or accreditation requirements. Taken together, we provided the evidence that the presented scheme ranged from troubleshooting to the elimination of surface contamination, could serve as critical foundation for developing regular environmental surveillance guidelines for PCR laboratories. © 2017 Wiley Periodicals, Inc.
Krych, Łukasz; Kot, Witold; Bendtsen, Katja M B; Hansen, Axel K; Vogensen, Finn K; Nielsen, Dennis S
2018-01-01
The Dextran Sulfate Sodium (DSS) induced colitis mouse model is commonly used to investigate human inflammatory bowel disease (IBD). Nucleic acid extracts originating from these animals are often contaminated with DSS, which is a strong inhibitor of many enzymatic based molecular biology reactions including PCR and reverse-transcription (RT). Methods for removing DSS from nucleic acids extracts exist for RNA, but no effective protocol for DNA or cDNA is currently available. However, spermine has previously been shown to be an effective agent for counteracting DSS inhibition of polynucleotide kinase, which led to the hypothesis, that spermine could be used to counteract DSS inhibition of PCR and RT. We investigated the means of adding spermine in an adequate concentration to PCR based protocols (including qPCR, two-step RT-qPCR, and amplicon sequencing library preparation) to remove DSS inhibition. Within the range up to 0.01g/L, spermine can be added to PCR/qPCR or RT prophylactically without a significant reduction of reaction efficiency. Addition of spermine at the concentration of 0.08g/L can be used to recover qualitative PCR signal inhibited by DSS in concentrations up to 0.32g/L. For optimal quantitative analysis, the concentration of spermine requires fine adjustment. Hence, we present here a simple fluorometric based method for adjusting the concentration of spermine ensuring an optimal efficiency of the reaction exposed to an unknown concentration of DSS. In conclusion, we demonstrate a cost effective and easy method to counteract DSS inhibition in PCR and two-step RT-qPCR. Fixed or fine-tuned concentrations of spermine can be administered depending on the qualitative or quantitative character of the analysis. Copyright © 2017 Elsevier B.V. All rights reserved.
Toledo, Víctor Fabio
2013-01-01
p. 33-34 En la actualidad se ha reavivado el debate en torno a los conceptos de Democracia y República. Desde el triunfo sobre el nazismo a mediados del siglo XX la democracia se ha constituido en un imperativo occidental y, a partir del derrumbe soviético, en uno cuasi universal. Sin embargo, en algunos casos —y no pocos por cierto— en el reclamo por la democratización se encontraron razones ideales para consagrar la concentración de los poderes del Estado, por paradójico que parezca. Es ...
Kletzel, Morris; Huang, Wei; Olszewski, Marie; Khan, Sana
2013-01-01
Post-hematopoietic stem cell transplantation (HSCT) chimerism monitoring is important to assess relapse and therapeutic intervention. The purpose of our study is to compare two methods variable number tandem repeats (VNTR) vs. quantitative real- time polymerase chain reaction (qPCR) in terms of determining chimerism. 127 (peripheral blood n=112, bone marrow n=15) samples were simultaneously tested by VNTR using APO-B, D1S80, D1S111, D17S30, gene loci SRY and ZP3 and qPCR using 34 assays (CA001-CA034) that are designed to a bi-allelic insertion/deletion (indel) polymorphism in the human genome. Samples were separated in three subsets: total WBC, T-cell and Myeloid cells. Extraction of DNA was performed then quantified. We analyzed column statistics, paired t-test and regression analysis for both methods. There was complete correlation between the two methods. The simplicity and rapidity of the test results from the qPCR method is more efficient and accurate to assess chimerism.
Directory of Open Access Journals (Sweden)
Fatemeh Dehghan
2014-11-01
Full Text Available Background: Detection of bacterial contamination in drinking water by culture method is a time and cost consuming method and spends a few days depending on contamination degree. However, the people use the tap water during that time. Molecular methods are rapid and sensitive. In this study a rapid Multiplex PCR method was used for rapid analysis both coliform bacteria and E.coli, and probable detection of VBNC bacteria in drinking water, the experiments were performed in bacteriological lab of water and Wastewater Corporation in Markazi province. Material and Methods:Amplification of a fragment from each of lacZ and uidA genes in a Multiplex PCR was used for detection of coliforms. Eight samples was taken from Arak drinking water system including 36 samples of wells, 41 samples of water distribution network and 3 samples from water storages were examined by amplification of lacZ and uidA genes in a Multiplex PCR. Equivalently, the MPN test was applied as a standard method for all samples for comparison of results. Standard bacteria, pure bacteria isolated from positive MPN and CRM were examined by PCR and MPN method. Results: The result of most samples water network, water storages, and water well were same in both MPN and PCR method .The results of standard bacteria and pure cultures of bacteria isolated from positive MPN and CRM confirmed the PCR method. Five samples were positive in PCR but negative in MPN method. Duration time of PCR was decreased about 105 min by changing the PCR program and electrophoreses factors. Conclusion: The Multiplex PCR can detect coliform bacteria and E.coli synchronous in drinking water.
Applications: REP-rate pulse power technology
International Nuclear Information System (INIS)
Anon.
1979-01-01
Research on the following topics is discussed: (1) REP-rate pulse power technology, (2) RTF-I, 300-J, 100-pps test facility experiments, (3) transformer development, (4) reactor system studies, (5) general conceptual design, (6) economic considerations, (7) specific reactor designs, (8) low-current density diode physics studies, and (9) plasma injected, microsecond, E-beam diodes
Teertstra, Wieke R.; van der Velden, Gisela J.; de Jong, Jan F.; Kruijtzer, John A. W.; Liskamp, Rob M. J.; Kroon-Batenburg, Loes M. J.; Muller, Wally H.; Gebbink, Martijn F. B. G.; Wosten, Han A. B.
2009-01-01
Repellents of the maize pathogen Ustilago maydis are involved in formation of hydrophobic aerial hyphae and in cellular attachment. These peptides, called Rep1-1 to Rep1-11, are encoded by the rep1 gene and result from cleavage of the precursor protein Rep1 during passage of the secretion pathway.
Seo, K H; Valentin-Bon, I E; Brackett, R E
2006-03-01
Salmonellosis caused by Salmonella Enteritidis (SE) is a significant cause of foodborne illnesses in the United States. Consumption of undercooked eggs and egg-containing products has been the primary risk factor for the disease. The importance of the bacterial enumeration technique has been enormously stressed because of the quantitative risk analysis of SE in shell eggs. Traditional enumeration methods mainly depend on slow and tedious most-probable-number (MPN) methods. Therefore, specific, sensitive, and rapid methods for SE quantitation are needed to collect sufficient data for risk assessment and food safety policy development. We previously developed a real-time quantitative PCR assay for the direct detection and enumeration of SE and, in this study, applied it to naturally contaminated ice cream samples with and without enrichment. The detection limit of the real-time PCR assay was determined with artificially inoculated ice cream. When applied to the direct detection and quantification of SE in ice cream, the real-time PCR assay was as sensitive as the conventional plate count method in frequency of detection. However, populations of SE derived from real-time quantitative PCR were approximately 1 log higher than provided by MPN and CFU values obtained by conventional culture methods. The detection and enumeration of SE in naturally contaminated ice cream can be completed in 3 h by this real-time PCR method, whereas the cultural enrichment method requires 5 to 7 days. A commercial immunoassay for the specific detection of SE was also included in the study. The real-time PCR assay proved to be a valuable tool that may be useful to the food industry in monitoring its processes to improve product quality and safety.
Detecting analogical resemblance without retrieving the source analogy.
Kostic, Bogdan; Cleary, Anne M; Severin, Kaye; Miller, Samuel W
2010-06-01
We examined whether people can detect analogical resemblance to an earlier experimental episode without being able to recall the experimental source of the analogical resemblance. We used four-word analogies (e.g., robin-nest/beaver-dam), in a variation of the recognition-without-cued-recall method (Cleary, 2004). Participants studied word pairs (e.g., robin-nest) and were shown new word pairs at test, half of which analogically related to studied word pairs (e.g., beaver-dam) and half of which did not. For each test pair, participants first attempted to recall an analogically similar pair from the study list. Then, regardless of whether successful recall occurred, participants were prompted to rate the familiarity of the test pair, which was said to indicate the likelihood that a pair that was analogically similar to the test pair had been studied. Across three experiments, participants demonstrated an ability to detect analogical resemblance without recalling the source analogy. Findings are discussed in terms of their potential relevance to the study of analogical reasoning and insight, as well as to the study of familiarity and recognition memory.
Evolution of REP diversity: a comparative study
Czech Academy of Sciences Publication Activity Database
Nunvář, Jaroslav; Lichá, I.; Schneider, Bohdan
2013-01-01
Roč. 14, č. 385 (2013) ISSN 1471-2164 R&D Projects: GA ČR GAP305/12/1801 Institutional research plan: CEZ:AV0Z50520701 Keywords : REP elements * Stenotrophomonas maltophilia * Pseudomonas fluorescens Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.041, year: 2013
Study of the Efficacy of Real Time-PCR Method for Amikacin Determination Using Microbial Assay
Directory of Open Access Journals (Sweden)
Farzaneh Lotfipour
2015-06-01
Full Text Available Purpose: Microbial assay is used to determine the potency of antibiotics and vitamins. In spite of its advantages like simplicity and easiness, and to reveal the slight changes in the molecules, the microbial assay suffers from significant limitations; these methods are of lower specificity, accuracy and sensitivity. The objective of the present study is to evaluate the efficacy of real time-PCR technique in comparison with turbidimetric method for microbial assay of amikacin. Methods: Microbial determination of amikacin by turbidimetric method was performed according to USP. Also amikacin concentrations were determined by microbial assay using taq-man quantitative PCR method. Standard curves in different concentration for both methods were plotted and method validation parameters of linearity, precision and accuracy were calculated using statistical procedures. Results: The RT-PCR method was linear in the wider concentration range (5.12 – 38.08 for RT-PCR versus 8.00 – 30.47 for turbidimetric method with a better correlation coefficient (0.976 for RT-PCR versus 0.958 for turbidimetric method. RT-PCR method with LOQ of 5.12 ng/ml was more sensitive than turbidimetric method with LOQ of 8.00 ng/ml and the former could detect and quantify low concentrations of amikacin. The results of accuracy and precision evaluation showed that the RT-PCR method was accurate and precise in all of the tested concentration. Conclusion: The RT-PCR method described here provided an accurate and precise technique for measurement of amikacin potency and it can be a candidate for microbial determination of the antibiotics with the same test organism.
ReRep: Computational detection of repetitive sequences in genome survey sequences (GSS
Directory of Open Access Journals (Sweden)
Alves-Ferreira Marcelo
2008-09-01
Full Text Available Abstract Background Genome survey sequences (GSS offer a preliminary global view of a genome since, unlike ESTs, they cover coding as well as non-coding DNA and include repetitive regions of the genome. A more precise estimation of the nature, quantity and variability of repetitive sequences very early in a genome sequencing project is of considerable importance, as such data strongly influence the estimation of genome coverage, library quality and progress in scaffold construction. Also, the elimination of repetitive sequences from the initial assembly process is important to avoid errors and unnecessary complexity. Repetitive sequences are also of interest in a variety of other studies, for instance as molecular markers. Results We designed and implemented a straightforward pipeline called ReRep, which combines bioinformatics tools for identifying repetitive structures in a GSS dataset. In a case study, we first applied the pipeline to a set of 970 GSSs, sequenced in our laboratory from the human pathogen Leishmania braziliensis, the causative agent of leishmaniosis, an important public health problem in Brazil. We also verified the applicability of ReRep to new sequencing technologies using a set of 454-reads of an Escheria coli. The behaviour of several parameters in the algorithm is evaluated and suggestions are made for tuning of the analysis. Conclusion The ReRep approach for identification of repetitive elements in GSS datasets proved to be straightforward and efficient. Several potential repetitive sequences were found in a L. braziliensis GSS dataset generated in our laboratory, and further validated by the analysis of a more complete genomic dataset from the EMBL and Sanger Centre databases. ReRep also identified most of the E. coli K12 repeats prior to assembly in an example dataset obtained by automated sequencing using 454 technology. The parameters controlling the algorithm behaved consistently and may be tuned to the properties
Patel, Divya A.; Shih, Yang-Jen; Newton, Duane W.; Michael, Claire W.; Oeth, Paul A.; Kane, Michael D.; Opipari, Anthony W.; Ruffin, Mack T.; Kalikin, Linda M.; Kurnit, David M.
2010-01-01
Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay. PMID:19410602
Patel, Divya A; Shih, Yang-Jen; Newton, Duane W; Michael, Claire W; Oeth, Paul A; Kane, Michael D; Opipari, Anthony W; Ruffin, Mack T; Kalikin, Linda M; Kurnit, David M
2009-09-01
Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High-Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay.
Rigotto, C; Sincero, T C M; Simões, C M O; Barardi, C R M
2005-01-01
We tested three PCR based methodologies to detect adenoviruses associated with cultivated oysters. Conventional-PCR, nested-PCR, and integrated cell culture-PCR (ICC/PCR) were first optimized using oysters seeded with know amounts of Adenovirus serotype 5 (Ad5). The maximum sensitivity for Ad5 detection was determined for each method, and then used to detect natural adenovirus contamination in oysters from three aquiculture farms in Florianopolis, Santa Catarina State, Brazil, over a period of 6 months. The results showed that the nested-PCR was more sensitive (limit of detection: 1.2 PFU/g of tissue) than conventional-PCR and ICC-PCR (limit of detection for both: 1.2 x 10(2)PFU/g of tissue) for detection of Ad5 in oyster extracts. Nested-PCR was able to detect 90% of Ad5 contamination in harvested oyster samples, while conventional-PCR was unable to detect Ad5 in any of the samples. The present work suggests that detection of human adenoviruses can be used as a tool to monitor the presence of human viruses in marine environments where shellfish grow, and that nested-PCR is the method of choice.
El concepto de República en José Martí
Dr. Ibrahim Hidalgo
2015-01-01
El acercamiento a una visión martiana sobre el concepto de la república es la esencia del artículo, donde se parte del análisis de sus textos, situando el concepto de república en el centro de su pensamiento y su actuar políticos e ideológicos, que han devenido objeto de análisis y valoraciones desde diversos ángulos, perspectivas y proyecciones por autores que a lo largo del siglo XX, y en la actualidad. El elemento esencial de la concepción es el ser individualmente considerado, cuya unión ...
A rapid method for screening arrayed plasmid cDNA library by PCR
International Nuclear Information System (INIS)
Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong
1999-01-01
Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency
Obliquamente, os mitos. (República, II
Directory of Open Access Journals (Sweden)
Loraine Oliveira
2016-12-01
Full Text Available A República é um texto repleto de mitos, que ora são condenados, ora integrados à educação na cidade. No livro II a discussão mostra quais são condenáveis e quais são úteis. E o motivo dessa posição ambivalente de Platão a respeito do mito é um só: os mitos se imprimem na alma. Sendo assim, eles são formadores do caráter. O problema é que há mitos pseûdos, ou seja, falsos, mentirosos, fictícios. E há mitos que possuem um elemento de verdade e um elemento pseûdos. Mas eles jamais são completamente verdadeiros. Ora, qual a função do pseûdos, considerando que os mitos formam o caráter? Um discurso, seja ficcional, ou mítico, pode ser filosófico? Se isso for possível, o texto da República não é ele mesmo uma ficção? Um mito? Por breves apontamentos, este estudo segue essas questões.
Directory of Open Access Journals (Sweden)
J. Wang
2013-10-01
Full Text Available Psathyrostachys huashanica Keng is an endangered species that is endemic to China, which provides an important gene pool for wheat improvement. We developed a quick and reliable PCR-based diagnostic assay to accurately and efficiently detect P. huashanica DNA sequences from introgression lines, which was based on a species-specific marker derived from genomic DNA. The 900-bp PCR-amplified band used as a P. huashanica-specific RAPD marker was tested with 21 different plant species and was converted into a sequence-characterized amplified region (SCAR marker by cloning and sequencing the selected fragments (pHs11. This SCAR marker, which was designated as RHS23, could clearly distinguish the presence of P. huashanica DNA repetitive sequences in wheat-P. huashanica derivative lines. The specificity of the marker was validated using 21 different plant species and a complete set of wheat-P. huashanica disomic addition lines (1Ns–7Ns, 2n=44=22II. This specific sequence targeted the Ns genome of P. huashanica and it was present in all the seven P. huashanica chromosomes. Therefore, this SCAR marker is specific for P. huashanica chromosomes and may be used in the identification of alien repetitive sequences in large gene pools. This diagnostic PCR assay for screening the target genetic material may play a key role in marker-assisted selective breeding programs.
Lamartina, S; Roscilli, G; Rinaudo, D; Delmastro, P; Toniatti, C
1998-09-01
Adeno-associated virus (AAV) integrates very efficiently into a specific site (AAVS1) of human chromosome 19. Two elements of the AAV genome are sufficient: the inverted terminal repeats (ITRs) and the Rep78 or Rep68 protein. The incorporation of the AAV integration machinery in nonviral delivery systems is of great interest for gene therapy. We demonstrate that purified recombinant Rep68 protein is functionally active when directly delivered into human cells by using the polycationic liposome Lipofectamine, promoting the rescue-replication of a codelivered ITR-flanked cassette in adenovirus-infected cells and its site-specific integration in noninfected cells. The sequencing of cloned virus-host DNA junctions confirmed that lipofected Rep68 protein triggers site-specific integration at the same sites in chromosome 19 already characterized in cells latently infected with AAV.
Energy Technology Data Exchange (ETDEWEB)
Haddad, Taghrid
2015-05-29
This Thesis is a contribution for dimensioning aspects of circuits designs in superconductor electronics. Mainly superconductor comparators inclusive Josephson comparators as well as QOJS-Comparators are investigated. Both types were investigated in terms of speed and sensitivity. The influence of the thermal noise on the decision process of the comparators represent in so called gray zone, which is analysed in this thesis. Thereby, different relations between design parameters were derived. A circuit model of the Josephson comparator was verified by experiments. Concepts of superconductor analog-to-digital converters, which are based on above called comparators, were investigated in detail. From the comparator design rules, new rules for AD-converters were derived. Because of the reduced switching energy, the signal to noise ratio (SNR) of the circuits is affected and therefore the reliability of the decision-process is affected. For special applications with very demanding requirements in terms of the speed and accuracy superconductor analog-to-digital converters offer an excellent performance. This thesis provides relations between different design paramenters and shows resulting trade-offs, This method is transparent and easy to transfer to other circuit topologies. As a main result, a highly predictive tool for dimensioning of superconducting ADC's is proved.
An enhanced method for sequence walking and paralog mining: TOPO® Vector-Ligation PCR
Directory of Open Access Journals (Sweden)
Davis Thomas M
2010-03-01
Full Text Available Abstract Background Although technological advances allow for the economical acquisition of whole genome sequences, many organisms' genomes remain unsequenced, and fully sequenced genomes may contain gaps. Researchers reliant upon partial genomic or heterologous sequence information require methods for obtaining unknown sequences from loci of interest. Various PCR based techniques are available for sequence walking - i.e., the acquisition of unknown DNA sequence adjacent to known sequence. Many such methods require rigid, elaborate protocols and/or impose narrowly confined options in the choice of restriction enzymes for necessary genomic digests. We describe a new method, TOPO® Vector-Ligation PCR (or TVL-PCR that innovatively integrates available tools and familiar concepts to offer advantages as a means of both targeted sequence walking and paralog mining. Findings TVL-PCR exploits the ligation efficiency of the pCR®4-TOPO® (Invitrogen, Carlsbad, California vector system to capture fragments of unknown sequence by creating chimeric molecules containing defined priming sites at both ends. Initially, restriction enzyme-digested genomic DNA is end-repaired to create 3' adenosine overhangs and is then ligated to pCR4-TOPO vectors. The ligation product pool is used directly as a template for nested PCR, using specific primers to target orthologous sequences, or degenerate primers to enable capture of paralogous gene family members. We demonstrated the efficacy of this method by capturing entire coding and partial promoter sequences of several strawberry Superman-like genes. Conclusions TVL-PCR is a convenient and efficient method for DNA sequence walking and paralog mining that is applicable to any organism for which relevant DNA sequence is available as a basis for primer design.
Typing of Y chromosome SNPs with multiplex PCR methods
DEFF Research Database (Denmark)
Sanchez Sanchez, Juan Jose; Børsting, Claus; Morling, Niels
2005-01-01
We describe a method for the simultaneous typing of Y-chromosome single nucleotide polymorphism (SNP) markers by means of multiplex polymerase chain reaction (PCR) strategies that allow the detection of 35 Y chromosome SNPs on 25 amplicons from 100 to 200 pg of chromosomal deoxyribonucleic acid...... factors for the creation of larger SNP typing PCR multiplexes include careful selection of primers for the primary amplification and the SBE reaction, use of DNA primers with homogenous composition, and balancing the primer concentrations for both the amplification and the SBE reactions....
Hariduspoliitikas ilmnevad üksmeele märgid / Mailis Reps
Reps, Mailis, 1975-
2006-01-01
Ilmunud ka: Severnoje Poberezhje 7. juuni lk. 2, Nädaline 10. juuni lk. 2. Haridusminister Mailis Reps Res Publica ja Isamaaliidu ühisest haridusprogrammist ning juba teostumas hariduspoliitilistest eesmärkidest
A Simple PCR Method for Rapid Genotype Analysis of Mycobacterium ulcerans
Stinear, Timothy; Davies, John K.; Jenkin, Grant A.; Portaels, Françoise; Ross, Bruce C.; OppEdIsano, Frances; Purcell, Maria; Hayman, John A.; Johnson, Paul D. R.
2000-01-01
Two high-copy-number insertion sequences, IS2404 and IS2606, were recently identified in Mycobacterium ulcerans and were shown by Southern hybridization to possess restriction fragment length polymorphism between strains from different geographic origins. We have designed a simple genotyping method that captures these differences by PCR amplification of the region between adjacent copies of IS2404 and IS2606. We have called this system 2426 PCR. The method is rapid, reproducible, sensitive, and specific for M. ulcerans, and it has confirmed previous studies suggesting a clonal population structure of M. ulcerans within a geographic region. M. ulcerans isolates from Australia, Papua New Guinea, Malaysia, Surinam, Mexico, Japan, China, and several countries in Africa were easily differentiated based on an array of 4 to 14 PCR products ranging in size from 200 to 900 bp. Numerical analysis of the banding patterns suggested a close evolutionary link between M. ulcerans isolates from Africa and southeast Asia. The application of 2426 PCR to total DNA, extracted directly from M. ulcerans-infected tissue specimens without culture, demonstrated the sensitivity and specificity of this method and confirmed for the first time that both animal and human isolates from areas of endemicity in southeast Australia have the same genotype. PMID:10747130
Kraft, Jeffrey J.; Jeong, Changhoon; Novotny, John E.; Seacrist, Thomas; Chan, Gilbert; Domzalski, Marcin; Turka, Christina M.; Richardson, Dean W.; Dodge, George R.
2011-01-01
Objective: Many approaches are being taken to generate cartilage replacement materials. The goal of this study was to use a self-aggregating suspension culture model of chondrocytes with mechanical preconditioning. Design: Our model differs from others in that it is based on a scaffold-less, self-aggregating culture model that produces a cartilage tissue analog that has been shown to share many similarities with the natural cartilage phenotype. Owing to the known loaded environment under which chondrocytes function in vivo, we hypothesized that applying force to the suspension culture–derived chondrocyte biomass would improve its cartilage-like characteristics and provide a new model for engineering cartilage tissue analogs. Results: In this study, we used a specialized hydrostatic pressure bioreactor system to apply mechanical forces during the growth phase to improve biochemical and biophysical properties of the biomaterial formed. We demonstrated that using this high-density suspension culture, a biomaterial more consistent with the hyaline cartilage phenotype was produced without any foreign material added. Unpassaged chondrocytes responded to a physiologically relevant hydrostatic load by significantly increasing gene expression of critical cartilage molecule collagen and aggrecan along with other cartilage relevant genes, CD44, perlecan, decorin, COMP, and iNOS. Conclusions: This study describes a self-aggregating bioreactor model without foreign material or scaffold in which chondrocytes form a cartilage tissue analog with many features similar to native cartilage. This study represents a promising scaffold-less, methodological advancement in cartilage tissue engineering with potential translational applications to cartilage repair. PMID:26069584
Létant, Sonia E; Murphy, Gloria A; Alfaro, Teneile M; Avila, Julie R; Kane, Staci R; Raber, Ellen; Bunt, Thomas M; Shah, Sanjiv R
2011-09-01
In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real-time PCR analysis is conducted on samples before and after incubation. The method, referred to as rapid-viability (RV)-PCR, uses the change in cycle threshold after incubation to detect the presence of live organisms. In this article, we report a novel RV-PCR method for detection of live, virulent Bacillus anthracis, in which the incubation time was reduced from 14 h to 9 h, bringing the total turnaround time for results below 15 h. The method incorporates a magnetic bead-based DNA extraction and purification step prior to PCR analysis, as well as specific real-time PCR assays for the B. anthracis chromosome and pXO1 and pXO2 plasmids. A single laboratory verification of the optimized method applied to the detection of virulent B. anthracis in environmental samples was conducted and showed a detection level of 10 to 99 CFU/sample with both manual and automated RV-PCR methods in the presence of various challenges. Experiments exploring the relationship between the incubation time and the limit of detection suggest that the method could be further shortened by an additional 2 to 3 h for relatively clean samples.
da Fonseca, Allex Jardim; Galvão, Renata Silva; Miranda, Angelica Espinosa; Ferreira, Luiz Carlos de Lima; Chen, Zigui
2016-05-01
To compare the diagnostic performance for HPV infection using three laboratorial techniques. Ninty-five cervicovaginal samples were randomly selected; each was tested for HPV DNA and genotypes using 3 methods in parallel: Multiplex-PCR, the Nested PCR followed by Sanger sequencing, and the Next_Gen Sequencing (NGS) with two assays (NGS-A1, NGS-A2). The study was approved by the Brazilian National IRB (CONEP protocol 16,800). The prevalence of HPV by the NGS assays was higher than that using the Multiplex-PCR (64.2% vs. 45.2%, respectively; P = 0.001) and the Nested-PCR (64.2% vs. 49.5%, respectively; P = 0.003). NGS also showed better performance in detecting high-risk HPV (HR-HPV) and HPV16. There was a weak interobservers agreement between the results of Multiplex-PCR and Nested-PCR in relation to NGS for the diagnosis of HPV infection, and a moderate correlation for HR-HPV detection. Both NGS assays showed a strong correlation for detection of HPVs (k = 0.86), HR-HPVs (k = 0.91), HPV16 (k = 0.92) and HPV18 (k = 0.91). NGS is more sensitive than the traditional Sanger sequencing and the Multiplex PCR to genotype HPVs, with promising ability to detect multiple infections, and may have the potential to establish an alternative method for the diagnosis and genotyping of HPV. © 2015 Wiley Periodicals, Inc.
Reynolds analogy for the Rayleigh problem at various flow modes.
Abramov, A A; Butkovskii, A V
2016-07-01
The Reynolds analogy and the extended Reynolds analogy for the Rayleigh problem are considered. For a viscous incompressible fluid we derive the Reynolds analogy as a function of the Prandtl number and the Eckert number. We show that for any positive Eckert number, the Reynolds analogy as a function of the Prandtl number has a maximum. For a monatomic gas in the transitional flow regime, using the direct simulation Monte Carlo method, we investigate the extended Reynolds analogy, i.e., the relation between the shear stress and the energy flux transferred to the boundary surface, at different velocities and temperatures. We find that the extended Reynolds analogy for a rarefied monatomic gas flow with the temperature of the undisturbed gas equal to the surface temperature depends weakly on time and is close to 0.5. We show that at any fixed dimensionless time the extended Reynolds analogy depends on the plate velocity and temperature and undisturbed gas temperature mainly via the Eckert number. For Eckert numbers of the order of unity or less we generalize an extended Reynolds analogy. The generalized Reynolds analogy depends mainly only on dimensionless time for all considered Eckert numbers of the order of unity or less.
RT-PCR Protocols - Methods in Molecular Biology
Directory of Open Access Journals (Sweden)
Manuela Monti
2011-03-01
Full Text Available “The first record I have of it, is when I made a computer file which I usually did whenever I had an idea, that would have been on the Monday when I got back, and I called it Chain Reaction.POL, meaning polymerase. That was the identifier for it and later I called the thing the Polymerase Chain Reaction, which a lot of people thought was a dumb name for it, but it stuck, and it became PCR”. With these words the Nobel prize winner, Kary Mullis, explains how he named the PCR: one of the most important techniques ever invented and currently used in molecular biology. This book “RT-PCR Protocols” covers a wide range of aspects important for the setting of a PCR experiment for both beginners and advanced users. In my opinion the book is very well structured in three different sections. The first one describes the different technologies now available, like competitive RT-PCR, nested RT-PCR or RT-PCR for cloning. An important part regards the usage of PCR in single cell mouse embryos, stressing how important...........
An analog computer method for solving flux distribution problems in multi region nuclear reactors
Energy Technology Data Exchange (ETDEWEB)
Radanovic, L; Bingulac, S; Lazarevic, B; Matausek, M [Boris Kidric Institute of Nuclear Sciences Vinca, Beograd (Yugoslavia)
1963-04-15
The paper describes a method developed for determining criticality conditions and plotting flux distribution curves in multi region nuclear reactors on a standard analog computer. The method, which is based on the one-dimensional two group treatment, avoids iterative procedures normally used for boundary value problems and is practically insensitive to errors in initial conditions. The amount of analog equipment required is reduced to a minimum and is independent of the number of core regions and reflectors. (author)
Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun
2016-07-07
To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and
DNA extraction methods for panbacterial and panfungal PCR detection in intraocular fluids.
Mazoteras, Paloma; Bispo, Paulo José Martins; Höfling-Lima, Ana Luisa; Casaroli-Marano, Ricardo P
2015-07-01
Three different methods of DNA extraction from intraocular fluids were compared with subsequent detection for bacterial and fungal DNA by universal PCR amplification. Three DNA extraction methods, from aqueous and vitreous humors, were evaluated to compare their relative efficiency. Bacterial (Gram positive and negative) and fungal strains were used in this study: Escherichia coli, Staphylococcus epidermidis and Candida albicans. The quality, quantification, and detection limit for DNA extraction and PCR amplification were analyzed. Validation procedures for 13 aqueous humor and 14 vitreous samples, from 20 patients with clinically suspected endophthalmitis were carried out. The column-based extraction method was the most time-effective, achieving DNA detection limits ≥10(2) and 10(3 )CFU/100 µL for bacteria and fungi, respectively. PCR amplification detected 100 fg, 1 pg and 10 pg of genomic DNA of E. coli, S. epidermidis and C. albicans respectively. PCR detected 90.0% of the causative agents from 27 intraocular samples collected from 20 patients with clinically suspected endophthalmitis, while standard microbiological techniques could detect only 60.0%. The most frequently found organisms were Streptococcus spp. in 38.9% (n = 7) of patients and Staphylococcus spp. found in 22.2% (n = 4). The column-based extraction method for very small inocula in small volume samples (50-100 µL) of aqueous and/or vitreous humors allowed PCR amplification in all samples with sufficient quality for subsequent sequencing and identification of the microorganism in the majority of them.
PCR-RFLP Method to Identify Salmonid Species of Economic Importance
Directory of Open Access Journals (Sweden)
Andreea Dudu
2011-05-01
Full Text Available The identification of different fish species by molecular methods has become necessary to avoid both the incorrect labelling of individuals involved in repopulation programmes and the commercial frauds on the fish market. Different fish species of great economical importance, like the salmonids, which are very much requested for their meat, can be identified using molecular techniques such as PCR-RFLP. The method is based on the amplification of a target region from the genome by PCR reaction followed by endonucleases digestion to detect the polymorphism of restriction fragments. In our study we analysed the following salmonid species from Romania: Salmo trutta fario, Salmo labrax, Salvelinus fontinalis, Onchorhynchus mykiss, Thymallus thymallus and Hucho hucho. In order to discriminate between the analysed species we amplified a fragment of mitochondrial genome comprising tRNAGlu/ cytochrome b/ tRNAThr/ tRNAPro/ D-loop/ tRNAPhe, followed by digestion with a specific restriction enzyme. The direct digestion of unpurified PCR products generated species-specific restriction patterns and proved to be a simple, reliable, inexpensive and fast method. Thus, it may be successfully utilized in specialized laboratories for the correct identification of the fish species for multiple purposes, including the traceability of fish food products.
Energy Technology Data Exchange (ETDEWEB)
Pearsons, Todd N.; Johnson, Christopher L. (Washington Department of Fish and Wildlife, Olympia, WA)
2003-04-01
The benefits that marine derived nutrients from adult salmon carcasses provide to juvenile salmonids are increasingly being recognized. Current estimates suggest that only 6-7% of marine-derived nitrogen and phosphorus that were historically available to salmonids in the Pacific Northwest are currently available. Food limitation may be a major constraint limiting the restoration of salmonids. A variety of methods have been proposed to offset this nutrient deficit including: allowing greater salmon spawning escapement, stocking hatchery salmon carcasses, and stocking inorganic nutrients. Unfortunately, each of these methods has some ecological or socio-economic shortcoming. We intend to overcome many of these shortcomings by making and evaluating a pathogen free product that simulates a salmon carcass (analog). Abundant sources of marine derived nutrients are available such as fish offal from commercial fishing and salmon carcasses from hatcheries. However, a method for recycling these nutrients into a pathogen free analog that degrades at a similar rate as a natural salmon carcass has never been developed. We endeavored to (1) develop a salmon carcass analog that will increase the food available to salmonids, (2) determine the pathways that salmonids use to acquire food from analogs, and (3) determine the benefits to salmonids and the potential for application to salmonid restoration. We used a before-after-control-impact-paired design in six tributaries of the upper Yakima basin to determine the utility of stocking carcass analogs. Our preliminary results suggest that the introduction of carcass analogs into food-limited streams can be used to restore food pathways previously provided by anadromous salmon. The analogs probably reproduced both of the major food pathways that salmon carcasses produce: direct consumption and food chain enhancement. Trout and salmon fed directly on the carcass analogs during the late summer and presumably benefited from the increased
Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes
Directory of Open Access Journals (Sweden)
Georg Walch
2016-04-01
Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.
Topology reconstruction for B-Rep modeling from 3D mesh in reverse engineering applications
Bénière, Roseline; Subsol, Gérard; Gesquière, Gilles; Le Breton, François; Puech, William
2012-03-01
Nowadays, most of the manufactured objects are designed using CAD (Computer-Aided Design) software. Nevertheless, for visualization, data exchange or manufacturing applications, the geometric model has to be discretized into a 3D mesh composed of a finite number of vertices and edges. But, in some cases, the initial model may be lost or unavailable. In other cases, the 3D discrete representation may be modified, for example after a numerical simulation, and does not correspond anymore to the initial model. A reverse engineering method is then required to reconstruct a 3D continuous representation from the discrete one. In previous work, we have presented a new approach for 3D geometric primitive extraction. In this paper, to complete our automatic and comprehensive reverse engineering process, we propose a method to construct the topology of the retrieved object. To reconstruct a B-Rep model, a new formalism is now introduced to define the adjacency relations. Then a new process is used to construct the boundaries of the object. The whole process is tested on 3D industrial meshes and bring a solution to recover B-Rep models.
Directory of Open Access Journals (Sweden)
Jeni Vuong
Full Text Available Neisseria meningitidis (Nm, Haemophilus influenzae (Hi, and Streptococcus pneumoniae (Sp are the lead causes of bacterial meningitis. Detection of these pathogens from clinical specimens using traditional real-time PCR (rt-PCR requires DNA extraction to remove the PCR inhibitors prior to testing, which is time consuming and labor intensive. In this study, five species-specific (Nm-sodC and -ctrA, Hi-hpd#1 and -hpd#3 and Sp-lytA and six serogroup-specific rt-PCR tests (A, B, C, W, X, Y targeting Nm capsular genes were evaluated in the two direct rt-PCR methods using PerfeCTa and 5x Omni that do not require DNA extraction. The sensitivity and specify of the two direct rt-PCR methods were compared to TaqMan traditional rt-PCR, the current standard rt-PCR method for the detection of meningitis pathogens. The LLD for all 11 rt-PCR tests ranged from 6,227 to 272,229 CFU/ml for TaqMan, 1,824-135,982 for 5x Omni, and 168-6,836 CFU/ml for PerfeCTa. The diagnostic sensitivity using TaqMan ranged from 89.2%-99.6%, except for NmB-csb, which was 69.7%. For 5x Omni, the sensitivity varied from 67.1% to 99.8%, with three tests below 90%. The sensitivity of these tests using PerfeCTa varied from 89.4% to 99.8%. The specificity ranges of the 11 tests were 98.0-99.9%, 97.5-99.9%, and 92.9-99.9% for TaqMan, 5x Omni, and PerfeCTa, respectively. PerfeCTa direct rt-PCR demonstrated similar or better sensitivity compared to 5x Omni direct rt-PCR or TaqMan traditional rt-PCR. Since the direct rt-PCR method does not require DNA extraction, it reduces the time and cost for processing CSF specimens, increases testing throughput, decreases the risk of cross-contamination, and conserves precious CSF. The direct rt-PCR method will be beneficial to laboratories with high testing volume.
International Nuclear Information System (INIS)
Prasad, C. Krishna; Meyers, Craig; Zhan Dejin; You Hong; Chiriva-Internati, Maurizio; Mehta, Jawahar L.; Liu Yong; Hermonat, Paul L.
2003-01-01
Multiple epidemiologic studies show that adeno-associated virus (AAV) is negatively associated with cervical cancer (CX CA), a cancer which is positively associated with human papillomavirus (HPV) infection. Mechanisms for this correlation may be by Rep78's (AAV's major regulatory protein) ability to bind the HPV-16 p97 promoter DNA and inhibit transcription, to bind and interfere with the functions of the E7 oncoprotein of HPV-16, and to bind a variety of HPV-important cellular transcription factors such as Sp1 and TBP. c-Jun is another important cellular factor intimately linked to the HPV life cycle, as well as keratinocyte differentiation and skin development. Skin is the natural host tissue for both HPV and AAV. In this article it is demonstrated that Rep78 directly interacts with c-Jun, both in vitro and in vivo, as analyzed by Western blot, yeast two-hybrid cDNA, and electrophoretic mobility shift-supershift assay (EMSA supershift). Addition of anti-Rep78 antibodies inhibited the EMSA supershift. Investigating the biological implications of this interaction, Rep78 inhibited the c-Jun-dependent c-jun promoter in transient and stable chloramphenicol acetyl-transferase (CAT) assays. Rep78 also inhibited c-Jun-augmented c-jun promoter as well as the HPV-16 p97 promoter activity (also c-Jun regulated) in in vitro transcription assays in T47D nuclear extracts. Finally, the Rep78-c-Jun interaction mapped to the amino-half of Rep78. The ability of Rep78 to interact with c-Jun and down-regulate AP-1-dependent transcription suggests one more mechanism by which AAV may modulate the HPV life cycle and the carcinogenesis process
Directory of Open Access Journals (Sweden)
Elena Cibrián Uhalte
Full Text Available Protein kinase C iota is required for various cell biological processes including epithelial tissue polarity and organ morphogenesis. To gain mechanistic insight into different roles of this kinase, it is essential to identify specific substrate proteins in their cellular context. The analog-sensitive kinase method provides a powerful tool for the identification of kinase substrates under in vivo conditions. However, it has remained a major challenge to establish screens based on this method in multicellular model organisms. Here, we report the methodology for in vivo conditions using the analog-sensitive kinase method in a genetically-tractable vertebrate model organism, the zebrafish. With this approach, kinase substrates can uniquely be labeled in the developing zebrafish embryo using bulky ATPγS analogs which results in the thiophosphorylation of substrates. The labeling of kinase substrates with a thiophosphoester epitope differs from phosphoesters that are generated by all other kinases and allows for an enrichment of thiophosphopeptides by immunoaffinity purification. This study provides the foundation for using the analog-sensitive kinase method in the context of complex vertebrate development, physiology, or disease.
[A Duplex PCR Method for Detection of Babesia caballi and Theileria equi].
Zhang, Yang; Zhang, Yu-ting; Wang, Zhen-bao; Bolati; Li, Hai; Bayinchahan
2015-04-01
To develop a duplex PCR assay for detection of Babesia caballi and Theileria equi. Two pairs of primers were designed according to the BC48 gene of B. caballi and 18 s rRNA gene of T. equi, and a duplex PCR assay was developed by the optimization of reaction conditions. The specificity, sensitivity and reliability of the method were tested. The horse blood samples of suspected cases were collected from Yili region, and detected by the duplex PCR, microspopy, conventional PCR, and fluorescence quantitative PCR, and the results were compared. Using the duplex PCR assay, the specific fragments of 155 bp and 280 bp were amplified from DNA samples of B. caballi and T. equi, respectively. No specific fragment was amplified from DNA samples of B. bigemina, Theilerdia annulata, Theilerdia sergenti, Toxoplasma gondii, Neospora caninum, and Trypanosoma evansi. The limit of detection was 4.85 x 10(5) copies/L for B. caballi DNA and 4.85 x 10(4) copies/µl for T. equi DNA, respectively. Among the 24 blood samples, 11 were found B. caballi-positive by the duplex PCR assay, and 18 were T. equi-positive. The coincidence rate of microscopy, conventional PCR, and fluorescence quantitative PCR with duplex PCR was 91.7% (22/24), 95.8% (23/24), and 95.8% (23/24), respectively. A duplex PCR assay for simultaneous detection of B. caballi and T. equi is established.
Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y
2018-01-01
Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage
Profiles of the Hα line by means of the analogical television system
International Nuclear Information System (INIS)
Andrillat, Y.; Fehrenbach, Ch.
1981-01-01
High resolution profiles of the Hα line are derived for about thirty Be stars and several bright stars by means of the analogical television system. The profiles obtained with this method fairly agree with the theoretical ones (α Lyrae). (Auth.)
Devonshire, Alison S; O'Sullivan, Denise M; Honeyborne, Isobella; Jones, Gerwyn; Karczmarczyk, Maria; Pavšič, Jernej; Gutteridge, Alice; Milavec, Mojca; Mendoza, Pablo; Schimmel, Heinz; Van Heuverswyn, Fran; Gorton, Rebecca; Cirillo, Daniela Maria; Borroni, Emanuele; Harris, Kathryn; Barnard, Marinus; Heydenrych, Anthenette; Ndusilo, Norah; Wallis, Carole L; Pillay, Keshree; Barry, Thomas; Reddington, Kate; Richter, Elvira; Mozioğlu, Erkan; Akyürek, Sema; Yalçınkaya, Burhanettin; Akgoz, Muslum; Žel, Jana; Foy, Carole A; McHugh, Timothy D; Huggett, Jim F
2016-08-03
Real-time PCR (qPCR) based methods, such as the Xpert MTB/RIF, are increasingly being used to diagnose tuberculosis (TB). While qualitative methods are adequate for diagnosis, the therapeutic monitoring of TB patients requires quantitative methods currently performed using smear microscopy. The potential use of quantitative molecular measurements for therapeutic monitoring has been investigated but findings have been variable and inconclusive. The lack of an adequate reference method and reference materials is a barrier to understanding the source of such disagreement. Digital PCR (dPCR) offers the potential for an accurate method for quantification of specific DNA sequences in reference materials which can be used to evaluate quantitative molecular methods for TB treatment monitoring. To assess a novel approach for the development of quality assurance materials we used dPCR to quantify specific DNA sequences in a range of prototype reference materials and evaluated accuracy between different laboratories and instruments. The materials were then also used to evaluate the quantitative performance of qPCR and Xpert MTB/RIF in eight clinical testing laboratories. dPCR was found to provide results in good agreement with the other methods tested and to be highly reproducible between laboratories without calibration even when using different instruments. When the reference materials were analysed with qPCR and Xpert MTB/RIF by clinical laboratories, all laboratories were able to correctly rank the reference materials according to concentration, however there was a marked difference in the measured magnitude. TB is a disease where the quantification of the pathogen could lead to better patient management and qPCR methods offer the potential to rapidly perform such analysis. However, our findings suggest that when precisely characterised materials are used to evaluate qPCR methods, the measurement result variation is too high to determine whether molecular quantification
Zhu, Hai-Ying; Jin, Long; Guo, Qing; Luo, Zhao-Bo; Li, Xiao-Chen; Zhang, Yu-Chen; Xing, Xiao-Xu; Xuan, Mei-Fu; Zhang, Guang-Lei; Luo, Qi-Rong; Wang, Jun-Xia; Cui, Cheng-Du; Li, Wen-Xue; Cui, Zheng-Yun; Yin, Xi-Jun; Kang, Jin-Dan
2017-05-01
To investigate the effect of the small molecule, RepSox, on the expression of developmentally important genes and the pre-implantation development of rhesus monkey-pig interspecies somatic cell nuclear transfer (iSCNT) embryos. Rhesus monkey cells expressing the monomeric red fluorescent protein 1 which have a normal (42) chromosome complement, were used as donor cells to generate iSCNT embryos. RepSox increased the expression levels of the pluripotency-related genes, Oct4 and Nanog (p 0.05), this was not significant. RepSox can improve the developmental potential of rhesus monkey-pig iSCNT embryos by regulating the expression of pluripotency-related genes.
A simple method to adapt time sampling of the analog signal
International Nuclear Information System (INIS)
Kalinin, Yu.G.; Martyanov, I.S.; Sadykov, Kh.; Zastrozhnova, N.N.
2004-01-01
In this paper we briefly describe the time sampling method, which is adapted to the speed of the signal change. Principally, this method is based on a simple idea--the combination of discrete integration with differentiation of the analog signal. This method can be used in nuclear electronics research into the characteristics of detectors and the shape of the pulse signal, pulse and transitive characteristics of inertial systems of processing of signals, etc
Polymerase chain reaction methods (PCR in agrobiotechnology
Directory of Open Access Journals (Sweden)
Taški-Ajduković Ksenija
2006-01-01
Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.
Mohamad, Nurhidayatul Asma; Mustafa, Shuhaimi; Khairil Mokhtar, Nur Fadhilah; El Sheikha, Aly Farag
2018-03-05
The pharmaceutical industry has boosted gelatin consumption worldwide. This is supported by the availability of cost-effective gelatin production from porcine by-products. However, cross-contamination of gelatin materials, where porcine gelatin was unintentionally included in the other animal sources of gelatin, has caused significant concerns about halal authenticity. The real-time polymerase chain reaction (PCR) has enabled a highly specific and sensitive animal species detection method in various food products. Hence, such a technique was employed in the present study to detect and quantify porcine DNA in gelatin using a molecular beacon probe, with differences in performance between mitochondrial (cytochrome b gene) and chromosomal DNA-(MPRE42 repetitive element) based porcine-specific PCR assays being compared. A higher sensitivity was observed in chromosomal DNA (MPRE-PCR assay), where this assay allows the detection of gelatin DNA at amounts as as low as 1 pg, whereas mitochondrial DNA (CBH-PCR assay) can only detect at levels down to 10 pg of gelatin DNA. When an analysis with commercial gelatin and gelatin capsule samples was conducted, the same result was observed, with a significantly more sensitive detection being provided by the repetitive element of chromosomal DNA. The present study has established highly sensitive DNA-based porcine detection systems derived from chromosomal DNA that are feasible for highly processed products such as gelatin and gelatin capsules containing a minute amount of DNA. This sensitive detection method can also be implemented to assist the halal authentication process of various food products available on the market. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.
Forecasting telecommunication new service demand by analogy method and combined forecast
Directory of Open Access Journals (Sweden)
Lin Feng-Jenq
2005-01-01
Full Text Available In the modeling forecast field, we are usually faced with the more difficult problems of forecasting market demand for a new service or product. A new service or product is defined as that there is absence of historical data in this new market. We hardly use models to execute the forecasting work directly. In the Taiwan telecommunication industry, after liberalization in 1996, there are many new services opened continually. For optimal investment, it is necessary that the operators, who have been granted the concessions and licenses, forecast this new service within their planning process. Though there are some methods to solve or avoid this predicament, in this paper, we will propose one forecasting procedure that integrates the concept of analogy method and the idea of combined forecast to generate new service forecast. In view of the above, the first half of this paper describes the procedure of analogy method and the approach of combined forecast, and the second half provides the case of forecasting low-tier phone demand in Taiwan to illustrate this procedure's feasibility.
El concepto de República en José Martí
Directory of Open Access Journals (Sweden)
Dr. Ibrahim Hidalgo
2015-10-01
Full Text Available El acercamiento a una visión martiana sobre el concepto de la república es la esencia del artículo, donde se parte del análisis de sus textos, situando el concepto de república en el centro de su pensamiento y su actuar políticos e ideológicos, que han devenido objeto de análisis y valoraciones desde diversos ángulos, perspectivas y proyecciones por autores que a lo largo del siglo XX, y en la actualidad. El elemento esencial de la concepción es el ser individualmente considerado, cuya unión constituye el pueblo, que deviene así no un ente abstracto y amorfo, sino un conglomerado de personas
Immuno-PCR, a new technique for the serodiagnosis of tuberculosis.
Mehta, Promod K; Dahiya, Bhawna; Sharma, Suman; Singh, Netrapal; Dharra, Renu; Thakur, Zoozeal; Mehta, Neeru; Gupta, Krishna B; Gupta, Mahesh C; Chaudhary, Dhruva
2017-08-01
Rapid and accurate diagnosis of tuberculosis (TB) is essential to control the disease. The conventional microbiological tests have limitations and there is an urgent need to devise a simple, rapid and reliable point-of-care (POC) test. The failure of TB diagnostic tests based on antibody detection due to inconsistent and imprecise results has stimulated renewed interest in the development of rapid antigen detection methods. However, the World Health Organization (WHO) has emphasized to continue research for designing new antibody-based detection tests with improved accuracy. Immuno-polymerase chain reaction (I-PCR) combines the simplicity and versatility of enzyme-linked immunosorbent assay (ELISA) with the exponential amplification capacity and sensitivity of PCR thus leading to several-fold increase in sensitivity in comparison to analogous ELISA. In this review, we have described the serodiagnostic potential of I-PCR assays for an early diagnosis of TB based on the detection of potential mycobacterial antigens and circulating antibodies in body fluids of TB patients. Copyright © 2017 Elsevier B.V. All rights reserved.
Amini, F; Kachuei, R; Noorbakhsh, F; Imani Fooladi, A A
2015-06-01
The aim of this study was the detection of Aspergillus species and Mycobacterium tuberculosis together in bronchoalveolar lavage (BAL) using of multiplex PCR. In this study, from September 2012 until June 2013, 100 bronchoalveolar lavage (BAL) specimens were collected from patients suspected of tuberculosis (TB). After the direct and culture test, multiplex PCR were utilized in order to diagnose Aspergillus species and M. tuberculosis. Phenol-chloroform manual method was used in order to extract DNA from these microorganisms. Aspergillus specific primers, M. tuberculosis designed primers and beta actin primers were used for multiplex PCR. In this study, by multiplex PCR method, Aspergillus species were identified in 12 samples (12%), positive samples in direct and culture test were respectively 11% and 10%. Sensitivity and specificity of this method in comparison to direct test were respectively 100% and 98.8%, also sensitivity and specificity of this method in comparison to culture test were respectively 100% and 97.7%. In this assay, M. tuberculosis was identified in 8 samples (8%). Mycobacterium-positive samples in molecular method, direct and culture test were respectively 6%, 5% and 7%. Sensitivity and specificity of PCR method in comparison to direct test were 80% and 97.8% also sensitivity and specificity of this method in comparison to culture test was 71.4% and 98.9%. In the present study, multiplex PCR method had higher sensitivity than direct and culture test in order to identify and detect Aspergillus, also this method had lower sensitivity for identification of M. tuberculosis, suggesting that the method of DNA extraction was not suitable. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
An Analog-Digital Mixed Measurement Method of Inductive Proximity Sensor
Directory of Open Access Journals (Sweden)
Yi-Xin Guo
2015-12-01
Full Text Available Inductive proximity sensors (IPSs are widely used in position detection given their unique advantages. To address the problem of temperature drift, this paper presents an analog-digital mixed measurement method based on the two-dimensional look-up table. The inductance and resistance components can be separated by processing the measurement data, thus reducing temperature drift and generating quantitative outputs. This study establishes and implements a two-dimensional look-up table that reduces the online computational complexity through structural modeling and by conducting an IPS operating principle analysis. This table is effectively compressed by considering the distribution characteristics of the sample data, thus simplifying the processing circuit. Moreover, power consumption is reduced. A real-time, built-in self-test (BIST function is also designed and achieved by analyzing abnormal sample data. Experiment results show that the proposed method obtains the advantages of both analog and digital measurements, which are stable, reliable, and taken in real time, without the use of floating-point arithmetic and process-control-based components. The quantitative output of displacement measurement accelerates and stabilizes the system control and detection process. The method is particularly suitable for meeting the high-performance requirements of the aviation and aerospace fields.
Creative Analogy Use in a Heterogeneous Design Team
DEFF Research Database (Denmark)
Christensen, Bo; Ball, Linden J.
2016-01-01
the design dialogue derived from team members with highly disparate educational backgrounds. Our analyses revealed that analogies that matched (versus mismatched) educational backgrounds were generated and revisited more frequently, presumably because they were more accessible. Matching analogies were also...
Bazinet, Michel; Pântea, Victor; Cebotarescu, Valentin; Cojuhari, Lilia; Jimbei, Pavlina; Albrecht, Jeffrey; Schmid, Peter; Le Gal, Frédéric; Gordien, Emmanuel; Krawczyk, Adalbert; Mijočević, Hrvoje; Karimzadeh, Hadi; Roggendorf, Michael; Vaillant, Andrew
2017-12-01
REP 2139 clears circulating hepatitis B virus (HBV) surface antigen (HBsAg), enhancing the restoration of functional control of HBV infection by immunotherapy. We assessed the safety and efficacy of REP 2139 and pegylated interferon alfa-2a in patients with chronic HBV and hepatitis D virus (HDV) co-infection. In this open-label, non-randomised, phase 2 trial, patients aged 18-55 years, who were treatment naive, hepatitis B e antigen [HBeAg] negative, anti-hepatitis D antigen [HDAg] positive, and HDV RNA positive, with serum HBsAg concentrations of more than 1000 IU/mL, and a history of HDV infection for 6 months or more before treatment, were recruited at Toma Ciorbă Hospital of Infectious Diseases in Chișinău, Moldova. Patients were excluded if they had HDV superinfection, liver infections other than HBV and HDV, or liver cirrhosis. Patients received 500 mg intravenous REP 2139 once per week for 15 weeks, followed by combined therapy with 250 mg intravenous REP 2139 and 180 μg subcutaneous pegylated interferon alfa-2a once per week for 15 weeks, then monotherapy with 180 μg pegylated interferon alfa-2a once per week for 33 weeks. The primary endpoints assessed at the end of treatment were the safety and tolerability of the treatment regimen, analysed in the intention-to-treat population. Secondary outcomes included the proportion of patients with serum HBsAg less than 50 IU/mL, the proportion of patients with suppressed HBV DNA, and the proportion of patients who maintained these responses through follow-up. The REP 301 trial is registered with ClinicalTrials.gov, number NCT02233075. We also did an additional follow-up at 1 year after the end of treatment, as an interim analysis of the REP 301-LTF trial (planned duration 3 years), registered with ClinicalTrials.gov, number NCT02876419, which is ongoing but not recruiting patients. Between Sept 8, 2014, and Jan 27, 2015, we enrolled 12 patients into the REP 301 study. All 12 patients experienced at least one
Las relaciones culturales de España en tiempo de crisis: de la II República a la Guerra Mundial
Directory of Open Access Journals (Sweden)
Lorenzo Delgado Gómez-Escalonilla
1994-01-01
Full Text Available En los primeros meses de 1936 el personal de la Junta de Relaciones Culturales preparaba la memoria correspondiente al año anterior. Se daba continuidad con ella a la difusión de las actividades del organismo, comenzada tras el establecimiento de la II República, y que contaba ya con las publicaciones relativas a los años 1931-1933 y 1934. Esa preocupación por divulgar los resultados de su labor era una muestra más del dinamismo que había adquirido la Junta de Relaciones Culturales después de la reforma que experimentó en 1931. También recordaba a la actuación de la Junta para Ampliación de Estudios, que editaba sistemáticamente las memorias de sus actividades para dejar constancia pública del trabajo realizado. La analogía a este respecto no era casual. Con la república los intelectuales reformistas procedentes de la Institución Libre de Enseñanza, que tiempo atrás inspiraron la creación de la Junta para Ampliación de Estudios, habían recuperado el predicamento sobre la planificación de la política cultural con el extranjero. Pero la memoria de la Junta del año 1935 nunca llegó a aparecer. La guerra civil se cruzó en el camino de quienes la redactaban.
2014-01-01
Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886
International Nuclear Information System (INIS)
Caballero-Casero, N.; Lunar, L.; Rubio, S.
2016-01-01
Bisphenol A (BPA) is ubiquitous in humans and the environment. Its potential adverse effects through genomic and non-genomic pathways have fostered BPA replacement by bisphenol analogs that, unfortunately, exert similar adverse effects. Many of these analogs, as well as their derivatives, have already found in humans and the environment and major concerns have arisen over their low dose- and mixture-related effects. This review aims to discuss the characteristics of the main analytical methods reported so far for the determination of mixtures of bisphenol analogs and/or derivatives in human and environmental exposure sources and biological fluids. Approaches followed for removal of background contamination, sample preparation and separation and detection of mixtures of bisphenols and derivatives are critically discussed. Sample treatment is matrix-dependent and common steps include analyte isolation, removal of interferences, evaporation of the extracts and solvent reconstitution. Separation and quantification has been almost exclusively carried out by liquid chromatography tandem mass spectrometry (LC-MS/MS) or gas chromatography mass spectrometry (GC–MS), in the last case prior derivatization, but LC-fluorescence detection has also found some applications. Main characteristics, advantages and drawbacks of these methods will be comparatively discussed. Although at an early stage, some approaches for the assessment of the risk to mixtures of bisphenols, mainly based on the combination of chemical target analysis and toxicity evaluation, have been already applied and they will be here presented. Current knowledge gaps hindering a reliable assessment of human and environmental risk to mixtures of bisphenols and derivatives will be outlined. - Highlights: • Analytical methods for the (bio)monitoring of mixtures of bisphenols are reviewed. • LC and CG coupled to MS are the preferred techniques. • Method-dependent sample treatments are required to remove matrix
Energy Technology Data Exchange (ETDEWEB)
Caballero-Casero, N.; Lunar, L.; Rubio, S., E-mail: qa1rubrs@uco.es
2016-02-18
Bisphenol A (BPA) is ubiquitous in humans and the environment. Its potential adverse effects through genomic and non-genomic pathways have fostered BPA replacement by bisphenol analogs that, unfortunately, exert similar adverse effects. Many of these analogs, as well as their derivatives, have already found in humans and the environment and major concerns have arisen over their low dose- and mixture-related effects. This review aims to discuss the characteristics of the main analytical methods reported so far for the determination of mixtures of bisphenol analogs and/or derivatives in human and environmental exposure sources and biological fluids. Approaches followed for removal of background contamination, sample preparation and separation and detection of mixtures of bisphenols and derivatives are critically discussed. Sample treatment is matrix-dependent and common steps include analyte isolation, removal of interferences, evaporation of the extracts and solvent reconstitution. Separation and quantification has been almost exclusively carried out by liquid chromatography tandem mass spectrometry (LC-MS/MS) or gas chromatography mass spectrometry (GC–MS), in the last case prior derivatization, but LC-fluorescence detection has also found some applications. Main characteristics, advantages and drawbacks of these methods will be comparatively discussed. Although at an early stage, some approaches for the assessment of the risk to mixtures of bisphenols, mainly based on the combination of chemical target analysis and toxicity evaluation, have been already applied and they will be here presented. Current knowledge gaps hindering a reliable assessment of human and environmental risk to mixtures of bisphenols and derivatives will be outlined. - Highlights: • Analytical methods for the (bio)monitoring of mixtures of bisphenols are reviewed. • LC and CG coupled to MS are the preferred techniques. • Method-dependent sample treatments are required to remove matrix
Energy Technology Data Exchange (ETDEWEB)
Schramm, M. (Klinik fuer Nuklearmedizin, Kiel Univ. (Germany)); Kaempfer, B. (Klinik fuer Nuklearmedizin, Kiel Univ. (Germany)); Wolf, H. (Klinik fuer Nuklearmedizin, Kiel Univ. (Germany)); Clausen, M. (Klinik fuer Nuklearmedizin, Kiel Univ. (Germany)); Wendhausen, H. (Klinik fuer Nuklearmedizin, Kiel Univ. (Germany)); Henze, E. (Klinik fuer Nuklearmedizin, Kiel Univ. (Germany))
1993-02-01
This study was undertaken to evaluate a quick, reliable and cheap method of digitizing analog scintigrams. 40 whole-body bone scintigrams were obtained simultaneously in analog and genuine digital format. The analog scans on X-ray film were then digitized seecondarily by three different methods: 300 dpi flatbed scanning, high-resolution camera scanning and camcorder recording. A simple exposure approach using a light box, a cheap camcorder, a PC and image grabber hard- and software proved to be optimal. Visual interpretation showed no differences in clinical findings when comparing the analog images with their secondarily digitized counterparts. To test the possibility of quantification, 126 equivalent ROIs were drawn both in the genuine digital and the secondarily digitized images. Comparing the ROI count to whole-body count percentage of the corresponding ROIs showed the correlation to be linear. The evaluation of phantom studies showed the linear correlation to be true within a wide activity range. Thus, secondary digitalization of analog scintigrams is an easy, cheap and reliable method of archiving images and allows secondary digital quantification. (orig.)
Neural correlates of creativity in analogical reasoning.
Green, Adam E; Kraemer, David J M; Fugelsang, Jonathan A; Gray, Jeremy R; Dunbar, Kevin N
2012-03-01
Brain-based evidence has implicated the frontal pole of the brain as important for analogical mapping. Separately, cognitive research has identified semantic distance as a key determinant of the creativity of analogical mapping (i.e., more distant analogies are generally more creative). Here, we used functional magnetic resonance imaging to assess brain activity during an analogy generation task in which we varied the semantic distance of analogical mapping (as derived quantitatively from a latent semantic analysis). Data indicated that activity within an a priori region of interest in left frontopolar cortex covaried parametrically with increasing semantic distance, even after removing effects of task difficulty. Results implicate increased recruitment of frontopolar cortex as a mechanism for integrating semantically distant information to generate solutions in creative analogical reasoning. 2012 APA, all rights reserved
An external standard method for quantification of human cytomegalovirus by PCR
International Nuclear Information System (INIS)
Rongsen, Shen; Liren, Ma; Fengqi, Zhou; Qingliang, Luo
1997-01-01
An external standard method for PCR quantification of HCMV was reported. [α- 32 P]dATP was used as a tracer. 32 P-labelled specific amplification product was separated by agarose gel electrophoresis. A gel piece containing the specific product band was excised and counted in a plastic scintillation counter. Distribution of [α- 32 P]dATP in the electrophoretic gel plate and effect of separation between the 32 P-labelled specific product and free [α- 32 P]dATP were observed. A standard curve for quantification of HCMV by PCR was established and detective results of quality control templets were presented. The external standard method and the electrophoresis separation effect were appraised. The results showed that the method could be used for relative quantification of HCMV. (author)
Directory of Open Access Journals (Sweden)
Elhamnia, F.
2010-07-01
Full Text Available Mycoplasma synoviae (MS is an important avian pathogen that can cause both respiratory disease and joint inflammation synovitis in poultry, inducing economic losses to the Iranian chicken industry especially breeder farms. The aim of this study was to use the MS specific PCR and culture methods in order to detect of M. synoviae from breeder farms where located in Tehran province. A total of 475 samples including choanal cleft, trachea, ovary and /or joint cavities from 23 broiler breeder farms of Tehran area were collected. Samples were cultured in PPLO broth media supplemented for MS isolation. The bacteria DNAs were extracted by phenol/chloroform method. Specific published primers amplify a 207 bp region of the 16S rRNA gene of MS were used for PCR method. Out of 475 samples, 146 cultures were shown positive and typical Mycoplasma colonies, 85 samples were also identified MS based on agglutination test with specific MS antiserum and the PCR method. A total of 122 samples, a band with 207 bp was shown as MS specific PCR product in electrophoresis. In addition to these 85 samples that were positives in both culture and PCR, 37 samples that had not grown in Mycoplasma media were positive in MS specific PCR. A total of 292 samples were negatives in both culture and PCR methods. 122 positive samples out of 475 samples (25.7% were belonged to 7 breeder farms (30.4%. On conclusions, the MS infection of broiler breeder farms of Tehran area was confirmed truly. From the results, as the PCR method reduces the time consuming, an effectiveness and efficient for detection of M. synoviae infection of chicken breeder. It is then suggested that the PCR method could be an alternative method for culturing.
Hyndman, D E
2013-01-01
Analog and Hybrid Computing focuses on the operations of analog and hybrid computers. The book first outlines the history of computing devices that influenced the creation of analog and digital computers. The types of problems to be solved on computers, computing systems, and digital computers are discussed. The text looks at the theory and operation of electronic analog computers, including linear and non-linear computing units and use of analog computers as operational amplifiers. The monograph examines the preparation of problems to be deciphered on computers. Flow diagrams, methods of ampl
A multiplex degenerate PCR analytical approach targeting to eight genes for screening GMOs.
Guo, Jinchao; Chen, Lili; Liu, Xin; Gao, Ying; Zhang, Dabing; Yang, Litao
2012-06-01
Currently, the detection methods with lower cost and higher throughput are the major trend in screening genetically modified (GM) food or feed before specific identification. In this study, we developed a quadruplex degenerate PCR screening approach for more than 90 approved GMO events. This assay is consisted of four PCR systems targeting on nine DNA sequences from eight trait genes widely introduced into GMOs, such as CP4-EPSPS derived from Acetobacterium tumefaciens sp. strain CP4, phosphinothricin acetyltransferase gene derived from Streptomyceshygroscopicus (bar) and Streptomyces viridochromogenes (pat), and Cry1Ab, Cry1Ac, Cry1A(b/c), mCry3A, and Cry3Bb1 derived from Bacillus thuringiensis. The quadruplex degenerate PCR assay offers high specificity and sensitivity with the absolute limit of detection (LOD) of approximate 80targetcopies. Furthermore, the applicability of the quadruplex PCR assay was confirmed by screening either several artificially prepared samples or samples of Grain Inspection, Packers and Stockyards Administration (GIPSA) proficiency program. Copyright © 2011 Elsevier Ltd. All rights reserved.
New multiplex PCR methods for rapid screening of genetically modified organisms in foods.
Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris
2015-01-01
We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.
New multiplex PCR methods for rapid screening of genetically modified organisms in foods
Directory of Open Access Journals (Sweden)
Nelly eDatukishvili
2015-07-01
Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.
International Nuclear Information System (INIS)
Yilmaz, R.; Cabi, E.; Dogan, M.
2014-01-01
RAPD-PCR (Random Amplified Polymorphic DNA Polymerase Chain Reaction) and Post PCR (Polymerase Chain Reaction) Melting Curve Analysis (MCA) have been used to investigate the pattern of genetic variation among some species in the genera Eremopyrum (Ledeb.) Jaub. and Spach and Agropyron Gaertner (Poaceae). Thirteen primers have been used in the study based on the RAPD-PCR and MCA analyses. Each species produced a distinct pattern of DNA fragments which have been used as a measure of the degree of relationship between species by means of using the RAPD-PCR results with three primers selected for identifying the genetic similarities. Polymorphic melting profiles have been obtained with Post PCR MCA method using three primers. Genetic similarities are calculated for all the species studied with RAPD-PCR and MCA methods, the dendrograms are obtained with the MVSP (Multi Variate Statistical Package) software using UPGMA (Unweighted Pair Group Method with Arithmetic Averages) and Jaccard's Coefficient. Polymorphism between 18 populations of Eremopyrum and 6 Agropyron populations and within the species are determined by using RAPD-PCR and Post PCR melting curve analysis (MCA) respectively. (author)
International Nuclear Information System (INIS)
Ferreira, Aline Leandra C.; Carregal, Virginia M.; Leite, Rodrigo S.; Ferreira, Sidney A.; Andrade, Antero Silva R.; Melo, Maria N.
2013-01-01
Visceral leishmaniasis (VL) in Brazil is caused by Leishmania infantum and dogs are considered the main domestic reservoirs of this parasite. The VL control program in Brazil emphasizes the use of serological surveys, followed by elimination of seropositive dogs. However, serologic tests have limitations in terms of sensitivity and specificity. Molecular methods such as PCR (Polymerase Chain Reaction) associated with hybridization using 32 P radiolabeled DNA probes (kDNA PCR hybridization) are useful tools in this scenario, since they are more specific and sensitive than conventional methods. A variety of samples can be employed with PCR; however non-invasive procedures are the most adequate. One of main obstacles for implementation of PCR in the canine visceral leishmaniasis (CVL) diagnosis is the lack of standardization. Few studies up to the moment compared the effectiveness of the different PCR methods and clinical samples available. The objective of this study was to compare the kDNA PCR hybridization and the Internal Transcribed Spacer 1 nested PCR (ITS1 nPCR) methods and four types of clinical samples for the diagnosis of CVL in dogs with and without clinical signs of the disease. The methods were compared using samples of conjunctival swab (SC), bone marrow (BM), skin (S) and peripheral blood (PB). A group of 60 mongrel dogs, all positive in serological and parasitological tests, were equally divided in two groups: S (with clinical signs) and A (without clinical signs). The frequencies of positive results for the kDNA PCR hybridization in the S group were: CS 97% (29/30), BM 83 % (25/30), S 63% (19/30) and PB 4 7% (14/30). By the same method the following results were obtained in the A group: CS 70% (21/30), BM 63% (19/30), S 57% (17/30) and PB 17% (5/30). The ITS1 nPCR allowed the following positivities for the S group: CS 83% (25/30), BM 97% (29/30), S 83% (25/30) and PB 70% (21/30). For the A group the following results were obtained: CS and BM 83% (25
Energy Technology Data Exchange (ETDEWEB)
Ferreira, Aline Leandra C.; Carregal, Virginia M.; Leite, Rodrigo S.; Ferreira, Sidney A.; Andrade, Antero Silva R., E-mail: alineleandra@hotmail.com, E-mail: streptos@hotmail.com, E-mail: rleite2005@gmail.com, E-mail: vidasnino@yahoo.com.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia; Melo, Maria N., E-mail: melo@icb.ufmg.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia
2013-07-01
Visceral leishmaniasis (VL) in Brazil is caused by Leishmania infantum and dogs are considered the main domestic reservoirs of this parasite. The VL control program in Brazil emphasizes the use of serological surveys, followed by elimination of seropositive dogs. However, serologic tests have limitations in terms of sensitivity and specificity. Molecular methods such as PCR (Polymerase Chain Reaction) associated with hybridization using {sup 32}P radiolabeled DNA probes (kDNA PCR hybridization) are useful tools in this scenario, since they are more specific and sensitive than conventional methods. A variety of samples can be employed with PCR; however non-invasive procedures are the most adequate. One of main obstacles for implementation of PCR in the canine visceral leishmaniasis (CVL) diagnosis is the lack of standardization. Few studies up to the moment compared the effectiveness of the different PCR methods and clinical samples available. The objective of this study was to compare the kDNA PCR hybridization and the Internal Transcribed Spacer 1 nested PCR (ITS1 nPCR) methods and four types of clinical samples for the diagnosis of CVL in dogs with and without clinical signs of the disease. The methods were compared using samples of conjunctival swab (SC), bone marrow (BM), skin (S) and peripheral blood (PB). A group of 60 mongrel dogs, all positive in serological and parasitological tests, were equally divided in two groups: S (with clinical signs) and A (without clinical signs). The frequencies of positive results for the kDNA PCR hybridization in the S group were: CS 97% (29/30), BM 83 % (25/30), S 63% (19/30) and PB 4 7% (14/30). By the same method the following results were obtained in the A group: CS 70% (21/30), BM 63% (19/30), S 57% (17/30) and PB 17% (5/30). The ITS1 nPCR allowed the following positivities for the S group: CS 83% (25/30), BM 97% (29/30), S 83% (25/30) and PB 70% (21/30). For the A group the following results were obtained: CS and BM 83
Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.
Kageyama, A; Benno, Y
2001-01-01
PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.
Two analogy strategies: the cases of mind metaphors and introspection
Fischer, Eugen
2018-04-01
Analogical reasoning is often employed in problem-solving and metaphor interpretation. This paper submits that, as a default, analogical reasoning addressing these different tasks employs different mapping strategies. In problem-solving, it employs analogy-maximising strategies (like structure mapping, Gentner, D., & Markman, A. B. (1997). Structure mapping in analogy and similarity. American Psychologist, 52, 45-56); in metaphor interpretation, analogy-minimising strategies (like ATT-Meta, Barnden, J. A. (2015). Open-ended elaborations in creative metaphor. In T. R. Besold, M. Schorlemmer, & A. Smaill (Eds.), Computational creativity research: Towards creative machines (pp. 217-242). Berlin: Springer). The two strategies interact in analogical reasoning with conceptual metaphors. This interaction leads to predictable fallacies. The paper supports these hypotheses through case-studies on "mind" metaphors from ordinary discourse, and abstract problem-solving in the philosophy of mind, respectively. It shows that (1) default metaphorical interpretations for vision- and space-cognition metaphors can be derived with a variant of the analogy-minimising ATT-Meta approach, (2) philosophically influential introspective conceptions of the mind can be derived with conceptual metaphors only through an analogy-maximising strategy, and (3) the interaction of these strategies leads to hitherto unrecognised fallacies in analogical reasoning with metaphors. This yields a debunking explanation of introspective conceptions.
Frequency of Chlamydia trachomatis in genital specimens: kerman city, PCR method
Directory of Open Access Journals (Sweden)
Khalili M
2008-06-01
Full Text Available Background: Chlamydia trachomatis (CT is an obligate intracellular bacterium that causes genital disease and the most common sexually transmitted infection in the world. The most frequent risk factors associated with chlamydial infection are related to sexual behavior, multiple partners, and inconsistent condom use. Presenting primarily as urtheritis in men and cervicitis in women, CT a major cause of chronic pelvic inflammatory disease and subsequent infertility in women, eye and lung infection in newborns and other manifestations. Identification of CT-infected patients may prevent its spread and thereby reduce the high morbidity associated with CT infections. Polymerase chain reaction (PCR is a sensitive and specific method for the detection of small quantity of bacterial DNA in clinical samples. The aim of this study was to determine the frequency of C. trachomatis by PCR in genital samples from patients in the city of Kerman.Methods: A total of 130 genital samples including 64 endocervical and 66 urethral swab samples were collected by physicians. Nucleic acid was extracted from each sample using a commercial DNA extraction kit. PCR primers specific for a conserved region of the C. trachomatis omp2 gene, encoding an outer membrane protein, were used for amplification. Results: A total of 9.2% (6.25% of cervicitis and 12.1% of urethritis of the samples were found positive for CT using this PCR method. Conclusions: The present study shows a high prevalence of CT infection, especially in men with urethritis. Such patients should be referred to genitourinary clinics for treatment and partner notification. Given its worldwide prevalence, further CT studies on more populations are needed to assess potential public health implications of these infections.
Increased efficacy for in-house validation of real-time PCR GMO detection methods.
Scholtens, I M J; Kok, E J; Hougs, L; Molenaar, B; Thissen, J T N M; van der Voet, H
2010-03-01
To improve the efficacy of the in-house validation of GMO detection methods (DNA isolation and real-time PCR, polymerase chain reaction), a study was performed to gain insight in the contribution of the different steps of the GMO detection method to the repeatability and in-house reproducibility. In the present study, 19 methods for (GM) soy, maize canola and potato were validated in-house of which 14 on the basis of an 8-day validation scheme using eight different samples and five on the basis of a more concise validation protocol. In this way, data was obtained with respect to the detection limit, accuracy and precision. Also, decision limits were calculated for declaring non-conformance (>0.9%) with 95% reliability. In order to estimate the contribution of the different steps in the GMO analysis to the total variation variance components were estimated using REML (residual maximum likelihood method). From these components, relative standard deviations for repeatability and reproducibility (RSD(r) and RSD(R)) were calculated. The results showed that not only the PCR reaction but also the factors 'DNA isolation' and 'PCR day' are important factors for the total variance and should therefore be included in the in-house validation. It is proposed to use a statistical model to estimate these factors from a large dataset of initial validations so that for similar GMO methods in the future, only the PCR step needs to be validated. The resulting data are discussed in the light of agreed European criteria for qualified GMO detection methods.
Shibuta, K; Abe, M; Suzuki, T
1994-01-01
The K variant of human butyrylcholinesterase is caused by a G/A transition in the butyrylcholinesterase gene, which neither creates nor destroys any restriction site. In an attempt to detect the K variant both simply and rapidly, we developed a two step method of "PCR primer introduced restriction analysis" (PCR-PIRA). The first step was used to introduce a new Fun4HI site into the normal allele for a screening test, while the second step was performed to create a new MaeIII site on the variant allele for a specific test. This method thus enabled us to distinguish clearly the K variant from the normal allele, and also showed that the frequency of the K variant allele is 0.164 in the Japanese population. Images PMID:7966197
Comparison of three mycobacterial DNA extraction methods from extrapulmonary samples for PCR assay
Directory of Open Access Journals (Sweden)
Khandaker Shadia
2012-01-01
Full Text Available Sensitivity of the molecular diagnostic tests of extrapulmonary tuberculosis largely depends upon the efficiency of DNA extraction methods. The objective of our study was to compare three methods of extracting DNA of Mycobacterium tuberculosis for testing by polymerase chain reaction. All three methods; heating, heating with sonication and addition of lysis buffer with heating and sonication were implicated on 20 extrapulmonary samples. PCR positivity was 2 (10%, 4 (20% and 7 (35% in the samples extracted by heating, heat+sonication and heat+sonication+lysis buffer method respectively. Of the extraction methods evaluated, maximum PCR positive results were achieved by combined heat, sonication and lysis buffer method which can be applied in routine clinical practice. Ibrahim Med. Coll. J. 2012; 6(1: 9-11
DAT/SERT Selectivity of Flexible GBR 12909 Analogs Modeled Using 3D-QSAR Methods
Gilbert, Kathleen M.; Boos, Terrence L.; Dersch, Christina M.; Greiner, Elisabeth; Jacobson, Arthur E.; Lewis, David; Matecka, Dorota; Prisinzano, Thomas E.; Zhang, Ying; Rothman, Richard B.; Rice, Kenner C.; Venanzi, Carol A.
2007-01-01
The dopamine reuptake inhibitor GBR 12909 (1-{2-[bis(4-fluorophenyl)methoxy]ethyl}-4-(3-phenylpropyl)piperazine, 1) and its analogs have been developed as tools to test the hypothesis that selective dopamine transporter (DAT) inhibitors will be useful therapeutics for cocaine addiction. This 3D-QSAR study focuses on the effect of substitutions in the phenylpropyl region of 1. CoMFA and CoMSIA techniques were used to determine a predictive and stable model for the DAT/serotonin transporter (SERT) selectivity (represented by pKi (DAT/SERT)) of a set of flexible analogs of 1, most of which have eight rotatable bonds. In the absence of a rigid analog to use as a 3D-QSAR template, six conformational families of analogs were constructed from six pairs of piperazine and piperidine template conformers identified by hierarchical clustering as representative molecular conformations. Three models stable to y-value scrambling were identified after a comprehensive CoMFA and CoMSIA survey with Region Focusing. Test set correlation validation led to an acceptable model, with q2 = 0.508, standard error of prediction = 0.601, two components, r2 = 0.685, standard error of estimate = 0.481, F value = 39, percent steric contribution = 65, and percent electrostatic contribution = 35. A CoMFA contour map identified areas of the molecule that affect pKi (DAT/SERT). This work outlines a protocol for deriving a stable and predictive model of the biological activity of a set of very flexible molecules. PMID:17127069
Open-Source Wax RepRap 3-D Printer for Rapid Prototyping Paper-Based Microfluidics.
Pearce, J M; Anzalone, N C; Heldt, C L
2016-08-01
The open-source release of self-replicating rapid prototypers (RepRaps) has created a rich opportunity for low-cost distributed digital fabrication of complex 3-D objects such as scientific equipment. For example, 3-D printable reactionware devices offer the opportunity to combine open hardware microfluidic handling with lab-on-a-chip reactionware to radically reduce costs and increase the number and complexity of microfluidic applications. To further drive down the cost while improving the performance of lab-on-a-chip paper-based microfluidic prototyping, this study reports on the development of a RepRap upgrade capable of converting a Prusa Mendel RepRap into a wax 3-D printer for paper-based microfluidic applications. An open-source hardware approach is used to demonstrate a 3-D printable upgrade for the 3-D printer, which combines a heated syringe pump with the RepRap/Arduino 3-D control. The bill of materials, designs, basic assembly, and use instructions are provided, along with a completely free and open-source software tool chain. The open-source hardware device described here accelerates the potential of the nascent field of electrochemical detection combined with paper-based microfluidics by dropping the marginal cost of prototyping to nearly zero while accelerating the turnover between paper-based microfluidic designs. © 2016 Society for Laboratory Automation and Screening.
Detection of Mycoplasma synoviae in clinical samples by VlhA-PCR method
Directory of Open Access Journals (Sweden)
H Ansari
2010-02-01
Full Text Available As one of the major pathogens of avian species, Mycoplasma Synoviae causes significant economic losses to the poultry industry. The main purpose of this study was to detect Mycoplasma Synoviae in clinical samples using the VlhA-PCR method. For serological screening test, 373 serum samples were collected from 25 breeder farms and rapid serum agglutination test conducted which revealed that 143 samples equivalent to 19 breeder farms were positive. For VlhA-PCR assay, 20 of the previously mentioned breeder farms were selected and sterile swab were collected from the palatine cleft, trachea, air sacs and lungs. Three swabs from 3 birds were placed in a test tube containing 1 ml of PBS and transferred to the laboratory for PCR test. Specific primers for VIhA gene were employed in this study. The PCR product from specific primers showed 350-400 bp for all field isolated on electrophoresis gel in 8 farms. VlhA-PCR with high sensitivity could be employed in definitive diagnosis of Mycoplasma Synoviae infection in the laboratory.
Directory of Open Access Journals (Sweden)
Maryam AlTamimi
2017-01-01
Full Text Available Dissemination of carbapenem resistance via Enterobacteriaceae, particularly among Klebsiella pneumoniae and Escherichia coli, is a major public health concern. Rapid methods for determining antimicrobial susceptibility are important to ensure adequate and appropriate use of antimicrobial agents and to limit the spread of these bacteria. In the current study, we compared the rapidity, sensitivity and specificity of traditional methods and molecular-based Xpert Carba-R PCR assay to identify sixty isolates, (26 E. coli and 34 K. pneumoniae. The specificity of MicroScan was 100% while sensitivity to ertapenem (ERT, imipenem (IMI, and meropenem (MER was 93%, 68.9%, and 55.17%, respectively. For the modified Hodge test, the specificity was 96.77% and sensitivity was 89.65%. Although some results of phenotypic assays matched with the definite PCR identification, some results were misleading. Out of the 29 positive PCR samples, three samples of K. pneumoniae were negative for the MHT and one E. coli sample was MHT positive but negative for the PCR. Nine samples were positive for the PCR but were determined as carbapenem sensitive by MicroScan. While MicroScan and MHT requires several hours and multi-steps to obtain results, Xpert Carba-R PCR assay takes less than an hour. Therefore, we recommend using Gene xpert Carba-R assay for the optimal carbapenemnase detection with reducing material, manpower and cost. Also it is important to know the type of carbapenemase is present.
Somily, Ali M; Garaween, Ghada A; Abukhalid, Norah; Absar, Muhammad M; Senok, Abiola C
2016-03-01
In recent years, there has been a rapid dissemination of carbapenem resistant Enterobacteriaceae (CRE). This study aimed to compare phenotypic and molecular methods for detection and characterization of CRE isolates at a large tertiary care hospital in Saudi Arabia. This study was carried out between January 2011 and November 2013 at the King Khalid University Hospital (KKUH) in Saudi Arabia. Determination of presence of extended-spectrum beta-lactamases (ESBL) and carbapenem resistance was in accordance with Clinical and Laboratory Standards Institute (CLSI) guidelines. Phenotypic classification was done by the MASTDISCS(TM) ID inhibitor combination disk method. Genotypic characterization of ESBL and carbapenemase genes was performed by the Check-MDR CT102. Diversilab rep-PCR was used for the determination of clonal relationship. Of the 883 ESBL-positive Enterobacteriaceae detected during the study period, 14 (1.6%) isolates were carbapenem resistant. Both the molecular genotypic characterization and phenotypic testing were in agreement in the detection of all 8 metalo-beta-lactamases (MBL) producing isolates. Of these 8 MBL-producers, 5 were positive for blaNDM gene and 3 were positive for blaVIM gene. Molecular method identified additional blaOXA gene isolates while MASTDISCS(TM) ID detected one AmpC producer isolate. Both methods agreed in identifying 2 carbapenem resistant isolates which were negative for carbapenemase genes. Diversilab rep-PCR analysis of the 9 Klebsiella pneumoniae isolates revealed polyclonal distribution into eight clusters. MASTDISCS(TM) ID is a reliable simple cheap phenotypic method for detection of majority of carbapenemase genes with the exception of the blaOXA gene. We recommend to use such method in the clinical laboratory.
Directory of Open Access Journals (Sweden)
S Farnia
2009-05-01
Full Text Available "nBackground: The aim was to compare three different methods (direct examination, culture and PCR methods for the diagnosis of Acanthamoeba keratitis (AK in corneal scrapes."nMethods: Twenty eight corneal scrapes and contact lenses were collected from keratitis patients and referred to the Department of Medical Parasitology and Mycology, School of Public Health, Tehran University of Medical Sciences. Corneal scrapes were divided in three parts for direct examination, culture on non-nutrient agar and PCR analysis. PCR analysis was also performed using a 18S rRNA gene primer pair (DF3 region. DF3 (Diagnostic fragment 3 is a region of the nuclear small subunit ribosomal RNA gene which is specific for detecting Acanthamoeba strains."nResults: Acanthamoeba was the causative agent of keratitis in 50% of the patients. Direct smear of all prepared corneal scrapes in AK patients was negative and culture was positive in only 14.3% of the isolates. PCR analysis was positive in 71.4% of AK patients. These three methods were negative in corneal scrapes of non-AK patients. The sensitivity and specificity of PCR technique for the detection of Acanthamoeba sp. were calculated as 71.4% and 100%, respectively."nConclusion: According to high sensitivity and specificity of PCR-based method, this study confirmed that PCR using 18S rRNA gene primers (DF3 region is more useful for detecting AK cases compare to culture and direct microscopy methods.
Baser, Mustafa
2007-01-01
Students have difficulties in physics because of the abstract nature of concepts and principles. One of the effective methods for overcoming students' difficulties is the use of analogies to visualize abstract concepts to promote conceptual understanding. According to Iding, analogies are consistent with the tenets of constructivist learning…
Brandwein, Michael; Al-Quntar, Abed; Goldberg, Hila; Mosheyev, Gregory; Goffer, Moshe; Marin-Iniesta, Fulgencio; López-Gómez, Antonio; Steinberg, Doron
2016-01-01
Various surfaces associated with the storage and packing of food are known to harbor distinct bacterial pathogens. Conspicuously absent among the plethora of studies implicating food packaging materials and machinery is the study of corrugated cardboard packaging, the worldwide medium for transporting fresh produce. In this study, we observed the microbial communities of three different store-bought fruits and vegetables, along with their analog cardboard packaging using high throughput sequencing technology. We further developed an anti-biofilm polymer meant to coat corrugated cardboard surfaces and mediate bacterial biofilm growth on said surfaces. Integration of a novel thiazolidinedione derivative into the acrylic emulsion polymers was assessed using Energy Dispersive X-ray Spectrometry (EDS) analysis and surface topography was visualized and quantified on corrugated cardboard surfaces. Biofilm growth was measured using q-PCR targeting the gene encoding 16s rRNA. Additionally, architectural structure of the biofilm was observed using SEM. The uniform integration of the thiazolidinedione derivative TZD-6 was confirmed, and it was determined via q-PCR to reduce biofilm growth by ~80% on tested surfaces. A novel and effective method for reducing microbial load and preventing contamination on food packaging is thereby proposed.
Development of a rapid HRM genotyping method for detection of dog-derived Giardia lamblia.
Tan, Liping; Yu, Xingang; Abdullahi, Auwalu Yusuf; Wu, Sheng; Zheng, Guochao; Hu, Wei; Song, Meiran; Wang, Zhen; Jiang, Biao; Li, Guoqing
2015-11-01
Giardia lamblia is a zoonotic flagellate protozoan in the intestine of human and many mammals including dogs. To assess a threat of dog-derived G. lamblia to humans, the common dog-derived G. lamblia assemblages A, C, and D were genotyped by high-resolution melting (HRM) technology. According to β-giardin gene sequence, the qPCR-HRM primers BG5 and BG7 were designed. A series of experiments on the stability, sensitivity, and accuracy of the HRM method were also tested. Results showed that the primers BG5 and BG7 could distinguish among three assemblages A, C, and D, which Tm value differences were about 1 °C to each other. The melting curves of intra-assay reproducibility were almost coincided, and those of inter-assay reproducibility were much the same shape. The lowest detection concentration was about 5 × 10(-6)-ng/μL sample. The genotyping results from 21 G. lamblia samples by the HRM method were in complete accordance with sequencing results. It is concluded that the HRM genotyping method is rapid, stable, specific, highly sensitive, and suitable for clinical detection and molecular epidemiological survey of dog-derived G. lamblia.
Directory of Open Access Journals (Sweden)
Junan Ren
Full Text Available Meat adulteration is a worldwide concern. In this paper, a new droplet digital PCR (ddPCR method was developed for the quantitative determination of the presence of chicken in sheep and goat meat products. Meanwhile, a constant (multiplication factor was introduced to transform the ratio of copy numbers to the proportion of meats. The presented ddPCR method was also proved to be more accurate (showing bias of less than 9% in the range from 5% to 80% than real-time PCR, which has been widely used in this determination. The method exhibited good repeatability and stability in different thermal treatments and at ultra-high pressure. The relative standard deviation (RSD values of 5% chicken content was less than 5.4% for ultra-high pressure or heat treatment. Moreover, we confirmed that different parts of meat had no effect on quantification accuracy of the ddPCR method. In contrast to real-time PCR, we examined the performance of ddPCR as a more precise, sensitive and stable analytical strategy to overcome potential problems of discrepancies in amplification efficiency discrepancy and to obtain the copy numbers directly without standard curves. The method and strategy developed in this study can be applied to quantify the presence and to confirm the absence of adulterants not only to sheep but also to other kinds of meat and meat products.
Directory of Open Access Journals (Sweden)
Koppel Juraj
2007-12-01
Full Text Available Abstract Background Fluorescent data obtained from real-time PCR must be processed by some method of data analysis to obtain the relative quantity of target mRNA. The method chosen for data analysis can strongly influence results of the quantification. Results To compare the performance of six techniques which are currently used for analysing fluorescent data in real-time PCR relative quantification, we quantified four cytokine transcripts (IL-1β, IL-6 TNF-α, and GM-CSF in an in vivo model of colonic inflammation. Accuracy of the methods was tested by quantification on samples with known relative amounts of target mRNAs. Reproducibility of the methods was estimated by the determination of the intra-assay and inter-assay variability. Cytokine expression normalized to the expression of three reference genes (ACTB, HPRT, SDHA was then determined using the six methods for data analysis. The best results were obtained with the relative standard curve method, comparative Ct method and with DART-PCR, LinRegPCR and Liu & Saint exponential methods when average amplification efficiency was used. The use of individual amplification efficiencies in DART-PCR, LinRegPCR and Liu & Saint exponential methods significantly impaired the results. The sigmoid curve-fitting (SCF method produced medium performance; the results indicate that the use of appropriate type of fluorescence data and in some instances manual selection of the number of amplification cycles included in the analysis is necessary when the SCF method is applied. We also compared amplification efficiencies (E and found that although the E values determined by different methods of analysis were not identical, all the methods were capable to identify two genes whose E values significantly differed from other genes. Conclusion Our results show that all the tested methods can provide quantitative values reflecting the amounts of measured mRNA in samples, but they differ in their accuracy and
Directory of Open Access Journals (Sweden)
Matías Muraca
2011-12-01
Full Text Available Este artigo tem como objetivo revisar e analisar como aparece a discussão sobre República ao longo dos anos de redemocratização na Argentina, articulando com outra categoria da teoria política: o populismo. Os conteúdos e sentidos da demanda republicana que se conjuga com populismo são analisados nas edições de um dos mais importantes jornais argentinos durante o segundo governo de Carlos Saúl Menem (1995-1999 e o governo de Aliança (1999-2001. Especificamente, é revisado nas Colunas de Opinião do Diário “La Nación” a primeira etapa das críticas republicanas centradas em um dos seus componentes principais: a questão da corrupção associada a problemática da moral.
Hussain, Musaddeq
2015-11-10
Chinese hamster ovary (CHO) cells are the host cell of choice for manufacturing of monoclonal antibody (mAb) drugs in the biopharmaceutical industry. Host cell DNA is an impurity of such manufacturing process and must be controlled and monitored in order to ensure drug purity and safety. A conventional method for quantification of host residual DNA in drug requires extraction of DNA from the mAb drug substance with subsequent quantification of the extracted DNA using real-time PCR (qPCR). Here we report a method where the DNA extraction step is eliminated prior to qPCR. In this method, which we have named 'direct resDNA qPCR', the mAb drug substance is digested with a protease called KAPA in a 96-well PCR plate, the protease in the digest is then denatured at high temperature, qPCR reagents are added to the resultant reaction wells in the plate along with standards and controls in other wells of the same plate, and the plate subjected to qPCR for analysis of residual host DNA in the samples. This direct resDNA qPCR method for CHO is sensitive to 5.0fg of DNA with high precision and accuracy and has a wide linear range of determination. The method has been successfully tested with four mAbs drug, two IgG1 and two IgG4. Both the purified drug substance as well as a number of process intermediate samples, e.g., bioreactor harvest, Protein A column eluate and ion-exchange column eluates were tested. This method simplifies the residual DNA quantification protocol, reduces time of analysis and leads to increased assay sensitivity and development of automated high-throughput methods. Copyright © 2015 Elsevier B.V. All rights reserved.
Diazaquinomycins E–G, Novel Diaza-Anthracene Analogs from a Marine-Derived Streptomyces sp.
Directory of Open Access Journals (Sweden)
Michael W. Mullowney
2014-06-01
Full Text Available As part of our program to identify novel secondary metabolites that target drug-resistant ovarian cancers, a screening of our aquatic-derived actinomycete fraction library against a cisplatin-resistant ovarian cancer cell line (OVCAR5 led to the isolation of novel diaza-anthracene antibiotic diazaquinomycin E (DAQE; 1, the isomeric mixture of diazaquinomycin F (DAQF; 2 and diazaquinomycin G (DAQG; 3, and known analog diazaquinomycin A (DAQA; 4. The structures of DAQF and DAQG were solved through deconvolution of X-Ray diffraction data of their corresponding co-crystal. DAQE and DAQA exhibited moderate LC50 values against OVCAR5 of 9.0 and 8.8 μM, respectively. At lethal concentrations of DAQA, evidence of DNA damage was observed via induction of apoptosis through cleaved-PARP. Herein, we will discuss the isolation, structure elucidation, and biological activity of these secondary metabolites.
Alkaline Extraction of DNA from Pathogenic Fungi for PCR-RFLP Analysis
Matsumoto, Masaru; Mishima, Shinobu; Matsuyama, Nobuaki; 松元, 賢; 松山, 宣明
1997-01-01
For the preparation of DNA samples from fungal mycelia alkaline extraction method was applied and assessed its usefulness for PCR-RFLP analysis. Using alkaline treatment protocols, 18S ribosomal DNAs (rDNA) derived from fungal genomic DNA of Pyricularia oryzae, P. zingiberi, Rhizoctonia solani and R. oryzae were PCR-amplified and digested with Hha I, Msp I and Hae ill. RFLP analysis with HhaI showed the divergent polymorphism between genus Pyricularia and Rhizoctonia. The alkaline DNA extract...
Directory of Open Access Journals (Sweden)
Tomasz Kulik
2012-12-01
Full Text Available We identified a species level of the fungal cultures isolated from selected crop seeds using traditional method and BIO-PCR. The use of BIO-PCR did not correspond completely to the morphological analyses. Both methods showed increased infection with F. poae in winter wheat seed sample originated from north Poland. Fungal culture No 40 (isolated from faba bean and identified with traditional method as mixed culture with F. culmorum and F. graminearum did not produce expected product after PCR reaction with species specific primers OPT18F470, OPT18R470. However, the use of additional primers Fc01F, Fc01R allowed for reliable identification of F. culmorum in the culture.
Real-Time PCR (qPCR) Primer Design Using Free Online Software
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…
EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. The viral ribonucleic acid (RNA) from water sample concentrates is extracted and tested for enterovirus and norovirus RNA using reverse transcription-quantitative PCR (RT-qPCR). V...
Theory of analogous force on number sets
Energy Technology Data Exchange (ETDEWEB)
Canessa, Enrique [Abdus Salam International Centre for Theoretical Physics, Trieste (Italy)
2003-08-01
A general statistical thermodynamic theory that considers given sequences of x-integers to play the role of particles of known type in an isolated elastic system is proposed. By also considering some explicit discrete probability distributions p{sub x} for natural numbers, we claim that they lead to a better understanding of probabilistic laws associated with number theory. Sequences of numbers are treated as the size measure of finite sets. By considering p{sub x} to describe complex phenomena, the theory leads to derive a distinct analogous force f{sub x} on number sets proportional to ({partial_derivative}p{sub x}/{partial_derivative}x){sub T} at an analogous system temperature T. In particular, this yields to an understanding of the uneven distribution of integers of random sets in terms of analogous scale invariance and a screened inverse square force acting on the significant digits. The theory also allows to establish recursion relations to predict sequences of Fibonacci numbers and to give an answer to the interesting theoretical question of the appearance of the Benford's law in Fibonacci numbers. A possible relevance to prime numbers is also analyzed. (author)
Directory of Open Access Journals (Sweden)
Lu Jia
2011-10-01
Full Text Available Abstract Background Although a variety of methods and expensive kits are available, molecular cloning can be a time-consuming and frustrating process. Results Here we report a highly simplified, reliable, and efficient PCR-based cloning technique to insert any DNA fragment into a plasmid vector or into a gene (cDNA in a vector at any desired position. With this method, the vector and insert are PCR amplified separately, with only 18 cycles, using a high fidelity DNA polymerase. The amplified insert has the ends with ~16-base overlapping with the ends of the amplified vector. After DpnI digestion of the mixture of the amplified vector and insert to eliminate the DNA templates used in PCR reactions, the mixture is directly transformed into competent E. coli cells to obtain the desired clones. This technique has many advantages over other cloning methods. First, it does not need gel purification of the PCR product or linearized vector. Second, there is no need of any cloning kit or specialized enzyme for cloning. Furthermore, with reduced number of PCR cycles, it also decreases the chance of random mutations. In addition, this method is highly effective and reproducible. Finally, since this cloning method is also sequence independent, we demonstrated that it can be used for chimera construction, insertion, and multiple mutations spanning a stretch of DNA up to 120 bp. Conclusion Our FastCloning technique provides a very simple, effective, reliable, and versatile tool for molecular cloning, chimera construction, insertion of any DNA sequences of interest and also for multiple mutations in a short stretch of a cDNA.
A mutant screening method by critical annealing temperature-PCR for site-directed mutagenesis.
Liu, Ying; Wu, Ting; Song, Jian; Chen, Xuelian; Zhang, Yu; Wan, Yu
2013-03-11
Distinguishing desired mutants from parental templates and undesired mutants is a problem not well solved in Quikchange™ mutagenesis. Although Dpn I digestion can eliminate methylated parental (WT) DNA, the efficiency is not satisfying due to the existence of hemi-methylated DNA in the PCR products, which is resistant to Dpn I. The present study designed a novel critical annealing temperature (T(c))-PCR to replace Dpn I digestion for more perfect mutant distinguishing, in which part-overlapping primers containing mutation(s) were used to reduce initial concentration of template DNA in mutagenic PCR. A T(c)-PCR with the same mutagenic primers was performed without Dpn I digestion. The T(c) for each pair of the primers was identified by gradient PCR. The relationship between PCR-identified T(c) and T(m) of the primers was analyzed and modeled with correlation and regression. Gradient PCR identified a T(c) for each of 14 tested mutagenic primers, which could discriminate mismatched parental molecules and undesired mutants from desired mutants. The PCR-identified T(c) was correlated to the primer's T(m) (r = 0.804, P<0.0001). Thus, in practical applications, the T(c) can be easily calculated with a regression equation, T(c)= 48.81 + 0.253*T(m). The new protocol introduced a novel T(c)-PCR method for mutant screening which can more efficiently and accurately select against parental molecules and undesired mutations in mutagenic sequence segments.
A república e o sonho The republic and its dream
Directory of Open Access Journals (Sweden)
Maria Tereza Chaves de Mello
2011-06-01
Full Text Available O desencanto com a República brasileira tem sido tema de reflexões desde os seus momentos iniciais. Buscando os conteúdos concretos dos sonhos republicanos na década de 1880 e na Primeira República vamos achar uma importante defasagem entre eles não exatamente em função do marco cronológico, mas do grupo social que, respectivamente, os acalentou.The disillusion with the Brazilian Republic since its first days has been a topic of academician reflexions. Examinating the concrete contents of the 1880`s and the First Republic republican dreams we will find a substantive difference between them. To be exact, this difference must not be related to the chronological demarcation but to the social group that embraced each of them.
A quantitative method to evaluate mesenchymal stem cell lipofection using real-time PCR.
Ribeiro, S C; Mendes, R; Madeira, C; Monteiro, G A; da Silva, C L; Cabral, J M S
2010-01-01
Genetic modification of human mesenchymal stem cells (MSC) is a powerful tool to improve the therapeutic utility of these cells and to increase the knowledge on their regulation mechanisms. In this context, strong efforts have been made recently to develop efficient nonviral gene delivery systems. Although several studies addressed this question most of them use the end product of a reporter gene instead of the DNA uptake quantification to test the transfection efficiency. In this study, we established a method based on quantitative real-time PCR (RT-PCR) to determine the intracellular plasmid DNA copy number in human MSC after lipofection. The procedure requires neither specific cell lysis nor DNA purification. The influence of cell number on the RT-PCR sensitivity was evaluated. The method showed good reproducibility, high sensitivity, and a wide linear range of 75-2.5 x 10⁶ plasmid DNA copies per cell. RT-PCR results were then compared with the percentage of transfected cells assessed by flow cytometry analysis, which showed that flow cytometry-based results are not always proportional to plasmid cellular uptake determined by RT-PCR. This work contributed for the establishment of a rapid quantitative assay to determine intracellular plasmid DNA in stem cells, which will be extremely beneficial for the optimization of gene delivery strategies. © 2010 American Institute of Chemical Engineers
Inoue, Hiroaki; Takama, Tomoko; Yoshizaki, Miwa; Agata, Kunio
2015-01-01
We detected Legionella species in 111 bath water samples and 95 cooling tower water samples by using a combination of conventional plate culture, quantitative polymerase chain reaction (qPCR) and qPCR combined with ethidium monoazide treatment (EMA-qPCR) methods. In the case of bath water samples, Legionella spp. were detected in 30 samples by plate culture, in 85 samples by qPCR, and in 49 samples by EMA-qPCR. Of 81 samples determined to be Legionella-negative by plate culture, 56 and 23 samples were positive by qPCR and EMA-qPCR, respectively. Therefore, EMA treatment decreased the number of Legionella-positive bath water samples detected by qPCR. In contrast, EMA treatment had no effect on cooling tower water samples. We therefore expect that EMA-qPCR is a useful method for the rapid detection of viable Legionella spp. from bath water samples.
A Novel Green Synthesis of Thalidomide and Analogs
Directory of Open Access Journals (Sweden)
Ellis Benjamin
2017-01-01
Full Text Available Thalidomide and its derivatives are currently under investigation for their antiangiogenic, immunomodulative, and anticancer properties. Current methods used to synthesize these compounds involve multiple steps and extensive workup procedures. Described herein is an efficient microwave irradiation green synthesis method that allows preparation of thalidomide and its analogs in a one-pot multicomponent synthesis system. The multicomponent synthesis system developed involves an array of cyclic anhydrides, glutamic acid, and ammonium chloride in the presence of catalytic amounts of 4-N,N-dimethylaminopyridine (DMAP to produce thalidomide and structurally related compounds within minutes in good isolated yields.
Directory of Open Access Journals (Sweden)
Dilley Robert
2009-01-01
Full Text Available Abstract Background Adeno-associated virus (AAV vectors are promising tools for gene therapy. Currently, their potential is limited by difficulties in producing high vector yields with which to generate transgene protein product. AAV vector production depends in part upon the replication (Rep proteins required for viral replication. We tested the hypothesis that mutations in the start codon and upstream regulatory elements of Rep78/68 in AAV helper plasmids can regulate recombinant AAV (rAAV vector production. We further tested whether the resulting rAAV vector preparation augments the production of the potentially therapeutic transgene, insulin-like growth factor I (IGF-I. Results We constructed a series of AAV helper plasmids containing different Rep78/68 start codon in combination with different gene regulatory sequences. rAAV vectors carrying the human IGF-I gene were prepared with these vectors and the vector preparations used to transduce HT1080 target cells. We found that the substitution of ATG by ACG in the Rep78/68 start codon in an AAV helper plasmid (pAAV-RC eliminated Rep78/68 translation, rAAV and IGF-I production. Replacement of the heterologous sequence upstream of Rep78/68 in pAAV-RC with the AAV2 endogenous p5 promoter restored translational activity to the ACG mutant, and restored rAAV and IGF-I production. Insertion of the AAV2 p19 promoter sequence into pAAV-RC in front of the heterologous sequence also enabled ACG to function as a start codon for Rep78/68 translation. The data further indicate that the function of the AAV helper construct (pAAV-RC, that is in current widespread use for rAAV production, may be improved by replacement of its AAV2 unrelated heterologous sequence with the native AAV2 p5 promoter. Conclusion Taken together, the data demonstrate an interplay between the start codon and upstream regulatory sequences in the regulation of Rep78/68 and indicate that selective mutations in Rep78/68 regulatory elements
Antimicrobial and cell-penetrating properties of penetratin analogs
DEFF Research Database (Denmark)
Bahnsen, Jesper Søborg; Franzyk, Henrik; Sandberg-Schaal, Anne
2013-01-01
Cell-penetrating peptides (CPPs) and antimicrobial peptides (AMPs) show great potential as drug delivery vectors and new antibiotic drug entities, respectively. The current study deals with the properties of a variety of peptide analogs derived from the well-known CPP penetratin as well as octaar......Cell-penetrating peptides (CPPs) and antimicrobial peptides (AMPs) show great potential as drug delivery vectors and new antibiotic drug entities, respectively. The current study deals with the properties of a variety of peptide analogs derived from the well-known CPP penetratin as well...... as octaarginine and different Tat sequences. The effects of peptide length, guanidinium content, and sequence of non-cationic residues were assessed in mammalian and bacterial cells. The arginine (Arg) content in the penetratin analogs was found to influence eukaryotic cell uptake efficiency, antimicrobial...... was similar, the eukaryotic cellular uptake of the shuffled analogs was noticeably lower than for native penetratin. Moreover, a point substitution of Met to Leu in native penetratin had no influence on eukaryotic cellular uptake and antimicrobial effect, and only a minor effect on cytotoxicity, in contrast...
Design rules for superconducting analog-digital transducers
International Nuclear Information System (INIS)
Haddad, Taghrid
2015-01-01
This Thesis is a contribution for dimensioning aspects of circuits designs in superconductor electronics. Mainly superconductor comparators inclusive Josephson comparators as well as QOJS-Comparators are investigated. Both types were investigated in terms of speed and sensitivity. The influence of the thermal noise on the decision process of the comparators represent in so called gray zone, which is analysed in this thesis. Thereby, different relations between design parameters were derived. A circuit model of the Josephson comparator was verified by experiments. Concepts of superconductor analog-to-digital converters, which are based on above called comparators, were investigated in detail. From the comparator design rules, new rules for AD-converters were derived. Because of the reduced switching energy, the signal to noise ratio (SNR) of the circuits is affected and therefore the reliability of the decision-process is affected. For special applications with very demanding requirements in terms of the speed and accuracy superconductor analog-to-digital converters offer an excellent performance. This thesis provides relations between different design paramenters and shows resulting trade-offs, This method is transparent and easy to transfer to other circuit topologies. As a main result, a highly predictive tool for dimensioning of superconducting ADC's is proved.
Robinson, S; Follo, M; Haenel, D; Mauler, M; Stallmann, D; Tewari, M; Duerschmied, D; Peter, K; Bode, C; Ahrens, I; Hortmann, M
2018-04-15
micro-RNAs have shown promise as potential biomarkers for acute myocardial infarction and ischemia-reperfusion injury (I/R). Most recently droplet digital polymerase chain reaction (ddPCR) has been introduced as a more reliable and reproducible method for detecting micro-RNAs. We aimed to demonstrate the improved technical performance and diagnostic potential of ddPCR by measuring micro-RNAs in ST-elevation myocardial infarction (STEMI). A dilution series was performed in duplicate on synthetic Caenorrhabditis elegans-miR-39, comparing quantitative real-time PCR (qRT-PCR) and ddPCR. We used ddPCR and qRT-PCR to quantify the serum levels of miR-21, miR-208a and miR-499 between STEMI patients (n=24) and stable coronary artery disease (CAD) patients (n=20). In STEMI, I/R injury was assessed via measurement of ST-segment resolution. In the dilution series, ddPCR demonstrated superior coefficient of variation (12.1%vs.32.9%) and limit of detection (0.9325 vs.2.425copies/μl). In the patient cohort, ddPCR demonstrated greater differences in miR-21 levels (2190.5 vs. 484.7copies/μl; p=0.0004 for ddPCR and 136.4 vs. 122.8copies/μl; p=0.2273 for qRT-PCR) and in miR-208a (0 vs. 24.1copies/μl, p=0.0013 for ddPCR and 0 vs. 0copies/μl, p=0.0032 for qRT-PCR), with similar differences observed in miR-499 levels (9.4 vs. 81.5copies/μl, pPCR). ddPCR also more accurately defined STEMI for all miRNAs (area under the curve (AUC) of 0.8021/0.7740/0.9063 for miR-21/208a/499 with ddPCR vs. AUC of 0.6083/0.6917/0.8417 with qRT-PCR). However, there was no association between miR-21/208a/499 levels and ischemia-reperfusion injury. ddPCR demonstrates superiority in both technical performance and diagnostic potential compared to qRT-PCR. Ultimately, this supports its use as a diagnostic method for quantifying micro-RNAs, particularly in large multi-center trials. Copyright © 2017 Elsevier B.V. All rights reserved.
MARCELINO-GUIMARÃES, F. C.; GUIMARÃES, M. F. M.; DE-BARROS, E. G.
2009-01-01
The increasing presence of products derived from genetically modified (GM) plants in human and animal diets has led to the development of detection methods to distinguish biotechnology-derived foods from conventional ones. The conventional and real-time PCR have been used, respectively, to detect and quantify GM residues in highly processed foods. DNA extraction is a critical step during the analysis process. Some factors such as DNA degradation, matrix effects, and the presence of PCR inhibi...
Validation of a same-day real-time PCR method for screening of meat and carcass swabs for Salmonella
DEFF Research Database (Denmark)
Löfström, Charlotta; Krause, Michael; Josefsen, Mathilde Hartmann
2009-01-01
of the published PCR methods for Salmonella have been validated in collaborative studies. This study describes a validation including comparative and collaborative trials, based on the recommendations from the Nordic organization for validation of alternative microbiological methods (NordVal) of a same-day, non....... Partly based on results obtained in this study, the method has obtained NordVal approval for analysis of Salmonella in meat and carcass swabs. The PCR method was transferred to a production laboratory and the performance was compared with the BAX Salmonella test on 39 pork samples artificially...... contaminated with Salmonella. There was no significant difference in the results obtained by the two methods. Conclusion: The real-time PCR method for detection of Salmonella in meat and carcass swabs was validated in comparative and collaborative trials according to NordVal recommendations. The PCR method...
Structure problems in the analog computation
International Nuclear Information System (INIS)
Braffort, P.L.
1957-01-01
The recent mathematical development showed the importance of elementary structures (algebraic, topological, etc.) in abeyance under the great domains of classical analysis. Such structures in analog computation are put in evidence and possible development of applied mathematics are discussed. It also studied the topological structures of the standard representation of analog schemes such as additional triangles, integrators, phase inverters and functions generators. The analog method gives only the function of the variable: time, as results of its computations. But the course of computation, for systems including reactive circuits, introduces order structures which are called 'chronological'. Finally, it showed that the approximation methods of ordinary numerical and digital computation present the same structure as these analog computation. The structure analysis permits fruitful comparisons between the several domains of applied mathematics and suggests new important domains of application for analog method. (M.P.)
Uchiyama, Nahoko; Shimokawa, Yoshihiko; Kikura-Hanajiri, Ruri; Demizu, Yosuke; Goda, Yukihiro; Hakamatsuka, Takashi
Six new psychoactive substances were identified together with two other substances (compounds 1 - 8 ) in illegal products by our ongoing survey in Japan between January and July 2014. A new synthetic cannabinoid, FDU-NNEI [1-(4-fluorobenzyl)- N -(naphthalen-1-yl)-1 H -indole-3-carboxamide, 2 ], was detected with the newly distributed synthetic cannabinoid FDU-PB-22 ( 1 ). Two 2 H -indazole isomers of synthetic cannabinoids, AB-CHMINACA 2 H -indazole analog ( 3 ) and NNEI 2 H -indazole analog ( 4 ), were newly identified with 1 H -indazoles [AB-CHMINACA and NNEI indazole analog (MN-18)]. In addition, 2-methylpropyl N -(naphthalen-1-yl) carbamate ( 5 ) and isobutyl 1-pentyl-1 H -indazole-3-carboxylate ( 6 ) were detected in illegal products. Compound 6 is considered to be a by-product of the preparation of NNEI indazole analog from compound 5 and 1-pentyl-1 H -indazole. A phenethylamine derivative, N -OH-EDMA [ N -hydroxy-3,4-ethylenedioxy- N -methylamphetamine, 7 ], and a cathinone derivative, dimethoxy-α-PHP (dimethoxy-α-pyrrolidinohexanophenone, 8 ), were newly identified in illegal products. Among them, compounds 1 and 8 have been controlled as designated substances (Shitei-Yakubutsu) under the Pharmaceutical Affairs Law in Japan since August and November 2014, respectively.
Methods for microbial DNA extraction from soil for PCR amplification
Directory of Open Access Journals (Sweden)
Yeates C
1998-01-01
Full Text Available Amplification of DNA from soil is often inhibited by co-purified contaminants. A rapid, inexpensive, large-scale DNA extraction method involving minimal purification has been developed that is applicable to various soil types (1. DNA is also suitable for PCR amplification using various DNA targets. DNA was extracted from 100g of soil using direct lysis with glass beads and SDS followed by potassium acetate precipitation, polyethylene glycol precipitation, phenol extraction and isopropanol precipitation. This method was compared to other DNA extraction methods with regard to DNA purity and size.
High-rep-rate Thomson scattering for LHD
den Hartog, D. J.; Borchardt, M. T.; Holly, D. J.; Schmitz, O.; Yasuhara, R.; Yamada, I.; Funaba, H.; Osakabe, M.; Morisaki, T.
2017-10-01
A high-rep-rate pulse-burst laser system is being built for the LHD Thomson scattering (TS) diagnostic. This laser will have two operating scenarios, a fast-burst sequence of 15 kHz rep rate for at least 15 ms, and a slow-burst sequence of 1 kHz for at least 50 ms. There will be substantial flexibility in burst sequences for tailoring to experimental requirements. This new laser system will operate alongside the existing lasers in the LHD TS diagnostic, and will use the same beamline. This increase in temporal resolution capability complements the high spatial resolution (144 points) of the LHD TS diagnostic, providing unique measurement capability unmatched on any other fusion experiment. The new pulse-burst laser is a straightforward application of technology developed at UW-Madison, consisting of a Nd:YAG laser head with modular flashlamp drive units and a customized control system. Variable pulse-width drive of the flashlamps is accomplished by IGBT (insulated gate bipolar transistor) switching of electrolytic capacitor banks. Direct control of the laser Pockels cell drive enables optimal pulse energy extraction, producing >1.5 J q-switched pulses with 20 ns FWHM. Burst operation of this laser system will be used to capture fast time evolution of the electron temperature and density profiles during events such as ELMs, RMP perturbations, and various MHD modes. This work is supported by the U. S. Department of Energy and the National Institute for Fusion Science (Japan).
Vojkovska, H; Kubikova, I; Kralik, P
2015-03-01
Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014
Canine distemper virus detection by different methods of One-Step RT-qPCR
Directory of Open Access Journals (Sweden)
Claudia de Camargo Tozato
2016-01-01
Full Text Available ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A and a One-Step RT-qPCR combined with NESTED-qPCR (system B. Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100% urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology.
El Ecoturismo en los Humedales: Análisis de las Potencialidades de República Dominicana
Directory of Open Access Journals (Sweden)
Francisco Orgaz Agüera
2014-04-01
Full Text Available El turismo se configura como uno de los principales motores económicos de República Dominicana. En este sentido, el turismo de sol y playa es la principal tipología turística en el país. Aunque, República Dominicana cuenta con numerosas potencialidades turísticas para poner en marchas nuevas formas de turismo: Turismo gastronómico, turismo ornitológico, turismo cultural, ecoturismo, etc. El principal objetivo de esta investigación es analizar las potencialidades existentes en República Dominicana para desarrollar el ecoturismo en las zonas de humedales. La metodología ha consistido en un trabajo de campo, a través de las entrevistas, los grupos de discusión y la observación participante. Los resultados muestran las grandes potencialidades que tiene el país para desarrollar el ecoturismo en los humedales, y contribuir así, al desarrollo socioeconómico de las comunidades locales.
Han, Yang; Hou, Shao-Yang; Ji, Shang-Zhi; Cheng, Juan; Zhang, Meng-Yue; He, Li-Juan; Ye, Xiang-Zhong; Li, Yi-Min; Zhang, Yi-Xuan
2017-11-15
A novel method, real-time reverse transcription PCR (real-time RT-PCR) coupled with probe-melting curve analysis, has been established to detect two kinds of samples within one fluorescence channel. Besides a conventional TaqMan probe, this method employs another specially designed melting-probe with a 5' terminus modification which meets the same label with the same fluorescent group. By using an asymmetric PCR method, the melting-probe is able to detect an extra sample in the melting stage effectively while it almost has little influence on the amplification detection. Thus, this method allows the availability of united employment of both amplification stage and melting stage for detecting samples in one reaction. The further demonstration by simultaneous detection of human immunodeficiency virus (HIV) and hepatitis C virus (HCV) in one channel as a model system is presented in this essay. The sensitivity of detection by real-time RT-PCR coupled with probe-melting analysis was proved to be equal to that detected by conventional real-time RT-PCR. Because real-time RT-PCR coupled with probe-melting analysis can double the detection throughputs within one fluorescence channel, it is expected to be a good solution for the problem of low-throughput in current real-time PCR. Copyright © 2017 Elsevier Inc. All rights reserved.
Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.
Lee, Seong-Hun
2014-11-01
There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.
International Nuclear Information System (INIS)
Huang, Shuohao; Kawabe, Yoshinori; Ito, Akira; Kamihira, Masamichi
2012-01-01
Highlights: ► Adeno-associated virus (AAV) is capable of targeted integration in human cells. ► Integrase-defective retroviral vector (IDRV) enables a circular DNA delivery. ► A targeted integration system of IDRV DNA using the AAV integration mechanism. ► Targeted IDRV integration ameliorates the safety concerns for retroviral vectors. -- Abstract: Retroviral vectors have been employed in clinical trials for gene therapy owing to their relative large packaging capacity, alterable cell tropism, and chromosomal integration for stable transgene expression. However, uncontrollable integrations of transgenes are likely to cause safety issues, such as insertional mutagenesis. A targeted transgene integration system for retroviral vectors, therefore, is a straightforward way to address the insertional mutagenesis issue. Adeno-associated virus (AAV) is the only known virus capable of targeted integration in human cells. In the presence of AAV Rep proteins, plasmids possessing the p5 integration efficiency element (p5IEE) can be integrated into the AAV integration site (AAVS1) in the human genome. In this report, we describe a system that can target the circular DNA derived from non-integrating retroviral vectors to the AAVS1 site by utilizing the Rep/p5IEE integration mechanism. Our results showed that after G418 selection 30% of collected clones had retroviral DNA targeted at the AAVS1 site.
Mathematical analysis of the real time array PCR (RTA PCR) process
Dijksman, Johan Frederik; Pierik, A.
2012-01-01
Real time array PCR (RTA PCR) is a recently developed biochemical technique that measures amplification curves (like with quantitative real time Polymerase Chain Reaction (qRT PCR)) of a multitude of different templates in a sample. It combines two different methods in order to profit from the
Arbitrarily primed PCR- A rapid and simple method for typing of leptospiral serovars
Directory of Open Access Journals (Sweden)
Ramadass P
2002-01-01
Full Text Available PURPOSE: To investigate the use of arbitrarily primed polymerase chain reaction (AP-PCR for typing of leptospiral serovars. METHODS: AP-PCR was adopted for identification of laboratory strains of leptospires and leptospiral cultures at serovar level. A primer of 12 bp was used for amplifying DNA of 13 laboratory strains of leptospires as well as culture pellets of leptospires. RESULTS: Each serovar produced distinct DNA fingerprint which was characteristic for each serovar. These patterns were used for typing of 81 serum culture samples obtained from human leptospiral cases. Of these samples, 39 could be typed based on AP-PCR fingerprints belonging to serovars autumnalis, pomona, canicola, javanica, icterohaemorrhagiae, patoc and pyrogenes. These results were confirmed by RAPD fingerprinting of the DNA samples of the respective leptospiral serovars after culturing -FNx01them in EMJH media. One of the important findings of this work was that straight culture sample could be used for AP-PCR assay, without purification of DNA. By having more number of AP-PCR reference fingerprints, more serovars could be typed. CONCLUSIONS: AP-PCR technique provides great potential for simple and rapid identification of leptospires at serovar level, which could be useful in molecular epidemiological studies of leptospirosis.
Motamedi, Marjan; Mirhendi, Hossein; Zomorodian, Kamiar; Khodadadi, Hossein; Kharazi, Mahboobeh; Ghasemi, Zeinab; Shidfar, Mohammad Reza; Makimura, Koichi
2017-10-01
Following our previous report on evaluation of the beta tubulin real-time PCR for detection of dermatophytosis, this study aimed to compare the real-time PCR assay with conventional methods for the clinical assessment of its diagnostic performance. Samples from a total of 853 patients with suspected dermatophyte lesions were subjected to direct examination (all samples), culture (499 samples) and real-time PCR (all samples). Fungal DNA was extracted directly from clinical samples using a conical steel bullet, followed by purification with a commercial kit and subjected to the Taq-Man probe-based real-time PCR. The study showed that among the 499 specimens for which all three methods were used, 156 (31.2%), 128 (25.6%) and 205 (41.0%) were found to be positive by direct microscopy, culture and real-time PCR respectively. Real-time PCR significantly increased the detection rate of dermatophytes compared with microscopy (288 vs 229) with 87% concordance between the two methods. The sensitivity, specificity, positive predictive value, and negative predictive value of the real-time PCR was 87.5%, 85%, 66.5% and 95.2% respectively. Although real-time PCR performed better on skin than on nail samples, it should not yet fully replace conventional diagnosis. © 2017 Blackwell Verlag GmbH.
Maarif, Samsul
2016-01-01
The aim of this study was to identify the influence of discovery learning method towards the mathematical analogical ability of junior high school's students. This is a research using factorial design 2x2 with ANOVA-Two ways. The population of this research included the entire students of SMPN 13 Jakarta (State Junior High School 13 of Jakarta)…
REP Executive Education focuses on Midwest plant off-site emergency preparedness
Center for Homeland Defense and Security
2015-01-01
Center for Homeland Defense and Security News and Stories, PRESS RELEASES The Center for Homeland Defense and Security burgeoning Radiological Emergency Preparedness (REP) Executive Education Program convened June 8-12 with a special focus on emergency preparedness policy and strategic issues for...
De la Torre González, Francisco Javier; Gutiérrez Avendaño, Daniel Oswaldo; Gschaedler Mathis, Anne Christine; Kirchmayr, Manuel Reinhart
2018-06-06
Non- Saccharomyces yeasts are widespread microorganisms and some time ago were considered contaminants in the beverage industry. However, nowadays they have gained importance for their ability to produce aromatic compounds, which in alcoholic beverages improves aromatic complexity and therefore the overall quality. Thus, identification and differentiation of the species involved in fermentation processes is vital and can be classified in traditional methods and techniques based on molecular biology. Traditional methods, however, can be expensive, laborious and/or unable to accurately discriminate on strain level. In the present study, a total of 19 strains of Pichia kluyveri isolated from mezcal, tejuino and cacao fermentations were analyzed with rep-PCR fingerprinting and matrix assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS). The comparative analysis between MS spectra and rep-PCR patterns obtained from these strains showed a high similarity between both methods. However, minimal differences between the obtained rep-PCR and MALDI-TOF MS clusters could be observed. The data shown suggests that MALDI-TOF MS is a promising alternative technique for rapid, reliable and cost-effective differentiation of natives yeast strains isolated from different traditional fermented foods and beverages. This article is protected by copyright. All rights reserved.
PCR-RFLP diagnostic method for identifying Globodera species in Slovenia
Directory of Open Access Journals (Sweden)
Sasa ŠIRCA
2011-01-01
Full Text Available Species identification within the genus Globodera is based on the morphological and morphometrical characters of the cysts and second stage juveniles, and these are included in the majority of identification keys. Morphometrical methods are fast and can be applied to most of samples but they demand a trained and experienced specialist. Furthermore, some morphometrical characters may overlap between populations and beetwen species, leading to inaccurate identification. To confirm and complement the morphometrical identification of Globodera species molecular methods have been developed. Sequences of the internal transcribed spacer regions ITS1 and ITS2 of the rDNA gene cluster proved to be useful for identifying nematode species identification. A PCR-RFLP molecular method was used to identify Globodera rostochiensis, G. pallida, G. tabacum and G. achilleae. Globodera rostochiensis, G. pallida, G. tabacum and G. achilleae can be distinguished with PCR-RFLP analysis of the rDNA ITS fragment using five restriction enzymes. The RFLP patterns of G. rostochiensis, G. tabacum and G. achilleae were species-specific, while those of G. pallida varied. South American populations of G. pallida differed from other populations as their RFLP patterns were demonstrated to be distinct by in silico restriction of the ITS sequences deposited at NCBI.
Noordeen, Faseeha; Scougall, Catherine A.; Grosse, Arend; Qiao, Qiao; Ajilian, Behzad B.; Reaiche-Miller, Georget; Finnie, John; Werner, Melanie; Broering, Ruth; Schlaak, Joerg F.; Vaillant, Andrew; Jilbert, Allison R.
2015-01-01
Previous studies have demonstrated that nucleic acid polymers (NAPs) have both entry and post-entry inhibitory activity against duck hepatitis B virus (DHBV) infection. The inhibitory activity exhibited by NAPs prevented DHBV infection of primary duck hepatocytes in vitro and protected ducks from DHBV infection in vivo and did not result from direct activation of the immune response. In the current study treatment of primary human hepatocytes with NAP REP 2055 did not induce expression of the TNF, IL6, IL10, IFNA4 or IFNB1 genes, confirming the lack of direct immunostimulation by REP 2055. Ducks with persistent DHBV infection were treated with NAP 2055 to determine if the post-entry inhibitory activity exhibited by NAPs could provide a therapeutic effect against established DHBV infection in vivo. In all REP 2055-treated ducks, 28 days of treatment lead to initial rapid reductions in serum DHBsAg and DHBV DNA and increases in anti-DHBs antibodies. After treatment, 6/11 ducks experienced a sustained virologic response: DHBsAg and DHBV DNA remained at low or undetectable levels in the serum and no DHBsAg or DHBV core antigen positive hepatocytes and only trace amounts of DHBV total and covalently closed circular DNA (cccDNA) were detected in the liver at 9 or 16 weeks of follow-up. In the remaining 5/11 REP 2055-treated ducks, all markers of DHBV infection rapidly rebounded after treatment withdrawal: At 9 and 16 weeks of follow-up, levels of DHBsAg and DHBcAg and DHBV total and cccDNA in the liver had rebounded and matched levels observed in the control ducks treated with normal saline which remained persistently infected with DHBV. These data demonstrate that treatment with the NAP REP 2055 can lead to sustained control of persistent DHBV infection. These effects may be related to the unique ability of REP 2055 to block release of DHBsAg from infected hepatocytes. PMID:26560490
Tsukahara, Keita; Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Nishimaki-Mogami, Tomoko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi
2016-01-01
A real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event, MON87701. First, a standard plasmid for MON87701 quantification was constructed. The conversion factor (C f ) required to calculate the amount of genetically modified organism (GMO) was experimentally determined for a real-time PCR instrument. The determined C f for the real-time PCR instrument was 1.24. For the evaluation of the developed method, a blind test was carried out in an inter-laboratory trial. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDr), respectively. The determined biases and the RSDr values were less than 30 and 13%, respectively, at all evaluated concentrations. The limit of quantitation of the method was 0.5%, and the developed method would thus be applicable for practical analyses for the detection and quantification of MON87701.
PCR-based methods for the detection of L1014 kdr mutation in Anopheles culicifacies sensu lato
Singh, Om P; Bali, Prerna; Hemingway, Janet; Subbarao, Sarala K; Dash, Aditya P; Adak, Tridibes
2009-01-01
Background Anopheles culicifacies s.l., a major malaria vector in India, has developed widespread resistance to DDT and is becoming resistant to pyrethroids–the only insecticide class recommended for the impregnation of bed nets. Knock-down resistance due to a point mutation in the voltage gated sodium channel at L1014 residue (kdr) is a common mechanism of resistance to DDT and pyrethroids. The selection of this resistance may pose a serious threat to the success of the pyrethroid-impregnated bed net programme. This study reports the presence of kdr mutation (L1014F) in a field population of An. culicifacies s.l. and three new PCR-based methods for kdr genotyping. Methods The IIS4-IIS5 linker to IIS6 segments of the para type voltage gated sodium channel gene of DDT and pyrethroid resistant An. culicifacies s.l. population from the Surat district of India was sequenced. This revealed the presence of an A-to-T substitution at position 1014 leading to a leucine-phenylalanine mutation (L1014F) in a few individuals. Three molecular methods viz. Allele Specific PCR (AS-PCR), an Amplification Refractory Mutation System (ARMS) and Primer Introduced Restriction Analysis-PCR (PIRA-PCR) were developed and tested for kdr genotyping. The specificity of the three assays was validated following DNA sequencing of the samples genotyped. Results The genotyping of this An. culicifacies s.l. population by the three PCR based assays provided consistent result and were in agreement with DNA sequencing result. A low frequency of the kdr allele mostly in heterozygous condition was observed in the resistant population. Frequencies of the different genotypes were in Hardy-Weinberg equilibrium. Conclusion The Leu-Phe mutation, which generates the kdr phenotype in many insects, was detected in a pyrethroid and DDT resistant An. culicifacies s.l. population. Three PCR-based methods were developed for kdr genotyping. All the three assays were specific. The ARMS method was refractory to non
PCR-based methods for the detection of L1014 kdr mutation in Anopheles culicifacies sensu lato
Directory of Open Access Journals (Sweden)
Dash Aditya P
2009-07-01
Full Text Available Abstract Background Anopheles culicifacies s.l., a major malaria vector in India, has developed widespread resistance to DDT and is becoming resistant to pyrethroids–the only insecticide class recommended for the impregnation of bed nets. Knock-down resistance due to a point mutation in the voltage gated sodium channel at L1014 residue (kdr is a common mechanism of resistance to DDT and pyrethroids. The selection of this resistance may pose a serious threat to the success of the pyrethroid-impregnated bed net programme. This study reports the presence of kdr mutation (L1014F in a field population of An. culicifacies s.l. and three new PCR-based methods for kdr genotyping. Methods The IIS4-IIS5 linker to IIS6 segments of the para type voltage gated sodium channel gene of DDT and pyrethroid resistant An. culicifacies s.l. population from the Surat district of India was sequenced. This revealed the presence of an A-to-T substitution at position 1014 leading to a leucine-phenylalanine mutation (L1014F in a few individuals. Three molecular methods viz. Allele Specific PCR (AS-PCR, an Amplification Refractory Mutation System (ARMS and Primer Introduced Restriction Analysis-PCR (PIRA-PCR were developed and tested for kdr genotyping. The specificity of the three assays was validated following DNA sequencing of the samples genotyped. Results The genotyping of this An. culicifacies s.l. population by the three PCR based assays provided consistent result and were in agreement with DNA sequencing result. A low frequency of the kdr allele mostly in heterozygous condition was observed in the resistant population. Frequencies of the different genotypes were in Hardy-Weinberg equilibrium. Conclusion The Leu-Phe mutation, which generates the kdr phenotype in many insects, was detected in a pyrethroid and DDT resistant An. culicifacies s.l. population. Three PCR-based methods were developed for kdr genotyping. All the three assays were specific. The ARMS method
Kalle, Elena; Gulevich, Alexander; Rensing, Christopher
2013-11-01
In a mixed template, the presence of homologous target DNA sequences creates environments that almost inevitably give rise to artifacts and biases during PCR. Heteroduplexes, chimeras, and skewed template-to-product ratios are the exclusive attributes of mixed template PCR and never occur in a single template assay. Yet, multi-template PCR has been used without appropriate attention to quality control and assay validation, in spite of the fact that such practice diminishes the reliability of results. External and internal amplification controls became obligatory elements of good laboratory practice in different PCR assays. We propose the inclusion of an analogous approach as a quality control system for multi-template PCR applications. The amplification controls must take into account the characteristics of multi-template PCR and be able to effectively monitor particular assay performance. This study demonstrated the efficiency of a model mixed template as an adequate external amplification control for a particular PCR application. The conditions of multi-template PCR do not allow implementation of a classic internal control; therefore we developed a convenient semi-internal control as an acceptable alternative. In order to evaluate the effects of inhibitors, a model multi-template mix was amplified in a mixture with DNAse-treated sample. Semi-internal control allowed establishment of intervals for robust PCR performance for different samples, thus enabling correct comparison of the samples. The complexity of the external and semi-internal amplification controls must be comparable with the assumed complexity of the samples. We also emphasize that amplification controls should be applied in multi-template PCR regardless of the post-assay method used to analyze products. © 2013 Elsevier B.V. All rights reserved.
Mano, Junichi; Masubuchi, Tomoko; Hatano, Shuko; Futo, Satoshi; Koiwa, Tomohiro; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Takabatake, Reona; Kitta, Kazumi
2013-01-01
In this article, we report a novel real-time PCR-based analytical method for quantitation of the GM maize event LY038. We designed LY038-specific and maize endogenous reference DNA-specific PCR amplifications. After confirming the specificity and linearity of the LY038-specific PCR amplification, we determined the conversion factor required to calculate the weight-based content of GM organism (GMO) in a multilaboratory evaluation. Finally, in order to validate the developed method, an interlaboratory collaborative trial according to the internationally harmonized guidelines was performed with blind DNA samples containing LY038 at the mixing levels of 0, 0.5, 1.0, 5.0 and 10.0%. The precision of the method was evaluated as the RSD of reproducibility (RSDR), and the values obtained were all less than 25%. The limit of quantitation of the method was judged to be 0.5% based on the definition of ISO 24276 guideline. The results from the collaborative trial suggested that the developed quantitative method would be suitable for practical testing of LY038 maize.
Peng, Cheng; Wang, Pengfei; Xu, Xiaoli; Wang, Xiaofu; Wei, Wei; Chen, Xiaoyun; Xu, Junfeng
2016-01-01
As the amount of commercially available genetically modified organisms (GMOs) grows recent years, the diversity of target sequences for molecular detection techniques are eagerly needed. Considered as the gold standard for GMO analysis, the real-time PCR technology was optimized to produce a high-throughput GMO screening method. With this method we can detect 19 transgenic targets. The specificity of the assays was demonstrated to be 100 % by the specific amplification of DNA derived from reference material from 20 genetically modified crops and 4 non modified crops. Furthermore, most assays showed a very sensitive detection, reaching the limit of ten copies. The 19 assays are the most frequently used genetic elements present in GM crops and theoretically enable the screening of the known GMO described in Chinese markets. Easy to use, fast and cost efficient, this method approach fits the purpose of GMO testing laboratories.
A novel PCR-based method to enumerate Salmonella in animal feed
DEFF Research Database (Denmark)
Löfström, Charlotta; Andersson, Gunnar; Häggblom, Per
2010-01-01
and pellets) only three gave results that differed between the PCR and MSRV methods. Ct values for naturally contaminated samples were higher compared to samples artificially contaminated with low numbers (approx. 2 CFU/25 g feed) of stressed Salmonella. To allow quantification of low numbers of Salmonella...
Directory of Open Access Journals (Sweden)
Zahra Gharibi
2017-10-01
Full Text Available Objective: To evaluate Entamoeba spp. diagnosis in patients with inflammatory diarrhea by staining, copro-antigen ELISA and multiplex PCR methods. Methods: In this descriptive cross-sectional survey, 200 stool samples were randomly collected during 2015–2016. The stool samples were evaluated microscopically for the presence of the parasite using direct and formalin-ether concentration and trichrome staining methods. Then, the stool samples were examined by copro-antigen ELISA (Biomerica Company and multiplex PCR methods. Results: Of 200 samples, 17, 29 and 23 cases were positive for Entamoeba species by the staining, copro-antigen ELISA and multiplex PCR methods, respectively. Of 23 positive samples in multiplex PCR test, 13 and 10 samples were positive for Entamoeba dispar (E. dispar and Entamoeba histolytica (E. histolytica, respectively. Conclusions: Our finding indicated a relatively high prevalence of Entamoeba species in patients with inflammatory diarrhea in Ahvaz city. Due to the complications of E. histolytica/ dispar infection, the health authorities of the city must pay more attention to control and prevent the transmission of E. histolytica/dispar to individuals.
Diagnosis of clinical samples spotted on FTA cards using PCR-based methods.
Jamjoom, Manal; Sultan, Amal H
2009-04-01
The broad clinical presentation of Leishmaniasis makes the diagnosis of current and past cases of this disease rather difficult. Differential diagnosis is important because diseases caused by other aetiologies and a clinical spectrum similar to that of leishmaniasis (e.g. leprosy, skin cancers and tuberculosis for CL; malaria and schistosomiasis for VL) are often present in endemic areas of endemicity. Presently, a variety of methods have been developed and tested to aid the identification and diagnosis of Leishmania. The advent of the PCR technology has opened new channels for the diagnosis of leishmaniasis in a variety of clinical materials. PCR is a simple, rapid procedure that has been adapted for diagnosis of leishmaniasis. A range of tools is currently available for the diagnosis and identification of leishmaniasis and Leishmania species, respectively. However, none of these diagnostic tools are examined and tested using samples spotted on FTA cards. Three different PCR-based approaches were examined including: kDNA minicircle, Leishmania 18S rRNA gene and PCR-RFLP of Intergenic region of ribosomal protein. PCR primers were designed that sit within the coding sequences of genes (relatively well conserved) but which amplify across the intervening intergenic sequence (relatively variable). These were used in PCR-RFLP on reference isolates of 10 of the most important Leishmania species: L. donovani, L. infantum, L. major & L. tropica. Digestion of PCR products with restriction enzymes produced species-specific restriction patterns allowed discrimination of reference isolates. The kDNA minicircle primers are highly sensitive in diagnosis of both bone marrow and skin smears from FTA cards. Leishmania 18S rRNA gene conserved region is sensitive in identification of bone marrow smear but less sensitive in diagnosing skin smears. The intergenic nested PCR-RFLP using P5 & P6 as well as P1 & P2 newly designed primers showed high level of reproducibility and sensitivity
International Nuclear Information System (INIS)
Wintzer, K.
1977-01-01
Process for analog-to-digital and digital-to-analog conversion in telecommunication systems whose outstations each have an analog transmitter and an analog receiver. The invention illustrates a method of reducing the power demand of the converters at times when no conversion processes take place. (RW) [de
Detection of virulence genes in Uropathogenic E. coli (UPEC strains by Multiplex-PCR method
Directory of Open Access Journals (Sweden)
Javad Mohammadi
2017-06-01
Full Text Available Background & Objectives: Urinary tract infection caused by E. coli is one of the most common illnesses in all age groups worldwide. Presence of virulence genes is a key factor in bacterial pathogens in uroepithelial cells. The present study was performed to detect iha, iroN, ompT genes in the Uropathogenic E.coli isolates from clinical samples using multiplex-PCR method in Kerman. Materials & Methods: In this descriptive cross-sectional study, 200 samples of patients with urinary tract infections in Kerman hospitals were collected. After biochemical and microbiological tests, all strains were tested with regard to the presence of iha, iroN, and ompT genes using multiplex-PCR method. Results: The results of Multiplex-PCR showed that all specimens had one, two, or three virulence genes simultaneously. The highest and lowest frequency distribution of genes was related to iha (56.7% and iroN (20% respectively. Conclusion: According to the prevalence of urinary tract infection in the community and distribution of resistance and virulence factors, the fast and accurate detection of the strains and virulence genes is necessary
Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco
1999-01-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy pr...
Directory of Open Access Journals (Sweden)
Bahman Navidshad
2012-02-01
Full Text Available The applications of conventional culture-dependent assays to quantify bacteria populations are limited by their dependence on the inconsistent success of the different culture-steps involved. In addition, some bacteria can be pathogenic or a source of endotoxins and pose a health risk to the researchers. Bacterial quantification based on the real-time PCR method can overcome the above-mentioned problems. However, the quantification of bacteria using this approach is commonly expressed as absolute quantities even though the composition of samples (like those of digesta can vary widely; thus, the final results may be affected if the samples are not properly homogenized, especially when multiple samples are to be pooled together before DNA extraction. The objective of this study was to determine the correlation coefficients between four different methods of expressing the output data of real-time PCR-based bacterial quantification. The four methods were: (i the common absolute method expressed as the cell number of specific bacteria per gram of digesta; (ii the Livak and Schmittgen, ΔΔCt method; (iii the Pfaffl equation; and (iv a simple relative method based on the ratio of cell number of specific bacteria to the total bacterial cells. Because of the effect on total bacteria population in the results obtained using ΔCt-based methods (ΔΔCt and Pfaffl, these methods lack the acceptable consistency to be used as valid and reliable methods in real-time PCR-based bacterial quantification studies. On the other hand, because of the variable compositions of digesta samples, a simple ratio of cell number of specific bacteria to the corresponding total bacterial cells of the same sample can be a more accurate method to quantify the population.
European validation of Real-Time PCR method for detection of Salmonella spp. in pork meat.
Delibato, Elisabetta; Rodriguez-Lazaro, David; Gianfranceschi, Monica; De Cesare, Alessandra; Comin, Damiano; Gattuso, Antonietta; Hernandez, Marta; Sonnessa, Michele; Pasquali, Frédérique; Sreter-Lancz, Zuzsanna; Saiz-Abajo, María-José; Pérez-De-Juan, Javier; Butrón, Javier; Prukner-Radovcic, Estella; Horvatek Tomic, Danijela; Johannessen, Gro S; Jakočiūnė, Džiuginta; Olsen, John E; Chemaly, Marianne; Le Gall, Francoise; González-García, Patricia; Lettini, Antonia Anna; Lukac, Maja; Quesne, Segolénè; Zampieron, Claudia; De Santis, Paola; Lovari, Sarah; Bertasi, Barbara; Pavoni, Enrico; Proroga, Yolande T R; Capuano, Federico; Manfreda, Gerardo; De Medici, Dario
2014-08-01
The classical microbiological method for detection of Salmonella spp. requires more than five days for final confirmation, and consequently there is a need for an alternative methodology for detection of this pathogen particularly in those food categories with a short shelf-life. This study presents an international (at European level) ISO 16140-based validation study of a non-proprietary Real-Time PCR-based method that can generate final results the day following sample analysis. It is based on an ISO compatible enrichment coupled to an easy and inexpensive DNA extraction and a consolidated Real-Time PCR assay. Thirteen laboratories from seven European Countries participated to this trial, and pork meat was selected as food model. The limit of detection observed was down to 10 CFU per 25 g of sample, showing excellent concordance and accordance values between samples and laboratories (100%). In addition, excellent values were obtained for relative accuracy, specificity and sensitivity (100%) when the results obtained for the Real-Time PCR-based methods were compared to those of the ISO 6579:2002 standard method. The results of this international trial demonstrate that the evaluated Real-Time PCR-based method represents an excellent alternative to the ISO standard. In fact, it shows an equal and solid performance as well as it reduces dramatically the extent of the analytical process, and can be easily implemented routinely by the Competent Authorities and Food Industry laboratories. Copyright © 2014 Elsevier B.V. All rights reserved.
Averróis e a República de Platão
Directory of Open Access Journals (Sweden)
Pereira, Rosalie Helena de Souza
2007-01-01
Full Text Available Sobre República é o único comentário de uma obra de Platão deixado por Averróis, o comentador por antonomásia, diga-se de Aristóteles. Embora se tenha perdido o original árabe, a teles. Embora se tenha perdido o original árabe, a posteridade recebeu uma versão hebraíca e duas latinas. O comentário (ou paráfrase a República de Platão pode ser considerado uma obra original - divida em três livros - já que apenas um terço dela corresponde ao texto platônico. Além de apresentar conceitos aristotélicos retirados da Ética Nicomaquéia e de obras políticas de Al-Farabi, Averróis apresenta reflexões próprias e faz críticas à sociedade em que vive
Directory of Open Access Journals (Sweden)
Ramachandran Kogeethavani
2015-12-01
Full Text Available The Erwinia species are well-known pathogens of economic importance in Malaysia causing serious damage to high-value fruit crops that include pineapple [Ananas comosus (L. Merr.] and papaya (Carica papaya L..The 16S rRNA sequence using eubacteria fD1 and rP2 primers, identified two bacteria species; Dickeya zeae from pineapple heart rot, and Erwinia mallotivora from papaya dieback. Phylogenetic analysis based on the neighbor-joining method indicated that all the bacterial isolates clustered in their own taxa and formed monophyletic clades. From the pathogenicity test, all isolates of D. zeae and E. mallotivora showed pathogenic reactions on their respective host plants. Genetic variability of these isolates was assessed using repetitive sequence-based PCR (rep-PCR fingerprinting. The results indicated interspecies, and intraspecies variation in both species’ isolates. There were more polymorphic bands shown by rep-PCR fingerprints than enterobacterial repetitive intergenic consensus (ERIC and BOX- PCRs, however both species’ isolates produced distinguishable banding patterns. Unweighted pair-group method with arithmetic averages (UPGMA cluster analysis indicated that all Dickeya and Erwinia isolates from the same species were grouped in the same main cluster. Similarity among the isolates ranged from 77 to 99%. Sequencing of 16S rRNA using eubacteria fD1 and rP2 primers, and rep-PCR fingerprinting revealed diversity among Dickeya and Erwinia isolates. But this method appears to be reliable for discriminating isolates from pineapple heart rot and papaya dieback.
On Lovelock analogs of the Riemann tensor
Camanho, Xián O.; Dadhich, Naresh
2016-03-01
It is possible to define an analog of the Riemann tensor for Nth order Lovelock gravity, its characterizing property being that the trace of its Bianchi derivative yields the corresponding analog of the Einstein tensor. Interestingly there exist two parallel but distinct such analogs and the main purpose of this note is to reconcile both formulations. In addition we will introduce a simple tensor identity and use it to show that any pure Lovelock vacuum in odd d=2N+1 dimensions is Lovelock flat, i.e. any vacuum solution of the theory has vanishing Lovelock-Riemann tensor. Further, in the presence of cosmological constant it is the Lovelock-Weyl tensor that vanishes.
Gyawali, P; Sidhu, J P S; Ahmed, W; Jagals, P; Toze, S
2017-06-01
Accurate quantitative measurement of viable hookworm ova from environmental samples is the key to controlling hookworm re-infections in the endemic regions. In this study, the accuracy of three quantitative detection methods [culture-based, vital stain and propidium monoazide-quantitative polymerase chain reaction (PMA-qPCR)] was evaluated by enumerating 1,000 ± 50 Ancylostoma caninum ova in the laboratory. The culture-based method was able to quantify an average of 397 ± 59 viable hookworm ova. Similarly, vital stain and PMA-qPCR methods quantified 644 ± 87 and 587 ± 91 viable ova, respectively. The numbers of viable ova estimated by the culture-based method were significantly (P methods. Therefore, both PMA-qPCR and vital stain methods appear to be suitable for the quantitative detection of viable hookworm ova. However, PMA-qPCR would be preferable over the vital stain method in scenarios where ova speciation is needed.
Evaluation of methods for oligonucleotide array data via quantitative real-time PCR.
Qin, Li-Xuan; Beyer, Richard P; Hudson, Francesca N; Linford, Nancy J; Morris, Daryl E; Kerr, Kathleen F
2006-01-17
There are currently many different methods for processing and summarizing probe-level data from Affymetrix oligonucleotide arrays. It is of great interest to validate these methods and identify those that are most effective. There is no single best way to do this validation, and a variety of approaches is needed. Moreover, gene expression data are collected to answer a variety of scientific questions, and the same method may not be best for all questions. Only a handful of validation studies have been done so far, most of which rely on spike-in datasets and focus on the question of detecting differential expression. Here we seek methods that excel at estimating relative expression. We evaluate methods by identifying those that give the strongest linear association between expression measurements by array and the "gold-standard" assay. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) is generally considered the "gold-standard" assay for measuring gene expression by biologists and is often used to confirm findings from microarray data. Here we use qRT-PCR measurements to validate methods for the components of processing oligo array data: background adjustment, normalization, mismatch adjustment, and probeset summary. An advantage of our approach over spike-in studies is that methods are validated on a real dataset that was collected to address a scientific question. We initially identify three of six popular methods that consistently produced the best agreement between oligo array and RT-PCR data for medium- and high-intensity genes. The three methods are generally known as MAS5, gcRMA, and the dChip mismatch mode. For medium- and high-intensity genes, we identified use of data from mismatch probes (as in MAS5 and dChip mismatch) and a sequence-based method of background adjustment (as in gcRMA) as the most important factors in methods' performances. However, we found poor reliability for methods using mismatch probes for low-intensity genes
Evaluation of methods for oligonucleotide array data via quantitative real-time PCR
Directory of Open Access Journals (Sweden)
Morris Daryl E
2006-01-01
Full Text Available Abstract Background There are currently many different methods for processing and summarizing probe-level data from Affymetrix oligonucleotide arrays. It is of great interest to validate these methods and identify those that are most effective. There is no single best way to do this validation, and a variety of approaches is needed. Moreover, gene expression data are collected to answer a variety of scientific questions, and the same method may not be best for all questions. Only a handful of validation studies have been done so far, most of which rely on spike-in datasets and focus on the question of detecting differential expression. Here we seek methods that excel at estimating relative expression. We evaluate methods by identifying those that give the strongest linear association between expression measurements by array and the "gold-standard" assay. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR is generally considered the "gold-standard" assay for measuring gene expression by biologists and is often used to confirm findings from microarray data. Here we use qRT-PCR measurements to validate methods for the components of processing oligo array data: background adjustment, normalization, mismatch adjustment, and probeset summary. An advantage of our approach over spike-in studies is that methods are validated on a real dataset that was collected to address a scientific question. Results We initially identify three of six popular methods that consistently produced the best agreement between oligo array and RT-PCR data for medium- and high-intensity genes. The three methods are generally known as MAS5, gcRMA, and the dChip mismatch mode. For medium- and high-intensity genes, we identified use of data from mismatch probes (as in MAS5 and dChip mismatch and a sequence-based method of background adjustment (as in gcRMA as the most important factors in methods' performances. However, we found poor reliability for methods
Directory of Open Access Journals (Sweden)
Paola Judith Margulis
2012-01-01
Full Text Available El presente artículo se propone reconstruir una zona de la historia del documental argentino a partir del abordaje de tres films que tuvieron un alto impacto en Argentina hacia la transición democrática: La República perdida (Miguel Pérez, 1983, su secuela La República perdida II (Miguel Pérez, 1986 y Evita, quien quiera oír que oiga (Eduardo Mignogna, 1984. Dada la importancia de estos films -tanto en términos políticos como de impacto en el público-, intentaremos situarlos en contexto y analizar algunos aspectos inherentes a su lógica fílmica.
PCR melting profile (PCR MP - a new tool for differentiation of Candida albicans strains
Directory of Open Access Journals (Sweden)
Nowak Magdalena
2009-11-01
Full Text Available Abstract Background We have previously reported the use of PCR Melting Profile (PCR MP technique based on using low denaturation temperatures during ligation mediated PCR (LM PCR for bacterial strain differentiation. The aim of the current study was to evaluate this method for intra-species differentiation of Candida albicans strains. Methods In total 123 Candida albicans strains (including 7 reference, 11 clinical unrelated, and 105 isolates from patients of two hospitals in Poland were examined using three genotyping methods: PCR MP, macrorestriction analysis of the chromosomal DNA by pulsed-field gel electrophoresis (REA-PFGE and RAPD techniques. Results The genotyping results of the PCR MP were compared with results from REA-PFGE and RAPD techniques giving 27, 26 and 25 unique types, respectively. The results showed that the PCR MP technique has at least the same discriminatory power as REA-PFGE and RAPD. Conclusion Data presented here show for the first time the evaluation of PCR MP technique for candidial strains differentiation and we propose that this can be used as a relatively simple and cheap technique for epidemiological studies in short period of time in hospital.
Ferreira, HL; Spilki, FR; dos Santos, MMAB; de Almeida, RS; Arns, CW
2009-01-01
Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...
CoolRep H22: Synthesis report on R and D results on geological disposal up to 2009
International Nuclear Information System (INIS)
Umeki, Hiroyuki; Hioki, Kazumasa; Osawa, Hideaki; Fujita, Tomoo; Shibata, Masahiro; Makino, Hitoshi; Takeuchi, Shinji; Ishimaru, Tsuneari
2011-02-01
The Japan Atomic Energy Agency (JAEA) has been performing research and development on geological disposal technology of high level radioactive waste. At the end of fiscal year 2009, the Geological Isolation Research and Development Directorate of JAEA made publicly available the 'CoolRep H22', which is a web-based report that summarizes the R and D results, on its website. This document reports the contents of CoolRep H22. (author)
Guo, Jinchao; Yang, Litao; Liu, Xin; Guan, Xiaoyan; Jiang, Lingxi; Zhang, Dabing
2009-08-26
Genetically modified (GM) papaya (Carica papaya L.), Huanong No. 1, was approved for commercialization in Guangdong province, China in 2006, and the development of the Huanong No. 1 papaya detection method is necessary for implementing genetically modified organism (GMO) labeling regulations. In this study, we reported the characterization of the exogenous integration of GM Huanong No. 1 papaya by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. The results suggested that one intact copy of the initial construction was integrated in the papaya genome and which probably resulted in one deletion (38 bp in size) of the host genomic DNA. Also, one unintended insertion of a 92 bp truncated NptII fragment was observed at the 5' end of the exogenous insert. Furthermore, we revealed its 5' and 3' flanking sequences between the insert DNA and the papaya genomic DNA, and developed the event-specific qualitative and quantitative PCR assays for GM Huanong No. 1 papaya based on the 5' integration flanking sequence. The relative limit of detection (LOD) of the qualitative PCR assay was about 0.01% in 100 ng of total papaya genomic DNA, corresponding to about 25 copies of papaya haploid genome. In the quantitative PCR, the limits of detection and quantification (LOD and LOQ) were as low as 12.5 and 25 copies of papaya haploid genome, respectively. In practical sample quantification, the quantified biases between the test and true values of three samples ranged from 0.44% to 4.41%. Collectively, we proposed that all of these results are useful for the identification and quantification of Huanong No. 1 papaya and its derivates.
Gianfranceschi, Monica Virginia; Rodriguez-Lazaro, David; Hernandez, Marta; González-García, Patricia; Comin, Damiano; Gattuso, Antonietta; Delibato, Elisabetta; Sonnessa, Michele; Pasquali, Frederique; Prencipe, Vincenza; Sreter-Lancz, Zuzsanna; Saiz-Abajo, María-José; Pérez-De-Juan, Javier; Butrón, Javier; Kozačinski, Lidija; Tomic, Danijela Horvatek; Zdolec, Nevijo; Johannessen, Gro S; Jakočiūnė, Džiuginta; Olsen, John Elmerdahl; De Santis, Paola; Lovari, Sarah; Bertasi, Barbara; Pavoni, Enrico; Paiusco, Antonella; De Cesare, Alessandra; Manfreda, Gerardo; De Medici, Dario
2014-08-01
The classical microbiological method for detection of Listeria monocytogenes requires around 7 days for final confirmation, and due to perishable nature of RTE food products, there is a clear need for an alternative methodology for detection of this pathogen. This study presents an international (at European level) ISO 16140-based validation trial of a non-proprietary real-time PCR-based methodology that can generate final results in the following day of the analysis. This methodology is based on an ISO compatible enrichment coupled to a bacterial DNA extraction and a consolidated real-time PCR assay. Twelve laboratories from six European countries participated in this trial, and soft cheese was selected as food model since it can represent a difficult matrix for the bacterial DNA extraction and real-time PCR amplification. The limit of detection observed was down to 10 CFU per 25 of sample, showing excellent concordance and accordance values between samples and laboratories (>75%). In addition, excellent values were obtained for relative accuracy, specificity and sensitivity (82.75%, 96.70% and 97.62%, respectively) when the results obtained for the real-time PCR-based methods were compared to those of the ISO 11290-1 standard method. An interesting observation was that the L. monocytogenes detection by the real-time PCR method was less affected in the presence of Listeria innocua in the contaminated samples, proving therefore to be more reliable than the reference method. The results of this international trial demonstrate that the evaluated real-time PCR-based method represents an excellent alterative to the ISO standard since it shows a higher performance as well as reduce the extent of the analytical process, and can be easily implemented routinely by the competent authorities and food industry laboratories. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
M Heydarnezhadi
2011-09-01
Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidiosis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neelsen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed primers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopically were positive. The described primary and nested PCR method could detect all Cryptosporidium positive samples from human and cattle. Regards to suspected negative samples in primary PCR examination, the Nested PCR could approve two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was negative in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.
Improvement Methods in NPP's Radiation Emergency Plan: An Administrative Approach
International Nuclear Information System (INIS)
Lee, Yoon Wook; Yang, He Sun
2009-01-01
The Radiation Emergency Plan (REP) can be divided into a technical and an administrative responses. The domestic NPP's REPs are reviewed from the viewpoint of the administrative response and improvement methods are also suggested in this treatise. The fields of the reviews are the composition of the emergency response organizations, the activation criteria of the organizations, the selection of the staffings and the reasonableness of the REP's volume. In addition, the limitations of the current radiation exercises are reviewed and the improvement method of the exercise is presented. It is expected that the suggested recommendations will be helpful in establishing useful REPs and making practical radiation exercises in Korea
Sampling methods for rumen microbial counts by Real-Time PCR techniques
Directory of Open Access Journals (Sweden)
S. Puppo
2010-02-01
Full Text Available Fresh rumen samples were withdrawn from 4 cannulated buffalo females fed a fibrous diets in order to quantify bacteria concentration in the rumen by Real-Time PCR techniques. To obtain DNA of a good quality from whole rumen fluid, eight (M1-M8 different pre-filtration methods (cheese cloths, glass-fibre and nylon filter in combination with various centrifugation speeds (1000, 5000 and 14,000 rpm were tested. Genomic DNA extraction was performed either on fresh or frozen samples (-20°C. The quantitative bacteria analysis was realized according to Real-Time PCR procedure for Butyrivibrio fibrisolvens reported in literature. M5 resulted the best sampling procedure allowing to obtain a suitable genomic DNA. No differences were revealed between fresh and frozen samples.
A simple negative selection method to identify adenovirus recombinants using colony PCR
Directory of Open Access Journals (Sweden)
Yongliang Zhao
2014-01-01
Conclusions: The negative selection method to identify AdEasy adenovirus recombinants by colony PCR can identify the recombined colony within a short time-period, and maximally avoid damage to the recombinant plasmid by limiting recombination time, resulting in improved adenovirus packaging.
A PCR detection method for rapid identification of Melissococcus pluton in honeybee larvae.
Govan, V A; Brözel, V; Allsopp, M H; Davison, S
1998-05-01
Melissococcus pluton is the causative agent of European foulbrood, a disease of honeybee larvae. This bacterium is particularly difficult to isolate because of its stringent growth requirements and competition from other bacteria. PCR was used selectively to amplify specific rRNA gene sequences of M. pluton from pure culture, from crude cell lysates, and directly from infected bee larvae. The PCR primers were designed from M. pluton 16S rRNA sequence data. The PCR products were visualized by agarose gel electrophoresis and confirmed as originating from M. pluton by sequencing in both directions. Detection was highly specific, and the probes did not hybridize with DNA from other bacterial species tested. This method enabled the rapid and specific detection and identification of M. pluton from pure cultures and infected bee larvae.
Iberia : capital federal de la IIª República Española (Un proyecto de Rubio i Tuduri
Directory of Open Access Journals (Sweden)
Carlos Sambricio
1996-01-01
Full Text Available A los pocos meses de proclamarse, en 1931, la II República Española, Nicolás Rubio i Tuduri presentaba —en el marco de la Exposición organizada por la Asociación de Arquitectos de Cataluña, celebrada en la barcelonesa Galería Maragall— una propuesta un tanto sorprendente: el proyecto de una nueva Capital Federal de la República Española que él denominaba Iberia.
International Nuclear Information System (INIS)
Inayama, Seiichi; Tokunaga, Yukiko; Hosoya, Eikichi; Nakadate, Teruo; Niwaguchi, Tetsukichi.
1980-01-01
N-Carboxymethylmethamphetamine, a derivative of methamphetamine, was prepared through a new synthetic pathway from ephedrine. Specific antiserum was obtained by immunization of rabbits with the conjugate of N-carboxymethylmethamphetamine with bovine serum albumin. A radioimmunoassay procedure was established using this antibody (specific for methamphetamine) and a 125 I-methamphetamine derivative. A high degree of specificity of the antibody was confirmed by testing for cross-reaction with several methamphetamine analogs, and the sensitivity was found to be 1 ng/tube. The present micro method using radioimmunoassay is highly sensitive, rapid, simple and may be useful as a micro-scale primary screening test for methamphetamine excreted in human urine, for forensic and medical purposes. (author)
Stachelska, M A
2017-09-26
The aim of the present study was to establish a rapid and accurate real-time PCR method to detect pathogenic Yersinia enterocolitica in pork. Yersinia enterocolitica is considered to be a crucial zoonosis, which can provoke diseases both in humans and animals. The classical culture methods designated to detect Y. enterocolitica species in food matrices are often very time-consuming. The chromosomal locus _tag CH49_3099 gene, that appears in pathogenic Y. enterocolitica strains, was applied as DNA target for the 5' nuclease PCR protocol. The probe was labelled at the 5' end with the fluorescent reporter dye (FAM) and at the 3' end with the quencher dye (TAMRA). The real-time PCR cycling parameters included 41 cycles. A Ct value which reached a value higher than 40 constituted a negative result. The developed for the needs of this study qualitative real-time PCR method appeared to give very specific and reliable results. The detection rate of locus _tag CH49_3099 - positive Y. enterocolitica in 150 pig tonsils was 85 % and 32 % with PCR and culture methods, respectively. Both the Real-time PCR results and culture method results were obtained from material that was enriched during overnight incubation. The subject of the study were also raw pork meat samples. Among 80 samples examined, 7 ones were positive when real-time PCR was applied, and 6 ones were positive when classical culture method was applied. The application of molecular techniques based on the analysis of DNA sequences such as the Real-time PCR enables to detect this pathogenic bacteria very rapidly and with higher specificity, sensitivity and reliability in comparison to classical culture methods.
Analog circuit design art, science and personalities
Williams, Jim
1991-01-01
This book is far more than just another tutorial or reference guide - it's a tour through the world of analog design, combining theory and applications with the philosophies behind the design process. Readers will learn how leading analog circuit designers approach problems and how they think about solutions to those problems. They'll also learn about the `analog way' - a broad, flexible method of thinking about analog design tasks.A comprehensive and useful guide to analog theory and applications. Covers visualizing the operation of analog circuits. Looks at how to rap
Repérage d’Images Ordinaires : Analyse des Requêtes des Chercheurs d’Images
Directory of Open Access Journals (Sweden)
Elaine Ménard
2009-06-01
also emphasizes the pressing necessity to optimize the methods used for image processing, in order to facilitate image retrieval and dissemination in multilingual environments. Résumé Depuis quelques années, le web est devenu un média incontournable pour la diffusion de ressources multilingues. Cependant, les différences linguistiques constituent souvent un obstacle majeur aux échanges de documents scientifiques, culturels, pédagogiques et commerciaux. En plus de cette diversité linguistique, on constate le développement croissant de bases de données et de collections composées de différents types de documents textuels ou multimédias, ce qui complexifie également le processus de repérage documentaire. Par exemple, les collections d’images numériques sont aussi nombreuses que diversifiées. Le besoin de repérer une image spécifique dans diverses collections est devenu une préoccupation partagée par plusieurs communautés. La croissance du web a mis en relief le besoin pressant de se doter d’outils propres à la description des images dans le but de faciliter leur repérage, puisque l’on retrouve celles-ci dans la plupart des ressources disponibles. Cette recherche compare le repérage d’images dans deux contextes linguistiques différents : un contexte monolingue, c’est-à-dire que la langue de la requête (français est la même que la langue d’indexation (français; et un contexte multilingue où la langue de la requête (français est différente de la langue d’indexation (anglais. Cet article présente les résultats de l’analyse des requêtes formulées par les participants pour repérer un ensemble d’images ordinaires représentant des objets de la vie quotidienne, en contexte de repérage multilingue. L’examen des termes contenus dans les requêtes des chercheurs d’images révèle les tendances observées sur le plan terminologique, perceptuel et structurel. Les participants emploient généralement des requêtes simples
Zamora, Paul O [Gaithersburg, MD; Pena, Louis A [Poquott, NY; Lin, Xinhua [Plainview, NY; Takahashi, Kazuyuki [Germantown, MD
2012-07-24
The present invention provides a fibroblast growth factor heparin-binding analog of the formula: ##STR00001## where R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, X, Y and Z are as defined, pharmaceutical compositions, coating compositions and medical devices including the fibroblast growth factor heparin-binding analog of the foregoing formula, and methods and uses thereof.
Malatinkova, Eva; Kiselinova, Maja; Bonczkowski, Pawel; Trypsteen, Wim; Messiaen, Peter; Vermeire, Jolien; Verhasselt, Bruno; Vervisch, Karen; Vandekerckhove, Linos; De Spiegelaere, Ward
2014-01-01
In HIV-infected patients on combination antiretroviral therapy (cART), the detection of episomal HIV 2-LTR circles is a potential marker for ongoing viral replication. Quantification of 2-LTR circles is based on quantitative PCR or more recently on digital PCR assessment, but is hampered due to its low abundance. Sample pre-PCR processing is a critical step for 2-LTR circles quantification, which has not yet been sufficiently evaluated in patient derived samples. We compared two sample processing procedures to more accurately quantify 2-LTR circles using droplet digital PCR (ddPCR). Episomal HIV 2-LTR circles were either isolated by genomic DNA isolation or by a modified plasmid DNA isolation, to separate the small episomal circular DNA from chromosomal DNA. This was performed in a dilution series of HIV-infected cells and HIV-1 infected patient derived samples (n=59). Samples for the plasmid DNA isolation method were spiked with an internal control plasmid. Genomic DNA isolation enables robust 2-LTR circles quantification. However, in the lower ranges of detection, PCR inhibition caused by high genomic DNA load substantially limits the amount of sample input and this impacts sensitivity and accuracy. Moreover, total genomic DNA isolation resulted in a lower recovery of 2-LTR templates per isolate, further reducing its sensitivity. The modified plasmid DNA isolation with a spiked reference for normalization was more accurate in these low ranges compared to genomic DNA isolation. A linear correlation of both methods was observed in the dilution series (R2=0.974) and in the patient derived samples with 2-LTR numbers above 10 copies per million peripheral blood mononuclear cells (PBMCs), (R2=0.671). Furthermore, Bland-Altman analysis revealed an average agreement between the methods within the 27 samples in which 2-LTR circles were detectable with both methods (bias: 0.3875±1.2657 log10). 2-LTR circles quantification in HIV-infected patients proved to be more
Jiang, Shu-Mei; Hu, Jun; Yin, Wei-Bo; Chen, Yu-Hong; Wang, Richard R-C; Hu, Zan-Min
2005-09-01
Homology-based gene/gene-analog cloning method has been extensively applied in isolation of RGAs (resistance gene analogs) in various plant species. However, serious interference of sequences on homoeologous chromosomes in polyploidy species usually occurred when cloning RGAs in a specific chromosome. In this research, the techniques of chromosome microdissection combined with homology-based cloning were used to clone RGAs from a specific chromosome of Wheat-Thinopyrum alien addition line TAi-27, which was derived from common wheat and Thinopyrum intermedium with a pair of chromosomes from Th. intermedium. The alien chromosomes carry genes for resistance to BYDV. The alien chromosome in TAi-27 was isolated by a glass needle and digested with proteinase K. The DNA of the alien chromosome was amplified by two rounds of Sau3A linker adaptor-mediated PCR. RGAs were amplified by PCR with the degenerated primers designed based on conserved domains of published resistance genes (R genes) by using the alien chromosome DNA, genomic DNA and cDNA of Th. intermedium, TAi-27 and 3B-2 (a parent of TAi-27) as templates. A total of seven RGAs were obtained and sequenced. Of which, a constitutively expressed single-copy NBS-LRR type RGA ACR 3 was amplified from the dissected alien chromosome of TAi-27, TcDR 2 and TcDR 3 were from cDNA of Th. intermedium, AcDR 3 was from cDNA of TAi-27, FcDR 2 was from cDNA of 3B-2, AR 2 was from genomic DNA of TAi-27 and TR 2 was from genomic DNA of Th. intermedium. Sequence homology analyses showed that the above RGAs were highly homologous with known resistance genes or resistance gene analogs and belonged to NBS-LRR type of R genes. ACR 3 was recovered by PCR from genomic DNA and cDNA of Th. intermedium and TAi-27, but not from 3B-2. Southern hybridization using the digested genomic DNA of Th. intermedium, TAi-27 and 3B-2 as the template and ACR 3 as the probe showed that there is only one copy of ACR 3 in the genome of Th. intermedium and TAi
Sun, Zhibin; Huang, Yan; Wang, Yanzhuo; Zhao, Yuguo; Cui, Zhongli
2014-01-01
Genomic DNA extraction from Gram-positive bacteria is a laborious and time-consuming process. A rapid and convenient method was established to extract genomic DNA from a single colony as a PCR template. KOH-EDTA is used as a lysis buffer to disrupt the cell envelope, releasing genomic DNA, and Tris-HCl (pH = 4) is then added to neutralize the lysate. The lysate can be used directly as a template for PCR amplification. 16S rDNA was successfully amplified from Gram-positive bacteria from the genera of Bacillus, Streptomyces, Micromonospora, Nonomuraea, Microbispora, and Staphylococcus. Amplification of the trpB gene indicated that this method could also be applied to the amplification of functional genes. Compared to colony PCR methods without KOH-EDTA, this method is extremely fast and efficient, and it is applicable to high-throughput PCR amplifications.
Energy Technology Data Exchange (ETDEWEB)
Hipp, Katharina; Rau, Peter; Schäfer, Benjamin [Institut für Biomaterialien und biomolekulare Systeme, Abteilung für Molekularbiologie und Virologie der Pflanzen, Universität Stuttgart, Pfaffenwaldring 57, D-70550 Stuttgart (Germany); Gronenborn, Bruno [Institut des Sciences du Végétal, CNRS, 91198 Gif-sur-Yvette (France); Jeske, Holger, E-mail: holger.jeske@bio.uni-stuttgart.de [Institut für Biomaterialien und biomolekulare Systeme, Abteilung für Molekularbiologie und Virologie der Pflanzen, Universität Stuttgart, Pfaffenwaldring 57, D-70550 Stuttgart (Germany)
2014-08-15
Geminiviruses, single-stranded DNA plant viruses, encode a replication-initiator protein (Rep) that is indispensable for virus replication. A potential cyclin interaction motif (RXL) in the sequence of African cassava mosaic virus Rep may be an alternative link to cell cycle controls to the known interaction with plant homologs of retinoblastoma protein (pRBR). Mutation of this motif abrogated rereplication in fission yeast induced by expression of wildtype Rep suggesting that Rep interacts via its RXL motif with one or several yeast proteins. The RXL motif is essential for viral infection of Nicotiana benthamiana plants, since mutation of this motif in infectious clones prevented any symptomatic infection. The cell-cycle link (Clink) protein of a nanovirus (faba bean necrotic yellows virus) was investigated that activates the cell cycle by binding via its LXCXE motif to pRBR. Expression of wildtype Clink and a Clink mutant deficient in pRBR-binding did not trigger rereplication in fission yeast. - Highlights: • A potential cyclin interaction motif is conserved in geminivirus Rep proteins. • In ACMV Rep, this motif (RXL) is essential for rereplication of fission yeast DNA. • Mutating RXL abrogated viral infection completely in Nicotiana benthamiana. • Expression of a nanovirus Clink protein in yeast did not induce rereplication. • Plant viruses may have evolved multiple routes to exploit host DNA synthesis.
International Nuclear Information System (INIS)
Hipp, Katharina; Rau, Peter; Schäfer, Benjamin; Gronenborn, Bruno; Jeske, Holger
2014-01-01
Geminiviruses, single-stranded DNA plant viruses, encode a replication-initiator protein (Rep) that is indispensable for virus replication. A potential cyclin interaction motif (RXL) in the sequence of African cassava mosaic virus Rep may be an alternative link to cell cycle controls to the known interaction with plant homologs of retinoblastoma protein (pRBR). Mutation of this motif abrogated rereplication in fission yeast induced by expression of wildtype Rep suggesting that Rep interacts via its RXL motif with one or several yeast proteins. The RXL motif is essential for viral infection of Nicotiana benthamiana plants, since mutation of this motif in infectious clones prevented any symptomatic infection. The cell-cycle link (Clink) protein of a nanovirus (faba bean necrotic yellows virus) was investigated that activates the cell cycle by binding via its LXCXE motif to pRBR. Expression of wildtype Clink and a Clink mutant deficient in pRBR-binding did not trigger rereplication in fission yeast. - Highlights: • A potential cyclin interaction motif is conserved in geminivirus Rep proteins. • In ACMV Rep, this motif (RXL) is essential for rereplication of fission yeast DNA. • Mutating RXL abrogated viral infection completely in Nicotiana benthamiana. • Expression of a nanovirus Clink protein in yeast did not induce rereplication. • Plant viruses may have evolved multiple routes to exploit host DNA synthesis
Development and validation of a Q-PCR based TCID50 method for human herpesvirus 6
Directory of Open Access Journals (Sweden)
Gustafsson Rasmus K L
2012-12-01
Full Text Available Abstract Background For titer assessment of human herpesvirus 6 (HHV-6, IFA targeting viral proteins or a TCID50 method with ocular inspection for CPE can be used. These methods rely on the subjective decision of the assessor, obstructing the ability to obtain unanimous results. Findings We have developed and validated an alternative TCID50 read-out approach where infection in the titration culture plate is assessed by viral DNA load change by quantitative PCR. A ten time increase in viral DNA load was determined as cut point for infection since that yielded a maximum correlation with viral protein expression (93%. The average intra-assay CV was 9% for quantitative PCR read-out of TCID50 compared to 45% for ocular inspection read-out of TCID50, 14% for IFA read-out of TCID50, and 43% for an infectious units approach using IFA. The average inter-assay CV for quantitative PCR read-out of TCID50 was 73%, compared to 66%, 25% and 77% for the ocular inspection read-out for TCID50, IFA read-out of TCID50 and infectious unit approaches respectively. Conclusions The quantitative PCR based read-out of TCID50 proved to be more robust and easier to interpret than traditional TCID50 assessment approaches for HHV-6, and therefore it might be considered as an alternative method.
Efficacy of a novel PCR- and microarray-based method in diagnosis of a prosthetic joint infection
2014-01-01
Background and purpose Polymerase chain reaction (PCR) methods enable detection and species identification of many pathogens. We assessed the efficacy of a new PCR and microarray-based platform for detection of bacteria in prosthetic joint infections (PJIs). Methods This prospective study involved 61 suspected PJIs in hip and knee prostheses and 20 negative controls. 142 samples were analyzed by Prove-it Bone and Joint assay. The laboratory staff conducting the Prove-it analysis were not aware of the results of microbiological culture and clinical findings. The results of the analysis were compared with diagnosis of PJIs defined according to the Musculoskeletal Infection Society (MSIS) criteria and with the results of microbiological culture. Results 38 of 61 suspected PJIs met the definition of PJI according to the MSIS criteria. Of the 38 patients, the PCR detected bacteria in 31 whereas bacterial culture was positive in 28 patients. 15 of the PJI patients were undergoing antimicrobial treatment as the samples for analysis were obtained. When antimicrobial treatment had lasted 4 days or more, PCR detected bacteria in 6 of the 9 patients, but positive cultures were noted in only 2 of the 9 patients. All PCR results for the controls were negative. Of the 61 suspected PJIs, there were false-positive PCR results in 6 cases. Interpretation The Prove-it assay was helpful in PJI diagnostics during ongoing antimicrobial treatment. Without preceding treatment with antimicrobials, PCR and microarray-based assay did not appear to give any additional information over culture. PMID:24564748
Analogies between colored Lévy noise and random channel approach to disordered kinetics
Vlad, Marcel O.; Velarde, Manuel G.; Ross, John
2004-02-01
We point out some interesting analogies between colored Lévy noise and the random channel approach to disordered kinetics. These analogies are due to the fact that the probability density of the Lévy noise source plays a similar role as the probability density of rate coefficients in disordered kinetics. Although the equations for the two approaches are not identical, the analogies can be used for deriving new, useful results for both problems. The random channel approach makes it possible to generalize the fractional Uhlenbeck-Ornstein processes (FUO) for space- and time-dependent colored noise. We describe the properties of colored noise in terms of characteristic functionals, which are evaluated by using a generalization of Huber's approach to complex relaxation [Phys. Rev. B 31, 6070 (1985)]. We start out by investigating the properties of symmetrical white noise and then define the Lévy colored noise in terms of a Langevin equation with a Lévy white noise source. We derive exact analytical expressions for the various characteristic functionals, which characterize the noise, and a functional fractional Fokker-Planck equation for the probability density functional of the noise at a given moment in time. Second, by making an analogy between the theory of colored noise and the random channel approach to disordered kinetics, we derive fractional equations for the evolution of the probability densities of the random rate coefficients in disordered kinetics. These equations serve as a basis for developing methods for the evaluation of the statistical properties of the random rate coefficients from experimental data. Special attention is paid to the analysis of systems for which the observed kinetic curves can be described by linear or nonlinear stretched exponential kinetics.
Revolución versus reforma educativa en la segunda república española. Elementos de ruptura
Directory of Open Access Journals (Sweden)
Juan Manuel FERNÁNDEZ SORIA
2010-03-01
Full Text Available RESUMEN: Están fuera de toda duda las conexiones existentes entre la República de 1931-35 y la de 1936-39. En este sentido estamos de acuerdo con quienes afirman que el estallido de la guerra del 36 es el resultado de un proceso que arranca del mismo año en que se proclama la II República, iniciándose ya entonces —como sostiene Andrés M. Kramer— la «mecánica de guerra civil». La educación republicana en tiempo de guerra no puede quedar fuera de esta consideración, porque aquélla sumerge sus cimientos más profundos en la política educativa de 1931-35. Efectivamente, muchas de las acciones educativas y culturales llevadas a cabo durante la guerra no tendrían fácil explicación si no se examina previamente la tarea de la República del 31 en estos mismos aspectos.
Estrada-Barraza, Deyanira; Dávalos Martínez, Arturo; Flores-Padilla, Luis; Mendoza-De Elias, Roberto; Sánchez-Vargas, Luis Octavio
2011-01-01
The increase in the incidence of yeast species causing fungemia in susceptible immunocompromised patients in the last two decades and the low sensitivity of conventional blood culture has led to the need to develop alternative approaches for the early detection and identification of causative species. The aim of this study was to compare the usefulness of molecular testing by the polymerase chain reaction (PCR) and conventional methods to identify clinical isolates of different species, using the ID32C ATB system (bioMérieux, France), chromogenic culture Chromagar Candida® (CHROMagar, France) and morphogenesis in corn meal agar. We studied 79 isolates, in which the most prevalent species using the system ID32C and PCR was C. albicans, followed by C. tropicalis, C. glabrata and C .krusei. PCR patterns obtained for the identification of clinical isolates were stable and consistent in the various independent studies and showed good reproducibility, concluding that PCR with species-specific primers that amplify genes ITS1 and ITS2 for rRNA or topoisomerase II primers is a very specific and sensitive method for the identification of C. glabrata, C. krusei, C. albicans, and with less specificity for C. tropicalis. Copyright © 2010 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.
Detection of Brucella melitensis and Brucella abortus strains using a single-stage PCR method
Directory of Open Access Journals (Sweden)
Alamian, S.
2015-04-01
Full Text Available Brucella melitensis and Brucella abortus are of the most important causes of brucellosis, an infectious disease which is transmitted either directly or indirectly including consuming unpasteurized dairy products. Both strains are considered endemic in Iran. Common diagnostic methods such as bacteriologic cultures are difficult and time consuming regarding the bacteria. The aim of this study was to suggest a single-stage PCR method using a pair of primers to detect both B. melitensis and B. abortus. The primers were named UF1 and UR1 and the results showed that the final size of PCR products were 84 bp and 99 bp for B. melitensis and B. abortus, respectively. Therefore the method could be useful for rapid detection of B. melitensis and B. abortus simultaneously.
SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD
Directory of Open Access Journals (Sweden)
Mehmet AYBEKE
2015-12-01
Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.
Doubling-resolution analog-to-digital conversion based on PIC18F45K80
Directory of Open Access Journals (Sweden)
Yueyang Yuan
2014-08-01
Full Text Available Aiming at the analog signal being converted into the digital with a higher precision, a method to improve the analog-to-digital converter (ADC resolution is proposed and described. Based on the microcomputer PIC18F45K80 in which the internal ADC modules are embedded, a circuit is designed for doubling the resolution of ADC. According to the circuit diagram, the mathematical formula for calculating this resolution is derived. The corresponding software and print circuit board assembly is also prepared. With the experiment, a 13 bit ADC is achieved based on the 12 bit ADC module predesigned in the PIC18F45K80.
Zarrinfar, Hossein; Makimura, Koichi; Satoh, Kazuo; Khodadadi, Hossein; Mirhendi, Hossein
2013-05-01
Although the incidence of invasive aspergillosis in the intensive care unit (ICU) is scarce, it has emerged as major problems in critically ill patients. In this study, the incidence of pulmonary aspergillosis (PA) in ICU patients has evaluated and direct microscopy and culture has compared with nested polymerase chain reaction (PCR) and real-time PCR for detection of Aspergillus fumigatus and A. flavus in bronchoalveolar lavage (BAL) samples of the patients. Thirty BAL samples obtained from ICU patients during a 16-month period were subjected to direct examinations on 20% potassium hydroxide (KOH) and culture on two culture media. Nested PCR targeting internal transcribed spacer ribosomal DNA and TaqMan real-time PCR assay targeting β-tubulin gene were used for the detection of A. fumigatus and A. flavus. Of 30 patients, 60% were men and 40% were women. The diagnosis of invasive PA was probable in 1 (3%), possible in 11 (37%), and not IPA in 18 (60%). Nine samples were positive in nested PCR including seven samples by A. flavus and two by A. fumigatus specific primers. The lowest amount of DNA that TaqMan real-time PCR could detect was ≥40 copy numbers. Only one of the samples had a positive result of A. flavus real-time PCR with Ct value of 37.5. Although a significant number of specimens were positive in nested PCR, results of this study showed that establishment of a correlation between the conventional methods with nested PCR and real-time PCR needs more data confirmed by a prospective study with a larger sample group. © 2013 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Costa Elena
2011-05-01
Full Text Available Abstract Background 22q11.2 microdeletion is responsible for the DiGeorge Syndrome, characterized by heart defects, psychiatric disorders, endocrine and immune alterations and a 1 in 4000 live birth prevalence. Real-time quantitative PCR (qPCR approaches for allelic copy number determination have recently been investigated in 22q11.2 microdeletions detection. The qPCR method was performed for 22q11.2 microdeletions detection as a first-level screening approach in a genetically unknown series of patients with congenital heart defects. A technical issue related to the VPREB1 qPCR marker was pointed out. Methods A set of 100 unrelated Italian patients with congenital heart defects were tested for 22q11.2 microdeletions by a qPCR method using six different markers. Fluorescence In Situ Hybridization technique (FISH was used for confirmation. Results qPCR identified six patients harbouring the 22q11.2 microdeletion, confirmed by FISH. The VPREB1 gene marker presented with a pattern consistent with hemideletion in one 3 Mb deleted patient, suggestive for a long distal deletion, and in additional five non-deleted patients. The long distal 22q11.2 deletion was not confirmed by Comparative Genomic Hybridization. Indeed, the VPREB1 gene marker generated false positive results in association with the rs1320 G/A SNP, a polymorphism localized within the VPREB1 marker reverse primer sequence. Patients heterozygous for rs1320 SNP, showed a qPCR profile consistent with the presence of a hemideletion. Conclusions Though the qPCR technique showed advantages as a screening approach in terms of cost and time, the VPREB1 marker case revealed that single nucleotide polymorphisms can interfere with qPCR data generating erroneous allelic copy number interpretations.
Progressive Conversion from B-rep to BSP for Streaming Geometric Modeling.
Bajaj, Chandrajit; Paoluzzi, Alberto; Scorzelli, Giorgio
2006-01-01
We introduce a novel progressive approach to generate a Binary Space Partition (BSP) tree and a convex cell decomposition for any input triangles boundary representation (B-rep), by utilizing a fast calculation of the surface inertia. We also generate a solid model at progressive levels of detail. This approach relies on a variation of standard BSP tree generation, allowing for labeling cells as in, out and fuzzy, and which permits a comprehensive representation of a solid as the Hasse diagram of a cell complex. Our new algorithm is embedded in a streaming computational framework, using four types of dataflow processes that continuously produce, transform, combine or consume subsets of cells depending on their number or input/output stream. A varied collection of geometric modeling techniques are integrated in this streaming framework, including polygonal, spline, solid and heterogeneous modeling with boundary and decompositive representations, Boolean set operations, Cartesian products and adaptive refinement. The real-time B-rep to BSP streaming results we report in this paper are a large step forward in the ultimate unification of rapid conceptual and detailed shape design methodologies.
Quantification of DNA fragmentation in processed foods using real-time PCR.
Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi
2017-07-01
DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Amir Aliramezani
2012-01-01
Full Text Available Background and Aims: Periodontitis is one of the most common oral diseases with the various incidence rates in different populations. A number of bacteria are considered as the major etiologic agents of periodontitis. The aim of the present study was to determine the prevalence of periodontopathogen bacteria in patients using both PCR and culture techniques.Materials and Methods: In this study, one-hundred patients (including 62 females and 38 males with an average age of 49±11.5 years with adult periodontitis referred to periodontics department of School of Dentistry/Tehran University of Medical Sciences were investigated. The samples were taken and sent immediately to the laboratory for culture and molecular evaluation. The PCR was performed using specific primers and the statistical analysis of data was performed using SPSS statistic software and McNemar test.Results: The results demonstrated that the total detection rate in culture method was 64%. The rate of Aggregatibacter actinomycetemcomitans (Aa was 28% which was significantly higher than that of Porphyromonas gingivalis (Pg (6% and Prevotella intermedia (Pi (3%. 27% of cases showed mixed bacterial growth. 65% of patients were positive using molecular method. The rate of Aa (30% was significantly higher than that of Pg (7% and Pi (5%. The mixed PCR positive rate containing of Aa, Pg and Pi was (23%.Conclusion: In this study, it was found that most of the bacteria isolated using culture and molecular methods were Aa, Pg and Pi, respectively. Although the detection frequencies of both techniques were similar, the specificity, sensitivity and bacterial detection speed of the PCR technique is obviously higher. Therefore, the use of molecular techniques is strongly recommended. However, both techniques seem to be suitable for microbiological diagnostics.
Torriani, S; Zapparoli, G; Dellaglio, F
1999-10-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.
Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco
1999-01-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059
Directory of Open Access Journals (Sweden)
Tanja Pasanen
Full Text Available Multidrug-resistant Acinetobacter baumannii (MDRAB is an increasing problem worldwide. Prevalence of carbapenem resistance in Acinetobacter spp. due to acquired carbapenemase genes is not known in Finland. The purpose of this study was to examine prevalence and clonal spread of multiresistant A. baumannii group species, and their carbapenemase genes. A total of 55 Acinetobacter isolates were evaluated with repetitive PCR (DiversiLab to analyse clonality of isolates, in conjunction with antimicrobial susceptibility profile for ampicillin/sulbactam, colistin, imipenem, meropenem, rifampicin and tigecycline. In addition, a new real-time PCR assay, detecting most clinically important carbapenemase genes just in two multiplex reactions, was developed. The assay detects genes for KPC, VIM, IMP, GES-1/-10, OXA-48, NDM, GIM-1, SPM-1, IMI/NMC-A, SME, CMY-10, SFC-1, SIM-1, OXA-23-like, OXA-24/40-like, OXA-58 and ISAbaI-OXA-51-like junction, and allows confident detection of isolates harbouring acquired carbapenemase genes. There was a time-dependent, clonal spread of multiresistant A. baumannii strongly correlating with carbapenamase gene profile, at least in this geographically restricted study material. The new carbapenemase screening assay was able to detect all the genes correctly suggesting it might be suitable for epidemiologic screening purposes in clinical laboratories.
HLA-DQA1 typing in Danes by two polymerase chain reaction (PCR) based methods
DEFF Research Database (Denmark)
Cowland, J B; Madsen, H O; Morling, N
1995-01-01
(ASA) method, which together recognise eight alleles. In 146 unrelated Danish individuals, the HLA-DQA1 alleles were in Hardy-Weinberg equilibrium. For identity testing, the power of discrimination (PD) of HLA-DQA1 was 0.932 with the RDB method and 0.942 with the PCR-RFLP/ASA method. For paternity...
Continuous administration of short-lived radioisotope tracers and the analogous Laplace transform
International Nuclear Information System (INIS)
Orr, J.S.
1979-01-01
Short-lived radioactive tracers are used because of the low radiation dose to patients. Another advantage finding increasing use, however, is that the equilibrium activities achieved by continuous administration to a steady state contain kinetic information. This is not the case with long-lived isotopes. The derivation of quantitative kinetic information in the form of rate constants or flows requires the formulation of a model of the system being studied. Several approaches to this have been published based on a model of single compartments with simultaneous arrival of tracer. To deal with more realistic models a method is proposed which uses the analogy between the procedure of continuous administration of short-lived tracer and the Laplace transform. This analogy permits all the theorems of Laplace transform theory to be applied to the analysis of measured activities. The basis of the analogy is explained and examples are given of its application to a number of models which represent actual physiology more realistically than single compartment models. In these applications the transformed equations representing the model, with measured values of activity inserted for each transform, are solved to derive the rate constants. This is different from the use of Laplace transforms where the constant coefficients are known and the initial value problem is solved to find the behaviour of the variables. (author)
Análisis de la relación comercial entre la República de Colombia y la República de Costa Rica
Romero Escobar, Juán Sebastián; Bermudez Monroy, María Gabriela
2012-01-01
Dadas las relaciones de cooperación internacional que presentan las Repúblicas de Colombia y Costa Rica, que se evidencia en los fuertes vínculos comerciales existentes entre las dos naciones, Proexport por medio de su oficina comercial en Costa Rica, ha mantenido al tanto la situación en la que se desenvuelve la alianza comercial entre Colombia y Costa Rica. Él último de estos informes, demuestra la potencialidad de Costa Rica como un mercado para los bienes colombianos y una posibilidad par...
Rampling, Jeremy; Mitchell, Alex J; Von Oertzen, Tim; Docker, James; Jackson, Jemima; Cock, Hannah; Agrawal, Niruj
2012-10-01
Depression is an important but underdiagnosed complication of epilepsy. This study compares potentially suitable screening tools head-to-head. We enrolled 266 attendees with a confirmed diagnosis of epilepsy at a specialized neurologic epilepsy service in London and compared verbal self-report and visual analog (VAS) screening methods for depression. These included two generic depression scales (Hospital Anxiety and Depression Scale [HADS], Beck Depression Inventory II [BDI-II]), one epilepsy specific scale (Neurological Disorders Depression Inventory for Epilepsy [NDDI-E]) and one new visual-analog scale (Emotional Thermometers [ET]). We used Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) criteria for major depression and International Classification of Diseases, Tenth Revision (ICD-10) criteria for depressive episode as the reference standard. Against ICD-10-defined depression the most accurate scales by receiver operating characteristic (ROC) curve area were HADS Total (HADS-T, 0.924), BDI-II (0.898) and NDDI-E (0.897). New visual-analog methods had similar accuracy measured either in combination or individually. Although no test performed well in a case-finding role, several performed well as a rule-out initial step, owing to high negative predictive value and specificity. In this role, the optimal performing conventional tools were the HADS depression subsscale (HADS-D) and the NDDI-E and the optimal single VAS were the depression thermometer (DepT) and the distress thermometer (DT). Against DSM-IV- defined major depression, results were similar with optimal performance by the HADS-T, BDI-II, and NDDI-E, but here the anxiety thermometer (AnxT) as well as DepT and DT also offered good performance. Given that no test performed well in a case-finding role, we suggest that these tests are used as an initial first step to rule out patients who are unlikely to have depression. We suggest that the six-item NDDI-E or seven-item HADS
Naddaf, S R; Kishdehi, M; Siavashi, Mr
2011-01-01
The mainstay of diagnosis of relapsing fever (RF) is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by microscopy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spirochetemia. Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR targeting flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were performed on blood samples with various degrees of spirochetemia. The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spirochete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL) was used as template. The centrifuged-based enrichment method turned positive with as low concentration as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.
Letovanec, Igor; Finn, Stephen; Zygoura, Panagiota; Smyth, Paul; Soltermann, Alex; Bubendorf, Lukas; Speel, Ernst-Jan; Marchetti, Antonio; Nonaka, Daisuke; Monkhorst, Kim; Hager, Henrik; Martorell, Miguel; Sejda, Aleksandra; Cheney, Richard; Hernandez-Losa, Javier; Verbeken, Eric; Weder, Walter; Savic, Spasenija; Di Lorito, Alessia; Navarro, Atilio; Felip, Enriqueta; Warth, Arne; Baas, Paul; Meldgaard, Peter; Blackhall, Fiona; Dingemans, Anne-Marie; Dienemann, Hendrik; Dziadziuszko, Rafal; Vansteenkiste, Johan; O'Brien, Cathal; Geiger, Thomas; Sherlock, Jon; Schageman, Jeoffrey; Dafni, Urania; Kammler, Roswitha; Kerr, Keith; Thunnissen, Erik; Stahel, Rolf; Peters, Solange
2018-03-01
The reported prevalence of ALK receptor tyrosine kinase gene (ALK) rearrangement in NSCLC ranges from 2% to 7%. The primary standard diagnostic method is fluorescence in situ hybridization (FISH). Recently, immunohistochemistry (IHC) has also proved to be a reproducible and sensitive technique. Reverse-transcriptase polymerase chain reaction (RT-PCR) has also been advocated, and most recently, the advent of targeted next-generation sequencing (NGS) for ALK and other fusions has become possible. This study compares anaplastic lymphoma kinase (ALK) evaluation with all four techniques in resected NSCLC from the large European Thoracic Oncology Platform Lungscape cohort. A total of 96 cases from the European Thoracic Oncology Platform Lungscape iBiobank, with any ALK immunoreactivity were examined by FISH, central RT-PCR, and NGS. An H-score higher than 120 defines IHC positivity. RNA was extracted from the same formalin-fixed, paraffin-embedded tissues. For RT-PCR, primers covered the most frequent ALK translocations. For NGS, the Oncomine Solid Tumour Fusion Transcript Kit (Thermo Fisher Scientific, Waltham, MA) was used. The concordance was assessed using the Cohen κ coefficient (two-sided α ≤ 5%). NGS provided results for 77 of the 95 cases tested (81.1%), whereas RT-PCR provided results for 77 of 96 (80.2%). Concordance occurred in 55 cases of the 60 cases tested with all four methods (43 ALK negative and 12 ALK positive). Using ALK copositivity for IHC and FISH as the criterion standard, we derived a sensitivity for RT-PCR/NGS of 70.0%/85.0%, with a specificity of 87.1%/79.0%. When either RT-PCR or NGS was combined with IHC, the sensitivity remained the same, whereas the specificity increased to 88.7% and 83.9% respectively. NGS evaluation with the Oncomine Solid Tumour Fusion transcript kit and RT-PCR proved to have high sensitivity and specificity, advocating their use in routine practice. For maximal sensitivity and specificity, ALK status should be
On derivation and interpretation of Kuo-Eliassen equation
Directory of Open Access Journals (Sweden)
Jun-Ichi Yano
2011-05-01
Full Text Available The Kuo–Eliassen equation provides a balance condition for both tropical–cyclone like vortex systems as well as zonally–symmetric meridional circulations. This condition is examined with the former application more in mind. The condition is derived more ped- agogically based on the bounded derivative method. Some physical interpretations as well as basic mathematical remarks on this condition are provided. Analogy with quasi–geostrophic system is also remarked.
Ultra Fast, High Rep Rate, High Voltage Spark Gap Pulser
1995-07-01
current rise time. The spark gap was designed to have a coaxial geometry reducing its inductance. Provisions were made to pass flowing gas between the...ULTRA FAST, HIGH REP RATE, HIGH VOLTAGE SPARK GAP PULSER Robert A. Pastore Jr., Lawrence E. Kingsley, Kevin Fonda, Erik Lenzing Electrophysics and...Modeling Branch AMSRL-PS-EA Tel.: (908)-532-0271 FAX: (908)-542-3348 U.S. Army Research Laboratory Physical Sciences Directorate Ft. Monmouth
Spuesens, Emiel B M; van de Kreeke, Nick; Estevão, Silvia; Hoogenboezem, Theo; Sluijter, Marcel; Hartwig, Nico G; van Rossum, Annemarie M C; Vink, Cornelis
2011-02-01
Mycoplasma pneumoniae is a human pathogen that causes a range of respiratory tract infections. The first step in infection is adherence of the bacteria to the respiratory epithelium. This step is mediated by a specialized organelle, which contains several proteins (cytadhesins) that have an important function in adherence. Two of these cytadhesins, P40 and P90, represent the proteolytic products from a single 130 kDa protein precursor, which is encoded by the MPN142 gene. Interestingly, MPN142 contains a repetitive DNA element, termed RepMP5, of which homologues are found at seven other loci within the M. pneumoniae genome. It has been hypothesized that these RepMP5 elements, which are similar but not identical in sequence, recombine with their counterpart within MPN142 and thereby provide a source of sequence variation for this gene. As this variation may give rise to amino acid changes within P40 and P90, the recombination between RepMP5 elements may constitute the basis of antigenic variation and, possibly, immune evasion by M. pneumoniae. To investigate the sequence variation of MPN142 in relation to inter-RepMP5 recombination, we determined the sequences of all RepMP5 elements in a collection of 25 strains. The results indicate that: (i) inter-RepMP5 recombination events have occurred in seven of the strains, and (ii) putative RepMP5 recombination events involving MPN142 have induced amino acid changes in a surface-exposed part of the P40 protein in two of the strains. We conclude that recombination between RepMP5 elements is a common phenomenon that may lead to sequence variation of MPN142-encoded proteins.
How Often Is p[subscript rep] Close to the True Replication Probability?
Trafimow, David; MacDonald, Justin A.; Rice, Stephen; Clason, Dennis L.
2010-01-01
Largely due to dissatisfaction with the standard null hypothesis significance testing procedure, researchers have begun to consider alternatives. For example, Killeen (2005a) has argued that researchers should calculate p[subscript rep] that is purported to indicate the probability that, if the experiment in question were replicated, the obtained…
Validation of a same-day real-time PCR method for screening of meat and carcass swabs for Salmonella
2009-01-01
Background One of the major sources of human Salmonella infections is meat. Therefore, efficient and rapid monitoring of Salmonella in the meat production chain is necessary. Validation of alternative methods is needed to prove that the performance is equal to established methods. Very few of the published PCR methods for Salmonella have been validated in collaborative studies. This study describes a validation including comparative and collaborative trials, based on the recommendations from the Nordic organization for validation of alternative microbiological methods (NordVal) of a same-day, non-commercial real-time PCR method for detection of Salmonella in meat and carcass swabs. Results The comparative trial was performed against a reference method (NMKL-71:5, 1999) using artificially and naturally contaminated samples (60 minced veal and pork meat samples, 60 poultry neck-skins, and 120 pig carcass swabs). The relative accuracy was 99%, relative detection level 100%, relative sensitivity 103% and relative specificity 100%. The collaborative trial included six laboratories testing minced meat, poultry neck-skins, and carcass swabs as un-inoculated samples and samples artificially contaminated with 1–10 CFU/25 g, and 10–100 CFU/25 g. Valid results were obtained from five of the laboratories and used for the statistical analysis. Apart from one of the non-inoculated samples being false positive with PCR for one of the laboratories, no false positive or false negative results were reported. Partly based on results obtained in this study, the method has obtained NordVal approval for analysis of Salmonella in meat and carcass swabs. The PCR method was transferred to a production laboratory and the performance was compared with the BAX Salmonella test on 39 pork samples artificially contaminated with Salmonella. There was no significant difference in the results obtained by the two methods. Conclusion The real-time PCR method for detection of Salmonella in meat
Directory of Open Access Journals (Sweden)
Bárbara Angulo
Full Text Available The objective of this study is to compare two EGFR testing methodologies (a commercial real-time PCR kit and a specific EGFR mutant immunohistochemistry, with direct sequencing and to investigate the limit of detection (LOD of both PCR-based methods. We identified EGFR mutations in 21 (16% of the 136 tumours analyzed by direct sequencing. Interestingly, the Therascreen EGFR Mutation Test kit was able to characterize as wild-type one tumour that could not be analyzed by direct sequencing of the PCR product. We then compared the LOD of the kit and that of direct sequencing using the available mutant tumours. The kit was able to detect the presence of a mutation in a 1% dilution of the total DNA in nine of the 18 tumours (50%, which tested positive with the real-time quantitative PCR method. In all cases, EGFR mutation was identified at a dilution of 5%. Where the mutant DNA represented 30% of the total DNA, sequencing was able to detect mutations in 12 out of 19 cases (63%. Additional experiments with genetically defined standards (EGFR ΔE746-A750/+ and EGFR L858R/+ yielded similar results. Immunohistochemistry (IHC staining with exon 19-specific antibody was seen in eight out of nine cases with E746-A750del detected by direct sequencing. Neither of the two tumours with complex deletions were positive. Of the five L858R-mutated tumours detected by the PCR methods, only two were positive for the exon 21-specific antibody. The specificity was 100% for both antibodies. The LOD of the real-time PCR method was lower than that of direct sequencing. The mutation specific IHC produced excellent specificity.
Directory of Open Access Journals (Sweden)
S. Sameie-Shirkadeh
2017-01-01
Full Text Available Introduction: P. syringae pv. syringae (P.s.s, the causal agent of blast of citrus trees, is one of the most important plant pathogens in the world. P.s.s is unique among most P. syringae pathovars according to its ability to cause disease in over 180 species of plants in several unrelated genera. Traditionally, Strains of P.s.s are identified on the basis of biochemical and nutritional tests and symptom expression in host plants. Genomic fingerprinting methods based on the polymerase chain reaction (PCR have been applied for identification and classification of plant-associated bacteria to the subspecies level. The objectives of this study were the phenotypic and molecular evaluation of P.s. pv. syringae strains causing citrus blast in the West of Mazandaran and the East of Guilan, and study of genetic diversity of P.s.s isolates of citrus by using ERIC and REP-PCR markers. Materials and Methods: During 2011 to 2012, citrus infected tissues were sampled from different orchards in the West of Mazandaran and the East of Guilan. Bacterial phenotypes were studied based on standard physiological and biochemical tests. Gram reaction was determined by potassium hydroxide solubility test (KOH test. Strains were grown on King'B medium (KB and fluorescent pigment production was evaluated. Levan formation, oxidase reaction, potato soft rot, Arginine dihydrolase and induction of the hypersensitive reaction in tobacco leaves (LOPAT tests, were done as described by Schadd et al. The standard strains of P.s. pv. syringae form IVIA were used as reference strains in this study. Pathogenicity Test was done as described by Yessad et al. Citrus seedlings were maintained in a greenhouse at 20°C. In addition, a PCR-based method was used to confirm the genus and species of bacteria by using bacterial specific primer pair’s designed for a specific gene of syringomycin B. Genetic diversity among the strains, was studied by rep-PCR fingerprinting. Genomic
Directory of Open Access Journals (Sweden)
Sabrina R.A. Queiroz
2013-01-01
Full Text Available RNA replicon derived from Flavivirus genome is a valuable tool for studying viral replication independent of virion assembly and maturation, besides being a great potencial for heterologous gene expression. In this study we described the construction of subgenomic replicons of yellow fever virus by yeast-based homologous recombination technique. The plasmid containing the yellow fever 17D strain replicon (pBSC-repYFV-17D, previously characterized, was handled to heterologous expression of the green fluorescent protein (repYFV-17D-GFP and firefly luciferase (repYFV-17D-Luc reporter genes. Both replicons were constructed by homologous recombination between the linearized vector pBSC-repYFV-17D and the PCR product containing homologous 25 nucleotides ends incorporated into PCR primers. The genomic organization of these constructs is similar to repYFV-17D, but with insertion of the reporter gene between the remaining 63 N-terminal nucleotides of the capsid protein and 72 C-terminal nucleotides of the E protein. The replicons repYFV-17D-GFP and repYFV-17D-Luc showed efficient replication and expression of the reporter genes. The yeast-based homologous recombination technique used in this study proved to be applicable for manipulation of the yellow fever virus genome in order to construct subgenomic replicons.O replicon de RNA derivado do genoma de Flavivirus é uma ferramenta valiosa para o estudo de replicação viral independente da montagem e da maturação do virion, além de possuir um grande potencial para expressão de genes heterólogos. Neste estudo nós descrevemos a construção de replicons subgenômicos do vírus da febre amarela utilizando a técnica de recombinação homóloga em levedura. O plasmídeo contendo o replicon do vírus febre amarela cepa 17D (pBSC-repYFV-17D, caracterizado anteriormente, foi manipulado para a expressão heteróloga dos genes repórteres green fluorescent protein (repYFV-17D-GFP e firelly luciferase (rep
Chahorm, Kanchana; Prakitchaiwattana, Cheunjit
2018-01-02
The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004
Boogert, van den P.H.J.F.; Gent-Pelzer, van M.P.E.; Bonants, P.J.M.; Boer, de S.H.; Wander, J.G.N.; Lévesque, C.A.; Leeuwen, van G.C.M.; Baayen, R.P.
2005-01-01
Abstract PCR-based methods were developed for the detection and quantification of the potato pathogen Synchytrium endobioticum in soil extracts and in planta. PCR primers, based on the internal transcribed spacer region of the multi-copy gene rDNA were tested for specificity, sensitivity and
Molecular typing of uropathogenic E. coli strains by the ERIC-PCR method.
Ardakani, Maryam Afkhami; Ranjbar, Reza
2016-04-01
Escherichia coli (E. coli) is the most common cause of urinary infections in hospitals. The aim of this study was to evaluate the ERIC-PCR method for molecular typing of uropathogenic E. coli strains isolated from hospitalized patients. In a cross sectional study, 98 E. coli samples were collected from urine samples taken from patients admitted to Baqiyatallah Hospital from June 2014 to January 2015. The disk agar diffusion method was used to determine antibiotic sensitivity. DNA proliferation based on repetitive intergenic consensus was used to classify the E. coli strains. The products of proliferation were electrophoresed on 1.5% agarose gel, and their dendrograms were drawn. The data were analyzed by online Insillico software. The method used in this research proliferated numerous bands (4-17 bands), ranging from 100 to 3000 base pairs. The detected strains were classified into six clusters (E1-E6) with 70% similarity between them. In this study, uropathogenic E. coli strains belonged to different genotypic clusters. It was found that ERIC-PCR had good differentiation power for molecular typing of uropathogenic E. coli strains isolated from the patients in the study.
Camilo, Lilian Muniz; Pereira-Chioccola, Vera Lucia; Gava, Ricardo; Meira-Strejevitch, Cristina da Silva; Vidal, Jose Ernesto; Brandão de Mattos, Cinara Cássia; Frederico, Fábio Batista; De Mattos, Luiz Carlos; Spegiorin, Lígia Cosentino Junqueira Franco
Symptomatic forms of toxoplasmosis are a serious public health problem and occur in around 10-20% of the infected people. Aiming to improve the molecular diagnosis of symptomatic toxoplasmosis in Brazilian patients, this study evaluated the performance of real time PCR testing two primer sets (B1 and REP-529) in detecting Toxoplasma gondii DNA. The methodology was assayed in 807 clinical samples with known clinical diagnosis, ELISA, and conventional PCR results in a 9-year period. All samples were from patients with clinical suspicion of several features of toxoplasmosis. According to the minimum detection limit curve (in C T ), REP-529 had greater sensitivity to detect T. gondii DNA than B1. Both primer sets were retrospectively evaluated using 515 DNA from different clinical samples. The 122 patients without toxoplasmosis provided high specificity (REP-529, 99.2% and B1, 100%). From the 393 samples with positive ELISA, 146 had clinical diagnosis of toxoplasmosis and positive conventional PCR. REP-529 and B1 sensitivities were 95.9% and 83.6%, respectively. Comparison of REP-529 and B1 performances was further analyzed prospectively in 292 samples. Thus, from a total of 807 DNA analyzed, 217 (26.89%) had positive PCR with, at least one primer set and symptomatic toxoplasmosis confirmed by clinical diagnosis. REP-529 was positive in 97.23%, whereas B1 amplified only 78.80%. After comparing several samples in a Brazilian referral laboratory, this study concluded that REP-529 primer set had better performance than B1 one. These observations were based after using cases with defined clinical diagnosis, ELISA, and conventional PCR. Copyright © 2017 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.
Assessment of the real-time PCR and different digital PCR platforms for DNA quantification.
Pavšič, Jernej; Žel, Jana; Milavec, Mojca
2016-01-01
Digital PCR (dPCR) is beginning to supersede real-time PCR (qPCR) for quantification of nucleic acids in many different applications. Several analytical properties of the two most commonly used dPCR platforms, namely the QX100 system (Bio-Rad) and the 12.765 array of the Biomark system (Fluidigm), have already been evaluated and compared with those of qPCR. However, to the best of our knowledge, direct comparison between the three of these platforms using the same DNA material has not been done, and the 37 K array on the Biomark system has also not been evaluated in terms of linearity, analytical sensitivity and limit of quantification. Here, a first assessment of qPCR, the QX100 system and both arrays of the Biomark system was performed with plasmid and genomic DNA from human cytomegalovirus. With use of PCR components that alter the efficiency of qPCR, each dPCR platform demonstrated consistent copy-number estimations, which indicates the high resilience of dPCR. Two approaches, one considering the total reaction volume and the other considering the effective reaction size, were used to assess linearity, analytical sensitivity and variability. When the total reaction volume was considered, the best performance was observed with qPCR, followed by the QX100 system and the Biomark system. In contrast, when the effective reaction size was considered, all three platforms showed almost equal limits of detection and variability. Although dPCR might not always be more appropriate than qPCR for quantification of low copy numbers, dPCR is a suitable method for robust and reproducible quantification of viral DNA, and a promising technology for the higher-order reference measurement method.
Nitrate analogs as attractants for soybean cyst nematode.
Hosoi, Akito; Katsuyama, Tsutomu; Sasaki, Yasuyuki; Kondo, Tatsuhiko; Yajima, Shunsuke; Ito, Shinsaku
2017-08-01
Soybean cyst nematode (SCN) Heterodera glycines Ichinohe, a plant parasite, is one of the most serious pests of soybean. In this paper, we report that SCN is attracted to nitrate and its analogs. We performed attraction assays to screen for novel attractants for SCN and found that nitrates were attractants for SCN and SCN recognized nitrate gradients. However, attraction of SCN to nitrates was not observed on agar containing nitrate. To further elucidate the attraction mechanism in SCN, we performed attraction assays using nitrate analogs ([Formula: see text], [Formula: see text], [Formula: see text]). SCN was attracted to all nitrate analogs; however, attraction of SCN to nitrate analogs was not observed on agar containing nitrate. In contrast, SCN was attracted to azuki root, irrespective of presence or absence of nitrate in agar media. Our results suggest that the attraction mechanisms differ between plant-derived attractant and nitrate.
A multiplex PCR method for rapid identification of Brachionus rotifers.
Vasileiadou, Kalliopi; Papakostas, Spiros; Triantafyllidis, Alexander; Kappas, Ilias; Abatzopoulos, Theodore J
2009-01-01
Cryptic species are increasingly being recognized in many organisms. In Brachionus rotifers, many morphologically similar yet genetically distinct species/biotypes have been described. A number of Brachionus cryptic species have been recognized among hatchery strains. In this study, we present a simple, one-step genetic method to detect the presence of those Brachionus sp. rotifers that have been found in hatcheries. With the proposed technique, each of the B. plicatilis sensu stricto, B. ibericus, Brachionus sp. Nevada, Brachionus sp. Austria, Brachionus sp. Manjavacas, and Brachionus sp. Cayman species and/or biotypes can be identified with polymerase chain reaction (PCR) analysis. Based on 233 cytochrome c oxidase subunit I sequences, we reviewed all the available cryptic Brachionus sp. genetic polymorphisms, and we designed six nested primers. With these primers, a specific amplicon of distinct size is produced for every one of the involved species/biotypes. Two highly sensitive protocols were developed for using the primers. Many of the primers can be combined in the same PCR. The proposed method has been found to be an effective and practical tool to investigate the presence of the above six cryptic species/biotypes in both individual and communal (bulk) rotifer deoxyribonucleic acid extractions from hatcheries. With this technique, hatchery managers could easily determine their rotifer composition at the level of cryptic species and monitor their cultures more efficiently.
Directory of Open Access Journals (Sweden)
Alejandro G Schijman
Full Text Available BACKGROUND: A century after its discovery, Chagas disease still represents a major neglected tropical threat. Accurate diagnostics tools as well as surrogate markers of parasitological response to treatment are research priorities in the field. The purpose of this study was to evaluate the performance of PCR methods in detection of Trypanosoma cruzi DNA by an external quality evaluation. METHODOLOGY/FINDINGS: An international collaborative study was launched by expert PCR laboratories from 16 countries. Currently used strategies were challenged against serial dilutions of purified DNA from stocks representing T. cruzi discrete typing units (DTU I, IV and VI (set A, human blood spiked with parasite cells (set B and Guanidine Hidrochloride-EDTA blood samples from 32 seropositive and 10 seronegative patients from Southern Cone countries (set C. Forty eight PCR tests were reported for set A and 44 for sets B and C; 28 targeted minicircle DNA (kDNA, 13 satellite DNA (Sat-DNA and the remainder low copy number sequences. In set A, commercial master mixes and Sat-DNA Real Time PCR showed better specificity, but kDNA-PCR was more sensitive to detect DTU I DNA. In set B, commercial DNA extraction kits presented better specificity than solvent extraction protocols. Sat-DNA PCR tests had higher specificity, with sensitivities of 0.05-0.5 parasites/mL whereas specific kDNA tests detected 5.10(-3 par/mL. Sixteen specific and coherent methods had a Good Performance in both sets A and B (10 fg/µl of DNA from all stocks, 5 par/mL spiked blood. The median values of sensitivities, specificities and accuracies obtained in testing the Set C samples with the 16 tests determined to be good performing by analyzing Sets A and B samples varied considerably. Out of them, four methods depicted the best performing parameters in all three sets of samples, detecting at least 10 fg/µl for each DNA stock, 0.5 par/mL and a sensitivity between 83.3-94.4%, specificity of 85
International Nuclear Information System (INIS)
Fox, J.C.; Ait-Khaled, Mounir; Webster, Alison; Emery, V.C.
1991-01-01
The sensitivity of polymerase chain reaction (PCR) can mean that even very low levels of contamination with the target DNA will result in a positive signal. At present this aspect is a major limitation in the use of PCR as a routine diagnostic method. By exposing PCR reagents to UV light, contaminating DNA can be inactivated, thus providing an opportunity to eradicate false positive reactions. UV irradiation was applied to PCR systems used for detection of human cytomegalovirus CMV and human immunodeficiency virus (HIV) and shown to be effective in eradicating both laboratory encountered contamination and plasmid DNA (below 100 pg) added to PCR systems prior to UV exposure. Sensitivity of a PCR system to amplify the long terminal repeat (LTR) sequence of HIV-1 was not affected by the irradiation procedure; however, ultimate sensitivity of a PCR system for the amplification of an early gene pro-motor sequence of the CMV genome was reduced 1000-fold. UV irradiation did not affect the size of the PCR product as determined by strand separating polyacrylamide gel electrophoresis of a 32 P-labelled amplimer. Thus, a simple pre-exposure to UV light would seem a worth-wile step to incorporate into PCR protocols provided that the effects on sensitivity have been determined empirically for each PCR system. (author). 11 refs.; 3 figs
Blaya, Josefa; Lloret, Eva; Santísima-Trinidad, Ana B; Ros, Margarita; Pascual, Jose A
2016-04-01
Currently, real-time polymerase chain reaction (qPCR) is the technique most often used to quantify pathogen presence. Digital PCR (dPCR) is a new technique with the potential to have a substantial impact on plant pathology research owing to its reproducibility, sensitivity and low susceptibility to inhibitors. In this study, we evaluated the feasibility of using dPCR and qPCR to quantify Phytophthora nicotianae in several background matrices, including host tissues (stems and roots) and soil samples. In spite of the low dynamic range of dPCR (3 logs compared with 7 logs for qPCR), this technique proved to have very high precision applicable at very low copy numbers. The dPCR was able to detect accurately the pathogen in all type of samples in a broad concentration range. Moreover, dPCR seems to be less susceptible to inhibitors than qPCR in plant samples. Linear regression analysis showed a high correlation between the results obtained with the two techniques in soil, stem and root samples, with R(2) = 0.873, 0.999 and 0.995 respectively. These results suggest that dPCR is a promising alternative for quantifying soil-borne pathogens in environmental samples, even in early stages of the disease. © 2015 Society of Chemical Industry.
Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay
Ogrean, Christy; Jackson, Ben; Covino, James
2010-01-01
The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and accuracy of the assay. These primer/probe sets are pre-designed to >98% of the human and mouse genomes and feature significant improvements from previously available technologies. These improvements were made possible by virtue of a novel design algorithm, developed by Thermo Scientific bioinformatics experts. Several convenient features have been incorporated into the Solaris qPCR Assay to streamline the process of performing quantitative real-time PCR. First, the protocol is similar to commonly employed alternatives, so the methods used during qPCR are likely to be familiar. Second, the master mix is blue, which makes setting the qPCR reactions easier to track. Third, the thermal cycling conditions are the same for all assays (genes), making it possible to run many samples at a time and reducing the potential for error. Finally, the probe and primer sequence information are provided, simplifying the publication process. Here, we demonstrate how to obtain the appropriate Solaris reagents using the GENEius product search feature found on the ordering web site (www.thermo.com/solaris) and how to use the Solaris reagents for performing qPCR using the standard curve method. PMID:20567213
Witte, Anna Kristina; Fister, Susanne; Mester, Patrick; Schoder, Dagmar; Rossmanith, Peter
2016-11-01
Fast and reliable pathogen detection is an important issue for human health. Since conventional microbiological methods are rather slow, there is growing interest in detection and quantification using molecular methods. The droplet digital polymerase chain reaction (ddPCR) is a relatively new PCR method for absolute and accurate quantification without external standards. Using the Listeria monocytogenes specific prfA assay, we focused on the questions of whether the assay was directly transferable to ddPCR and whether ddPCR was suitable for samples derived from heterogeneous matrices, such as foodstuffs that often included inhibitors and a non-target bacterial background flora. Although the prfA assay showed suboptimal cluster formation, use of ddPCR for quantification of L. monocytogenes from pure bacterial cultures, artificially contaminated cheese, and naturally contaminated foodstuff was satisfactory over a relatively broad dynamic range. Moreover, results demonstrated the outstanding detection limit of one copy. However, while poorer DNA quality, such as resulting from longer storage, can impair ddPCR, internal amplification control (IAC) of prfA by ddPCR, that is integrated in the genome of L. monocytogenes ΔprfA, showed even slightly better quantification over a broader dynamic range. Graphical Abstract Evaluating the absolute quantification potential of ddPCR targeting Listeria monocytogenes prfA.
Directory of Open Access Journals (Sweden)
Luis A. Merino
2003-06-01
Full Text Available Salmonella Infantis has been the second most common serovar in Argentina in the last two years, being isolated mostly from paediatric hospitalised patients. In order to determine the clonal relationship among Salmonella Infantis strains, we examined 15 isolates from paediatric patient faeces in Argentina (12 geographically related and 3 geographically non-related by using antimicrobial susceptibility, plasmid profiling, repetitive extragenic palindromic (REP PCR, enterobacterial repetitive intergenic consensus (ERIC PCR, and low-frequency restriction analysis of chromosomal DNA by pulsed field gel electrophoresis (PFGE. Four Spanish strains were included as controls of clonal diversity in molecular techniques. Antibiotype and plasmid profile was not useful as epidemiological tools. PFGE and REP-PCR were able to discriminate between Argentinean and Spanish isolates of Salmonella Infantis allowing to detect genetically related strains in three different cities. This finding indicates that a possible spread of a clone of this serovar in the North-eastern Region of Argentina has taken place in 1998.Salmonella Infantis ha sido el segundo serovar más común en la Argentina en los últimos dos años, siendo aislada principalmente, a partir de pacientes pediátricos hospitalizados. La relación clonal entre 15 aislamientos de Salmonella Infantis obtenidos de heces de pacientes pediátricos en Argentina se estudió mediante la susceptibilidad antimicrobiana, el perfil plasmídico, amplificación por reacción en cadena de la polimerasa (PCR de las secuencias repetitivas REP y ERIC, y electroforesis de ADN total en campo pulsátil (PFGE. Cuatro cepas españolas fueron incluidas como control de diversidad clonal. El antibiotipo y el perfil plasmídico no fueron herramientas útiles en la tipificación. PFGE y REP-PCR fueron capaces de discriminar entre las cepas argentinas y españolas de Salmonella Infantis, permitiendo detectar cepas gen
Birmingham Rep, Youth and Community, and the Products and Possibilities of Precarity
Cochrane, Claire
2017-01-01
Birmingham Rep, a leading producing theatre based in the UK's "second city", has historically had a complex relationship with the cultural priorities of its home city. In recent years, Birmingham City Council has faced multiple challenges represented by debt burden, government-imposed cuts in public funding, scandals linked to failing…
Directory of Open Access Journals (Sweden)
SR Naddaf
2011-06-01
Full Text Available Background: The mainstay of diagnosis of relapsing fever (RF is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by microscopy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spirochetemia. Methods: Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR targeting flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were performed on blood samples with various degrees of spirochetemia. Results: The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spirochete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL was used as template. The centrifuged-based enrichment method turned positive with as low concentration as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Conclusion: Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.
Directory of Open Access Journals (Sweden)
SR Naddaf
2011-06-01
Background: The mainstay of diagnosis of relapsing fever (RF is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by microscopy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spirochetemia. Methods: Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR targeting flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were performed on blood samples with various degrees of spirochetemia. Results: The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spirochete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL was used as template. The centrifuged-based enrichment method turned positive with as low concentration as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Conclusion: Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.
Analog forecasting with dynamics-adapted kernels
Zhao, Zhizhen; Giannakis, Dimitrios
2016-09-01
Analog forecasting is a nonparametric technique introduced by Lorenz in 1969 which predicts the evolution of states of a dynamical system (or observables defined on the states) by following the evolution of the sample in a historical record of observations which most closely resembles the current initial data. Here, we introduce a suite of forecasting methods which improve traditional analog forecasting by combining ideas from kernel methods developed in harmonic analysis and machine learning and state-space reconstruction for dynamical systems. A key ingredient of our approach is to replace single-analog forecasting with weighted ensembles of analogs constructed using local similarity kernels. The kernels used here employ a number of dynamics-dependent features designed to improve forecast skill, including Takens’ delay-coordinate maps (to recover information in the initial data lost through partial observations) and a directional dependence on the dynamical vector field generating the data. Mathematically, our approach is closely related to kernel methods for out-of-sample extension of functions, and we discuss alternative strategies based on the Nyström method and the multiscale Laplacian pyramids technique. We illustrate these techniques in applications to forecasting in a low-order deterministic model for atmospheric dynamics with chaotic metastability, and interannual-scale forecasting in the North Pacific sector of a comprehensive climate model. We find that forecasts based on kernel-weighted ensembles have significantly higher skill than the conventional approach following a single analog.
Song, Kyung-Young; Hwang, Hyun Jin; Kim, Jeong Hee
2017-08-15
The aim of this study was to develop an ultra-fast molecular detection method for meat identification using convection Palm polymerase chain reaction (PCR). The mitochondrial cytochrome b (Cyt b) gene was used as a target gene. Amplicon size was designed to be different for beef, lamb, and pork. When these primer sets were used, each species-specific set specifically detected the target meat species in singleplex and multiplex modes in a 24min PCR run. The detection limit was 1pg of DNA for each meat species. The convection PCR method could detect as low as 1% of meat adulteration. The stability of the assay was confirmed using thermal processed meats. We also showed that direct PCR can be successfully performed with mixed meats and food samples. These results suggest that the developed assay may be useful in the authentication of meats and meat products in laboratory and rapid on-site applications. Copyright © 2017 Elsevier Ltd. All rights reserved.
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
Nucleic acid extraction, oligonucleotide probes and PCR methods
International Nuclear Information System (INIS)
Zhongtang Yu; Forster, R.J.
2005-01-01
Complex microbiomes of rumen and gastrointestinal tracts. Bacteria, fungi and protozoa, present in rumen and gastrointestinal (GI) tracts, interact with feed, with each other, and with their host animals, resulting in a complex symbiotic microbiota of distinctive composition and structure. Such microbiota is dynamic and highly responsive to a variety of biotic and abiotic factors, such as diet, feed additives, age, health and physiological status of the host animal, geographical locations, season and feeding regimen (reviewed in Ref. [39]). This symbiotic microbiota has been the focus of microbial research for over half a century in search for improved ruminant nutrition. Before the advent of molecular biology techniques, microorganisms in rumen and GI tracts, as in other habitats, were studied with cultivation-based techniques, which only allows for the isolation and characterization of a limited number of readily culturable species. As estimated, there are more than 400 species of bacteria and up to 100 species of protozoa and fungi inhabiting rumen and GI tracts. In human GI tracts, as much as 60% of these members cannot be isolated on agar plates and, thus, remain unknown. In ruminants, although it is not known, the culturable species of the microbiota are probably in the same range. Even among the culturable species, probably only some of them have been isolated and described. The application of cultivation-independent, more sensitive and accurate molecular techniques to the study of ruminal and GI microorganisms provided an alternative to directly examining the diversity and the community structure of ruminal and GI microbiota on the basis of genotypes, instead of phenotypes. Both polymerase chain reaction (PCR)-based methods, such as denaturing gradient gel electrophoresis (DGGE), ribosomal intergenic spacer analysis, terminal restriction fragment length polymorphism, cloning and sequencing of PCR amplicons and amplified 16S ribosomal DNA restriction
Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M
2016-01-01
Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.
Venema, K.; Maathuis, A.J.H.
2003-01-01
A polymerase chain reaction (PCR)-based method was developed for the identification of isolates of Bifidobacterium at the species level. Using two Bifidobacterium-specific primers directed against the 16S ribosomal gene (Bif164 and Bif662), a PCR product was obtained from the type strains of 12
Directory of Open Access Journals (Sweden)
Karolina Stojowska
Full Text Available We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s, while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR, whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR. The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal "band-based" results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3' recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5' rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided.
Stojowska, Karolina; Krawczyk, Beata
2014-01-01
We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR) method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s), while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR), whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR). The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal "band-based" results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb) complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3' recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5' rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided.
A RAPID DNA EXTRACTION METHOD FOR PCR IDENTIFICATION OF FUNGAL INDOOR AIR CONTAMINANTS
Following air sampling, fungal DNA needs to be extracted and purified to a state suitable for laboratory use. Our laboratory has developed a simple method of extraction and purification of fungal DNA appropriate for enzymatic manipulation and polymerase chain reaction (PCR) appli...
Control conception for REP 1300 MW units of the Electricite de France
International Nuclear Information System (INIS)
Blanc, P.; Guesnier, G.
1986-01-01
The paper describes the control equipment for the REP 1300 MW units including the reactor protection system, the control rods drive system and nuclear instrumentation, the control of the auxiliaries in the systems important for the reactor safety and the safety survey computer. Finally, the digital connections between different control systems are presented
Analogy, explanation, and proof
Hummel, John E.; Licato, John; Bringsjord, Selmer
2014-01-01
People are habitual explanation generators. At its most mundane, our propensity to explain allows us to infer that we should not drink milk that smells sour; at the other extreme, it allows us to establish facts (e.g., theorems in mathematical logic) whose truth was not even known prior to the existence of the explanation (proof). What do the cognitive operations underlying the inference that the milk is sour have in common with the proof that, say, the square root of two is irrational? Our ability to generate explanations bears striking similarities to our ability to make analogies. Both reflect a capacity to generate inferences and generalizations that go beyond the featural similarities between a novel problem and familiar problems in terms of which the novel problem may be understood. However, a notable difference between analogy-making and explanation-generation is that the former is a process in which a single source situation is used to reason about a single target, whereas the latter often requires the reasoner to integrate multiple sources of knowledge. This seemingly small difference poses a challenge to the task of marshaling our understanding of analogical reasoning to understanding explanation. We describe a model of explanation, derived from a model of analogy, adapted to permit systematic violations of this one-to-one mapping constraint. Simulation results demonstrate that the resulting model can generate explanations for novel explananda and that, like the explanations generated by human reasoners, these explanations vary in their coherence. PMID:25414655
Analogy, Explanation, and Proof
Directory of Open Access Journals (Sweden)
John eHummel
2014-11-01
Full Text Available People are habitual explanation generators. At its most mundane, our propensity to explain allows us to infer that we should not drink milk that smells sour; at the other extreme, it allows us to establish facts (e.g., theorems in mathematical logic whose truth was not even known prior to the existence of the explanation (proof. What do the cognitive operations underlying the (inductive inference that the milk is sour have in common with the (deductive proof that, say, the square root of two is irrational? Our ability to generate explanations bears striking similarities to our ability to make analogies. Both reflect a capacity to generate inferences and generalizations that go beyond the featural similarities between a novel problem and familiar problems in terms of which the novel problem may be understood. However, a notable difference between analogy-making and explanation-generation is that the former is a process in which a single source situation is used to reason about a single target, whereas the latter often requires the reasoner to integrate multiple sources of knowledge. This small-seeming difference poses a challenge to the task of marshaling our understanding of analogical reasoning in the service of understanding explanation. We describe a model of explanation, derived from a model of analogy, adapted to permit systematic violations of this one-to-one mapping constraint. Simulation results demonstrate that the resulting model can generate explanations for novel explananda and that, like the explanations generated by human reasoners, these explanations vary in their coherence.
Teng, William; Shannon, Harlan
2011-01-01
The USDA World Agricultural Outlook Board (WAOB) is responsible for monitoring weather and climate impacts on domestic and foreign crop development. One of WAOB's primary goals is to determine the net cumulative effect of weather and climate anomalies on final crop yields. To this end, a broad array of information is consulted, including maps, charts, and time series of recent weather, climate, and crop observations; numerical output from weather and crop models; and reports from the press, USDA attach s, and foreign governments. The resulting agricultural weather assessments are published in the Weekly Weather and Crop Bulletin, to keep farmers, policy makers, and commercial agricultural interests informed of weather and climate impacts on agriculture. Because both the amount and timing of precipitation significantly affect crop yields, WAOB often uses precipitation time series to identify growing seasons with similar weather patterns and help estimate crop yields for the current growing season, based on observed yields in analog years. Historically, these analog years are visually identified; however, the qualitative nature of this method sometimes precludes the definitive identification of the best analog year. Thus, one goal of this study is to derive a more rigorous, statistical approach for identifying analog years, based on a modified coefficient of determination, termed the analog index (AI). A second goal is to compare the performance of AI for time series derived from surface-based observations vs. satellite-based measurements (NASA TRMM and other data).
Perceptions of Rebuttal Analogy: Politeness and Implications for Persuasion.
Whaley, Bryan B.
1997-01-01
States that recent theorizing about the role of analogy in persuasion suggests that "rebuttal" analogy addresses two communicative functions by serving as argument and a method of social attack. Examines message receivers' perceptions of rebuttal analogy and rebuttal analogy users. Finds that participants perceived the communicator using…
Directory of Open Access Journals (Sweden)
Mateusz G Adamski
Full Text Available Over the past decade rapid advances have occurred in the understanding of RNA expression and its regulation. Quantitative polymerase chain reactions (qPCR have become the gold standard for quantifying gene expression. Microfluidic next generation, high throughput qPCR now permits the detection of transcript copy number in thousands of reactions simultaneously, dramatically increasing the sensitivity over standard qPCR. Here we present a gene expression analysis method applicable to both standard polymerase chain reactions (qPCR and high throughput qPCR. This technique is adjusted to the input sample quantity (e.g., the number of cells and is independent of control gene expression. It is efficiency-corrected and with the use of a universal reference sample (commercial complementary DNA (cDNA permits the normalization of results between different batches and between different instruments--regardless of potential differences in transcript amplification efficiency. Modifications of the input quantity method include (1 the achievement of absolute quantification and (2 a non-efficiency corrected analysis. When compared to other commonly used algorithms the input quantity method proved to be valid. This method is of particular value for clinical studies of whole blood and circulating leukocytes where cell counts are readily available.
A novel mean-centering method for normalizing microRNA expression from high-throughput RT-qPCR data
Directory of Open Access Journals (Sweden)
Wylie Dennis
2011-12-01
Full Text Available Abstract Background Normalization is critical for accurate gene expression analysis. A significant challenge in the quantitation of gene expression from biofluids samples is the inability to quantify RNA concentration prior to analysis, underscoring the need for robust normalization tools for this sample type. In this investigation, we evaluated various methods of normalization to determine the optimal approach for quantifying microRNA (miRNA expression from biofluids and tissue samples when using the TaqMan® Megaplex™ high-throughput RT-qPCR platform with low RNA inputs. Findings We compared seven normalization methods in the analysis of variation of miRNA expression from biofluid and tissue samples. We developed a novel variant of the common mean-centering normalization strategy, herein referred to as mean-centering restricted (MCR normalization, which is adapted to the TaqMan Megaplex RT-qPCR platform, but is likely applicable to other high-throughput RT-qPCR-based platforms. Our results indicate that MCR normalization performs comparable to or better than both standard mean-centering and other normalization methods. We also propose an extension of this method to be used when migrating biomarker signatures from Megaplex to singleplex RT-qPCR platforms, based on the identification of a small number of normalizer miRNAs that closely track the mean of expressed miRNAs. Conclusions We developed the MCR method for normalizing miRNA expression from biofluids samples when using the TaqMan Megaplex RT-qPCR platform. Our results suggest that normalization based on the mean of all fully observed (fully detected miRNAs minimizes technical variance in normalized expression values, and that a small number of normalizer miRNAs can be selected when migrating from Megaplex to singleplex assays. In our study, we find that normalization methods that focus on a restricted set of miRNAs tend to perform better than methods that focus on all miRNAs, including
Directory of Open Access Journals (Sweden)
Zhou Liqing
2010-04-01
Full Text Available Abstract Background Salmonella Typhi causes an estimated 21 million new cases of typhoid fever and 216,000 deaths every year. Blood culture is currently the gold standard for diagnosis of typhoid fever, but it is time-consuming and takes several days for isolation and identification of causative organisms. It is then too late to initiate proper antibiotic therapy. Serological tests have very low sensitivity and specificity, and no practical value in endemic areas. As early diagnosis of the disease and prompt treatment are essential for optimal management, especially in children, a rapid sensitive detection method for typhoid fever is urgently needed. Although PCR is sensitive and rapid, initial research indicated similar sensitivity to blood culture and lower specificity. We developed a fast and highly sensitive blood culture PCR method for detection of Salmonella Typhi, allowing same-day initiation of treatment after accurate diagnosis of typhoid. Methods An ox bile tryptone soy broth was optimized for blood culture, which allows the complete lysis of blood cells to release intracellular bacteria without inhibiting the growth of Salmonella Typhi. Using the optimised broth Salmonella Typhi bacteria in artificial blood samples were enriched in blood culture and then detected by a PCR targeting the fliC-d gene of Salmonella Typhi. Results Tests demonstrated that 2.4% ox bile in blood culture not only lyzes blood cells completely within 1.5 hours so that the intracellular bacteria could be released, but also has no inhibiting effect on the growth of Salmonella Typhi. Three hour enrichment of Salmonella Typhi in tryptone soya broth containing 2.4% ox bile could increase the bacterial number from 0.75 CFU per millilitre of blood which is similar to clinical typhoid samples to the level which regular PCR can detect. The whole blood culture PCR assay takes less than 8 hours to complete rather than several days for conventional blood culture
DEFF Research Database (Denmark)
Olsen, Morten Tange; Bérubé, Martine; Robbins, Jooke
2012-01-01
BACKGROUND:Telomeres, the protective cap of chromosomes, have emerged as powerful markers of biological age and life history in model and non-model species. The qPCR method for telomere length estimation is one of the most common methods for telomere length estimation, but has received recent...... steps of qPCR. In order to evaluate the utility of the qPCR method for telomere length estimation in non-model species, we carried out four different qPCR assays directed at humpback whale telomeres, and subsequently performed a rigorous quality control to evaluate the performance of each assay. RESULTS...... to 40% depending on assay and quantification method, however this variation only affected telomere length estimates in the worst performing assays. CONCLUSION:Our results suggest that seemingly well performing qPCR assays may contain biases that will only be detected by extensive quality control...
Edagawa, Akiko; Kimura, Akio; Kawabuchi-Kurata, Takako; Adachi, Shinichi; Furuhata, Katsunori; Miyamoto, Hiroshi
2015-10-19
We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR), and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%). Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%). In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8%) compared with real-time qPCR alone (46/68, 67.6%). Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1%) compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%). Legionella was not detected in the remaining six samples (6/68, 8.8%), irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples.
Directory of Open Access Journals (Sweden)
Gadani F
2014-12-01
Full Text Available Analytical methods based on the polymerase chain reaction (PCR technology are increasingly used for the detection of deoxyribonucleic acid (DNA sequences associated with genetically modified organisms (GMOs. In the European Union and Switzerland, mandatory labeling of novel foods and food ingredients consisting of, or containing GMOs is required according to food regulations and is triggered by the presence of newly introduced foreign DNA sequences, or newly expressed proteins. In order to meet regulatory and consumer demand, numerous PCR-based methods have been developed which can detect, identify and quantify GMOs in agricultural crops, food and feed. Moreover, the determination of genetic identity allows for segregation and traceability (identity preservation throughout the supply chain of GM crops that have been enhanced with value-added quality traits. Prerequisites for GMO detection include a minimum amount of the target gene and prior knowledge of the type of genetic modification, such as virus or insect resistance traits, including controlling elements (promoters and terminators. Moreover, DNA extraction and purification is a critical step for the preparation of PCR-quality samples, particularly for processed agricultural crops such as tobacco. This paper reviews the state-of-the-art of PCR-based method development for the qualitative and quantitative determination and identification of GMOs, and includes a short summary of official and validated GMO detection methods.
Directory of Open Access Journals (Sweden)
Tian-Min Qiao
2016-10-01
Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.
Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui
2016-01-01
Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691
Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui
2016-10-01
Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.
Energy Technology Data Exchange (ETDEWEB)
Ferreira, Aline Leandra C.; Ferreira, Sidney A.; Carregal, Virginia M.; Andrade, Antero Silva R., E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia; Melo, Maria N., E-mail: melo@icb.ufmg.br [Departamento de Parasitologia. Instituto de Ciencias Biologicas. Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil)
2011-07-01
Leishmania (Leishmania) chagasi is responsible for visceral leishmaniasis (VL) in Brazil and the dog is the main domestic reservoir. Disease control is based on the elimination of infected animals and the use of a sensitive and specific diagnostic test is necessary. The Brazilian VL control program emphasizes serologic surveys, mainly using the enzyme-linked immunosorbent assay (ELISA) and the immunofluorescence antibody test (IFAT), followed by the elimination of the seropositive dogs. However, these techniques present limitations in terms of sensitivity and specificity. The Polymerase Chain Reaction (PCR) associated to hybridization with DNA probes labeled with {sup 32}P has been recognized as a valuable tool for Leishmania identification. In this study, the sensitivity of kDNA PCR hybridization method was compared with three other molecular methods: Internal Transcribed Spacer 1 Nested PCR (ITS-1nPCR), Leishmania nested PCR (LnPCR) and Seminested kDNA PCR (kDNA snPCR). The comparison was performed in different clinical specimens: conjunctival swab, skin, blood and bone marrow. A group of thirty symptomatic dogs, positive in the parasitological and serological tests, was used. When. The techniques targeting kDNA mini-circles (kDNA snPCR and KDNA PCR-hybridization) showed the worst result for blood samples. The KDNA-PCR hybridization showed the best sensitivity for conjunctival swab. By comparing the samples on the basis of positivity obtained by the sum of all methods, the blood showed the worst outcome (71/120).The bone marrow showed the highest positivity (106/120), followed by conjunctival swab (100/120) and skin (89/120). Since the bone marrow samples are unsuitable for routine epidemiological surveys, the conjunctival swab was recommended because it allows high sensitivity, especially when associated with kDNA PCR hybridization method, and is a noninvasive sampling method. (author)
International Nuclear Information System (INIS)
Ferreira, Aline Leandra C.; Ferreira, Sidney A.; Carregal, Virginia M.; Andrade, Antero Silva R.
2011-01-01
Leishmania (Leishmania) chagasi is responsible for visceral leishmaniasis (VL) in Brazil and the dog is the main domestic reservoir. Disease control is based on the elimination of infected animals and the use of a sensitive and specific diagnostic test is necessary. The Brazilian VL control program emphasizes serologic surveys, mainly using the enzyme-linked immunosorbent assay (ELISA) and the immunofluorescence antibody test (IFAT), followed by the elimination of the seropositive dogs. However, these techniques present limitations in terms of sensitivity and specificity. The Polymerase Chain Reaction (PCR) associated to hybridization with DNA probes labeled with 32 P has been recognized as a valuable tool for Leishmania identification. In this study, the sensitivity of kDNA PCR hybridization method was compared with three other molecular methods: Internal Transcribed Spacer 1 Nested PCR (ITS-1nPCR), Leishmania nested PCR (LnPCR) and Seminested kDNA PCR (kDNA snPCR). The comparison was performed in different clinical specimens: conjunctival swab, skin, blood and bone marrow. A group of thirty symptomatic dogs, positive in the parasitological and serological tests, was used. When. The techniques targeting kDNA mini-circles (kDNA snPCR and KDNA PCR-hybridization) showed the worst result for blood samples. The KDNA-PCR hybridization showed the best sensitivity for conjunctival swab. By comparing the samples on the basis of positivity obtained by the sum of all methods, the blood showed the worst outcome (71/120).The bone marrow showed the highest positivity (106/120), followed by conjunctival swab (100/120) and skin (89/120). Since the bone marrow samples are unsuitable for routine epidemiological surveys, the conjunctival swab was recommended because it allows high sensitivity, especially when associated with kDNA PCR hybridization method, and is a noninvasive sampling method. (author)
Wang, Chao; Dong, Dong; Wang, Guangce; Zhang, Baoyu; Peng, Guang; Xu, Pu; Tang, Xiaorong
2009-09-01
An improved method of PCR in which the small segment of conchocelis is amplified directly without DNA extraction was used to amplify a RUBISCO intergenic spacer DNA fragment from nine species of red algal genus Porphyra (Bangiales, Rhodophyta), including Porphyra yezoensis (Jiangsu, China), P. haitanensis (Fujian, China), P. oligospermatangia (Qingdao, China), P. katadai (Qingdao, China), P. tenera (Qingdao, China), P. suborboculata (Fujian, China), P. pseudolinearis (Kogendo, Korea), P. linearis (Devon, England), and P. fallax (Seattle, USA). Standard PCR and the method developed here were both conducted using primers specific for the RUBISCO spacer region, after which the two PCR products were sequenced. The sequencing data of the amplicons obtained using both methods were identical, suggesting that the improved PCR method was functional. These findings indicate that the method developed here may be useful for the rapid identification of species of Porphyra in a germplasm bank. In addition, a phylogenetic tree was constructed using the RUBISCO spacer and partial rbcS sequence, and the results were in concordant with possible alternative phylogenies based on traditional morphological taxonomic characteristics, indicating that the RUBISCO spacer is a useful region for phylogenetic studies.
SEATURTLE: Sustained Engagement Autonomous Tracking of Underwater RepTiLEs
Budd, Johnathan
2015-01-01
While oceans cover the majority of our planet, these vast expanses remain relatively unexplored. Among the most interesting parts of the ocean are the shallow reef systems, which contain a huge amount of the planet’s biodiversity. The Sustained Engagement Autonomous Tracking of Underwater RepTiLEs or SEATURTLE is a low cost Autonomous Underwater Vehicle designed to carry out missions in these shallow environments. Its small displacement and precise movement make it ideal for navigating tight ...
Iida, Takao; Mizuno, Yukie; Kaizaki, Yasuharu
2017-10-27
Mutations in RAS and BRAF are predictors of the efficacy of anti-epidermal growth factor receptor (EGFR) therapy in patients with metastatic colorectal cancer (mCRC). Therefore, simple, rapid, cost-effective methods to detect these mutations in the clinical setting are greatly needed. In the present study, we evaluated BNA Real-time PCR Mutation Detection Kit Extended RAS (BNA Real-time PCR), a real-time PCR method that uses bridged nucleic acid clamping technology to rapidly detect mutations in RAS exons 2-4 and BRAF exon 15. Genomic DNA was extracted from 54 formalin-fixed paraffin-embedded (FFPE) tissue samples obtained from mCRC patients. Among the 54 FFPE samples, BNA Real-time PCR detected 21 RAS mutations (38.9%) and 5 BRAF mutations (9.3%), and the reference assay (KRAS Mutation Detection Kit and MEBGEN™ RASKET KIT) detected 22 RAS mutations (40.7%). The concordance rate of detected RAS mutations between the BNA Real-time PCR assay and the reference assays was 98.2% (53/54). The BNA Real-time PCR assay proved to be a more simple, rapid, and cost-effective method for detecting KRAS and RAS mutations compared with existing assays. These findings suggest that BNA Real-time PCR is a valuable tool for predicting the efficacy of early anti-EGFR therapy in mCRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.
Suñén, Ester; Casas, Nerea; Moreno, Belén; Zigorraga, Carmen
2004-03-01
The detection of hepatitis A virus in shellfish by reverse transcription-nested polymerase chain reaction (RT-nested PCR) is hampered mainly by low levels of virus contamination and PCR inhibitors in shellfish. In this study, we focused on getting a rapid and sensitive processing procedure for the detection of HAV by RT-nested PCR in clam samples (Tapes spp.). Two previously developed processing methods for virus concentration in shellfish have been improved upon and compared. The first method involves acid adsorption, elution, polyethylene glycol (PEG) precipitation, chloroform extraction and PEG precipitation. The second method is based on elution with a glycine buffer at pH 10, chloroform extraction and concentration by ultracentrifugation. Final clam concentrates were processed by RNA extraction or immunomagnetic capture of viruses (IMC) before the RT-nested PCR reaction. Both methods of sample processing combined with the RNA extraction from the concentrates were very efficient when they were assayed in seeded and naturally contaminated samples. The results show that the first method was more effective in removal inhibitors and the second was simpler and faster. The IMC of HAV from clam concentrates processed by method 1 was revealed to be a very effective method of simultaneously removing residual PCR inhibitors and of concentrating the virus.
DEFF Research Database (Denmark)
Schmidt, Gunilla Veslemøy; Mellerup, Anders; Christiansen, Lasse Engbo
2015-01-01
The aim of this article was to define the sampling level and method combination that captures antibiotic resistance at pig herd level utilizing qPCR antibiotic resistance gene quantification and culture-based quantification of antibiotic resistant coliform indicator bacteria. Fourteen qPCR assays...... for commonly detected antibiotic resistance genes were developed, and used to quantify antibiotic resistance genes in total DNA from swine fecal samples that were obtained using different sampling and pooling methods. In parallel, the number of antibiotic resistant coliform indicator bacteria was determined...... in the same swine fecal samples. The results showed that the qPCR assays were capable of detecting differences in antibiotic resistance levels in individual animals that the coliform bacteria colony forming units (CFU) could not. Also, the qPCR assays more accurately quantified antibiotic resistance genes...
Ramírez, Juan Carlos; Cura, Carolina Inés; da Cruz Moreira, Otacilio; Lages-Silva, Eliane; Juiz, Natalia; Velázquez, Elsa; Ramírez, Juan David; Alberti, Anahí; Pavia, Paula; Flores-Chávez, María Delmans; Muñoz-Calderón, Arturo; Pérez-Morales, Deyanira; Santalla, José; Marcos da Matta Guedes, Paulo; Peneau, Julie; Marcet, Paula; Padilla, Carlos; Cruz-Robles, David; Valencia, Edward; Crisante, Gladys Elena; Greif, Gonzalo; Zulantay, Inés; Costales, Jaime Alfredo; Alvarez-Martínez, Miriam; Martínez, Norma Edith; Villarroel, Rodrigo; Villarroel, Sandro; Sánchez, Zunilda; Bisio, Margarita; Parrado, Rudy; Maria da Cunha Galvão, Lúcia; Jácome da Câmara, Antonia Cláudia; Espinoza, Bertha; Alarcón de Noya, Belkisyole; Puerta, Concepción; Riarte, Adelina; Diosque, Patricio; Sosa-Estani, Sergio; Guhl, Felipe; Ribeiro, Isabela; Aznar, Christine; Britto, Constança; Yadón, Zaida Estela; Schijman, Alejandro G
2015-09-01
An international study was performed by 26 experienced PCR laboratories from 14 countries to assess the performance of duplex quantitative real-time PCR (qPCR) strategies on the basis of TaqMan probes for detection and quantification of parasitic loads in peripheral blood samples from Chagas disease patients. Two methods were studied: Satellite DNA (SatDNA) qPCR and kinetoplastid DNA (kDNA) qPCR. Both methods included an internal amplification control. Reportable range, analytical sensitivity, limits of detection and quantification, and precision were estimated according to international guidelines. In addition, inclusivity and exclusivity were estimated with DNA from stocks representing the different Trypanosoma cruzi discrete typing units and Trypanosoma rangeli and Leishmania spp. Both methods were challenged against 156 blood samples provided by the participant laboratories, including samples from acute and chronic patients with varied clinical findings, infected by oral route or vectorial transmission. kDNA qPCR showed better analytical sensitivity than SatDNA qPCR with limits of detection of 0.23 and 0.70 parasite equivalents/mL, respectively. Analyses of clinical samples revealed a high concordance in terms of sensitivity and parasitic loads determined by both SatDNA and kDNA qPCRs. This effort is a major step toward international validation of qPCR methods for the quantification of T. cruzi DNA in human blood samples, aiming to provide an accurate surrogate biomarker for diagnosis and treatment monitoring for patients with Chagas disease. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Comparison of nine DNA extraction methods for the diagnosis of bovine tuberculosis by real time PCR
Directory of Open Access Journals (Sweden)
André Moura
2016-07-01
Full Text Available ABSTRACT: Bovine tuberculosis is an infectious disease with a high impact on the cattle industry, particularly in developing countries. PCR is a very sensitive method for detection of infectious agents, but the sensitivity of molecular diagnosis is largely dependent on the efficiency of the DNA extraction methods. The objective of this study was to evaluate DNA extraction methods for direct detection of Mycobacterium bovis in bovine tissue. Nine commercial kits for DNA extraction were evaluated when combined with two real time PCRs. The DNeasy Blood & Tissue Kit from QIAGEN showed better performance and sensitivity followed by the DNA Mini Kit RBC and FTA Elute Micro Card. Results suggested that, even when the analytical sensitivity of the qPCR is very high, the extraction method can influence the diagnostic sensitivity.
Analogical scaffolding: Making meaning in physics through representation and analogy
Podolefsky, Noah Solomon
This work reviews the literature on analogy, introduces a new model of analogy, and presents a series of experiments that test and confirm the utility of this model to describe and predict student learning in physics with analogy. Pilot studies demonstrate that representations (e.g., diagrams) can play a key role in students' use of analogy. A new model of analogy, Analogical Scaffolding, is developed to explain these initial empirical results. This model will be described in detail, and then applied to describe and predict the outcomes of further experiments. Two large-scale (N>100) studies will demonstrate that: (1) students taught with analogies, according to the Analogical Scaffolding model, outperform students taught without analogies on pre-post assessments focused on electromagnetic waves; (2) the representational forms used to teach with analogy can play a significant role in student learning, with students in one treatment group outperforming students in other treatment groups by factors of two or three. It will be demonstrated that Analogical Scaffolding can be used to predict these results, as well as finer-grained results such as the types of distracters students choose in different treatment groups, and to describe and analyze student reasoning in interviews. Abstraction in physics is reconsidered using Analogical Scaffolding. An operational definition of abstraction is developed within the Analogical Scaffolding framework and employed to explain (a) why physicists consider some ideas more abstract than others in physics, and (b) how students conceptions of these ideas can be modeled. This new approach to abstraction suggests novel approaches to curriculum design in physics using Analogical Scaffolding.
Meghdadi, Hossein; Khosravi, Azar D; Ghadiri, Ata A; Sina, Amir H; Alami, Ameneh
2015-01-01
Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39-31.27% for rpoB-PCR, 36.44-60.83% for IS6110- PCR, 75.29-92.93% for nested-rpoB PCR, and 87.98-99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100
Directory of Open Access Journals (Sweden)
Akiko Edagawa
2015-10-01
Full Text Available We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR, and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%. Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%. In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8% compared with real-time qPCR alone (46/68, 67.6%. Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1% compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%. Legionella was not detected in the remaining six samples (6/68, 8.8%, irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples.
A hierarchical spatiotemporal analog forecasting model for count data.
McDermott, Patrick L; Wikle, Christopher K; Millspaugh, Joshua
2018-01-01
Analog forecasting is a mechanism-free nonlinear method that forecasts a system forward in time by examining how past states deemed similar to the current state moved forward. Previous applications of analog forecasting has been successful at producing robust forecasts for a variety of ecological and physical processes, but it has typically been presented in an empirical or heuristic procedure, rather than as a formal statistical model. The methodology presented here extends the model-based analog method of McDermott and Wikle (Environmetrics, 27, 2016, 70) by placing analog forecasting within a fully hierarchical statistical framework that can accommodate count observations. Using a Bayesian approach, the hierarchical analog model is able to quantify rigorously the uncertainty associated with forecasts. Forecasting waterfowl settling patterns in the northwestern United States and Canada is conducted by applying the hierarchical analog model to a breeding population survey dataset. Sea surface temperature (SST) in the Pacific Ocean is used to help identify potential analogs for the waterfowl settling patterns.
Rasmussen Hellberg, Rosalee S; Morrissey, Michael T; Hanner, Robert H
2010-09-01
The purpose of this study was to develop a species-specific multiplex polymerase chain reaction (PCR) method that allows for the detection of salmon species substitution on the commercial market. Species-specific primers and TaqMan® probes were developed based on a comprehensive collection of mitochondrial 5' cytochrome c oxidase subunit I (COI) deoxyribonucleic acid (DNA) "barcode" sequences. Primers and probes were combined into multiplex assays and tested for specificity against 112 reference samples representing 25 species. Sensitivity and linearity tests were conducted using 10-fold serial dilutions of target DNA (single-species samples) and DNA admixtures containing the target species at levels of 10%, 1.0%, and 0.1% mixed with a secondary species. The specificity tests showed positive signals for the target DNA in both real-time and conventional PCR systems. Nonspecific amplification in both systems was minimal; however, false positives were detected at low levels (1.2% to 8.3%) in conventional PCR. Detection levels were similar for admixtures and single-species samples based on a 30 PCR cycle cut-off, with limits of 0.25 to 2.5 ng (1% to 10%) in conventional PCR and 0.05 to 5.0 ng (0.1% to 10%) in real-time PCR. A small-scale test with food samples showed promising results, with species identification possible even in heavily processed food items. Overall, this study presents a rapid, specific, and sensitive method for salmon species identification that can be applied to mixed-species and heavily processed samples in either conventional or real-time PCR formats. This study provides a newly developed method for salmon and trout species identification that will assist both industry and regulatory agencies in the detection and prevention of species substitution. This multiplex PCR method allows for rapid, high-throughput species identification even in heavily processed and mixed-species samples. An inter-laboratory study is currently being carried out to
Directory of Open Access Journals (Sweden)
Amanda eMartino
2012-01-01
Full Text Available A degenerate PCR-based method of whole-genome amplification, designed to work fluidly with 454 sequencing technology, was developed and tested for use on deep marine subsurface DNA samples. The method, which we have called Random Amplification Metagenomic PCR (RAMP, involves the use of specific primers from Roche 454 amplicon sequencing, modified by the addition of a degenerate region at the 3’ end. It utilizes a PCR reaction, which resulted in no amplification from blanks, even after 50 cycles of PCR. After efforts to optimize experimental conditions, the method was tested with DNA extracted from cultured E. coli cells, and genome coverage was estimated after sequencing on three different occasions. Coverage did not vary greatly with the different experimental conditions tested, and was around 62% with a sequencing effort equivalent to a theoretical genome coverage of 14.10X. The GC content of the sequenced amplification product was within 2% of the predicted values for this strain of E. coli. The method was also applied to DNA extracted from marine subsurface samples from ODP Leg 201 site 1229 (Peru Margin, and results of a taxonomic analysis revealed microbial communities dominated by Proteobacteria, Chloroflexi, Firmicutes, Euryarchaeota, and Crenarchaeota, among others. These results were similar to those obtained previously for those samples; however, variations in the proportions of taxa show that community analysis can be sensitive to both the amplification technique used and the method of assigning sequences to taxonomic groups. Overall, we find that RAMP represents a valid methodology for amplifying metagenomes from low biomass samples.
International Nuclear Information System (INIS)
Ramadan, A.; Soukkaria, S.
2013-01-01
Fungal infections caused by Aspergillus species generally are occupying a second place among invasive fungal infections in the world, especially A. fumigatus, which is considered the main cause of invasive Aspergillosis (IA). Although IA rarely infects immunocompetent individuals, however, it can lead to death in immunocompromised patients. Therefore, it is necessary to diagnose the infection early in order to treat the disease efficiently. However, the conventional diagnostic tools, currently used to detect infections, has low sensitivity and reliability. Polymerase chain reaction (PCR) technology distribution as a molecular and high sensitive technology has allowed us to make comparative study between sensitivity of traditional currently used diagnostic method and Nested-PCR, the result of the study of sputum samples that experimentally infected with different concentrations of A.fumigatus spores ramping from 10 to10 6 spore/ml, have high sensitivity and specificity of Nested-PCR in detecting the lower concentrations, comparing with traditional diagnostic method (culture on Sabouraud media) that were negative in all concetrations. (author)
A number of PCR-based methods for detecting human fecal material in environmental waters have been developed over the past decade, but these methods have rarely received independent comparative testing. Here, we evaluated ten of these methods (BacH, BacHum-UCD, B. thetaiotaomic...
Analogical reasoning for reliability analysis based on generic data
Energy Technology Data Exchange (ETDEWEB)
Kozin, Igor O
1996-10-01
The paper suggests using the systemic concept 'analogy' for the foundation of an approach to analyze system reliability on the basis of generic data, describing the method of structuring the set that defines analogical models, an approach of transition from the analogical model to a reliability model and a way of obtaining reliability intervals of analogous objects.
Analogical reasoning for reliability analysis based on generic data
International Nuclear Information System (INIS)
Kozin, Igor O.
1996-01-01
The paper suggests using the systemic concept 'analogy' for the foundation of an approach to analyze system reliability on the basis of generic data, describing the method of structuring the set that defines analogical models, an approach of transition from the analogical model to a reliability model and a way of obtaining reliability intervals of analogous objects
DEFF Research Database (Denmark)
Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas
2017-01-01
, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...
Molecular characterization of Streptococcus agalactiae strains isolated from fishes in Malaysia.
Amal, M N A; Zamri-Saad, M; Siti-Zahrah, A; Zulkafli, A R; Nur-Nazifah, M
2013-07-01
The aim of this study was to characterize Streptococcus agalactiae strains that were isolated from fishes in Malaysia using random amplified polymorphic DNA (RAPD) and repetitive extragenic palindromic PCR (REP-PCR) techniques. A total of 181 strains of Strep. agalactiae isolated from red hybrid tilapia (Oreochromis sp.) and golden pompano (Trachinotus blochii) were characterized using RAPD and REP-PCR techniques. Both the fingerprinting techniques generated reproducible band patterns, differing in the number and molecular mass amplicons. The RAPD technique displayed greater discriminatory power by its production of more complex binding pattern and divided all the strains into 13 groups, compared to 9 by REP-PCR technique. Both techniques showed the availability to differentiate the genetic profiles of the strains according to their geographical location of origin. Three strains of Strep. agalactiae that were recovered from golden pompano showed a genetic dissimilarity from the strains isolated from red hybrid tilapia, while the strain of ATCC 27956 that recovered from bovine displayed a unique profile for both methods. Both techniques possess excellent discriminative capabilities and can be used as a rapid means of comparing Strep. agalactiae strains for future epidemiological investigation. Framework as the guideline in traceability of this disease and in the search for potential local vaccine candidates for streptococcosis in this country. Journal of Applied Microbiology © 2013 The Society for Applied Microbiology.
A method for accurate detection of genomic microdeletions using real-time quantitative PCR
Directory of Open Access Journals (Sweden)
Bassett Anne S
2005-12-01
Full Text Available Abstract Background Quantitative Polymerase Chain Reaction (qPCR is a well-established method for quantifying levels of gene expression, but has not been routinely applied to the detection of constitutional copy number alterations of human genomic DNA. Microdeletions or microduplications of the human genome are associated with a variety of genetic disorders. Although, clinical laboratories routinely use fluorescence in situ hybridization (FISH to identify such cryptic genomic alterations, there remains a significant number of individuals in which constitutional genomic imbalance is suspected, based on clinical parameters, but cannot be readily detected using current cytogenetic techniques. Results In this study, a novel application for real-time qPCR is presented that can be used to reproducibly detect chromosomal microdeletions and microduplications. This approach was applied to DNA from a series of patient samples and controls to validate genomic copy number alteration at cytoband 22q11. The study group comprised 12 patients with clinical symptoms of chromosome 22q11 deletion syndrome (22q11DS, 1 patient trisomic for 22q11 and 4 normal controls. 6 of the patients (group 1 had known hemizygous deletions, as detected by standard diagnostic FISH, whilst the remaining 6 patients (group 2 were classified as 22q11DS negative using the clinical FISH assay. Screening of the patients and controls with a set of 10 real time qPCR primers, spanning the 22q11.2-deleted region and flanking sequence, confirmed the FISH assay results for all patients with 100% concordance. Moreover, this qPCR enabled a refinement of the region of deletion at 22q11. Analysis of DNA from chromosome 22 trisomic sample demonstrated genomic duplication within 22q11. Conclusion In this paper we present a qPCR approach for the detection of chromosomal microdeletions and microduplications. The strategic use of in silico modelling for qPCR primer design to avoid regions of repetitive
Simultaneous detection of peanut and hazelnut allergens in food matrices using multiplex PCR method
Directory of Open Access Journals (Sweden)
Eva Renčová
2014-01-01
Full Text Available Multiplex PCR analysis for the detection of two targeting segments of genes coding major food protein allergens as peanut (Arachis hypogaea Ara h 1 gene and hazelnut (Corylus avellana Cor a 1 gene was developed. Two sets of primers were designed and tested to their specificity on a broad range of ingredients. The identity of amplicons (Ara h 1- 180 bp, Cor a 1 – 258 bp by sequencing and alignment of sequences with sequences deposited in Genbank was confirmed. When testing the specificity of designed primer pairs on a spectrum of food ingredients, no cross reactions were detected. A potential inhibition of PCR reaction was eliminated using the universal plant primers of chloroplast gene 124 bp for the plant matrices confirmation. The intrinsic detection limit was 10 pg·ml-1 and the practical detection limit was 0.001% w/w (10 mg·kg-1 for both peanuts and hazelnuts. The method was applied to the investigation of 60 commercial food samples. The developed multiplex PCR method is cheap, specific and sensitive enough and can be used as a simple, one day procedure for the checking of undeclared peanut and hazelnut major allergens in food.
Molecular Strain Typing of Mycobacterium tuberculosis: a Review of Frequently Used Methods
2016-01-01
Tuberculosis, caused by the bacterium Mycobacterium tuberculosis, remains one of the most serious global health problems. Molecular typing of M. tuberculosis has been used for various epidemiologic purposes as well as for clinical management. Currently, many techniques are available to type M. tuberculosis. Choosing the most appropriate technique in accordance with the existing laboratory conditions and the specific features of the geographic region is important. Insertion sequence IS6110-based restriction fragment length polymorphism (RFLP) analysis is considered the gold standard for the molecular epidemiologic investigations of tuberculosis. However, other polymerase chain reaction-based methods such as spacer oligonucleotide typing (spoligotyping), which detects 43 spacer sequence-interspersing direct repeats (DRs) in the genomic DR region; mycobacterial interspersed repetitive units–variable number tandem repeats, (MIRU-VNTR), which determines the number and size of tandem repetitive DNA sequences; repetitive-sequence-based PCR (rep-PCR), which provides high-throughput genotypic fingerprinting of multiple Mycobacterium species; and the recently developed genome-based whole genome sequencing methods demonstrate similar discriminatory power and greater convenience. This review focuses on techniques frequently used for the molecular typing of M. tuberculosis and discusses their general aspects and applications. PMID:27709842
Analogy as a means of theoretical adoption of pedagogical disciplines
Directory of Open Access Journals (Sweden)
Solovcova Irina A.
2006-01-01
Full Text Available The paper considers an application of analogy in the initial-teacher training as a tool of approaching pedagogical disciplines. The author proposes a classification of pedagogical analogies which provides choices of the most efficient model for a specific didactic situation. The article clarifies the model of the theoretical approach to pedagogical disciplines through active use of analogy, which contributes to a higher efficiency in a teacher and student interaction. The model consists of three stages: training (the stage of acquiring analogy model, the analytical stage (acquisition of pedagogical concepts, phenomena and systems through the application of analogy, and the stage of self-realization (the application of analogy method in students’ scientific-research activities considering external and internal didactic conditions which transform analogy from a teaching method into a tool for the acquisition of pedagogical disciplines. The author demonstrates that the application of analogy has a positive effect not only on the acquisition of pedagogical knowledge (especially methodic and the development of heuristic skills in students, but also on motivation for the study of pedagogical disciplines (cognitive aspect and professional pedagogical activity (formation of an individual-pedagogical attitude. .
Go, M F; Chan, K Y; Versalovic, J; Koeuth, T; Graham, D Y; Lupski, J R
1995-07-01
Helicobacter pylori infection is now accepted as the most common cause of chronic active gastritis and peptic ulcer disease. The etiologies of many infectious diseases have been attributed to specific or clonal strains of bacterial pathogens. Polymerase chain reaction (PCR) amplification of DNA between repetitive DNA sequences, REP elements (REP-PCR), has been utilized to generate DNA fingerprints to examine similarity among strains within a bacterial species. Genomic DNA from H. pylori isolates obtained from 70 individuals (39 duodenal ulcers and 31 simple gastritis) was PCR-amplified using consensus probes to repetitive DNA elements. The H. pylori DNA fingerprints were analyzed for similarity and correlated with disease presentation using the NTSYS-pc computer program. Each H. pylori strain had a distinct DNA fingerprint except for two pairs. Single-colony DNA fingerprints of H. pylori from the same patient were identical, suggesting that each patient harbors a single strain. Computer-assisted cluster analysis of the REP-PCR DNA fingerprints showed two large clusters of isolates, one associated with simple gastritis and the other with duodenal ulcer disease. Cluster analysis of REP-PCR DNA fingerprints of H. pylori strains suggests that duodenal ulcer isolates, as a group, are more similar to one another and different from gastritis isolates. These results suggest that disease-specific strains may exist.
Overview of RepLab 2014: Author Profiling and Reputation Dimensions for Online Reputation Management
Amigó, E.; Carrillo-de-Albornoz, J.; Chugur, I.; Corujo, A.; Gonzalo, J.; Meij, E.; de Rijke, M.; Spina, D.; Kanoulas, E.; Lupu, M.; Clough, P.; Sanderson, M.; Hall, M.; Hanbury, A.; Toms, E.
2014-01-01
This paper describes the organisation and results of RepLab 2014, the third competitive evaluation campaign for Online Reputation Management systems. This year the focus lied on two new tasks: reputation dimensions classification and author profiling, which complement the aspects of reputation
SASqPCR: robust and rapid analysis of RT-qPCR data in SAS.
Directory of Open Access Journals (Sweden)
Daijun Ling
Full Text Available Reverse transcription quantitative real-time PCR (RT-qPCR is a key method for measurement of relative gene expression. Analysis of RT-qPCR data requires many iterative computations for data normalization and analytical optimization. Currently no computer program for RT-qPCR data analysis is suitable for analytical optimization and user-controllable customization based on data quality, experimental design as well as specific research aims. Here I introduce an all-in-one computer program, SASqPCR, for robust and rapid analysis of RT-qPCR data in SAS. This program has multiple macros for assessment of PCR efficiencies, validation of reference genes, optimization of data normalizers, normalization of confounding variations across samples, and statistical comparison of target gene expression in parallel samples. Users can simply change the macro variables to test various analytical strategies, optimize results and customize the analytical processes. In addition, it is highly automatic and functionally extendable. Thus users are the actual decision-makers controlling RT-qPCR data analyses. SASqPCR and its tutorial are freely available at http://code.google.com/p/sasqpcr/downloads/list.
Directory of Open Access Journals (Sweden)
Raquel M. Fernández
2013-01-01
Full Text Available Preimplantation genetic diagnosis (PGD of single gene disorders, combined with HLA matching (PGD-HLA, has emerged as a tool for couples at risk of transmitting a genetic disease to select unaffected embryos of an HLA tissue type compatible with that of an existing affected child. Here, we present a novel one-step multiplex PCR to genotype a spectrum of STRs to simultaneously perform HLA typing and PGD for -thalassemia. This method is being routinely used for PGD-HLA cycles in our department, with a genotyping success rate of 100%. As an example, we present the first successful PGD-HLA typing in Spain, which resulted in the birth of a boy and subsequent successful HSC transplantation to his affected brother, who is doing well 4 years following transplantation. The advantage of our method is that it involves only a round of single PCR for multiple markers amplification (up to 10 markers within the HLA and 6 markers at the -globin loci. This strategy has allowed us to considerably reduce the optimization of the PCR method for each specific PGD-HLA family as well as the time to obtain molecular results in each cycle.
Rapid Methods to Distinguish Heterodera schachtii from Heterodera glycines Using PCR Technique
Directory of Open Access Journals (Sweden)
Hyoung Rai Ko
2017-09-01
Full Text Available The purpose of this study was to develop rapid methods for distinguishing between Heterodera schachtii and H. glycines detected from chinese cabbage fields of highland in Gangwon, Korea. To do this, we performed PCR-RFLP and PCR with the primers set developed in this study for GC147, GC408 and PM001 population, H. schachtii, and YS224, DA142 and BC115 population, H. glycines. Eight restriction enzymes generated RFLP profiles of mtDNA COI region for populations of H. schachtii and H. glycines, repectively. As a result, treatment of two restriction enzymes, RsaI and HinfI, were allowed to distinguish H. schachtii from H. glycines based on the differences of DNA band patterns. The primer set, #JBS1, #JBG1 and #JB3R, amplified specific fragments with 277 and 339 bp of H. schachtii, 339 bp of H. glycines, respectively, while it did not amplify fragments from three root-knot nematodes and two root-lesion nematodes. Thus, the primer set developed in this study could be a good method, which is used to distinguish between H. schachtii and H. glycines.
Directory of Open Access Journals (Sweden)
Husheng Liu
2016-11-01
Full Text Available The time-interleaved analog-to-digital converter (TIADC is an architecture used to achieve a high sampling rate and high dynamic performance. However, estimation and compensation methods are required to maintain the dynamic performance of the constituent analog-to-digital converters (ADCs due to channel mismatches. This paper proposes a blind adaptive method to calibrate the nonlinear mismatches in M-channel TIADCs (M-TIADCs. The nonlinearity-induced error signal is reconstructed by the proposed multiplier Hadamard transform (MHT structure, and the nonlinear parameters are estimated by the filtered-X least-mean square (FxLMS algorithm. The performance of cascade calibration is also analyzed. The numerical simulation results show that the proposed method consumes much less hardware resources while maintaining the calibration performance.
A survey of tools for the analysis of quantitative PCR (qPCR) data.
Pabinger, Stephan; Rödiger, Stefan; Kriegner, Albert; Vierlinger, Klemens; Weinhäusel, Andreas
2014-09-01
Real-time quantitative polymerase-chain-reaction (qPCR) is a standard technique in most laboratories used for various applications in basic research. Analysis of qPCR data is a crucial part of the entire experiment, which has led to the development of a plethora of methods. The released tools either cover specific parts of the workflow or provide complete analysis solutions. Here, we surveyed 27 open-access software packages and tools for the analysis of qPCR data. The survey includes 8 Microsoft Windows, 5 web-based, 9 R-based and 5 tools from other platforms. Reviewed packages and tools support the analysis of different qPCR applications, such as RNA quantification, DNA methylation, genotyping, identification of copy number variations, and digital PCR. We report an overview of the functionality, features and specific requirements of the individual software tools, such as data exchange formats, availability of a graphical user interface, included procedures for graphical data presentation, and offered statistical methods. In addition, we provide an overview about quantification strategies, and report various applications of qPCR. Our comprehensive survey showed that most tools use their own file format and only a fraction of the currently existing tools support the standardized data exchange format RDML. To allow a more streamlined and comparable analysis of qPCR data, more vendors and tools need to adapt the standardized format to encourage the exchange of data between instrument software, analysis tools, and researchers.
A PURE NODAL-ANALYSIS METHOD SUITABLE FOR ANALOG CIRCUITS USING NULLORS
E. Tlelo-Cuautle; L.A. Sarmiento-Reyes
2003-01-01
A novel technique suitable for computer-aided analysis of analog integrated circuits (ICs) is introduced. This technique uses the features of both nodal-analysis (NA) and symbolic analysis, at nullor level. First, the nullor is used to model the ideal behavior of several analog devices, namely: transistors, opamps, OTAs, and current conveyors. From this modeling approach, it is shown how to transform circuits working in voltage-mode to current-mode and vice-versa. Second, it is demonstrated t...
Probe-based real-time PCR method for multilocus melt typing of Xylella fastidiosa strains.
Brady, Jeff A; Faske, Jennifer B; Ator, Rebecca A; Castañeda-Gill, Jessica M; Mitchell, Forrest L
2012-04-01
Epidemiological studies of Pierce's disease (PD) can be confounded by a lack of taxonomic detail on the bacterial causative agent, Xylella fastidiosa (Xf). PD in grape is caused by strains of Xylella fastidiosa subsp. fastidiosa, but is not caused by other subspecies of Xf that typically colonize plants other than grape. Detection assays using ELISA and qPCR are effective at detecting and quantifying Xf presence or absence, but offer no information on Xf subspecies or strain identity. Surveying insects or host plants for Xf by current ELISA or qPCR methods provides only presence/absence and quantity information for any and all Xf subspecies, potentially leading to false assessments of disease threat. This study uses a series of adjacent-hybridizing DNA melt analysis probes that are capable of efficiently discriminating Xf subspecies and strain relationships in rapid real-time PCR reactions. Copyright © 2012 Elsevier B.V. All rights reserved.
Detecting analogies unconsciously
Directory of Open Access Journals (Sweden)
Thomas Peter Reber
2014-01-01
Full Text Available Analogies may arise from the conscious detection of similarities between a present and a past situation. In this functional magnetic resonance imaging study, we tested whether young volunteers would detect analogies unconsciously between a current supraliminal (visible and a past subliminal (invisible situation. The subliminal encoding of the past situation precludes awareness of analogy detection in the current situation. First, participants encoded subliminal pairs of unrelated words in either one or nine encoding trials. Later, they judged the semantic fit of supraliminally presented new words that either retained a previously encoded semantic relation (‘analog’ or not (‘broken analog’. Words in analogs versus broken analogs were judged closer semantically, which reflects unconscious analogy detection. Hippocampal activity associated with subliminal encoding correlated with the behavioral measure of unconscious analogy detection. Analogs versus broken analogs were processed with reduced prefrontal but enhanced medial temporal activity. We conclude that analogous episodes can be detected even unconsciously drawing on the episodic memory network.
Blanchard, Philippe; Regnault, Julie; Schurr, Frank; Dubois, Eric; Ribière, Magali
2012-03-01
Chronic bee paralysis virus (CBPV) is responsible for chronic bee paralysis, an infectious and contagious disease in adult honey bees (Apis mellifera L.). A real-time RT-PCR assay to quantitate the CBPV load is now available. To propose this assay as a reference method, it was characterised further in an intra-laboratory study during which the reliability and the repeatability of results and the performance of the assay were confirmed. The qPCR assay alone and the whole quantitation method (from sample RNA extraction to analysis) were both assessed following the ISO/IEC 17025 standard and the recent XP U47-600 standard issued by the French Standards Institute. The performance of the qPCR assay and of the overall CBPV quantitation method were validated over a 6 log range from 10(2) to 10(8) with a detection limit of 50 and 100 CBPV RNA copies, respectively, and the protocol of the real-time RT-qPCR assay for CBPV quantitation was approved by the French Accreditation Committee. Copyright © 2011 Elsevier B.V. All rights reserved.
Automated Production of High Rep Rate Foam Targets
Hall, F.; Spindloe, C.; Haddock, D.; Tolley, M.; Nazarov, W.
2016-04-01
Manufacturing low density targets in the numbers needed for high rep rate experiments is highly challenging. This report summarises advances from manual production to semiautomated and the improvements that follow both in terms of production time and target uniformity. The production process is described and shown to be improved by the integration of an xyz robot with dispensing capabilities. Results are obtained from manual and semiautomated production runs and compared. The variance in the foam thickness is reduced significantly which should decrease experimental variation due to target parameters and could allow for whole batches to be characterised by the measurement of a few samples. The work applies to both foil backed and free standing foam targets.
Differentiation of Pseudomonas syringae Pathovars Originating from Stone Fruits
Directory of Open Access Journals (Sweden)
Katarina Gašić
2012-01-01
Full Text Available Due to an overlapping host range, similar symptomatology and many common characteristics,Pseudomonas syringae pathovars originating from stone fruits can easily be misidentified.In order to select tests for rapid and efficient differentiation of P. s. pvs. syringae,morsprunorum and persicae, we studied the suitability and differentiating potential ofsome standard bacteriological and molecular methods. Differentiation of the strains wasperformed using LOPAT, GATTa and ice nucleation tests, nutrient sucrose broth growthand utilization of various carbon sources. PCR method enabled the detection of toxin-producinggenes: syrB and syrD in P. s. pv. syringae, and cfl gene in P. s. pv. morsprunorum race1. Syringomycin production by pv. syringae was confirmed in bioassay using Geotrichumcandidum, Saccharomyces cerevisiae and Rhodotorula pilimanae as indicator organisms.Pathogenicity test on lemon and immature nectarine fruits, as well as on string bean pods,showed different intensity of reaction of the inoculated material which could separate pv.syringae from the other two pathovars. PCR-based repetitive sequences, Rep-PCR withREP, ERIC and BOX primers revealed different genetic profiles within P. syringae pathovars.
DEFF Research Database (Denmark)
Schmidt, Gunilla Veslemøy; Mellerup, Anders; Christiansen, Lasse Engbo
2015-01-01
The aim of this article was to define the sampling level and method combination that captures antibiotic resistance at pig herd level utilizing qPCR antibiotic resistance gene quantification and culture-based quantification of antibiotic resistant coliform indicator bacteria. Fourteen qPCR assays...... for commonly detected antibiotic resistance genes were developed, and used to quantify antibiotic resistance genes in total DNA from swine fecal samples that were obtained using different sampling and pooling methods. In parallel, the number of antibiotic resistant coliform indicator bacteria was determined...... when comparing individual sampling and pooling methods. qPCR on pooled samples was found to be a good representative for the general resistance level in a pig herd compared to the coliform CFU counts. It had significantly reduced relative standard deviations compared to coliform CFU counts in the same...
Stachelska, Milena A
2017-12-04
The aim of this paper was to detect Lactobacillus delbrueckii and Streptococcus thermophilus using real-time quantitative PCR assay in 7-day ripening cheese produced from unpasteurised milk. Real-time quantitative PCR assays were designed to identify and enumerate the chosen species of lactic acid bacteria (LAB) in ripened cheese. The results of molecular quantification and classic bacterial enumeration showed a high level of similarity proving that DNA extraction was carried out in a proper way and that genomic DNA solutions were free of PCR inhibitors. These methods revealed the presence of L. delbrueckii and S. thermophilus. The real-time PCR enabled quantification with a detection of 101-103 CFU/g of product. qPCR-standard curves were linear over seven log units down to 101 copies per reaction; efficiencies ranged from 77.9% to 93.6%. Cheese samples were analysed with plate count method and qPCR in parallel. Compared with the classic plate count method, the newly developed qPCR method provided faster and species specific identification of two dairy LAB and yielded comparable quantitative results.
A Quantitative PCR-Electrochemical Genosensor Test for the Screening of Biotech Crops
Directory of Open Access Journals (Sweden)
Suely Moura-Melo
2017-04-01
Full Text Available The design of screening methods for the detection of genetically modified organisms (GMOs in food would improve the efficiency in their control. We report here a PCR amplification method combined with a sequence-specific electrochemical genosensor for the quantification of a DNA sequence characteristic of the 35S promoter derived from the cauliflower mosaic virus (CaMV. Specifically, we employ a genosensor constructed by chemisorption of a thiolated capture probe and p-aminothiophenol gold surfaces to entrap on the sensing layer the unpurified PCR amplicons, together with a signaling probe labeled with fluorescein. The proposed test allows for the determination of a transgene copy number in both hemizygous (maize MON810 trait and homozygous (soybean GTS40-3-2 transformed plants, and exhibits a limit of quantification of at least 0.25% for both kinds of GMO lines.
Directory of Open Access Journals (Sweden)
Iveta Svobodová
Full Text Available Detection and characterization of circulating cell-free fetal DNA (cffDNA from maternal circulation requires an extremely sensitive and precise method due to very low cffDNA concentration. In our study, droplet digital PCR (ddPCR was implemented for fetal RHD genotyping from maternal plasma to compare this new quantification alternative with real-time PCR (qPCR as a golden standard for quantitative analysis of cffDNA. In the first stage of study, a DNA quantification standard was used. Clinical samples, including 10 non-pregnant and 35 pregnant women, were analyzed as a next step. Both methods' performance parameters-standard curve linearity, detection limit and measurement precision-were evaluated. ddPCR in comparison with qPCR has demonstrated sufficient sensitivity for analysing of cffDNA and determination of fetal RhD status from maternal circulation, results of both methods strongly correlated. Despite the more demanding workflow, ddPCR was found to be slightly more precise technology, as evaluated using quantitative standard. Regarding the clinical samples, the precision of both methods equalized with decreasing concentrations of tested DNA samples. In case of cffDNA with very low concentrations, variance parameters of both techniques were comparable. Detected levels of fetal cfDNA in maternal plasma were slightly higher than expected and correlated significantly with gestational age as measured by both methods (ddPCR r = 0.459; qPCR r = 0.438.
Zhan, Fangfang; Zhou, Xiaoming
2012-12-01
Rotaviruses are double-stranded RNA viruses belonging to the family of enteric pathogens. It is a major cause of diarrhoeal disease in infants and young children worldwide. Consequently, rapid and accurate detection of rotaviruses is of great importance in controlling and preventing food- and waterborne diseases and outbreaks. Reverse transcription-polymerase chain reaction (RT-PCR) is a reliable method that possesses high specificity and sensitivity. It has been widely used to detection of viruses. Electrochemiluminescence (ECL) can be considered as an important and powerful tool in analytical and clinical application with high sensitivity, excellent specificity, and low cost. Here we have developed a method for the detection of rotavirus by combining in situ magnetic beads (MBs) based RT-PCR with ECL. RT of rotavirus RNA was carried out in a traditional way and the resulting cDNA was directly amplified on MBs. Forward primers were covalently bounded to MBs and reverse primers were labeled with tris-(2, 2'-bipyridyl) ruthenium (TBR). During the PCR cycling, the TBR labeled products were directly loaded and enriched on the surface of MBs. Then the MBs-TBR complexes could be analyzed by a magnetic ECL platform without any post-modification or post-incubation which avoid some laborious manual operations and achieve rapid yet sensitive detection. In this study, rotavirus from fecal specimens was successfully detected within 2 h, and the limit of detection was estimated to be 104copies/μL. This novel in situ MBs based RT-PCR with ECL detection method can be used for pathogen detection in food safety field and clinical diagnosis.
Higher-derivative generalization of conformal mechanics
Baranovsky, Oleg
2017-08-01
Higher-derivative analogs of multidimensional conformal particle and many-body conformal mechanics are constructed. Their Newton-Hooke counterparts are derived by applying appropriate coordinate transformations.
Hoef, A M; Kok, E J; Bouw, E; Kuiper, H A; Keijer, J
1998-10-01
A method has been developed to distinguish between traditional soy beans and transgenic Roundup Ready soy beans, i.e. the glyphosate ('Roundup') resistant soy bean variety developed by Monsanto Company. Glyphosate resistance results from the incorporation of an Agrobacterium-derived 5-enol-pyruvyl-shikimate-3-phosphatesynthase (EPSPS) gene. The detection method developed is based on a nested Polymerase Chain Reaction (PCR) procedure. Ten femtograms of soy bean DNA can be detected, while, starting from whole soy beans, Roundup Ready DNA can be detected at a level of 1 Roundup Ready soy bean in 5000 non-GM soy beans (0.02% Roundup Ready soy bean). The method has been applied to samples of soy bean, soy-meal pellets and soy bean flour, as well as a number of processed complex products such as infant formula based on soy, tofu, tempeh, soy-based desserts, bakery products and complex meat and meat-replacing products. The results obtained are discussed with respect to practical application of the detection method developed.
PCR-mediated recombination in amplification products derived from polyploid cotton.
Richard C. Cronn; M. Cedroni; T. Haselkorn; C. Grover; Jonathan F. Wendel
2002-01-01
PCR recombination describes a process of in vitro chimera formation from non-identical templates. The key requirements of this process is the inclusion of two partially homologous templates in one reaction, a condition met when amplifying any locus from polyploid organisms and members of multigene families from diploid organisms. Because polyploids possess two or more...
Directory of Open Access Journals (Sweden)
M Fallah
2012-09-01
Full Text Available Background: Metronidazole is drug of choice recommended by WHO for treatment of trichomoniasis, however, some reports claims drug resistance in Trichomonas vaginalis isolates recently. The objective of this study was to determine the minimum lethal concentration (MLC of metronidazole in resistant and sensitive strains, as well as genetic patterns of these stains by PCR method. Methods: From February 2006 to March 2007, in a cross sectional study, clinical and wet mount examination of vaginal smear along with culture were performed on 683 women attending to public and private outpatient clinics in Hamadan. Trichomoniasis marked based on major clinical symptoms. Diagnosis confirmed using wet mount microscopically and culture in Diamond medium. A serial concentration of metronidazole was provided and all isolated Trichomonas strains (resistant and sensitive tested by standard method. Finally, all sensitive and resistant strains examined by PCR technique. Results: Only 15/683, (2.2% of patients clinically diagnosed trichomonal vaginitis were positive for T. vaginalis by wet smear and culture. The minimum lethal concentration (MLC for clinically sensitive isolates was 25 µg/ml; however, this concentration for resistant isolates was 200 µg/ml after 24 h and 100 µg/ml after 50 h. The results of PCR examination of DNA from sensitive and resistant isolates had same pattern. The lanes appeared by two primers were 98 bp and 261 bp for both clinically sensitive and resistant strains. Conclusion: Resistance to metronidazole in T. vaginalis has not relation to genetic variations and might be related to some physiologic pathways of organism.
Optimization of a 12-hour TaqMan PCR-based method for detection of Salmonella bacteria in meat
DEFF Research Database (Denmark)
Josefsen, Mathilde Hartmann; Krause, Michael; Hansen, F.
2007-01-01
no positive effects and resulted in decreased reproducibility. Increasing the amount of PCR template DNA from 5 to 20 mu l improved the threshold cycle value by approximately 2. The improved 12-h PCR method was successfully compared to a reference culture method with 100 minced meat and poultry samples...... the highest number of salmonellae. When analyzing minced meat samples, positive effects of increasing the initial sampling volume from 1 to 5 ml and increasing the amount of paramagnetic particles to 90 mu l were observed. However, washing the pellet and eluting the DNA in reduced volumes (25 and 50 mu l) had...
Analog filters in nanometer CMOS
Uhrmann, Heimo; Zimmermann, Horst
2014-01-01
Starting from the basics of analog filters and the poor transistor characteristics in nanometer CMOS 10 high-performance analog filters developed by the authors in 120 nm and 65 nm CMOS are described extensively. Among them are gm-C filters, current-mode filters, and active filters for system-on-chip realization for Bluetooth, WCDMA, UWB, DVB-H, and LTE applications. For the active filters several operational amplifier designs are described. The book, furthermore, contains a review of the newest state of research on low-voltage low-power analog filters. To cover the topic of the book comprehensively, linearization issues and measurement methods for the characterization of advanced analog filters are introduced in addition. Numerous elaborate illustrations promote an easy comprehension. This book will be of value to engineers and researchers in industry as well as scientists and Ph.D students at universities. The book is also recommendable to graduate students specializing on nanoelectronics, microelectronics ...
Learning on the fly with the analogical method
Directory of Open Access Journals (Sweden)
Zara Mehrnoosh
2016-04-01
Full Text Available Today in Italy 20-25% of students in primary school is reported to have difficulties with mathematical skills, although several researchers have noticed a man’s natural predisposition towards numbers. In the light of this high number of reports becomes therefore necessary to reconsider the didactic context to better support the natural evolution of numerical and mathematical cognition from early childhood. The following article presents the analogical method developed by Camillo Bortolato: non-conceptual didactic path focused on semantic process, subitizing and mental math. Apprendere al volo con il metodo analogicoAd oggi in Italia il 20-25% degli alunni nella scuola primaria viene segnalato per difficoltà nel calcolo, nonostante diversi ricercatori abbiano evidenziato una naturale predisposizione dell’uomo verso la numerosità. Alla luce di questo elevato numero di segnalazioni diviene necessario ripensare il contesto didattico per sostenere al meglio e fin dalla prima infanzia la naturale evoluzione della cognizione numerica e di calcolo. Nel seguente articolo viene presentato il metodo analogico di Camillo Bortolato, un percorso didattico non concettuale attento ai processi semantici, al ruolo del subitizing e del calcolo a mente.
Automatic activation of categorical and abstract analogical relations in analogical reasoning.
Green, Adam E; Fugelsang, Jonathan A; Dunbar, Kevin N
2006-10-01
We examined activation of concepts during analogical reasoning. Subjects made either analogical judgments or categorical judgments about four-word sets. After each four-word set, they named the ink color of a single word in a modified Stroop task. Words that referred to category relations were primed (as indicated by longer response times on Stroop color naming) subsequent to analogical judgments and categorical judgments. This finding suggests that activation of category concepts plays a fundamental role in analogical thinking. When colored words referred to analogical relations, priming occurred subsequent to analogical judgments, but not to categorical judgments, even though identical four-word stimuli were used for both types of judgments. This finding lends empirical support to the hypothesis that, when people comprehend the analogy between two items, they activate an abstract analogical relation that is distinct from the specific content items that compose the analogy.
The force of dissimilar analogies in bioethics.
Mertes, Heidi; Pennings, Guido
2011-04-01
Although analogical reasoning has long been a popular method of reasoning in bioethics, current literature does not sufficiently grasp its variety. We assert that the main shortcoming is the fact that an analogy's value is often judged on the extent of similarity between the source situation and the target situation, while in (bio)ethics, analogies are often used because of certain dissimilarities rather than in spite of them. We make a clear distinction between dissimilarities that aim to reinforce a similar approach in the source situation and the target situation and dissimilarities that aim to undermine or denounce a similar approach. The former kind of dissimilarity offers the analogy more normative force than if there were no dissimilarities present; this is often overlooked by authors who regard all relevant dissimilarities as detrimental to the analogy's strength. Another observation is that an evaluation of the normative force of an analogy cannot be made independently of moral principles or theories. Without these, one cannot select which elements in an analogy are morally relevant nor determine how they should be interpreted.
Jia, Xianbo; Lin, Xinjian; Chen, Jichen
2017-11-02
Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.
Novel methods of cytokine detection: Real-time PCR, ELISPOT, and intracellular cytokine staining
Directory of Open Access Journals (Sweden)
Eliza Turlej
2009-05-01
Full Text Available Cytokines are small hormone-like proteins that play important roles in immune system control. Cytokines regulate the proliferation and differentiation of cells and hematopoiesis and act as mediators in the inflammatory reaction. Changes in cytokine levels are found in many diseases, such as sepsis, bowel inflammatory disease, autoimmune diseases, as well as graft-versus-host disease. Cytokines levels can be detected using in vivo, in vitro, and ex vivo techniques. The level of cytokine produced can be measured by immunoenzymatic test (ELISA in supernatant after cell culture with the addition of stimulant and in plasma by techniques that measure the level of cytokine secretion in cells (e.g. immunohistochemical staining, ELISPOT, and intracellular cytokine staining, and by molecular biological methods (RPA, real-time PCR, in situ hybridization, and Northern blot. Detection of cytokine mRNA in tissues is useful in the direct determination of heterogenic populations of cytokine-producing cells. Nowadays the most frequently used methods for measuring cytokine level are ELISPOT, intracellular cytokine staining with flow cytometry detection, and real-time PCR. These methods have an important clinical role in vaccine efficacy, in viral, bacterial, and verminous diagnostics, and in determining the efficacy of cancer treatment.
Directory of Open Access Journals (Sweden)
Jokovic Natasa
2011-01-01
Full Text Available Two hundred thirteen non-starter lactic acid bacteria isolated from Radan cheese during ripening were identified with both a classical biochemical test and rep-PCR with (GTG5 primer. For most isolates, which belong to the Lactococcus lactis subsp. lactis, Leuconostoc mesenteroides, Lactobacillus plantarum, Lactobacillus paraplantarum and Enterococcus faecium, a phenotypic identification was in good agreement with rep-PCR identification. Lactococeus lactis subsp. lactis, Enterococcus faecium and subspecies from the Lenconostoc mesenteroides group were the dominant population of lactic acid bacteria in cheese until 10 days of ripening and only one Streptococcus thermophilus strain was isolated from the 5-day-old cheese sample. As ripening progressed, Lactobacillus plantarum became the predominant species together with the group of heterofermentative species of lactobacilli that could not be precisely identified with rep-PCR.
Panneum, S; Rukkwamsuk, T
2017-03-01
For preventive and control strategies of Caprine Arthritis Encephalitis Virus (CAEV) infection in dairy goats, performance of the available diagnostic tests was described as one of the most important and necessary aspects. The study aimed at evaluating the diagnostic test performance, including PCR, ELISA and viral culture, for CAEV infection in dairy goats in Thailand. Blood samples of 29 dairy goats from five low- to medium-prevalence herds and one very low-prevalence herd were collected for PCR and ELISA methods. The performance of these two diagnostic methods was evaluated by comparing with cytopathic effects (CPE) in the co-cultivation of CAEV and primary synovial cells. Results indicated that sensitivity, specificity were, respectively, 69.6%, 100%, for PCR; and 95.7%, 83.3% for ELISA. The PCR assay tended to have lower sensitivity and higher specificity than ELISA. When multiple tests were applied, parallel testing provided sensitivity and specificity of 98.7% and 83.3%, while series testing showed sensitivity and specificity of 66.6% and 100% respectively. These results indicated that combination of ELISA and PCR provided some advantages and possibly offered optimal methods to detect CAEV-infected goats. Kappa value of the agreement between PCR and ELISA test was 0.34, indicating fair agreement. Regarding the possibility of antigenic variation between CAEV strains used in both PCR and ELISA assays, the actual circulating CAEV strain should be reviewed in order to develop and enhance the diagnostic tests using the CAE viral antigens derived from specific local strains of Thailand.
Myers, Michael J; Yancy, Haile F; Araneta, Michael; Armour, Jennifer; Derr, Janice; Hoostelaere, Lawrence A D; Farmer, Doris; Jackson, Falana; Kiessling, William M; Koch, Henry; Lin, Huahua; Liu, Yan; Mowlds, Gabrielle; Pinero, David; Riter, Ken L; Sedwick, John; Shen, Yuelian; Wetherington, June; Younkins, Ronsha
2006-01-01
A method trial was initiated to validate the use of a commercial DNA forensic kit to extract DNA from animal feed as part of a PCR-based method. Four different PCR primer pairs (one bovine pair, one porcine pair, one ovine primer pair, and one multispecies pair) were also evaluated. Each laboratory was required to analyze a total of 120 dairy feed samples either not fortified (control, true negative) or fortified with bovine meat and bone meal, porcine meat and bone meal (PMBM), or lamb meal. Feeds were fortified with the animal meals at a concentration of 0.1% (wt/wt). Ten laboratories participated in this trial, and each laboratory was required to evaluate two different primer pairs, i.e., each PCR primer pair was evaluated by five different laboratories. The method was considered to be validated for a given animal source when three or more laboratories achieved at least 97% accuracy (29 correct of 30 samples for 96.7% accuracy, rounded up to 97%) in detecting the fortified samples for that source. Using this criterion, the method was validated for the bovine primer because three laboratories met the criterion, with an average accuracy of 98.9%. The average false-positive rate was 3.0% in these laboratories. A fourth laboratory was 80% accurate in identifying the samples fortified with bovine meat and bone meal. A fifth laboratory was not able to consistently extract the DNA from the feed samples and did not achieve the criterion for accuracy for either the bovine or multispecies PCR primers. For the porcine primers, the method was validated, with four laboratories meeting the criterion for accuracy with an average accuracy of 99.2%. The fifth laboratory had a 93.3% accuracy outcome for the porcine primer. Collectively, these five laboratories had a 1.3% false-positive rate for the porcine primer. No laboratory was able to meet the criterion for accuracy with the ovine primers, most likely because of problems with the synthesis of the primer pair; none of the
Directory of Open Access Journals (Sweden)
Siska Irhamnawati Pulogu
2017-07-01
Full Text Available Witches‘ broom of peanut caused by phytoplasma is a common disease found in Indonesia. Phytoplasma is able to be detected using polymerase chain reaction (PCR technique. One of important factor which determine the successful of phytoplasma amplification is the DNA availability from fresh tissues. The research was aimed to evaluate some preservation methods of phytoplasma from infected plant samples. The aspects to be evaluated consisted of time (1, 2, 3, and 4 weeks, temperature (-20 °C, 4 °C, and 25 °C, and preservation medium (1X PGB buffer, 3 M NaCl, CTAB buffer, 70% ethanol, non medium, and FTA-card for storing the fresh phytoplasma infected samples. Good preservation method will optimize the phytoplasma DNA amplification using PCR standard technique followed by nested-PCR. The results showed that preservation of samples at -20 °C, 4 °C, and 25 °C in CTAB buffer was able to maintain the tissue freshness for 4 weeks and was able to provide the DNA of either quality or quantity sufficiently for PCR detection. PCR standard using a primer pair P1/P7 showed that not all of the preserved DNA of phytoplasma were amplified positively. However, standard PCR followed by nested-PCR using primer pair fU5/rU3 was able to increase the DNA detectability. Preserved samples derived from various medium and stored for 4 weeks gave positive results. This results were in contrary with previous same samples which were detected negatively by standard PCR technique.
Nicolas, Armel; Alazard-Dany, Nathalie; Biollay, Coline; Arata, Loredana; Jolinon, Nelly; Kuhn, Lauriane; Ferro, Myriam; Weller, Sandra K; Epstein, Alberto L; Salvetti, Anna; Greco, Anna
2010-09-01
Adeno-associated virus (AAV) is a human parvovirus that replicates only in cells coinfected with a helper virus, such as adenovirus or herpes simplex virus type 1 (HSV-1). We previously showed that nine HSV-1 factors are able to support AAV rep gene expression and genome replication. To elucidate the strategy of AAV replication in the presence of HSV-1, we undertook a proteomic analysis of cellular and HSV-1 factors associated with Rep proteins and thus potentially recruited within AAV replication compartments (AAV RCs). This study resulted in the identification of approximately 60 cellular proteins, among which factors involved in DNA and RNA metabolism represented the largest functional categories. Validation analyses indicated that the cellular DNA replication enzymes RPA, RFC, and PCNA were recruited within HSV-1-induced AAV RCs. Polymerase delta was not identified but subsequently was shown to colocalize with Rep within AAV RCs even in the presence of the HSV-1 polymerase complex. In addition, we found that AAV replication is associated with the recruitment of components of the Mre11/Rad50/Nbs1 complex, Ku70 and -86, and the mismatch repair proteins MSH2, -3, and -6. Finally, several HSV-1 factors were also found to be associated with Rep, including UL12. We demonstrated for the first time that this protein plays a role during AAV replication by enhancing the resolution of AAV replicative forms and AAV particle production. Altogether, these analyses provide the basis to understand how AAV adapts its replication strategy to the nuclear environment induced by the helper virus.
Martino, Amanda J.; Rhodes, Matthew E.; Biddle, Jennifer F.; Brandt, Leah D.; Tomsho, Lynn P.; House, Christopher H.
2011-01-01
A degenerate polymerase chain reaction (PCR)-based method of whole-genome amplification, designed to work fluidly with 454 sequencing technology, was developed and tested for use on deep marine subsurface DNA samples. While optimized here for use with Roche 454 technology, the general framework presented may be applicable to other next generation sequencing systems as well (e.g., Illumina, Ion Torrent). The method, which we have called random amplification metagenomic PCR (RAMP), involves the use of specific primers from Roche 454 amplicon sequencing, modified by the addition of a degenerate region at the 3′ end. It utilizes a PCR reaction, which resulted in no amplification from blanks, even after 50 cycles of PCR. After efforts to optimize experimental conditions, the method was tested with DNA extracted from cultured E. coli cells, and genome coverage was estimated after sequencing on three different occasions. Coverage did not vary greatly with the different experimental conditions tested, and was around 62% with a sequencing effort equivalent to a theoretical genome coverage of 14.10×. The GC content of the sequenced amplification product was within 2% of the predicted values for this strain of E. coli. The method was also applied to DNA extracted from marine subsurface samples from ODP Leg 201 site 1229 (Peru Margin), and results of a taxonomic analysis revealed microbial communities dominated by Proteobacteria, Chloroflexi, Firmicutes, Euryarchaeota, and Crenarchaeota, among others. These results were similar to those obtained previously for those samples; however, variations in the proportions of taxa identified illustrates well the generally accepted view that community analysis is sensitive to both the amplification technique used and the method of assigning sequences to taxonomic groups. Overall, we find that RAMP represents a valid methodology for amplifying metagenomes from low-biomass samples. PMID:22319519
Hubalkova, Zora; Rencova, Eva
2011-10-01
A one-step polymerase chain reaction (PCR) method for the simultaneous detection of the major allergens of pecan and Brazil nuts was developed. Primer pairs for the amplification of partial sequences of genes encoding the allergens were designed and tested for their specificity on a range of food components. The targeted amplicon size was 173 bp of Ber e 1 gene of Brazil nuts and 72 bp of vicilin-like seed storage protein gene in pecan nuts. The primer pair detecting the noncoding region of the chloroplast DNA was used as the internal control of amplification. The intrinsic detection limit of the PCR method was 100 pg mL(-1) pecan or Brazil nuts DNA. The practical detection limit was 0.1% w/w (1 g kg(-1)). The method was applied for the investigation of 63 samples with the declaration of pecans, Brazil nuts, other different nut species or nuts generally. In 15 food samples pecans and Brazil nuts allergens were identified in the conformity with the food declaration. The presented multiplex PCR method is specific enough and can be used as a fast approach for the detection of major allergens of pecan or Brazil nuts in food. Copyright © 2011 Society of Chemical Industry.
Ulmann, Bernd
2013-01-01
This book is a comprehensive introduction to analog computing. As most textbooks about this powerful computing paradigm date back to the 1960s and 1970s, it fills a void and forges a bridge from the early days of analog computing to future applications. The idea of analog computing is not new. In fact, this computing paradigm is nearly forgotten, although it offers a path to both high-speed and low-power computing, which are in even more demand now than they were back in the heyday of electronic analog computers.
Abstract analogical reasoning in high-functioning children with autism spectrum disorders.
Green, Adam E; Kenworthy, Lauren; Mosner, Maya G; Gallagher, Natalie M; Fearon, Edward W; Balhana, Carlos D; Yerys, Benjamin E
2014-12-01
Children with autism spectrum disorders (ASD) exhibit a deficit in spontaneously recognizing abstract similarities that are crucial for generalizing learning to new situations. This may contribute to deficits in the development of appropriate schemas for navigating novel situations, including social interactions. Analogical reasoning is the central cognitive mechanism that enables typically developing children to understand abstract similarities between different situations. Intriguingly, studies of high-functioning children with ASD point to a relative cognitive strength in basic, nonabstract forms of analogical reasoning. If this analogical reasoning ability extends to abstract analogical reasoning (i.e., between superficially dissimilar situations), it may provide a bridge between a cognitive capability and core ASD deficits in areas such as generalization and categorization. This study tested whether preserved analogical reasoning abilities in ASD can be extended to abstract analogical reasoning, using photographs of real-world items and situations. Abstractness of the analogies was determined via a quantitative measure of semantic distance derived from latent semantic analysis. Children with ASD performed as well as typically developing children at identifying abstract analogical similarities when explicitly instructed to apply analogical reasoning. Individual differences in abstract analogical reasoning ability predicted individual differences in a measure of social function in the ASD group. Preliminary analyses indicated that children with ASD, but not typically developing children, showed an effect of age on abstract analogical reasoning. These results provide new evidence that children with ASD are capable of identifying abstract similarities through analogical reasoning, pointing to abstract analogical reasoning as a potential lever for improving generalization skills and social function in ASD. © 2014 International Society for Autism Research, Wiley
Directory of Open Access Journals (Sweden)
Jiabing Ji
Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.
The Microphone Feedback Analogy for Chatter in Machining
Directory of Open Access Journals (Sweden)
Tony Schmitz
2015-01-01
Full Text Available This paper provides experimental evidence for the analogy between the time-delay feedback in public address systems and chatter in machining. Machining stability theory derived using the Nyquist criterion is applied to predict the squeal frequency in a microphone/speaker setup. Comparisons between predictions and measurements are presented.
Design, synthesis and biological evaluation of novel desmuramyldipeptide analogs.
Jakopin, Žiga; Corsini, Emanuela; Gobec, Martina; Mlinarič-Raščan, Irena; Dolenc, Marija Sollner
2011-09-01
A series of novel desmuramyldipeptides have been designed and synthesized as part of our search for therapeutically useful muramyldipeptide (MDP) analogs. Their immunomodulatory properties were initially assessed in vitro, evaluating their effect on lipopolysaccharide (LPS)-induced cytokine release in THP-1 cells. Following the initial screening, selected compounds were further investigated for immunomodulatory properties using LPS and phorbol 12-myristate 13-acetate (PMA)/ionomycin-stimulated human peripheral blood mononuclear cells. The results confirmed the immunomodulatory properties of some of the synthesized desmuramyldipeptide analogs. Taken together, presented data confirmed the immunostimulatory effect of compound 44, MDP derivative incorporating a pyrido-fused [1,2]-benzisothiazole moiety, while for compounds 32 and 39, indole scaffold-based derivatives of MDP, an immunosuppressive effect was observed. Further studies will be necessary to address their potential therapeutic use as immunomodulatory drugs, both as immunostimulants or anti-inflammatory agents. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells
International Nuclear Information System (INIS)
Raynor, Michael; Stephenson, Sally-Anne; Walsh, David CA; Pittman, Kenneth B; Dobrovic, Alexander
2002-01-01
Immunomagnetic enrichment followed by RT-PCR (immunobead RT-PCR) is an efficient methodology to identify disseminated carcinoma cells in the blood and bone marrow. The RT-PCR assays must be both specific for the tumor cells and sufficiently sensitive to enable detection of single tumor cells. We have developed a method to test RT-PCR assays for any cancer. This has been investigated using a panel of RT-PCR markers suitable for the detection of breast cancer cells. In the assay, a single cell line-derived tumor cell is added to 100 peripheral blood mononuclear cells (PBMNCs) after which mRNA is isolated and reverse transcribed for RT-PCR analysis. PBMNCs without added tumor cells are used as specificity controls. The previously studied markers epidermal growth factor receptor (EGFR), mammaglobin 1 (MGB1), epithelial cell adhesion molecule (EpCAM/TACSTD1), mucin 1 (MUC1), carcinoembryonic antigen (CEA) were tested. Two new epithelial-specific markers ELF3 and EphB4 were also tested. MUC1 was unsuitable as strong amplification was detected in 100 cell PBMNC controls. Expression of ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 was found to be both specific for the tumor cell, as demonstrated by the absence of a signal in most 100 cell PBMNC controls, and sensitive enough to detect a single tumor cell in 100 PBMNCs using a single round of RT-PCR. ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 are appropriate RT-PCR markers for use in a marker panel to detect disseminated breast cancer cells after immunomagnetic enrichment
Two-temperature PCR for Microfluidics
Kodzius, Rimantas
2010-05-01
Since its invention in 1983, polymerase chain reaction (PCR) has been the method of choice for DNA amplification. Successful PCR depends on the optimization of several parameters, which is a cumbersome task due to the many variables (conditions and compon
Two-temperature PCR for Microfluidics
Kodzius, Rimantas; Chang, Donald Choy; Sheng, Ping; Wen, Weijia; Wu, Jinbo; Xiao, Kang; Yu, Vivian
2010-01-01
Since its invention in 1983, polymerase chain reaction (PCR) has been the method of choice for DNA amplification. Successful PCR depends on the optimization of several parameters, which is a cumbersome task due to the many variables (conditions and compon
Detection and Identification of Free-living Amoeba from Environmental Water in Taiwan by PCR Method
Tsai, H. F.; Hsu, B. M.; Huang, K. H.; She, C. Y.; Kao, P. M.; Shen, S. M.; Tseng, S. F.; Chen, J. S.
2012-04-01
Acanthamoeba, Naegleria, Balamuthia and Hartmannella all belong to free-living amoebae that are present ubiquitously in the environment including water, soil, and air. Free-living amoebae are parasites which can infect humans and can lead to serious illness and even death. The aim of this study is to investigate the presence of free-living amoebae in aquatic environment in Taiwan, and to compare the differences between Acanthamoeba and Naegleria in diverse cultivation methods and conditions. In this study, we used molecular method by PCR amplification with specific primers to analyze the occurrence of free-living amoebae. We collected 176 samples from environmental water including drinking water treatment plants, stream water, and hot spring recreational areas in Taiwan. Based on the results of PCR, 43 water samples (24.4%) were detected positive for free-living amoebae. The most common Acanthamoeba genotype isolated from samples including T2, T4, T5, T12, and T15. N. australiensis and N. lovaniensis were also identified by molecular biology techniques. Furthermore, we found that both Acanthamoeba and Naegleria can be cultured by PYG in 30° C, but not all free-living amoebae can be isolated and enriched by using storage-cultivation method. Because of the widespread presence of Acanthamoeba and Naegleria in aquatic environments, the water quality and safety of aquatic environments should be more conscious in Taiwan and worldwide. Keywords: free-living amoebae; Acanthamoeba; Naegleria; Balamuthia; Hartmannella; PCR
Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi
2014-01-01
A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) maize event, MIR162. We first prepared a standard plasmid for MIR162 quantification. The conversion factor (Cf) required to calculate the genetically modified organism (GMO) amount was empirically determined for two real-time PCR instruments, the Applied Biosystems 7900HT (ABI7900) and the Applied Biosystems 7500 (ABI7500) for which the determined Cf values were 0.697 and 0.635, respectively. To validate the developed method, a blind test was carried out in an interlaboratory study. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDr). The determined biases were less than 25% and the RSDr values were less than 20% at all evaluated concentrations. These results suggested that the limit of quantitation of the method was 0.5%, and that the developed method would thus be suitable for practical analyses for the detection and quantification of MIR162.
Directory of Open Access Journals (Sweden)
Adriana Peci
2016-08-01
Full Text Available Legionella is a gram-negative bacterium that can cause Pontiac fever, a mild upper respiratory infection and Legionnaire’s disease, a more severe illness. We aimed to compare the performance of urine antigen, culture and PCR test methods and to determine if sputum is an alternative to the use of more invasive bronchoalveolar lavage (BAL. Data for this study included specimens tested for Legionella at PHOL from January 1, 2010 to April 30, 2014, as part of routine clinical testing. We found sensitivity of UAT compared to culture to be 87%, specificity 94.7%, positive predictive value (PPV 63.8% and negative predictive value (NPV 98.5%. Sensitivity of UAT compared to PCR was 74.7%, specificity 98.3%, PPV 77.7% and NPV 98.1%. Of 146 patients who had a Legionella positive result by PCR, only 66(45.2% also had a positive result by culture. Sensitivity for culture was the same using either sputum or BAL (13.6%; sensitivity for PCR was 10.3% for sputum and 12.8% for BAL. Both sputum and BAL yield similar results despite testing methods (Fisher Exact p-values=1.0, for each test. In summary, all test methods have inherent weaknesses in identifying Legionella; thereforemore than one testing method should be used. Obtaining a single specimen type from patients with pneumonia limits the ability to diagnose Legionella, particularly when urine is the specimen type submitted. Given ease of collection, and similar sensitivity to BAL, clinicians are encouraged to submit sputum in addition to urine when BAL submission is not practical, from patients being tested for Legionella.
International Nuclear Information System (INIS)
Kubasik, N.P.; Lundberg, P.A.; Brodows, R.G.; Hallauer, G.D.; Same, D.G.; Lindstedt, G.; Bengtsson, C.; Nystroem, E.
1983-01-01
The first performance evaluation of a new direct method for free thyroxin (T4) in serum by radioimmunoassay, with use of coated tubes and a radioiodinated T4 analog (Diagnostic Products Corp.) is presented. The assay is precise and robust: within-run imprecision (CV), 3.1-6.6%; between-run imprecision, 4.0-7.9%; no demonstrable variation between technologists irrespective of experience with the method. No outliers were observed when we compared the free T4 results with serum total T4. Reference values are reported for a total of 1243 euthyroid subjects; there was no significant age effect on serum free T4 in women 26 to 72 years old. The biological variation was about +/- 35% of the mean (2 SD). Free T4 results are the same for serum and plasma. The assay performs well in hypothyroidism and hyperthyroidism, and distinguishes individuals with thyroid disease from normal individuals. Free T4 values in women taking oral contraceptives are normal. Depressed results were often observed in acute nonthyroidal illness and continuing pregnancy. These results were directly comparable with those of another commercial direct radiolabeled-T4 analog kit for free T4
Before new, rapid quantitative PCR (qPCR) methods for recreational water quality assessment and microbial source tracking (MST) can be useful in a regulatory context, an understanding of the ability of the method to detect a DNA target (marker) when the contaminant soure has been...
International Nuclear Information System (INIS)
Kweon, H.; Park, K. C.
2001-01-01
An analogy for evaporative heat transfer with mass transfer was derived. From von-Karman analogy which has been applied between heat and momentum transfer in single phase turbulent flow, a modified Karman analogy was suggested at present paper. Nusselt number from this analogy showed good agreement with experimental results. Such a result shows that the analogy for a complex heat transfer mode between heat transfer and momentum transfer accompanying evaporation or condensation on the interface can be established
Gupta, Vivek; Bhake, Arvind
2018-01-01
The diagnosis of tubercular lymphadenitis (TBLN) is challenging. This study assesses the role of diagnostic intervention with real-time PCR in clinically suspected tubercular lymphadenopathy in relation to cytology and microbiological methods. The cross-sectional study involved 214 patients, and PCR, cytology, and Ziehl-Neelsen (ZN) staining was performed on aspirates. The findings were compared with culture on Lowenstein-Jensen medium. The overall concordance of cytology and PCR, both individually and combined, was calculated. χ2 and Phi values were assessed between cytology, PCR, and culture. A cytological diagnosis of tuberculosis (TB), reactive lymphoid hyperplasia, and suppurative lymphadenitis was made in 71, 112, and 6 patients, respectively. PCR and culture were positive in 40% of the cases. Among the TBLN patients, PCR showed higher positivity in necrosis and culture showed higher positivity in necrotizing granuloma. Positive ZN staining was observed in 29.6% of the TBLN cases, with an overall positivity of 11%. PCR could additionally detect 82 cases missed by ZN staining. The overall concordance rate for either diagnostic modality, i.e., PCR or cytology, was highest (75%), and for PCR alone was 74%. Phi values were observed to be 0.47 between PCR and culture. Real-time PCR for Mycobacterium tuberculosis complex on aspirates offers a definitive and comparable diagnosis of TBLN. Including this approach as the primary investigation in the work-up of TBLN could reduce the burden of TB. © 2017 S. Karger AG, Basel.
Stability of the IMEX Methods, CNLF and BDF2-AB2, for Uncoupling Systems of Evolution Equations
2011-02-01
Implicit-Explicit linear multistep methods, Tech. rep., Centrum Wiskunde and Informatica (CWI) (1996). [14] W. Hundsdorfer, J. Verwer, Numerical...component splitting for the Crank-Nicolson Leap- Frog integration method, Tech. rep., Centrum Wiskunde and Informatica (CWI) (2009). [23] J. Verwer
Haghani, I; Amirinia, F; Nowroozpoor-Dailami, K; Shokohi, T
2015-06-01
Fungal keratitis is a suppurative, ulcerative, and sight-threatening infection of the cornea that sometimes leads to blindness. The aims of this study were: recuperating facilities for laboratory diagnosis, determining the causative microorganisms, and comparing conventional laboratory diagnostic tools and semi-nested PCR. Sampling was conducted in patients with suspected fungal keratitis. Two corneal scrapings specimens, one for direct smear and culture and the other for semi- nested PCR were obtained. Of the 40 expected cases of mycotic keratitis, calcofluor white staining showed positivity in 25%, culture in 17.5%, KOH in 10%, and semi-nested PCR in 27.5%. The sensitivities of semi-nested PCR, KOH, and CFW were 57.1%, 28.5%, and 42% while the specificities were 78.7%, 94%, and 78.7%, respectively. The time taken for PCR assay was 4 to 8 hours, whereas positive fungal cultures took at least 5 to 7 days. Due to the increasing incidence of fungal infections in people with weakened immune systems, uninformed using of topical corticosteroids and improper use of contact lens, fast diagnosis and accurate treatment of keratomycosis seems to be essential . Therefore, according to the current study, molecular methods can detect mycotic keratitis early and correctly leading to appropriate treatment.
Borowska, D; Rothwell, L; Bailey, R A; Watson, K; Kaiser, P
2016-02-01
Quantitative polymerase chain reaction (qPCR) is a powerful technique for quantification of gene expression, especially genes involved in immune responses. Although qPCR is a very efficient and sensitive tool, variations in the enzymatic efficiency, quality of RNA and the presence of inhibitors can lead to errors. Therefore, qPCR needs to be normalised to obtain reliable results and allow comparison. The most common approach is to use reference genes as internal controls in qPCR analyses. In this study, expression of seven genes, including β-actin (ACTB), β-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-glucuronidase (GUSB), TATA box binding protein (TBP), α-tubulin (TUBAT) and 28S ribosomal RNA (r28S), was determined in cells isolated from chicken lymphoid tissues and stimulated with three different mitogens. The stability of the genes was measured using geNorm, NormFinder and BestKeeper software. The results from both geNorm and NormFinder were that the three most stably expressed genes in this panel were TBP, GAPDH and r28S. BestKeeper did not generate clear answers because of the highly heterogeneous sample set. Based on these data we will include TBP in future qPCR normalisation. The study shows the importance of appropriate reference gene normalisation in other tissues before qPCR analysis. Copyright © 2016 Elsevier B.V. All rights reserved.
Centelleghe, Cinzia; Beffagna, Giorgia; Zanetti, Rossella; Zappulli, Valentina; Di Guardo, Giovanni; Mazzariol, Sandro
2016-09-01
Cetacean Morbillivirus (CeMV) has been identified as the most pathogenic virus for cetaceans. Over the past three decades, this RNA virus has caused several outbreaks of lethal disease in odontocetes and mysticetes worldwide. Isolation and identification of CeMV RNA is very challenging in whales because of the poor preservation status frequently shown by tissues from stranded animals. Nested reverse transcription polymerase chain reaction (nested RT-PCR) is used instead of conventional RT-PCR when it is necessary to increase the sensitivity and the specificity of the reaction. This study describes a new nested RT-PCR technique useful to amplify small amounts of the cDNA copy of Cetacean morbillivirus (CeMV) when it is present in scant quantity in whales' biological specimens. This technique was used to analyze different tissues (lung, brain, spleen and other lymphoid tissues) from one under human care seal and seven cetaceans stranded along the Italian coastline between October 2011 and September 2015. A well-characterized, 200 base pair (bp) fragment of the dolphin Morbillivirus (DMV) haemagglutinin (H) gene, obtained by nested RT-PCR, was sequenced and used to confirm DMV positivity in all the eight marine mammals under study. In conclusion, this nested RT-PCR protocol can represent a sensitive detection method to identify CeMV-positive, poorly preserved tissue samples. Furthermore, this is also a rather inexpensive molecular technique, relatively easy to apply. Copyright © 2016 Elsevier B.V. All rights reserved.
Application of the Analog Method to Modelling Heat Waves: A Case Study with Power Transformers
2017-04-21
UNCLASSIFIED Massachusetts Institute of Technology Lincoln Laboratory APPLICATION OF THE ANALOG METHOD TO MODELLING HEAT WAVES: A CASE STUDY WITH...18 2 Calibration and validation statistics with the use of five atmospheric vari- ables to construct analogue diagnostics for JJA of transformer T2...electrical grid as a series of nodes (transformers) and edges (transmission lines) so that basic mathematical anal- ysis can be performed. The mathematics
D-piece modifications of the hemiasterlin analog HTI-286 produce potent tubulin inhibitors.
Zask, Arie; Birnberg, Gary; Cheung, Katherine; Kaplan, Joshua; Niu, Chuan; Norton, Emily; Yamashita, Ayako; Beyer, Carl; Krishnamurthy, Girija; Greenberger, Lee M; Loganzo, Frank; Ayral-Kaloustian, Semiramis
2004-08-16
Modifications of the D-piece carboxylic acid group of the hemiasterlin analog HTI-286 gave tubulin inhibitors which were potent cytotoxic agents in taxol resistant cell lines expressing P-glycoprotein. Amides derived from proline had potency comparable to HTI-286. Reduction of the carboxylic acid to ketones and alcohols or its conversion to acidic heterocycles also gave potent analogs. Synthetic modifications of the carboxylic acid could be carried out selectively using a wide range of synthetic reagents. Proline analog 3 was found to be effective in a human xenograft model in athymic mice.
Non-analog Monte Carlo estimators for radiation momentum deposition
International Nuclear Information System (INIS)
Hykes, Joshua M.; Densmore, Jeffery D.
2009-01-01
The standard method for calculating radiation momentum deposition in Monte Carlo simulations is the analog estimator, which tallies the change in a particle's momentum at each interaction with the matter. Unfortunately, the analog estimator can suffer from large amounts of statistical error. In this paper, we present three new non-analog techniques for estimating momentum deposition. Specifically, we use absorption, collision, and track-length estimators to evaluate a simple integral expression for momentum deposition that does not contain terms that can cause large amounts of statistical error in the analog scheme. We compare our new non-analog estimators to the analog estimator with a set of test problems that encompass a wide range of material properties and both isotropic and anisotropic scattering. In nearly all cases, the new non-analog estimators outperform the analog estimator. The track-length estimator consistently yields the highest performance gains, improving upon the analog-estimator figure of merit by factors of up to two orders of magnitude.
Li, M; Ishiguro, Y; Kageyama, K; Zhu, Z
2015-08-01
Most of the current research into the quantification of soil-borne pathogenic oomycetes lacks determination of DNA extraction efficiency, probably leading to an incorrect estimation of DNA quantity. In this study, we developed a convenient method by using a 100 bp artificially synthesized DNA sequence derived from the mitochondrion NADH dehydrogenase subunit 2 gene of Thunnus thynnus as a control to determine the DNA extraction efficiency. The control DNA was added to soils and then co-extracted along with soil genomic DNA. DNA extraction efficiency was determined by the control DNA. Two different DNA extraction methods were compared and evaluated using different types of soils, and the commercial kit was proved to give more consistent results. We used the control DNA combined with real-time PCR to quantify the oomycete DNAs from 12 naturally infested soils. Detectable target DNA concentrations were three to five times higher after normalization. Our tests also showed that the extraction efficiencies varied on a sample-to-sample basis and were simple and useful for the accurate quantification of soil-borne pathogenic oomycetes. Oomycetes include many important plant pathogens. Accurate quantification of these pathogens is essential in the management of diseases. This study reports an easy method utilizing an external DNA control for the normalization of DNA extraction by real-time PCR. By combining two different efficient soil DNA extraction methods, the developed quantification method dramatically improved the results. This study also proves that the developed normalization method is necessary and useful for the accurate quantification of soil-borne plant pathogenic oomycetes. © 2015 The Society for Applied Microbiology.
Analog to digital workflow improvement: a quantitative study.
Wideman, Catherine; Gallet, Jacqueline
2006-01-01
This study tracked a radiology department's conversion from utilization of a Kodak Amber analog system to a Kodak DirectView DR 5100 digital system. Through the use of ProModel Optimization Suite, a workflow simulation software package, significant quantitative information was derived from workflow process data measured before and after the change to a digital system. Once the digital room was fully operational and the radiology staff comfortable with the new system, average patient examination time was reduced from 9.24 to 5.28 min, indicating that a higher patient throughput could be achieved. Compared to the analog system, chest examination time for modality specific activities was reduced by 43%. The percentage of repeat examinations experienced with the digital system also decreased to 8% vs. the level of 9.5% experienced with the analog system. The study indicated that it is possible to quantitatively study clinical workflow and productivity by using commercially available software.
Science Teachers' Analogical Reasoning
Mozzer, Nilmara Braga; Justi, Rosária
2013-08-01
Analogies can play a relevant role in students' learning. However, for the effective use of analogies, teachers should not only have a well-prepared repertoire of validated analogies, which could serve as bridges between the students' prior knowledge and the scientific knowledge they desire them to understand, but also know how to introduce analogies in their lessons. Both aspects have been discussed in the literature in the last few decades. However, almost nothing is known about how teachers draw their own analogies for instructional purposes or, in other words, about how they reason analogically when planning and conducting teaching. This is the focus of this paper. Six secondary teachers were individually interviewed; the aim was to characterize how they perform each of the analogical reasoning subprocesses, as well as to identify their views on analogies and their use in science teaching. The results were analyzed by considering elements of both theories about analogical reasoning: the structural mapping proposed by Gentner and the analogical mechanism described by Vosniadou. A comprehensive discussion of our results makes it evident that teachers' content knowledge on scientific topics and on analogies as well as their pedagogical content knowledge on the use of analogies influence all their analogical reasoning subprocesses. Our results also point to the need for improving teachers' knowledge about analogies and their ability to perform analogical reasoning.
Muino Acuna, J.M.
2011-01-01
WARNING: This library was yield low amount of material and it was over-amplified by PCR. This libraries are used study the robustness of several statitical methods against PCR artifacts. ChIP experiments were performed on Arabidopsis wildtype inflorescences using an antibody raised against a
A novel method for detection of dioxins. Exonuclease protection mediated PCR assay
Energy Technology Data Exchange (ETDEWEB)
Xu, S.Q.; Sun, X.; Li, F.; Li, B.S. [Huazhong Univ. of Science and Technology, Wuhan, HB (China). Tongji Medical College
2004-09-15
The aromatic hydrocarbon receptor (AhR) is a ligand-actived transcription factor that mediates many of the biologic and toxicologic effects of dioxin-like chemicals (DLCs), such as 2,3,7,8- tetrachlorodibenzo-p-dioxin (TCDD). Numerous AhR-based bioassays for identification and detection of DLCs have been developed in vitro. Such as the chemical-activated luciferase gene expression (CALUX), ethoxyresolufin-O-deethylase (EROD) activity are sometimes represented as the next best system when compared with whole body or in vivo systems. However, cell systems can be affected by the toxic chemical itself during the assay, thus confusing problems couldn't be avoided in the assay. Incorporation of metabolism in cell systems with uncertain consequences prolongs assay complexity and time. Thus these drawbacks limit the utility of cell systems for screening purposes. Most cell-free bioassays require radioactivity, such as the gel retardation of AhR binding (GRAB) assay, or antibody of AhR or ligand, which are unfeasible for some laboratories. Here a cell-free bioanalysis method, Exonuclease Protection Mediated PCR (EPM-PCR) bioassay, was established for detection of AhR ligands based on the binding of the dioxin:AhR complex to the specific DNA. EPM-PCR can provide indirect detection of ligands by quantification of the specific AhR-binding DNA, no necessary of any DNA labeling and sophisticated equipments. This new bioassay not only has the higher sensitivity and specificity, but it is rapid and easy to perform.
International Nuclear Information System (INIS)
Li, Wan-Ming; Hu, Ting-Ting; Zhou, Lin-Lin; Feng, Yi-Ming; Wang, Yun-Yi; Fang, Jin
2016-01-01
The PIK3CA H1047R mutation is considered to be a potential predictive biomarker for EGFR-targeted therapies. In this study, we developed a novel PCR-PFLP approach to detect the PIK3CA H1047R mutation in high effectiveness. A 126-bp fragment of PIK3CA exon-20 was amplified by PCR, digested with FspI restriction endonuclease and separated by 3 % agarose gel electrophoresis for the PCR-RFLP analysis. The mutant sequence of the PIK3CA H1047R was spiked into the corresponding wild-type sequence in decreasing ratios for sensitivity analysis. Eight-six cases of formalin-fixed paraffin-embedded colorectal cancer (CRC) specimens were subjected to PCR-RFLP to evaluate the applicability of the method. The PCR-RFLP method had a capability to detect as litter as 0.4 % of mutation, and revealed 16.3 % of the PIK3CA H1047R mutation in 86 CRC tissues, which was significantly higher than that discovered by DNA sequencing (9.3 %). A positive association between the PIK3CA H1047R mutation and the patients’ age was first found, except for the negative relationship with the degree of tumor differentiation. In addition, the highly sensitive detection of a combinatorial mutation of PIK3CA, KRAS and BRAF was achieved using individual PCR-RFLP methods. We developed a sensitive, simple and rapid approach to detect the low-abundance PIK3CA H1047R mutation in real CRC specimens, providing an effective tool for guiding cancer targeted therapy
Ohtsuka, E; Tanaka, T; Ikehara, M
1979-01-01
E. Coli tRNAfMet fragments, C-G-C-G-Gp (bases 1-5), U-G-C-G-Gp (base 1 transition, analog) pG-G-C-G-Gp (base 1 transversion analog) and pG-G-s4U-G-Gp (bases 6-10) were synthesized by triester methods using 2'-O-(o-nitrobenzyl) nucleotides including a 3',5'-bisphosphorylated guanosine derivative. The s4U containing pentanucleotide was derived from the pG-G-C-G-Gp by treatment with liquid hydrogen sulfide. Images PMID:390499
Energy Technology Data Exchange (ETDEWEB)
Gray, R. O.; Briley, M. M.; Lambert, R. A.; Fuller, V. A.; Newsome, I. M.; Seeds, M. F. [Department of Physics and Astronomy, Appalachian State University, Boone, NC 26808 (United States); Saken, J. M.; Kahvaz, Y. [Department of Physics and Physical Science, Marshall University, Huntington, WV 25755 (United States); Corbally, C. J. [Vatican Observatory Research Group, Steward Observatory, Tucson, AZ 85721-0065 (United States)
2015-12-15
This is the first in a series of papers presenting methods and results from the Young Solar Analogs Project, which began in 2007. This project monitors both spectroscopically and photometrically a set of 31 young (300–1500 Myr) solar-type stars with the goal of gaining insight into the space environment of the Earth during the period when life first appeared. From our spectroscopic observations we derive the Mount Wilson S chromospheric activity index (S{sub MW}), and describe the method we use to transform our instrumental indices to S{sub MW} without the need for a color term. We introduce three photospheric indices based on strong absorption features in the blue-violet spectrum—the G-band, the Ca i resonance line, and the Hydrogen-γ line—with the expectation that these indices might prove to be useful in detecting variations in the surface temperatures of active solar-type stars. We also describe our photometric program, and in particular our “Superstar technique” for differential photometry which, instead of relying on a handful of comparison stars, uses the photon flux in the entire star field in the CCD image to derive the program star magnitude. This enables photometric errors on the order of 0.005–0.007 magnitude. We present time series plots of our spectroscopic data for all four indices, and carry out extensive statistical tests on those time series demonstrating the reality of variations on timescales of years in all four indices. We also statistically test for and discover correlations and anti-correlations between the four indices. We discuss the physical basis of those correlations. As it turns out, the “photospheric” indices appear to be most strongly affected by emission in the Paschen continuum. We thus anticipate that these indices may prove to be useful proxies for monitoring emission in the ultraviolet Balmer continuum. Future papers in this series will discuss variability of the program stars on medium (days–months) and short
Analysis of ELA-DQB exon 2 polymorphism in Argentine Creole horses by PCR-RFLP and PCR-SSCP.
Villegas-Castagnasso, E E; Díaz, S; Giovambattista, G; Dulout, F N; Peral-García, P
2003-08-01
The second exon of equine leucocyte antigen (ELA)-DQB genes was amplified from genomic DNA of 32 Argentine Creole horses by PCR. Amplified DNA was analysed by PCR-restriction fragment length polymorphism (RFLP) and PCR-single-strand conformation polymorphism (SSCP). The PCR-RFLP analysis revealed two HaeIII patterns, four RsaI patterns, five MspI patterns and two HinfI patterns. EcoRI showed no variation in the analysed sample. Additional patterns that did not account for known exon 2 DNA sequences were observed, suggesting the existence of novel ELA-DQB alleles. PCR-SSCP analysis exhibited seven different band patterns, and the number of bands per animal ranged from four to nine. Both methods indicated that at least two DQB genes are present. The presence of more than two alleles in each animal showed that the primers employed in this work are not specific for a unique DQB locus. The improvement of this PCR-RFLP method should provide a simple and rapid technique for an accurate definition of ELA-DQB typing in horses.
Sarpeshkar, R
2014-03-28
We analyse the pros and cons of analog versus digital computation in living cells. Our analysis is based on fundamental laws of noise in gene and protein expression, which set limits on the energy, time, space, molecular count and part-count resources needed to compute at a given level of precision. We conclude that analog computation is significantly more efficient in its use of resources than deterministic digital computation even at relatively high levels of precision in the cell. Based on this analysis, we conclude that synthetic biology must use analog, collective analog, probabilistic and hybrid analog-digital computational approaches; otherwise, even relatively simple synthetic computations in cells such as addition will exceed energy and molecular-count budgets. We present schematics for efficiently representing analog DNA-protein computation in cells. Analog electronic flow in subthreshold transistors and analog molecular flux in chemical reactions obey Boltzmann exponential laws of thermodynamics and are described by astoundingly similar logarithmic electrochemical potentials. Therefore, cytomorphic circuits can help to map circuit designs between electronic and biochemical domains. We review recent work that uses positive-feedback linearization circuits to architect wide-dynamic-range logarithmic analog computation in Escherichia coli using three transcription factors, nearly two orders of magnitude more efficient in parts than prior digital implementations.
Balachandran, Priya; Friberg, Maria; Vanlandingham, V; Kozak, K; Manolis, Amanda; Brevnov, Maxim; Crowley, Erin; Bird, Patrick; Goins, David; Furtado, Manohar R; Petrauskene, Olga V; Tebbs, Robert S; Charbonneau, Duane
2012-02-01
Reducing the risk of Salmonella contamination in pet food is critical for both companion animals and humans, and its importance is reflected by the substantial increase in the demand for pathogen testing. Accurate and rapid detection of foodborne pathogens improves food safety, protects the public health, and benefits food producers by assuring product quality while facilitating product release in a timely manner. Traditional culture-based methods for Salmonella screening are laborious and can take 5 to 7 days to obtain definitive results. In this study, we developed two methods for the detection of low levels of Salmonella in pet food using real-time PCR: (i) detection of Salmonella in 25 g of dried pet food in less than 14 h with an automated magnetic bead-based nucleic acid extraction method and (ii) detection of Salmonella in 375 g of composite dry pet food matrix in less than 24 h with a manual centrifugation-based nucleic acid preparation method. Both methods included a preclarification step using a novel protocol that removes food matrix-associated debris and PCR inhibitors and improves the sensitivity of detection. Validation studies revealed no significant differences between the two real-time PCR methods and the standard U.S. Food and Drug Administration Bacteriological Analytical Manual (chapter 5) culture confirmation method.
Stachelska, Milena Alicja
2017-01-01
Yersiniosis is believed to be the third most common intestinal zoonosis in the European Union, after campylobacteriosis and salmonellosis. Yersinia enterocolitica is the most common species responsible for human infections. Pigs are regarded as the biggest reservoir of pathogenic Y. enterocolitica strains, which are mainly isolated from pig tonsils. The aim of this paper is to examine the prevalence of inv-positive and ail-positive Y. enterocolitica in pigs which were slaughtered in a Polish abattoir. Real-time PCR and culture methods were used to assess the prevalence of patho- genic Y. enterocolitica strains in pig tonsils. Real-time PCR was applied to detect inv-positive and ail-positive Y. enterocolitica. Y. enterocolitica was also isolated by applying direct plating, unselective (tryptic soy broth) and selective (irgasan-ticarcillin-potassium chlorate bouillon) enrichment. A total of 180 pigs were studied, of which 85% and 32% respectively were found to be infected with inv-positive and ail-positive Y. enterocolitica. The 92 inv-positive and ail-positive isolates, from 57 culture- positive tonsils, underwent bio- and serotyping. The most common was bioserotype 4/O:3, which was found in 53 (93%) out of 57 culture-positive tonsils. Strains of bioserotypes 2/O:5, 2/O:9 and 2/O:5.27 occurred in significantly lower numbers. The prevalence of inv-positive and ail-positive Y. enterocolitica was found to be high in the ton- sils of slaughtered pigs, using real-time PCR. The real-time PCR method for the detection and identification of pathogenic Y. enterocolitica is sensitive and specific, which has been verified by specificity and sensitivity tests using the pure cultures. Serotypes were distinguished from each other using PCR serotyping. The PCR method was essential in forming our conclusions.
Directory of Open Access Journals (Sweden)
López-Revilla Rubén
2010-05-01
Full Text Available Abstract Background We have developed an ultrasensitive method based on conventional PCR preamplification followed by nested amplification through real time PCR (qPCR in the presence of the DNA intercalating agent EvaGreen. Results Amplification mixtures calibrated with a known number of pHV101 copies carrying a 645 base pair (bp-long insert of the human papillomavirus type 16 (HPV16 E6 oncogene were used to generate the E6-1 amplicon of 645 bp by conventional PCR and then the E6-2 amplicon of 237 bp by nested qPCR. Direct and nested qPCR mixtures for E6-2 amplification corresponding to 2.5 × 102-2.5 × 106 initial pHV101 copies had threshold cycle (Ct values in the ranges of 18.7-29.0 and 10.0-25.0, respectively. The Ct of qPCR mixtures prepared with 1/50 volumes of preamplified mixtures containing 50 ng of DNA of the SiHa cell line (derived from an invasive cervical cancer with one HPV16 genome per cell was 19.9. Thermal fluorescence extinction profiles of E6-2 amplicons generated from pHV101 and SiHa DNA were identical, with a peak at 85.5°C. Conclusions Our method based on conventional preamplification for 15 cycles increased 10,750 times the sensitivity of nested qPCR for the quantitation of the E6 viral oncogene and confirmed that the SiHa cell line contains one E6-HPV16 copy per cell.
Wilkes, Rebecca P; Lee, Pei-Yu A; Tsai, Yun-Long; Tsai, Chuan-Fu; Chang, Hsiu-Hui; Chang, Hsiao-Fen G; Wang, Hwa-Tang T
2015-08-01
Canine parvovirus type 2 (CPV-2), including subtypes 2a, 2b and 2c, causes an acute enteric disease in both domestic and wild animals. Rapid and sensitive diagnosis aids effective disease management at points of need (PON). A commercially available, field-deployable and user-friendly system, designed with insulated isothermal PCR (iiPCR) technology, displays excellent sensitivity and specificity for nucleic acid detection. An iiPCR method was developed for on-site detection of all circulating CPV-2 strains. Limit of detection was determined using plasmid DNA. CPV-2a, 2b and 2c strains, a feline panleukopenia virus (FPV) strain, and nine canine pathogens were tested to evaluate assay specificity. Reaction sensitivity and performance were compared with an in-house real-time PCR using serial dilutions of a CPV-2b strain and 100 canine fecal clinical samples collected from 2010 to 2014, respectively. The 95% limit of detection of the iiPCR method was 13 copies of standard DNA and detection limits for CPV-2b DNA were equivalent for iiPCR and real-time PCR. The iiPCR reaction detected CPV-2a, 2b and 2c and FPV. Non-targeted pathogens were not detected. Test results of real-time PCR and iiPCR from 99 fecal samples agreed with each other, while one real-time PCR-positive sample tested negative by iiPCR. Therefore, excellent agreement (k = 0.98) with sensitivity of 98.41% and specificity of 100% in detecting CPV-2 in feces was found between the two methods. In conclusion, the iiPCR system has potential to serve as a useful tool for rapid and accurate PON, molecular detection of CPV-2. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Inhibitory effect of common microfluidic materials on PCR outcome
Kodzius, Rimantas; Xiao, Kang; Wu, Jinbo; Yi, Xin; Gong, Xiuqing; Foulds, Ian G.; Wen, Weijia
2013-01-01
In this study, we established a simple method for evaluating the PCR compatibility of various common materials employed when fabricating microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most cases, adding bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, although they noticeably interacted with the polymerase. We provide a simple method of performing PCR-compatibility testing of materials using inexpensive instrumentation that is common in molecular biology laboratories. Furthermore, our method is direct, being performed under actual PCR conditions with high temperature. Our results provide an overview of materials that are PCR-friendly for fabricating microfluidic devices. The PCR reaction, without any additives, performed best with pyrex glass, and it performed worst with PMMA or acrylic glue materials.
Inhibitory effect of common microfluidic materials on PCR outcome
Kodzius, Rimantas
2013-10-10
In this study, we established a simple method for evaluating the PCR compatibility of various common materials employed when fabricating microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most cases, adding bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, although they noticeably interacted with the polymerase. We provide a simple method of performing PCR-compatibility testing of materials using inexpensive instrumentation that is common in molecular biology laboratories. Furthermore, our method is direct, being performed under actual PCR conditions with high temperature. Our results provide an overview of materials that are PCR-friendly for fabricating microfluidic devices. The PCR reaction, without any additives, performed best with pyrex glass, and it performed worst with PMMA or acrylic glue materials.
Generalized Tensor Analysis Model for Multi-Subcarrier Analog Optical Systems
DEFF Research Database (Denmark)
Zhao, Ying; Yu, Xianbin; Zheng, Xiaoping
2011-01-01
We propose and develop a general tensor analysis framework for a subcarrier multiplex analog optical fiber link for applications in microwave photonics. The goal of this work is to construct an uniform method to address nonlinear distortions of a discrete frequency transmission system. We employ....... In addition, it is demonstrated that each corresponding tensor is formally determined by device structures, which allows for a synthesized study of device combinations more systematically. For implementing numerical methods, the practical significance of the tensor model is it simplifies the derivation...... details compared with series-based approaches by hiding the underlying multi-fold summation and index operation. The integrity of the proposed methodology is validated by investigating the classical intensity modulated system. Furthermore, to give an application model of the tensor formalism, we make...
Mehle, Nataša; Dobnik, David; Ravnikar, Maja; Pompe Novak, Maruša
2018-05-03
RNA viruses have a great potential for high genetic variability and rapid evolution that is generated by mutation and recombination under selection pressure. This is also the case of Potato virus Y (PVY), which comprises a high diversity of different recombinant and non-recombinant strains. Consequently, it is hard to develop reverse transcription real-time quantitative PCR (RT-qPCR) with the same amplification efficiencies for all PVY strains which would enable their equilibrate quantification; this is specially needed in mixed infections and other studies of pathogenesis. To achieve this, we initially transferred the PVY universal RT-qPCR assay to a reverse transcription droplet digital PCR (RT-ddPCR) format. RT-ddPCR is an absolute quantification method, where a calibration curve is not needed, and it is less prone to inhibitors. The RT-ddPCR developed and validated in this study achieved a dynamic range of quantification over five orders of magnitude, and in terms of its sensitivity, it was comparable to, or even better than, RT-qPCR. RT-ddPCR showed lower measurement variability. We have shown that RT-ddPCR can be used as a reference tool for the evaluation of different RT-qPCR assays. In addition, it can be used for quantification of RNA based on in-house reference materials that can then be used as calibrators in diagnostic laboratories.
Arvia, Rosaria; Sollai, Mauro; Pierucci, Federica; Urso, Carmelo; Massi, Daniela; Zakrzewska, Krystyna
2017-08-01
Merkel cell polyomavirus (MCPyV) is associated with Merkel cell carcinoma and high viral load in the skin was proposed as a risk factor for the occurrence of this tumour. MCPyV DNA was detected, with lower frequency, in different skin cancers but since the viral load was usually low, the real prevalence of viral DNA could be underestimated. To evaluate the performance of two assays (qPCR and ddPCR) for MCPyV detection and quantification in formalin fixed paraffin embedded (FFPE) tissue samples. Both assays were designed to simultaneous detection and quantification of both MCPyV as well as house-keeping DNA in clinical samples. The performance of MCPyV quantification was investigated using serial dilutions of cloned target DNA. We also evaluated the applicability of both tests for the analysis of 76 FFPE cutaneous biopsies. The two approaches resulted equivalent with regard to the reproducibility and repeatability and showed a high degree of linearity in the dynamic range tested in the present study. Moreover, qPCR was able to quantify ≥10 5 copies per reaction, while the upper limit of ddPCR was 10 4 copies. There was not significant difference between viral load measured by the two methods The detection limit of both tests was 0,15 copies per reaction, however, the number of positive samples obtained by ddPCR was higher than that obtained by qPCR (45% and 37% respectively). The ddPCR represents a better method for detection of MCPyV in FFPE biopsies, mostly these containing low copies number of viral genome. Copyright © 2017 Elsevier B.V. All rights reserved.
Ferreira H.L.; Spilki F.R.; dos Santos M.M.A.B.; de Almeida R.S.; Arns C.W.
2009-01-01
Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...
Nuevo, Michel; Cooper, George; Saunders, John; Buffo, Christina E.; Materese, Christopher K.; Sandford, Scott A.
2018-01-01
Carbonaceous meteorites such as Murchison contain a large variety of organic compounds of astrobiological interest such as amino acids, other amphiphilic compounds, functionalized nitrogen heterocycles (including nucleobases), functionalized polycylic aromatic hydro-carbons (including quinones), and sugar derivatives. The presence of such a broad variety of organics in meteorites strongly suggests that molecules essential to life can form abiotically under astrophysical conditions. This hypothesis is strongly supported by laboratory studies in which astrophysical ice analogs (i.e., mixtures of H2O, CO, CO2, CH3OH, CH4, NH3, etc.) are subjected to ultraviolet (UV) irradiation at low temperature (less than 15 K) to simulate cold interstellar environments. These studies have shown that the organic residues recovered at room temperature after irradiation contain organic compounds that are very similar to those found in meteorites. No systematic search for the presence of sugar derivatives in laboratory residues had been carried out until the recent detection of ribose, the sugar of RNA, as well as other sugars, sugar alcohols, and sugar acids in one residue produced from the UV irradiation of an ice mixture containing H2O, CH3OH, and NH3 at 80 K. In this work, we present a detailed study of the formation of sugar derivatives contained in organic residues that are produced from the UV irradiation of ice mixtures of different starting compositions (H2O, CH3OH, CO, CO2, and/or NH3) at less than 15 K. While the presence of sugar alcohols, sugars, and sugar acids-in some cases with up to 6 carbon atoms-could be confirmed in all these residues, their distribution was shown to vary with the composition of the starting ices. In particular, only a few ices result in the formation of sugar derivatives displaying a distribution that resembles that of meteorites, in which sugar alcohols and sugar acids are very abundant while sugars are mostly absent.
Slawiak, M.; Beckhoven, van J.R.C.M.; Speksnijder, A.G.C.L.; Czajkowski, R.L.; Grabe, G.; Wolf, van der J.M.
2009-01-01
Sixty-five potato strains of the soft rot-causing plant pathogenic bacterium Dickeya spp., and two strains from hyacinth, were characterised using biochemical assays, REP-PCR genomic finger printing, 16S rDNA and dnaX sequence analysis. These methods were compared with nineteen strains representing
Gattuso, Antonietta; Gianfranceschi, Monica Virginia; Sonnessa, Michele; Delibato, Elisabetta; Marchesan, Massimo; Hernandez, Marta; De Medici, Dario; Rodriguez-Lazaro, David
2014-08-01
The aim of this study was to optimize a Real-Time PCR protocol for a rapid detection of Listeria monocytogenes in pork meat, using reduced volumes of primary selective enrichment broth and times of incubation to decrease the cost and time for analysis. Forty-five samples of pork meat were artificially contaminated with two different levels of L. monocytogenes (1-10 CFU per sample and 10-100 CFU per sample), homogenized in three different volumes of Half Fraser Broth (1:3; 1:5 and 1:10) and incubated at 30°C ± 1°C for 5h, 8h and 24h. The detection was conducted in parallel by Real-Time PCR and the ISO standard 11290-1 methods. L. monocytogenes was detected in all the samples after 24h by Real-Time PCR method, also using reduced volumes of Half Fraser Broth. This represents a clear advantage as the time to final detection and the inherent costs were significantly reduced compared to the ISO reference method. All samples artificially contaminated were correctly detected also after 8 of incubation at 30°C ± 1°C in Half Fraser Broth and 24h in Fraser Broth at 37°C ± 1°C using cultural method. Copyright © 2014 Elsevier B.V. All rights reserved.
Peci, Adriana; Winter, Anne-Luise; Gubbay, Jonathan B.
2016-01-01
Legionella is a Gram-negative bacterium that can cause Pontiac fever, a mild upper respiratory infection and Legionnaire’s disease, a more severe illness. We aimed to compare the performance of urine antigen, culture, and polymerase chain reaction (PCR) test methods and to determine if sputum is an acceptable alternative to the use of more invasive bronchoalveolar lavage (BAL). Data for this study included specimens tested for Legionella at Public Health Ontario Laboratories from 1st January, 2010 to 30th April, 2014, as part of routine clinical testing. We found sensitivity of urinary antigen test (UAT) compared to culture to be 87%, specificity 94.7%, positive predictive value (PPV) 63.8%, and negative predictive value (NPV) 98.5%. Sensitivity of UAT compared to PCR was 74.7%, specificity 98.3%, PPV 77.7%, and NPV 98.1%. Out of 146 patients who had a Legionella-positive result by PCR, only 66 (45.2%) also had a positive result by culture. Sensitivity for culture was the same using either sputum or BAL (13.6%); sensitivity for PCR was 10.3% for sputum and 12.8% for BAL. Both sputum and BAL yield similar results regardless testing methods (Fisher Exact p-values = 1.0, for each test). In summary, all test methods have inherent weaknesses in identifying Legionella; therefore, more than one testing method should be used. Obtaining a single specimen type from patients with pneumonia limits the ability to diagnose Legionella, particularly when urine is the specimen type submitted. Given ease of collection and similar sensitivity to BAL, clinicians are encouraged to submit sputum in addition to urine when BAL submission is not practical from patients being tested for Legionella. PMID:27630979
A combined HM-PCR/SNuPE method for high sensitive detection of rare DNA methylation
Directory of Open Access Journals (Sweden)
Tierling Sascha
2010-06-01
Full Text Available Abstract Background DNA methylation changes are widely used as early molecular markers in cancer detection. Sensitive detection and classification of rare methylation changes in DNA extracted from circulating body fluids or complex tissue samples is crucial for the understanding of tumor etiology, clinical diagnosis and treatment. In this paper, we describe a combined method to monitor the presence of methylated tumor DNA in an excess of unmethylated background DNA of non-tumorous cells. The method combines heavy methyl-PCR, which favors preferential amplification of methylated marker sequence from bisulfite-treated DNA with a methylation-specific single nucleotide primer extension monitored by ion-pair, reversed-phase, high-performance liquid chromatography separation. Results This combined method allows detection of 14 pg (that is, four to five genomic copies of methylated chromosomal DNA in a 2000-fold excess (that is, 50 ng of unmethylated chromosomal background, with an analytical sensitivity of > 90%. We outline a detailed protocol for the combined assay on two examples of known cancer markers (SEPT9 and TMEFF2 and discuss general aspects of assay design and data interpretation. Finally, we provide an application example for rapid testing on tumor methylation in plasma DNA derived from a small cohort of patients with colorectal cancer. Conclusion The method allows unambiguous detection of rare DNA methylation, for example in body fluid or DNA isolates from cells or tissues, with very high sensitivity and accuracy. The application combines standard technologies and can easily be adapted to any target region of interest. It does not require costly reagents and can be used for routine screening of many samples.
Comparison of PCR-RFLP pattern with sequencing analysis of the ITS region of Hyrcanain\\'s Tilia
Directory of Open Access Journals (Sweden)
Hamed Yousefzadeh
2014-01-01
T. hyrcana and T. rubra from Hyrcanian's origin, but it could not separate T. begonifloia from the other hyrcanian species. In this respect, derived results were similar to sequencing one. In conclusion, with regard to less expensive and less time consuming PCR-RFLP technique and high similarity between its result with sequencing, we recommend this method as a simple and economical method with relatively high efficiency studding plant phylogeny.
Directory of Open Access Journals (Sweden)
Perkins James R
2012-07-01
Full Text Available Abstract Background Measuring gene transcription using real-time reverse transcription polymerase chain reaction (RT-qPCR technology is a mainstay of molecular biology. Technologies now exist to measure the abundance of many transcripts in parallel. The selection of the optimal reference gene for the normalisation of this data is a recurring problem, and several algorithms have been developed in order to solve it. So far nothing in R exists to unite these methods, together with other functions to read in and normalise the data using the chosen reference gene(s. Results We have developed two R/Bioconductor packages, ReadqPCR and NormqPCR, intended for a user with some experience with high-throughput data analysis using R, who wishes to use R to analyse RT-qPCR data. We illustrate their potential use in a workflow analysing a generic RT-qPCR experiment, and apply this to a real dataset. Packages are available from http://www.bioconductor.org/packages/release/bioc/html/ReadqPCR.htmland http://www.bioconductor.org/packages/release/bioc/html/NormqPCR.html Conclusions These packages increase the repetoire of RT-qPCR analysis tools available to the R user and allow them to (amongst other things read their data into R, hold it in an ExpressionSet compatible R object, choose appropriate reference genes, normalise the data and look for differential expression between samples.
Green, Adam E; Kraemer, David J M; Fugelsang, Jonathan A; Gray, Jeremy R; Dunbar, Kevin N
2010-01-01
Solving problems often requires seeing new connections between concepts or events that seemed unrelated at first. Innovative solutions of this kind depend on analogical reasoning, a relational reasoning process that involves mapping similarities between concepts. Brain-based evidence has implicated the frontal pole of the brain as important for analogical mapping. Separately, cognitive research has identified semantic distance as a key characteristic of the kind of analogical mapping that can support innovation (i.e., identifying similarities across greater semantic distance reveals connections that support more innovative solutions and models). However, the neural substrates of semantically distant analogical mapping are not well understood. Here, we used functional magnetic resonance imaging (fMRI) to measure brain activity during an analogical reasoning task, in which we parametrically varied the semantic distance between the items in the analogies. Semantic distance was derived quantitatively from latent semantic analysis. Across 23 participants, activity in an a priori region of interest (ROI) in left frontopolar cortex covaried parametrically with increasing semantic distance, even after removing effects of task difficulty. This ROI was centered on a functional peak that we previously associated with analogical mapping. To our knowledge, these data represent a first empirical characterization of how the brain mediates semantically distant analogical mapping.
Murphy, Helen R; Lee, Seulgi; da Silva, Alexandre J
2017-07-01
Cyclospora cayetanensis is a protozoan parasite that causes human diarrheal disease associated with the consumption of fresh produce or water contaminated with C. cayetanensis oocysts. In the United States, foodborne outbreaks of cyclosporiasis have been linked to various types of imported fresh produce, including cilantro and raspberries. An improved method was developed for identification of C. cayetanensis in produce at the U.S. Food and Drug Administration. The method relies on a 0.1% Alconox produce wash solution for efficient recovery of oocysts, a commercial kit for DNA template preparation, and an optimized TaqMan real-time PCR assay with an internal amplification control for molecular detection of the parasite. A single laboratory validation study was performed to assess the method's performance and compare the optimized TaqMan real-time PCR assay and a reference nested PCR assay by examining 128 samples. The samples consisted of 25 g of cilantro or 50 g of raspberries seeded with 0, 5, 10, or 200 C. cayetanensis oocysts. Detection rates for cilantro seeded with 5 and 10 oocysts were 50.0 and 87.5%, respectively, with the real-time PCR assay and 43.7 and 94.8%, respectively, with the nested PCR assay. Detection rates for raspberries seeded with 5 and 10 oocysts were 25.0 and 75.0%, respectively, with the real-time PCR assay and 18.8 and 68.8%, respectively, with the nested PCR assay. All unseeded samples were negative, and all samples seeded with 200 oocysts were positive. Detection rates using the two PCR methods were statistically similar, but the real-time PCR assay is less laborious and less prone to amplicon contamination and allows monitoring of amplification and analysis of results, making it more attractive to diagnostic testing laboratories. The improved sample preparation steps and the TaqMan real-time PCR assay provide a robust, streamlined, and rapid analytical procedure for surveillance, outbreak response, and regulatory testing of foods for
France, Lydéric; Nicollet, Christian
2010-06-01
MetaRep is a program based on our earlier program CMAS 3D. It is developed in MATLAB ® script. MetaRep objectives are to visualize and project major element compositions of mafic and pelitic rocks and their minerals in the pseudo-quaternary projections of the ACF-S, ACF-N, CMAS, AFM-K, AFM-S and AKF-S systems. These six systems are commonly used to describe metamorphic mineral assemblages and magmatic evolutions. Each system, made of four apices, can be represented in a tetrahedron that can be visualized in three dimensions with MetaRep; the four tetrahedron apices represent oxides or combination of oxides that define the composition of the projected rock or mineral. The three-dimensional representation allows one to obtain a better understanding of the topology of the relationships between the rocks and minerals and relations. From these systems, MetaRep can also project data in ternary plots (for example, the ACF, AFM and AKF ternary projections can be generated). A functional interface makes it easy to use and does not require any knowledge of MATLAB ® programming. To facilitate the use, MetaRep loads, from the main interface, data compiled in a Microsoft Excel ™ spreadsheet. Although useful for scientific research, the program is also a powerful tool for teaching. We propose an application example that, by using two combined systems (ACF-S and ACF-N), provides strong confirmation in the petrological interpretation.
Ding, Hui; Ding, Wanjing; Ma, Zhongjun
2017-03-22
Two prenylated indole alkaloids were isolated from the ethyl acetate extracts of a marine-derived fungus Penicillium sp. NH-SL and one of them exhibited potent cytotoxic activity against mouse hepa 1c1c7 cells. In order to detect other bioactive analogs, we used liquid chromatogram tandem mass spectrometry (LC-MS/MS) to analyze the mass spectrometric characteristics of the isolated compounds as well as the crude extracts. As a result, three other analogs were detected, and their structures were deduced according to the similar fragmentation patterns. This is the first systematic report on the mass spectrometric characteristics of prenylated indole derivatives.
Evaluation of PCR and multiplex PCR in relation to nested PCR for diagnosing Theileria equi
Directory of Open Access Journals (Sweden)
Danielle C. Leal
2011-07-01
Full Text Available Conventional PCR (PCRTeq for diagnosing Theileria equi and multiplex PCR (M/PCRTeq-Bc for diagnosing T. equi and Babesia caballi were comparatively evaluated with nested PCR (N/PCR-Teq for diagnosing equine piroplasmosis. In DNA sensitivity determinations, in multiple dilutions of equine blood that had tested positive for T. equi, PCR-Teq and N/PCR-Teq detected hemoparasite DNA in the larger dilutions (1:128, but did not differ significantly from the M/PCRTeq-Bc (1:64. In analyses on equine serum tested by ELISA, there was high agreement between this serological test and PCR-Teq (k = 0.780 and moderate agreement with N/PCR-Teq (k = 0.562 and M/PCRTeq-Bc (k = 0.488. PCR-Teq found a higher frequency of T. equi both in extensively and intensively reared horses, but this was not significant in relation to N/PCR-Teq (P>0.05, and both PCRs indicated that there was an endemic situation regarding T. equi in the population of horses of this sample. PCR-Teq was only significantly different from M/PCR-Teq-Bc (P<0.05. PCR-Teq presented high sensitivity and specificity, comparable to N/PCR-Teq, but with the advantage of higher speed in obtaining results and lower costs and risks of laboratory contamination. This accredits PCR-Teq for epidemiological studies and for determinations on affected horses.
Directory of Open Access Journals (Sweden)
Siwon Lee
2013-09-01
Full Text Available For quarantine purpose, we developed the RT- and nested PCR module of Tomato black ring virus (TBRV, Arabis mosaic virus (ArMV, Cherry leafroll virus (CLRV and Grapevine fanleaf virus (GFLV. The PCR modules, developed in this study make diagnosis more convenient and speedy because of same PCR condition. And also, the methods are more accurate because it can check whether the result is contamination or not using the mutation-positive control. We discard or return the 27 cases of Nepovirus infection seed by employing the module past 3 years. This study provides a rapid and useful method for detection of four quarantine plant viruses.
Viability qPCR, a new tool for Legionella risk management.
Lizana, X; López, A; Benito, S; Agustí, G; Ríos, M; Piqué, N; Marqués, A M; Codony, F
2017-11-01
Viability quantitative Polymerase Chain Reaction (v-qPCR) is a recent analytical approach for only detecting live microorganisms by DNA amplification-based methods This approach is based on the use of a reagent that irreversibly fixes dead cells DNA. In this study, we evaluate the utility of v-qPCR versus culture method for Legionellosis risk management. The present study was performed using 116 real samples. Water samples were simultaneously analysed by culture, v-qPCR and qPCR methods. Results were compared by means of a non-parametric test. In 11.6% of samples using both methods (culture method and v-qPCR) results were positive, in 50.0% of samples both methods gave rise to negative results. As expected, equivalence between methods was not observed in all cases, as in 32.1% of samples positive results were obtained by v-qPCR and all of them gave rise to negative results by culture. Only in 6.3% of samples, with very low Legionella levels, was culture positive and v-qPCR negative. In 3.5% of samples, overgrowth of other bacteria did not allow performing the culture. When comparing both methods, significant differences between culture and v-qPCR were in the samples belonging to the cooling towers-evaporative condensers group. The v-qPCR method detected greater presence and obtained higher concentrations of Legionella spp. (p<0.001). Otherwise, no significant differences between methods were found in the rest of the groups. The v-qPCR method can be used as a quick tool to evaluate Legionellosis risk, especially in cooling towers-evaporative condensers, where this technique can detect higher levels than culture. The combined interpretation of PCR results along with the ratio of live cells is proposed as a tool for understanding the sample context and estimating the Legionellosis risk potential according to 4 levels of hierarchy. Copyright © 2017 Elsevier GmbH. All rights reserved.
The genotypic diversity and lipase production of some thermophilic bacilli from different genera
Koc, Melih; Cokmus, Cumhur; Cihan, Arzu Coleri
2015-01-01
Abstract Thermophilic 32 isolates and 20 reference bacilli were subjected to Rep-PCR and ITS-PCR fingerprinting for determination of their genotypic diversity, before screening lipase activities. By these methods, all the isolates and references could easily be differentiated up to subspecies level from each other. In screening assay, 11 isolates and 7 references were found to be lipase producing. Their extracellular lipase activities were measured quantitatively by incubating in both tributy...
Aristy-Escuder, Jaime
2010-01-01
La pobreza del pueblo haitiano influye de forma determinante sobre los flujos migratorios hacia la República Dominicana. Este artículo se propone estimar el impacto de la inmigración haitiana sobre el mercado laboral dominicano, así como sobre sus finanzas públicas. Luego de un exhaustivo análisis teórico y aplicado, el artículo concluye que la mano de obra haitiana es complementaria al capital y a la mano de obra calificada de la República Dominicana. En cambio, es sustituta d...
Presently there is no established cell line or small animal model that allows for the detection of infectious human norovirus. Current methods based on RT-PCR and RT-qPCR detect both infectious and non-infectious virus and thus the conclusions that may be drawn regarding the publ...
Li, Dan; Tong, Tiezheng; Zeng, Siyu; Lin, Yiwen; Wu, Shuxu; He, Miao
2014-02-01
The detection of viable bacteria in wastewater treatment plants (WWTPs) is very important for public health, as WWTPs are a medium with a high potential for waterborne disease transmission. The aim of this study was to use propidium monoazide (PMA) combined with the quantitative polymerase chain reaction (PMA-qPCR) to selectively detect and quantify viable bacteria cells in full-scale WWTPs in China. PMA was added to the concentrated WWTP samples at a final concentration of 100 micromol/L and the samples were incubated in the dark for 5 min, and then lighted for 4 min prior to DNA extraction and qPCR with specific primers for Escherichia coli and Enterococci, respectively. The results showed that PMA treatment removed more than 99% of DNA from non-viable cells in all the WWTP samples, while matrices in sludge samples markedly reduced the effectiveness of PMA treatment. Compared to qPCR, PMA-qPCR results were similar and highly linearly correlated to those obtained by culture assay, indicating that DNA from non-viable cells present in WWTP samples can be eliminated by PMA treatment, and that PMA-qPCR is a reliable method for detection of viable bacteria in environmental samples. This study demonstrated that PMA-qPCR is a rapid and selective detection method for viable bacteria in WWTP samples, and that WWTPs have an obvious function in removing both viable and non-viable bacteria. The results proved that PMA-qPCR is a promising detection method that has a high potential for application as a complementary method to the standard culture-based method in the future.
Real-Time PCR for Universal Phytoplasma Detection and Quantification
DEFF Research Database (Denmark)
Christensen, Nynne Meyn; Nyskjold, Henriette; Nicolaisen, Mogens
2013-01-01
Currently, the most efficient detection and precise quantification of phytoplasmas is by real-time PCR. Compared to nested PCR, this method is less sensitive to contamination and is less work intensive. Therefore, a universal real-time PCR method will be valuable in screening programs and in other...
Elges, Sandra; Arnold, Renate; Liesenfeld, Oliver; Kofla, Grzegorz; Mikolajewska, Agata; Schwartz, Stefan; Uharek, Lutz; Ruhnke, Markus
2017-12-01
We prospectively evaluated a multiplex real-time PCR assay (SeptiFast, SF) in a cohort of patients undergoing allo-BMT in comparison to an in-house PCR method (IH-PCR). Overall 847 blood samples (mean 8 samples/patient) from 104 patients with haematological malignancies were analysed. The majority of patients had acute leukaemia (62%) with a mean age of 52 years (54% female). Pathogens could be detected in 91 of 847 (11%) samples by SF compared to 38 of 205 (18.5%) samples by BC, and 57 of 847 (6.7%) samples by IH-PCR. Coagulase-negative staphylococci (n=41 in SF, n=29 in BC) were the most frequently detected bacteria followed by Escherichia coli (n=9 in SF, n=6 in BC). Candida albicans (n=17 in SF, n=0 in BC, n=24 in IH-PCR) was the most frequently detected fungal pathogen. SF gave positive results in 5% of samples during surveillance vs in 26% of samples during fever episodes. Overall, the majority of blood samples gave negative results in both PCR methods resulting in 93% overall agreement resulting in a negative predictive value of 0.96 (95% CI: 0.95-0.97), and a positive predictive value of 0.10 (95% CI: -0.01 to 0.21). SeptiFast appeared to be superior over BC and the IH-PCR method. © 2017 Blackwell Verlag GmbH.
Detection of Mycobacterium Tuberculosis by using PCR
International Nuclear Information System (INIS)
Suhadi, F; Dadang-Sudrajat; Maria-Lina, R.
1996-01-01
Polymerase Chain Reaction (PCR) procedure using three primary set derived from repetitive DNA sequence specific to mycobacteria was used to diagnose pathogenic Mycobacterium tuberculosis. The assay was specific for M. tuberculosis and could be used to detect the amount DNA less than 10 -9 g
Kaspar, A; Pfister, K; Nielsen, M K; Silaghi, C; Fink, H; Scheuerle, M C
2017-01-11
Strongylus vulgaris has become a rare parasite in Germany during the past 50 years due to the practice of frequent prophylactic anthelmintic therapy. To date, the emerging development of resistance in Cyathostominae and Parascaris spp. to numerous equine anthelmintics has changed deworming management and the frequency of anthelmintic usage. In this regard, reliable detection of parasitic infections, especially of the highly pathogenic S. vulgaris is essential. In the current study, two diagnostic methods for the detection of infections with S. vulgaris were compared and information on the occurrence of this parasite in German horses was gained. For this purpose, faecal samples of 501 horses were screened for S. vulgaris with real-time PCR and an additional larval culture was performed in samples of 278 horses. A subset of 26 horses underwent multiple follow-up examinations with both methods in order to evaluate both the persistence of S. vulgaris infections and the reproducibility of each diagnostic method. The real-time PCR revealed S. vulgaris-DNA in ten of 501 investigated equine samples (1.9%). The larval culture demonstrated larvae of S. vulgaris in three of the 278 samples (1.1%). A direct comparison of the two methods was possible in 321 samples including 43 follow-up examinations with the result of 11 S. vulgaris-positive samples by real-time PCR and 4 S. vulgaris-positive samples by larval culture. The McNemar's test (p-value = 0.016) revealed a significant difference and the kappa values (0.525) showed a moderate agreement between real-time PCR and larval culture. The real-time PCR detected a significantly higher proportion of positives of S. vulgaris compared to larval culture and should thus be considered as a routine diagnostic method for the detection of S. vulgaris in equine samples.
Bovine Papillomavirus in Brazil: Detection of Coinfection of Unusual Types by a PCR-RFLP Method
Directory of Open Access Journals (Sweden)
R. F. Carvalho
2013-01-01
Full Text Available Bovine papillomavirus (BPV is recognized as a causal agent of benign and malignant tumors in cattle. Thirteen types of BPV are currently characterized and classified into three distinct genera, associated with different pathological outcomes. The described BPV types as well as other putative ones have been demonstrated by molecular biology methods, mainly by the employment of degenerated PCR primers. Specifically, divergences in the nucleotide sequence of the L1 gene are useful for the identification and classification of new papillomavirus types. On the present work, a method based on the PCR-RFLP technique and DNA sequencing was evaluated as a screening tool, allowing for the detection of two relatively rare types of BPV in lesions samples from a six-year-old Holstein dairy cow, chronically affected with cutaneous papillomatosis. These findings point to the dissemination of BPVs with unclear pathogenic potential, since two relatively rare, new described BPV types, which were first characterized in Japan, were also detected in Brazil.
Directory of Open Access Journals (Sweden)
Yuny Erwanto
2013-03-01
Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction ABSTRAK Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang
Directory of Open Access Journals (Sweden)
CHENG Fang
2013-04-01
Full Text Available Real-time PCR technique has been widely used in quantitative GMO detection in recent years.The accuracy of GMOs quantification based on the real-time PCR methods is still a difficult problem,especially for the quantification of high processed samples.To develop the suitable and accurate real-time PCR system for high processed GM samples,we made ameliorations to several real-time PCR parameters,including re-designed shorter target DNA fragment,similar lengths of amplified endogenous and exogenous gene targets,similar GC contents and melting temperatures of PCR primers and TaqMan probes.Also,one Heat-Treatment Processing Model (HTPM was established using soybean flour samples containing GM soybean GTS 40-3-2 to validate the effectiveness of the improved real-time PCR system.Tested results showed that the quantitative bias of GM content in heat processed samples were lowered using the new PCR system.The improved duplex real-time PCR was further validated using processed foods derived from GM soybean,and more accurate GM content values in these foods was also achieved.These results demonstrated that the improved duplex real-time PCR would be quite suitable in quantitative detection of high processed food products.
Directory of Open Access Journals (Sweden)
Gandhy Shruti U
2012-11-01
Full Text Available Abstract Background Curcumin inhibits growth of several cancer cell lines, and studies in this laboratory in bladder and pancreatic cancer cells show that curcumin downregulates specificity protein (Sp transcription factors Sp1, Sp3 and Sp4 and pro-oncogenic Sp-regulated genes. In this study, we investigated the anticancer activity of curcumin and several synthetic cyclohexanone and piperidine analogs in colon cancer cells. Methods The effects of curcumin and synthetic analogs on colon cancer cell proliferation and apoptosis were determined using standardized assays. The changes in Sp proteins and Sp-regulated gene products were analysed by western blots, and real time PCR was used to determine microRNA-27a (miR-27a, miR-20a, miR-17-5p and ZBTB10 and ZBTB4 mRNA expression. Results The IC50 (half-maximal values for growth inhibition (24 hr of colon cancer cells by curcumin and synthetic cyclohexanone and piperidine analogs of curcumin varied from 10 μM for curcumin to 0.7 μM for the most active synthetic piperidine analog RL197, which was used along with curcumin as model agents in this study. Curcumin and RL197 inhibited RKO and SW480 colon cancer cell growth and induced apoptosis, and this was accompanied by downregulation of specificity protein (Sp transcription factors Sp1, Sp3 and Sp4 and Sp-regulated genes including the epidermal growth factor receptor (EGFR, hepatocyte growth factor receptor (c-MET, survivin, bcl-2, cyclin D1 and NFκB (p65 and p50. Curcumin and RL197 also induced reactive oxygen species (ROS, and cotreatment with the antioxidant glutathione significantly attenuated curcumin- and RL197-induced growth inhibition and downregulation of Sp1, Sp3, Sp4 and Sp-regulated genes. The mechanism of curcumin-/RL197-induced repression of Sp transcription factors was ROS-dependent and due to induction of the Sp repressors ZBTB10 and ZBTB4 and downregulation of microRNAs (miR-27a, miR-20a and miR-17-5p that regulate these repressors
Directory of Open Access Journals (Sweden)
Touseef Hussain
2018-05-01
Full Text Available Phytophthora infestans (mont de Bary is a pathogen of great concern across the globe, and accurate detection is an important component in responding to the outbreaks of potential disease. Although the molecular diagnostic protocol used in regulatory programs has been evaluated but till date methods implying direct comparison has rarely used. In this study, a known area soil samples from potato fields where light blight appear every year (both A1 and A2 mating type was assayed by soil bait method, PCR assay detection and quantification of the inoculums. Suspected disease symptoms appeared on bait tubers were further confirmed by rapid PCR, inoculums were quantified through Real Time PCR, which confirms presence of P. infestans. These diagnostic methods can be highly correlated with one another. Potato tuber baiting increased the sensitivity of the assay compared with direct extraction of DNA from tuber and soil samples. Our study determines diagnostic sensitivity and specificity of the assays to determine the performance of each method. Overall, molecular techniques based on different types of PCR amplification and Real-time PCR can lead to high throughput, faster and more accurate detection method which can be used in quarantine programmes in potato industry and diagnostic laboratory.
Budiati, Titik; Rusul, Gulam; Wan-Abdullah, Wan Nadiah; Chuah, Li-Oon; Ahmad, Rosma; Thong, Kwai Lin
2016-04-01
A total of 43 Salmonella enterica isolates belonging to different serovars (Salmonella Albany, Salmonella Agona, Salmonella Corvallis, Salmonella Stanley, Salmonella Typhimurium, Salmonella Mikawasima, and Salmonella Bovismorbificans) were isolated from catfish (Clarias gariepinus) and tilapia (Tilapia mossambica) obtained from nine wet markets and eight ponds in Penang, Malaysia. Thirteen, 19, and 11 isolates were isolated from 9 of 32 catfish, 14 of 32 tilapia, and 11 of 44 water samples, respectively. Fish reared in ponds were fed chicken offal, spoiled eggs, and commercial fish feed. The genetic relatedness of these Salmonella isolates was determined by random amplified polymorphic DNA PCR (RAPD-PCR) using primer OPC2, repetitive extragenic palindromic PCR (REP-PCR), and pulsed-field gel electrophoresis (PFGE). Composite analysis of the RAPD-PCR, REP-PCR, and PFGE results showed that the Salmonella serovars could be differentiated into six clusters and 15 singletons. RAPD-PCR differentiated the Salmonella isolates into 11 clusters and 10 singletons, while REP-PCR differentiated them into 4 clusters and 1 singleton. PFGE differentiated the Salmonella isolates into seven clusters and seven singletons. The close genetic relationship of Salmonella isolates from catfish or tilapia obtained from different ponds, irrespective of the type of feed given, may be caused by several factors, such as the quality of the water, density of fish, and size of ponds.
La República de los historiadores del Paraguay posbélico
Telesca, Ignacio
2015-01-01
En ocasión del bicentenario de la adopción de la República como sistema de gobierno, e independiente tanto de España como de Buenos Aires, este artículo reflexiona sobre como los historiadores paraguayos de fines de siglo XIX reflexionaron sobre el tema, relacionándolo con la adopción de un nuevo sistema de gobierno con la constitución de 1870 (calco de la argentina). Fil: Telesca, Ignacio. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico - CONICET ...
International Nuclear Information System (INIS)
Qasem, J.A.; Al-Mouqati, S.; Rajkumar, G.
2005-01-01
The identification of Salmonella spp. from poultry meat was studied by comparing bacterial detection using the Gene-Trak colorimetric hybridization method, a PCR amplification kit and an Enzyme Linked Immunosorbent Assay (ELISA), and these methods were compared with the conventional methodology proposed by the United States Food and Drug Administration (US FDA) for detection of Salmonella in food samples. Forty positive and negative samples were studied. The three methods yielded similar results with levels of Salmonella greater than 10 CFU per sample, even when the samples were highly contaminated with competing bacteria. In contrast, 20 CFU of seed inoculum per sample was the lowest level of Salmonella detectable with all three methods and the standard culture method. The detection limits of the PCR and ELISA assays were 5 CFU/g after enrichment at 37 deg. C for 6 and 9 hours, respectively. Compared with conventional bacteriology, all three methods here demonstrated high sensitivity and specificity for Salmonella. (author)
Aparecida de Oliveira, Maria; Abeid Ribeiro, Eliana Guimarães; Morato Bergamini, Alzira Maria; Pereira De Martinis, Elaine Cristina
2010-02-01
Modern lifestyle markedly changed eating habits worldwide, with an increasing demand for ready-to-eat foods, such as minimally processed fruits and leafy greens. Packaging and storage conditions of those products may favor the growth of psychrotrophic bacteria, including the pathogen Listeria monocytogenes. In this work, minimally processed leafy vegetables samples (n = 162) from retail market from Ribeirão Preto, São Paulo, Brazil, were tested for the presence or absence of Listeria spp. by the immunoassay Listeria Rapid Test, Oxoid. Two L. monocytogenes positive and six artificially contaminated samples of minimally processed leafy vegetables were evaluated by the Most Probable Number (MPN) with detection by classical culture method and also culture method combined with real-time PCR (RTi-PCR) for 16S rRNA genes of L. monocytogenes. Positive MPN enrichment tubes were analyzed by RTi-PCR with primers specific for L. monocytogenes using the commercial preparation ABSOLUTE QPCR SYBR Green Mix (ABgene, UK). Real-time PCR assay presented good exclusivity and inclusivity results and no statistical significant difference was found in comparison with the conventional culture method (p < 0.05). Moreover, RTi-PCR was fast and easy to perform, with MPN results obtained in ca. 48 h for RTi-PCR in comparison to 7 days for conventional method.
Use of real-time PCR to evaluate two DNA extraction methods from food
Directory of Open Access Journals (Sweden)
Maria Regina Branquinho
2012-03-01
Full Text Available The DNA extraction is a critical step in Genetically Modified Organisms analysis based on real-time PCR. In this study, the CTAB and DNeasy methods provided good quality and quantity of DNA from the texturized soy protein, infant formula, and soy milk samples. Concerning the Certified Reference Material consisting of 5% Roundup Ready® soybean, neither method yielded DNA of good quality. However, the dilution test applied in the CTAB extracts showed no interference of inhibitory substances. The PCR efficiencies of lectin target amplification were not statistically different, and the coefficients of correlation (R² demonstrated high degree of correlation between the copy numbers and the threshold cycle (Ct values. ANOVA showed suitable adjustment of the regression and absence of significant linear deviations. The efficiencies of the p35S amplification were not statistically different, and all R² values using DNeasy extracts were above 0.98 with no significant linear deviations. Two out of three R² values using CTAB extracts were lower than 0.98, corresponding to lower degree of correlation, and the lack-of-fit test showed significant linear deviation in one run. The comparative analysis of the Ct values for the p35S and lectin targets demonstrated no statistical significant differences between the analytical curves of each target.
Directory of Open Access Journals (Sweden)
Andi Yasmon
2010-11-01
Full Text Available Aim: Since culture method is time-consuming and has low sensitivity, we developed a duplex PCR (dPCR assay for the detection of Legionella sp. and L. pneumophila in cooling tower samples. We used culture method as a gold standard.Methods: Optimization of dPCR method was performed to obtain an assay with high sensitivity and specifi city. The optimized method was used to detect Legionella sp. dan L. pneumophila in 9 samples obtained from 9 buildings in Jakarta. For culture method, the bacteria were grown or isolated on selective growth factor supplemented-buffered charcoal yeast extract (BCYE media.Results: Of 9 samples tested by dPCR assay, 6 were positive for Legionella species,1 was positive for L. pneumophila, and 2 showed negative results. For the same samples, no Legionella sp. was detected by the culture method.Conclusion: dPCR assay was much more sensitive than the culture method and was potentially used as a rapid, specifi c and sensitive test for routine detection of Legionella sp. dan for L. pneumophila in water samples. (Med J Indones 2010; 19:223-7Keywords: BCYE media, mip gene, 16S-rRNA gene
Directory of Open Access Journals (Sweden)
Aytül Sofu
2017-01-01
Full Text Available Lactic acid bacteria (LAB with different ecological niches are widely seen in fermented meat, vegetables, dairy products and cereals as well as in fermented beverages. Lactic acid bacteria are the most important group of bacteria in dairy industry due to their probiotic characteristics and fermentation agents as starter culture. In the taxonomy of the lactic acid bacteria; by means of rep-PCR, which is the analysis of repetitive sequences that are based on 16S ribosomal RNA (rRNA gene sequence, it is possible to conduct structural microbial community analyses such as Restriction Fragment Length Polymorphism (RFLP analysis of DNA fragments of different sizes cut with enzymes, Random Amplified Polymorphic DNA (RAPD polymorphic DNA amplified randomly at low temperatures and Amplified Fragment-Length Polymorphism (AFLP-PCR of cut genomic DNA. Besides, in the recent years, non-culture-based molecular methods such as Pulse Field Gel Electrophoresis (PFGE, Denaturing Gradient Gel Electrophoresis (DGGE, Thermal Gradient Gel Electrophoresis (TGGE, and Fluorescence In-situ Hybridization (FISH have replaced classical methods once used for the identification of LAB. Identification of lactic acid bacteria culture independent regardless of the method will be one of the most important methods used in the future pyrosequencing as a Next Generation Sequencing (NGS techniques. This paper reviews molecular-method based studies conducted on the identification of LAB species in dairy products.