WorldWideScience

Sample records for method provide improved

  1. Incentives and provider payment methods.

    Science.gov (United States)

    Barnum, H; Kutzin, J; Saxenian, H

    1995-01-01

    The mode of payment creates powerful incentives affecting provider behavior and the efficiency, equity and quality outcomes of health finance reforms. This article examines provider incentives as well as administrative costs, and institutional conditions for successful implementation associated with provider payment alternatives. The alternatives considered are budget reforms, capitation, fee-for-service, and case-based reimbursement. We conclude that competition, whether through a regulated private sector or within a public system, has the potential to improve the performance of any payment method. All methods generate both adverse and beneficial incentives. Systems with mixed forms of provider payment can provide tradeoffs to offset the disadvantages of individual modes. Low-income countries should avoid complex payment systems requiring higher levels of institutional development.

  2. Evaluating the impact of healthcare provider training to improve tuberculosis management: a systematic review of methods and outcome indicators used.

    Science.gov (United States)

    Wu, Shishi; Roychowdhury, Imara; Khan, Mishal

    2017-03-01

    Developing human resources capacity is vital for tuberculosis (TB) control in low- and middle-income countries. Although investments in TB healthcare provider (HCP) training programmes have increased, it is unclear whether these are robustly evaluated. The objective of this systematic review was to synthesize the methods and outcome indicators used to assess TB HCP training programmes. A systematic scoping review of publications reporting on evaluations of training programmes for TB HCPs - including doctors, nurses, paramedics, and lay health workers - was conducted through a search in three electronic databases, Google Scholar, and five websites of non-profit organizations. Data on the study location, population trained, outcomes assessed, and evaluation approach were extracted. After screening 499 unique publications, 21 were eligible for inclusion in the analysis. The majority of evaluations were conducted in Africa. The most common evaluation methods were a review of patient records (n=8, 38%) and post-training interview with trainees (n=7, 33%). In terms of outcomes, more than half of the studies (n=12, 57%) evaluated knowledge acquisition of trainees, with only six (29%) assessing on-the-job behaviour change. Even though more funds have been invested in TB HCP training, publications from robust evaluations assessing the impact on quality of care and behaviour change are limited. Copyright © 2016. Published by Elsevier Ltd.

  3. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, December 2015

    International Nuclear Information System (INIS)

    Cabellos, Oscar; De Saint Jean, Cyrille; Hursin, Mathieu; Pelloni, Sandro; Ivanov, Evgeny; Kodeli, Ivan; Leconte, Pierre; Palmiotti, Giuseppe; Salvatores, Massimo; Sobes, Vladimir; Yokoyama, Kenji

    2015-12-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the fifth formal Subgroup 39 meeting held at the Institute Curie, Paris, France, on 4 December 2015. It comprises a Summary Record of the meeting, and all the available presentations (slides) given by the participants: A - Sensitivity methods: - 1: Short update on deliverables (K. Yokoyama); - 2: Does one shot Bayesian is equivalent to successive update? Bayesian inference: some matrix linear algebra (C. De Saint Jean); - 3: Progress in Methodology (G. Palmiotti); - SG39-3: Use of PIA approach. Possible application to neutron propagation experiments (S. Pelloni); - 4: Update on sensitivity coefficient methods (E. Ivanov); - 5: Stress test for U-235 fission (H. Wu); - 6: Methods and approaches development at ORNL for providing feedback from integral benchmark experiments for improvement of nuclear data files (V. Sobes); B - Integral experiments: - 7a: Update on SEG analysis (G. Palmiotti); - 7b:Status of MANTRA (G. Palmiotti); - 7c: Possible new experiments at NRAD (G. Palmiotti); - 8: B-eff experiments (I. Kodeli); - 9: On going CEA activities related to dedicated integral experiments for nuclear date validation in the Fast energy range (P. Leconte); - 10: PROTEUS Experiments: an update (M. Hursin); - 11: Short updates on neutron propagation experiments, STEK, CIELO status (O. Cabellos)

  4. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, November 2014

    International Nuclear Information System (INIS)

    Aufiero, Manuele; Ivanov, Evgeny; Hoefer, Axel; Yokoyama, Kenji; Da Cruz, Dirceu Ferreira; KODELI, Ivan-Alexander; Hursin, Mathieu; Pelloni, Sandro; Palmiotti, Giuseppe; Salvatores, Massimo; Barnes, Andrew; Cabellos De Francisco, Oscar; ); Ivanova, Tatiana; )

    2014-11-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the third formal Subgroup meeting held at the NEA, Issy-les-Moulineaux, France, on 27-28 November 2014. It comprises a Summary Record of the meeting and all the available presentations (slides) given by the participants: A - Sensitivity methods: 1 - Perturbation/sensitivity calculations with Serpent (M. Aufiero); 2 - Comparison of deterministic and Monte Carlo sensitivity analysis of SNEAK-7A and FLATTOP-Pu Benchmarks (I. Kodeli); B - Integral experiments: 1 - PROTEUS experiments: selected experiments sensitivity profiles and availability, (M. Hursin, M. Salvatores - PROTEUS Experiments, HCLWR configurations); 2 - SINBAD Benchmark Database and FNS/JAEA Liquid Oxygen TOF Experiment Analysis (I. Kodeli); 3 - STEK experiment Opportunity for Validation of Fission Products Nuclear Data (D. Da Cruz); 4 - SEG (tailored adjoint flux shapes) (M. Savatores - comments) 5 - IPPE transmission experiments (Fe, 238 U) (T. Ivanova); 6 - RPI semi-integral (Fe, 238 U) (G. Palmiotti - comments); 7 - New experiments, e.g. in connection with the new NSC Expert Group on 'Improvement of Integral Experiments Data for Minor Actinide Management' (G. Palmiotti - Some comments from the Expert Group) 8 - Additional PSI adjustment studies accounting for nonlinearity (S. Pelloni); 9 - Adjustment methodology issues (G. Palmiotti); C - Am-241 and fission product issues: 1 - Am-241 validation for criticality-safety calculations (A. Barnes - Visio

  5. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, May 2015

    International Nuclear Information System (INIS)

    Wang, Wenming; Yokoyama, Kenji; Kim, Do Heon; Kodeli, Ivan-Alexander; Hursin, Mathieu; Pelloni, Sandro; Palmiotti, Giuseppe; Salvatores, Massimo; Touran, Nicholas; Cabellos De Francisco, Oscar; )

    2015-05-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the fourth Subgroup meeting, held at the NEA, Issy-les-Moulineaux, France, on 19-20 May 2015. It comprises a Summary Record of the meeting, two papers on deliverables and all the available presentations (slides) given by the participants: 1 - Status of Deliverables: '1. Methodology' (K. Yokoyama); 2 - Status of Deliverables: '2. Comments on covariance data' (K. Yokoyama); 3 - PROTEUS HCLWR Experiments (M. Hursin); 4 - Preliminary UQ Efforts for TWR Design (N. Touran); 5 - Potential use of beta-eff and other benchmark for adjustment (I. Kodeli); 6 - k_e_f_f uncertainties for a simple case of Am"2"4"1 using different codes and evaluated files (I. Kodeli); 7 - k_e_f_f uncertainties for a simple case of Am"2"4"1 using TSUNAMI (O. Cabellos); 8 - REWIND: Ranking Experiments by Weighting to Improve Nuclear Data (G. Palmiotti); 9 - Recent analysis on NUDUNA/MOCABA applications to reactor physics parameters (E. Castro); 10 - INL exploratory study for SEG (A. Hummel); 11 - The Development of Nuclear Data Adjustment Code at CNDC (H. Wu); 12 - SG39 Perspectives (M. Salvatores). A list of issues and actions conclude the document

  6. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, December 2016

    International Nuclear Information System (INIS)

    Cabellos, Oscar; ); PELLONI, Sandro; Ivanov, Evgeny; Sobes, Vladimir; Fukushima, M.; Yokoyama, Kenji; Palmiotti, Giuseppe; Kodeli, Ivo

    2016-12-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the eighth Subgroup 39 meeting, held at the OECD NEA, Boulogne-Billancourt, France, on 1-2 December 2016. It comprises all the available presentations (slides) given by the participants: A - Presentations: Welcome and actions review (Oscar CABELLOS); B - Methods: - Detailed comparison of Progressive Incremental Adjustment (PIA) sequence results involving adjustments of spectral indices and coolant density effects on the basis of the SG33 benchmark (Sandro PELLONI); - ND assessment alternatives: Validation matrix vs XS adjustment (Evgeny IVANOV); - Implementation of Resonance Parameter Sensitivity Coefficients Calculation in CE TSUNAMI-3D (Vladimir SOBES); C - Experiment analysis, sensitivity calculations and benchmarks: - Benchmark tests of ENDF/B-VIII.0 beta 1 using sodium void reactivity worth of FCA-XXVII-1 assembly (M. FUKUSHIMA, Kenji YOKOYAMA); D - Adjustments: - Cross-section adjustment based on JENDL-4.0 using new experiments on the basis of the SG33 benchmark (Kenji YOKOYAMA); - Comparison of adjustment trends with the Cielo evaluation (Sandro PELLONI); - Expanded adjustment in support of CIELO initiative (Giuseppe PALMIOTTI); - First preliminary results of the adjustment exercise using ASPIS Fe88 and SNEAK-7A/7B k_e_f_f and b_e_f_f benchmarks (Ivo KODELI); E - Future actions, deliverables: - Discussion on future of SG39 and possible new subgroup (Giuseppe PALMIOTTI); - WPEC sub-group proposal: Investigation of Covariance Data in

  7. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, November 2013

    International Nuclear Information System (INIS)

    De Saint Jean, C.; Dupont, E.; ); Dyrda, J.; Hursin, M.; Pelloni, S.; Ishikawa, M.; Ivanov, E.; Ivanova, T.; Kim, D.H.; Ee, Y.O.; Kodeli, I.; Leal, L.; Leichtle, D.; Palmiotti, G.; Salvatores, M.; Pronyaev, V.; Simakov, S.; )

    2013-11-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the first formal Subgroup 39 meeting held at the NEA, Issy-les-Moulineaux, France, on 28-29 November 2013. It comprises a Summary Record of the meeting and all the available presentations (slides) given by the participants: A - Recent data adjustments performances and trends: 1 - Recommendations from ADJ2010 adjustment (M. Ishikawa); 2 - Feedback on CIELO isotopes from ENDF/B-VII.0 adjustment (G. Palmiotti); 3 - Sensitivity and uncertainty results on FLATTOP-Pu (I. Kodeli); 4 - SG33 benchmark: Comparative adjustment results (S. Pelloni) 5 - Integral benchmarks for data assimilation: selection of a consistent set and establishment of integral correlations (E. Ivanov); 6 - PROTEUS experimental data (M. Hursin); 7 - Additional information on High Conversion Light Water Reactor (HCLWR aka FDWR-II) experiments (14 January 2014); 8 - Data assimilation of benchmark experiments for homogenous thermal/epithermal uranium systems (J. Dyrda); B - Methodology issues: 1 - Adjustment methodology issues (G. Palmiotti); 2 - Marginalisation, methodology issues and nuclear data parameter adjustment (C. De Saint Jean); 3 - Nuclear data parameter adjustment (G. Palmiotti). A list of issues and actions conclude the document

  8. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, May 2014

    International Nuclear Information System (INIS)

    Aliberti, G.; Archier, P.; Dunn, M.; Dupont, E.; Hill, I.; ); Garcia, A.; Hursin, M.; Pelloni, S.; Ivanova, T.; Kodeli, I.; Palmiotti, G.; Salvatores, M.; Touran, N.; Wenming, Wang; Yokoyama, K.

    2014-05-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the second Subgroup meeting, held at the NEA, Issy-les-Moulineaux, France, on 13 May 2014. It comprises a Summary Record of the meeting and all the available presentations (slides) given by the participants: A - Welcome: Review of actions (M. Salvatores); B - Inter-comparison of sensitivity coefficients: 1 - Sensitivity Computation with Monte Carlo Methods (T. Ivanova); 2 - Sensitivity analysis of FLATTOP-Pu (I. Kodeli); 3 - Sensitivity coefficients by means of SERPENT-2 (S. Pelloni); 4 - Demonstration - Database for ICSBEP (DICE) and Database and Analysis Tool for IRPhE (IDAT) (I. Hill); C - Specific new experiments: 1 - PROTEUS FDWR-II (HCLWR) program summary (M. Hursin); 2 - STEK and SEG Experiments, M. Salvatores 3 - Experiments related to "2"3"5U, "2"3"8U, "5"6Fe and "2"3Na, G. Palmiotti); 4 - Validation of Iron Cross Sections against ASPIS Experiments (JEF/DOC-420) (I. Kodeli); 5 - Benchmark analysis of Iron Cross-sections (EFFDOC-1221) (I. Kodeli 6 - Integral Beta-effective Measurements (K. Yokoyama on behalf of M. Ishikawa); D - Adjustment results: 1 - Impacts of Covariance Data and Interpretation of Adjustment Trends of ADJ2010, (K. Yokoyama); 2 - Revised Recommendations from ADJ2010 Adjustment (K. Yokoyama); 3 - Comparisons and Discussions on Adjustment trends from JEFF (CEA) (P. Archier); 4 - Feedback on CIELO Isotopes from ENDF/B-VII.0 Adjustment (G. Palmiotti); 5 - Demonstration - Plot comparisons of participants' results (E

  9. Patients Provide Recommendations for Improving Patient Satisfaction.

    Science.gov (United States)

    Moore, Angelo D; Hamilton, Jill B; Krusel, Jessica L; Moore, LeeAntoinette G; Pierre-Louis, Bosny J

    2016-04-01

    National Committee for Quality Assurance recommends patient-centered medical homes incorporate input from patient populations; however, many health care organizations do not. This qualitative study used two open-ended questions from 148 active duty Army Soldiers and their family members to illicit recommendations for primary care providers and clinic leadership that would improve their health care experiences. Content analysis and descriptive statistics were used to analyze responses. Participant responses were related to four major themes: Access to Care, Interpersonal Interaction, Satisfaction of Care, and Quality of Care. Participants were overall satisfied with their care; however, spending less time waiting for appointments and to see the provider or specialist were the most frequently requested improvements related to Access to Care. For Interpersonal Interaction, 82% of the responses recommended that providers be more attentive listeners, courteous, patient, caring, and respectful. Decreasing wait times and improving interpersonal skills would improve health care experiences and patient satisfaction. Reprint & Copyright © 2016 Association of Military Surgeons of the U.S.

  10. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, May 2016

    International Nuclear Information System (INIS)

    Herman, Michal Wladyslaw; Cabellos De Francisco, Oscar; Beck, Bret; Ignatyuk, Anatoly V.; Palmiotti, Giuseppe; Grudzevich, Oleg T.; Salvatores, Massimo; Chadwick, Mark; Pelloni, Sandro; Diez De La Obra, Carlos Javier; Wu, Haicheng; Sobes, Vladimir; Rearden, Bradley T.; Yokoyama, Kenji; Hursin, Mathieu; Penttila, Heikki; Kodeli, Ivan-Alexander; Plevnik, Lucijan; Plompen, Arjan; Gabrielli, Fabrizio; Leal, Luiz Carlos; Aufiero, Manuele; Fiorito, Luca; Hummel, Andrew; Siefman, Daniel; Leconte, Pierre

    2016-05-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. WPEC subgroup 40-CIELO (Collaborative International Evaluated Library Organization) provides a new working paradigm to facilitate evaluated nuclear reaction data advances. It brings together experts from across the international nuclear reaction data community to identify and document discrepancies among existing evaluated data libraries, measured data, and model calculation interpretations, and aims to make progress in reconciling these discrepancies to create more accurate ENDF-formatted files. SG40-CIELO focusses on 6 important isotopes: "1H, "1"6O, "5"6Fe, "2"3"5","2"3"8U, "2"3"9Pu. This document is the proceedings of the seventh formal Subgroup 39 meeting and of the Joint SG39+SG40 Session held at the NEA, OECD Conference Center, Paris, France on 10-11 May 2016. It comprises a Summary Record of the meeting, and all the available presentations (slides) given by the participants: A - Welcome and actions review (Oscar CABELLOS); B - Methods: - XGPT: uncertainty propagation and data assimilation from continuous energy covariance matrix and resonance parameters covariances (Manuele AUFIERO); - Optimal experiment utilization (REWINDing PIA), (G. Palmiotti); C - Experiment analysis, sensitivity calculations and benchmarks: - Tripoli-4 analysis of SEG experiments (Andrew HUMMEL); - Tripoli-4 analysis of BERENICE experiments (P. DUFAY, Cyrille DE SAINT JEAN); - Preparation of sensitivities of k-eff, beta-eff and shielding benchmarks for adjustment exercise (Ivo KODELI); - SA and

  11. Improving communication when seeking informed consent: a randomised controlled study of a computer-based method for providing information to prospective clinical trial participants.

    Science.gov (United States)

    Karunaratne, Asuntha S; Korenman, Stanley G; Thomas, Samantha L; Myles, Paul S; Komesaroff, Paul A

    2010-04-05

    To assess the efficacy, with respect to participant understanding of information, of a computer-based approach to communication about complex, technical issues that commonly arise when seeking informed consent for clinical research trials. An open, randomised controlled study of 60 patients with diabetes mellitus, aged 27-70 years, recruited between August 2006 and October 2007 from the Department of Diabetes and Endocrinology at the Alfred Hospital and Baker IDI Heart and Diabetes Institute, Melbourne. Participants were asked to read information about a mock study via a computer-based presentation (n = 30) or a conventional paper-based information statement (n = 30). The computer-based presentation contained visual aids, including diagrams, video, hyperlinks and quiz pages. Understanding of information as assessed by quantitative and qualitative means. Assessment scores used to measure level of understanding were significantly higher in the group that completed the computer-based task than the group that completed the paper-based task (82% v 73%; P = 0.005). More participants in the group that completed the computer-based task expressed interest in taking part in the mock study (23 v 17 participants; P = 0.01). Most participants from both groups preferred the idea of a computer-based presentation to the paper-based statement (21 in the computer-based task group, 18 in the paper-based task group). A computer-based method of providing information may help overcome existing deficiencies in communication about clinical research, and may reduce costs and improve efficiency in recruiting participants for clinical trials.

  12. Reconciling patient and provider priorities for improving the care of critically ill patients: A consensus method and qualitative analysis of decision making.

    Science.gov (United States)

    McKenzie, Emily; Potestio, Melissa L; Boyd, Jamie M; Niven, Daniel J; Brundin-Mather, Rebecca; Bagshaw, Sean M; Stelfox, Henry T

    2017-12-01

    Providers have traditionally established priorities for quality improvement; however, patients and their family members have recently become involved in priority setting. Little is known about how to reconcile priorities of different stakeholder groups into a single prioritized list that is actionable for organizations. To describe the decision-making process for establishing consensus used by a diverse panel of stakeholders to reconcile two sets of quality improvement priorities (provider/decision maker priorities n=9; patient/family priorities n=19) into a single prioritized list. We employed a modified Delphi process with a diverse group of panellists to reconcile priorities for improving care of critically ill patients in the intensive care unit (ICU). Proceedings were audio-recorded, transcribed and analysed using qualitative content analysis to explore the decision-making process for establishing consensus. Nine panellists including three providers, three decision makers and three family members of previously critically ill patients. Panellists rated and revised 28 priorities over three rounds of review and reached consensus on the "Top 5" priorities for quality improvement: transition of patient care from ICU to hospital ward; family presence and effective communication; delirium screening and management; early mobilization; and transition of patient care between ICU providers. Four themes were identified as important for establishing consensus: storytelling (sharing personal experiences), amalgamating priorities (negotiating priority scope), considering evaluation criteria and having a priority champion. Our study demonstrates the feasibility of incorporating families of patients into a multistakeholder prioritization exercise. The approach described can be used to guide consensus building and reconcile priorities of diverse stakeholder groups. © 2017 The Authors Health Expectations Published by John Wiley & Sons Ltd.

  13. Statistical methods for quality improvement

    National Research Council Canada - National Science Library

    Ryan, Thomas P

    2011-01-01

    ...."-TechnometricsThis new edition continues to provide the most current, proven statistical methods for quality control and quality improvementThe use of quantitative methods offers numerous benefits...

  14. Engaging service providers in improving industry performance

    International Nuclear Information System (INIS)

    Oberth, R.

    2012-01-01

    Effective task leadership is the key to achieving results in the nuclear industry and in most other industries. One of the themes of this conference is to discuss how the nuclear industry can undertake Issue-Identification and Definition as a means of 'identifying what needs attention' and then 'defining what needs to be done to make that happen'. I will explore this theme from the perspective of the 'Service Provider' - which by the definition of this conference includes everyone not within an operating utility - meaning 'those involved in everything from inspection and repair to research and plant architecture' - basically the member companies of my association, OCI. Our members take the definition of the roles and responsibilities of the 'Service Provider' community very seriously. In the context of this discussion a key utility function is the early definition of requirements and expectations of Service Providers in supplying to these requirements. Let's explore for a moment the Service Provider role and perspective. Service Providers are by nature pro-active - they seek ways to engage with utilities (and tier one vendors) to solve problems and achieve good outcomes. They come to industry conferences like this one to learn about upcoming utility programs and supply opportunities and how they can improve performance. Service Providers particularly want to hear senior utility people comment on emerging issues even those at the very early identification stage. Some Clarification of Roles is in Order - as that is the focus of this conference: 'Issue-Identification and Definition'. 'Issue-Identification' is the utility's job - it is the utility's role to identify as early as possible 'what needs attention and what their needs and expectations are'. This takes place before service provider engagement. 'Issue-Definition' is more challenging. It means 'determining and prioritizing what needs to be done to deal with the situation at hand'. This typically involves

  15. Improved radioanalytical methods

    International Nuclear Information System (INIS)

    Erickson, M.D.; Aldstadt, J.H.; Alvarado, J.S.; Crain, J.S.; Orlandini, K.A.; Smith, L.L.

    1995-01-01

    Methods for the chemical characterization of the environment are being developed under a multitask project for the Analytical Services Division (EM-263) within the US Department of Energy (DOE) Office of Environmental Management. This project focuses on improvement of radioanalytical methods with an emphasis on faster and cheaper routine methods. We have developed improved methods, for separation of environmental levels of technetium-99 and strontium-89/90, radium, and actinides from soil and water; and for separation of actinides from soil and water matrix interferences. Among the novel separation techniques being used are element- and class-specific resins and membranes. (The 3M Corporation is commercializing Empore trademark membranes under a cooperative research and development agreement [CRADA] initiated under this project). We have also developed methods for simultaneous detection of multiple isotopes using inductively coupled plasma-mass spectrometry (ICP-MS). The ICP-MS method requires less rigorous chemical separations than traditional radiochemical analyses because of its mass-selective mode of detection. Actinides and their progeny have been isolated and concentrated from a variety of natural water matrices by using automated batch separation incorporating selective resins prior to ICP-MS analyses. In addition, improvements in detection limits, sample volume, and time of analysis were obtained by using other sample introduction techniques, such as ultrasonic nebulization and electrothermal vaporization. Integration and automation of the separation methods with the ICP-MS methodology by using flow injection analysis is underway, with an objective of automating methods to achieve more reproducible results, reduce labor costs, cut analysis time, and minimize secondary waste generation through miniaturization of the process

  16. Refinements of the attending equations for several spectral methods that provide improved quantification of B-carotene and/or lycopene in selected foods

    Science.gov (United States)

    Developing and maintaining maximal levels of carotenoids in fruits and vegetables that contain them is a concern of the produce industry. Toward this end, reliable methods for quantifying lycopene and B-carotene, two of the major health-enhancing carotenoids, are necessary. The goal of this resear...

  17. Improved power performance assessment methods

    Energy Technology Data Exchange (ETDEWEB)

    Frandsen, S; Antoniou, I; Dahlberg, J A [and others

    1999-03-01

    The uncertainty of presently-used methods for retrospective assessment of the productive capacity of wind farms is unacceptably large. The possibilities of improving the accuracy have been investigated and are reported. A method is presented that includes an extended power curve and site calibration. In addition, blockage effects with respect to reference wind speed measurements are analysed. It is found that significant accuracy improvements are possible by the introduction of more input variables such as turbulence and wind shear, in addition to mean wind speed and air density. Also, the testing of several or all machines in the wind farm - instead of only one or two - may provide a better estimate of the average performance. (au)

  18. Improved cytometry method

    International Nuclear Information System (INIS)

    McLean, J.R.N.

    1995-09-01

    Chromosome aberrations are widely used as biological indicators of radiation exposure. Chromosomes, isolated from human peripheral blood lymphocytes, are assessed by microscopy for the presence of dicentric aberrations. Dicentric figures are produced almost exclusively by exposure to ionizing radiation. The 'natural' background frequency of the dicentric in non-smoking humans is estimated at 1 in 1000-2000 cells (1). The frequency of this aberration increases with the radiation dose and age, and may possibly be related to lifestyle. The chromosome dicentric is most reliable as a biological dosimeter for uniform whole body exposures delivered at high dose rate (acute exposure). One practical shortcoming of using the frequency of dicentrics as an indicator of radiation dose, is the labor intensive nature of the analysis. State-of-the-art imaging software cannot recognize the wide variety of shapes that can be assumed by dicentric chromosomes. The time required to perform other labor intensive elements of the analytical process can be decreased by means of computer routines. These components include data reduction, recording and collation. Often, these tasks contribute little to the validity of the final dose estimate but nevertheless represent bookkeeping functions that are essential for verification and audit purposes should the need ever arise. This report describes a computer-assisted method of chromosomes dicentric analysis that more than doubles the efficiency of the analytical process. (author). 4 refs., 3 figs

  19. Improved cytometry method

    Energy Technology Data Exchange (ETDEWEB)

    McLean, J R.N. [Health Canada, Ottawa, ON (Canada). Radiation Protection Bureau

    1995-09-01

    Chromosome aberrations are widely used as biological indicators of radiation exposure. Chromosomes, isolated from human peripheral blood lymphocytes, are assessed by microscopy for the presence of dicentric aberrations. Dicentric figures are produced almost exclusively by exposure to ionizing radiation. The `natural` background frequency of the dicentric in non-smoking humans is estimated at 1 in 1000-2000 cells (1). The frequency of this aberration increases with the radiation dose and age, and may possibly be related to lifestyle. The chromosome dicentric is most reliable as a biological dosimeter for uniform whole body exposures delivered at high dose rate (acute exposure). One practical shortcoming of using the frequency of dicentrics as an indicator of radiation dose, is the labor intensive nature of the analysis. State-of-the-art imaging software cannot recognize the wide variety of shapes that can be assumed by dicentric chromosomes. The time required to perform other labor intensive elements of the analytical process can be decreased by means of computer routines. These components include data reduction, recording and collation. Often, these tasks contribute little to the validity of the final dose estimate but nevertheless represent bookkeeping functions that are essential for verification and audit purposes should the need ever arise. This report describes a computer-assisted method of chromosomes dicentric analysis that more than doubles the efficiency of the analytical process. (author). 4 refs., 3 figs.

  20. Patient and provider perspectives on improving the linkage of HIV ...

    African Journals Online (AJOL)

    This study examined barriers and facilitators to the linkage of HIV-positive pregnant women from antenatal care (ANC) to long-term HIV care from patient and provider perspectives, following the implementation of a collaborative quality improvement project in Eastern Uganda. It also solicited recommendations for improving ...

  1. Improving the Service with the Servqual Method

    Science.gov (United States)

    Midor, Katarzyna; Kučera, Marian

    2018-03-01

    At the time when economy is growing, there is strong competition in the market, and customers have increasingly higher expectations as regards quality of service and products. Under such conditions, organizations need to improve. One of the areas of improvement for an organization is to research the level of customer satisfaction. The article presents results of customer satisfaction surveys conducted by the Servqual method in a pharmaceutical service company. Use of this method allowed to improve the services provided by that pharmaceutical wholesaler, identify areas that need to be improved as soon as possible in order to improve the level of service provided.

  2. Improving glycaemic control and life skills in adolescents with type 1 diabetes: A randomised, controlled intervention study using the Guided Self-Determination-Young method in triads of adolescents, parents and health care providers integrated into routine paediatric outpatient clinics

    Directory of Open Access Journals (Sweden)

    Esbensen Bente

    2011-06-01

    Full Text Available Abstract Background Adolescents with type 1 diabetes face demanding challenges due to conflicting priorities between psychosocial needs and diabetes management. This conflict often results in poor glycaemic control and discord between adolescents and parents. Adolescent-parent conflicts are thus a barrier for health care providers (HCPs to overcome in their attempts to involve both adolescents and parents in improvement of glycaemic control. Evidence-based interventions that involve all three parties (i.e., adolescents, parents and HCPs and are integrated into routine outpatient clinic visits are lacking. The Guided Self-Determination method is proven effective in adult care and has been adapted to adolescents and parents (Guided Self-Determination-Young (GSD-Y for use in paediatric diabetes outpatient clinics. Our objective is to test whether GSD-Y used in routine paediatric outpatient clinic visits will reduce haemoglobin A1c (HbA1c concentrations and improve adolescents' life skills compared with a control group. Methods/Design Using a mixed methods design comprising a randomised controlled trial and a nested qualitative evaluation, we will recruit 68 adolescents age 13 - 18 years with type 1 diabetes (HbA1c > 8.0% and their parents from 2 Danish hospitals and randomise into GSD-Y or control groups. During an 8-12 month period, the GSD-Y group will complete 8 outpatient GSD-Y visits, and the control group will completes an equal number of standard visits. The primary outcome is HbA1c. Secondary outcomes include the following: number of self-monitored blood glucose values and levels of autonomous motivation, involvement and autonomy support from parents, autonomy support from HCPs, perceived competence in managing diabetes, well-being, and diabetes-related problems. Primary and secondary outcomes will be evaluated within and between groups by comparing data from baseline, after completion of the visits, and again after a 6-month follow-up. To

  3. Improving glycaemic control and life skills in adolescents with type 1 diabetes: A randomised, controlled intervention study using the Guided Self-Determination-Young method in triads of adolescents, parents and health care providers integrated into routine paediatric outpatient clinics

    DEFF Research Database (Denmark)

    Husted, Gitte; Thorsteinsson, Birger; Esbensen, Bente Appel

    2011-01-01

    visits will reduce haemoglobin A1c (HbA1c) concentrations and improve adolescents' life skills compared with a control group. METHODS: Using a mixed methods design comprising a randomised controlled trial and a nested qualitative evaluation, we will recruit 68 adolescents age 13 - 18 years with type 1......ABSTRACT: BACKGROUND: Adolescents with type 1 diabetes face demanding challenges due to conflicting priorities between psychosocial needs and diabetes management. This conflict often results in poor glycaemic control and discord between adolescents and parents. Adolescent-parent conflicts are thus...... are lacking. The Guided Self-Determination method is proven effective in adult care and has been adapted to adolescents and parents (Guided Self-Determination-Young (GSD-Y)) for use in paediatric diabetes outpatient clinics. Our objective is to test whether GSD-Y used in routine paediatric outpatient clinic...

  4. Improving Interdisciplinary Provider Communication Through a Unified Paging System.

    Science.gov (United States)

    Heidemann, Lauren; Petrilli, Christopher; Gupta, Ashwin; Campbell, Ian; Thompson, Maureen; Cinti, Sandro; Stewart, David A

    2016-06-01

    Interdisciplinary communication at a Veterans Affairs (VA) academic teaching hospital is largely dependent on alphanumeric paging, which has limitations as a result of one-way communication and lack of reliable physician identification. Adverse patient outcomes related to difficulty contacting the correct consulting provider in a timely manner have been reported. House officers were surveyed on the level of satisfaction with the current VA communication system and the rate of perceived adverse patient outcomes caused by potential delays within this system. Respondents were then asked to identify the ideal paging system. These results were used to develop and deploy a new Web site. A postimplementation survey was repeated 1 year later. This study was conducted as a quality improvement project. House officer satisfaction with the preintervention system was 3%. The majority used more than four modalities to identify consultants, with 59% stating that word of mouth was a typical source. The preferred mode of paging was the university hospital paging system, a Web-based program that is used at the partnering academic institution. Following integration of VA consulting services within the university hospital paging system, the level of satisfaction improved to 87%. Significant decreases were seen in perceived adverse patient outcomes (from 16% to 2%), delays in patient care (from 90% to 16%), and extended hospitalizations (from 46% to 4%). Our study demonstrates significant improvement in physician satisfaction with a newly implemented paging system that was associated with a decreased perceived number of adverse patient events and delays in care.

  5. Methods for providing intermediates in the synthesis of atorvastatin.

    NARCIS (Netherlands)

    Dömling, Alexander Stephan Siegfried

    2016-01-01

    The invention relates to the field of medicinal chemistry, In particular, it relates to methods for providing intermediates in the synthesis of Atorvastatin, a competitive inhibitor of HMG-Co A reductase. Provided is a process for providing a compound having a Formula (I) or a pharmaceutically

  6. Method to improve commercial bonded SOI material

    Science.gov (United States)

    Maris, Humphrey John; Sadana, Devendra Kumar

    2000-07-11

    A method of improving the bonding characteristics of a previously bonded silicon on insulator (SOI) structure is provided. The improvement in the bonding characteristics is achieved in the present invention by, optionally, forming an oxide cap layer on the silicon surface of the bonded SOI structure and then annealing either the uncapped or oxide capped structure in a slightly oxidizing ambient at temperatures greater than 1200.degree. C. Also provided herein is a method for detecting the bonding characteristics of previously bonded SOI structures. According to this aspect of the present invention, a pico-second laser pulse technique is employed to determine the bonding imperfections of previously bonded SOI structures.

  7. Improved verification methods for OVI security ink

    Science.gov (United States)

    Coombs, Paul G.; Markantes, Tom

    2000-04-01

    Together, OVP Security Pigment in OVI Security Ink, provide an excellent method of overt banknote protection. The effective use of overt security feature requires an educated public. The rapid rise in computer-generated counterfeits indicates that consumers are not as educate das to banknote security features as they should be. To counter the education issue, new methodologies have been developed to improve the validation of banknotes using the OVI ink feature itself. One of the new methods takes advantage of the overt nature of the product's optically variable effect. Another method utilizes the unique optical interference characteristics provided by the OVP platelets.

  8. Application of improved AHP method to radiation protection optimization

    International Nuclear Information System (INIS)

    Wang Chuan; Zhang Jianguo; Yu Lei

    2014-01-01

    Aimed at the deficiency of traditional AHP method, a hierarchy model for optimum project selection of radiation protection was established with the improved AHP method. The result of comparison between the improved AHP method and the traditional AHP method shows that the improved AHP method can reduce personal judgment subjectivity, and its calculation process is compact and reasonable. The improved AHP method can provide scientific basis for radiation protection optimization. (authors)

  9. Improving Educational Outcomes by Providing Educational Services through Mobile Technology

    OpenAIRE

    Hosam Farouk El-Sofany

    2013-01-01

    The use of Computers, Networks, and Internet has successfully enabled educational institutions to provide their students and instructors with various online educational services. With the recent developments in M-learning and mobile technology, further possibilities are emerging to provide such services through mobile devices such as mobile phones and PDAs. By providing the educational services using wireless and mobile technologies, the educational institutions can potentially bring great co...

  10. Improving Health Care Provider Availability through Information Technology

    National Research Council Canada - National Science Library

    Lasell, Jon R

    2005-01-01

    .... This study identifies the need for change in collecting data on patient care time, reviews different methods/systems for gathering data, documents the implementation of the selected system (eUCAPERS...

  11. MEDICARE: Improvements Needed in Provider Communications and Contracting Procedures

    National Research Council Canada - National Science Library

    Aronovitz, Leslie

    2001-01-01

    .... Under Medicare's fee-for-service system-which accounts for over 80 percent of program beneficiaries physicians, hospitals, and other providers submit claims to receive reimbursement for services...

  12. Recent improvements in check valve monitoring methods

    International Nuclear Information System (INIS)

    Haynes, H.D.

    1990-01-01

    In support of the NRC Nuclear Plant Aging Research (NPAR) program, ORNL has carried out an evaluation of three check valve monitoring methods: acoustic emission, ultrasonic inspection, and magnetic flux signature analysis (MFSA). This work has focused on determining the capabilities of each method to provide diagnostic information useful in determining check valve aging and service wear effects (degradation) and undesirable operating modes. In addition, as part of the ORNL Advanced Diagnostic Engineering Research and Development Center (ADEC), two noval nonintrusive monitoring methods were developed (external ac- and dc-magnetic monitoring) that provide several improvements over the other methods. None of the examined methods could, by themselves, monitor the instantaneous position and motion of check valve internals and valve leakage; however, the combination of acoustic emission monitoring with one of the other methods provides the means to determine vital check valve operational information. This paper describes the benefits and limitations associated with each method and includes recent laboratory and field test data to illustrate the capabilities of these methods to detect simulated check valve degradation. 3 refs., 22 figs., 4 tabs

  13. Recent improvements in check valve monitoring methods

    International Nuclear Information System (INIS)

    Haynes, H.D.

    1991-01-01

    In support of the NRC Nuclear Plant Aging Research (NPAR) program, ORNL has carried out an evaluation of three check valve monitoring methods: acoustic emission, ultrasonic inspection, and magnetic flux signature analysis (MFSA). This work has focussed on determining the capabilities of each method to provide diagnostic information useful in determining check valve aging and service wear effects (degradation) and undesirable operating modes. In addition, as part of the ORNL Advanced Diagnostic Engineering Research and Development Center (ADEC), two novel nonintrusive monitoring methods were developed (external ac- and dc-magnetic monitoring) that provide several improvements over the other methods. None of the examined methods could, by themselves, monitor the instantaneous position and motion of check valve internals and valve leakage; however, the combination of acoustic emission monitoring with one of the other methods provides the means to determine vital check valve operational information. This paper describes the benefits and limitations associated with each method and includes recent laboratory and field test data to illustrate the capabilities of these methods to detect simulated check valve degradation. 3 refs., 22 figs., 4 tabs

  14. Improving palliative care outcomes for Aboriginal Australians: service providers' perspectives.

    Science.gov (United States)

    Shahid, Shaouli; Bessarab, Dawn; van Schaik, Katherine D; Aoun, Samar M; Thompson, Sandra C

    2013-07-23

    Aboriginal Australians have a lower rate of utilisation of palliative care services than the general population. This study aimed to explore care providers' experiences and concerns in providing palliative care for Aboriginal people, and to identify opportunities for overcoming gaps in understanding between them and their Aboriginal patients and families. In-depth, qualitative interviews with urban, rural and remote palliative care providers were undertaken in inpatient and community settings in Western Australia. Interviews were audio-recorded, transcribed verbatim and coded independently by two researchers with QSR NVivo 10 software used to help manage data. Data analysis was informed by multiple theoretical standpoints, including the social ecological model, critical cultural theories and the 'cultural security' framework. Thematic analysis was carried out that identified patterns within data. Fifteen palliative care providers were interviewed. Overall they reported lack of understanding of Aboriginal culture and being uncertain of the needs and priorities of Aboriginal people during end-of-life care. According to several participants, very few Aboriginal people had an understanding of palliative care. Managing issues such as anger, denial, the need for non-medical support due to socioeconomic disadvantage, and dealing with crises and conflicts over funeral arrangements were reported as some of the tensions between Aboriginal patients and families and the service providers. Early referral to palliative care is important in demonstrating and maintaining a caring therapeutic relationship. Paramount to meeting the needs for Aboriginal patients was access to appropriate information and logistical, psychological and emotional support. These were often seen as essential but additional to standard palliative care services. The broader context of Aboriginal history and historical distrust of mainstream services was seen to impinge on Aboriginal people's willingness and

  15. Provide good air quality for people and improve their productivity

    DEFF Research Database (Denmark)

    Fanger, Povl Ole

    2000-01-01

    Three recent independent studies have documented that the quality of indoor air has a significant and positive influence on the productivity of office workers. A combined analysis of the results of the three studies shows a significant relationship between productivity and perceived indoor air...... quality. The impact on productivity justifies a much higher indoor air quality than the minimum levels prescribed in present standards and guidelines. One way of providing air of high quality for people to breathe, without involving excessive ventilation rates and energy use, is to provide "personalized...... air" to each individual. The application of this concept is discussed....

  16. Method for providing uranium with a protective copper coating

    Science.gov (United States)

    Waldrop, Forrest B.; Jones, Edward

    1981-01-01

    The present invention is directed to a method for providing uranium metal with a protective coating of copper. Uranium metal is subjected to a conventional cleaning operation wherein oxides and other surface contaminants are removed, followed by etching and pickling operations. The copper coating is provided by first electrodepositing a thin and relatively porous flash layer of copper on the uranium in a copper cyanide bath. The resulting copper-layered article is then heated in an air or inert atmosphere to volatilize and drive off the volatile material underlying the copper flash layer. After the heating step an adherent and essentially non-porous layer of copper is electro-deposited on the flash layer of copper to provide an adherent, multi-layer copper coating which is essentially impervious to corrosion by most gases.

  17. System and Method for Providing a Climate Data Persistence Service

    Science.gov (United States)

    Schnase, John L. (Inventor); Ripley, III, William David (Inventor); Duffy, Daniel Q. (Inventor); Thompson, John H. (Inventor); Strong, Savannah L. (Inventor); McInerney, Mark (Inventor); Sinno, Scott (Inventor); Tamkin, Glenn S. (Inventor); Nadeau, Denis (Inventor)

    2018-01-01

    A system, method and computer-readable storage devices for providing a climate data persistence service. A system configured to provide the service can include a climate data server that performs data and metadata storage and management functions for climate data objects, a compute-storage platform that provides the resources needed to support a climate data server, provisioning software that allows climate data server instances to be deployed as virtual climate data servers in a cloud computing environment, and a service interface, wherein persistence service capabilities are invoked by software applications running on a client device. The climate data objects can be in various formats, such as International Organization for Standards (ISO) Open Archival Information System (OAIS) Reference Model Submission Information Packages, Archive Information Packages, and Dissemination Information Packages. The climate data server can enable scalable, federated storage, management, discovery, and access, and can be tailored for particular use cases.

  18. Improved Collaborative Transport Planning at Dutch Logistics Service Provider Fritom

    NARCIS (Netherlands)

    Buijs, Paul; Lopez Alvarez, Jose Alejandro; Veenstra, Marjolein; Roodbergen, Kees Jan

    2016-01-01

    We study the collaborative transport planning for two autonomous business units of Fritom, a Dutch logistics service provider. This difficult planning problem does not fit any existing type of vehicle routing problem proposed in the academic literature; therefore, we define a new problem class, the

  19. The New COIN of the Domestic Realm: How the Military Services Can Combine Emerging Warfighting Doctrine with Innovative Methods of Interagency Coordination to Provide Improved Disaster Response and Relief

    National Research Council Canada - National Science Library

    Hildebrand, Steven J

    2007-01-01

    ... for the establishment of basic services that underpin the counterinsurgency warfighting model can be successfully transferred to the task of providing support to civil authorities during disaster response operations...

  20. Improving Educational Outcomes by Providing Educational Services through Mobile Technology

    Directory of Open Access Journals (Sweden)

    Hosam Farouk El-Sofany

    2013-01-01

    Full Text Available The use of Computers, Networks, and Internet has successfully enabled educational institutions to provide their students and instructors with various online educational services. With the recent developments in M-learning and mobile technology, further possibilities are emerging to provide such services through mobile devices such as mobile phones and PDAs. By providing the educational services using wireless and mobile technologies, the educational institutions can potentially bring great convenience to those off-campus students who do not always have time to find Internet enabled computers to get the important educational information from their academic institutions. With the mobile or M-educational services, both the students and the instructors can access the services anytime and anywhere they want. This paper discusses those M-educational services that can be moved to the mobile platform and then presents the system prototype and architecture that integrate these services into the mobile technology platform. The paper will conclude with a description of the formative evaluation of the system prototype.

  1. An improvement on LSB+ method

    OpenAIRE

    Qazanfari, Kazem; Ghaemmaghami, Shahrokh

    2017-01-01

    The Least Significant Bit (LSB) substitution is an old and simple data hiding method that could almost effortlessly be implemented in spatial or transform domain over any digital media. This method can be attacked by several steganalysis methods, because it detectably changes statistical and perceptual characteristics of the cover signal. A typical method for steganalysis of the LSB substitution is the histogram attack that attempts to diagnose anomalies in the cover image's histogram. A well...

  2. Method for Providing Semiconductors Having Self-Aligned Ion Implant

    Science.gov (United States)

    Neudeck, Philip G. (Inventor)

    2014-01-01

    A method is disclosed that provides a self-aligned nitrogen-implant particularly suited for a Junction Field Effect Transistor (JFET) semiconductor device preferably comprised of a silicon carbide (SiC). This self-aligned nitrogen-implant allows for the realization of durable and stable electrical functionality of high temperature transistors such as JFETs. The method implements the self-aligned nitrogen-implant having predetermined dimensions, at a particular step in the fabrication process, so that the SiC junction field effect transistors are capable of being electrically operating continuously at 500.degree. C. for over 10,000 hours in an air ambient with less than a 10% change in operational transistor parameters.

  3. Method for providing a low density high strength polyurethane foam

    Science.gov (United States)

    Whinnery, Jr., Leroy L.; Goods, Steven H.; Skala, Dawn M.; Henderson, Craig C.; Keifer, Patrick N.

    2013-06-18

    Disclosed is a method for making a polyurethane closed-cell foam material exhibiting a bulk density below 4 lbs/ft.sup.3 and high strength. The present embodiment uses the reaction product of a modified MDI and a sucrose/glycerine based polyether polyol resin wherein a small measured quantity of the polyol resin is "pre-reacted" with a larger quantity of the isocyanate in a defined ratio such that when the necessary remaining quantity of the polyol resin is added to the "pre-reacted" resin together with a tertiary amine catalyst and water as a blowing agent, the polymerization proceeds slowly enough to provide a stable foam body.

  4. Quality Quandaries: Improving a customer value stream at a financial service provider

    NARCIS (Netherlands)

    Kuiper, A.; van de Hoef, R.; Wesseling, M.; Lameijer, B.A.; Does, R.J.M.M.

    2016-01-01

    In the wake of the financial crisis, the financial sector had to make tremendous efforts in being more transparent and cost efficient (Blom and Kuenen 2009). As a consequence, over the last decade, various financial service providers have embraced a range of methods for improving their customer

  5. Improving Providers' Role Definitions to Decrease Overcrowding and Improve In-Hospital Cardiac Arrest Response.

    Science.gov (United States)

    Leary, Marion; Schweickert, William; Neefe, Stacie; Tsypenyuk, Boris; Falk, Scott Austin; Holena, Daniel N

    2016-07-01

    How nontechnical factors such as inadequate role definition and overcrowding affect outcomes of in-hospital cardiac arrest (IHCA) is unknown. Using a bundled intervention, we sought to improve providers' role definitions and decrease overcrowding during IHCA events. To determine if a bundled intervention consisting of a nurse/physician leadership dyad, visual cues for provider roles, and a "role check" would lead to reductions in crowding and improve perceptions of communication and team leadership. Baseline data on the number and type of IHCA providers were collected. Providers were asked to complete a postevent survey rating communication and leadership. A bundled intervention was then introduced. Data were then obtained for the subsequent IHCA events. Twenty ICHA events were captured before and 34 after the intervention. The number of physicians present at pulse checks 2 (median [interquartile range]: 6 [5-8] before vs 5 [3-6] after, P = .02) and 3 (7 [5-9] vs 4 [4-5], P = .004) decreased significantly after the intervention. The overall number of providers at the third pulse check (18 [14-22] before vs 14 [12-16] after, P = .04) also decreased after the intervention. On a 10-point Likert scale, ratings of communication (8 [7-8]) and physician leadership (8 [7-9]) did not differ significantly from before to after the intervention. Both the physician leads (90%) and patients' primary nurses (97%) were able to identify clear nurse leaders. A bundled intervention targeted at improving IHCA response led to a decrease in overcrowding at ICHA events without substantial changes in the perceptions of communication or physician leadership. ©2016 American Association of Critical-Care Nurses.

  6. An improved selective sampling method

    International Nuclear Information System (INIS)

    Miyahara, Hiroshi; Iida, Nobuyuki; Watanabe, Tamaki

    1986-01-01

    The coincidence methods which are currently used for the accurate activity standardisation of radio-nuclides, require dead time and resolving time corrections which tend to become increasingly uncertain as countrates exceed about 10 K. To reduce the dependence on such corrections, Muller, in 1981, proposed the selective sampling method using a fast multichannel analyser (50 ns ch -1 ) for measuring the countrates. It is, in many ways, more convenient and possibly potentially more reliable to replace the MCA with scalers and a circuit is described employing five scalers; two of them serving to measure the background correction. Results of comparisons using our new method and the coincidence method for measuring the activity of 60 Co sources yielded agree-ment within statistical uncertainties. (author)

  7. Improved method for methane generation

    DEFF Research Database (Denmark)

    2010-01-01

    A method for treatment of a material comprising lignocellulosic fibres is disclosed. More particularly, the treatment increases the accessibility of the lignocellulosic fibres for following microbial or biological processes....

  8. Methods for safety culture improvement

    International Nuclear Information System (INIS)

    Sivintsev, Yu.V.

    1998-01-01

    New IAEA publication concerning the problems of safety assurance covering different aspects beginning from terminology applied and up to concrete examples of well and poor safety culture development at nuclear facilities is discussed. The safety culture is defined as such set of characteristics and specific activities of institutions and individual persons which states that safety problems of a nuclear facility are given the attention determined by their importance as being of highest priority. The statements of the new document have recommended, not mandatory character. It is emphasized that the process of safety culture improvement at nuclear facilities should be integral component of management procedure, not a bolt on extra

  9. Continuous improvement methods in the nuclear industry

    International Nuclear Information System (INIS)

    Heising, Carolyn D.

    1995-01-01

    The purpose of this paper is to investigate management methods for improved safety in the nuclear power industry. Process improvement management, methods of business process reengineering, total quality management, and continued process improvement (KAIZEN) are explored. The anticipated advantages of extensive use of improved process oriented management methods in the nuclear industry are increased effectiveness and efficiency in virtually all tasks of plant operation and maintenance. Important spin off include increased plant safety and economy. (author). 6 refs., 1 fig

  10. AIR Tools II: algebraic iterative reconstruction methods, improved implementation

    DEFF Research Database (Denmark)

    Hansen, Per Christian; Jørgensen, Jakob Sauer

    2017-01-01

    with algebraic iterative methods and their convergence properties. The present software is a much expanded and improved version of the package AIR Tools from 2012, based on a new modular design. In addition to improved performance and memory use, we provide more flexible iterative methods, a column-action method...

  11. 32 CFR 199.14 - Provider reimbursement methods.

    Science.gov (United States)

    2010-07-01

    ... physicians. (6) All services provided by nurse anesthetists. (7) All services related to discharges involving... more accurate data became available. (v) No update for inflation. The children's hospital differential... considered lower volume hospitals. (B) Hospitals that subsequently become higher volume hospitals. In any...

  12. Methodical Approaches to Communicative Providing of Retailer Branding

    Directory of Open Access Journals (Sweden)

    Andrey Kataev

    2017-07-01

    Full Text Available The thesis is devoted to the rationalization of methodical approaches for provision of branding of retail trade enterprises. The article considers the features of brand perception by retail consumers and clarifies the specifics of customer reviews of stores for the procedures accompanying brand management. It is proved that besides traditional communication mix, the most important tool of communicative influence on buyers is the store itself as a place for comfortable shopping. The shop should have a stimulating effect on all five human senses, including sight, smell, hearing, touch, and taste, which shall help maximize consumer integration into the buying process.

  13. Improved methods for operating public transportation services.

    Science.gov (United States)

    2013-03-01

    In this joint project, West Virginia University and the University of Maryland collaborated in developing improved methods for analyzing and managing public transportation services. Transit travel time data were collected using GPS tracking services ...

  14. An improved spatial contour tree constructed method

    Science.gov (United States)

    Zheng, Yi; Zhang, Ling; Guilbert, Eric; Long, Yi

    2018-05-01

    Contours are important data to delineate the landform on a map. A contour tree provides an object-oriented description of landforms and can be used to enrich the topological information. The traditional contour tree is used to store topological relationships between contours in a hierarchical structure and allows for the identification of eminences and depressions as sets of nested contours. This research proposes an improved contour tree so-called spatial contour tree that contains not only the topological but also the geometric information. It can be regarded as a terrain skeleton in 3-dimention, and it is established based on the spatial nodes of contours which have the latitude, longitude and elevation information. The spatial contour tree is built by connecting spatial nodes from low to high elevation for a positive landform, and from high to low elevation for a negative landform to form a hierarchical structure. The connection between two spatial nodes can provide the real distance and direction as a Euclidean vector in 3-dimention. In this paper, the construction method is tested in the experiment, and the results are discussed. The proposed hierarchical structure is in 3-demintion and can show the skeleton inside a terrain. The structure, where all nodes have geo-information, can be used to distinguish different landforms and applied for contour generalization with consideration of geographic characteristics.

  15. An improved calcium chloride method preparation and ...

    African Journals Online (AJOL)

    Transformation is one of the fundamental and essential molecular cloning techniques. In this paper, we have reported a modified method for preparation and transformation of competent cells. This modified method, improved from a classical protocol, has made some modifications on the concentration of calcium chloride ...

  16. Complementary and conventional providers in cancer care: experience of communication with patients and steps to improve communication with other providers.

    Science.gov (United States)

    Stub, Trine; Quandt, Sara A; Arcury, Thomas A; Sandberg, Joanne C; Kristoffersen, Agnete E

    2017-06-08

    Effective interdisciplinary communication is important to achieve better quality in health care. The aims of this study were to compare conventional and complementary providers' experience of communication about complementary therapies and conventional medicine with their cancer patients, and to investigate how they experience interdisciplinary communication and cooperation. This study analyzed data from a self-administrated questionnaire. A total of 606 different health care providers, from four counties in Norway, completed the questionnaire. The survey was developed to describe aspects of the communication pattern among oncology doctors, nurses, family physicians and complementary therapists (acupuncturists, massage therapists and reflexologists/zone-therapists). Between-group differences were analyzed using chi-square, ANOVA and Fisher's exact tests. Significance level was defined as p communication with their cancer patients regarding complementary therapies. While complementary therapists advised their patients to apply both complementary and conventional modalities, medical doctors were less supportive of their patients' use of complementary therapies. Of conventional providers, nurses expressed more positive attitudes toward complementary therapies. Opportunities to improve communication between conventional and complementary providers were most strongly supported by complementary providers and nurses; medical doctors were less supportive of such attempts. A number of doctors showed lack of respect for complementary therapists, but asked for more research, guidelines for complementary modalities and training in conventional medicine for complementary therapists. For better quality of care, greater communication about complementary therapy use is needed between cancer patients and their conventional and complementary providers. In addition, more communication between conventional and complementary providers is needed. Nurses may have a crucial role in

  17. Improved methods for high resolution electron microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, J.R.

    1987-04-01

    Existing methods of making support films for high resolution transmission electron microscopy are investigated and novel methods are developed. Existing methods of fabricating fenestrated, metal reinforced specimen supports (microgrids) are evaluated for their potential to reduce beam induced movement of monolamellar crystals of C/sub 44/H/sub 90/ paraffin supported on thin carbon films. Improved methods of producing hydrophobic carbon films by vacuum evaporation, and improved methods of depositing well ordered monolamellar paraffin crystals on carbon films are developed. A novel technique for vacuum evaporation of metals is described which is used to reinforce microgrids. A technique is also developed to bond thin carbon films to microgrids with a polymer bonding agent. Unique biochemical methods are described to accomplish site specific covalent modification of membrane proteins. Protocols are given which covalently convert the carboxy terminus of papain cleaved bacteriorhodopsin to a free thiol. 53 refs., 19 figs., 1 tab.

  18. A improved tidal method without water level

    Science.gov (United States)

    Luo, xiaowen

    2017-04-01

    Now most tide are obtained use water Level and pressure type water gage, but it is difficult to install them and reading is in low accuracy in this method . In view of above-mentioned facts, In order to improve tide accuracy, A improved method is introduced.sea level is obtained in given time using high-precision GNSS buoy combined instantaneous position from pressure gage. two steps are as following, (1) the GNSS time service is used as the source of synchronization reference in tidal measurement; (2) centimeter-level sea surface positions are obtained in real time using difference GNSS The improved method used in seafloor topography survey,in 145 cross points, 95% meet the requirements of the Hydrographic survey specification. It is effective method to obtain higher accuracy tide.

  19. Novel combined patient instruction and discharge summary tool improves timeliness of documentation and outpatient provider satisfaction

    Directory of Open Access Journals (Sweden)

    Meredith Gilliam

    2017-03-01

    Full Text Available Background: Incomplete or delayed access to discharge information by outpatient providers and patients contributes to discontinuity of care and poor outcomes. Objective: To evaluate the effect of a new electronic discharge summary tool on the timeliness of documentation and communication with outpatient providers. Methods: In June 2012, we implemented an electronic discharge summary tool at our 145-bed university-affiliated Veterans Affairs hospital. The tool facilitates completion of a comprehensive discharge summary note that is available for patients and outpatient medical providers at the time of hospital discharge. Discharge summary note availability, outpatient provider satisfaction, and time between the decision to discharge a patient and discharge note completion were all evaluated before and after implementation of the tool. Results: The percentage of discharge summary notes completed by the time of first post-discharge clinical contact improved from 43% in February 2012 to 100% in September 2012 and was maintained at 100% in 2014. A survey of 22 outpatient providers showed that 90% preferred the new summary and 86% found it comprehensive. Despite increasing required documentation, the time required to discharge a patient, from physician decision to discharge note completion, improved from 5.6 h in 2010 to 4.1 h in 2012 (p = 0.04, and to 2.8 h in 2015 (p < 0.001. Conclusion: The implementation of a novel discharge summary tool improved the timeliness and comprehensiveness of discharge information as needed for the delivery of appropriate, high-quality follow-up care, without adversely affecting the efficiency of the discharge process.

  20. A REVIEW OF ORDER PICKING IMPROVEMENT METHODS

    Directory of Open Access Journals (Sweden)

    Johan Oscar Ong

    2014-09-01

    Full Text Available As a crucial and one of the most important parts of warehousing, order picking often raises discussion between warehousing professionals, resulting in various studies aiming to analyze how order picking activity can be improved from various perspective. This paper reviews various past researches on order picking improvement, and the various methods those studies analyzed or developed. This literature review is based on twenty research articles on order picking improvement viewed from four different perspectives: Automation (specifically, stock-to-picker system, storage assignment policy, order batching, and order picking sequencing. By reviewing these studies, we try to identify the most prevalent order picking improvement approach to order picking improvement. Keywords: warehousing; stock-to-picker; storage assignment; order batching; order picking sequencing; improvement

  1. TRIZ method application for improving the special vehicles maintenance

    OpenAIRE

    Petrović Saša; Lozanović-Šajić Jasmina; Knežević Tijana; Pavlović Jovan; Ivanov Goran

    2014-01-01

    TRIZ methodology provides an opportunity for improving the classical engineering approach based on personal knowledge and experience. This paper presents the application of TRIZ methods for improving vehicle maintenance where special equipment is installed. A specific problem is the maintenance of the periscopes with heating system. Protective glass panels with heating system are rectangular glass elements. Their purpose is to perform mechanical protection ...

  2. Position detectors, methods of detecting position, and methods of providing positional detectors

    Science.gov (United States)

    Weinberg, David M.; Harding, L. Dean; Larsen, Eric D.

    2002-01-01

    Position detectors, welding system position detectors, methods of detecting various positions, and methods of providing position detectors are described. In one embodiment, a welding system positional detector includes a base that is configured to engage and be moved along a curved surface of a welding work piece. At least one position detection apparatus is provided and is connected with the base and configured to measure angular position of the detector relative to a reference vector. In another embodiment, a welding system positional detector includes a weld head and at least one inclinometer mounted on the weld head. The one inclinometer is configured to develop positional data relative to a reference vector and the position of the weld head on a non-planar weldable work piece.

  3. Exploring Service Providers' Perspectives in Improving Childhood Obesity Prevention among CALD Communities in Victoria, Australia

    Science.gov (United States)

    Cyril, Sheila; Green, Julie; Nicholson, Jan M.; Agho, Kingsley; Renzaho, Andre M. N.

    2016-01-01

    Background Childhood obesity rates have been increasing disproportionately among disadvantaged communities including culturally and linguistically diverse (CALD) migrant groups in Australia due to their poor participation in the available obesity prevention initiatives. We sought to explore service providers’ perceptions of the key factors influencing the participation of CALD communities in the existing obesity prevention services and the service requirements needed to improve CALD communities’ participation in these services. Methods We conducted a qualitative study using focus group discussions involving fifty-nine service providers from a range of services, who are involved in the health and wellbeing of children from CALD groups living in four socioeconomically disadvantaged areas in Victoria, Australia. Results Thematic analysis of the data showed three major themes including community-level barriers to CALD engagement in childhood obesity prevention services; service-level barriers to the delivery of these services; and proposed changes to current childhood obesity prevention approaches. Integrating obesity prevention messages within existing programs, better coordination between prevention and treatment services and the establishment of a childhood obesity surveillance system, were some of the important changes suggested by service providers. Conclusion This study has found that low CALD health literacy, lack of knowledge of cultural barriers among service providers and co-existing deficiencies in the structure and delivery of obesity prevention services negatively impacted the participation of CALD communities in obesity prevention services. Cultural competency training of service providers would improve their understanding of the cultural influences of childhood obesity and incorporate them into the design and development of obesity prevention initiatives. Service providers need to be educated on the pre-migratory health service experiences and health

  4. Improved method of measurement for outer leak

    International Nuclear Information System (INIS)

    Xu Guang

    2012-01-01

    Pneumatic pipeline is installed for the airborne radioactivity measurement equipment, air tightness and outer leak rate are essential for the testing of the characteristics, both in the national criteria and ISO standards, an improved practical method is available for the measurement of the outer air leak rate based on the engineering experiences for the equipment acceptance and testing procedure. (authors)

  5. Self-Study Guide for Florida VPK Provider Improvement Plan Development

    Science.gov (United States)

    Phillips, Beth M.; Mazzeo, Debbie; Smith, Kevin

    2016-01-01

    This Self-Study Guide has been developed to support Florida Voluntary Prekindergarten Providers (VPK) who are required to complete an improvement plan process (i.e., low-performing providers). The guide has sections that can be used during both the process of selecting target areas for an improvement plan and the process of implementing new or…

  6. Improved GLR method to instrument failure detection

    International Nuclear Information System (INIS)

    Jeong, Hak Yeoung; Chang, Soon Heung

    1985-01-01

    The generalized likehood radio(GLR) method performs statistical tests on the innovations sequence of a Kalman-Buchy filter state estimator for system failure detection and its identification. However, the major drawback of the convensional GLR is to hypothesize particular failure type in each case. In this paper, a method to solve this drawback is proposed. The improved GLR method is applied to a PWR pressurizer and gives successful results in detection and identification of any failure. Furthmore, some benefit on the processing time per each cycle of failure detection and its identification can be accompanied. (Author)

  7. Primary healthcare providers' views on improving sexual and reproductive healthcare for adolescents in Bolivia, Ecuador, and Nicaragua

    DEFF Research Database (Denmark)

    Jaruseviciene, L.; Orozco, M.; Ibarra, M.

    2013-01-01

    Objectives: To elicit the views of primary healthcare providers from Bolivia, Ecuador, and Nicaragua on how adolescent sexual and reproductive health (ASRH) care in their communities can be improved. Methods: Overall, 126 healthcare providers (46 from Bolivia, 39 from Ecuador, and 41 from Nicarag...

  8. Identifying barriers and improving communication between cancer service providers and Aboriginal patients and their families: the perspective of service providers

    Science.gov (United States)

    2013-01-01

    Background Aboriginal Australians experience poorer outcomes from cancer compared to the non-Aboriginal population. Some progress has been made in understanding Aboriginal Australians’ perspectives about cancer and their experiences with cancer services. However, little is known of cancer service providers’ (CSPs) thoughts and perceptions regarding Aboriginal patients and their experiences providing optimal cancer care to Aboriginal people. Communication between Aboriginal patients and non-Aboriginal health service providers has been identified as an impediment to good Aboriginal health outcomes. This paper reports on CSPs’ views about the factors impairing communication and offers practical strategies for promoting effective communication with Aboriginal patients in Western Australia (WA). Methods A qualitative study involving in-depth interviews with 62 Aboriginal and non-Aboriginal CSPs from across WA was conducted between March 2006 - September 2007 and April-October 2011. CSPs were asked to share their experiences with Aboriginal patients and families experiencing cancer. Thematic analysis was carried out. Our analysis was primarily underpinned by the socio-ecological model, but concepts of Whiteness and privilege, and cultural security also guided our analysis. Results CSPs’ lack of knowledge about the needs of Aboriginal people with cancer and Aboriginal patients’ limited understanding of the Western medical system were identified as the two major impediments to communication. For effective patient–provider communication, attention is needed to language, communication style, knowledge and use of medical terminology and cross-cultural differences in the concept of time. Aboriginal marginalization within mainstream society and Aboriginal people’s distrust of the health system were also key issues impacting on communication. Potential solutions to effective Aboriginal patient-provider communication included recruiting more Aboriginal staff

  9. Standard CMMIsm Appraisal Method for Process Improvement (SCAMPIsm), Version 1.1: Method Definition Document

    National Research Council Canada - National Science Library

    2001-01-01

    The Standard CMMI Appraisal Method for Process Improvement (SCAMPI(Service Mark)) is designed to provide benchmark quality ratings relative to Capability Maturity Model(registered) Integration (CMMI(Service Mark)) models...

  10. Improved Stereo Matching With Boosting Method

    Directory of Open Access Journals (Sweden)

    Shiny B

    2015-06-01

    Full Text Available Abstract This paper presents an approach based on classification for improving the accuracy of stereo matching methods. We propose this method for occlusion handling. This work employs classification of pixels for finding the erroneous disparity values. Due to the wide applications of disparity map in 3D television medical imaging etc the accuracy of disparity map has high significance. An initial disparity map is obtained using local or global stereo matching methods from the input stereo image pair. The various features for classification are computed from the input stereo image pair and the obtained disparity map. Then the computed feature vector is used for classification of pixels by using GentleBoost as the classification method. The erroneous disparity values in the disparity map found by classification are corrected through a completion stage or filling stage. A performance evaluation of stereo matching using AdaBoostM1 RUSBoost Neural networks and GentleBoost is performed.

  11. A Framework to Improve Communication and Reliability Between Cloud Consumer and Provider in the Cloud

    OpenAIRE

    Vivek Sridhar

    2014-01-01

    Cloud services consumers demand reliable methods for choosing appropriate cloud service provider for their requirements. Number of cloud consumer is increasing day by day and so cloud providers, hence requirement for a common platform for interacting between cloud provider and cloud consumer is also on the raise. This paper introduces Cloud Providers Market Platform Dashboard. This will act as not only just cloud provider discoverability but also provide timely report to consumer on cloud ser...

  12. A management framework for training providers to improve workplace skills development

    Directory of Open Access Journals (Sweden)

    C. Govender

    2007-12-01

    Full Text Available Purpose: Deputy President, Ms Phumzile Mlambo-Ngcuka, says a skills revolution is necessary for South Africa’s (SA skills crisis. The SA skills revolution began with the skills legislation of 1998-9 when the Departments of Labour (DOL and Education (DOE intended a seamless, integrated approach to rapid skills development. The National Skills Development Strategy (NSDS, the Sector Education and Training Providers (SETAs, the South African Qualifications Authorities (SAQA and the National Qualifications Framework (NQF were established to drive the human resource and skills development revolutionary strategy. The purpose of this paper is to present the findings of the 2001-3 research investigating an internal management framework for training providers, employers and managers to accelerate workplace skills development. Design/Methodology/Approach: An integrated, multi-method research model was employed to gather empirical evidence on skills practices. A robust quantitative survey was conducted within 600 organisations. Simultaneously, rich, descriptive data was gathered from managers and employees using a structured qualitative interview strategy. The integrated data pool was factor analysed. The research findings, conclusion and recommended framework were reported in a PhD thesis. Findings: The research findings reveal major gaps in the effectiveness of SA training providers to radically accelerate and improve workplace skills development as per national skills legislation, implementation and management criteria. Implications: If the skills revolution in SA is to succeed, training providers especially, must become less complacent, more assertive and fully equipped when participating in the skills development arena. Originality/Value: Via this research, training providers will gain critical, reflective insight into their management framework for meeting skills legislative criteria and for managing training interventions and skills projects.

  13. An improved loopless mounting method for cryocrystallography

    International Nuclear Information System (INIS)

    Jian-Xun, Qi; Fan, Jiang

    2010-01-01

    Based on a recent loopless mounting method, a simplified loopless and bufferless crystal mounting method is developed for macromolecular crystallography. This simplified crystal mounting system is composed of the following components: a home-made glass capillary, a brass seat for holding the glass capillary, a flow regulator, and a vacuum pump for evacuation. Compared with the currently prevalent loop mounting method, this simplified method has almost the same mounting procedure and thus is compatible with the current automated crystal mounting system. The advantages of this method include higher signal-to-noise ratio, more accurate measurement, more rapid flash cooling, less x-ray absorption and thus less radiation damage to the crystal. This method can be extended to the flash-freeing of a crystal without or with soaking it in a lower concentration of cryoprotectant, thus it may be the best option for data collection in the absence of suitable cryoprotectant. Therefore, it is suggested that this mounting method should be further improved and extensively applied to cryocrystallographic experiments. (general)

  14. An improved loopless mounting method for cryocrystallography

    Science.gov (United States)

    Qi, Jian-Xun; Jiang, Fan

    2010-01-01

    Based on a recent loopless mounting method, a simplified loopless and bufferless crystal mounting method is developed for macromolecular crystallography. This simplified crystal mounting system is composed of the following components: a home-made glass capillary, a brass seat for holding the glass capillary, a flow regulator, and a vacuum pump for evacuation. Compared with the currently prevalent loop mounting method, this simplified method has almost the same mounting procedure and thus is compatible with the current automated crystal mounting system. The advantages of this method include higher signal-to-noise ratio, more accurate measurement, more rapid flash cooling, less x-ray absorption and thus less radiation damage to the crystal. This method can be extended to the flash-freeing of a crystal without or with soaking it in a lower concentration of cryoprotectant, thus it may be the best option for data collection in the absence of suitable cryoprotectant. Therefore, it is suggested that this mounting method should be further improved and extensively applied to cryocrystallographic experiments.

  15. Analyzing and improving a chaotic encryption method

    International Nuclear Information System (INIS)

    Wu Xiaogang; Hu Hanping; Zhang Baoliang

    2004-01-01

    To resist the return map attack [Phys. Rev. Lett. 74 (1995) 1970] presented by Perez and Cerdeira, Shouliang Bu and Bing-Hong Wang proposed a simple method to improve the security of the chaotic encryption by modulating the chaotic carrier with an appropriately chosen scalar signal in [Chaos, Solitons and Fractals 19 (2004) 919]. They maintained that this modulating strategy not only preserved all appropriate information required for synchronizing chaotic systems but also destroyed the possibility of the phase space reconstruction of the sender dynamics such as a return map. However, a critical defect does exist in this scheme. This paper gives a zero-point autocorrelation method, which can recover the parameters of the scalar signal from the modulated signal. Consequently, the messages will be extracted from the demodulated chaotic carrier by using return map. Based on such a fact, an improved scheme is presented to obtain higher security, and the numerical simulation indicates the improvement of the synchronizing performance as well

  16. Improvement in PWR automatic optimization reloading methods using genetic algorithm

    International Nuclear Information System (INIS)

    Levine, S.H.; Ivanov, K.; Feltus, M.

    1996-01-01

    The objective of using automatic optimized reloading methods is to provide the Nuclear Engineer with an efficient method for reloading a nuclear reactor which results in superior core configurations that minimize fuel costs. Previous methods developed by Levine et al required a large effort to develop the initial core loading using a priority loading scheme. Subsequent modifications to this core configuration were made using expert rules to produce the final core design. Improvements in this technique have been made by using a genetic algorithm to produce improved core reload designs for PWRs more efficiently (authors)

  17. Improvement in PWR automatic optimization reloading methods using genetic algorithm

    Energy Technology Data Exchange (ETDEWEB)

    Levine, S H; Ivanov, K; Feltus, M [Pennsylvania State Univ., University Park, PA (United States)

    1996-12-01

    The objective of using automatic optimized reloading methods is to provide the Nuclear Engineer with an efficient method for reloading a nuclear reactor which results in superior core configurations that minimize fuel costs. Previous methods developed by Levine et al required a large effort to develop the initial core loading using a priority loading scheme. Subsequent modifications to this core configuration were made using expert rules to produce the final core design. Improvements in this technique have been made by using a genetic algorithm to produce improved core reload designs for PWRs more efficiently (authors).

  18. Improving reading comprehension through Reciprocal Teaching Method

    Directory of Open Access Journals (Sweden)

    Endang Komariah

    2015-10-01

    Full Text Available This study is aimed at discovering the benefits of the Reciprocal Teaching Method (RTM in the reading classroom, finding out the achievements of students after four comprehension training sessions of using RTM, and exploring the perceptions of students on the use of RTM. This method uses four comprehension strategies: predicting, questioning, clarifying, and summarizing, to help learners monitor their development of reading comprehension by themselves. Students work in groups of four or five and the members are divided into five roles which are the leader, predictor, clarifier, questioner, and summarizer. The subjects were 24 students from the twelfth grade at a high school in Banda Aceh. Observations, tests, documents and interviews were collected to get the data. The results showed that the students were more active and productive in the reading classroom after RTM sessions and their reading proficiency improved. They learnt how to apply several of the strategies from RTM while reading. The results also showed that they preferred this method for teaching-learning reading compared to the conventional one. Therefore, teachers are suggested to consider using this method for teaching reading that instils the students on how to apply the four comprehension strategies used in reading.

  19. [An Improved Spectral Quaternion Interpolation Method of Diffusion Tensor Imaging].

    Science.gov (United States)

    Xu, Yonghong; Gao, Shangce; Hao, Xiaofei

    2016-04-01

    Diffusion tensor imaging(DTI)is a rapid development technology in recent years of magnetic resonance imaging.The diffusion tensor interpolation is a very important procedure in DTI image processing.The traditional spectral quaternion interpolation method revises the direction of the interpolation tensor and can preserve tensors anisotropy,but the method does not revise the size of tensors.The present study puts forward an improved spectral quaternion interpolation method on the basis of traditional spectral quaternion interpolation.Firstly,we decomposed diffusion tensors with the direction of tensors being represented by quaternion.Then we revised the size and direction of the tensor respectively according to different situations.Finally,we acquired the tensor of interpolation point by calculating the weighted average.We compared the improved method with the spectral quaternion method and the Log-Euclidean method by the simulation data and the real data.The results showed that the improved method could not only keep the monotonicity of the fractional anisotropy(FA)and the determinant of tensors,but also preserve the tensor anisotropy at the same time.In conclusion,the improved method provides a kind of important interpolation method for diffusion tensor image processing.

  20. Developing methods for establishing improved plant reliability

    International Nuclear Information System (INIS)

    Zebroski, E.L.; Lapides, M.E.; Johnson, L.

    1976-01-01

    The current average capacity factor for nuclear electric generating facilities is approximately 60 percent, virtually the same as that for large, modern fossil-fired units. There is a clear cost advantage for nuclear electrical generation in comparison to coal-fired units at a common performance level. Because of the accelerated increase in capital and fuel costs of coal-fired units, the nuclear units will usually exhibit a cost advantage even when operating at lower capacity factor values. The incentives for improvement follow from the utility objectives to provide electricity at the most economical rates possible and are reflected in reduced system fuel costs and capital requirements. These objectives require maximizing the productivity of existing or planned investments in nuclear generation. The requirements are to: (1) achieve and sustain the highest capacity factor consistent with each utility's electric transmission system configuration and demand; (2) accelerate the rate of attainment of operational ''maturity'' of new generation; and (3) avoid low-probability but large-consequence forced-outage events. Nuclear unit productivity improvement involves utilities, regulatory agencies and industrial and government research and development organizations; the efforts appropriate to each organization were identified in a previous study. Since no foreseeable set of warranties begins to cover the consequential costs of low performance, the greatest incentive for improvement rests with each individual utility. The paper addresses the methodology and information sources for productivity actions by utilities during unit procurement and design phases

  1. Provider perceptions of an integrated primary care quality improvement strategy: The PPAQ toolkit.

    Science.gov (United States)

    Beehler, Gregory P; Lilienthal, Kaitlin R

    2017-02-01

    The Primary Care Behavioral Health (PCBH) model of integrated primary care is challenging to implement with high fidelity. The Primary Care Behavioral Health Provider Adherence Questionnaire (PPAQ) was designed to assess provider adherence to essential model components and has recently been adapted into a quality improvement toolkit. The aim of this pilot project was to gather preliminary feedback on providers' perceptions of the acceptability and utility of the PPAQ toolkit for making beneficial practice changes. Twelve mental health providers working in Department of Veterans Affairs integrated primary care clinics participated in semistructured interviews to gather quantitative and qualitative data. Descriptive statistics and qualitative content analysis were used to analyze data. Providers identified several positive features of the PPAQ toolkit organization and structure that resulted in high ratings of acceptability, while also identifying several toolkit components in need of modification to improve usability. Toolkit content was considered highly representative of the (PCBH) model and therefore could be used as a diagnostic self-assessment of model adherence. The toolkit was considered to be high in applicability to providers regardless of their degree of prior professional preparation or current clinical setting. Additionally, providers identified several system-level contextual factors that could impact the usefulness of the toolkit. These findings suggest that frontline mental health providers working in (PCBH) settings may be receptive to using an adherence-focused toolkit for ongoing quality improvement. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  2. Sodium oxybate therapy provides multidimensional improvement in fibromyalgia: results of an international phase 3 trial

    Science.gov (United States)

    Spaeth, Michael; Bennett, Robert M; Benson, Beverly A; Wang, Y Grace; Lai, Chinglin; Choy, Ernest H

    2012-01-01

    Background Fibromyalgia is characterised by chronic musculoskeletal pain and multiple symptoms including fatigue, multidimensional function impairment, sleep disturbance and tenderness. Along with pain and fatigue, non-restorative sleep is a core symptom of fibromyalgia. Sodium oxybate (SXB) is thought to reduce non-restorative sleep abnormalities. This study evaluated effects of SXB on fibromyalgia-related pain and other symptoms. Methods 573 patients with fibromyalgia according to 1990 American College of Rheumatology criteria were enrolled at 108 centres in eight countries. Subjects were randomly assigned to placebo, SXB 4.5 g/night or SXB 6 g/night. The primary efficacy endpoint was the proportion of subjects with ≥30% reduction in pain visual analogue scale from baseline to treatment end. Other efficacy assessments included function, sleep quality, effect of sleep on function, fatigue, tenderness, health-related quality of life and subject's impression of change in overall wellbeing. Results Significant improvements in pain, sleep and other symptoms associated with fibromyalgia were seen in SXB treated subjects compared with placebo. The proportion of subjects with ≥30% pain reduction was 42.0% for SXB4.5 g/night (p=0.002) and 51.4% for SXB6 g/night (pQuality of sleep (Jenkins sleep scale) improved by 20% for SXB4.5 g/night (p≤0.001) and 25% for SXB6 g/night (p≤0.001) versus 0.5% for placebo. Adverse events with an incidence ≥5% and twice placebo were nausea, dizziness, vomiting, insomnia, anxiety, somnolence, fatigue, muscle spasms and peripheral oedema. Conclusion These results, combined with findings from previous phase 2 and 3 studies, provide supportive evidence that SXB therapy affordsimportant benefits across multiple symptoms in subjects with fibromyalgia. PMID:22294641

  3. Contemporary management of median arcuate ligament syndrome provides early symptom improvement

    Science.gov (United States)

    Columbo, Jesse A.; Trus, Thadeus; Nolan, Brian; Goodney, Philip; Rzucidlo, Eva; Powell, Richard; Walsh, Daniel; Stone, David

    2017-01-01

    Objective Optimal diagnosis and management of median arcuate ligament (MAL) syndrome (MALS) remains unclear in contemporary practice. The advent and evolution of laparoscopic and endovascular techniques has redirected management toward a less invasive therapeutic algorithm. This study examined our contemporary outcomes of patients treated for MALS. Methods All patients treated for MALS at Dartmouth-Hitchcock Medical Center from 2000 to 2013 were retrospectively reviewed. Demographics and comorbidities were recorded. Freedom from symptoms and freedom from reintervention were the primary end points. Return to work or school was assessed. Follow-up by clinic visits and telephone allowed quantitative comparisons among the patients. Results During the study interval, 21 patients (24% male), with a median age of 42 years, were treated for MALS. All patients complained of abdominal pain in the presence of a celiac stenosis, 16 (76%) also reported weight loss at the time of presentation, and 57% had a concomitant psychiatric history. Diagnostic imaging most commonly used included duplex ultrasound (81%), computed tomography angiography (66%), angiography (57%), and magnetic resonance angiography (5%). Fourteen patients (67%) underwent multiple diagnostic studies. All patients underwent initial laparoscopic MAL release. Seven patients (33%) underwent subsequent celiac stent placement in the setting of recurrent or unresolved symptoms with persistent celiac stenosis at a mean interval of 49 days. Two patients required surgical bypass after an endovascular intervention failed. The 6-month freedom from symptoms was 75% and freedom from reintervention was 64%. Eighteen patients (81%) reported early symptom improvement and weight gain, and 66% were able to return to work. Conclusions A multidisciplinary treatment approach using initial laparoscopic release and subsequent stent placement and bypass surgery provides symptom improvement in most patients treated for MALS. The

  4. Management of natural health products in pediatrics: a provider-focused quality improvement project.

    Science.gov (United States)

    Gutierrez, Emily; Silbert-Flagg, JoAnne; Vohra, Sunita

    2015-01-01

    The use of natural health products by pediatric patients is common, yet health care providers often do not provide management guidance. The purpose of this project was to improve management of natural health products by pediatric nurse practitioners. Pediatric nurse practitioners from large metropolitan city were recruited (n = 32). A paired pretest-posttest design was used. Study participants were engaged to improve knowledge of natural health products, and a management toolkit was created and tested. Mean knowledge scores increased from 59.19 to 76.3 (p improved with regard to patient guidance (p product use (p = .51) and drug/herb interactions (p = .35) were not significant. This investigation is the first known study to improve knowledge and management of natural health products in pediatric clinical practice. Copyright © 2015 National Association of Pediatric Nurse Practitioners. Published by Elsevier Inc. All rights reserved.

  5. Modifying Provider Practice To Improve Assessment of Unhealthy Weight and Lifestyle in Young Children: Translating Evidence in a Quality Improvement Initiative for At-Risk Children.

    Science.gov (United States)

    Camp, Nadine L; Robert, Rebecca C; Nash, Jessica E; Lichtenstein, Cara B; Dawes, Candice S; Kelly, Katherine Patterson

    2017-06-01

    We designed a quality improvement (QI) project to address the high prevalence of childhood overweight and obesity (OW/OB) in our patient population and the inconsistencies among primary care providers in recognizing and addressing OW/OB. We used mixed methods data collection approach to evaluate a QI project, the Childhood Healthy Behaviors Intervention (CHBI), to improve provider obesity prevention practice in two low-income, predominantly African American pediatric primary care clinics. Electronic record data were extracted from all 2-9 year well visits pre- and postintervention for frequency of appropriate diagnostic coding of OW/OB. We reviewed a random sample of records for details of health habit assessment and counseling documentation. Focused interviews were conducted to elicit provider responses regarding impressions of the intervention. The preintervention sample of records (n = 267) was extracted from 18 providers and the postsample (n = 253) from 19 providers. Providers showed improvement in the recognition of OW/OB with appropriate diagnostic coding (52% pre, 68% post), improvement in assessment of health habits informed by the habit survey (0% pre, 76% post), improvement in counseling of healthy behaviors (86% pre, 92% post), and improvement in goal setting of healthy behaviors (12% pre, 70% post). Our findings suggest that implementing a time efficient primary care intervention with brief provider training can improve provider recognition of OW/OB, as well as improve provider behavior targeted at childhood obesity prevention. This project contributes needed QI evidence on interventions to prevent and address OW/OB in primary care settings and calls for further work to strengthen implementation in similar contexts.

  6. Better Together: Co-Location of Dental and Primary Care Provides Opportunities to Improve Oral Health.

    Science.gov (United States)

    Pourat, Nadereh; Martinez, Ana E; Crall, James J

    2015-09-01

    Community Health Centers (CHCs) are one of the principal safety-net providers of health care for low-income and uninsured populations. Co-locating dental services in primary care settings provides an opportunity to improve access to dental care. Yet this study of California CHCs that provide primary care services shows that only about one-third of them co-located primary and dental care services on-site. An additional one-third were members of multisite organizations in which at least one other site provided dental care. The remaining one-third of CHC sites had no dental care capacity. Policy options to promote co-location include requiring on-site availability of dental services, providing infrastructure funding to build and equip dental facilities, and offering financial incentives to provide dental care and recruit dental providers.

  7. Provider-Payer Partnerships as an Engine for Continuous Quality Improvement.

    Science.gov (United States)

    Balfour, Margaret E; Zinn, Tylar E; Cason, Karena; Fox, Jerimya; Morales, Myra; Berdeja, Cesar; Gray, Jay

    2018-03-01

    The authors describe a quality improvement approach in which a crisis center and a payer collaborate to improve care. Each crisis visit is considered as a potentially missed opportunity for community stabilization. Daily data on crisis visits are sent to the payer for a more up-to-date analysis of trends than is possible with financial claims data, which may lag behind services provided by up to 90 days. Using these trend data, the two organizations collaborate to identify patterns that lead to opportunities for improvement and develop multiple rapid-cycle projects for better management of services, resulting in significant decreases in readmissions and in the number of high utilizers.

  8. Capacity and readiness for quality improvement among home and community-based service providers.

    Science.gov (United States)

    Abrahamson, Kathleen; Myers, Jaclyn; Arling, Greg; Davila, Heather; Mueller, Christine; Abery, Brian; Cai, Yun

    2016-01-01

    The objective of this study was to explore home and community-based service (HCBS) providers' perspectives of organizational readiness for quality improvement (QI). Data were obtained from a survey of participants (N = 56) in a state-sponsored HCBS QI initiative. Quality improvement challenges included lack of time and resources, staff apprehension or resistance, resistance from consumers and families, and project sustainability. Support from leadership was viewed as an important factor in participating organizations' decision to engage in QI. Internal resources available to support QI varied widely between participating organizations, with differences observed between smaller and larger agencies, as well as between provider types and populations served.

  9. TRIZ method application for improving the special vehicles maintenance

    Directory of Open Access Journals (Sweden)

    Petrović Saša

    2014-01-01

    Full Text Available TRIZ methodology provides an opportunity for improving the classical engineering approach based on personal knowledge and experience. This paper presents the application of TRIZ methods for improving vehicle maintenance where special equipment is installed. A specific problem is the maintenance of the periscopes with heating system. Protective glass panels with heating system are rectangular glass elements. Their purpose is to perform mechanical protection of built-in prisms and provide heating of the prisms. Aging and long-term use leads to failure of these elements. The practice requires solutions in order to extend the lifetime of the system. New solution is evaluated by simulation and experiment.

  10. Identifying barriers and improving communication between cancer service providers and Aboriginal patients and their families: the perspective of service providers.

    Science.gov (United States)

    Shahid, Shaouli; Durey, Angela; Bessarab, Dawn; Aoun, Samar M; Thompson, Sandra C

    2013-11-04

    Aboriginal Australians experience poorer outcomes from cancer compared to the non-Aboriginal population. Some progress has been made in understanding Aboriginal Australians' perspectives about cancer and their experiences with cancer services. However, little is known of cancer service providers' (CSPs) thoughts and perceptions regarding Aboriginal patients and their experiences providing optimal cancer care to Aboriginal people. Communication between Aboriginal patients and non-Aboriginal health service providers has been identified as an impediment to good Aboriginal health outcomes. This paper reports on CSPs' views about the factors impairing communication and offers practical strategies for promoting effective communication with Aboriginal patients in Western Australia (WA). A qualitative study involving in-depth interviews with 62 Aboriginal and non-Aboriginal CSPs from across WA was conducted between March 2006-September 2007 and April-October 2011. CSPs were asked to share their experiences with Aboriginal patients and families experiencing cancer. Thematic analysis was carried out. Our analysis was primarily underpinned by the socio-ecological model, but concepts of Whiteness and privilege, and cultural security also guided our analysis. CSPs' lack of knowledge about the needs of Aboriginal people with cancer and Aboriginal patients' limited understanding of the Western medical system were identified as the two major impediments to communication. For effective patient-provider communication, attention is needed to language, communication style, knowledge and use of medical terminology and cross-cultural differences in the concept of time. Aboriginal marginalization within mainstream society and Aboriginal people's distrust of the health system were also key issues impacting on communication. Potential solutions to effective Aboriginal patient-provider communication included recruiting more Aboriginal staff, providing appropriate cultural training for CSPs

  11. A Mixed-Methods Research Framework for Healthcare Process Improvement.

    Science.gov (United States)

    Bastian, Nathaniel D; Munoz, David; Ventura, Marta

    2016-01-01

    The healthcare system in the United States is spiraling out of control due to ever-increasing costs without significant improvements in quality, access to care, satisfaction, and efficiency. Efficient workflow is paramount to improving healthcare value while maintaining the utmost standards of patient care and provider satisfaction in high stress environments. This article provides healthcare managers and quality engineers with a practical healthcare process improvement framework to assess, measure and improve clinical workflow processes. The proposed mixed-methods research framework integrates qualitative and quantitative tools to foster the improvement of processes and workflow in a systematic way. The framework consists of three distinct phases: 1) stakeholder analysis, 2a) survey design, 2b) time-motion study, and 3) process improvement. The proposed framework is applied to the pediatric intensive care unit of the Penn State Hershey Children's Hospital. The implementation of this methodology led to identification and categorization of different workflow tasks and activities into both value-added and non-value added in an effort to provide more valuable and higher quality patient care. Based upon the lessons learned from the case study, the three-phase methodology provides a better, broader, leaner, and holistic assessment of clinical workflow. The proposed framework can be implemented in various healthcare settings to support continuous improvement efforts in which complexity is a daily element that impacts workflow. We proffer a general methodology for process improvement in a healthcare setting, providing decision makers and stakeholders with a useful framework to help their organizations improve efficiency. Published by Elsevier Inc.

  12. Reducing Anxiety and Improving Engagement in Health Care Providers Through an Auricular Acupuncture Intervention.

    Science.gov (United States)

    Buchanan, Teresa M; Reilly, Patricia M; Vafides, Carol; Dykes, Patricia

    Stress and anxiety are experienced by health care providers as a consequence of caregiving and may result in physical, emotional, and psychological outcomes that negatively impact work engagement. The purpose of this study was to determine whether auricular acupuncture can reduce provider anxiety and improve work engagement. Study participants received 5 auricular acupuncture sessions within a 16-week period utilizing the National Acupuncture Detoxification Association protocol for treating emotional trauma. Each participant completed the State-Trait Anxiety Inventory and the Utrecht Work Engagement Scale (UWES-9) prior to their first session and again after their fifth treatment. Significant reductions were found in state and trait anxiety (State-Trait Anxiety Inventory), as well as significant increases in the overall scores on the UWES as compared with baseline. Only the dedication subcategory of the UWES showed significant improvement. Engagement has been linked to increased productivity and well-being and improved patient and organizational outcomes. Providing effective strategies such as auricular acupuncture to support health care providers in reducing anxiety in the workplace may improve engagement.

  13. Iraqi primary care system in Kurdistan region: providers' perspectives on problems and opportunities for improvement.

    Science.gov (United States)

    Shabila, Nazar P; Al-Tawil, Namir G; Al-Hadithi, Tariq S; Sondorp, Egbert; Vaughan, Kelsey

    2012-09-27

    As part of a comprehensive study on the primary health care system in Iraq, we sought to explore primary care providers' perspectives about the main problems influencing the provision of primary care services and opportunities to improve the system. A qualitative study based on four focus groups involving 40 primary care providers from 12 primary health care centres was conducted in Erbil governorate in the Iraqi Kurdistan region between July and October 2010. A topic guide was used to lead discussions and covered questions on positive aspects of and current problems with the primary care system in addition to the priority needs for its improvement. The discussions were fully transcribed and the qualitative data was analyzed by content analysis, followed by a thematic analysis. Problems facing the primary care system included inappropriate health service delivery (irrational use of health services, irrational treatment, poor referral system, poor infrastructure and poor hygiene), health workforce challenges (high number of specialists, uneven distribution of the health workforce, rapid turnover, lack of training and educational opportunities and discrepancies in the salary system), shortage in resources (shortage and low quality of medical supplies and shortage in financing), poor information technology and poor leadership/governance. The greatest emphasis was placed on poor organization of health services delivery, particularly the irrational use of health services and the related overcrowding and overload on primary care providers and health facilities. Suggestions for improving the system included application of a family medicine approach and ensuring effective planning and monitoring. This study has provided a comprehensive understanding of the factors that negatively affect the primary care system in Iraq's Kurdistan region from the perspective of primary care providers. From their experience, primary care providers have a role in informing the community and

  14. A novel method of providing a library of n-mers or biopolymers

    DEFF Research Database (Denmark)

    2012-01-01

    The present invention relates to a method of providing a library of n-mer sequences, wherein the library is composed of an n-mer sequence. Also the invention concerns a method of providing a library of biopolymer sequences having one or more n-mers in common. Further provided are specific primers...

  15. Provider Communication, Prompts, and Feedback to Improve HPV Vaccination Rates in Resident Clinics.

    Science.gov (United States)

    Rand, Cynthia M; Schaffer, Stanley J; Dhepyasuwan, Nui; Blumkin, Aaron; Albertin, Christina; Serwint, Janet R; Darden, Paul M; Humiston, Sharon G; Mann, Keith J; Stratbucker, William; Szilagyi, Peter G

    2018-04-01

    Human papillomavirus (HPV) vaccination rates lag behind vaccination rates for other adolescent vaccines; a bundled intervention may improve HPV vaccination rates. Our objective is to evaluate the impact of quality improvement (QI) training plus a bundled practice-based intervention (provider prompts plus communication skills training plus performance feedback) on improving HPV vaccinations in pediatric resident continuity clinics. Staff and providers in 8 resident clinics participated in a 12-month QI study. The intervention included training to strengthen provider communication about the HPV vaccine. Clinics also implemented provider prompts, received monthly performance feedback, and participated in learning collaborative calls. The primary outcome measure was eligible visits with vaccination divided by vaccine-eligible visits (captured HPV vaccination opportunities). Practices performed chart audits that were fed into monthly performance feedback on captured HPV vaccination opportunities. We used conditional logistic regression (conditioning on practice) to assess captured vaccination opportunities, with the time period of the study (before and after the QI intervention) as the independent variable. Overall, captured opportunities for HPV vaccination increased by 16.4 percentage points, from 46.9% to 63.3%. Special cause was demonstrated by centerline shift, with 8 consecutive points above the preintervention mean. On adjusted analyses, patients were more likely to receive a vaccine during, versus before, the intervention (odds ratio: 1.87; 95% confidence interval: 1.54-2.28). Captured HPV vaccination rates improved at both well-child and other visits (by 11.7 and 13.0 percentage points, respectively). A bundled intervention of provider prompts and training in communication skills plus performance feedback increased captured opportunities for HPV vaccination. Copyright © 2018 by the American Academy of Pediatrics.

  16. Provide a model to improve the performance of intrusion detection systems in the cloud

    OpenAIRE

    Foroogh Sedighi

    2016-01-01

    High availability of tools and service providers in cloud computing and the fact that cloud computing services are provided by internet and deal with public, have caused important challenges for new computing model. Cloud computing faces problems and challenges such as user privacy, data security, data ownership, availability of services, and recovery after breaking down, performance, scalability, programmability. So far, many different methods are presented for detection of intrusion in clou...

  17. A management framework for training providers to improve skills development in the workplace

    OpenAIRE

    2011-01-01

    D.Ed. A skills revolution was launched in the South African workplace by the Department of Labour in 1998. Various skills development legislation were introduced to meet international standards, redress skills imbalances, curb skills shortages and improve the general skills in the current workforce. Training providers were the drivers of workplace training, yet are now displaced by skills authorities, such as the SET As, the ETQAs and SAQA. While the custody of skills development is placed...

  18. Blood Pressure Directed Booster Trainings Improve Intensive Care Unit Provider Retention of Excellent Cardiopulmonary Resuscitation Skills.

    Science.gov (United States)

    Wolfe, Heather; Maltese, Matthew R; Niles, Dana E; Fischman, Elizabeth; Legkobitova, Veronika; Leffelman, Jessica; Berg, Robert A; Nadkarni, Vinay M; Sutton, Robert M

    2015-11-01

    Brief, intermittent cardiopulmonary resuscitation (CPR) training sessions, "Booster Trainings," improve CPR skill acquisition and short-term retention. The objective of this study was to incorporate arterial blood pressure (ABP) tracings into Booster Trainings to improve CPR skill retention. We hypothesized that ABP-directed CPR "Booster Trainings" would improve intensive care unit (ICU) provider 3-month retention of excellent CPR skills without need for interval retraining. A CPR manikin creating a realistic relationship between chest compression depth and ABP was used for training/testing. Thirty-six ICU providers were randomized to brief, bedside ABP-directed CPR manikin skill retrainings: (1) Booster Plus (ABP visible during training and testing) versus (2) Booster Alone (ABP visible only during training, not testing) versus (3) control (testing, no intervention). Subjects completed skill tests pretraining (baseline), immediately after training (acquisition), and then retention was assessed at 12 hours, 3 and 6 months. The primary outcome was retention of excellent CPR skills at 3 months. Excellent CPR was defined as systolic blood pressure of 100 mm Hg or higher and compression rate 100 to 120 per minute. Overall, 14 of 24 (58%) participants acquired excellent CPR skills after their initial training (Booster Plus 75% vs 50% Booster Alone, P = 0.21). Adjusted for age, ABP-trained providers were 5.2× more likely to perform excellent CPR after the initial training (95% confidence interval [95% CI], 1.3-21.2; P = 0.02), and to retain these skills at 12 hours (adjusted odds ratio, 4.4; 95% CI, 1.3-14.9; P = 0.018) and 3 months (adjusted odds ratio, 4.1; 95% CI, 1.2-13.9; P = 0.023) when compared to baseline performance. The ABP-directed CPR booster trainings improved ICU provider 3-month retention of excellent CPR skills without the need for interval retraining.

  19. Hyper-Realistic, Team-Centered Fleet Surgical Team Training Provides Sustained Improvements in Performance.

    Science.gov (United States)

    Hoang, Tuan N; Kang, Jeff; Siriratsivawong, Kris; LaPorta, Anthony; Heck, Amber; Ferraro, Jessica; Robinson, Douglas; Walsh, Jonathan

    2016-01-01

    The high-stress, fast-paced environment of combat casualty care relies on effective teamwork and communication which translates into quality patient care. A training course was developed for U.S. Navy Fleet Surgical Teams to address these aspects of patient care by emphasizing efficiency and appropriate patient care. An effective training course provides knowledge and skills to pass the course evaluation and sustain the knowledge and skills acquired over time. The course included classroom didactic hours, and hands-on simulation sessions. A pretest was administered before the course, a posttest upon completion, and a sustainment test 5 months following course completion. The evaluation process measured changes in patient time to disposition and critical errors made during patient care. Naval Base San Diego, with resuscitation and surgical simulations carried out within the shipboard medical spaces. United States Navy medical personnel including physicians of various specialties, corpsmen, nurses, and nurse anesthetists deploying aboard ships. Time to disposition improved significantly, 11 ± 3 minutes, from pretest to posttest, and critical errors improved by 4 ± 1 errors per encounter. From posttest to sustainment test, time to disposition increased by 3 ± 1, and critical errors decreased by 1 ± 1. This course showed value in improving teamwork and communication skills of participants, immediately upon completion of the course, and after 5 months had passed. Therefore, with ongoing sustainment activities within 6 months, this course can substantially improve trauma care provided by shipboard deployed Navy medical personnel to wounded service members. Published by Elsevier Inc.

  20. A Qualitative Study of Multidisciplinary Providers' Experiences With the Transfer Process for Injured Children and Ideas for Improvement.

    Science.gov (United States)

    Gawel, Marcie; Emerson, Beth; Giuliano, John S; Rosenberg, Alana; Minges, Karl E; Feder, Shelli; Violano, Pina; Morrell, Patricia; Petersen, Judy; Christison-Lagay, Emily; Auerbach, Marc

    2018-02-01

    Most injured children initially present to a community hospital, and many will require transfer to a regional pediatric trauma center. The purpose of this study was 1) to explore multidisciplinary providers' experiences with the process of transferring injured children and 2) to describe proposed ideas for process improvement. This qualitative study involved 26 semistructured interviews. Subjects were recruited from 6 community hospital emergency departments and the trauma and transport teams of a level I pediatric trauma center in New Haven, Conn. Participants (n = 34) included interprofessional providers from sending facilities, transport teams, and receiving facilities. Using the constant comparative method, a multidisciplinary team coded transcripts and collectively refined codes to generate recurrent themes across interviews until theoretical saturation was achieved. Participants reported that the transfer process for injured children is complex, stressful, and necessitates collaboration. The transfer process was perceived to involve numerous interrelated components, including professions, disciplines, and institutions. The 5 themes identified as areas to improve this transfer process included 1) Creation of a unified standard operating procedure that crosses institutions/teams, 2) Enhancing 'shared sense making' of all providers, 3) Improving provider confidence, expertise, and skills in caring for pediatric trauma transfer cases, 4) Addressing organization and environmental factors that may impede/delay transfer, and 5) Fostering institutional and personal relationships. Efforts to improve the transfer process for injured children should be guided by the experiences of and input from multidisciplinary frontline emergency providers.

  1. Efficiency and hospital effectiveness in improving Hospital Consumer Assessment of Healthcare Providers and Systems ratings.

    Science.gov (United States)

    Al-Amin, Mona; Makarem, Suzanne C; Rosko, Michael

    2016-01-01

    Efficiency has emerged as a central goal to the operations of health care organizations. There are two competing perspectives on the relationship between efficiency and organizational performance. Some argue that organizational slack is a waste and that efficiency contributes to organizational performance, whereas others maintain that slack acts as a buffer, allowing organizations to adapt to environmental demands and contributing to organizational performance. As value-based purchasing becomes more prevalent, health care organizations are incented to become more efficient and, at the same time, improve their patients' experiences and outcomes. Unused slack resources might facilitate the timely implementation of these improvements. Building on previous research on organizational slack and inertia, we test whether efficiency and other organizational factors predict organizational effectiveness in improving Hospital Consumer Assessment of Healthcare Providers and Systems (HCAHPS) ratings. We rely on data from the American Hospital Association and HCAHPS. We estimate hospital cost-efficiency by Stochastic Frontier Analysis and use regression analysis to determine whether efficiency, competition, hospital size, and other organizational factors are significant predictors of hospital effectiveness. Our findings indicate that efficiency and hospital size have a significant negative association with organizational ability to improve HCAHPS ratings. Although achieving organizational efficiency is necessary for health care organizations, given the changes that are currently occurring in the U.S. health care system, it is important for health care managers to maintain a certain level of slack to respond to environmental demands and have the resources needed to improve their performance.

  2. Provider and Patient Directed Financial Incentives to Improve Care and Outcomes for Patients with Diabetes

    Science.gov (United States)

    Lorincz, Ilona S.; Lawson, Brittany C. T.

    2012-01-01

    Incentive programs directed at both providers and patients have become increasingly widespread. Pay-for-performance (P4P) where providers receive financial incentives to carry out specific care or improve clinical outcomes has been widely implemented. The existing literature indicates they probably spur initial gains which then level off or partially revert if incentives are withdrawn. The literature also indicates that process measures are easier to influence through P4P programs but that intermediate outcomes such as glucose, blood pressure, and cholesterol control are harder to influence, and the long term impact of P4P programs on health is largely unknown. Programs directed at patients show greater promise as a means to influence patient behavior and intermediate outcomes such as weight loss; however, the evidence for long term effects are lacking. In combination, both patient and provider incentives are potentially powerful tools but whether they are cost-effective has yet to be determined. PMID:23225214

  3. Exploring Service Providers' Perspectives in Improving Childhood Obesity Prevention among CALD Communities in Victoria, Australia.

    Directory of Open Access Journals (Sweden)

    Sheila Cyril

    Full Text Available Childhood obesity rates have been increasing disproportionately among disadvantaged communities including culturally and linguistically diverse (CALD migrant groups in Australia due to their poor participation in the available obesity prevention initiatives. We sought to explore service providers' perceptions of the key factors influencing the participation of CALD communities in the existing obesity prevention services and the service requirements needed to improve CALD communities' participation in these services.We conducted a qualitative study using focus group discussions involving fifty-nine service providers from a range of services, who are involved in the health and wellbeing of children from CALD groups living in four socioeconomically disadvantaged areas in Victoria, Australia.Thematic analysis of the data showed three major themes including community-level barriers to CALD engagement in childhood obesity prevention services; service-level barriers to the delivery of these services; and proposed changes to current childhood obesity prevention approaches. Integrating obesity prevention messages within existing programs, better coordination between prevention and treatment services and the establishment of a childhood obesity surveillance system, were some of the important changes suggested by service providers.This study has found that low CALD health literacy, lack of knowledge of cultural barriers among service providers and co-existing deficiencies in the structure and delivery of obesity prevention services negatively impacted the participation of CALD communities in obesity prevention services. Cultural competency training of service providers would improve their understanding of the cultural influences of childhood obesity and incorporate them into the design and development of obesity prevention initiatives. Service providers need to be educated on the pre-migratory health service experiences and health conditions of CALD

  4. Exploring Service Providers' Perspectives in Improving Childhood Obesity Prevention among CALD Communities in Victoria, Australia.

    Science.gov (United States)

    Cyril, Sheila; Green, Julie; Nicholson, Jan M; Agho, Kingsley; Renzaho, Andre M N

    2016-01-01

    Childhood obesity rates have been increasing disproportionately among disadvantaged communities including culturally and linguistically diverse (CALD) migrant groups in Australia due to their poor participation in the available obesity prevention initiatives. We sought to explore service providers' perceptions of the key factors influencing the participation of CALD communities in the existing obesity prevention services and the service requirements needed to improve CALD communities' participation in these services. We conducted a qualitative study using focus group discussions involving fifty-nine service providers from a range of services, who are involved in the health and wellbeing of children from CALD groups living in four socioeconomically disadvantaged areas in Victoria, Australia. Thematic analysis of the data showed three major themes including community-level barriers to CALD engagement in childhood obesity prevention services; service-level barriers to the delivery of these services; and proposed changes to current childhood obesity prevention approaches. Integrating obesity prevention messages within existing programs, better coordination between prevention and treatment services and the establishment of a childhood obesity surveillance system, were some of the important changes suggested by service providers. This study has found that low CALD health literacy, lack of knowledge of cultural barriers among service providers and co-existing deficiencies in the structure and delivery of obesity prevention services negatively impacted the participation of CALD communities in obesity prevention services. Cultural competency training of service providers would improve their understanding of the cultural influences of childhood obesity and incorporate them into the design and development of obesity prevention initiatives. Service providers need to be educated on the pre-migratory health service experiences and health conditions of CALD communities to ensure

  5. An improved calcium chloride method preparation and ...

    African Journals Online (AJOL)

    Jane

    2010-12-13

    Dec 13, 2010 ... In this paper, we have reported a modified method for preparation and transformation of competent cells. This modified ... MATERIALS AND METHODS. Growth media ..... lipidic phase-transition temperature, and thus enhance.

  6. On the Exploitation of Sensitivity Derivatives for Improving Sampling Methods

    Science.gov (United States)

    Cao, Yanzhao; Hussaini, M. Yousuff; Zang, Thomas A.

    2003-01-01

    Many application codes, such as finite-element structural analyses and computational fluid dynamics codes, are capable of producing many sensitivity derivatives at a small fraction of the cost of the underlying analysis. This paper describes a simple variance reduction method that exploits such inexpensive sensitivity derivatives to increase the accuracy of sampling methods. Three examples, including a finite-element structural analysis of an aircraft wing, are provided that illustrate an order of magnitude improvement in accuracy for both Monte Carlo and stratified sampling schemes.

  7. A method for analyzing the business case for provider participation in the National Cancer Institute's Community Clinical Oncology Program and similar federally funded, provider-based research networks.

    Science.gov (United States)

    Reiter, Kristin L; Song, Paula H; Minasian, Lori; Good, Marjorie; Weiner, Bryan J; McAlearney, Ann Scheck

    2012-09-01

    The Community Clinical Oncology Program (CCOP) plays an essential role in the efforts of the National Cancer Institute (NCI) to increase enrollment in clinical trials. Currently, there is little practical guidance in the literature to assist provider organizations in analyzing the return on investment (ROI), or business case, for establishing and operating a provider-based research network (PBRN) such as the CCOP. In this article, the authors present a conceptual model of the business case for PBRN participation, a spreadsheet-based tool and advice for evaluating the business case for provider participation in a CCOP organization. A comparative, case-study approach was used to identify key components of the business case for hospitals attempting to support a CCOP research infrastructure. Semistructured interviews were conducted with providers and administrators. Key themes were identified and used to develop the financial analysis tool. Key components of the business case included CCOP start-up costs, direct revenue from the NCI CCOP grant, direct expenses required to maintain the CCOP research infrastructure, and incidental benefits, most notably downstream revenues from CCOP patients. The authors recognized the value of incidental benefits as an important contributor to the business case for CCOP participation; however, currently, this component is not calculated. The current results indicated that providing a method for documenting the business case for CCOP or other PBRN involvement will contribute to the long-term sustainability and expansion of these programs by improving providers' understanding of the financial implications of participation. Copyright © 2011 American Cancer Society.

  8. Non-ablative fractional laser provides long-term improvement of mature burn scars

    DEFF Research Database (Denmark)

    Taudorf, Elisabeth H; Danielsen, Patricia L; Paulsen, Ida F

    2015-01-01

    BACKGROUND AND OBJECTIVES: Non-ablative fractional laser-treatment is evolving for burn scars. The objective of this study was to evaluate clinical and histological long-term outcome of 1,540 nm fractional Erbium: Glass laser, targeting superficial, and deep components of mature burn scars....... MATERIALS & METHODS: Side-by-side scar-areas were randomized to untreated control or three monthly non-ablative fractional laser-treatments using superficial and extra-deep handpieces. Patient follow-up were at 1, 3, and 6 months. Primary outcome was improvement in overall scar-appearance on a modified...... of scar-appearance. CONCLUSIONS: Combined superficial and deep non-ablative fractional laser-treatments induce long-term clinical and histological improvement of mature burn scars....

  9. Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement.

    Science.gov (United States)

    Zhang, Tianzhen; Hu, Yan; Jiang, Wenkai; Fang, Lei; Guan, Xueying; Chen, Jiedan; Zhang, Jinbo; Saski, Christopher A; Scheffler, Brian E; Stelly, David M; Hulse-Kemp, Amanda M; Wan, Qun; Liu, Bingliang; Liu, Chunxiao; Wang, Sen; Pan, Mengqiao; Wang, Yangkun; Wang, Dawei; Ye, Wenxue; Chang, Lijing; Zhang, Wenpan; Song, Qingxin; Kirkbride, Ryan C; Chen, Xiaoya; Dennis, Elizabeth; Llewellyn, Danny J; Peterson, Daniel G; Thaxton, Peggy; Jones, Don C; Wang, Qiong; Xu, Xiaoyang; Zhang, Hua; Wu, Huaitong; Zhou, Lei; Mei, Gaofu; Chen, Shuqi; Tian, Yue; Xiang, Dan; Li, Xinghe; Ding, Jian; Zuo, Qiyang; Tao, Linna; Liu, Yunchao; Li, Ji; Lin, Yu; Hui, Yuanyuan; Cao, Zhisheng; Cai, Caiping; Zhu, Xiefei; Jiang, Zhi; Zhou, Baoliang; Guo, Wangzhen; Li, Ruiqiang; Chen, Z Jeffrey

    2015-05-01

    Upland cotton is a model for polyploid crop domestication and transgenic improvement. Here we sequenced the allotetraploid Gossypium hirsutum L. acc. TM-1 genome by integrating whole-genome shotgun reads, bacterial artificial chromosome (BAC)-end sequences and genotype-by-sequencing genetic maps. We assembled and annotated 32,032 A-subgenome genes and 34,402 D-subgenome genes. Structural rearrangements, gene loss, disrupted genes and sequence divergence were more common in the A subgenome than in the D subgenome, suggesting asymmetric evolution. However, no genome-wide expression dominance was found between the subgenomes. Genomic signatures of selection and domestication are associated with positively selected genes (PSGs) for fiber improvement in the A subgenome and for stress tolerance in the D subgenome. This draft genome sequence provides a resource for engineering superior cotton lines.

  10. Improvement in Space Food Packaging Methods

    Data.gov (United States)

    National Aeronautics and Space Administration — The Space Food Systems Laboratory's (SFSL) current Bulk Overwrap Bag (BOB) package, while simple and effective, leaves room for improvement. Currently, BOBs are...

  11. Improved methods for the mathematically controlled comparison of biochemical systems

    Directory of Open Access Journals (Sweden)

    Schwacke John H

    2004-06-01

    Full Text Available Abstract The method of mathematically controlled comparison provides a structured approach for the comparison of alternative biochemical pathways with respect to selected functional effectiveness measures. Under this approach, alternative implementations of a biochemical pathway are modeled mathematically, forced to be equivalent through the application of selected constraints, and compared with respect to selected functional effectiveness measures. While the method has been applied successfully in a variety of studies, we offer recommendations for improvements to the method that (1 relax requirements for definition of constraints sufficient to remove all degrees of freedom in forming the equivalent alternative, (2 facilitate generalization of the results thus avoiding the need to condition those findings on the selected constraints, and (3 provide additional insights into the effect of selected constraints on the functional effectiveness measures. We present improvements to the method and related statistical models, apply the method to a previously conducted comparison of network regulation in the immune system, and compare our results to those previously reported.

  12. Composition and methods for improved fuel production

    Science.gov (United States)

    Steele, Philip H.; Tanneru, Sathishkumar; Gajjela, Sanjeev K.

    2015-12-29

    Certain embodiments of the present invention are configured to produce boiler and transportation fuels. A first phase of the method may include oxidation and/or hyper-acidification of bio-oil to produce an intermediate product. A second phase of the method may include catalytic deoxygenation, esterification, or olefination/esterification of the intermediate product under pressurized syngas. The composition of the resulting product--e.g., a boiler fuel--produced by these methods may be used directly or further upgraded to a transportation fuel. Certain embodiments of the present invention also include catalytic compositions configured for use in the method embodiments.

  13. Improvement of sizing methods using focussed probes

    International Nuclear Information System (INIS)

    Birac, A.M.; Saglio, R.; Frappier, J.C.

    1983-05-01

    Three methods are described; these three methods, using the advantages of focussed probes allow, used simultaneously according to the nature of the detected defects, to evaluate with a good accuracy the dimensions and the orientation of the real or artificial defects [fr

  14. An improved front tracking method for the Euler equations

    NARCIS (Netherlands)

    Witteveen, J.A.S.; Koren, B.; Bakker, P.G.

    2007-01-01

    An improved front tracking method for hyperbolic conservation laws is presented. The improved method accurately resolves discontinuities as well as continuous phenomena. The method is based on an improved front interaction model for a physically more accurate modeling of the Euler equations, as

  15. Organization Complexity and Primary Care Providers' Perceptions of Quality Improvement Culture Within the Veterans Health Administration.

    Science.gov (United States)

    Korom-Djakovic, Danijela; Canamucio, Anne; Lempa, Michele; Yano, Elizabeth M; Long, Judith A

    2016-01-01

    This study examined how aspects of quality improvement (QI) culture changed during the introduction of the Veterans Health Administration (VHA) patient-centered medical home initiative and how they were influenced by existing organizational factors, including VHA facility complexity and practice location. A voluntary survey, measuring primary care providers' (PCPs') perspectives on QI culture at their primary care clinics, was administered in 2010 and 2012. Participants were 320 PCPs from hospital- and community-based primary care practices in Pennsylvania, West Virginia, Delaware, New Jersey, New York, and Ohio. PCPs in community-based outpatient clinics reported an improvement in established processes for QI, and communication and cooperation from 2010 to 2012. However, their peers in hospital-based clinics did not report any significant improvements in QI culture. In both years, compared with high-complexity facilities, medium- and low-complexity facilities had better scores on the scales assessing established processes for QI, and communication and cooperation. © The Author(s) 2014.

  16. Supporting Process Improvement using Method Increments

    NARCIS (Netherlands)

    Vlaanderen, Kevin

    2014-01-01

    With the research described in this dissertation, we aim to shed light on the characteristics of process improvement efforts by looking at their evolution (how to change?) rather than their content (what to change?). This research is triggered by three main propositions, derived from earlier work:

  17. Improved cold neutron radiographic apparatus and method

    International Nuclear Information System (INIS)

    1981-01-01

    An improved cold neutron radiography technique is described in which the neutron temperature is matched to the specific material to be analyzed. In addition to a beam source and detector the apparatus incorporates a cryogenic refrigerator which enables the moderator material to be cooled to a predetermined adjustable temperature below the Bragg edge temperature of the sample. (U.K.)

  18. Academic Detailing with Provider Audit and Feedback Improve Prescribing Quality for Older Veterans.

    Science.gov (United States)

    Vandenberg, Ann E; Echt, Katharina V; Kemp, Lawanda; McGwin, Gerald; Perkins, Molly M; Mirk, Anna K

    2018-03-01

    Suboptimal prescribing persists as a driver of poor quality care of older veterans and is associated with risk of hospitalization and emergency department visits. We adapted a successful medication management model, Integrated Management and Polypharmacy Review of Vulnerable Elders (IMPROVE), from an urban geriatric specialty clinic to rural community-based clinics that deliver primary care. The goals were to promote prescribing quality and safety for older adults, including reduced prescribing of potentially inappropriate medications (PIMs). We augmented the original model, which involved a pharmacist-led, one-on-one medication review with high-risk older veterans, to provide rural primary care providers (PCPs) and pharmacists with educational outreach through academic detailing and tools to support safe geriatric prescribing practices, as well as individual audit and feedback on prescribing practice and confidential peer benchmarking. Twenty PCPs and 4 pharmacists at 4 rural Georgia community-based outpatient clinics participated. More than 7,000 older veterans were seen in more than 20,000 PCP encounters during the 14-month intervention period. Implementation of the IMPROVE intervention reduced PIM prescribing incidence from 9.6 new medications per 100 encounters during baseline to 8.7 after the intervention (P = .009). IMPROVE reduced PIM prevalence (proportion of encounters involving veterans who were taking at least 1 PIM) from 22.6% to 16.7% (P < .001). These approaches were effective in reducing PIMs prescribed to older veterans in a rural setting and constitute a feasible model for disseminating geriatric best practices to the primary care setting. © 2018, Copyright the Authors Journal compilation © 2018, The American Geriatrics Society.

  19. An improved sampling method of complex network

    Science.gov (United States)

    Gao, Qi; Ding, Xintong; Pan, Feng; Li, Weixing

    2014-12-01

    Sampling subnet is an important topic of complex network research. Sampling methods influence the structure and characteristics of subnet. Random multiple snowball with Cohen (RMSC) process sampling which combines the advantages of random sampling and snowball sampling is proposed in this paper. It has the ability to explore global information and discover the local structure at the same time. The experiments indicate that this novel sampling method could keep the similarity between sampling subnet and original network on degree distribution, connectivity rate and average shortest path. This method is applicable to the situation where the prior knowledge about degree distribution of original network is not sufficient.

  20. Private providers' knowledge, attitudes and misconceptions related to long-acting and permanent contraceptive methods: a case study in Bangladesh.

    Science.gov (United States)

    Ugaz, Jorge; Banke, Kathryn; Rahaim, Stephen; Chowdhury, Wahiduzzaman; Williams, Julie

    2016-11-01

    In Bangladesh, use of long-acting and permanent methods of contraception (LAPMs) remains stagnant. Providers' limited knowledge and biases may be a factor. We assessed private providers' knowledge, misconceptions and general attitudes towards LAPM in two urban areas. The ultimate goal is to shape programs and interventions to overcome these obstacles and improve full method choice in Bangladesh. Trained data collectors interviewed a convenience sample of 235 female doctors (obstetricians-gynecologists and general practitioners) and 150 female nurses from 194 commercial (for-profit) health care facilities in Chittagong City Corporation and Dhaka district. Data were collected on the nature of the practice, training received, knowledge about modern contraceptives and attitudes towards LAPM [including intrauterine device (IUDs), implants, female and male sterilization]. All providers, and especially doctors, lacked adequate knowledge regarding side effects for all LAPMs, particularly female and male sterilization. Providers had misconceptions about the effectiveness and convenience of LAPMs compared to short-acting contraceptive methods. Implants and IUDs were generally perceived more negatively than other methods. The majority of providers believed that husbands favor short-acting methods rather than LAPMs and that women should not use a method that their husbands do not approve of. Our findings document knowledge and attitudinal barriers among private for-profit providers in urban areas affecting their provision of accurate information about LAPM choices. Practitioners should be offered the necessary tools to provide women full access to all modern methods, especially LAPMs, in order to contribute to decreasing unmet need and improving full method choice in Bangladesh. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Improved Mirror Source Method in Roomacoustics

    Science.gov (United States)

    Mechel, F. P.

    2002-10-01

    Most authors in room acoustics qualify the mirror source method (MS-method) as the only exact method to evaluate sound fields in auditoria. But evidently nobody applies it. The reason for this discrepancy is the abundantly high numbers of needed mirror sources which are reported in the literature, although such estimations of needed numbers of mirror sources mostly are used for the justification of more or less heuristic modifications of the MS-method. The present, intentionally tutorial article accentuates the analytical foundations of the MS-method whereby the number of needed mirror sources is reduced already. Further, the task of field evaluation in three-dimensional spaces is reduced to a sequence of tasks in two-dimensional room edges. This not only allows the use of easier geometrical computations in two dimensions, but also the sound field in corner areas can be represented by a single (directional) source sitting on the corner line, so that only this "corner source" must be mirror-reflected in the further process. This procedure gives a drastic reduction of the number of needed equivalent sources. Finally, the traditional MS-method is not applicable in rooms with convex corners (the angle between the corner flanks, measured on the room side, exceeds 180°). In such cases, the MS-method is combined below with the second principle of superposition(PSP). It reduces the scattering task at convex corners to two sub-tasks between one flank and the median plane of the room wedge, i.e., always in concave corner areas where the MS-method can be applied.

  2. System and Method for Providing Vertical Profile Measurements of Atmospheric Gases

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — A system and method for using an air collection device to collect a continuous air sample as the device descends through the atmosphere are provided. The air...

  3. Interconnection blocks: a method for providing reusable, rapid, multiple, aligned and planar microfluidic interconnections

    DEFF Research Database (Denmark)

    Sabourin, David; Snakenborg, Detlef; Dufva, Hans Martin

    2009-01-01

    In this paper a method is presented for creating 'interconnection blocks' that are re-usable and provide multiple, aligned and planar microfluidic interconnections. Interconnection blocks made from polydimethylsiloxane allow rapid testing of microfluidic chips and unobstructed microfluidic observ...

  4. METHOD OF IMPROVING CORROSION RESISTANCE OF ZIRCONIUM

    Science.gov (United States)

    Shannon, D.W.

    1961-03-28

    An improved intermediate rinse for zirconium counteracts an anomalous deposit that often results in crevices and outof-the-way places when ordinary water is used to rinse away a strong fluoride etching solution designed to promote passivation of the metal. The intermediate rinse, which is used after the etching solution and before the water, is characterized by a complexing agent for fluoride ions such as aluminum or zirconium nitrates or chlorides.

  5. Methods improvements incorporated into the SAPHIRE ASP models

    International Nuclear Information System (INIS)

    Sattison, M.B.; Blackman, H.S.; Novack, S.D.

    1995-01-01

    The Office for Analysis and Evaluation of Operational Data (AEOD) has sought the assistance of the Idaho National Engineering Laboratory (INEL) to make some significant enhancements to the SAPHIRE-based Accident Sequence Precursor (ASP) models recently developed by the INEL. The challenge of this project is to provide the features of a full-scale PRA within the framework of the simplified ASP models. Some of these features include: (1) uncertainty analysis addressing the standard PRA uncertainties and the uncertainties unique to the ASP models and methods, (2) incorporation and proper quantification of individual human actions and the interaction among human actions, (3) enhanced treatment of common cause failures, and (4) extension of the ASP models to more closely mimic full-scale PRAs (inclusion of more initiators, explicitly modeling support system failures, etc.). This paper provides an overview of the methods being used to make the above improvements

  6. Improvements in biamperometric method for remote analysis of uranium

    International Nuclear Information System (INIS)

    Palamalai, A.; Thankachan, T.S.; Balasubramanian, G.R.

    1979-01-01

    One of the titrimetric methods most suitable for remote operations with Master Slave Manipulators inside hot cells is the biamperometric method. The biamperometric method for the analysis of uranium reported in the literature is found to give rise to a significant bias, especially with low aliquots of uranium and the waste volume is also considerable which is not desirable from the point of view of radioactive waste disposal. In the present method, the bias as well as waste volume are reduced. Also addition of vanadyl sulphate is found necessary to provide a sharp end point in the titration curve. The role of vanadyl sulphate in improving the titration method has been investigated by spectrophotometry and electrometry. A new mechanism for the role of vanadyl sulphate which is in conformity with the observations made in coulometric titration of uranium, is proposed. Interference from deliberate additions of high concentrations of stable species of fission product elements is found negligible. Hence this method is considered highly suitable for remote analysis of uranium in intensely radioactive reprocessing solutions for control purposes, provided radioactivity does not pose new problems. (auth.)

  7. Systems and methods for providing power to a load based upon a control strategy

    Science.gov (United States)

    Perisic, Milun; Kajouke, Lateef A; Ransom, Ray M

    2013-12-24

    Systems and methods are provided for an electrical system. The electrical system includes a load, an interface configured to receive a voltage from a voltage source, and a controller configured to receive the voltage from the voltage source through the interface and to provide a voltage and current to the load. Wherein, when the controller is in a constant voltage mode, the controller provides a constant voltage to the load, when the controller is in a constant current mode, the controller provides a constant current to the load, and when the controller is in a constant power mode, the controller provides a constant power to the load.

  8. Economic Insights into Providing Access to Improved Groundwater Sources in Remote, Low-Resource Areas

    Science.gov (United States)

    Abramson, A.; Lazarovitch, N.; Adar, E.

    2013-12-01

    Groundwater is often the most or only feasible drinking water source in remote, low-resource areas. Yet the economics of its development have not been systematically outlined. We applied CBARWI (Cost-Benefit Analysis for Remote Water Improvements), a recently developed Decision Support System, to investigate the economic, physical and management factors related to the costs and benefits of non-networked groundwater supply in remote areas. Synthetic profiles of community water services (n = 17,962), defined across 14 parameters' values and ranges relevant to remote areas, were imputed into the decision framework, and the parameter effects on economic outcomes were investigated through regression analysis (Table 1). Several approaches were included for financing the improvements, after Abramson et al, 2011: willingness-to -pay (WTP), -borrow (WTB) and -work (WTW) in community irrigation (';water-for-work'). We found that low-cost groundwater development approaches are almost 7 times more cost-effective than conventional boreholes fitted with handpumps. The costs of electric, submersible borehole pumps are comparable only when providing expanded water supplies, and off-grid communities pay significantly more for such expansions. In our model, new source construction is less cost-effective than improvement of existing wells, but necessary for expanding access to isolated households. The financing approach significantly impacts the feasibility of demand-driven cost recovery; in our investigation, benefit exceeds cost in 16, 32 and 48% of water service configurations financed by WTP, WTB and WTW, respectively. Regressions of total cost (R2 = 0.723) and net benefit under WTW (R2 = 0.829) along with analysis of output distributions indicate that parameters determining the profitability of irrigation are different from those determining costs and other measures of net benefit. These findings suggest that the cost-benefit outcomes associated with groundwater-based water

  9. Method and Apparatus Providing Deception and/or Altered Operation in an Information System Operating System

    Science.gov (United States)

    Cohen, Fred; Rogers, Deanna T.; Neagoe, Vicentiu

    2008-10-14

    A method and/or system and/or apparatus providing deception and/or execution alteration in an information system. In specific embodiments, deceptions and/or protections are provided by intercepting and/or modifying operation of one or more system calls of an operating system.

  10. Provider Payment Trends and Methods in the Massachusetts Health Care System

    OpenAIRE

    Allison Barrett; Timothy Lake

    2010-01-01

    This report investigates provider payment methods in Massachusetts. Payments include fee-for-service, the predominant model; global payments, which pay providers a single fee for all or most required services during a contract period; and pay-for-performance models, which layer quality incentives onto payments.

  11. 47 CFR 51.329 - Notice of network changes: Methods for providing notice.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 3 2010-10-01 2010-10-01 false Notice of network changes: Methods for providing notice. 51.329 Section 51.329 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED...) Filing a public notice with the Commission; or (2) Providing public notice through industry fora...

  12. Numerical method improvement for a subchannel code

    Energy Technology Data Exchange (ETDEWEB)

    Ding, W.J.; Gou, J.L.; Shan, J.Q. [Xi' an Jiaotong Univ., Shaanxi (China). School of Nuclear Science and Technology

    2016-07-15

    Previous studies showed that the subchannel codes need most CPU time to solve the matrix formed by the conservation equations. Traditional matrix solving method such as Gaussian elimination method and Gaussian-Seidel iteration method cannot meet the requirement of the computational efficiency. Therefore, a new algorithm for solving the block penta-diagonal matrix is designed based on Stone's incomplete LU (ILU) decomposition method. In the new algorithm, the original block penta-diagonal matrix will be decomposed into a block upper triangular matrix and a lower block triangular matrix as well as a nonzero small matrix. After that, the LU algorithm is applied to solve the matrix until the convergence. In order to compare the computational efficiency, the new designed algorithm is applied to the ATHAS code in this paper. The calculation results show that more than 80 % of the total CPU time can be saved with the new designed ILU algorithm for a 324-channel PWR assembly problem, compared with the original ATHAS code.

  13. Some improved methods in neutron transport theory

    Energy Technology Data Exchange (ETDEWEB)

    Pop-Jordanov, J; Stefanovic, D; Kocic, A; Matausek, M; Bosevski, T [Boris Kidric Institute of Nuclear Sciences Vinca, Beograd (Yugoslavia)

    1973-07-01

    The methods described in this paper are: analytical approach to neutron spectra in case of energy dependent anisotropy of elastic scattering; Monte Carlo estimations of neutron absorption reaction rate during slowing down process; spherical harmonics treatment of space-angle-lethargy dependent slowing down transport equation; integral transport theory based on point-wise representation of variables.

  14. Improving Science and IT Literacy by Providing Urban-Based Environmental Science Research Opportunities

    Science.gov (United States)

    Cuff, K. E.; Corazza, L.; Liang, J.

    2007-12-01

    A U.C. Berkeley-based outreach program known as Environmental Science Information Technology Activities has been in operation over the past four years. The primary aim of the program is to provide opportunities for grades 9 and 10 students in diverse East San Francisco Bay Area communities to develop deeper understandings of the nature and conduct of science, which will increase their capacity to enroll and perform successfully in science, technology, engineering, and mathematics (STEM) courses in the future. Design of the program has been informed by recent research that indicates a close relationship between educational activities that promote the perception of STEM as being relevant and the ability to foster development of deeper conceptual understandings among teens. Accordingly, ESITA includes an important student-led environmental science research project component, which provides participants with opportunities to engage in research investigations that are directly linked to relevant, real-world environmental problems and issues facing their communities. Analysis of evidence gleaned from questionnaires, interviews with participants and specific assessment/evaluation instruments indicates that ESITA program activities, including after-school meetings, summer and school year research projects, and conference preparations and presentations has provided students with high-quality inquiry science experiences that increased their knowledge of STEM and IT concepts, as well as their understanding of the nature of the scientific enterprise. In addition, the program has achieved a high degree of success in that it has: enhanced participants' intellectual self-confidence with regard to STEM; developed deeper appreciation of how scientific research can contribute to the maintenance of healthy local environments; developed a greater interest in participating in STEM-related courses of study and after school programs; and improved attitudes toward STEM. Overall

  15. Expert advice provided through telemedicine improves healing of chronic wounds: prospective cluster controlled study.

    Science.gov (United States)

    Zarchi, Kian; Haugaard, Vibeke B; Dufour, Deirdre N; Jemec, Gregor B E

    2015-03-01

    Telemedicine is widely considered as an efficient approach to manage the growing problem of chronic wounds. However, to date, there is no convincing evidence to support the clinical efficacy of telemedicine in wound management. In this prospective cluster controlled study, we tested the hypothesis that advice on wound management provided by a team of wound-care specialists through telemedicine would significantly improve the likelihood of wound healing compared with the best available conventional practice. A total of 90 chronic wound patients in home care met all study criteria and were included: 50 in the telemedicine group and 40 in the conventional group. Patients with pressure ulcers, surgical wounds, and cancer wounds were excluded. During the 1-year follow-up, complete wound healing was achieved in 35 patients (70%) in the telemedicine group compared with 18 patients (45%) in the conventional group. After adjusting for important covariates, offering advice on wound management through telemedicine was associated with significantly increased healing compared with the best available conventional practice (telemedicine vs. conventional practice: adjusted hazard ratio 2.19; 95% confidence interval: 1.15-4.17; P=0.017). This study strongly supports the use of telemedicine to connect home-care nurses to a team of wound experts in order to improve the management of chronic wounds.

  16. Improvements of the integral transport theory method

    International Nuclear Information System (INIS)

    Kavenoky, A.; Lam-Hime, M.; Stankovski, Z.

    1979-01-01

    The integral transport theory is widely used in practical reactor design calculations however it is computer time consuming for two dimensional calculations of large media. In the first part of this report a new treatment is presented; it is based on the Galerkin method: inside each region the total flux is expanded over a three component basis. Numerical comparison shows that this method can considerably reduce the computing time. The second part of the this report is devoted to homogeneization theory: a straightforward calculation of the fundamental mode for an heterogeneous cell is presented. At first general presentation of the problem is given, then it is simplified to plane geometry and numerical results are presented

  17. Improved method of static radionuclide ventriculography

    International Nuclear Information System (INIS)

    Davidzon, G.S.; Myasnik, B.N.

    1988-01-01

    A method of 2-stage recording of radionuclide ventriculography has been proposed, the second stage being shifted to a certain time interval, i.e. a delay line is introduced between a synchronizing device and computer. Particular attention is drawn to a choice of delay time depending on a computer memory volume: in a small memory volume delay time must be approximately one-third of the patient's R-R interval

  18. An improved method for simulating radiographs

    International Nuclear Information System (INIS)

    Laguna, G.W.

    1986-01-01

    The parameters involved in generating actual radiographs and what can and cannot be modeled are examined in this report. Using the spectral distribution of the radiation source and the mass absorption curve for the material comprising the part to be modeled, the actual amount of radiation that would pass through the part and reach the film is determined. This method increases confidence in the results of the simulation and enables the modeling of parts made of multiple materials

  19. [A web information system for enhancing management and improving special care services provided to dependent persons].

    Science.gov (United States)

    Alvarez-Bermejo, J A; Hernández-Capel, D M; Belmonte-Ureña, L J; Roca-Piera, J

    2009-01-01

    Ensuring the quality of services provided in centres where dependent persons are seen by specialist services, by improving and enhancing how information -salary, control of tasks, patients' records, etc.- is shared between staff and carers. A web information system has been developed and experimentally deployed to accomplish this. The accuracy of the system was evaluated by assessing how confident the employees were with it rather than relying on statistical data. It was experimentally deployed since January 2009 in Asociación de Personas con Discapacidad "El Saliente" that manages several day centres in Almeria, for dependent persons over 65 years old, particularly those affected by Alzheimer' disease. Incidence data was collected during the experimental period. A total of 84% of the employees thought that the system helped to manage documents, administrative duties, etc., and 92.4% said they could attend to really important tasks because the system was responsible for alerting them of every task, such as medication timetables, checking all patients were present (to prevent an Alzheimer affected person leaving the centre) etc. During this period the incidences reported were reduced by about a 30%, although data is still partially representative. As the life expectancy of the population gets longer, these centres will increase. Providing systems such as the one presented here would be of great help for administrative duties (sensitive data protection...) as well as ensuring high quality care and attention.

  20. The role of mixed methods in improved cookstove research.

    Science.gov (United States)

    Stanistreet, Debbi; Hyseni, Lirije; Bashin, Michelle; Sadumah, Ibrahim; Pope, Daniel; Sage, Michael; Bruce, Nigel

    2015-01-01

    The challenge of promoting access to clean and efficient household energy for cooking and heating is a critical issue facing low- and middle-income countries today. Along with clean fuels, improved cookstoves (ICSs) continue to play an important part in efforts to reduce the 4 million annual premature deaths attributed to household air pollution. Although a range of ICSs are available, there is little empirical evidence on appropriate behavior change approaches to inform adoption and sustained used at scale. Specifically, evaluations using either quantitative or qualitative methods provide an incomplete picture of the challenges in facilitating ICS adoption. This article examines how studies that use the strengths of both these approaches can offer important insights into behavior change in relation to ICS uptake and scale-up. Epistemological approaches, study design frameworks, methods of data collection, analytical approaches, and issues of validity and reliability in the context of mixed methods ICS research are examined, and the article presents an example study design from an evaluation study in Kenya incorporating a nested approach and a convergent case oriented design. The authors discuss the benefits and methodological challenges of mixed-methods approaches in the context of researching behavior change and ICS use recognizing that such methods represent relatively uncharted territory. The authors propose that more published examples are needed to provide frameworks for other researchers seeking to apply mixed methods in this context and suggest a comprehensive research agenda is required that incorporates integrated mixed-methods approaches, to provide best evidence for future scale-up.

  1. Recent improvement of the resonance analysis methods

    International Nuclear Information System (INIS)

    Sirakov, I.; Lukyanov, A.

    2000-01-01

    By the use of a two-step method called Combined, the R-matrix Wigner-Eisenbud representation in the resonance reaction theory has been converted into other equivalent representations (parameterizations) of the collision matrix with Poles in E domain. Two of them called Capture Elimination (CE) and Reaction Elimination (RE) representation respectively, have energy independent parameters and are both rigorous and applicable. The CE representation is essentially a generalization of the Reich-Moore (RM) formalism. The RE representation, in turn, offers some distinct advantages when analyzing fissile nuclei. The latter does not require any approximation for the capture channels and does not need any assumption about the number of fission channels in contrast to the RM representation. Unlike the RM parameters the RE ones are uniquely determined for applications in the resonance analysis. When given in the RE representation, neutron cross sections of fissile nuclei in the resolved resonance region are presented through simple scalar expressions without the need of matrix inversion. Various computer codes have been developed to demonstrate the viability of the new method. The RM parameters of the fissile nuclei have been converted into equivalent RE parameters implying the RM assumptions (REFINE code). Conversely, the RE parameters have been converted into corresponding RM parameters when one fission channel is present and the RM parameter set is unique, e.g. Pu-239, J =1 (REVERSE code). To further enhance the flexibility of the proposed method the obtained RE parameters have been converted into equivalent Generalized Pole parameters (REFILE code), which are parameters of the rigorous pole expansion of the collision matrix in √E domain. equi valent sets of RM, RE and GP parameters of 239 Pu are given as an example. It has been pointed out that all the advantages of the newly proposed representation can be implemented through an independent evaluation of the RE resonance

  2. Improved pattern recognition systems by hybrid methods

    International Nuclear Information System (INIS)

    Duerr, B.; Haettich, W.; Tropf, H.; Winkler, G.; Fraunhofer-Gesellschaft zur Foerderung der Angewandten Forschung e.V., Karlsruhe

    1978-12-01

    This report describes a combination of statistical and syntactical pattern recongition methods. The hierarchically structured recognition system consists of a conventional statistical classifier, a structural classifier analysing the topological composition of the patterns, a stage reducing the number of hypotheses made by the first two stages, and a mixed stage based on a search for maximum similarity between syntactically generated prototypes and patterns. The stages work on different principles to avoid mistakes made in one stage in the other stages. This concept is applied to the recognition of numerals written without constraints. If no samples are rejected, a recognition rate of 99,5% is obtained. (orig.) [de

  3. System and Method for Providing a Climate Data Analytic Services Application Programming Interface Distribution Package

    Science.gov (United States)

    Schnase, John L. (Inventor); Duffy, Daniel Q. (Inventor); Tamkin, Glenn S. (Inventor)

    2016-01-01

    A system, method and computer-readable storage devices for providing a climate data analytic services application programming interface distribution package. The example system can provide various components. The system provides a climate data analytic services application programming interface library that enables software applications running on a client device to invoke the capabilities of a climate data analytic service. The system provides a command-line interface that provides a means of interacting with a climate data analytic service by issuing commands directly to the system's server interface. The system provides sample programs that call on the capabilities of the application programming interface library and can be used as templates for the construction of new client applications. The system can also provide test utilities, build utilities, service integration utilities, and documentation.

  4. Method for improved gas-solids separation

    Science.gov (United States)

    Kusik, C.L.; He, B.X.

    1990-11-13

    Methods are disclosed for the removal of particulate solids from a gas stream at high separation efficiency, including the removal of submicron size particles. The apparatus includes a cyclone separator type of device which contains an axially mounted perforated cylindrical hollow rotor. The rotor is rotated at high velocity in the same direction as the flow of an input particle-laden gas stream to thereby cause enhanced separation of particulate matter from the gas stream in the cylindrical annular space between the rotor and the sidewall of the cyclone vessel. Substantially particle-free gas passes through the perforated surface of the spinning rotor and into the hollow rotor, from where it is discharged out of the top of the apparatus. Separated particulates are removed from the bottom of the vessel. 4 figs.

  5. K. OXYTOCA BACTERIOPHAGES ISOLATION METHODS IMPROVEMENT

    Directory of Open Access Journals (Sweden)

    G. R. Sadrtdinova

    2017-01-01

    Full Text Available The article presents the results of a study related to increasing the efficiency of phage isolation of bacteria of the species K. oxytoca, by developing the optimal composition of the medium used in the work. In scientific research, in almost all methods associated with the isolation of bacteriophages, meat-peptone broth and meat-peptone agar are used as the nutrient basis. The peculiarities of growth and cultivation of microorganisms create certain difficulties for the isolation of phages active against bacteria of the species K. oxytoca. The selection of components and the creation of an environment that would ensure the optimal growth of both the bacterial culture and the reproduction of the virus makes it possible to facilitate the isolation of bacteriophages. The number of bacterial strains used in the work was 7. All strains of cultures were obtained from the Museum of the Department of Microbiology, Virology, Epizootology and Veterinary and Sanitary Expertise of the Federal State Budget Educational Institution of Higher Education “Ulyanovsk State Agrarian University named after P.A. Stolypin”. The studies included 2 main stages. The first stage consisted in isolation of bacteriophages by the method of isolation from the external environment by the method of Adelson L.I., Lyashenko E.A. The material for the studies were samples: soil, sewage sample, fecal samples (2. Only 4 samples. According to the chosen method, the sowing of the putative phagolysate was carried out on meat-peptone agar (1.5% and the agar for isolating bacteriophages (Aph (1.5%. A positive result was the presence on the environment of negative colonies, clearly visible on the matt background of deep growth of bacteria. A negative result is a continuous growth (“lawn” of bacterial culture. As a control, the culture of the microorganism studied was used for the media. In the course of the conducted studies for the first stage, 2 bacteriophages were isolated, active

  6. An improved method of preparing silicon carbide

    International Nuclear Information System (INIS)

    Baney, R.H.

    1979-01-01

    A method of preparing silicon carbide is described which comprises forming a desired shape from a polysilane of the average formula:[(CH 3 ) 2 Si][CH 3 Si]. The polysilane contains from 0 to 60 mole percent (CH 3 ) 2 Si units and from 40 to 100 mole percent CH 3 Si units. The remaining bonds on the silicon are attached to another silicon atom or to a halogen atom in such manner that the average ratio of halogen to silicon in the polysilane is from 0.3:1 to 1:1. The polysilane has a melt viscosity at 150 0 C of from 0.005 to 500 Pa.s and an intrinsic viscosity in toluene of from 0.0001 to 0.1. The shaped polysilane is heated in an inert atmosphere or in a vacuum to an elevated temperature until the polysilane is converted to silicon carbide. (author)

  7. Feedback to providers improves evidence-based implantable cardioverter-defibrillator programming and reduces shocks.

    Science.gov (United States)

    Silver, Marc T; Sterns, Laurence D; Piccini, Jonathan P; Joung, Boyoung; Ching, Chi-Keong; Pickett, Robert A; Rabinovich, Rafael; Liu, Shufeng; Peterson, Brett J; Lexcen, Daniel R

    2015-03-01

    Implantable cardioverter-defibrillator (ICD) shocks are associated with increased anxiety, health care utilization, and potentially mortality. The purpose of the Shock-Less Study was to determine if providing feedback reports to physicians on their adherence to evidence-based shock reduction programming could improve their programming behavior and reduce shocks. Shock-Less enrolled primary prevention (PP) and secondary prevention (SP) ICD patients between 2009 and 2012 at 118 study centers worldwide and followed patients longitudinally after their ICD implant. Center-specific therapy programming reports (TPRs) were delivered to each center 9 to 12 months after their first enrollment. The reports detailed adherence to evidence-based programming targets: number of intervals to detect ventricular fibrillation (VF NID), longest treatment interval (LTI), supraventricular tachycardia (SVT) discriminators (Wavelet, PR Logic), SVT limit, Lead Integrity Alert (LIA), and antitachycardia pacing (ATP). Clinicians programmed ICDs at their discretion. The primary outcome measure was the change in utilization of evidence-based shock reduction programming before (phase I, n = 2694 patients) and after initiation of the TPR (phase II, n = 1438 patients). Patients implanted after feedback reports (phase II) were up to 20% more likely to have their ICDs programmed in line with evidence-based shock reduction programming (eg, VF NID in PP patients 30/40 in 33.5% vs 18.6%, P programming feedback reports improves adherence to evidence-based shock reduction programming and is associated with lower risk of ICD shocks. Copyright © 2015 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

  8. Spinal Cord Stimulation Provides Pain Relief with Improved Psychosocial Function: Results from EMP3OWER.

    Science.gov (United States)

    Rosenberg, Jason; Fabi, Alain; Candido, Kenneth; Knezevic, Nick; Creamer, Michael; Carayannopoulos, Alexios; Ghodsi, Abdi; Nelson, Christopher; Bennett, Matthew

    2016-12-01

    The EMP 3 OWER™ study evaluated spinal cord stimulation (SCS) safety and efficacy and the associated changes in psychosocial and functional outcomes. Upon informed consent and IRB approval, 620 eligible subjects were enrolled prior to SCS trial evaluation and were assessed at baseline, 3, 6 and 12 months post-implant. Patient-reported pain relief (PRP), numerical rating scale (NRS), satisfaction, quality of life (QOL), and pain disability index (PDI) were assessed at all follow-up visits while the pain catastrophizing scale (PCS), short form-36 (SF-36), short form-McGill pain questionnaire version 2 (SF-MPQ-2), and the state-trait anxiety inventory (STAI) were assessed at the 6- and 12-month follow-up visits. Device and/or procedure-related adverse events were also recorded and reported. Subjects reporting a PRP ≥ 50% were considered responders. Repeated measures analysis of variance (RMANOVA) examined the changes across time for all continuous measures. A total of 401 (71%) subjects received a permanent implant. Mean (±SD) patient-reported pain relief was 59.3% (±26.2), 59.2% (±28.9), and 58.2% (±32.0) at 3, 6, and 12 months, respectively. A majority of enrolled subjects were responders at 3 (75.5%), 6 (74.7%), and 12 months (69.7%). RMANOVA revealed a statistically significant change for NRS, PCS, PDI, SF-36, SF-MPQ-2, and STAI scores. At 3 months, the majority of subjects (85.7%) were either very satisfied or satisfied with their device, with similar results at 6 and 12 months. At 3 months, the majority of subjects (73.3%) reported greatly improved or improved QOL with similar results at 6 and 12 months. Spinal cord stimulation provided pain relief and significant improvement of patient psychological and functional outcome measures. © 2016 American Academy of Pain Medicine. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. An Improved Image Contrast Assessment Method

    Directory of Open Access Journals (Sweden)

    Yuanyuan Fan

    2013-07-01

    Full Text Available Contrast is an important factor affecting the image quality. In order to overcome the problems of local band-limited contrast, a novel image contrast assessment method based on the property of HVS is proposed. Firstly, the image by low-pass filter is performed fast wavelet decomposition. Secondly, all levels of band-pass filtered image and its corresponding low-pass filtered image are obtained by processing wavelet coefficients. Thirdly, local band-limited contrast is calculated, and the local band-limited contrast entropy is calculated according to the definition of entropy, Finally, the contrast entropy of image is obtained by averaging the local band-limited contrast entropy weighed using CSF coefficient. The experiment results show that the best contrast image can be accurately identified in the sequence images obtained by adjusting the exposure time and stretching gray respectively, the assessment results accord with human visual characteristics and make up the lack of local band-limited contrast.

  10. Feedback providing improvement strategies and reflection on feedback use: Effects on students' writing motivation, process, and performance

    NARCIS (Netherlands)

    Duijnhouwer, H.; Prins, F.J.; Stokking, K.M.

    2012-01-01

    This study investigated the effects of feedback providing improvement strategies and a reflection assignment on students’ writing motivation, process, and performance. Students in the experimental feedback condition (n = 41) received feedback including improvement strategies, whereas students in the

  11. Interconnection blocks: a method for providing reusable, rapid, multiple, aligned and planar microfluidic interconnections

    International Nuclear Information System (INIS)

    Sabourin, D; Snakenborg, D; Dufva, M

    2009-01-01

    In this paper a method is presented for creating 'interconnection blocks' that are re-usable and provide multiple, aligned and planar microfluidic interconnections. Interconnection blocks made from polydimethylsiloxane allow rapid testing of microfluidic chips and unobstructed microfluidic observation. The interconnection block method is scalable, flexible and supports high interconnection density. The average pressure limit of the interconnection block was near 5.5 bar and all individual results were well above the 2 bar threshold considered applicable to most microfluidic applications

  12. Configurable memory system and method for providing atomic counting operations in a memory device

    Science.gov (United States)

    Bellofatto, Ralph E.; Gara, Alan G.; Giampapa, Mark E.; Ohmacht, Martin

    2010-09-14

    A memory system and method for providing atomic memory-based counter operations to operating systems and applications that make most efficient use of counter-backing memory and virtual and physical address space, while simplifying operating system memory management, and enabling the counter-backing memory to be used for purposes other than counter-backing storage when desired. The encoding and address decoding enabled by the invention provides all this functionality through a combination of software and hardware.

  13. Method of immobilizing weapons plutonium to provide a durable, disposable waste product

    Science.gov (United States)

    Ewing, Rodney C.; Lutze, Werner; Weber, William J.

    1996-01-01

    A method of atomic scale fixation and immobilization of plutonium to provide a durable waste product. Plutonium is provided in the form of either PuO.sub.2 or Pu(NO.sub.3).sub.4 and is mixed with and SiO.sub.2. The resulting mixture is cold pressed and then heated under pressure to form (Zr,Pu)SiO.sub.4 as the waste product.

  14. Cloud Service Provider Methods for Managing Insider Threats: Analysis Phase 1

    Science.gov (United States)

    2013-11-01

    of Standards and Technology (NIST) Special Publication 800-145 (NIST SP 800-145) defines three types of cloud services : Software as a Service ( SaaS ...among these three models. NIST SP 800-145 describes the three service models as follows: SaaS —The capability provided to the consumer is to use the...Cloud Service Provider Methods for Managing Insider Threats: Analysis Phase I Greg Porter November 2013 TECHNICAL NOTE CMU/SEI-2013-TN-020

  15. A Dynamical Model of Pitch Memory Provides an Improved Basis for Implied Harmony Estimation

    Science.gov (United States)

    Kim, Ji Chul

    2017-01-01

    Tonal melody can imply vertical harmony through a sequence of tones. Current methods for automatic chord estimation commonly use chroma-based features extracted from audio signals. However, the implied harmony of unaccompanied melodies can be difficult to estimate on the basis of chroma content in the presence of frequent nonchord tones. Here we present a novel approach to automatic chord estimation based on the human perception of pitch sequences. We use cohesion and inhibition between pitches in auditory short-term memory to differentiate chord tones and nonchord tones in tonal melodies. We model short-term pitch memory as a gradient frequency neural network, which is a biologically realistic model of auditory neural processing. The model is a dynamical system consisting of a network of tonotopically tuned nonlinear oscillators driven by audio signals. The oscillators interact with each other through nonlinear resonance and lateral inhibition, and the pattern of oscillatory traces emerging from the interactions is taken as a measure of pitch salience. We test the model with a collection of unaccompanied tonal melodies to evaluate it as a feature extractor for chord estimation. We show that chord tones are selectively enhanced in the response of the model, thereby increasing the accuracy of implied harmony estimation. We also find that, like other existing features for chord estimation, the performance of the model can be improved by using segmented input signals. We discuss possible ways to expand the present model into a full chord estimation system within the dynamical systems framework. PMID:28522983

  16. A Dynamical Model of Pitch Memory Provides an Improved Basis for Implied Harmony Estimation.

    Science.gov (United States)

    Kim, Ji Chul

    2017-01-01

    Tonal melody can imply vertical harmony through a sequence of tones. Current methods for automatic chord estimation commonly use chroma-based features extracted from audio signals. However, the implied harmony of unaccompanied melodies can be difficult to estimate on the basis of chroma content in the presence of frequent nonchord tones. Here we present a novel approach to automatic chord estimation based on the human perception of pitch sequences. We use cohesion and inhibition between pitches in auditory short-term memory to differentiate chord tones and nonchord tones in tonal melodies. We model short-term pitch memory as a gradient frequency neural network, which is a biologically realistic model of auditory neural processing. The model is a dynamical system consisting of a network of tonotopically tuned nonlinear oscillators driven by audio signals. The oscillators interact with each other through nonlinear resonance and lateral inhibition, and the pattern of oscillatory traces emerging from the interactions is taken as a measure of pitch salience. We test the model with a collection of unaccompanied tonal melodies to evaluate it as a feature extractor for chord estimation. We show that chord tones are selectively enhanced in the response of the model, thereby increasing the accuracy of implied harmony estimation. We also find that, like other existing features for chord estimation, the performance of the model can be improved by using segmented input signals. We discuss possible ways to expand the present model into a full chord estimation system within the dynamical systems framework.

  17. A Dynamical Model of Pitch Memory Provides an Improved Basis for Implied Harmony Estimation

    Directory of Open Access Journals (Sweden)

    Ji Chul Kim

    2017-05-01

    Full Text Available Tonal melody can imply vertical harmony through a sequence of tones. Current methods for automatic chord estimation commonly use chroma-based features extracted from audio signals. However, the implied harmony of unaccompanied melodies can be difficult to estimate on the basis of chroma content in the presence of frequent nonchord tones. Here we present a novel approach to automatic chord estimation based on the human perception of pitch sequences. We use cohesion and inhibition between pitches in auditory short-term memory to differentiate chord tones and nonchord tones in tonal melodies. We model short-term pitch memory as a gradient frequency neural network, which is a biologically realistic model of auditory neural processing. The model is a dynamical system consisting of a network of tonotopically tuned nonlinear oscillators driven by audio signals. The oscillators interact with each other through nonlinear resonance and lateral inhibition, and the pattern of oscillatory traces emerging from the interactions is taken as a measure of pitch salience. We test the model with a collection of unaccompanied tonal melodies to evaluate it as a feature extractor for chord estimation. We show that chord tones are selectively enhanced in the response of the model, thereby increasing the accuracy of implied harmony estimation. We also find that, like other existing features for chord estimation, the performance of the model can be improved by using segmented input signals. We discuss possible ways to expand the present model into a full chord estimation system within the dynamical systems framework.

  18. Providing Quality Therapeutics in Switzerland: Role of the Stakeholders and Recent Incentives for Further Improvements.

    Science.gov (United States)

    Besson, Marie; Samer, Caroline; Rollason, Victoria; Dayer, Pierre; Desmeules, Jules

    2015-07-01

    Quality therapeutics play an important role in Switzerland's health care and economy. Switzerland holds a key position in the world of research and development, as well as in drug production. Recently, new emphasis has been placed on promoting clinical research and maintaining Switzerland's position as a center of excellence in the field. Recent revisions to the law regarding medical trials in human research allow for better allocation of regulatory resources and simplified procedures for drugs already authorized in Switzerland. The country has its own regulatory agency, the Swiss Agency for Therapeutic Products (Swissmedic), which is a public institution of the Swiss government. Swissmedic is responsible for ensuring safety in medicines, particularly regarding authorizations and market surveillance in the sector of medicinal products and medical devices. Although the centralized authorization procedure of the European Union for medicines does not apply to Switzerland, there are mutual recognition mechanisms between the Swiss medicine regulatory authority and the European Medicines Agency. Swissmedic is also in charge of postmarketing safety and oversees the national pharmacovigilance center, which collaborates closely with the World Health Organization center in Uppsala. In addition, university hospital-based clinical pharmacologists, who are involved in basic science and clinical research, regulatory affairs, ethics committees, and pharmacovigilance, promote quality therapeutics. This article discusses the role of the various stakeholders and the recent efforts made to provide a better allocation of resources aimed at further improving quality therapeutics in Switzerland. Copyright © 2015 Elsevier HS Journals, Inc. All rights reserved.

  19. The Importance of Providing Multiple-Channel Sections in Dredging Activities to Improve Fish Habitat Environments

    Directory of Open Access Journals (Sweden)

    Hung-Pin Chiu

    2016-01-01

    Full Text Available After Typhoon Morakot, dredging engineering was conducted while taking the safety of humans and structures into consideration, but partial stream reaches were formed in the multiple-channel sections in Cishan Stream because of anthropogenic and natural influences. This study mainly explores the distribution of each fish species in both the multiple- and single-channel sections in the Cishan Stream. Parts of the environments did not exhibit significant differences according to a one-way ANOVA comparing the multiple- and single-channel sections, but certain areas of the multiple-channel sections had more diverse habitats. Each fish species was widely distributed by non-metric multidimensional scaling in the multiple-channel sections as compared to those in the single-channel sections. In addition, according to the principal component analysis, each fish species has a preferred environment, and all of them have a wide choice of habitat environments in the multiple-channel sections. Finally, the existence of multiple-channel sections could significantly affect the existence of the fish species under consideration in this study. However, no environmental factors were found to have an influence on fish species in the single-channel sections, with the exception of Rhinogobius nantaiensis. The results show that providing multiple-channel sections in dredging activities could improve fish habitat environments.

  20. The DEDUCE Guided Query tool: providing simplified access to clinical data for research and quality improvement.

    Science.gov (United States)

    Horvath, Monica M; Winfield, Stephanie; Evans, Steve; Slopek, Steve; Shang, Howard; Ferranti, Jeffrey

    2011-04-01

    In many healthcare organizations, comparative effectiveness research and quality improvement (QI) investigations are hampered by a lack of access to data created as a byproduct of patient care. Data collection often hinges upon either manual chart review or ad hoc requests to technical experts who support legacy clinical systems. In order to facilitate this needed capacity for data exploration at our institution (Duke University Health System), we have designed and deployed a robust Web application for cohort identification and data extraction--the Duke Enterprise Data Unified Content Explorer (DEDUCE). DEDUCE is envisioned as a simple, web-based environment that allows investigators access to administrative, financial, and clinical information generated during patient care. By using business intelligence tools to create a view into Duke Medicine's enterprise data warehouse, DEDUCE provides a Guided Query functionality using a wizard-like interface that lets users filter through millions of clinical records, explore aggregate reports, and, export extracts. Researchers and QI specialists can obtain detailed patient- and observation-level extracts without needing to understand structured query language or the underlying database model. Developers designing such tools must devote sufficient training and develop application safeguards to ensure that patient-centered clinical researchers understand when observation-level extracts should be used. This may mitigate the risk of data being misunderstood and consequently used in an improper fashion. Copyright © 2010 Elsevier Inc. All rights reserved.

  1. Operating cost budgeting methods: quantitative methods to improve the process

    Directory of Open Access Journals (Sweden)

    José Olegário Rodrigues da Silva

    Full Text Available Abstract Operating cost forecasts are used in economic feasibility studies of projects and in budgeting process. Studies have pointed out that some companies are not satisfied with the budgeting process and chief executive officers want updates more frequently. In these cases, the main problem lies in the costs versus benefits. Companies seek simple and cheap forecasting methods without, at the same time, conceding in terms of quality of the resulting information. This study aims to compare operating cost forecasting models to identify the ones that are relatively easy to implement and turn out less deviation. For this purpose, we applied ARIMA (autoregressive integrated moving average and distributed dynamic lag models to data from a Brazilian petroleum company. The results suggest that the models have potential application, and that multivariate models fitted better and showed itself a better way to forecast costs than univariate models.

  2. Methods improvements incorporated into the SAPHIRE ASP models

    International Nuclear Information System (INIS)

    Sattison, M.B.; Blackman, H.S.; Novack, S.D.; Smith, C.L.; Rasmuson, D.M.

    1994-01-01

    The Office for Analysis and Evaluation of Operational Data (AEOD) has sought the assistance of the Idaho National Engineering Laboratory (INEL) to make some significant enhancements to the SAPHIRE-based Accident Sequence Precursor (ASP) models recently developed by the INEL. The challenge of this project is to provide the features of a full-scale PRA within the framework of the simplified ASP models. Some of these features include: (1) uncertainty analysis addressing the standard PRA uncertainties and the uncertainties unique to the ASP models and methodology, (2) incorporation and proper quantification of individual human actions and the interaction among human actions, (3) enhanced treatment of common cause failures, and (4) extension of the ASP models to more closely mimic full-scale PRAs (inclusion of more initiators, explicitly modeling support system failures, etc.). This paper provides an overview of the methods being used to make the above improvements

  3. Interprofessional Oral Health Education Improves Knowledge, Confidence, and Practice for Pediatric Healthcare Providers

    Directory of Open Access Journals (Sweden)

    Devon Cooper

    2017-08-01

    Full Text Available Dental caries is the most prevalent chronic childhood disease in the United States. Dental caries affects the health of 60–90% of school-aged children worldwide. The prevalence of untreated early childhood dental caries is 19% for children 2–5 years of age in the U.S. Some factors that contribute to the progression of dental caries include socioeconomic status, access to dental care, and lack of anticipatory guidance. The prevalence of dental caries remains highest for children from specific ethnic or racial groups, especially those living in underserved areas where there may be limited access to a dentist. Although researchers have acknowledged the various links between oral health and overall systemic health, oral health care is not usually a component of pediatric primary health care. To address this public health crisis and oral health disparity in children, new collaborative efforts among health professionals is critical for dental disease prevention and optimal oral health. This evaluation study focused on a 10-week interprofessional practice and education (IPE course on children’s oral health involving dental, osteopathic medical, and nurse practitioner students at the University of California, San Francisco. This study’s objective was to evaluate changes in knowledge, confidence, attitude, and clinical practice in children’s oral health of the students completed the course. Thirty-one students participated in the IPE and completed demographic questionnaires and four questionnaires before and after the IPE course: (1 course content knowledge, (2 confidence, (3 attitudes, and (4 clinical practice. Results showed a statistically significant improvement in the overall knowledge of children’s oral health topics, confidence in their ability to provide oral health services, and clinical practice. There was no statistically significant difference in attitude, but there was an upward trend toward positivity. To conclude, this IPE

  4. Improving the performance of solar still by using nanofluids and providing vacuum

    International Nuclear Information System (INIS)

    Kabeel, A.E.; Omara, Z.M.; Essa, F.A.

    2014-01-01

    Highlights: • Modified solar still integrated with an external condenser and used nanofluids were studied. • The results obtained that using cuprous oxide increased the distilled productivity by 133.64%. • Using the aluminum oxide–water nanofluid increased the distillate productivity of the modified still by 125.0%. - Abstract: The experimental modifications were carried out into the conventional solar still, considerably increasing the distillate water productivity. The effects of using different types of nanomaterials on the performance of solar still were studied. The investigated solid nanoparticles are the cuprous and aluminum oxides. The performance was investigated at different weight fraction concentrations of nanoparticles in the basin water with and without providing vacuum. These additions and modifications greatly improve the evaporation and condensation rates and hence the distillate yield was augmented. The research was conducted for range of concentrations starting from 0.02% to 0.2% with a step of 0.02%. The maxima productivity was obtained for using the cuprous oxide nanoparticles with a concentration of 0.2% with operating the vacuum fan. The results obtained that using cuprous oxide nanoparticles increased the distilled productivity by 133.64% and 93.87% with and without the fan respectively. On the other hand, using aluminum oxide nanoparticles enhanced the distillate by 125.0% and 88.97% with and without the fan respectively as compared to the conventional still. The estimated cost of 1.0 l of distillate are approximately 0.035$, 0.045$ when using the cuprous oxide nanomaterial with and without the fan and, as well as the aluminum oxide nanoparticles, 0.038$ and 0.051$ respectively, and for the conventional still is 0.048$

  5. Electromagnetic heating method to improve steam assisted gravity drainage

    Energy Technology Data Exchange (ETDEWEB)

    Koolman, M.; Huber, N.; Diehl, D.; Wacker, B. [Siemens AG, Munich (Germany)

    2008-10-15

    The in-situ recovery of heavy and highly viscous bitumen has become economically feasible with the use of steam assisted gravity drainage (SAGD). However, several challenges exist, such as the energy cost for production of bitumen; environmental concerns over the consumption of water; limited recovery of bitumen; shallowness of the reservoirs; and the propagation of steam chambers leading to limited recovery. This paper described an opportunity to improve the widely applied SAGD process for in-situ production of bitumen from oil sands deposits. The technical concept was directed at electromagnetic (EM-SAGD) heating methods assisting the process. The paper described a preliminary investigation that was conducted in order to confirm the feasibility of different solutions and evaluate aspects of energy efficiency and environmental impact. A comparison of electrical heating methods showed that the inductive method was the most reasonable in terms of technical and economical feasibility. The paper also discussed a small scale sandbox test to verify a three-dimensional simulation provided with two different simulation tools. The results of reservoir simulation were also presented. Last, the paper examined health and safety considerations. It was concluded that inductive heating provides an additional, easy to handle control parameter. The study showed that if the geometries of the inductors related to the producer wells were selected in a tailor-made manner, individual reservoir conditions could be handled by an optimized operating strategy. 4 refs., 3 tabs., 15 figs.

  6. Method of Improving Personal Name Search in Academic Information Service

    Directory of Open Access Journals (Sweden)

    Heejun Han

    2012-12-01

    Full Text Available All academic information on the web or elsewhere has its creator, that is, a subject who has created the information. The subject can be an individual, a group, or an institution, and can be a nation depending on the nature of the relevant information. Most information is composed of a title, an author, and contents. An essay which is under the academic information category has metadata including a title, an author, keyword, abstract, data about publication, place of publication, ISSN, and the like. A patent has metadata including the title, an applicant, an inventor, an attorney, IPC, number of application, and claims of the invention. Most web-based academic information services enable users to search the information by processing the meta-information. An important element is to search information by using the author field which corresponds to a personal name. This study suggests a method of efficient indexing and using the adjacent operation result ranking algorithm to which phrase search-based boosting elements are applied, and thus improving the accuracy of the search results of personal names. It also describes a method for providing the results of searching co-authors and related researchers in searching personal names. This method can be effectively applied to providing accurate and additional search results in the academic information services.

  7. Teaching Literacy: Methods for Studying and Improving Library Instruction

    Directory of Open Access Journals (Sweden)

    Meggan Houlihan

    2012-12-01

    Full Text Available Objective – The aim of this paper is to evaluate teaching effectiveness in one-shotinformation literacy (IL instruction sessions. The authors used multiple methods,including plus/delta forms, peer evaluations, and instructor feedback surveys, in aneffort to improve student learning, individual teaching skill, and the overall IL programat the American University in Cairo.Methods – Researchers implemented three main evaluation tools to gather data in thisstudy. Librarians collected both quantitative and qualitative data using studentplus/delta surveys, peer evaluation, and faculty feedback in order to draw overallconclusions about the effectiveness of one-shot IL sessions. By designing a multi-methodstudy, and gathering information from students, faculty, and instruction librarians,results represented the perspectives of multiple stakeholders. Results – The data collected using the three evaluation tools provided insight into the needs and perspectives of three stakeholder groups. Individual instructors benefit from the opportunity to improve teaching through informed reflection, and are eager for feedback. Faculty members want their students to have more hands-on experience, but are pleased overall with instruction. Students need less lecturing and more authentic learning opportunities to engage with new knowledge.Conclusion – Including evaluation techniques in overall information literacy assessment plans is valuable, as instruction librarians gain opportunities for self-reflection and improvement, and administrators gather information about teaching skill levels. The authors gathered useful data that informed administrative decision making related to the IL program at the American University in Cairo. The findings discussed in this paper, both practical and theoretical, can help other college and university librarians think critically about their own IL programs, and influence how library instruction sessions might be evaluated and

  8. Work system innovation: Designing improvement methods for generative capability

    DEFF Research Database (Denmark)

    Hansen, David; Møller, Niels

    2013-01-01

    This paper explores how a work system’s capability for improvement is influenced by its improvement methods. Based on explorative case study at a Lean manufacturing facility, the methods problem solving and Appreciative Inquiry were compared through in-depth qualitative studies over a 12-month...

  9. Provider Profiling: A Population Health Improvement Tool for the Southeast Military Health System

    National Research Council Canada - National Science Library

    Pemberton, Phillip

    1999-01-01

    ...). Profiling with Provider Perspectives, a Primary Care Management Tool, provides the SEMHS with a standardized performance measurement system that offers feedback in a user friendly and non-threatening format...

  10. Passive Methods as a Solution for Improving Indoor Environments

    CERN Document Server

    Orosa, José A

    2012-01-01

    There are many aspects to consider when evaluating or improving an indoor environment; thermal comfort, energy saving, preservation of materials, hygiene and health are all key aspects which can be improved by passive methods of environmental control. Passive Methods as a Solution for Improving Indoor Environments endeavours to fill the lack of analysis in this area by using over ten years of research to illustrate the effects of methods such as thermal inertia and permeable coverings; for example, the use of permeable coverings is a well known passive method, but its effects and ways to improve indoor environments have been rarely analyzed.   Passive Methods as a Solution for Improving Indoor Environments  includes both software simulations and laboratory and field studies. Through these, the main parameters that characterize the behavior of internal coverings are defined. Furthermore, a new procedure is explained in depth which can be used to identify the real expected effects of permeable coverings such ...

  11. Providing Elementary Teachers in South Texas with Professional Development to Improve Earth Science Instruction

    Science.gov (United States)

    Borrego, H.; Ellins, K. K.

    2011-12-01

    Through three years of participation in the TeXas Earth and Space Science (TXESS) Revolution, an NSF-sponsored teacher professional development program, my knowledge of earth science, new pedagogical approaches, and confidence has improved dramatically. I have also received instructional materials and learned how to access high quality online resources and use a variety of web-based tools. In this session, I will share my experiences and report on how I used my own learning to help both teachers and students to become more earth science literate individuals. Earth Science test scores at the elementary level throughout South Texas are consistently low in comparison to other regions in the state. The majority of the teachers lack the content-knowledge, confidence, or experience to teach Earth Sciences. My TXESS Revolution experience helped me to understand the needs of these teachers and to identify teaching resources that would be useful to them. Particularly noteworthy are TERC's EarthLabs: Earth System Science and GLOBE activities. Although these Earthlab investigations are designed for high schools students, I demonstrated how they could be adapted for elementary students. As a result, I have provided professional development in the Earth Sciences to about 300 South Texas elementary teachers. TXESS Revolution has also equipped me to empower the students I teach. My students this past year presented their challenge Legacy Cycle Project to the community. The TXESS Revolution teamed up with the Texas Water Development Board to deliver training on the implementation of a new online challenged-based curriculum called the Water Exploration Legacy Cycles. This training gave me the tools to guide my students learning through authentic scientific research. To carry out their challenge, students researched an area of interest, read literature, consulted with experts in the field, consider different prospective, and presented their final products via PowerPoint, poster

  12. Improvement of human reliability analysis method for PRA

    International Nuclear Information System (INIS)

    Tanji, Junichi; Fujimoto, Haruo

    2013-09-01

    It is required to refine human reliability analysis (HRA) method by, for example, incorporating consideration for the cognitive process of operator into the evaluation of diagnosis errors and decision-making errors, as a part of the development and improvement of methods used in probabilistic risk assessments (PRAs). JNES has been developed a HRA method based on ATHENA which is suitable to handle the structured relationship among diagnosis errors, decision-making errors and operator cognition process. This report summarizes outcomes obtained from the improvement of HRA method, in which enhancement to evaluate how the plant degraded condition affects operator cognitive process and to evaluate human error probabilities (HEPs) which correspond to the contents of operator tasks is made. In addition, this report describes the results of case studies on the representative accident sequences to investigate the applicability of HRA method developed. HEPs of the same accident sequences are also estimated using THERP method, which is most popularly used HRA method, and comparisons of the results obtained using these two methods are made to depict the differences of these methods and issues to be solved. Important conclusions obtained are as follows: (1) Improvement of HRA method using operator cognitive action model. Clarification of factors to be considered in the evaluation of human errors, incorporation of degraded plant safety condition into HRA and investigation of HEPs which are affected by the contents of operator tasks were made to improve the HRA method which can integrate operator cognitive action model into ATHENA method. In addition, the detail of procedures of the improved method was delineated in the form of flowchart. (2) Case studies and comparison with the results evaluated by THERP method. Four operator actions modeled in the PRAs of representative BWR5 and 4-loop PWR plants were selected and evaluated as case studies. These cases were also evaluated using

  13. THIRD PARTY LOGISTIC SERVICE PROVIDER SELECTION USING FUZZY AHP AND TOPSIS METHOD

    Directory of Open Access Journals (Sweden)

    Golam Kabir

    2012-03-01

    Full Text Available The use of third party logistic(3PL services providers is increasing globally to accomplish the strategic objectives. In the increasingly competitive environment, logistics strategic management requires systematic and structured approach to have cutting edge over the rival. Logistics service provider selection is a complex multi-criteria decision making process; in which, decision makers have to deals with the optimization of conflicting objectives such as quality, cost, and delivery time. In this paper, fuzzy analytic hierarchy process (FAHP approach based on technique for order preference by similarity to ideal solution (TOPSIS method has been proposed for evaluating and selecting an appropriate logistics service provider, where the ratings of each alternative and importance weight of each criterion are expressed in triangular fuzzy numbers.

  14. A method of providing a barrier in a fracture-containing system

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention relates to a method of providing a barrier in a fracture-containing system, comprising: i) Providing a treatment fluid comprising: a) a base fluid; b) an elastomeric material, wherein said elastomeric material comprises at least one polymer capable of crosslinking into an el......The present invention relates to a method of providing a barrier in a fracture-containing system, comprising: i) Providing a treatment fluid comprising: a) a base fluid; b) an elastomeric material, wherein said elastomeric material comprises at least one polymer capable of crosslinking...... into an elastomer, and c) at least one crosslinking agent; ii) Placing the treatment fluid in a fracture-containing system; iii) Allowing the elastomeric material to crosslink with itself to form a barrier in said fracture-containing system; wherein the elastomeric material and/or the crosslinking agent...... are of neutral buoyancy with regard to the base fluid. The invention is contemplated to having utility not only in the oil-drilling industry but also in the plugging of fractures in sewer drains, pipelines etc....

  15. POSSIBILITY OF IMPROVING EXISTING STANDARDS AND METHODOLOGIES FOR AUDITING INFORMATION SYSTEMS TO PROVIDE E-GOVERNMENT SERVICES

    Directory of Open Access Journals (Sweden)

    Евгений Геннадьевич Панкратов

    2014-03-01

    Full Text Available This article analyzes the existing methods of e-government systems audit, their shortcomings are examined.  The approaches to improve existing techniques and adapt them to the specific characteristics of e-government systems are suggested. The paper describes the methodology, providing possibilities of integrated assessment of information systems. This methodology uses systems maturity models and can be used in the construction of e-government rankings, as well as in the audit of their implementation process. Maturity models are based on COBIT, COSO methodologies and models of e-government, developed by the relevant committee of the UN. The methodology was tested during the audit of information systems involved in the payment of temporary disability benefits. The audit was carried out during analysis of the outcome of the pilot project for the abolition of the principle of crediting payments for disability benefits.DOI: http://dx.doi.org/10.12731/2218-7405-2014-2-5

  16. A Process Improvement Evaluation of Sequential Compression Device Compliance and Effects of Provider Intervention.

    Science.gov (United States)

    Beachler, Jason A; Krueger, Chad A; Johnson, Anthony E

    This process improvement study sought to evaluate the compliance in orthopaedic patients with sequential compression devices and to monitor any improvement in compliance following an educational intervention. All non-intensive care unit orthopaedic primary patients were evaluated at random times and their compliance with sequential compression devices was monitored and recorded. Following a 2-week period of data collection, an educational flyer was displayed in every patient's room and nursing staff held an in-service training event focusing on the importance of sequential compression device use in the surgical patient. Patients were then monitored, again at random, and compliance was recorded. With the addition of a simple flyer and a single in-service on the importance of mechanical compression in the surgical patient, a significant improvement in compliance was documented at the authors' institution from 28% to 59% (p < .0001).

  17. Providing Transthoracic Echocardiography Training for Intensive Care Unit Trainees: An Educational Improvement Initiative.

    Science.gov (United States)

    Kuza, Catherine M; Hanifi, M Tariq; Koç, Melissa; Stopfkuchen-Evans, Matthias

    2018-04-09

    Transthoracic echocardiography (TTE) is important in the management of critically ill patients, yet it has not been incorporated into many residency programs' curricula. Our objective is to determine if trainees undergoing a 60-minute training session on TTE have improved knowledge, ultrasound skills, and increases the utilization of TTE during their rotation in the intensive care unit (ICU). We will also compare the results of participants with prior TTE exposure to TTE-naïve trainees. Our hypothesis is that after the training, participants' will have improved knowledge and ultrasound skills compared to before training. Our secondary hypotheses are that TTE-naïve trainees will have greater improvements in knowledge scores compared to those who have had prior TTE experience and trainees will increase their use of TTE in the ICU. Single-center, prospective trial. Brigham and Women's Hospital (academic hospital). Residents and fellows rotating through the ICU, at any level of postgraduate training. Forty-two trainees participated in the study. Statistically significant improvement after training was observed for all multiple choice questions (MCQ) and practical assessments (p < 0.001). When assessing the differences in score improvement between TTE-experienced versus TTE-naïve users, mean score improvements were notably higher for TTE-naïve participants (MCQ: 28.2 ± 11.6; echo clinical: 48.6 ± 23.4) compared to TTE-experienced users (MCQ: 18.6 ± 13.5, p = 0.01; echo clinical: 38.3 ± 30.2, p = 0.04). A short didactic presentation on TTE use may be useful in teaching ICU trainees basic TTE skills and encouraging the use of bedside TTE in the ICU. Copyright © 2018 Association of Program Directors in Surgery. Published by Elsevier Inc. All rights reserved.

  18. The Efficacy of Private Sector Providers in Improving Public Educational Outcomes

    Science.gov (United States)

    Heinrich, Carolyn J.; Nisar, Hiren

    2013-01-01

    School districts required under No Child Left Behind (NCLB) to provide supplemental educational services (SES) to students in schools that are not making adequate yearly progress rely heavily on the private sector to offer choice in services. If the market does not drive out ineffective providers, students may not gain through SES participation.…

  19. Metric-based method of software requirements correctness improvement

    Directory of Open Access Journals (Sweden)

    Yaremchuk Svitlana

    2017-01-01

    Full Text Available The work highlights the most important principles of software reliability management (SRM. The SRM concept construes a basis for developing a method of requirements correctness improvement. The method assumes that complicated requirements contain more actual and potential design faults/defects. The method applies a newer metric to evaluate the requirements complexity and double sorting technique evaluating the priority and complexity of a particular requirement. The method enables to improve requirements correctness due to identification of a higher number of defects with restricted resources. Practical application of the proposed method in the course of demands review assured a sensible technical and economic effect.

  20. Improvement of Tone's method with two-term rational approximation

    International Nuclear Information System (INIS)

    Yamamoto, Akio; Endo, Tomohiro; Chiba, Go

    2011-01-01

    An improvement of Tone's method, which is a resonance calculation method based on the equivalence theory, is proposed. In order to increase calculation accuracy, the two-term rational approximation is incorporated for the representation of neutron flux. Furthermore, some theoretical aspects of Tone's method, i.e., its inherent approximation and choice of adequate multigroup cross section for collision probability estimation, are also discussed. The validity of improved Tone's method is confirmed through a verification calculation in an irregular lattice geometry, which represents part of an LWR fuel assembly. The calculation result clarifies the validity of the present method. (author)

  1. Pediatric primary care providers' perspectives regarding hospital discharge communication: a mixed methods analysis.

    Science.gov (United States)

    Leyenaar, JoAnna K; Bergert, Lora; Mallory, Leah A; Engel, Richard; Rassbach, Caroline; Shen, Mark; Woehrlen, Tess; Cooperberg, David; Coghlin, Daniel

    2015-01-01

    Effective communication between inpatient and outpatient providers may mitigate risks of adverse events associated with hospital discharge. However, there is an absence of pediatric literature defining effective discharge communication strategies at both freestanding children's hospitals and general hospitals. The objectives of this study were to assess associations between pediatric primary care providers' (PCPs) reported receipt of discharge communication and referral hospital type, and to describe PCPs' perspectives regarding effective discharge communication and areas for improvement. We administered a questionnaire to PCPs referring to 16 pediatric hospital medicine programs nationally. Multivariable models were developed to assess associations between referral hospital type and receipt and completeness of discharge communication. Open-ended questions asked respondents to describe effective strategies and areas requiring improvement regarding discharge communication. Conventional qualitative content analysis was performed to identify emergent themes. Responses were received from 201 PCPs, for a response rate of 63%. Although there were no differences between referral hospital type and PCP-reported receipt of discharge communication (relative risk 1.61, 95% confidence interval 0.97-2.67), PCPs referring to general hospitals more frequently reported completeness of discharge communication relative to those referring to freestanding children's hospitals (relative risk 1.78, 95% confidence interval 1.26-2.51). Analysis of free text responses yielded 4 major themes: 1) structured discharge communication, 2) direct personal communication, 3) reliability and timeliness of communication, and 4) communication for effective postdischarge care. This study highlights potential differences in the experiences of PCPs referring to general hospitals and freestanding children's hospitals, and presents valuable contextual data for future quality improvement initiatives

  2. A Method for Improving Galactic Cepheid Reddenings and Distances

    Energy Technology Data Exchange (ETDEWEB)

    Madore, Barry F. [The Observatories Carnegie Institution for Science 813 Santa Barbara St., Pasadena, CA 91101 (United States); Freedman, Wendy L.; Moak, Sandy, E-mail: barry.f.madore@gmail.com, E-mail: sandymoak@gmail.com, E-mail: wfreedman@uchicago.edu [Dept. of Astronomy and Astrophysics, University of Chicago, Chicago, IL (United States)

    2017-06-10

    We present a new photometric method by which improved high-precision reddenings and true distance moduli can be determined to individual Galactic Cepheids once distance measurements are available. We illustrate that the relative positioning of stars in the Cepheid period–luminosity (PL) relation (Leavitt law) is preserved as a function of wavelength. This information then provides a powerful constraint for determining reddenings to individual Cepheids, as well as their distances. As a first step, we apply this method to the 59 Cepheids in the compilation of Fouqué et al. Updated reddenings, distance moduli (or parallaxes), and absolute magnitudes in seven (optical through near-infrared) bands are given. From these intrinsic quantities, multiwavelength PL and color–color relations are derived. We find that the V -band period–luminosity–color relation has an rms scatter of only 0.06 mag, so that individual Cepheid distances can be measured to 3%, compared with dispersions of 6 to 13% for the one-parameter K through B PL relations, respectively. This method will be especially useful in conjunction with the new accurate parallax sample upcoming from Gaia .

  3. Rubisco catalytic properties of wild and domesticated relatives provide scope for improving wheat photosynthesis.

    Science.gov (United States)

    Prins, Anneke; Orr, Douglas J; Andralojc, P John; Reynolds, Matthew P; Carmo-Silva, Elizabete; Parry, Martin A J

    2016-03-01

    Rubisco is a major target for improving crop photosynthesis and yield, yet natural diversity in catalytic properties of this enzyme is poorly understood. Rubisco from 25 genotypes of the Triticeae tribe, including wild relatives of bread wheat (Triticum aestivum), were surveyed to identify superior enzymes for improving photosynthesis in this crop. In vitro Rubisco carboxylation velocity (V c), Michaelis-Menten constants for CO2 (K c) and O2 (K o) and specificity factor (S c/o) were measured at 25 and 35 °C. V c and K c correlated positively, while V c and S c/o were inversely related. Rubisco large subunit genes (rbcL) were sequenced, and predicted corresponding amino acid differences analysed in relation to the corresponding catalytic properties. The effect of replacing native wheat Rubisco with counterparts from closely related species was analysed by modelling the response of photosynthesis to varying CO2 concentrations. The model predicted that two Rubisco enzymes would increase photosynthetic performance at 25 °C while only one of these also increased photosynthesis at 35 °C. Thus, under otherwise identical conditions, catalytic variation in the Rubiscos analysed is predicted to improve photosynthetic rates at physiological CO2 concentrations. Naturally occurring Rubiscos with superior properties amongst the Triticeae tribe can be exploited to improve wheat photosynthesis and crop productivity. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  4. Providing Students with Interdisciplinary Support to Improve Their Organic Chemistry Posters

    Science.gov (United States)

    Widanski, Bozena; Thompson, Jo Ann; Foran-Mulcahy, Katie; Abafo, Amy

    2016-01-01

    A two-semester-long interdisciplinary support effort to improve student posters in organic chemistry lab is described. In the first semester, students' literature search report is supported by a workshop conducted by an Instruction Librarian. During the subsequent semester, a second workshop is presented by the Instruction Librarian, an English…

  5. Partnership working and improved service delivery: views of staff providing sexual health services.

    Science.gov (United States)

    Pow, Janette; Elliott, Lawrie; Raeside, Robert; Themessl-Huber, Markus; Claveirole, Anne

    2013-07-01

    Successful partnership working has theoretically been linked to improvements in service delivery and is dependent on the strength of the partnership, trust, communication, professional roles and resource sharing. Empirical evidence to confirm the relationships between these factors and improved service provision, however, is lacking. Our aim was to assess the views of staff as to the conditions required for partnership working. This study was a cross-sectional survey of 687 staff offering sexual health education, information or support to young people in the Healthy Respect intervention area in Scotland. Views of each variable were scored and structural equation modelling was used to assess the theoretical model. Responses were received from 284 (41%) staff. Greater strength of partnership was directly associated with increasing the number of referrals. Establishing professional roles between organizations was also associated with increasing the number of referrals. Strength of partnership was indirectly associated with working more effectively with young people and this relationship depended on clear communication, trust, established professional roles and shared resources. Effective partnership working depends on a number of interdependent relationships between organizations, which act synergistically to improve organizational outcomes. Effective partnership working leads to improved service delivery though there is a need for better controlled studies which demonstrate the effect on health outcomes.

  6. Quality of provided care in vascular surgery : outcome assessment & improvement strategies

    NARCIS (Netherlands)

    Flu, Hans Christiaan

    2010-01-01

    The aim of this thesis was to evaluate the quality of care in vascular surgery in end-stage renal disease (ESRD) and peripheral arterial occlusive disease (PAOD): intermittent claudication (IC) and critical lower limb ischaemia (CLI) patients. Therefore firstly it focused on the improvement of the

  7. Improving participation rates by providing choice of participation mode: two randomized controlled trials

    NARCIS (Netherlands)

    Heijmans, N.; Lieshout, J. van; Wensing, M.J.

    2015-01-01

    BACKGROUND: Low participation rates reduce effective sample size, statistical power and can increase risk for selection bias. Previous research suggests that offering choice of participation mode can improve participation rates. However, few head-to-head trials compared choice of participation mode

  8. ELV Recycling Service Provider Selection Using the Hybrid MCDM Method: A Case Application in China

    Directory of Open Access Journals (Sweden)

    Fuli Zhou

    2016-05-01

    Full Text Available With the rapid depletion of natural resources and undesired environmental changes globally, more interest has been shown in the research of green supply chain practices, including end-of-life vehicle (ELV recycling. The ELV recycling is mandatory for auto-manufacturers by legislation for the purpose of minimizing potential environmental damages. The purpose of the present research is to determine the best choice of ELV recycling service provider by employing an integrating hybrid multi-criteria decision making (MCDM method. In this research, economic, environmental and social factors are taken into consideration. The linguistic variables and trapezoidal fuzzy numbers (TFNs are applied into this evaluation to deal with the vague and qualitative information. With the combined weight calculation of criteria based on fuzzy aggregation and Shannon Entropy techniques, the normative multi-criteria optimization technique (FVIKOR method is applied to explore the best solution. An application was performed based on the proposed hybrid MCDM method, and sensitivity analysis was conducted on different decision making scenarios. The present study provides a decision-making approach on ELV recycling business selection under sustainability and green philosophy with high robustness and easy implementation.

  9. A mixed-methods examination of communication between oncologists and primary care providers among primary care physicians in underserved communities.

    Science.gov (United States)

    Shen, Megan Johnson; Binz-Scharf, Maria; D'Agostino, Tom; Blakeney, Natasha; Weiss, Elisa; Michaels, Margo; Patel, Shilpa; McKee, M Diane; Bylund, Carma L

    2015-03-15

    Research has demonstrated that communication and care coordination improve cancer patient outcomes. To improve communication and care coordination, it is important to understand primary care providers' (PCPs') perceptions of communication with oncologists as well as PCPs' communication needs. A mixed-methods approach was used in the present study. In the qualitative phase of the study, 18 PCPs practicing in underserved, minority communities were interviewed about their experiences communicating with oncologists. In the quantitative phase of the study, 128 PCPs completed an online survey about their preferences, experiences, and satisfaction with communication with oncologists. Results indicated a PCP-oncologist gap in communication occurred between diagnosis and treatment. PCPs wanted more communication with oncologists, updates on their patients' prognosis throughout treatment, and to be contacted via telephone or email and saw their role as crucial in providing supportive care for their patients. Although PCPs recognize that they play a critical, proactive role in supporting patients throughout the continuum of their cancer care experience, existing norms regarding postreferral engagement and oncologist-PCP communication often hinder activation of this role among PCPs. Expected standards regarding the method, frequency, and quality of postreferral communication should be jointly articulated and made accountable between PCPs and oncologists to help improve cancer patients' quality of care, particularly in minority communities. © 2014 American Cancer Society.

  10. Provider-Initiated Patient Satisfaction Reporting Yields Improved Physician Ratings Relative to Online Rating Websites.

    Science.gov (United States)

    Ricciardi, Benjamin F; Waddell, Brad S; Nodzo, Scott R; Lange, Jeffrey; Nocon, Allina A; Amundsen, Spencer; Tarity, T David; McLawhorn, Alexander S

    2017-09-01

    Recently, providers have begun to publicly report the results of patient satisfaction surveys from their practices. However, these outcomes have never been compared with the findings of commercial online physician rating websites. The goals of the current study were to (1) compare overall patient satisfaction ratings for orthopedic surgeons derived from provider-based third-party surveys with existing commercial physician rating websites and (2) determine the association between patient ratings and provider characteristics. The authors identified 12 institutions that provided publicly available patient satisfaction outcomes derived from third-party surveys for their orthopedic surgeons as of August 2016. Orthopedic surgeons at these institutions were eligible for inclusion (N=340 surgeons). Provider characteristics were recorded from publicly available data. Four high-traffic commercial online physician rating websites were identified: Healthgrades.com, UCompareHealthCare.com, Vitals.com, and RateMDs.com. For each surgeon, overall ratings (on a scale of 1-5), total number of ratings, and percentage of negative ratings were compared between provider-initiated internal ratings and each commercial online website. Associations between baseline factors and overall physician ratings and negative ratings were assessed. Provider-initiated internal patient satisfaction ratings showed a greater number of overall patient ratings, higher overall patient satisfaction ratings, and a lower percentage of negative comments compared with commercial online physician rating websites. A greater number of years in practice had a weak association with lower internal ratings, and an academic practice setting and a location in the Northeast were protective factors for negative physician ratings. Compared with commercial online physician rating websites, provider-initiated patient satisfaction ratings of orthopedic surgeons appear to be more favorable, with greater numbers of responses

  11. Job satisfaction and career commitment among Alzheimer's care providers: addressing turnover and improving staff empowerment.

    Science.gov (United States)

    Coogle, Constance L; Parham, Iris A; Rachel, Colleen A

    2011-11-01

    This study investigated the relation between job satisfaction and career commitment among 262 Alzheimer's care staff working in long-term and community-based care settings. It was anticipated that the results would suggest whether career commitment could be enhanced to positively influence job satisfaction, and conversely, if improvements in job satisfaction might contribute to a deepened sense of vocational empowerment. Participants attended dementia-specific training and completed 2 short work-related questionnaires that measured job satisfaction and career commitment. The results of stepwise regression revealed interrelations between the 2 constructs. Congruence appeared to be reciprocal with respect to the overall scale scores and the intrinsic job satisfaction measure. Unexpected relations appeared in analyses of the extrinsic job satisfaction measure and the career planning subscale. Results are indicative of the fundamental distinction between job satisfaction and career commitment. Implications for efforts to reduce turnover and improve staff empowerment are also considered.

  12. The improving of the heat networks operating process under the conditions of the energy efficiency providing

    Directory of Open Access Journals (Sweden)

    Blinova Tatiana

    2016-01-01

    Full Text Available Among the priorities it is important to highlight the modernization and improvement of energy efficiency of housing and communal services, as well as the transition to the principle of using the most efficient technologies used in reproduction (construction, creation of objects of municipal infrastructure and housing modernization. The main hypothesis of this study lies in the fact that in modern conditions the realization of the most important priorities of the state policy in the sphere of housing and communal services, is possible in the conditions of use of the most effective control technologies for the reproduction of thermal networks. It is possible to raise the level of information security Heat Distribution Company, and other market participants by improving business processes through the development of organizational and economic mechanism in the conditions of complex monitoring of heat network operation processes

  13. Completion plug design provides improved operational efficiency and safety while minimizing environmental risks

    Energy Technology Data Exchange (ETDEWEB)

    Dum, Frank [T.D. Williamson, Inc., Tulsa, OK (United States)

    2012-07-01

    Pipeline repair standards have been raised with recent improvements for completion plugs when used with a brand new setting tool, resulting in lower environmental risks, improved operational efficiency and safety. The design changes were originally made to serve in an offshore environment in order to minimize the diver's time in the water and simplify steps by the diver to execute pipeline repair operations in cold, dark conditions. Enhancements in the design include fewer number of fittings, plugs, o-rings and gaskets isolating the pipeline product found inside the pipe. The new design is a step toward meeting strict operational and safety standards demanded in the field of pipeline maintenance and repair. (author)

  14. A novel class of laboratory middleware. Promoting information flow and improving computerized provider order entry.

    Science.gov (United States)

    Grisson, Ricky; Kim, Ji Yeon; Brodsky, Victor; Kamis, Irina K; Singh, Balaji; Belkziz, Sidi M; Batra, Shalini; Myers, Harold J; Demyanov, Alexander; Dighe, Anand S

    2010-06-01

    A central duty of the laboratory is to inform clinicians about the availability and usefulness of laboratory testing. In this report, we describe a new class of laboratory middleware that connects the traditional clinical laboratory information system with the rest of the enterprise, facilitating information flow about testing services. We demonstrate the value of this approach in efficiently supporting an inpatient order entry application. We also show that order entry monitoring and iterative middleware updates can enhance ordering efficiency and promote improved ordering practices. Furthermore, we demonstrate the value of algorithmic approaches to improve the accuracy and completeness of laboratory test searches. We conclude with a discussion of design recommendations for middleware applications and discuss the potential role of middleware as a sharable, centralized repository of laboratory test information.

  15. Applying BI Techniques To Improve Decision Making And Provide Knowledge Based Management

    Directory of Open Access Journals (Sweden)

    Alexandra Maria Ioana FLOREA

    2015-07-01

    Full Text Available The paper focuses on BI techniques and especially data mining algorithms that can support and improve the decision making process, with applications within the financial sector. We consider the data mining techniques to be more efficient and thus we applied several techniques, supervised and unsupervised learning algorithms The case study in which these algorithms have been implemented regards the activity of a banking institution, with focus on the management of lending activities.

  16. Improving Deployment-Related Primary Care Provider Assessments of PTSD and Mental Health Conditions

    Science.gov (United States)

    2011-10-01

    Eich, P., Kiss , A., & Wossmer, B. (1998). Improving communication skills--a randomized controlled behaviorally oriented intervention study for...cases this misconduct was drug-related (Highfill-McRoy, Larson, Booth - Kewley, and Garland 2010).  Both experiencing trauma (i.e. being wounded...their data (Highfill-McRoy, Larson, Booth -Kewley, and Garland 2010). o In an article that reviewed 29 other studies on PTSD found that studies with the

  17. How do I provide leukapheresis products? Blood center experience and evidence for process improvement.

    Science.gov (United States)

    Ginzburg, Yelena; Kessler, Debra; Narici, Manlio; Caltabiano, Melinda; Rebosa, Mark; Strauss, Donna; Shaz, Beth

    2013-10-01

    The past few decades have seen a resurgence of interest in leukapheresis products to improve the survival of infected patients with neutropenia. These products have a short shelf life and require donor stimulation with dexamethasone before collection. Additionally, a system with good communications and logistical support is essential. A recent survey of blood centers in North America revealed that the majority of centers collecting leukapheresis products use steroid-stimulated donors. The survey results suggested that an analysis of the process and potential process improvement would be of interest to the transfusion medicine community. Data from 2008 to 2011 regarding donor selection, donor dexamethasone stimulation, leukapheresis collection, and correlations between potentially pertinent variables for process improvement were analyzed. Results from an analysis of cost are also included. We evaluate 432 leukapheresis donations and demonstrate correlations between 1) pre- and poststimulation white blood cell (WBC) count (pproduct granulocyte yield (pimprovement in granulocyte quality and yield can be accomplished in dexamethasone-stimulated donors, by selecting eligible donors with relatively high normal prestimulation WBC counts and/or previously good responses to dexamethasone, increasing the duration between dexamethasone stimulation and granulocyte collection, and maintaining optimal hematocrit (5%-10%) in granulocyte collections. Because the majority of surveyed blood centers collecting stimulated granulocytes use steroids alone, modifications presented here may prove useful. Further assessment of correlation between granulocyte yield and clinical outcome will await results of additional studies. © 2012 American Association of Blood Banks.

  18. System and method of providing quick thermal comfort with reduced energy by using directed spot conditioning

    Science.gov (United States)

    Wang, Mingyu; Kadle, Prasad S.; Ghosh, Debashis; Zima, Mark J.; Wolfe, IV, Edward; Craig, Timothy D

    2016-10-04

    A heating, ventilation, and air conditioning (HVAC) system and a method of controlling a HVAC system that is configured to provide a perceived comfortable ambient environment to an occupant seated in a vehicle cabin. The system includes a nozzle configured to direct an air stream from the HVAC system to the location of a thermally sensitive portion of the body of the occupant. The system also includes a controller configured to determine an air stream temperature and an air stream flow rate necessary to establish the desired heat supply rate for the sensitive portion and provide a comfortable thermal environment by thermally isolating the occupant from the ambient vehicle cabin temperature. The system may include a sensor to determine the location of the sensitive portion. The nozzle may include a thermoelectric device to heat or cool the air stream.

  19. Improved parallel solution techniques for the integral transport matrix method

    Energy Technology Data Exchange (ETDEWEB)

    Zerr, R. Joseph, E-mail: rjz116@psu.edu [Department of Mechanical and Nuclear Engineering, The Pennsylvania State University, University Park, PA (United States); Azmy, Yousry Y., E-mail: yyazmy@ncsu.edu [Department of Nuclear Engineering, North Carolina State University, Burlington Engineering Laboratories, Raleigh, NC (United States)

    2011-07-01

    Alternative solution strategies to the parallel block Jacobi (PBJ) method for the solution of the global problem with the integral transport matrix method operators have been designed and tested. The most straightforward improvement to the Jacobi iterative method is the Gauss-Seidel alternative. The parallel red-black Gauss-Seidel (PGS) algorithm can improve on the number of iterations and reduce work per iteration by applying an alternating red-black color-set to the subdomains and assigning multiple sub-domains per processor. A parallel GMRES(m) method was implemented as an alternative to stationary iterations. Computational results show that the PGS method can improve on the PBJ method execution time by up to 10´ when eight sub-domains per processor are used. However, compared to traditional source iterations with diffusion synthetic acceleration, it is still approximately an order of magnitude slower. The best-performing cases are optically thick because sub-domains decouple, yielding faster convergence. Further tests revealed that 64 sub-domains per processor was the best performing level of sub-domain division. An acceleration technique that improves the convergence rate would greatly improve the ITMM. The GMRES(m) method with a diagonal block pre conditioner consumes approximately the same time as the PBJ solver but could be improved by an as yet undeveloped, more efficient pre conditioner. (author)

  20. Improved parallel solution techniques for the integral transport matrix method

    International Nuclear Information System (INIS)

    Zerr, R. Joseph; Azmy, Yousry Y.

    2011-01-01

    Alternative solution strategies to the parallel block Jacobi (PBJ) method for the solution of the global problem with the integral transport matrix method operators have been designed and tested. The most straightforward improvement to the Jacobi iterative method is the Gauss-Seidel alternative. The parallel red-black Gauss-Seidel (PGS) algorithm can improve on the number of iterations and reduce work per iteration by applying an alternating red-black color-set to the subdomains and assigning multiple sub-domains per processor. A parallel GMRES(m) method was implemented as an alternative to stationary iterations. Computational results show that the PGS method can improve on the PBJ method execution time by up to 10´ when eight sub-domains per processor are used. However, compared to traditional source iterations with diffusion synthetic acceleration, it is still approximately an order of magnitude slower. The best-performing cases are optically thick because sub-domains decouple, yielding faster convergence. Further tests revealed that 64 sub-domains per processor was the best performing level of sub-domain division. An acceleration technique that improves the convergence rate would greatly improve the ITMM. The GMRES(m) method with a diagonal block pre conditioner consumes approximately the same time as the PBJ solver but could be improved by an as yet undeveloped, more efficient pre conditioner. (author)

  1. Method of App Selection for Healthcare Providers Based on Consumer Needs.

    Science.gov (United States)

    Lee, Jisan; Kim, Jeongeun

    2018-01-01

    Mobile device applications can be used to manage health. However, healthcare providers hesitate to use them because selection methods that consider the needs of health consumers and identify the most appropriate application are rare. This study aimed to create an effective method of identifying applications that address user needs. Women experiencing dysmenorrhea and premenstrual syndrome were the targeted users. First, we searched for related applications from two major sources of mobile applications. Brainstorming, mind mapping, and persona and scenario techniques were used to create a checklist of relevant criteria, which was used to rate the applications. Of the 2784 applications found, 369 were analyzed quantitatively. Of those, five of the top candidates were evaluated by three groups: application experts, clinical experts, and potential users. All three groups ranked one application the highest; however, the remaining rankings differed. The results of this study suggest that the method created is useful because it considers not only the needs of various users but also the knowledge of application and clinical experts. This study proposes a method for finding and using the best among existing applications and highlights the need for nurses who can understand and combine opinions of users and application and clinical experts.

  2. Discussion of a method for providing general risk information by linking with the nuclear information

    International Nuclear Information System (INIS)

    Shobu, Nobuhiro; Yokomizo, Shirou; Umezawa, Sayaka

    2004-06-01

    'Risk information navigator (http://www.ricotti.jp/risknavi/)', an internet tool for arousing public interest and fostering people's risk literacy, has been developed as the contents for the official website of Techno Community Square 'RICOTTI' (http://www.ricotti.jp) at TOKAI village. In this report we classified the risk information into the fields, Health/Daily Life', 'Society/Crime/Disaster' and Technology/Environment/Energy', for the internet tool contents. According to these categories we discussed a method for providing various risk information on general fields by linking with the information on nuclear field. The web contents are attached to this report with the CD-R media. (author)

  3. An improved mixing model providing joint statistics of scalar and scalar dissipation

    Energy Technology Data Exchange (ETDEWEB)

    Meyer, Daniel W. [Department of Energy Resources Engineering, Stanford University, Stanford, CA (United States); Jenny, Patrick [Institute of Fluid Dynamics, ETH Zurich (Switzerland)

    2008-11-15

    For the calculation of nonpremixed turbulent flames with thin reaction zones the joint probability density function (PDF) of the mixture fraction and its dissipation rate plays an important role. The corresponding PDF transport equation involves a mixing model for the closure of the molecular mixing term. Here, the parameterized scalar profile (PSP) mixing model is extended to provide the required joint statistics. Model predictions are validated using direct numerical simulation (DNS) data of a passive scalar mixing in a statistically homogeneous turbulent flow. Comparisons between the DNS and the model predictions are provided, which involve different initial scalar-field lengthscales. (author)

  4. Improvement of numerical analysis method for FBR core characteristics. 3

    International Nuclear Information System (INIS)

    Takeda, Toshikazu; Yamamoto, Toshihisa; Kitada, Takanori; Katagi, Yousuke

    1998-03-01

    As the improvement of numerical analysis method for FBR core characteristics, studies on several topics have been conducted; multiband method, Monte Carlo perturbation and nodal transport method. This report is composed of the following three parts. Part 1: Improvement of Reaction Rate Calculation Method in the Blanket Region Based on the Multiband Method; A method was developed for precise evaluation of the reaction rate distribution in the blanket region using the multiband method. With the 3-band parameters obtained from the ordinary fitting method, major reaction rates such as U-238 capture, U-235 fission, Pu-239 fission and U-238 fission rate distributions were analyzed. Part 2: Improvement of Estimation Method for Reactivity Based on Monte-Carlo Perturbation Theory; Perturbation theory based on Monte-Carlo perturbation theory have been investigated and introduced into the calculational code. The Monte-Carlo perturbation code was applied to MONJU core and the calculational results were compared to the reference. Part 3: Improvement of Nodal Transport Calculation for Hexagonal Geometry; A method to evaluate the intra-subassembly power distribution from the nodal averaged neutron flux and surface fluxes at the node boundaries, was developed based on the transport theory. (J.P.N.)

  5. The cost-effectiveness of using financial incentives to improve provider quality: a framework and application

    DEFF Research Database (Denmark)

    Meacock, R.; Kristensen, Søren Rud; Sutton, M.

    2014-01-01

    Despite growing adoption of pay-for-performance (P4P) programmes in health care, there is remarkably little evidence on the cost-effectiveness of such schemes. We review the limited number of previous studies and critique the frameworks adopted and the narrow range of costs and outcomes considered......, and whether performance improvement is a transitory or investment activity. Our application to the Advancing Quality initiative demonstrates that the incentive payments represented less than half of the 13m pound total programme costs. By generating approximately 5200 quality-adjusted life years and 4.4m...

  6. Forms and Methods of Agricultural Sector Innovative Activity Improvement

    Directory of Open Access Journals (Sweden)

    Aisha S. Ablyaeva

    2013-01-01

    Full Text Available The article is focused on basic forms and methods to improve the efficiency of innovative activity in the agricultural sector of Ukraine. It was determined that the development of agriculture in Ukraine is affected by a number of factors that must be considered to design innovative models of entrepreneurship development and ways to improve the efficiency of innovative entrepreneurship activity.

  7. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation

    Science.gov (United States)

    2016-02-11

    unlimited. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation The views, opinions and...into Dynamics and Regulation of Yeast Translation Report Title Ribosome-footprint profiling provides genome-wide snapshots of translation, but...tend to slow translation. With the improved mRNA measurements, the variation attributable to translational control in exponentially growing yeast was

  8. Editorial: Advances in healthcare provider and patient training to improve the quality and safety of patient care

    OpenAIRE

    Elizabeth M. Borycki

    2015-01-01

    This special issue of the Knowledge Management & E-Learning: An International Journal is dedicated to describing “Advances in Healthcare Provider and Patient Training to Improve the Quality and Safety of Patient Care.” Patient safety is an important and fundamental requirement of ensuring the quality of patient care. Training and education has been identified as a key to improving healthcare provider patient safety competencies especially when working with new technologies such as electronic ...

  9. Feedback Providing Improvement Strategies and Reflection on Feedback Use: Effects on Students' Writing Motivation, Process, and Performance

    Science.gov (United States)

    Duijnhouwer, Hendrien; Prins, Frans J.; Stokking, Karel M.

    2012-01-01

    This study investigated the effects of feedback providing improvement strategies and a reflection assignment on students' writing motivation, process, and performance. Students in the experimental feedback condition (n = 41) received feedback including improvement strategies, whereas students in the control feedback condition (n = 41) received…

  10. BioTapestry now provides a web application and improved drawing and layout tools.

    Science.gov (United States)

    Paquette, Suzanne M; Leinonen, Kalle; Longabaugh, William J R

    2016-01-01

    Gene regulatory networks (GRNs) control embryonic development, and to understand this process in depth, researchers need to have a detailed understanding of both the network architecture and its dynamic evolution over time and space. Interactive visualization tools better enable researchers to conceptualize, understand, and share GRN models. BioTapestry is an established application designed to fill this role, and recent enhancements released in Versions 6 and 7 have targeted two major facets of the program. First, we introduced significant improvements for network drawing and automatic layout that have now made it much easier for the user to create larger, more organized network drawings. Second, we revised the program architecture so it could continue to support the current Java desktop Editor program, while introducing a new BioTapestry GRN Viewer that runs as a JavaScript web application in a browser. We have deployed a number of GRN models using this new web application. These improvements will ensure that BioTapestry remains viable as a research tool in the face of the continuing evolution of web technologies, and as our understanding of GRN models grows.

  11. Improved Cell Culture Method for Growing Contracting Skeletal Muscle Models

    Science.gov (United States)

    Marquette, Michele L.; Sognier, Marguerite A.

    2013-01-01

    An improved method for culturing immature muscle cells (myoblasts) into a mature skeletal muscle overcomes some of the notable limitations of prior culture methods. The development of the method is a major advance in tissue engineering in that, for the first time, a cell-based model spontaneously fuses and differentiates into masses of highly aligned, contracting myotubes. This method enables (1) the construction of improved two-dimensional (monolayer) skeletal muscle test beds; (2) development of contracting three-dimensional tissue models; and (3) improved transplantable tissues for biomedical and regenerative medicine applications. With adaptation, this method also offers potential application for production of other tissue types (i.e., bone and cardiac) from corresponding precursor cells.

  12. Redesigning geriatric healthcare: how cross-functional teams and process improvement provide a competitive advantage.

    Science.gov (United States)

    Andrews, B C; Kaye, J; Bowcutt, M; Campbell, J

    2001-01-01

    This study examines the consequences of adding a geriatric subacute unit to the traditional health care mix offered by a nonprofit hospital. Historically, geriatric health care offerings have been limited to either acute care units or long-term care facilities. The study's findings demonstrate that the addition of a subacute unit that is operated by an interdisciplinary team is a competitively rational move for two reasons. First, it provides a continuum of care that integrates services and departments, thereby reducing costs. Second, it provides a supportive environment for patients and their families. As a consequence patients have a higher probability of returning home than patients who are assigned to more traditional modes of care.

  13. The Otolaryngologist's Role in Providing Gender-Affirming Care: An Opportunity for Improved Education and Training.

    Science.gov (United States)

    Chaiet, Scott R; Yoshikawa, Noriko; Sturm, Angela; Flanary, Valerie; Ishman, Stacey; Streed, Carl G

    2018-06-01

    Currently, there are limited resources and training available for otolaryngologists and otolaryngology practice personnel to provide gender-affirming care for transgender or gender nonconforming patients. This unique patient population may present to our offices for gender-specific care or with complaints of the ear, nose, and throat unrelated to gender identity. Our current practice has unintentional but direct consequences on our patients care, as transgender patients often report negative experiences in the healthcare setting related to their gender identity. The absence of resources and training is also seen in other specialties. Physicians who create an environment where patients of all gender identities feel welcome can better meet their patients' health care needs. In addition, otolaryngologists can play a role in easing the gender dysphoria experienced by transgender patients. We suggest educational content should be created for and made available to otolaryngologists and office staff to provide gender-affirming care.

  14. Improved modeling of clinical data with kernel methods.

    Science.gov (United States)

    Daemen, Anneleen; Timmerman, Dirk; Van den Bosch, Thierry; Bottomley, Cecilia; Kirk, Emma; Van Holsbeke, Caroline; Valentin, Lil; Bourne, Tom; De Moor, Bart

    2012-02-01

    Despite the rise of high-throughput technologies, clinical data such as age, gender and medical history guide clinical management for most diseases and examinations. To improve clinical management, available patient information should be fully exploited. This requires appropriate modeling of relevant parameters. When kernel methods are used, traditional kernel functions such as the linear kernel are often applied to the set of clinical parameters. These kernel functions, however, have their disadvantages due to the specific characteristics of clinical data, being a mix of variable types with each variable its own range. We propose a new kernel function specifically adapted to the characteristics of clinical data. The clinical kernel function provides a better representation of patients' similarity by equalizing the influence of all variables and taking into account the range r of the variables. Moreover, it is robust with respect to changes in r. Incorporated in a least squares support vector machine, the new kernel function results in significantly improved diagnosis, prognosis and prediction of therapy response. This is illustrated on four clinical data sets within gynecology, with an average increase in test area under the ROC curve (AUC) of 0.023, 0.021, 0.122 and 0.019, respectively. Moreover, when combining clinical parameters and expression data in three case studies on breast cancer, results improved overall with use of the new kernel function and when considering both data types in a weighted fashion, with a larger weight assigned to the clinical parameters. The increase in AUC with respect to a standard kernel function and/or unweighted data combination was maximum 0.127, 0.042 and 0.118 for the three case studies. For clinical data consisting of variables of different types, the proposed kernel function--which takes into account the type and range of each variable--has shown to be a better alternative for linear and non-linear classification problems

  15. A method to provide rapid in situ determination of tip radius in dynamic atomic force microscopy

    International Nuclear Information System (INIS)

    Santos, Sergio; Guang Li; Souier, Tewfik; Gadelrab, Karim; Chiesa, Matteo; Thomson, Neil H.

    2012-01-01

    We provide a method to characterize the tip radius of an atomic force microscopy in situ by monitoring the dynamics of the cantilever in ambient conditions. The key concept is that the value of free amplitude for which transitions from the attractive to repulsive force regimes are observed, strongly depends on the curvature of the tip. In practice, the smaller the value of free amplitude required to observe a transition, the sharper the tip. This general behavior is remarkably independent of the properties of the sample and cantilever characteristics and shows the strong dependence of the transitions on the tip radius. The main advantage of this method is rapid in situ characterization. Rapid in situ characterization enables one to continuously monitor the tip size during experiments. Further, we show how to reproducibly shape the tip from a given initial size to any chosen larger size. This approach combined with the in situ tip size monitoring enables quantitative comparison of materials measurements between samples. These methods are set to allow quantitative data acquisition and make direct data comparison readily available in the community.

  16. Physicians' opinions about partner notification methods: case reporting, patient referral, and provider referral.

    Science.gov (United States)

    Hogben, M; St Lawrence, J S; Montaño, D E; Kasprzyk, D; Leichliter, J S; Phillips, W R

    2004-02-01

    The United States has relied upon partner notification strategies to help break the chain of infection and re-infection for sexually transmitted diseases (STD). Physicians are a vital link in the system of STD control, but little is known of physician opinions about partner notification strategies. We collected opinions about partner notification from a national probability sample of physicians in specialties diagnosing STDs. Physicians responded to 17 questions about three relevant forms of STD partner notification: patient based referral, provider based referral, and case reporting. Exploratory factor analyses showed that responses for each form of partner notification could be grouped into four categories: perceived practice norms, infection control, patient relationships, and time/money. Multivariate analyses of the factors showed that physicians endorsed patient based referral most favourably and provider based referral least favourably. Physicians' opinions about partner notification strategies appear to reflect objective reality in some areas, but not in others. Strategies that improve the fit between physicians' opinions and effective notification are needed: some are discussed here.

  17. Quality and use of consumer information provided with home test kits: room for improvement.

    Science.gov (United States)

    Grispen, Janaica E J; Ickenroth, Martine H P; de Vries, Nanne K; van der Weijden, Trudy; Ronda, Gaby

    2014-10-01

    Diagnostic self-tests (tests on body materials that are initiated by consumers with the aim of diagnosing a disorder or risk factor) are becoming increasingly available. Although the pros and cons of self-testing are currently not clear, it is an existing phenomenon that is likely to gain further popularity. To examine consumers' use of and needs for information about self-testing, and to assess the quality of consumer information provided with home test kits, as perceived by consumers and as assessed using a checklist of quality criteria. A cross-sectional Internet survey among 305 self-testers assessed their use of and needs for information and their perception of the quality of consumer information provided with self-test kits. A meta-search engine was used to identify Dutch and English consumer information for home diagnostic tests available online at the time of the study. The quality of this consumer information was evaluated using a checklist of quality criteria. The consumers' information needs were in line with the most frequently used information, and the information was perceived as being of moderate to good quality. The information was mostly in agreement with clinical practice guidelines, although information on reliability and follow-up behaviour was limited. Approximately half of the instruction leaflets did not include information on the target group of the test. Although generally of moderate to good quality, some aspects of the information provided were in many cases insufficient. European legislation concerning self-tests and accompanying information needs to be adapted and adhered to more closely. © 2012 John Wiley & Sons Ltd.

  18. Improving health care strategy planning through assessment of perceptions of consumers, providers and administrators.

    Science.gov (United States)

    Scammon, D; Kennard, L

    1983-01-01

    Perceptions of consumers, health care administrators, and physicians regarding health care providers are analyzed. Ratings on 26 dimensions of health care services were obtained from members of the three participant groups using measures of image and satisfaction of both physicians in general, and of specific physicians. Discriminant analysis reveals significantly different perceptions of the health care system among the three groups of respondents. These differences suggest some changes in health care administration which could lead to increased consumer satisfaction and competitive advantages for physicians and health care institutions.

  19. Training providers on issues of race and racism improve health care equity.

    Science.gov (United States)

    Nelson, Stephen C; Prasad, Shailendra; Hackman, Heather W

    2015-05-01

    Race is an independent factor in health disparity. We developed a training module to address race, racism, and health care. A group of 19 physicians participated in our training module. Anonymous survey results before and after the training were compared using a two-sample t-test. The awareness of racism and its impact on care increased in all participants. White participants showed a decrease in self-efficacy in caring for patients of color when compared to white patients. This training was successful in deconstructing white providers' previously held beliefs about race and racism. © 2015 Wiley Periodicals, Inc.

  20. Development and Validation of Improved Method for Fingerprint ...

    African Journals Online (AJOL)

    Purpose: To develop and validate an improved method by capillary zone electrophoresis with photodiode array detection for the fingerprint analysis of Ligusticum chuanxiong Hort. (Rhizoma Chuanxiong). Methods: The optimum high performance capillary electrophoresis (HPCE) conditions were 30 mM borax containing 5 ...

  1. Improved fixation quality provided by a Bessel beacon in an adaptive optics system.

    Science.gov (United States)

    Lambert, Andrew J; Daly, Elizabeth M; Dainty, Christopher J

    2013-07-01

    We investigate whether a structured probe beam that creates the beacon for use in a retinal imaging adaptive optics system can provide useful side effects. In particular we investigate whether a Bessel beam that is seen by the subject as a set of concentric rings has a dampening effect on fixation variations of the subject under observation. This calming effect would allow longer periods of observation, particularly for patients with abnormal fixation. An experimental adaptive optics system developed for retinal imaging is used to monitor the fluctuations in aberrations for artificial and human subjects. The probe beam is alternated between a traditional beacon and one provided by a Bessel beam created by SLM. Time-frequency analysis is used to indicate the differences in power and time variation during fixation depending on whether the Bessel beam or the traditional beacon is employed. Comparison is made with the response for an artificial eye to discount systemic variations. Significant evidence is accrued to indicate the reduced fluctuations in fixation when the Bessel beam is employed to create the beacon. © 2013 The Authors Ophthalmic & Physiological Optics © 2013 The College of Optometrists.

  2. Improved quasi-static nodal green's function method

    International Nuclear Information System (INIS)

    Li Junli; Jing Xingqing; Hu Dapu

    1997-01-01

    Improved Quasi-Static Green's Function Method (IQS/NGFM) is presented, as an new kinetic method. To solve the three-dimensional transient problem, improved Quasi-Static Method is adopted to deal with the temporal problem, which will increase the time step as long as possible so as to decrease the number of times of space calculation. The time step of IQS/NGFM can be increased to 5∼10 times longer than that of Full Implicit Differential Method. In spatial calculation, the NGFM is used to get the distribution of shape function, and it's spatial mesh can be nearly 20 times larger than that of Definite Differential Method. So the IQS/NGFM is considered as an efficient kinetic method

  3. New or improved computational methods and advanced reactor design

    International Nuclear Information System (INIS)

    Nakagawa, Masayuki; Takeda, Toshikazu; Ushio, Tadashi

    1997-01-01

    Nuclear computational method has been studied continuously up to date, as a fundamental technology supporting the nuclear development. At present, research on computational method according to new theory and the calculating method thought to be difficult to practise are also continued actively to find new development due to splendid improvement of features of computer. In Japan, many light water type reactors are now in operations, new computational methods are induced for nuclear design, and a lot of efforts are concentrated for intending to more improvement of economics and safety. In this paper, some new research results on the nuclear computational methods and their application to nuclear design of the reactor were described for introducing recent trend of the nuclear design of the reactor. 1) Advancement of the computational method, 2) Reactor core design and management of the light water reactor, and 3) Nuclear design of the fast reactor. (G.K.)

  4. Team dynamics, clinical work satisfaction, and patient care coordination between primary care providers: A mixed methods study.

    Science.gov (United States)

    Song, Hummy; Ryan, Molly; Tendulkar, Shalini; Fisher, Josephine; Martin, Julia; Peters, Antoinette S; Frolkis, Joseph P; Rosenthal, Meredith B; Chien, Alyna T; Singer, Sara J

    Team-based care is essential for delivering high-quality, comprehensive, and coordinated care. Despite considerable research about the effects of team-based care on patient outcomes, few studies have examined how team dynamics relate to provider outcomes. The aim of this study was to examine relationships among team dynamics, primary care provider (PCP) clinical work satisfaction, and patient care coordination between PCPs in 18 Harvard-affiliated primary care practices participating in Harvard's Academic Innovations Collaborative. First, we administered a cross-sectional survey to all 548 PCPs (267 attending clinicians, 281 resident physicians) working at participating practices; 65% responded. We assessed the relationship of team dynamics with PCPs' clinical work satisfaction and perception of patient care coordination between PCPs, respectively, and the potential mediating effect of patient care coordination on the relationship between team dynamics and work satisfaction. In addition, we embedded a qualitative evaluation within the quantitative evaluation to achieve a convergent mixed methods design to help us better understand our findings and illuminate relationships among key variables. Better team dynamics were positively associated with clinical work satisfaction and quality of patient care coordination between PCPs. Coordination partially mediated the relationship between team dynamics and satisfaction for attending clinicians, suggesting that higher satisfaction depends, in part, on better teamwork, yielding more coordinated patient care. We found no mediating effects for resident physicians. Qualitative results suggest that sources of satisfaction from positive team dynamics for PCPs may be most relevant to attending clinicians. Improving primary care team dynamics could improve clinical work satisfaction among PCPs and patient care coordination between PCPs. In addition to improving outcomes that directly concern health care providers, efforts to

  5. From Demonstration System to Prototype: ShakeAlert Beta Users Provide Feedback to Improve Alert Delivery

    Science.gov (United States)

    Strauss, J. A.; Vinci, M.; Steele, W. P.; Allen, R. M.; Hellweg, M.

    2013-12-01

    Earthquake Early Warning (EEW) is a system that can provide a few to tens of seconds to minutes of warning prior to ground shaking at a given location. The goal and purpose of such a system is to reduce the damage, costs, and casualties resulting from an earthquake. A prototype earthquake early warning system (ShakeAlert) is in development by the UC Berkeley Seismological Laboratory, Caltech, ETH Zurich, University of Washington, and the USGS. Events are published to the UserDisplay--ShakeAlert's Java based graphical interface, which is being tested by a small group of beta users throughout California. The beta users receive earthquake alerts in real-time and are providing feedback on their experiences. For early warning alerts to be useful, people, companies, and institutions must know beforehand what actions they will perform when they receive the information. Beta user interactions allow the ShakeAlert team to discern: which alert delivery options are most effective, what changes would make the UserDisplay more useful in a pre-disaster situation, and most importantly, what actions users plan to take for various scenarios. We also collect feedback detailing costs of implementing actions and challenges within the beta user organizations, as well as anticipated benefits and savings. Thus, creating a blueprint for a fully operational system that will meet the needs of the public. New California users as well as the first group of Pacific Northwest users are slated to join the ShakeAlert beta test group in the fall of 2013.

  6. Method for providing slip energy control in permanent magnet electrical machines

    Science.gov (United States)

    Hsu, John S.

    2006-11-14

    An electric machine (40) has a stator (43), a permanent magnet rotor (38) with permanent magnets (39) and a magnetic coupling uncluttered rotor (46) for inducing a slip energy current in secondary coils (47). A dc flux can be produced in the uncluttered rotor when the secondary coils are fed with dc currents. The magnetic coupling uncluttered rotor (46) has magnetic brushes (A, B, C, D) which couple flux in through the rotor (46) to the secondary coils (47c, 47d) without inducing a current in the rotor (46) and without coupling a stator rotational energy component to the secondary coils (47c, 47d). The machine can be operated as a motor or a generator in multi-phase or single-phase embodiments and is applicable to the hybrid electric vehicle. A method of providing a slip energy controller is also disclosed.

  7. Improved radionuclide bone imaging agent injection needle withdrawal method can improve image quality

    International Nuclear Information System (INIS)

    Qin Yongmei; Wang Laihao; Zhao Lihua; Guo Xiaogang; Kong Qingfeng

    2009-01-01

    Objective: To investigate the improvement of radionuclide bone imaging agent injection needle withdrawal method on whole body bone scan image quality. Methods: Elbow vein injection syringe needle directly into the bone imaging agent in the routine group of 117 cases, with a cotton swab needle injection method for the rapid pull out the needle puncture point pressing, pressing moment. Improvement of 117 cases of needle injection method to put two needles into the skin swabs and blood vessels, pull out the needle while pressing two or more entry point 5min. After 2 hours underwent whole body bone SPECT imaging plane. Results: The conventional group at the injection site imaging agents uptake rate was 16.24%, improved group was 2.56%. Conclusion: The modified bone imaging agent injection needle withdrawal method, injection-site imaging agent uptake were significantly decreased whole body bone imaging can improve image quality. (authors)

  8. Nutritional Supplement of Hatchery Eggshell Membrane Improves Poultry Performance and Provides Resistance against Endotoxin Stress.

    Directory of Open Access Journals (Sweden)

    S K Makkar

    Full Text Available Eggshells are significant part of hatchery waste which consist of calcium carbonate crust, membranes, and proteins and peptides of embryonic origins along with other entrapped contaminants including microbes. We hypothesized that using this product as a nutritional additive in poultry diet may confer better immunity to the chickens in the paradigm of mammalian milk that enhances immunity. Therefore, we investigated the effect of hatchery eggshell membranes (HESM as a short term feed supplement on growth performance and immunity of chickens under bacterial lipopolysaccharide (LPS challenged condition. Three studies were conducted to find the effect of HESM supplement on post hatch chickens. In the first study, the chickens were fed either a control diet or diets containing 0.5% whey protein or HESM as supplement and evaluated at 5 weeks of age using growth, hematology, clinical chemistry, plasma immunoglobulins, and corticosterone as variables. The second and third studies were done to compare the effects of LPS on control and HESM fed birds at 5 weeks of age following at 4 and 24 h of treatment where the HESM was also sterilized with ethanol to deplete bacterial factors. HESM supplement caused weight gain in 2 experiments and decreased blood corticosterone concentrations. While LPS caused a significant loss in body weight at 24 h following its administration, the HESM supplemented birds showed significantly less body weight loss compared with the control fed birds. The WBC, heterophil/lymphocyte ratio, and the levels of IgG were low in chickens fed diets with HESM supplement compared with control diet group. LPS challenge increased the expression of pro-inflammatory cytokine gene IL-6 but the HESM fed birds showed its effect curtailed, also, which also, favored the up-regulation of anti-inflammatory genes compared with control diet fed chickens. Post hatch supplementation of HESM appears to improve performance, modulate immunity, and increase

  9. [Assessment of financial performance improves the quality of healthcare provided by medical organizations].

    Science.gov (United States)

    Afek, Arnon; Meilik, Ahuva; Rotstein, Zeev

    2009-01-01

    Today, medical organizations have to contend with a highly competitive environment, an atmosphere saturated with a multitude of innovative new technologies and ever-increasing costs. The ability of these organizations to survive and to develop and expand their services mandates adoption of management guidelines based on the world of finance/commerce, adapted to make them relevant to the world of medical service. In this article the authors chose to present a management administration assessment which is a process that ensures that the management will effectively administer the organization's resources, and meet the goals set by the organization. The system demands that hospital "centers of responsibility" be defined, a management information system be set up, activities be priced, budget be defined and the expenses assessed. These processes make it possible to formulate a budget and assess any possible deviation between the budget and the actual running costs. An assessment of deviations will reveal any possible deviation of the most significant factor--efficiency. Medical organization managers, with the cooperation of the directors of the "centers of responsibility", can assess subunit activities and gain an understanding of the significance of management decisions and thus improve the quality of management, and the medical organization. The goal of this management system is not only to Lower costs and to meet the financial goals that were set; it is a tool that ensures quality. Decreasing expenditure is important in this case, but is only secondary in importance and will be a result of reducing the costs incurred by services lacking in quality.

  10. Nutritional Supplement of Hatchery Eggshell Membrane Improves Poultry Performance and Provides Resistance against Endotoxin Stress.

    Science.gov (United States)

    Makkar, S K; Rath, N C; Packialakshmi, B; Zhou, Z Y; Huff, G R; Donoghue, A M

    2016-01-01

    Eggshells are significant part of hatchery waste which consist of calcium carbonate crust, membranes, and proteins and peptides of embryonic origins along with other entrapped contaminants including microbes. We hypothesized that using this product as a nutritional additive in poultry diet may confer better immunity to the chickens in the paradigm of mammalian milk that enhances immunity. Therefore, we investigated the effect of hatchery eggshell membranes (HESM) as a short term feed supplement on growth performance and immunity of chickens under bacterial lipopolysaccharide (LPS) challenged condition. Three studies were conducted to find the effect of HESM supplement on post hatch chickens. In the first study, the chickens were fed either a control diet or diets containing 0.5% whey protein or HESM as supplement and evaluated at 5 weeks of age using growth, hematology, clinical chemistry, plasma immunoglobulins, and corticosterone as variables. The second and third studies were done to compare the effects of LPS on control and HESM fed birds at 5 weeks of age following at 4 and 24 h of treatment where the HESM was also sterilized with ethanol to deplete bacterial factors. HESM supplement caused weight gain in 2 experiments and decreased blood corticosterone concentrations. While LPS caused a significant loss in body weight at 24 h following its administration, the HESM supplemented birds showed significantly less body weight loss compared with the control fed birds. The WBC, heterophil/lymphocyte ratio, and the levels of IgG were low in chickens fed diets with HESM supplement compared with control diet group. LPS challenge increased the expression of pro-inflammatory cytokine gene IL-6 but the HESM fed birds showed its effect curtailed, also, which also, favored the up-regulation of anti-inflammatory genes compared with control diet fed chickens. Post hatch supplementation of HESM appears to improve performance, modulate immunity, and increase resistance of

  11. Through Their Eyes: Lessons Learned Using Participatory Methods in Health Care Quality Improvement Projects.

    Science.gov (United States)

    Balbale, Salva N; Locatelli, Sara M; LaVela, Sherri L

    2016-08-01

    In this methodological article, we examine participatory methods in depth to demonstrate how these methods can be adopted for quality improvement (QI) projects in health care. We draw on existing literature and our QI initiatives in the Department of Veterans Affairs to discuss the application of photovoice and guided tours in QI efforts. We highlight lessons learned and several benefits of using participatory methods in this area. Using participatory methods, evaluators can engage patients, providers, and other stakeholders as partners to enhance care. Participant involvement helps yield actionable data that can be translated into improved care practices. Use of these methods also helps generate key insights to inform improvements that truly resonate with stakeholders. Using participatory methods is a valuable strategy to harness participant engagement and drive improvements that address individual needs. In applying these innovative methodologies, evaluators can transcend traditional approaches to uniquely support evaluations and improvements in health care. © The Author(s) 2015.

  12. An Improved Pansharpening Method for Misaligned Panchromatic and Multispectral Data.

    Science.gov (United States)

    Li, Hui; Jing, Linhai; Tang, Yunwei; Ding, Haifeng

    2018-02-11

    Numerous pansharpening methods were proposed in recent decades for fusing low-spatial-resolution multispectral (MS) images with high-spatial-resolution (HSR) panchromatic (PAN) bands to produce fused HSR MS images, which are widely used in various remote sensing tasks. The effect of misregistration between MS and PAN bands on quality of fused products has gained much attention in recent years. An improved method for misaligned MS and PAN imagery is proposed, through two improvements made on a previously published method named RMI (reduce misalignment impact). The performance of the proposed method was assessed by comparing with some outstanding fusion methods, such as adaptive Gram-Schmidt and generalized Laplacian pyramid. Experimental results show that the improved version can reduce spectral distortions of fused dark pixels and sharpen boundaries between different image objects, as well as obtain similar quality indexes with the original RMI method. In addition, the proposed method was evaluated with respect to its sensitivity to misalignments between MS and PAN bands. It is certified that the proposed method is more robust to misalignments between MS and PAN bands than the other methods.

  13. Providing the physical basis of SCS curve number method and its proportionality relationship from Richards' equation

    Science.gov (United States)

    Hooshyar, M.; Wang, D.

    2016-12-01

    The empirical proportionality relationship, which indicates that the ratio of cumulative surface runoff and infiltration to their corresponding potentials are equal, is the basis of the extensively used Soil Conservation Service Curve Number (SCS-CN) method. The objective of this paper is to provide the physical basis of the SCS-CN method and its proportionality hypothesis from the infiltration excess runoff generation perspective. To achieve this purpose, an analytical solution of Richards' equation is derived for ponded infiltration in shallow water table environment under the following boundary conditions: 1) the soil is saturated at the land surface; and 2) there is a no-flux boundary which moves downward. The solution is established based on the assumptions of negligible gravitational effect, constant soil water diffusivity, and hydrostatic soil moisture profile between the no-flux boundary and water table. Based on the derived analytical solution, the proportionality hypothesis is a reasonable approximation for rainfall partitioning at the early stage of ponded infiltration in areas with a shallow water table for coarse textured soils.

  14. Content and Methods used to Train Tobacco Cessation Treatment Providers: An International Survey.

    Science.gov (United States)

    Kruse, Gina R; Rigotti, Nancy A; Raw, Martin; McNeill, Ann; Murray, Rachael; Piné-Abata, Hembadoon; Bitton, Asaf; McEwen, Andy

    2017-12-01

    There are limited existing data describing the training methods used to educate tobacco cessation treatment providers around the world. To measure the prevalence of tobacco cessation treatment content, skills training and teaching methods reported by tobacco treatment training programs across the world. Web-based survey in May-September 2013 among tobacco cessation training experts across six geographic regions and four World Bank income levels. Response rate was 73% (84 of 115 countries contacted). Of 104 individual programs from 84 countries, most reported teaching brief advice (78%) and one-to-one counseling (74%); telephone counseling was uncommon (33%). Overall, teaching of knowledge topics was more commonly reported than skills training. Programs in lower income countries less often reported teaching about medications, behavioral treatments and biomarkers and less often reported skills-based training about interviewing clients, medication management, biomarker measurement, assessing client outcomes, and assisting clients with co-morbidities. Programs reported a median 15 hours of training. Face-to-face training was common (85%); online programs were rare (19%). Almost half (47%) included no learner assessment. Only 35% offered continuing education. Nearly all programs reported teaching evidence-based treatment modalities in a face-to-face format. Few programs delivered training online or offered continuing education. Skills-based training was less common among low- and middle-income countries (LMICs). There is a large unmet need for tobacco treatment training protocols which emphasize practical skills, and which are more rapidly scalable than face-to-face training in LMICs.

  15. Dehydration protection provided by a maternal cuticle improves offspring fitness in the moss Funaria hygrometrica.

    Science.gov (United States)

    Budke, Jessica M; Goffinet, Bernard; Jones, Cynthia S

    2013-05-01

    In bryophytes the sporophyte offspring are in contact with, nourished from, and partially surrounded by the maternal gametophyte throughout their lifespan. During early development, the moss sporophyte is covered by the calyptra, a cap of maternal gametophyte tissue that has a multilayered cuticle. In this study the effects on sporophyte offspring fitness of removing the maternal calyptra cuticle, in combination with dehydration stress, is experimentally determined. Using the moss Funaria hygrometrica, calyptra cuticle waxes were removed by chemical extraction and individuals were exposed to a short-term dehydration event. Sporophytes were returned to high humidity to complete development and then aspects of sporophyte survival, development, functional morphology, and reproductive output were measured. It was found that removal of calyptra cuticle under low humidity results in significant negative impacts to moss sporophyte fitness, resulting in decreased survival, increased tissue damage, incomplete sporophyte development, more peristome malformations, and decreased reproductive output. This study represents the strongest evidence to date that the structure of the calyptra cuticle functions in dehydration protection of the immature moss sporophyte. The investment in a maternal calyptra with a multilayered cuticle increases offspring fitness and provides a functional explanation for calyptra retention across mosses. The moss calyptra may represent the earliest occurance of maternal protection via structural provisioning of a cuticle in green plants.

  16. The RooPfs study to assess whether improved housing provides additional protection against clinical malaria over current best practice in The Gambia

    DEFF Research Database (Denmark)

    Pinder, Margeret; Conteh, Lesong; Jeffries, David

    2016-01-01

    ) and prompt treatment in The Gambia, determine the incremental cost-effectiveness of the interventions, and analyze the housing market in The Gambia. Methods/design A two-armed, household, cluster-randomized, controlled study will be conducted to assess whether improved housing and LLINs combine to provide...

  17. Application of improved topsis method to comprehensive assessment of radiological environmental quality

    International Nuclear Information System (INIS)

    Shi Dongsheng; Di Yuming; Zhou Chunlin

    2007-01-01

    TOPSIS is a method for multiobjective decision-making, which can be applied to comprehensive assessment of radiological environmental quality. This paper introduces the principle of TOPSIS method and sets up the model of improved TOPSIS method, discusses the application of improved TOPSIS method to comprehensive assessment of radiological environmental quality. This method sufficiently makes use of the information of the optimal matrix. Analysis of practical examples using MATLAB program shows that it is objectively reasonable and feasible to comprehensively assess radiological environmental quality by improved TOPSIS method. This paper also provides the result of optimum number of sites and compares it with optimal index method based on TOPSIS method and traditional method. (authors)

  18. Deep Learning Methods for Improved Decoding of Linear Codes

    Science.gov (United States)

    Nachmani, Eliya; Marciano, Elad; Lugosch, Loren; Gross, Warren J.; Burshtein, David; Be'ery, Yair

    2018-02-01

    The problem of low complexity, close to optimal, channel decoding of linear codes with short to moderate block length is considered. It is shown that deep learning methods can be used to improve a standard belief propagation decoder, despite the large example space. Similar improvements are obtained for the min-sum algorithm. It is also shown that tying the parameters of the decoders across iterations, so as to form a recurrent neural network architecture, can be implemented with comparable results. The advantage is that significantly less parameters are required. We also introduce a recurrent neural decoder architecture based on the method of successive relaxation. Improvements over standard belief propagation are also observed on sparser Tanner graph representations of the codes. Furthermore, we demonstrate that the neural belief propagation decoder can be used to improve the performance, or alternatively reduce the computational complexity, of a close to optimal decoder of short BCH codes.

  19. Improved stochastic approximation methods for discretized parabolic partial differential equations

    Science.gov (United States)

    Guiaş, Flavius

    2016-12-01

    We present improvements of the stochastic direct simulation method, a known numerical scheme based on Markov jump processes which is used for approximating solutions of ordinary differential equations. This scheme is suited especially for spatial discretizations of evolution partial differential equations (PDEs). By exploiting the full path simulation of the stochastic method, we use this first approximation as a predictor and construct improved approximations by Picard iterations, Runge-Kutta steps, or a combination. This has as consequence an increased order of convergence. We illustrate the features of the improved method at a standard benchmark problem, a reaction-diffusion equation modeling a combustion process in one space dimension (1D) and two space dimensions (2D).

  20. Synthesis of research on Biogrout soil improvement method

    Directory of Open Access Journals (Sweden)

    Zsolt KALTENBACHER

    2014-12-01

    Full Text Available Because of the great rhythm of city developments, there is a great need for a new cost effective method for ground improvement. In this paper, a few chemical improvement technologies and a new biological ground improvement method called Biogrout are discussed. The method, used in the paper for a Sarmatian sand in Transylvania (Feleac locality implies using microorganisms as catalysts in order to induce a microbial carbonate precipitation (MICP to increase the strength and stiffness of cohesionless soils. For this calcium based procedure, the bacteria Sporosarcina Pasteurii (DSMZ 33 is used, while for the treatment solution urea (CO(NH22 and calcium chloride (CaCl2 are used. The study presents the triaxial testing of sand probes treated with Biogrout and the comparison of results obtained with untreated sand probes.

  1. TESTING METHODS FOR MECHANICALLY IMPROVED SOILS: RELIABILITY AND VALIDITY

    Directory of Open Access Journals (Sweden)

    Ana Petkovšek

    2017-10-01

    Full Text Available A possibility of in-situ mechanical improvement for reducing the liquefaction potential of silty sands was investigated by using three different techniques: Vibratory Roller Compaction, Rapid Impact Compaction (RIC and Soil Mixing. Material properties at all test sites were investigated before and after improvement with the laboratory and the in situ tests (CPT, SDMT, DPSH B, static and dynamic load plate test, geohydraulic tests. Correlation between the results obtained by different test methods gave inconclusive answers.

  2. Improved Method for PD-Quantification in Power Cables

    DEFF Research Database (Denmark)

    Holbøll, Joachim T.; Villefrance, Rasmus; Henriksen, Mogens

    1999-01-01

    n this paper, a method is described for improved quantification of partial discharges(PD) in power cables. The method is suitable for PD-detection and location systems in the MHz-range, where pulse attenuation and distortion along the cable cannot be neglected. The system transfer function...... was calculated and measured in order to form basis for magnitude calculation after each measurements. --- Limitations and capabilities of the method will be discussed and related to relevant field applications of high frequent PD-measurements. --- Methods for increased signal/noise ratio are easily implemented...

  3. Improving Reference Service: The Case for Using a Continuous Quality Improvement Method.

    Science.gov (United States)

    Aluri, Rao

    1993-01-01

    Discusses the evaluation of library reference service; examines problems with past evaluations, including the lack of long-term planning and a systems perspective; and suggests a method for continuously monitoring and improving reference service using quality improvement tools such as checklists, cause and effect diagrams, Pareto charts, and…

  4. Improving automated 3D reconstruction methods via vision metrology

    Science.gov (United States)

    Toschi, Isabella; Nocerino, Erica; Hess, Mona; Menna, Fabio; Sargeant, Ben; MacDonald, Lindsay; Remondino, Fabio; Robson, Stuart

    2015-05-01

    This paper aims to provide a procedure for improving automated 3D reconstruction methods via vision metrology. The 3D reconstruction problem is generally addressed using two different approaches. On the one hand, vision metrology (VM) systems try to accurately derive 3D coordinates of few sparse object points for industrial measurement and inspection applications; on the other, recent dense image matching (DIM) algorithms are designed to produce dense point clouds for surface representations and analyses. This paper strives to demonstrate a step towards narrowing the gap between traditional VM and DIM approaches. Efforts are therefore intended to (i) test the metric performance of the automated photogrammetric 3D reconstruction procedure, (ii) enhance the accuracy of the final results and (iii) obtain statistical indicators of the quality achieved in the orientation step. VM tools are exploited to integrate their main functionalities (centroid measurement, photogrammetric network adjustment, precision assessment, etc.) into the pipeline of 3D dense reconstruction. Finally, geometric analyses and accuracy evaluations are performed on the raw output of the matching (i.e. the point clouds) by adopting a metrological approach. The latter is based on the use of known geometric shapes and quality parameters derived from VDI/VDE guidelines. Tests are carried out by imaging the calibrated Portable Metric Test Object, designed and built at University College London (UCL), UK. It allows assessment of the performance of the image orientation and matching procedures within a typical industrial scenario, characterised by poor texture and known 3D/2D shapes.

  5. Parallel experimental design and multivariate analysis provides efficient screening of cell culture media supplements to improve biosimilar product quality.

    Science.gov (United States)

    Brühlmann, David; Sokolov, Michael; Butté, Alessandro; Sauer, Markus; Hemberger, Jürgen; Souquet, Jonathan; Broly, Hervé; Jordan, Martin

    2017-07-01

    Rational and high-throughput optimization of mammalian cell culture media has a great potential to modulate recombinant protein product quality. We present a process design method based on parallel design-of-experiment (DoE) of CHO fed-batch cultures in 96-deepwell plates to modulate monoclonal antibody (mAb) glycosylation using medium supplements. To reduce the risk of losing valuable information in an intricate joint screening, 17 compounds were separated into five different groups, considering their mode of biological action. The concentration ranges of the medium supplements were defined according to information encountered in the literature and in-house experience. The screening experiments produced wide glycosylation pattern ranges. Multivariate analysis including principal component analysis and decision trees was used to select the best performing glycosylation modulators. Subsequent D-optimal quadratic design with four factors (three promising compounds and temperature shift) in shake tubes confirmed the outcome of the selection process and provided a solid basis for sequential process development at a larger scale. The glycosylation profile with respect to the specifications for biosimilarity was greatly improved in shake tube experiments: 75% of the conditions were equally close or closer to the specifications for biosimilarity than the best 25% in 96-deepwell plates. Biotechnol. Bioeng. 2017;114: 1448-1458. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  6. Modeling the Ecosystem Services Provided by Trees in Urban Ecosystems: Using Biome-BGC to Improve i-Tree Eco

    Science.gov (United States)

    Brown, Molly E.; McGroddy, Megan; Spence, Caitlin; Flake, Leah; Sarfraz, Amna; Nowak, David J.; Milesi, Cristina

    2012-01-01

    As the world becomes increasingly urban, the need to quantify the effect of trees in urban environments on energy usage, air pollution, local climate and nutrient run-off has increased. By identifying, quantifying and valuing the ecological activity that provides services in urban areas, stronger policies and improved quality of life for urban residents can be obtained. Here we focus on two radically different models that can be used to characterize urban forests. The i-Tree Eco model (formerly UFORE model) quantifies ecosystem services (e.g., air pollution removal, carbon storage) and values derived from urban trees based on field measurements of trees and local ancillary data sets. Biome-BGC (Biome BioGeoChemistry) is used to simulate the fluxes and storage of carbon, water, and nitrogen in natural environments. This paper compares i-Tree Eco's methods to those of Biome-BGC, which estimates the fluxes and storage of energy, carbon, water and nitrogen for vegetation and soil components of the ecosystem. We describe the two models and their differences in the way they calculate similar properties, with a focus on carbon and nitrogen. Finally, we discuss the implications of further integration of these two communities for land managers such as those in Maryland.

  7. Improvement of Source Number Estimation Method for Single Channel Signal.

    Directory of Open Access Journals (Sweden)

    Zhi Dong

    Full Text Available Source number estimation methods for single channel signal have been investigated and the improvements for each method are suggested in this work. Firstly, the single channel data is converted to multi-channel form by delay process. Then, algorithms used in the array signal processing, such as Gerschgorin's disk estimation (GDE and minimum description length (MDL, are introduced to estimate the source number of the received signal. The previous results have shown that the MDL based on information theoretic criteria (ITC obtains a superior performance than GDE at low SNR. However it has no ability to handle the signals containing colored noise. On the contrary, the GDE method can eliminate the influence of colored noise. Nevertheless, its performance at low SNR is not satisfactory. In order to solve these problems and contradictions, the work makes remarkable improvements on these two methods on account of the above consideration. A diagonal loading technique is employed to ameliorate the MDL method and a jackknife technique is referenced to optimize the data covariance matrix in order to improve the performance of the GDE method. The results of simulation have illustrated that the performance of original methods have been promoted largely.

  8. Improvement Methods in NPP's Radiation Emergency Plan: An Administrative Approach

    International Nuclear Information System (INIS)

    Lee, Yoon Wook; Yang, He Sun

    2009-01-01

    The Radiation Emergency Plan (REP) can be divided into a technical and an administrative responses. The domestic NPP's REPs are reviewed from the viewpoint of the administrative response and improvement methods are also suggested in this treatise. The fields of the reviews are the composition of the emergency response organizations, the activation criteria of the organizations, the selection of the staffings and the reasonableness of the REP's volume. In addition, the limitations of the current radiation exercises are reviewed and the improvement method of the exercise is presented. It is expected that the suggested recommendations will be helpful in establishing useful REPs and making practical radiation exercises in Korea

  9. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  10. Security analysis and improvements to the PsychoPass method.

    Science.gov (United States)

    Brumen, Bostjan; Heričko, Marjan; Rozman, Ivan; Hölbl, Marko

    2013-08-13

    In a recent paper, Pietro Cipresso et al proposed the PsychoPass method, a simple way to create strong passwords that are easy to remember. However, the method has some security issues that need to be addressed. To perform a security analysis on the PsychoPass method and outline the limitations of and possible improvements to the method. We used the brute force analysis and dictionary attack analysis of the PsychoPass method to outline its weaknesses. The first issue with the Psychopass method is that it requires the password reproduction on the same keyboard layout as was used to generate the password. The second issue is a security weakness: although the produced password is 24 characters long, the password is still weak. We elaborate on the weakness and propose a solution that produces strong passwords. The proposed version first requires the use of the SHIFT and ALT-GR keys in combination with other keys, and second, the keys need to be 1-2 distances apart. The proposed improved PsychoPass method yields passwords that can be broken only in hundreds of years based on current computing powers. The proposed PsychoPass method requires 10 keys, as opposed to 20 keys in the original method, for comparable password strength.

  11. Development of guidance and methodical documents for providing the decommissioning of radiation-hazardous objects

    International Nuclear Information System (INIS)

    Ermakov, A.

    2015-01-01

    Federal Center for Nuclear and Radiation Safety (JSC FCNRS) developed and approbated guidance and methodical documents for providing the facility to radiologically safe status in the course of Building B decommissioning activity at JSC VNIINM (A.A. Bochvar High-Technology Scientific Research Institute for Inorganic Materials). The scope of application of the documents developed is as follows: - preliminary segregation of radwaste into streams during its collection and preparation for removal from facilities/sites under decommissioning; - express assessment of specific activity (activity) of radwaste generated in the course of dismantling and decontamination activities; - radiological survey of premises and building structures following completion of dismantling and decontamination activities; - SRW processing (compaction, reduction in size), packaging, characterisation and containerisation in order to reduce risks of spread of radioactive contamination. Documents that have been developed can be used both at nuclear facilities/ sites similar to the JSC VNIINM Building B in terms of work stages and types of waste to be generated, and other facilities/ sites taking into consideration their peculiarities. (author)

  12. Improved Methods for Production Manufacturing Processes in Environmentally Benign Manufacturing

    Directory of Open Access Journals (Sweden)

    Yan-Yan Wang

    2011-09-01

    Full Text Available How to design a production process with low carbon emissions and low environmental impact as well as high manufacturing performance is a key factor in the success of low-carbon production. It is important to address concerns about climate change for the large carbon emission source manufacturing industries because of their high energy consumption and environmental impact during the manufacturing stage of the production life cycle. In this paper, methodology for determining a production process is developed. This methodology integrates process determination from three different levels: new production processing, selected production processing and batch production processing. This approach is taken within a manufacturing enterprise based on prior research. The methodology is aimed at providing decision support for implementing Environmentally Benign Manufacturing (EBM and low-carbon production to improve the environmental performance of the manufacturing industry. At the first level, a decision-making model for new production processes based on the Genetic Simulated Annealing Algorithm (GSAA is presented. The decision-making model considers not only the traditional factors, such as time, quality and cost, but also energy and resource consumption and environmental impact, which are different from the traditional methods. At the second level, a methodology is developed based on an IPO (Input-Process-Output model that integrates assessments of resource consumption and environmental impact in terms of a materials balance principle for batch production processes. At the third level, based on the above two levels, a method for determining production processes that focus on low-carbon production is developed based on case-based reasoning, expert systems and feature technology for designing the process flow of a new component. Through the above three levels, a method for determining the production process to identify, quantify, assess, and optimize the

  13. Improved means and methods for expressing recombinant proteins

    NARCIS (Netherlands)

    Poolman, Berend; Martinez Linares, Daniel; Gul, Nadia

    2014-01-01

    The invention relates to the field of genetic engineering and the production of recombinant proteins in microbial host cells. Provided is a method for enhanced expression of a recombinant protein of interest in a microbial host cell, comprising providing a microbial host cell wherein the function of

  14. Improvement of methods for calculation of sound insulation in buildings

    OpenAIRE

    Mašović, Draško B.

    2015-01-01

    The main object of this work are the methods for calculation of sound insulation based on the classical model of sound propagation in buildings and single-number rating of sound insulation. The aim of the work is inspection of the possibilities for improvement of standard methods for quantification and calculation of sound insulation, in order to achieve higher accuracy of the obtained numerical values and their correlation with subjective impression of the acoustic comfort in buildings. Proc...

  15. Improvement Method of Gene Transfer in Kappaphycus Alvarezii

    OpenAIRE

    Triana, St. Hidayah; Alimuddin,; Widyastuti, Utut; Suharsono,; Suryati, Emma; Parenrengi, Andi

    2016-01-01

    Method of foreign gene transfer in red seaweed Kappaphycus alvarezii has been reported, however, li-mited number of transgenic F0 (broodstock) was obtained. This study was conducted to improve the method of gene transfer mediated by Agrobacterium tumefaciens in order to obtain high percentage of K. alvarezii transgenic. Superoxide dismutase gene from Melastoma malabatrichum (MmCu/Zn-SOD) was used as model towards increasing adaptability of K. alvarezii to environmental stress. The treat-ment...

  16. Development and testing of improved statistical wind power forecasting methods.

    Energy Technology Data Exchange (ETDEWEB)

    Mendes, J.; Bessa, R.J.; Keko, H.; Sumaili, J.; Miranda, V.; Ferreira, C.; Gama, J.; Botterud, A.; Zhou, Z.; Wang, J. (Decision and Information Sciences); (INESC Porto)

    2011-12-06

    Wind power forecasting (WPF) provides important inputs to power system operators and electricity market participants. It is therefore not surprising that WPF has attracted increasing interest within the electric power industry. In this report, we document our research on improving statistical WPF algorithms for point, uncertainty, and ramp forecasting. Below, we provide a brief introduction to the research presented in the following chapters. For a detailed overview of the state-of-the-art in wind power forecasting, we refer to [1]. Our related work on the application of WPF in operational decisions is documented in [2]. Point forecasts of wind power are highly dependent on the training criteria used in the statistical algorithms that are used to convert weather forecasts and observational data to a power forecast. In Chapter 2, we explore the application of information theoretic learning (ITL) as opposed to the classical minimum square error (MSE) criterion for point forecasting. In contrast to the MSE criterion, ITL criteria do not assume a Gaussian distribution of the forecasting errors. We investigate to what extent ITL criteria yield better results. In addition, we analyze time-adaptive training algorithms and how they enable WPF algorithms to cope with non-stationary data and, thus, to adapt to new situations without requiring additional offline training of the model. We test the new point forecasting algorithms on two wind farms located in the U.S. Midwest. Although there have been advancements in deterministic WPF, a single-valued forecast cannot provide information on the dispersion of observations around the predicted value. We argue that it is essential to generate, together with (or as an alternative to) point forecasts, a representation of the wind power uncertainty. Wind power uncertainty representation can take the form of probabilistic forecasts (e.g., probability density function, quantiles), risk indices (e.g., prediction risk index) or scenarios

  17. A New Method of Improving Transformer Restricted Earth Fault Protection

    Directory of Open Access Journals (Sweden)

    KRSTIVOJEVIC, J. P.

    2014-08-01

    Full Text Available A new method of avoiding malfunctioning of the transformer restricted earth fault (REF protection is presented. Application of the proposed method would eliminate unnecessary operation of REF protection in the cases of faults outside protected zone of a transformer or a magnetizing inrush accompanied by current transformer (CT saturation. On the basis of laboratory measurements and simulations the paper presents a detailed performance assessment of the proposed method which is based on digital phase comparator. The obtained results show that the new method was stable and precise for all tested faults and that its application would allow making a clear and precise difference between an internal fault and: (i external fault or (ii magnetizing inrush. The proposed method would improve performance of REF protection and reduce probability of maloperation due to CT saturation. The new method is robust and characterized by high speed of operation and high reliability and security.

  18. The Effect of Health Information Technology on Health Care Provider Communication: A Mixed-Method Protocol.

    Science.gov (United States)

    Manojlovich, Milisa; Adler-Milstein, Julia; Harrod, Molly; Sales, Anne; Hofer, Timothy P; Saint, Sanjay; Krein, Sarah L

    2015-06-11

    Communication failures between physicians and nurses are one of the most common causes of adverse events for hospitalized patients, as well as a major root cause of all sentinel events. Communication technology (ie, the electronic medical record, computerized provider order entry, email, and pagers), which is a component of health information technology (HIT), may help reduce some communication failures but increase others because of an inadequate understanding of how communication technology is used. Increasing use of health information and communication technologies is likely to affect communication between nurses and physicians. The purpose of this study is to describe, in detail, how health information and communication technologies facilitate or hinder communication between nurses and physicians with the ultimate goal of identifying how we can optimize the use of these technologies to support effective communication. Effective communication is the process of developing shared understanding between communicators by establishing, testing, and maintaining relationships. Our theoretical model, based in communication and sociology theories, describes how health information and communication technologies affect communication through communication practices (ie, use of rich media; the location and availability of computers) and work relationships (ie, hierarchies and team stability). Therefore we seek to (1) identify the range of health information and communication technologies used in a national sample of medical-surgical acute care units, (2) describe communication practices and work relationships that may be influenced by health information and communication technologies in these same settings, and (3) explore how differences in health information and communication technologies, communication practices, and work relationships between physicians and nurses influence communication. This 4-year study uses a sequential mixed-methods design, beginning with a

  19. Method and apparatus for improving the alignment of radiographic images

    International Nuclear Information System (INIS)

    Schuller, P.D.; Hatcher, D.C.; Caelli, T.M.; Eggert, F.M.; Yuzyk, J.

    1991-01-01

    This invention relates generally to the field of radiology, and has to do particularly with a method and apparatus for improving the alignment of radiographic images taken at different times of the same tissue structure, so that the images can be sequentially shown in aligned condition, whereby changes in the structure can be noted. (author). 10 figs

  20. An Improved Method for Extraction and Separation of Photosynthetic Pigments

    Science.gov (United States)

    Katayama, Nobuyasu; Kanaizuka, Yasuhiro; Sudarmi, Rini; Yokohama, Yasutsugu

    2003-01-01

    The method for extracting and separating hydrophobic photosynthetic pigments proposed by Katayama "et al." ("Japanese Journal of Phycology," 42, 71-77, 1994) has been improved to introduce it to student laboratories at the senior high school level. Silica gel powder was used for removing water from fresh materials prior to…

  1. Improvement on the Performance of Canal Network and Method of ...

    African Journals Online (AJOL)

    This paper presents the required improvement on the performance of canal network and method of on-farm water application systems at Tunga-Kawo irrigation scheme, Wushishi, Niger state. The problems of poor delivery of water to the farmland were identified to include erosion of canal embarkment, lack of water ...

  2. Implementation of client versus care-provider strategies to improve external cephalic version rates: a cluster randomized controlled trial

    NARCIS (Netherlands)

    Vlemmix, Floortje; Rosman, Ageeth N.; Rijnders, Marlies E.; Beuckens, Antje; Opmeer, Brent C.; Mol, Ben W. J.; Kok, Marjolein; Fleuren, Margot A. H.

    2015-01-01

    To determine the effectiveness of a client or care-provider strategy to improve the implementation of external cephalic version. Cluster randomized controlled trial. Twenty-five clusters; hospitals and their referring midwifery practices randomly selected in the Netherlands. Singleton breech

  3. Implementation of client versus care-provider strategies to improve external cephalic version rates: a cluster randomized controlled trial

    NARCIS (Netherlands)

    Vlemmix, F.; Rosman, A.N.; Rijnders, M.E.; Beuckens, A.; Opmeer, B.C.; Mol, B.W.J.; Kok, M.; Fleuren, M.A.H.

    2015-01-01

    Onjective: To determine the effectiveness of a client or care-provider strategy to improve the implementation of external cephalic version. Design: Cluster randomized controlled trial.Setting: Twenty-five clusters; hospitals and their referring midwifery practices randomly selected in the

  4. Statistical and numerical methods to improve the transient divided bar method

    DEFF Research Database (Denmark)

    Bording, Thue Sylvester; Nielsen, S.B.; Balling, N.

    The divided bar method is a commonly used method to measure thermal conductivity of rock samples in laboratory. We present improvements to this method that allows for simultaneous measurements of both thermal conductivity and thermal diffusivity. The divided bar setup is run in a transient mode...

  5. A mixed methods study of patient-provider communication about opioid analgesics.

    Science.gov (United States)

    Hughes, Helen Kinsman; Korthuis, Philip Todd; Saha, Somnath; Eggly, Susan; Sharp, Victoria; Cohn, Jonathan; Moore, Richard; Beach, Mary Catherine

    2015-04-01

    To describe patient-provider communication about opioid pain medicine and explore how these discussions affect provider attitudes toward patients. We audio-recorded 45 HIV providers and 423 patients in routine outpatient encounters at four sites across the country. Providers completed post-visit questionnaires assessing their attitudes toward patients. We identified discussions about opioid pain management and analyzed them qualitatively. We used logistic regression to assess the association between opioid discussion and providers' attitudes toward patients. 48 encounters (11% of the total sample) contained substantive discussion of opioid-related pain management. Most conversations were initiated by patients (n=28, 58%) and ended by the providers (n=36, 75%). Twelve encounters (25%) contained dialog suggesting a difference of opinion or conflict. Providers more often agreed than disagreed to give the prescription (50% vs. 23%), sometimes reluctantly; in 27% (n=13) of encounters, no decision was made. Fewer than half of providers (n=20, 42%) acknowledged the patient's experience of pain. Providers had a lower odds of positive regard for the patient (adjusted OR=0.51, 95% CI: 0.27-0.95) when opioids were discussed. Pain management discussions are common in routine outpatient HIV encounters and providers may regard patients less favorably if opioids are discussed during visits. The sometimes-adversarial nature of these discussions may negatively affect provider attitudes toward patients. Empathy and pain acknowledgment are tools that clinicians can use to facilitate productive discussions of pain management. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  6. Improvement of vector compensation method for vehicle magnetic distortion field

    Energy Technology Data Exchange (ETDEWEB)

    Pang, Hongfeng, E-mail: panghongfeng@126.com; Zhang, Qi; Li, Ji; Luo, Shitu; Chen, Dixiang; Pan, Mengchun; Luo, Feilu

    2014-03-15

    Magnetic distortions such as eddy-current field and low frequency magnetic field have not been considered in vector compensation methods. A new compensation method is proposed to suppress these magnetic distortions and improve compensation performance, in which the magnetic distortions related to measurement vectors and time are considered. The experimental system mainly consists of a three-axis fluxgate magnetometer (DM-050), an underwater vehicle and a proton magnetometer, in which the scalar value of magnetic field is obtained with the proton magnetometer and considered to be the true value. Comparing with traditional compensation methods, experimental results show that the magnetic distortions can be further reduced by two times. After compensation, error intensity and RMS error are reduced from 11684.013 nT and 7794.604 nT to 16.219 nT and 5.907 nT respectively. It suggests an effective way to improve the compensation performance of magnetic distortions. - Highlights: • A new vector compensation method is proposed for vehicle magnetic distortion. • The proposed model not only includes magnetometer error but also considers magnetic distortion. • Compensation parameters are computed directly by solving nonlinear equations. • Compared with traditional methods, the proposed method is not related with rotation angle rate. • Error intensity and RMS error can be reduced to 1/2 of the error with traditional methods.

  7. Improvement of vector compensation method for vehicle magnetic distortion field

    International Nuclear Information System (INIS)

    Pang, Hongfeng; Zhang, Qi; Li, Ji; Luo, Shitu; Chen, Dixiang; Pan, Mengchun; Luo, Feilu

    2014-01-01

    Magnetic distortions such as eddy-current field and low frequency magnetic field have not been considered in vector compensation methods. A new compensation method is proposed to suppress these magnetic distortions and improve compensation performance, in which the magnetic distortions related to measurement vectors and time are considered. The experimental system mainly consists of a three-axis fluxgate magnetometer (DM-050), an underwater vehicle and a proton magnetometer, in which the scalar value of magnetic field is obtained with the proton magnetometer and considered to be the true value. Comparing with traditional compensation methods, experimental results show that the magnetic distortions can be further reduced by two times. After compensation, error intensity and RMS error are reduced from 11684.013 nT and 7794.604 nT to 16.219 nT and 5.907 nT respectively. It suggests an effective way to improve the compensation performance of magnetic distortions. - Highlights: • A new vector compensation method is proposed for vehicle magnetic distortion. • The proposed model not only includes magnetometer error but also considers magnetic distortion. • Compensation parameters are computed directly by solving nonlinear equations. • Compared with traditional methods, the proposed method is not related with rotation angle rate. • Error intensity and RMS error can be reduced to 1/2 of the error with traditional methods

  8. Applying Process Improvement Methods to Clinical and Translational Research: Conceptual Framework and Case Examples.

    Science.gov (United States)

    Daudelin, Denise H; Selker, Harry P; Leslie, Laurel K

    2015-12-01

    There is growing appreciation that process improvement holds promise for improving quality and efficiency across the translational research continuum but frameworks for such programs are not often described. The purpose of this paper is to present a framework and case examples of a Research Process Improvement Program implemented at Tufts CTSI. To promote research process improvement, we developed online training seminars, workshops, and in-person consultation models to describe core process improvement principles and methods, demonstrate the use of improvement tools, and illustrate the application of these methods in case examples. We implemented these methods, as well as relational coordination theory, with junior researchers, pilot funding awardees, our CTRC, and CTSI resource and service providers. The program focuses on capacity building to address common process problems and quality gaps that threaten the efficient, timely and successful completion of clinical and translational studies. © 2015 The Authors. Clinical and Translational Science published by Wiley Periodicals, Inc.

  9. Distance Measurement Methods for Improved Insider Threat Detection

    Directory of Open Access Journals (Sweden)

    Owen Lo

    2018-01-01

    Full Text Available Insider threats are a considerable problem within cyber security and it is often difficult to detect these threats using signature detection. Increasing machine learning can provide a solution, but these methods often fail to take into account changes of behaviour of users. This work builds on a published method of detecting insider threats and applies Hidden Markov method on a CERT data set (CERT r4.2 and analyses a number of distance vector methods (Damerau–Levenshtein Distance, Cosine Distance, and Jaccard Distance in order to detect changes of behaviour, which are shown to have success in determining different insider threats.

  10. An improved partial bundle method for linearly constrained minimax problems

    Directory of Open Access Journals (Sweden)

    Chunming Tang

    2016-02-01

    Full Text Available In this paper, we propose an improved partial bundle method for solving linearly constrained minimax problems. In order to reduce the number of component function evaluations, we utilize a partial cutting-planes model to substitute for the traditional one. At each iteration, only one quadratic programming subproblem needs to be solved to obtain a new trial point. An improved descent test criterion is introduced to simplify the algorithm. The method produces a sequence of feasible trial points, and ensures that the objective function is monotonically decreasing on the sequence of stability centers. Global convergence of the algorithm is established. Moreover, we utilize the subgradient aggregation strategy to control the size of the bundle and therefore overcome the difficulty of computation and storage. Finally, some preliminary numerical results show that the proposed method is effective.

  11. An Improved Method of Training Overcomplete Dictionary Pair

    Directory of Open Access Journals (Sweden)

    Zhuozheng Wang

    2014-01-01

    Full Text Available Training overcomplete dictionary pair is a critical step of the mainstream superresolution methods. For the high time complexity and susceptible to corruption characteristics of training dictionary, an improved method based on lifting wavelet transform and robust principal component analysis is reported. The high-frequency components of example images are estimated through wavelet coefficients of 3-tier lifting wavelet transform decomposition. Sparse coefficients are similar in multiframe images. Accordingly, the inexact augmented Lagrange multiplier method is employed to achieve robust principal component analysis in the process of imposing global constraints. Experiments reveal that the new algorithm not only reduces the time complexity preserving the clarity but also improves the robustness for the corrupted example images.

  12. Methods to improve patient recruitment and retention in stroke trials

    DEFF Research Database (Denmark)

    Berge, Eivind; Stapf, Christian; Al-Shahi Salman, Rustam

    2016-01-01

    Background: The success of randomized-controlled stroke trials is dependent on the recruitment and retention of a sufficient number of patients, but fewer than half of all trials meet their target number of patients. Methods: We performed a search and review of the literature, and conducted...... a survey and workshop among 56 European stroke trialists, to identify barriers, suggest methods to improve recruitment and retention, and make a priority list of interventions that merit further evaluation. Results: The survey and workshop identified a number of barriers to patient recruitment...... and retention, from patients’ incapacity to consent, to handicaps that prevent patients from participation in trial-specific follow-up. Methods to improve recruitment and retention may include simple interventions with individual participants, funding of research networks, and reimbursement of new treatments...

  13. Narrative review of provider behavior in primary care behavioral health: How process data can inform quality improvement.

    Science.gov (United States)

    Beehler, Gregory P; Lilienthal, Kaitlin R; Possemato, Kyle; Johnson, Emily M; King, Paul R; Shepardson, Robyn L; Vair, Christina L; Reyner, Jacqueline; Funderburk, Jennifer S; Maisto, Stephen A; Wray, Laura O

    2017-09-01

    Primary care behavioral health (PCBH) is a population-based approach to delivering mental and behavioral health care in the primary care setting. Implementation of the PCBH model varies across practice settings, which can impact how PCBH providers deliver services to patients and in turn may predict a variety of important outcomes. This article aims to characterize PCBH provider engagement in key processes of integrated care as demonstrated in results from empirical studies of real-world clinical practice. For this narrative review of published studies on PCBH provider engagement in processes of care, PubMed and PsycINFO databases were searched from January 1990 through May 2016 to identify relevant articles. Provider adherence to the brief, time-limited treatment model appears suboptimal. Common mental health conditions, such as depression, were often the primary focus of provider attention, with less consistent emphasis on behavioral medicine concerns. Whereas providers regularly conducted qualitative functional assessments with patients, routine use of standardized measures was low. Engagement in interprofessional collaboration with the primary care team was also low, but engagement in behaviors that fostered therapeutic relationships was high. This review identified several strengths and weaknesses of typical PCBH provider practices. Results are discussed in relation to their value as areas for future quality improvement initiatives that can improve PCBH service delivery and, ultimately, patient outcomes. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  14. Improving methods estimation of the investment climate of the country

    Directory of Open Access Journals (Sweden)

    E. V. Ryabinin

    2016-01-01

    the most objective assessment of the investment climate in the country in order to build their strategies market functioning. The article describes two methods to obtain an estimate of the investment climate, a fundamental and expertise. Studies have shown that the fundamental method provides the most accurate and objective assessment of, but not all of the investment potential factors can be subjected to mathematical evaluation. The use of expert opinion on the practice of subjectivity difficult to experts, so its use requires special care. In modern economic practice it proved that the investment climate elements directly affect the investment decisions of companies. Improving the investment climate assessment methodology, it allows you to build the most optimal form of cooperation between investors from the host country. In today’s political tensions, this path requires clear cooperation of subjects, both in the domestic and international level. However, now, these measures will avoid the destabilization of Russia’s relations with foreign investors.

  15. Concepts of Scenario Methods in Improvement of an Enterprise

    Directory of Open Access Journals (Sweden)

    Edyta Bielinska-Dusza

    2013-06-01

    Full Text Available Purpose of the study, principal objectives, scope of the investigation, methods employed results and principal conclusion. Uncertainty makes both theoreticians and practicioners face new tasks to fulfil. Enterprises, in order to win the competitive struggle must constantly improve their processes and structures. On the other hand, thinking in the categories of the future becomes really difficult nowadays. This creates particularly convenient conditions to apply scenario methods. In connection with the above, the purpose of this study is to characterize the essence of scenario methods employed in enterprise development. The article addresses the issue of factors conditioning proper selection of methods in the enterprise development process, the principles of scenario planning and the opportunities to apply other techniques and methods in scenario planning.

  16. An improved electrokinetic method to consolidate porous materials

    DEFF Research Database (Denmark)

    Feijoo, Jorge; Ottosen, Lisbeth M.; Nóvoa, X. R.

    2017-01-01

    the consolidation using commercial products have some limitations, such as: (1) low penetrability; (2) no chemical and mineralogical affinity with the material to treat and (3) release of toxic compounds (VOCs), during the solvent evaporation. In the last years, a new consolidation method based on electrokinetic...... the pH of the solutions in contact with the porous material, which can damage it and (2) it is difficult to determine in which area the consolidation takes place. In this study an electrokinetic consolidation method, which has two steps between which the current is reversed, is proposed to solve all...... techniques was developed. This method allows filling some pores by the precipitation of an inorganic compound. As a result the method allows increasing the penetration depth of current consolidation treatments. However, this method needs to be improved since: (1) no special care is taking in controlling...

  17. Improved Taguchi method based contract capacity optimization for industrial consumer with self-owned generating units

    International Nuclear Information System (INIS)

    Yang, Hong-Tzer; Peng, Pai-Chun

    2012-01-01

    Highlights: ► We propose an improved Taguchi method to determine the optimal contract capacities with SOGUs. ► We solve the highly discrete and nonlinear optimization problem for the contract capacities with SOGUs. ► The proposed improved Taguchi method integrates PSO in Taguchi method. ► The customer using the proposed optimization approach may save up to 12.18% of power expenses. ► The improved Taguchi method can also be well applied to the other similar problems. - Abstract: Contract capacity setting for industrial consumer with self-owned generating units (SOGUs) is a highly discrete and nonlinear optimization problem considering expenditure on the electricity from the utility and operation costs of the SOGUs. This paper proposes an improved Taguchi method that combines existing Taguchi method and particle swarm optimization (PSO) algorithm to solve this problem. Taguchi method provides fast converging characteristics in searching the optimal solution through quality analysis in orthogonal matrices. The integrated PSO algorithm generates new solutions in the orthogonal matrices based on the searching experiences during the evolution process to further improve the quality of solution. To verify feasibility of the proposed method, the paper uses the real data obtained from a large optoelectronics factory in Taiwan. In comparison with the existing optimization methods, the proposed improved Taguchi method has superior performance as revealed in the numerical results in terms of the convergence process and the quality of solution obtained.

  18. Devices and methods of operation thereof for providing stable flow for centrifugal compressors

    Science.gov (United States)

    Skoch, Gary J. (Inventor); Stevens, Mark A. (Inventor); Jett, Thomas A. (Inventor)

    2008-01-01

    Centrifugal compressor flow stabilizing devices and methods of operation thereof are disclosed that act upon the flow field discharging from the impeller of a centrifugal compressor and modify the flow field ahead of the diffuser vanes such that flow conditions contributing to rotating stall and surge are reduced or even eliminated. In some embodiments, shaped rods and methods of operation thereof are disclosed, whereas in other embodiments reverse-tangent air injection devices and methods are disclosed.

  19. Implementation of bioassay methods to improve assessment of incorporated radionuclides

    International Nuclear Information System (INIS)

    Oeh, U.; Andrasi, A.; Bouvier-Capely, C.; De Carlan, L.; Fischer, H.; Franck, D.; Hollriegl, V.; Li, W. B.; Ritt, J.; Roth, P.; Schmitzer, Ch; Wahl, W.; Zombori, P.

    2007-01-01

    The present work which was carried out in the framework of an EU project (IDEA: Internal Dosimetry - Enhancements in Application; Contract Number: FIKR CT2001 00164) shall provide commonly acceptable guidelines for optimum performance of ICP-MS measurements with focus on urinary measurements of uranium, thorium and actinides. From the results of this work it is recommended that, whenever feasible, 24 h urine sampling should be conducted to avoid large uncertainties in the quantitation of daily urinary excretion values. For storage, urine samples should be acidified and kept frozen before analysis. Measurement of total uranium in urine by ICP-MS at physiological levels ( -1 ) requires no sample preparation besides UV photolysis and/or dilution. For the measurement of thorium in urine by ICP-MS, it can be concluded, that salt removal from the urine samples is not recommended. For the measurement of actinides in urine it is shown that ICP-MS is well-suited and a good alternative to alpha-spectrometry for isotopes with T 1/2 > 5 x 10 4 years. In general, ICP-MS measurements are an easy, fast and cost-saving methodology. New improved measuring techniques (HR-SF-ICP-MS) with detection limits in urine of 150 pg l -1 (1.9 μBq l -1 ) for 238 U, 30 pg l -1 (2.4 μBq l -1 ) for 235 U and 100 pg l -1 (0.4 μBq l -1 ) for 232 Th, respectively, meet all necessary requirements. This method should therefore become the routine technique for incorporation monitoring of workers and of members of the general public, in particular for uranium contamination. (authors)

  20. Editorial: Advances in healthcare provider and patient training to improve the quality and safety of patient care

    Directory of Open Access Journals (Sweden)

    Elizabeth M. Borycki

    2015-09-01

    Full Text Available This special issue of the Knowledge Management & E-Learning: An International Journal is dedicated to describing “Advances in Healthcare Provider and Patient Training to Improve the Quality and Safety of Patient Care.” Patient safety is an important and fundamental requirement of ensuring the quality of patient care. Training and education has been identified as a key to improving healthcare provider patient safety competencies especially when working with new technologies such as electronic health records and mobile health applications. Such technologies can be harnessed to improve patient safety; however, if not used properly they can negatively impact on patient safety. In this issue we focus on advances in training that can improve patient safety and the optimal use of new technologies in healthcare. For example, use of clinical simulations and online computer based training can be employed both to facilitate learning about new clinical discoveries as well as to integrate technology into day to day healthcare practices. In this issue we are publishing papers that describe advances in healthcare provider and patient training to improve patient safety as it relates to the use of educational technologies, health information technology and on-line health resources. In addition, in the special issue we describe new approaches to training and patient safety including, online communities, clinical simulations, on-the-job training, computer based training and health information systems that educate about and support safer patient care in real-time (i.e. when health professionals are providing care to patients. These educational and technological initiatives can be aimed at health professionals (i.e. students and those who are currently working in the field. The outcomes of this work are significant as they lead to safer care for patients and their family members. The issue has both theoretical and applied papers that describe advances in patient

  1. Improved exact method for the double TSP with multiple stacks

    DEFF Research Database (Denmark)

    Lusby, Richard Martin; Larsen, Jesper

    2011-01-01

    and delivery problems. The results suggest an impressive improvement, and we report, for the first time, optimal solutions to several unsolved instances from the literature containing 18 customers. Instances with 28 customers are also shown to be solvable within a few percent of optimality. © 2011 Wiley...... the first delivery, and the container cannot be repacked once packed. In this paper we improve the previously proposed exact method of Lusby et al. (Int Trans Oper Res 17 (2010), 637–652) through an additional preprocessing technique that uses the longest common subsequence between the respective pickup...

  2. Training Methods to Improve Evidence-Based Medicine Skills

    Directory of Open Access Journals (Sweden)

    Filiz Ozyigit

    2010-06-01

    Full Text Available Evidence based medicine (EBM is the conscientious, explicit and judicious use of current best evidence in making decisions about the care of individual patients. It is estimated that only 15% of medical interventions is evidence-based. Increasing demand, new technological developments, malpractice legislations, a very speed increase in knowledge and knowledge sources push the physicians forward for EBM, but at the same time increase load of physicians by giving them the responsibility to improve their skills. Clinical maneuvers are needed more, as the number of clinical trials and observational studies increase. However, many of the physicians, who are in front row of patient care do not use this increasing evidence. There are several examples related to different training methods in order to improve skills of physicians for evidence based practice. There are many training methods to improve EBM skills and these trainings might be given during medical school, during residency or as continuous trainings to the actual practitioners in the field. It is important to discuss these different training methods in our country as well and encourage dissemination of feasible and effective methods. [TAF Prev Med Bull 2010; 9(3.000: 245-254

  3. Improving timeliness and efficiency in the referral process for safety net providers: application of the Lean Six Sigma methodology.

    Science.gov (United States)

    Deckard, Gloria J; Borkowski, Nancy; Diaz, Deisell; Sanchez, Carlos; Boisette, Serge A

    2010-01-01

    Designated primary care clinics largely serve low-income and uninsured patients who present a disproportionate number of chronic illnesses and face great difficulty in obtaining the medical care they need, particularly the access to specialty physicians. With limited capacity for providing specialty care, these primary care clinics generally refer patients to safety net hospitals' specialty ambulatory care clinics. A large public safety net health system successfully improved the effectiveness and efficiency of the specialty clinic referral process through application of Lean Six Sigma, an advanced process-improvement methodology and set of tools driven by statistics and engineering concepts.

  4. Unsafe abortion in urban and rural Tanzania: method, provider and consequences

    DEFF Research Database (Denmark)

    Rasch, Vibeke; Kipingili, Rose

    2009-01-01

    OBJECTIVE: To describe unsafe abortion methods and associated health consequences in Tanzania, where induced abortion is restricted by law but common and known to account for a disproportionate share of hospital admissions. METHOD: Cross-sectional study of women admitted with alleged miscarriage...

  5. Implementation of bioassay methods to improve assessment of incorporated radionuclides

    International Nuclear Information System (INIS)

    Oeh, U.; Hoellriegl, V.; Li, W.B.; Roth, P.; Wahl, W.; Andrasi, A.; Zombori, P.; Bouvier, C.; Carlan de, L.; Franck, D.; Ritt, J.; Fischer, H.; Schmitzer, C.

    2005-01-01

    Application; Contract Number: FIKR CT2001 00164) shall provide commonly acceptable guidelines for optimum performance of ICP-MS measurements with main focus on urinary measurements of uranium, thorium, and actinides. From the results of this work it is recommended that, whenever feasible, 24-hrs urine sampling should be conducted to avoid large uncertainties in the quantitation of daily urinary excretion values. For storage, urine samples should be acidified and kept frozen before analysis. Measurement of total uranium ( 238 U) in urine by ICP-MS at physiological levels ( 1/2 > 5 x 10 4 years. In general, ICP-MS measurements are an easy, fast and cost-saving methodology. New improved measuring techniques (HR-SF-ICP-MS) with detection limits of 238 U of 0.01 ng/L, and respectively 0.25 ng /L for 235 U meet all necessary requirements. This method should therefore become the routine technique for incorporation monitoring of workers and of members of the general public. (author)

  6. Room for improvement? Leadership, innovation culture and uptake of quality improvement methods in general practice.

    Science.gov (United States)

    Apekey, Tanefa A; McSorley, Gerry; Tilling, Michelle; Siriwardena, A Niroshan

    2011-04-01

    Leadership and innovation are currently seen as essential elements for the development and maintenance of high-quality care. Little is known about the relationship between leadership and culture of innovation and the extent to which quality improvement methods are used in general practice. This study aimed to assess the relationship between leadership behaviour, culture of innovation and adoption of quality improvement methods in general practice. Self-administered postal questionnaires were sent to general practitioner quality improvement leads in one county in the UK between June and December 2007. The questionnaire consisted of background information, a 12-item scale to assess leadership behaviour, a seven-dimension self-rating scale for culture of innovation and questions on current use of quality improvement tools and techniques. Sixty-three completed questionnaires (62%) were returned. Leadership behaviours were not commonly reported. Most practices reported a positive culture of innovation, featuring relationship most strongly, followed by targets and information but rated lower on other dimensions of rewards, risk and resources. There was a significant positive correlation between leadership behaviour and the culture of innovation (r = 0.57; P improvement methods were not adopted by most participating practices. Leadership behaviours were infrequently reported and this was associated with a limited culture of innovation in participating general practices. There was little use of quality improvement methods beyond clinical and significant event audit. Practices need support to enhance leadership skills, encourage innovation and develop quality improvement skills if improvements in health care are to accelerate. © 2010 Blackwell Publishing Ltd.

  7. Improved stove programs need robust methods to estimate carbon offsets

    OpenAIRE

    Johnson, Michael; Edwards, Rufus; Masera, Omar

    2010-01-01

    Current standard methods result in significant discrepancies in carbon offset accounting compared to approaches based on representative community based subsamples, which provide more realistic assessments at reasonable cost. Perhaps more critically, neither of the currently approved methods incorporates uncertainties inherent in estimates of emission factors or non-renewable fuel usage (fNRB). Since emission factors and fNRB contribute 25% and 47%, respectively, to the overall uncertainty in ...

  8. Evaluating methods to improve safeguards training courses of ISCN

    International Nuclear Information System (INIS)

    Okumura, Yukiko; Nakamura, Yo; Kawata, Norio

    2014-01-01

    Although questionnaires were used to receive feedbacks from participants at the end of each training course, Integrated Support Center for Nuclear Nonproliferation and Nuclear Security (ISCN) of Japan Atomic Energy Agency (JAEA) did not establish a structured evaluation method. To this end, ISCN has started to study on methods to accurately evaluate the courses since April and started to introduce the evaluation method on trial, according to the Donald Kirkpatrick's Four-Level Training Evaluation Model, so as to better develop and conduct more effective courses. This paper will focus on how ISCN has modified the Kirkpatrick's Four-level to adapt to its safeguards training courses. This will then be followed by two particular cases of how the evaluation method functioned for the Additional Protocol training courses held in Malaysia in 2014, and the feedbacks received to improve future training courses. (author)

  9. Fundamentals of modern statistical methods substantially improving power and accuracy

    CERN Document Server

    Wilcox, Rand R

    2001-01-01

    Conventional statistical methods have a very serious flaw They routinely miss differences among groups or associations among variables that are detected by more modern techniques - even under very small departures from normality Hundreds of journal articles have described the reasons standard techniques can be unsatisfactory, but simple, intuitive explanations are generally unavailable Improved methods have been derived, but they are far from obvious or intuitive based on the training most researchers receive Situations arise where even highly nonsignificant results become significant when analyzed with more modern methods Without assuming any prior training in statistics, Part I of this book describes basic statistical principles from a point of view that makes their shortcomings intuitive and easy to understand The emphasis is on verbal and graphical descriptions of concepts Part II describes modern methods that address the problems covered in Part I Using data from actual studies, many examples are include...

  10. Improvement of correlated sampling Monte Carlo methods for reactivity calculations

    International Nuclear Information System (INIS)

    Nakagawa, Masayuki; Asaoka, Takumi

    1978-01-01

    Two correlated Monte Carlo methods, the similar flight path and the identical flight path methods, have been improved to evaluate up to the second order change of the reactivity perturbation. Secondary fission neutrons produced by neutrons having passed through perturbed regions in both unperturbed and perturbed systems are followed in a way to have a strong correlation between secondary neutrons in both the systems. These techniques are incorporated into the general purpose Monte Carlo code MORSE, so as to be able to estimate also the statistical error of the calculated reactivity change. The control rod worths measured in the FCA V-3 assembly are analyzed with the present techniques, which are shown to predict the measured values within the standard deviations. The identical flight path method has revealed itself more useful than the similar flight path method for the analysis of the control rod worth. (auth.)

  11. INTERIM REPORT IMPROVED METHODS FOR INCORPORATING RISK IN DECISION MAKING

    Energy Technology Data Exchange (ETDEWEB)

    Clausen, M. J.; Fraley, D. W.; Denning, R. S.

    1980-08-01

    This paper reports observations and preliminary investigations in the first phase of a research program covering methodologies for making safety-related decisions. The objective has been to gain insight into NRC perceptions of the value of formal decision methods, their possible applications, and how risk is, or may be, incorporated in decision making. The perception of formal decision making techniques, held by various decision makers, and what may be done to improve them, were explored through interviews with NRC staff. An initial survey of decision making methods, an assessment of the applicability of formal methods vis-a-vis the available information, and a review of methods of incorporating risk and uncertainty have also been conducted.

  12. Consumers' Interest In Provider Ratings Grows, And Improved Report Cards And Other Steps Could Accelerate Their Use.

    Science.gov (United States)

    Findlay, Steven D

    2016-04-01

    Encouraging patients and consumers to use data and other information in choosing health care providers is an important way to enhance patient engagement and improve the quality of care. The growing use of technology, including smart phones and near-ubiquitous Internet access, provides consumers with easy access to websites that collect and report assessments and ratings of providers, primarily physicians and hospitals. In addition to new technology, recent laws and changes in society and the delivery of care are laying the foundation for greater use by consumers of provider performance report cards. Such use could be accelerated if the shortcomings of current report card efforts were addressed. Recommendations include making online report cards easier to use and more understandable, engaging, substantive, and relevant to consumers' health and medical concerns and choices. Project HOPE—The People-to-People Health Foundation, Inc.

  13. Compositions and methods for providing plants with tolerance to abiotic stress conditions

    KAUST Repository

    Hirt, Heribert; De Zelicourt, Axel; Saad, Maged

    2017-01-01

    It has been discovered that the desert endophytic bacterium SA187 SA187 can provide resistance or tolerance to abiotic stress conditions to seeds or plants. Compositions containing SA187 can be used to enhance plant development and yield under

  14. An Improved AAM Method for Extracting Human Facial Features

    Directory of Open Access Journals (Sweden)

    Tao Zhou

    2012-01-01

    Full Text Available Active appearance model is a statistically parametrical model, which is widely used to extract human facial features and recognition. However, intensity values used in original AAM cannot provide enough information for image texture, which will lead to a larger error or a failure fitting of AAM. In order to overcome these defects and improve the fitting performance of AAM model, an improved texture representation is proposed in this paper. Firstly, translation invariant wavelet transform is performed on face images and then image structure is represented using the measure which is obtained by fusing the low-frequency coefficients with edge intensity. Experimental results show that the improved algorithm can increase the accuracy of the AAM fitting and express more information for structures of edge and texture.

  15. An improved intermediate resonance method for heterogeneous media

    International Nuclear Information System (INIS)

    Chiovato, O.; Corno, S.; Pasquantonio, F.Di.

    1977-01-01

    A new formulation is described of the Intermediate Resonance method which incorporates the previous developments suitably modified and improved, together with some new contributions. The 'intermediate' character is directly introduced in the integral operator K, allowing a more rigorous deduction of the equations for evaluating the intermediate parameters related to the nuclides involved in the system. There is no limit to the number of internal (admixed in the fuel) and external moderators. The capability to take into account the interference scattering has been extended to heterogeneous systems. The Doppler broadening is described by means of new accurate rational approximations to the broadened line shape psi. Finally the use of energy mean values suitably defined refines the values of the resonance integrals and resonance absorption cross sections. The Intermediate Resonance method so extended and improved, has been coded in a group of FORTRAN routines, which have been inserted as a calculation option in the fast section of the GGC code for the evaluation of multigroup cross sections. A series of calculations has been carried out, using these routines, and comparisons have been made with Monte Carlo and Nordheim's methods. The results obtained show that the Intermediate Resonance method developed in the present work offers considerable advantages over Nordheim's method: better accuracy in evaluating resonance absorption cross sections, and much smaller computing times. (author)

  16. Improving of Business Planning Using the Method of Fuzzy Numbers

    Directory of Open Access Journals (Sweden)

    Iryna Kosteteska

    2016-03-01

    Full Text Available Purpose: Summarize the experience of using modern methods in the business plan with the application of economic and mathematical modeling. Methodology: Theoretical and methodological basis of the study is the basic principles of economic theory, agricultural economics and scientific research of leading home and foreign scholars on the theory of planning. Originality: This further justifies business planning processes in agriculture from the standpoint of raising economic protection of farmers. The methodology for assessing farm income for planned indicators through the application of fuzzy numbers method in business planning is improved.

  17. Method for calculating annual energy efficiency improvement of TV sets

    International Nuclear Information System (INIS)

    Varman, M.; Mahlia, T.M.I.; Masjuki, H.H.

    2006-01-01

    The popularization of 24 h pay-TV, interactive video games, web-TV, VCD and DVD are poised to have a large impact on overall TV electricity consumption in the Malaysia. Following this increased consumption, energy efficiency standard present a highly effective measure for decreasing electricity consumption in the residential sector. The main problem in setting energy efficiency standard is identifying annual efficiency improvement, due to the lack of time series statistical data available in developing countries. This study attempts to present a method of calculating annual energy efficiency improvement for TV set, which can be used for implementing energy efficiency standard for TV sets in Malaysia and other developing countries. Although the presented result is only an approximation, definitely it is one of the ways of accomplishing energy standard. Furthermore, the method can be used for other appliances without any major modification

  18. Improved verification methods for safeguards verifications at enrichment plants

    International Nuclear Information System (INIS)

    Lebrun, A.; Kane, S. C.; Bourva, L.; Poirier, S.; Loghin, N. E.; Langlands, D.

    2009-01-01

    The International Atomic Energy Agency (IAEA) has initiated a coordinated research and development programme to improve its verification methods and equipment applicable to enrichment plants. The programme entails several individual projects to meet the objectives of the IAEA Safeguards Model Approach for Gas Centrifuge Enrichment Plants updated in 2006. Upgrades of verification methods to confirm the absence of HEU (highly enriched uranium) production have been initiated and, in particular, the Cascade Header Enrichment Monitor (CHEM) has been redesigned to reduce its weight and incorporate an electrically cooled germanium detector. Such detectors are also introduced to improve the attended verification of UF 6 cylinders for the verification of the material balance. Data sharing of authenticated operator weighing systems such as accountancy scales and process load cells is also investigated as a cost efficient and an effective safeguards measure combined with unannounced inspections, surveillance and non-destructive assay (NDA) measurement. (authors)

  19. Improved artificial bee colony algorithm based gravity matching navigation method.

    Science.gov (United States)

    Gao, Wei; Zhao, Bo; Zhou, Guang Tao; Wang, Qiu Ying; Yu, Chun Yang

    2014-07-18

    Gravity matching navigation algorithm is one of the key technologies for gravity aided inertial navigation systems. With the development of intelligent algorithms, the powerful search ability of the Artificial Bee Colony (ABC) algorithm makes it possible to be applied to the gravity matching navigation field. However, existing search mechanisms of basic ABC algorithms cannot meet the need for high accuracy in gravity aided navigation. Firstly, proper modifications are proposed to improve the performance of the basic ABC algorithm. Secondly, a new search mechanism is presented in this paper which is based on an improved ABC algorithm using external speed information. At last, modified Hausdorff distance is introduced to screen the possible matching results. Both simulations and ocean experiments verify the feasibility of the method, and results show that the matching rate of the method is high enough to obtain a precise matching position.

  20. Method for calculating annual energy efficiency improvement of TV sets

    Energy Technology Data Exchange (ETDEWEB)

    Varman, M. [Department of Mechanical Engineering, University of Malaya, Lembah Pantai, 50603 Kuala Lumpur (Malaysia); Mahlia, T.M.I. [Department of Mechanical Engineering, University of Malaya, Lembah Pantai, 50603 Kuala Lumpur (Malaysia)]. E-mail: indra@um.edu.my; Masjuki, H.H. [Department of Mechanical Engineering, University of Malaya, Lembah Pantai, 50603 Kuala Lumpur (Malaysia)

    2006-10-15

    The popularization of 24 h pay-TV, interactive video games, web-TV, VCD and DVD are poised to have a large impact on overall TV electricity consumption in the Malaysia. Following this increased consumption, energy efficiency standard present a highly effective measure for decreasing electricity consumption in the residential sector. The main problem in setting energy efficiency standard is identifying annual efficiency improvement, due to the lack of time series statistical data available in developing countries. This study attempts to present a method of calculating annual energy efficiency improvement for TV set, which can be used for implementing energy efficiency standard for TV sets in Malaysia and other developing countries. Although the presented result is only an approximation, definitely it is one of the ways of accomplishing energy standard. Furthermore, the method can be used for other appliances without any major modification.

  1. Improved verification methods for safeguards verifications at enrichment plants

    Energy Technology Data Exchange (ETDEWEB)

    Lebrun, A.; Kane, S. C.; Bourva, L.; Poirier, S.; Loghin, N. E.; Langlands, D. [Department of Safeguards, International Atomic Energy Agency, Wagramer Strasse 5, A1400 Vienna (Austria)

    2009-07-01

    The International Atomic Energy Agency (IAEA) has initiated a coordinated research and development programme to improve its verification methods and equipment applicable to enrichment plants. The programme entails several individual projects to meet the objectives of the IAEA Safeguards Model Approach for Gas Centrifuge Enrichment Plants updated in 2006. Upgrades of verification methods to confirm the absence of HEU (highly enriched uranium) production have been initiated and, in particular, the Cascade Header Enrichment Monitor (CHEM) has been redesigned to reduce its weight and incorporate an electrically cooled germanium detector. Such detectors are also introduced to improve the attended verification of UF{sub 6} cylinders for the verification of the material balance. Data sharing of authenticated operator weighing systems such as accountancy scales and process load cells is also investigated as a cost efficient and an effective safeguards measure combined with unannounced inspections, surveillance and non-destructive assay (NDA) measurement. (authors)

  2. Space discretization in SN methods: Features, improvements and convergence patterns

    International Nuclear Information System (INIS)

    Coppa, G.G.M.; Lapenta, G.; Ravetto, P.

    1990-01-01

    A comparative analysis of the space discretization schemes currently used in S N methods is performed and special attention is devoted to direct integration techniques. Some improvements are proposed in one- and two-dimensional applications, which are based on suitable choices for the spatial variation of the collision source. A study of the convergence pattern is carried out for eigenvalue calculations within the space asymptotic approximation by means of both analytical and numerical investigations. (orig.) [de

  3. An improved method of preparation of nanoparticular metal oxide catalysts

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention concerns an improved method of preparation of nanoparticular vanadium oxide/anatase titania catalysts having a narrow particle size distribution. In particular, the invention concerns preparation of nanoparticular vanadium oxide/anatase titania catalyst precursors comprising...... combustible crystallization seeds upon which the catalyst metal oxide is coprecipitated with the carrier metal oxide, which crystallization seeds are removed by combustion in a final calcining step....

  4. Improvement of dose evaluation method for employees at severe accident

    International Nuclear Information System (INIS)

    Onda, Takashi; Yoshida, Yoshitaka; Kudo, Seiichi; Nishimura, Kazuya

    2003-01-01

    It is expected that the selection of access routes for employees who engage in emergency work at a severe accident in a nuclear power plant makes a difference in their radiation dose values. In order to examine how much difference arises in the dose by the selection of the access routes, in the case of a severe accident in a pressurized water reactor plant, we improved the method to obtain the dose for employees and expanded the analyzing system. By the expansion of the system and the improvement of the method, we have realized the followings: (1) in the whole plant area, the dose evaluation is possible, (2) the efficiency of calculation is increased by the reduction of the number of radiation sources, etc, and (3) the function is improved by introduction of the sky shine calculation into the highest floor, etc. The improved system clarifies the followings: (1) the doses change by selected access routes, and this system can give the difference in the doses quantitatively, and (2) in order to suppress the dose, it is effective to choose the most adequate access route for the employees. (author)

  5. The impact of a quality-improvement package on reproductive health services delivered by private providers in Uganda.

    Science.gov (United States)

    Agha, Sohail

    2010-09-01

    This study assesses the effectiveness of a quality-improvement (QI) package designed to enable small-scale commercial reproductive health (RH) service providers to improve the services they offer. The study was conducted among midwives who are members of the Uganda Private Midwives Association. A pretest-post-test quasi-experimental panel study design was used wherein midwife clinics were allocated to two experimental groups and one control group. Baseline and follow-up measurements of structural and process attributes of quality were taken at the clinics by means of a facility inventory, interviews with midwives, and observations of client-provider interactions. Nearly 70 percent of the midwives who were trained to use the package reported that it was easy to use. Among clinics in which midwives received training in the use of the self-assessment tool and in developing action plans, structural and process attributes of quality improved only among those clinics in which the midwives' supervisors received training in finding solutions to the problems identified through self-assessments. The QI package may be implemented with small-scale private providers of RH services who are part of a professional association, network, or franchise that supervises their performance.

  6. Improved Multilevel Fast Multipole Method for Higher-Order discretizations

    DEFF Research Database (Denmark)

    Borries, Oscar Peter; Meincke, Peter; Jorgensen, Erik

    2014-01-01

    The Multilevel Fast Multipole Method (MLFMM) allows for a reduced computational complexity when solving electromagnetic scattering problems. Combining this with the reduced number of unknowns provided by Higher-Order discretizations has proven to be a difficult task, with the general conclusion b...

  7. Handbook for Conducting Standard CMMI Appraisal Method for Process Improvement (SCAMPI) B and C Appraisals, Version 1.1

    National Research Council Canada - National Science Library

    Hayes, Will; Miluk, Gene; Ming, Lisa; Glover, Margaret; Bisgrove, Jane; Cort, Corrine; Penn, Lynn; Jacobson, Nils; Beynon, Don; Allgood, Bruce

    2005-01-01

    The Standard CMMI Appraisal Method for Process Improvement (SCAMPI) provides a well-defined, publicly available set of methodologies for providing appraisals relative to Capability Maturity Model (trademark) Integration (CMMI) models...

  8. Implementation of client versus care-provider strategies to improve external cephalic version rates: a cluster randomized controlled trial.

    Science.gov (United States)

    Vlemmix, Floortje; Rosman, Ageeth N; Rijnders, Marlies E; Beuckens, Antje; Opmeer, Brent C; Mol, Ben W J; Kok, Marjolein; Fleuren, Margot A H

    2015-05-01

    To determine the effectiveness of a client or care-provider strategy to improve the implementation of external cephalic version. Cluster randomized controlled trial. Twenty-five clusters; hospitals and their referring midwifery practices randomly selected in the Netherlands. Singleton breech presentation from 32 weeks of gestation onwards. We randomized clusters to a client strategy (written information leaflets and decision aid), a care-provider strategy (1-day counseling course focused on knowledge and counseling skills), a combined client and care-provider strategy and care-as-usual strategy. We performed an intention-to-treat analysis. Rate of external cephalic version in various strategies. Secondary outcomes were the percentage of women counseled and opting for a version attempt. The overall implementation rate of external cephalic version was 72% (1169 of 1613 eligible clients) with a range between clusters of 8-95%. Neither the client strategy (OR 0.8, 95% CI 0.4-1.5) nor the care-provider strategy (OR 1.2, 95% CI 0.6-2.3) showed significant improvements. Results were comparable when we limited the analysis to those women who were actually offered intervention (OR 0.6, 95% CI 0.3-1.4 and OR 2.0, 95% CI 0.7-4.5). Neither a client nor a care-provider strategy improved the external cephalic version implementation rate for breech presentation, neither with regard to the number of version attempts offered nor the number of women accepting the procedure. © 2015 Nordic Federation of Societies of Obstetrics and Gynecology.

  9. Integrating qualitative research methods into care improvement efforts within a learning health system: addressing antibiotic overuse.

    Science.gov (United States)

    Munoz-Plaza, Corrine E; Parry, Carla; Hahn, Erin E; Tang, Tania; Nguyen, Huong Q; Gould, Michael K; Kanter, Michael H; Sharp, Adam L

    2016-08-15

    Despite reports advocating for integration of research into healthcare delivery, scant literature exists describing how this can be accomplished. Examples highlighting application of qualitative research methods embedded into a healthcare system are particularly needed. This article describes the process and value of embedding qualitative research as the second phase of an explanatory, sequential, mixed methods study to improve antibiotic stewardship for acute sinusitis. Purposive sampling of providers for in-depth interviews improved understanding of unwarranted antibiotic prescribing and elicited stakeholder recommendations for improvement. Qualitative data collection, transcription and constant comparative analyses occurred iteratively. Emerging themes and sub-themes identified primary drivers of unwarranted antibiotic prescribing patterns and recommendations for improving practice. These findings informed the design of a health system intervention to improve antibiotic stewardship for acute sinusitis. Core components of the intervention are also described. Qualitative research can be effectively applied in learning healthcare systems to elucidate quantitative results and inform improvement efforts.

  10. A continuous quality improvement intervention to improve the effectiveness of community health workers providing care to mothers and children: a cluster randomised controlled trial in South Africa.

    Science.gov (United States)

    Horwood, Christiane; Butler, Lisa; Barker, Pierre; Phakathi, Sifiso; Haskins, Lyn; Grant, Merridy; Mntambo, Ntokozo; Rollins, Nigel

    2017-06-13

    Community health workers (CHWs) play key roles in delivering health programmes in many countries worldwide. CHW programmes can improve coverage of maternal and child health services for the most disadvantaged and remote communities, leading to substantial benefits for mothers and children. However, there is limited evidence of effective mentoring and supervision approaches for CHWs. This is a cluster randomised controlled trial to investigate the effectiveness of a continuous quality improvement (CQI) intervention amongst CHWs providing home-based education and support to pregnant women and mothers. Thirty CHW supervisors were randomly allocated to intervention (n = 15) and control (n = 15) arms. Four CHWs were randomly selected from those routinely supported by each supervisor (n = 60 per arm). In the intervention arm, these four CHWs and their supervisor formed a quality improvement team. Intervention CHWs received a 2-week training in WHO Community Case Management followed by CQI mentoring for 12 months (preceded by 3 months lead-in to establish QI processes). Baseline and follow-up surveys were conducted with mothers of infants Improved training and CQI-based mentoring of CHWs can improve quantity and quality of CHW-mother interactions at household level, leading to improvements in mothers' knowledge and infant feeding practices. ClinicalTrials.Gov NCT01774136.

  11. Are students' impressions of improved learning through active learning methods reflected by improved test scores?

    Science.gov (United States)

    Everly, Marcee C

    2013-02-01

    To report the transformation from lecture to more active learning methods in a maternity nursing course and to evaluate whether student perception of improved learning through active-learning methods is supported by improved test scores. The process of transforming a course into an active-learning model of teaching is described. A voluntary mid-semester survey for student acceptance of the new teaching method was conducted. Course examination results, from both a standardized exam and a cumulative final exam, among students who received lecture in the classroom and students who had active learning activities in the classroom were compared. Active learning activities were very acceptable to students. The majority of students reported learning more from having active-learning activities in the classroom rather than lecture-only and this belief was supported by improved test scores. Students who had active learning activities in the classroom scored significantly higher on a standardized assessment test than students who received lecture only. The findings support the use of student reflection to evaluate the effectiveness of active-learning methods and help validate the use of student reflection of improved learning in other research projects. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. NMR system and method having a permanent magnet providing a rotating magnetic field

    Science.gov (United States)

    Schlueter, Ross D [Berkeley, CA; Budinger, Thomas F [Berkeley, CA

    2009-05-19

    Disclosed herein are systems and methods for generating a rotating magnetic field. The rotating magnetic field can be used to obtain rotating-field NMR spectra, such as magic angle spinning spectra, without having to physically rotate the sample. This result allows magic angle spinning NMR to be conducted on biological samples such as live animals, including humans.

  13. The duty to provide information in the case of neuroradiological examination methods

    International Nuclear Information System (INIS)

    Deutsch, E.

    1987-01-01

    The author gives a survey on the judicial decisions concerning the obligation to give information in the case of neuroradiological examination methods. The scope and content of the medical explanation depends inter alia on the urgency and the necessity of the medical diagnosis and on the understanding of the patient. (WG) [de

  14. An improved dynamic test method for solar collectors

    DEFF Research Database (Denmark)

    Kong, Weiqiang; Wang, Zhifeng; Fan, Jianhua

    2012-01-01

    A comprehensive improvement of the mathematical model for the so called transfer function method is presented in this study. This improved transfer function method can estimate the traditional solar collector parameters such as zero loss coefficient and heat loss coefficient. Two new collector...... parameters t and mfCf are obtained. t is a time scale parameter which can indicate the heat transfer ability of the solar collector. mfCf can be used to calculate the fluid volume content in the solar collector or to validate the regression process by comparing it to the physical fluid volume content...... for the second-order differential term with 6–9min as the best averaging time interval. The measured and predicted collector power output of the solar collector are compared during a test of 13days continuously both for the ITF method and the QDT method. The maximum and averaging error is 53.87W/m2 and 5.22W/m2...

  15. An improved method for estimating the frequency correlation function

    KAUST Repository

    Chelli, Ali; Pä tzold, Matthias

    2012-01-01

    For time-invariant frequency-selective channels, the transfer function is a superposition of waves having different propagation delays and path gains. In order to estimate the frequency correlation function (FCF) of such channels, the frequency averaging technique can be utilized. The obtained FCF can be expressed as a sum of auto-terms (ATs) and cross-terms (CTs). The ATs are caused by the autocorrelation of individual path components. The CTs are due to the cross-correlation of different path components. These CTs have no physical meaning and leads to an estimation error. We propose a new estimation method aiming to improve the estimation accuracy of the FCF of a band-limited transfer function. The basic idea behind the proposed method is to introduce a kernel function aiming to reduce the CT effect, while preserving the ATs. In this way, we can improve the estimation of the FCF. The performance of the proposed method and the frequency averaging technique is analyzed using a synthetically generated transfer function. We show that the proposed method is more accurate than the frequency averaging technique. The accurate estimation of the FCF is crucial for the system design. In fact, we can determine the coherence bandwidth from the FCF. The exact knowledge of the coherence bandwidth is beneficial in both the design as well as optimization of frequency interleaving and pilot arrangement schemes. © 2012 IEEE.

  16. An improved method for estimating the frequency correlation function

    KAUST Repository

    Chelli, Ali

    2012-04-01

    For time-invariant frequency-selective channels, the transfer function is a superposition of waves having different propagation delays and path gains. In order to estimate the frequency correlation function (FCF) of such channels, the frequency averaging technique can be utilized. The obtained FCF can be expressed as a sum of auto-terms (ATs) and cross-terms (CTs). The ATs are caused by the autocorrelation of individual path components. The CTs are due to the cross-correlation of different path components. These CTs have no physical meaning and leads to an estimation error. We propose a new estimation method aiming to improve the estimation accuracy of the FCF of a band-limited transfer function. The basic idea behind the proposed method is to introduce a kernel function aiming to reduce the CT effect, while preserving the ATs. In this way, we can improve the estimation of the FCF. The performance of the proposed method and the frequency averaging technique is analyzed using a synthetically generated transfer function. We show that the proposed method is more accurate than the frequency averaging technique. The accurate estimation of the FCF is crucial for the system design. In fact, we can determine the coherence bandwidth from the FCF. The exact knowledge of the coherence bandwidth is beneficial in both the design as well as optimization of frequency interleaving and pilot arrangement schemes. © 2012 IEEE.

  17. [An improved low spectral distortion PCA fusion method].

    Science.gov (United States)

    Peng, Shi; Zhang, Ai-Wu; Li, Han-Lun; Hu, Shao-Xing; Meng, Xian-Gang; Sun, Wei-Dong

    2013-10-01

    Aiming at the spectral distortion produced in PCA fusion process, the present paper proposes an improved low spectral distortion PCA fusion method. This method uses NCUT (normalized cut) image segmentation algorithm to make a complex hyperspectral remote sensing image into multiple sub-images for increasing the separability of samples, which can weaken the spectral distortions of traditional PCA fusion; Pixels similarity weighting matrix and masks were produced by using graph theory and clustering theory. These masks are used to cut the hyperspectral image and high-resolution image into some sub-region objects. All corresponding sub-region objects between the hyperspectral image and high-resolution image are fused by using PCA method, and all sub-regional integration results are spliced together to produce a new image. In the experiment, Hyperion hyperspectral data and Rapid Eye data were used. And the experiment result shows that the proposed method has the same ability to enhance spatial resolution and greater ability to improve spectral fidelity performance.

  18. Vehicle Tracking System, Vehicle Infrastructure Provided with Vehicle Tracking System and Method for Tracking

    NARCIS (Netherlands)

    Papp, Z.; Doodeman, G.J.N.; Nelisse, M.W.; Sijs, J.; Theeuwes, J.A.C.; Driessen, B.J.F.

    2010-01-01

    A vehicle tracking system is described comprising - a plurality of sensor nodes (10) that each provide a message (D) indicative for an occupancy status of a detection area of an vehicle infrastructure monitored by said sensor node, said sensor nodes (10) being arranged in the vehicle infrastructure

  19. Compositions and methods for providing plants with tolerance to abiotic stress conditions

    KAUST Repository

    Hirt, Heribert

    2017-07-27

    It has been discovered that the desert endophytic bacterium SA187 SA187 can provide resistance or tolerance to abiotic stress conditions to seeds or plants. Compositions containing SA187 can be used to enhance plant development and yield under environmental stress conditions.

  20. The Healthcare Improvement Scotland evidence note rapid review process: providing timely, reliable evidence to inform imperative decisions on healthcare.

    Science.gov (United States)

    McIntosh, Heather M; Calvert, Julie; Macpherson, Karen J; Thompson, Lorna

    2016-06-01

    Rapid review has become widely adopted by health technology assessment agencies in response to demand for evidence-based information to support imperative decisions. Concern about the credibility of rapid reviews and the reliability of their findings has prompted a call for wider publication of their methods. In publishing this overview of the accredited rapid review process developed by Healthcare Improvement Scotland, we aim to raise awareness of our methods and advance the discourse on best practice. Healthcare Improvement Scotland produces rapid reviews called evidence notes using a process that has achieved external accreditation through the National Institute for Health and Care Excellence. Key components include a structured approach to topic selection, initial scoping, considered stakeholder involvement, streamlined systematic review, internal quality assurance, external peer review and updating. The process was introduced in 2010 and continues to be refined over time in response to user feedback and operational experience. Decision-makers value the responsiveness of the process and perceive it as being a credible source of unbiased evidence-based information supporting advice for NHSScotland. Many agencies undertaking rapid reviews are striving to balance efficiency with methodological rigour. We agree that there is a need for methodological guidance and that it should be informed by better understanding of current approaches and the consequences of different approaches to streamlining systematic review methods. Greater transparency in the reporting of rapid review methods is essential to enable that to happen.

  1. Development and implementation of an online program to improve how patients communicate emotional concerns to their oncology providers.

    Science.gov (United States)

    Porter, Laura S; Pollak, Kathryn I; Farrell, David; Cooper, Meredith; Arnold, Robert M; Jeffreys, Amy S; Tulsky, James A

    2015-10-01

    Patients often struggle to express their emotional concerns to their oncology providers and may therefore experience unmet needs. This paper describes the development and implementation of an online program that teaches patients how to communicate their emotions to their oncology providers. The intervention was developed by a multidisciplinary team consisting of palliative care physicians, psychologists, and an intervention software developer and included input from patients. It incorporated elements of Social Cognitive Theory and validated cognitive behavioral strategies for communication skills training. Strategies to increase intervention adherence were implemented midway through the study. The intervention consists of four interactive, online modules to teach patients strategies for expressing emotional concerns to their providers and asking for support. In addition to skill-building, the intervention was designed to raise patients' expectations that expressing emotional concerns to providers would be helpful, to enhance their self-efficacy for doing so, and to help them overcome barriers to having these conversations. After implementing strategies to improve adherence, usage rates increased from 47 to 64 %. This intervention addresses an unmet educational need for patients with advanced cancer. Strategies to increase adherence led to improvements in usage rates in this population of older patients. We are currently evaluating the intervention in a randomized clinical trial to determine its efficacy in increasing patient expression of emotional concerns and requests for support. If successful, this intervention could serve as a model for future online patient education programs.

  2. Combining gene prediction methods to improve metagenomic gene annotation

    Directory of Open Access Journals (Sweden)

    Rosen Gail L

    2011-01-01

    Full Text Available Abstract Background Traditional gene annotation methods rely on characteristics that may not be available in short reads generated from next generation technology, resulting in suboptimal performance for metagenomic (environmental samples. Therefore, in recent years, new programs have been developed that optimize performance on short reads. In this work, we benchmark three metagenomic gene prediction programs and combine their predictions to improve metagenomic read gene annotation. Results We not only analyze the programs' performance at different read-lengths like similar studies, but also separate different types of reads, including intra- and intergenic regions, for analysis. The main deficiencies are in the algorithms' ability to predict non-coding regions and gene edges, resulting in more false-positives and false-negatives than desired. In fact, the specificities of the algorithms are notably worse than the sensitivities. By combining the programs' predictions, we show significant improvement in specificity at minimal cost to sensitivity, resulting in 4% improvement in accuracy for 100 bp reads with ~1% improvement in accuracy for 200 bp reads and above. To correctly annotate the start and stop of the genes, we find that a consensus of all the predictors performs best for shorter read lengths while a unanimous agreement is better for longer read lengths, boosting annotation accuracy by 1-8%. We also demonstrate use of the classifier combinations on a real dataset. Conclusions To optimize the performance for both prediction and annotation accuracies, we conclude that the consensus of all methods (or a majority vote is the best for reads 400 bp and shorter, while using the intersection of GeneMark and Orphelia predictions is the best for reads 500 bp and longer. We demonstrate that most methods predict over 80% coding (including partially coding reads on a real human gut sample sequenced by Illumina technology.

  3. An improved method for chromosome counting in maize.

    Science.gov (United States)

    Kato, A

    1997-09-01

    An improved method for counting chromosomes in maize (Zea mays L.) is presented. Application of cold treatment (5C, 24 hr), heat treatment (42 C, 5 min) and a second cold treatment (5C, 24 hr) to root tips before fixation increased the number of condensed and dispersed countable metaphase chromosome figures. Fixed root tips were prepared by the enzymatic maceration-air drying method and preparations were stained with acetic orcein. Under favorable conditions, one preparation with 50-100 countable chromosome figures could be obtained in diploid maize using this method. Conditions affecting the dispersion of the chromosomes are described. This technique is especially useful for determining the somatic chromosome number in triploid and tetraploid maize lines.

  4. Improving sexual health communication between older women and their providers: how the integrative model of behavioral prediction can help.

    Science.gov (United States)

    Hughes, Anne K; Rostant, Ola S; Curran, Paul G

    2014-07-01

    Talking about sexual health can be a challenge for some older women. This project was initiated to identify key factors that improve communication between aging women and their primary care providers. A sample of women (aged 60+) completed an online survey regarding their intent to communicate with a provider about sexual health. Using the integrative model of behavioral prediction as a guide, the survey instrument captured data on attitudes, perceived norms, self-efficacy, and intent to communicate with a provider about sexual health. Data were analyzed using structural equation modeling. Self-efficacy and perceived norms were the most important factors predicting intent to communicate for this sample of women. Intent did not vary with race, but mean scores of the predictors of intent varied for African American and White women. Results can guide practice and intervention with ethnically diverse older women who may be struggling to communicate about their sexual health concerns. © The Author(s) 2013.

  5. A Novel Resource Management Method of Providing Operating System as a Service for Mobile Transparent Computing

    Directory of Open Access Journals (Sweden)

    Yonghua Xiong

    2014-01-01

    Full Text Available This paper presents a framework for mobile transparent computing. It extends the PC transparent computing to mobile terminals. Since resources contain different kinds of operating systems and user data that are stored in a remote server, how to manage the network resources is essential. In this paper, we apply the technologies of quick emulator (QEMU virtualization and mobile agent for mobile transparent computing (MTC to devise a method of managing shared resources and services management (SRSM. It has three layers: a user layer, a manage layer, and a resource layer. A mobile virtual terminal in the user layer and virtual resource management in the manage layer cooperate to maintain the SRSM function accurately according to the user’s requirements. An example of SRSM is used to validate this method. Experiment results show that the strategy is effective and stable.

  6. A novel resource management method of providing operating system as a service for mobile transparent computing.

    Science.gov (United States)

    Xiong, Yonghua; Huang, Suzhen; Wu, Min; Zhang, Yaoxue; She, Jinhua

    2014-01-01

    This paper presents a framework for mobile transparent computing. It extends the PC transparent computing to mobile terminals. Since resources contain different kinds of operating systems and user data that are stored in a remote server, how to manage the network resources is essential. In this paper, we apply the technologies of quick emulator (QEMU) virtualization and mobile agent for mobile transparent computing (MTC) to devise a method of managing shared resources and services management (SRSM). It has three layers: a user layer, a manage layer, and a resource layer. A mobile virtual terminal in the user layer and virtual resource management in the manage layer cooperate to maintain the SRSM function accurately according to the user's requirements. An example of SRSM is used to validate this method. Experiment results show that the strategy is effective and stable.

  7. METHODS OF PROVIDING NOISE IMMUNITY IN AUTOMOBILE ANTI-THEFT SYSTEM CONTROL

    Directory of Open Access Journals (Sweden)

    Frolov, V.

    2013-06-01

    Full Text Available In modern ani-theft systems they use frequency and phase modulation. Since the width of the signal is limited, it is possible to intercept the signal and then switch off the alarm at the right time.To ensure the noise immunity and secrecy manufacturers use more sophisticated codes using the methods of cryptography. Significant increase in noise immunity in modern ani-theft systems is possible using broadband signals.

  8. System and Method for Providing Web-Based Remote Application Service

    OpenAIRE

    Shuen-Tai Wang; Yu-Ching Lin; Hsi-Ya Chang

    2017-01-01

    With the development of virtualization technologies, a new type of service named cloud computing service is produced. Cloud users usually encounter the problem of how to use the virtualized platform easily over the web without requiring the plug-in or installation of special software. The object of this paper is to develop a system and a method enabling process interfacing within an automation scenario for accessing remote application by using the web browser. To meet this challenge, we have ...

  9. Cloud Service Provider Methods for Managing Insider Threats: Analysis Phase 2, Expanded Analysis and Recommendations

    Science.gov (United States)

    2014-01-01

    and software as a service ( SaaS )) for staff’s abnormal behavior that may indicate an insider incident. As mentioned above, combining SIEM data...Mellon Software Engineering Institute, contacted commercial and government cloud service providers (CSPs) to better understand the administrative and...availability services . We have observed a number of scenarios in which a customer leaves a CSP’s IaaS, PaaS, or SaaS , but its data remains online for some

  10. THE FLUORBOARD A STATISTICALLY BASED DASHBOARD METHOD FOR IMPROVING SAFETY

    International Nuclear Information System (INIS)

    PREVETTE, S.S.

    2005-01-01

    The FluorBoard is a statistically based dashboard method for improving safety. Fluor Hanford has achieved significant safety improvements--including more than a 80% reduction in OSHA cases per 200,000 hours, during its work at the US Department of Energy's Hanford Site in Washington state. The massive project on the former nuclear materials production site is considered one of the largest environmental cleanup projects in the world. Fluor Hanford's safety improvements were achieved by a committed partnering of workers, managers, and statistical methodology. Safety achievements at the site have been due to a systematic approach to safety. This includes excellent cooperation between the field workers, the safety professionals, and management through OSHA Voluntary Protection Program principles. Fluor corporate values are centered around safety, and safety excellence is important for every manager in every project. In addition, Fluor Hanford has utilized a rigorous approach to using its safety statistics, based upon Dr. Shewhart's control charts, and Dr. Deming's management and quality methods

  11. Improving maternal and neonatal departments in high and low resource settings: the opinion of local health providers.

    Science.gov (United States)

    Trevisanuto, Daniele; Bavuusuren, Bayasgalantai; Wickramasinghe, Chandani S; Dharmaratne, Saminda M; Doglioni, Nicoletta; Giordan, Alessia; Zanardo, Vincenzo; Carlo, Waldemar A

    2011-10-01

    We compared local health caregivers' opinions regarding the priority areas for improving the maternal and neonatal departments in low and high resource countries. Personnel involved in maternal and neonatal care operating in level III, teaching hospitals in four countries (Sri Lanka, Mongolia, USA, and Italy) were asked to fill out an anonymous, written questionnaire. The questionnaire was completed by 1112 out of 1265 (87.9%) participants. "Personnel's education" was classified as the first most important intervention by health providers working in high (49.0%) as well as in low (29.9%) resource countries, respectively. Improvement in salary, equipment, internet access, and organizational protocols were considered as the most important interventions by a significantly larger percentage of personnel from low resource countries in comparison with those from high resource countries. Health providers from high resource countries considered organizational aspects (to define specific roles and responsibilities) as a priority more frequently than their colleagues from low resource countries. Although education of personnel was valued as the highest priority for improving maternal and neonatal departments there are substantial differences in priorities associated with the working setting. Local caregivers' opinion may contribute to better design interventions in settings with high or limited resources.

  12. Real-Time Pore Pressure Detection: Indicators and Improved Methods

    Directory of Open Access Journals (Sweden)

    Jincai Zhang

    2017-01-01

    Full Text Available High uncertainties may exist in the predrill pore pressure prediction in new prospects and deepwater subsalt wells; therefore, real-time pore pressure detection is highly needed to reduce drilling risks. The methods for pore pressure detection (the resistivity, sonic, and corrected d-exponent methods are improved using the depth-dependent normal compaction equations to adapt to the requirements of the real-time monitoring. A new method is proposed to calculate pore pressure from the connection gas or elevated background gas, which can be used for real-time pore pressure detection. The pore pressure detection using the logging-while-drilling, measurement-while-drilling, and mud logging data is also implemented and evaluated. Abnormal pore pressure indicators from the well logs, mud logs, and wellbore instability events are identified and analyzed to interpret abnormal pore pressures for guiding real-time drilling decisions. The principles for identifying abnormal pressure indicators are proposed to improve real-time pore pressure monitoring.

  13. Evaluation of Two Statistical Methods Provides Insights into the Complex Patterns of Alternative Polyadenylation Site Switching

    Science.gov (United States)

    Li, Jie; Li, Rui; You, Leiming; Xu, Anlong; Fu, Yonggui; Huang, Shengfeng

    2015-01-01

    Switching between different alternative polyadenylation (APA) sites plays an important role in the fine tuning of gene expression. New technologies for the execution of 3’-end enriched RNA-seq allow genome-wide detection of the genes that exhibit significant APA site switching between different samples. Here, we show that the independence test gives better results than the linear trend test in detecting APA site-switching events. Further examination suggests that the discrepancy between these two statistical methods arises from complex APA site-switching events that cannot be represented by a simple change of average 3’-UTR length. In theory, the linear trend test is only effective in detecting these simple changes. We classify the switching events into four switching patterns: two simple patterns (3’-UTR shortening and lengthening) and two complex patterns. By comparing the results of the two statistical methods, we show that complex patterns account for 1/4 of all observed switching events that happen between normal and cancerous human breast cell lines. Because simple and complex switching patterns may convey different biological meanings, they merit separate study. We therefore propose to combine both the independence test and the linear trend test in practice. First, the independence test should be used to detect APA site switching; second, the linear trend test should be invoked to identify simple switching events; and third, those complex switching events that pass independence testing but fail linear trend testing can be identified. PMID:25875641

  14. Forecasting space weather: Can new econometric methods improve accuracy?

    Science.gov (United States)

    Reikard, Gordon

    2011-06-01

    Space weather forecasts are currently used in areas ranging from navigation and communication to electric power system operations. The relevant forecast horizons can range from as little as 24 h to several days. This paper analyzes the predictability of two major space weather measures using new time series methods, many of them derived from econometrics. The data sets are the A p geomagnetic index and the solar radio flux at 10.7 cm. The methods tested include nonlinear regressions, neural networks, frequency domain algorithms, GARCH models (which utilize the residual variance), state transition models, and models that combine elements of several techniques. While combined models are complex, they can be programmed using modern statistical software. The data frequency is daily, and forecasting experiments are run over horizons ranging from 1 to 7 days. Two major conclusions stand out. First, the frequency domain method forecasts the A p index more accurately than any time domain model, including both regressions and neural networks. This finding is very robust, and holds for all forecast horizons. Combining the frequency domain method with other techniques yields a further small improvement in accuracy. Second, the neural network forecasts the solar flux more accurately than any other method, although at short horizons (2 days or less) the regression and net yield similar results. The neural net does best when it includes measures of the long-term component in the data.

  15. Panorama parking assistant system with improved particle swarm optimization method

    Science.gov (United States)

    Cheng, Ruzhong; Zhao, Yong; Li, Zhichao; Jiang, Weigang; Wang, Xin'an; Xu, Yong

    2013-10-01

    A panorama parking assistant system (PPAS) for the automotive aftermarket together with a practical improved particle swarm optimization method (IPSO) are proposed in this paper. In the PPAS system, four fisheye cameras are installed in the vehicle with different views, and four channels of video frames captured by the cameras are processed as a 360-deg top-view image around the vehicle. Besides the embedded design of PPAS, the key problem for image distortion correction and mosaicking is the efficiency of parameter optimization in the process of camera calibration. In order to address this problem, an IPSO method is proposed. Compared with other parameter optimization methods, the proposed method allows a certain range of dynamic change for the intrinsic and extrinsic parameters, and can exploit only one reference image to complete all of the optimization; therefore, the efficiency of the whole camera calibration is increased. The PPAS is commercially available, and the IPSO method is a highly practical way to increase the efficiency of the installation and the calibration of PPAS in automobile 4S shops.

  16. Improved perovskite phototransistor prepared using multi-step annealing method

    Science.gov (United States)

    Cao, Mingxuan; Zhang, Yating; Yu, Yu; Yao, Jianquan

    2018-02-01

    Organic-inorganic hybrid perovskites with good intrinsic physical properties have received substantial interest for solar cell and optoelectronic applications. However, perovskite film always suffers from a low carrier mobility due to its structural imperfection including sharp grain boundaries and pinholes, restricting their device performance and application potential. Here we demonstrate a straightforward strategy based on multi-step annealing process to improve the performance of perovskite photodetector. Annealing temperature and duration greatly affects the surface morphology and optoelectrical properties of perovskites which determines the device property of phototransistor. The perovskite films treated with multi-step annealing method tend to form highly uniform, well-crystallized and high surface coverage perovskite film, which exhibit stronger ultraviolet-visible absorption and photoluminescence spectrum compare to the perovskites prepared by conventional one-step annealing process. The field-effect mobilities of perovskite photodetector treated by one-step direct annealing method shows mobility as 0.121 (0.062) cm2V-1s-1 for holes (electrons), which increases to 1.01 (0.54) cm2V-1s-1 for that treated with muti-step slow annealing method. Moreover, the perovskite phototransistors exhibit a fast photoresponse speed of 78 μs. In general, this work focuses on the influence of annealing methods on perovskite phototransistor, instead of obtains best parameters of it. These findings prove that Multi-step annealing methods is feasible to prepared high performance based photodetector.

  17. Variable effectiveness of stepwise implementation of nudge-type interventions to improve provider compliance with intraoperative low tidal volume ventilation.

    Science.gov (United States)

    O'Reilly-Shah, Vikas N; Easton, George S; Jabaley, Craig S; Lynde, Grant C

    2018-05-18

    Identifying mechanisms to improve provider compliance with quality metrics is a common goal across medical disciplines. Nudge interventions are minimally invasive strategies that can influence behavioural changes and are increasingly used within healthcare settings. We hypothesised that nudge interventions may improve provider compliance with lung-protective ventilation (LPV) strategies during general anaesthesia. We developed an audit and feedback dashboard that included information on both provider-level and department-level compliance with LPV strategies in two academic hospitals, two non-academic hospitals and two academic surgery centres affiliated with a single healthcare system. Dashboards were emailed to providers four times over the course of the 9-month study. Additionally, the default setting on anaesthesia machines for tidal volume was decreased from 700 mL to 400 mL. Data on surgical cases performed between 1 September 2016 and 31 May 2017 were examined for compliance with LPV. The impact of the interventions was assessed via pairwise logistic regression analysis corrected for multiple comparisons. A total of 14 793 anaesthesia records were analysed. Absolute compliance rates increased from 59.3% to 87.8%preintervention to postintervention. Introduction of attending physician dashboards resulted in a 41% increase in the odds of compliance (OR 1.41, 95% CI 1.17 to 1.69, p=0.002). Subsequently, the addition of advanced practice provider and resident dashboards lead to an additional 93% increase in the odds of compliance (OR 1.93, 95% CI 1.52 to 2.46, p<0.001). Lastly, modifying ventilator defaults led to a 376% increase in the odds of compliance (OR 3.76, 95% CI 3.1 to 4.57, p<0.001). Audit and feedback tools in conjunction with default changes improve provider compliance. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise

  18. Standard epidemiological methods to understand and improve Apis mellifera health

    OpenAIRE

    Lengerich, Eugene; Spleen, Angela; Dainat, Benjamin; Cresswell, James; Baylis , Kathy; Nguyen, Bach Kim; Soroker, Victoria; Underwood, Robyn; Human, Hannelie; Le Conte, Yves; Saegerman, Claude

    2013-01-01

    In this paper, we describe the use of epidemiological methods to understand and reduce honey bee morbidity and mortality. Essential terms are presented and defined and we also give examples for their use. Defining such terms as disease, population, sensitivity, and specificity, provides a framework for epidemiological comparisons. The term population, in particular, is quite complex for an organism like the honey bee because one can view “epidemiological unit” as individual bees, colonies, ap...

  19. Neural interface methods and apparatus to provide artificial sensory capabilities to a subject

    Energy Technology Data Exchange (ETDEWEB)

    Buerger, Stephen P.; Olsson, III, Roy H.; Wojciechowski, Kenneth E.; Novick, David K.; Kholwadwala, Deepesh K.

    2017-01-24

    Embodiments of neural interfaces according to the present invention comprise sensor modules for sensing environmental attributes beyond the natural sensory capability of a subject, and communicating the attributes wirelessly to an external (ex-vivo) portable module attached to the subject. The ex-vivo module encodes and communicates the attributes via a transcutaneous inductively coupled link to an internal (in-vivo) module implanted within the subject. The in-vivo module converts the attribute information into electrical neural stimuli that are delivered to a peripheral nerve bundle within the subject, via an implanted electrode. Methods and apparatus according to the invention incorporate implantable batteries to power the in-vivo module allowing for transcutaneous bidirectional communication of low voltage (e.g. on the order of 5 volts) encoded signals as stimuli commands and neural responses, in a robust, low-error rate, communication channel with minimal effects to the subjects' skin.

  20. Method for providing uranium articles with a corrosion resistant anodized coating

    International Nuclear Information System (INIS)

    Waldrop, F.B.; Washington, C.A.

    1982-01-01

    Uranium articles are provided with anodized oxide coatings in an aqueous solution of an electrolyte selected from the group consisting of potassium phosphate, potassium hydroxide, ammonium hydroxide, and a mixture of potassium tetraborate and boric acid. The uranium articles are anodized at a temperature greater than about 75 degrees C. With a current flow of less than about 0.036 A/cm2 of surface area while the Ph of the solution is maintained in a range of about 2 to 11.5. The Ph values of the aqueous solution and the low current density utilized during the electrolysis prevent excessive dissolution of the uranium and porosity in the film or watering. The relatively high temperature of the electrolyte bath inhibits hydration and the attendant deleterious pitting so as to enhance corrosion resistance of the anodized coating

  1. A Statistical Method for Aggregated Wind Power Plants to Provide Secondary Frequency Control

    DEFF Research Database (Denmark)

    Hu, Junjie; Ziras, Charalampos; Bindner, Henrik W.

    2017-01-01

    curtailment for aggregated wind power plants providing secondary frequency control (SFC) to the power system. By using historical SFC signals and wind speed data, we calculate metrics for the reserve provision error as a function of the scheduled wind power. We show that wind curtailment can be significantly......The increasing penetration of wind power brings significant challenges to power system operators due to the wind’s inherent uncertainty and variability. Traditionally, power plants and more recently demand response have been used to balance the power system. However, the use of wind power...... as a balancing-power source has also been investigated, especially for wind power dominated power systems such as Denmark. The main drawback is that wind power must be curtailed by setting a lower operating point, in order to offer upward regulation. We propose a statistical approach to reduce wind power...

  2. Modern methods to improve the accuracy in fast neutron dosimetry

    International Nuclear Information System (INIS)

    Baers, B.; Karnani, H.; Seren, T.

    1985-01-01

    In order to improve the quality of fast neutron dose estimates at the reactor pressure vessel (PV) some modern methods are presented. In addition to basic principles, some error reduction procedures are also presented based on the combined use of relative measurements, direct sample taking from the pressure vessel and the use of iron and niobium as dosimeters. The influence of large systematic errors could be significantly reduced by carrying out relative measurements. This report also presents the successful use of niobium as a dosimeter by destructive treatment of PV samples. (author)

  3. Dynamic Response of Inextensible Beams by Improved Energy Balance Method

    DEFF Research Database (Denmark)

    Sfahani, M. G.; Barari, Amin; Omidvar, M.

    2011-01-01

    An improved He's energy balance method (EBM) for solving non-linear oscillatory differential equation using a new trial function is presented. The problem considered represents the governing equations of the non-linear, large-amplitude free vibrations of a slender cantilever beam...... with a rotationally flexible root and carrying a lumped mass at an intermediate position along its span. Based on the simple EBM, the variational integral of the non-linear conservative system is established, and the Fourier series expansion is employed to address the governing algebraic equations. An alternate...

  4. Improving Battery Reactor Core Design Using Optimization Method

    International Nuclear Information System (INIS)

    Son, Hyung M.; Suh, Kune Y.

    2011-01-01

    The Battery Omnibus Reactor Integral System (BORIS) is a small modular fast reactor being designed at Seoul National University to satisfy various energy demands, to maintain inherent safety by liquid-metal coolant lead for natural circulation heat transport, and to improve power conversion efficiency with the Modular Optimal Balance Integral System (MOBIS) using the supercritical carbon dioxide as working fluid. This study is focused on developing the Neutronics Optimized Reactor Analysis (NORA) method that can quickly generate conceptual design of a battery reactor core by means of first principle calculations, which is part of the optimization process for reactor assembly design of BORIS

  5. STIMULATION METHODS IMPROVEMENT OF EXIT ROUTE ON RAILWAY TRANSPORT

    Directory of Open Access Journals (Sweden)

    A. I. Verlan

    2014-01-01

    Full Text Available Purpose. The purpose of the article is to assess the costs, which are redistributed in the system «shipper−railroad−consignee» during routing of rail transportation and the development of tariff simulation methods of shippers to the exit routes formation. Methodology. Using economic and mathematical analysis the distribution of costs among the various participants of transportation process during the exit routes formation is investigated in the article. Findings. For implementation of the tariff simulation methods of exit routes and retention of the existing tariff structure it is proposed to provide in the «Tariff catalogue for freight transportation by railway transport of Ukraine» the discount, differentiated from haulage distance. A new method for determining the fees amount for cars supply and removal on approach tracks by train locomotives was also offered. Originality. As a result of the research a new method for determination of the exit rout efficiency that, unlike the existing one, takes into account the various interests of the individual participants in the transportation process was proposed. The dependence of the correction factors to the tariff for freight transportation in their own cars by direct exit routes from distance haulage was obtained. Implementation of these coefficients provides an approximation of railway tariffs to the traffic handling costs. A method for determination the rate of fees for cars supply and removal on approach tracks by train locomotives was offered. Practical value. InUkraine creation of the tariff discounts system for freight transportation by exit routes consistent with international practice and allows bringing the tariff to the real traffic handling cost. This change on the one hand will provide stimulation for private capital investments in infrastructure development and shunting means of approach tracks, on the other – it will fix the shippers to the railroads and stop their outflow

  6. Structural Aging Program approach to providing an improved basis for aging management of safety-related concrete structures

    International Nuclear Information System (INIS)

    Naus, D.J.; Oland, C.B.; Ellingwood, B.

    1993-01-01

    The Structural Aging (SAG) Program is being conducted at the Oak Ridge National Laboratory (ORNL) for the United States Nuclear Regulatory Commission (USNRC). The SAG Program is addressing the aging management of safety-related concrete structures in nuclear power plants for the purpose of providing improved technical bases for their continued service. The program is organized into four tasks: Program Management, Materials Property Data Base, Structural Component Assessment/Repair Technologies, and Quantitative Methodology for Continued Service Determinations. Objectives and a summary of recent accomplishments under each of these tasks are presented

  7. Public-private partnerships to improve primary healthcare surgeries: clarifying assumptions about the role of private provider activities.

    Science.gov (United States)

    Mudyarabikwa, Oliver; Tobi, Patrick; Regmi, Krishna

    2017-07-01

    Aim To examine assumptions about public-private partnership (PPP) activities and their role in improving public procurement of primary healthcare surgeries. PPPs were developed to improve the quality of care and patient satisfaction. However, evidence of their effectiveness in delivering health benefits is limited. A qualitative study design was employed. A total of 25 interviews with public sector staff (n=23) and private sector managers (n=2) were conducted to understand their interpretations of assumptions in the activities of private investors and service contractors participating in Local Improvement Finance Trust (LIFT) partnerships. Realist evaluation principles were applied in the data analysis to interpret the findings. Six thematic areas of assumed health benefits were identified: (i) quality improvement; (ii) improved risk management; (iii) reduced procurement costs; (iv) increased efficiency; (v) community involvement; and (vi) sustainable investment. Primary Care Trusts that chose to procure their surgeries through LIFT were expected to support its implementation by providing an environment conducive for the private participants to achieve these benefits. Private participant activities were found to be based on a range of explicit and tacit assumptions perceived helpful in achieving government objectives for LIFT. The success of PPPs depended upon private participants' (i) capacity to assess how PPP assumptions added value to their activities, (ii) effectiveness in interpreting assumptions in their expected activities, and (iii) preparedness to align their business principles to government objectives for PPPs. They risked missing some of the expected benefits because of some factors constraining realization of the assumptions. The ways in which private participants preferred to carry out their activities also influenced the extent to which expected benefits were achieved. Giving more discretion to public than private participants over critical

  8. Improved Fuzzy Art Method for Initializing K-means

    Directory of Open Access Journals (Sweden)

    Sevinc Ilhan

    2010-09-01

    Full Text Available The K-means algorithm is quite sensitive to the cluster centers selected initially and can perform different clusterings depending on these initialization conditions. Within the scope of this study, a new method based on the Fuzzy ART algorithm which is called Improved Fuzzy ART (IFART is used in the determination of initial cluster centers. By using IFART, better quality clusters are achieved than Fuzzy ART do and also IFART is as good as Fuzzy ART about capable of fast clustering and capability on large scaled data clustering. Consequently, it is observed that, with the proposed method, the clustering operation is completed in fewer steps, that it is performed in a more stable manner by fixing the initialization points and that it is completed with a smaller error margin compared with the conventional K-means.

  9. An improved method for the assay of platelet pyruvate dehydrogenase

    International Nuclear Information System (INIS)

    Schofield, P.J.; Griffiths, L.R.; Rogers, S.H.

    1980-01-01

    An improved method for the assay of human platelet pyruvate dehydrogenase is described. By generating the substrate [1- 14 C]pyruvate in situ from [1- 14 C]lactate plus L-lactate dehydrogenase, the rate of spontaneous decarboxylation is dramatically reduced, allowing far greater sensitivity in the assay of low activities of pyruvate dehydrogenase. In addition, no special precautions are required for the storage and use of [1- 14 C]lactate, in contrast to those for [1- 14 C]pyruvate. These factors allow a 5-10-fold increase in sensitivity compared with current methods. The pyruvate dehydrogenase activity of normal subjects as determined by the [1- 14 C]lactate system was 215+-55 pmol min -1 mg -1 protein (n=18). The advantages of this assay system are discussed. (Auth.)

  10. An improved brine shrimp larvae lethality microwell test method.

    Science.gov (United States)

    Zhang, Yi; Mu, Jun; Han, Jinyuan; Gu, Xiaojie

    2012-01-01

    This article described an improved brine shrimp larvae lethality microwell test method. A simply designed connecting vessel with alternative photoperiod was used to culture and collect high yield of active Artemia parthenogenetica nauplii for brine shrimp larvae lethality microwell test. Using this method, pure A. parthenogenetica nauplii suspension was easily cultured and harvested with high density about 100-150 larvae per milliliter and the natural mortality was reduced to near zero by elimination of unnecessary artificial disturbance. And its sensitivity was validated by determination of LC(50)-24 h of different reference toxicants including five antitumor agents, two pesticides, three organic pollutants, and four heavy metals salts, most of which exhibited LC(50)-24 h between 0.07 and 58.43 mg/L except for bleomycin and mitomycin C with LC(50)-24 h over 300 mg/L.

  11. Analysis of methods of providing anonymity in facial photographs; a randomised controlled study.

    LENUS (Irish Health Repository)

    Clover, A J P

    2010-09-01

    Clinical images are invaluable in medical teaching and research publications. In the past efforts to conceal patient identity, if any, were limited to a black bar concealing the eyes. However, there is no consensus on this among major journals and publishing houses. This research analyses the effectiveness of blacking out the eyes in facial photographs and evaluates alternative techniques. 126 questionnaires were completed. The average numbers of correct responses out of 30 was 24.64 (82.13%) in the control group, 20.59 (68.63%) in the eyes, 20.42 (68.07%) in the eyes and nose group, and 17.53 (58.43%) in the T-shaped group (eyes, nose and mouth). The traditional method of covering the eyes does significantly decrease recognition, however it is only as effective as covering the nose and mouth. The more of the face that is covered the less likely it is that the person is recognised. However, there are people who remain identifiable no matter how much of the face is covered. This work highlights the importance of obtaining consent prior to publication as well as attempting to hide identity.

  12. IMPROVEMENT METHOD OF GENE TRANSFER IN Kappaphycus alvarezii

    Directory of Open Access Journals (Sweden)

    St. Hidayah Triana

    2016-11-01

    Full Text Available Method of foreign gene transfer in red seaweed Kappaphycus alvarezii has been reported, however, li-mited number of transgenic F0 (broodstock was obtained. This study was conducted to improve the method of gene transfer mediated by Agrobacterium tumefaciens in order to obtain high percentage of K. alvarezii transgenic. Superoxide dismutase gene from Melastoma malabatrichum (MmCu/Zn-SOD was used as model towards increasing adaptability of K. alvarezii to environmental stress. The treat-ments were the culture media and recovery duration, and each treatment consisted of three replica-tions. The best method was co-cultivation using liquid media, then recovery was conducted in liquid media for 10 days. That treatment allowed higher transformation percentage (90%, regeneration effi-ciency (90%, putative bud efficiency (100%, number of buds and explants sprouted (100% and transgenic explants (100%. The transgenic explants showed an amplification PCR product of Mm-Cu/Zn-SOD gene fragment, whereas the non-transgenic explants showed no amplification product.  All results revealed that suitable method of transgenesis for K. alvarezii has been developed. Keywords:       Agrobacterium tumefaciens, culture media, Kappaphycus alvarezii, recovery duration, transformation

  13. Behavioral interventions for improving dual-method contraceptive use.

    Science.gov (United States)

    Lopez, Laureen M; Stockton, Laurie L; Chen, Mario; Steiner, Markus J; Gallo, Maria F

    2014-03-30

    Dual-method contraception refers to using condoms as well as another modern method of contraception. The latter (usually non-barrier) method is commonly hormonal (e.g., oral contraceptives) or a non-hormonal intrauterine device. Use of two methods can better prevent pregnancy and the transmission of HIV and other sexually transmitted infections (STIs) compared to single-method use. Unprotected sex increases risk for disease, disability, and mortality in many areas due to the prevalence and incidence of HIV/STI. Millions of women, especially in lower-resource areas, also have an unmet need for protection against unintended pregnancy. We examined comparative studies of behavioral interventions for improving use of dual methods of contraception. Dual-method use refers to using condoms as well as another modern contraceptive method. Our intent was to identify effective interventions for preventing pregnancy as well as HIV/STI transmission. Through January 2014, we searched MEDLINE, CENTRAL, POPLINE, EMBASE, COPAC, and Open Grey. In addition, we searched ClinicalTrials.gov and ICTRP for current trials and trials with relevant data or reports. We examined reference lists of pertinent papers, including review articles, for additional reports. Studies could be either randomized or non-randomized. They examined a behavioral intervention with an educational or counseling component to encourage or improve the use of dual methods, i.e., condoms and another modern contraceptive. The intervention had to address preventing pregnancy as well as the transmission of HIV/STI. The program or service could be targeted to individuals, couples, or communities. The comparison condition could be another behavioral intervention to improve contraceptive use, usual care, other health education, or no intervention.Studies had to report use of dual methods, i.e., condoms plus another modern contraceptive method. We focused on the investigator's assessment of consistent dual-method use or use at

  14. Gamma Knife radiosurgery of olfactory groove meningiomas provides a method to preserve subjective olfactory function.

    Science.gov (United States)

    Gande, Abhiram; Kano, Hideyuki; Bowden, Gregory; Mousavi, Seyed H; Niranjan, Ajay; Flickinger, John C; Lunsford, L Dade

    2014-02-01

    Anosmia is a common outcome after resection of olfactory groove meningioma(s) (OGM) and for some patients represents a significant disability. To evaluate long term tumor control rates and preservation of subjective olfaction after Gamma Knife (GK) stereotactic radiosurgery (SRS) of OGM. We performed a retrospective chart review and telephone assessments of 41 patients who underwent GK SRS between 1987 and 2008. Clinical outcomes were stratified by full, partial or no subjective olfaction, whereas tumor control was assessed by changes in volume greater or lesser than 25%. The median clinical and imaging follow-up were 76 and 65 months, respectively. Prior to SRS, 19 (46%) patients had surgical resections and two (5%) had received fractionated radiation therapy. Twenty four patients (59%) reported a normal sense of smell, 12 (29%) reported a reduced sense of smell and five (12%) had complete anosmia. The median tumor volume was 8.5 cm(3) (range 0.6-56.1), the mean radiation dose at the tumor margin was 13 Gy (range 10-20) and the median estimated dose to the olfactory nerve was 5.1 Gy (range 1.1-18.1). At follow-up, 27 patients (66%) reported intact olfaction (three (7%) described return to a normal sense of smell), nine (22%) described partial anosmia, and five (12%) had complete anosmia. No patient reported deterioration in olfaction after SRS. Thirteen patients (32%) showed significant tumor regression, 26 (63%) had no further growth and two (5%) had progressed. The progression free tumor control rates were 97% at 1 year and 95% at 2, 10 and 20 years. Symptomatic adverse radiation effects occurred in three (7%) patients. Stereotactic radiosurgery provided both long term tumor control and preservation of olfaction.

  15. Consumer Health Informatics: The Application of ICT in Improving Patient-Provider Partnership for a Better Health Care.

    Science.gov (United States)

    Abaidoo, Benjamin; Larweh, Benjamin Teye

    2014-01-01

    There is a growing interest concerning the potential of ICT solutions that are customized to consumers. This emerging discipline referred to as consumer health informatics (CHI) plays a major role in providing information to patients and the public, and facilitates the promotion of self-management. The concept of CHI has emerged out of the desire of most patients to shoulder responsibilities regarding their health and a growing desire of health practitioners to fully appreciate the potential of the patient. To describe the role of ICT in improving the patient-provider partnership in consumer health informatics. Systematic reviewing of literature, identification of reference sources and formulation of search strategies and manual search regarding the significance of developed CHI applications in healthcare delivery. New consumer health IT applications have been developed to be used on a variety of different platforms, including the Web, messaging systems, PDAs, and cell phones. These applications assists patients with self-management through reminders and prompts, delivery of real-time data on a patient's health condition to patients and providers, web-based communication and personal electronic health information. New tools are being developed for the purposes of providing information to patients and the public which has enhanced decision making in health matters and an avenue for clinicians and consumers to exchange health information for personal and public use. This calls for corroboration among healthcare organizations, governments and the ICT industry to develop new research and IT innovations which are tailored to the health needs of the consumer.

  16. Location Privacy Protection Based on Improved K-Value Method in Augmented Reality on Mobile Devices

    Directory of Open Access Journals (Sweden)

    Chunyong Yin

    2017-01-01

    Full Text Available With the development of Augmented Reality technology, the application of location based service (LBS is more and more popular, which provides enormous convenience to people’s life. User location information could be obtained at anytime and anywhere. So user location privacy security suffers huge threats. Therefore, it is crucial to pay attention to location privacy protection in LBS. Based on the architecture of the trusted third party (TTP, we analyzed the advantages and shortages of existing location privacy protection methods in LBS on mobile terminal. Then we proposed the improved K-value location privacy protection method according to privacy level, which combines k-anonymity method with pseudonym method. Through the simulation experiment, the results show that this improved method can anonymize all service requests effectively. In addition to the experiment of execution time, it demonstrated that our proposed method can realize the location privacy protection more efficiently.

  17. Evaluating clean energy alternatives for Jiangsu, China: An improved multi-criteria decision making method

    International Nuclear Information System (INIS)

    Zhang, Ling; Zhou, Peng; Newton, Sidney; Fang, Jian-xin; Zhou, De-qun; Zhang, Lu-ping

    2015-01-01

    Promoting the utilization of clean energy has been identified as one potential solution to addressing environmental pollution and achieving sustainable development in many countries around the world. Evaluating clean energy alternatives includes a requirement to balance multiple conflict criteria, including technology, environment, economy and society, all of which are incommensurate and interdependent. Traditional MCDM (multi-criteria decision making) methods, such as the weighted average method, often fail to aggregate such criteria consistently. In this paper, an improved MCDM method based on fuzzy measure and integral is developed and applied to evaluate four primary clean energy options for Jiangsu Province, China. The results confirm that the preferred clean energy option for Jiangsu is solar photovoltaic, followed by wind, biomass and finally nuclear. A sensitivity analysis is also conducted to evaluate the values of clean energy resources for Jiangsu. The ordered weighted average method is also applied to compare the method mentioned above in our empirical study. The results show that the improved MCDM method provides higher discrimination between alternative clean energy alternatives. - Highlights: • Interactions among evaluation criteria of clean energy resources are taken into account. • An improved multi-criteria decision making (MCDM) method is proposed based on entropy weight method, fuzzy measure and integral. • Clean energy resources of Jiangsu are evaluated with the improved MCDM method, and their ranks are identified.

  18. Method Improving Reading Comprehension In Primary Education Program Students

    Science.gov (United States)

    Rohana

    2018-01-01

    This study aims to determine the influence of reading comprehension skills of English for PGSD students through the application of SQ3R learning method. The type of this research is Pre-Experimental research because it is not yet a real experiment, there are external variables that influence the formation of a dependent variable, this is because there is no control variable and the sample is not chosen randomly. The research design is used is one-group pretest-post-test design involving one group that is an experimental group. In this design, the observation is done twice before and after the experiment. Observations made before the experiment (O1) are called pretests and the post-experimental observation (O2) is called posttest. The difference between O1 and O2 ie O2 - O1 is the effect of the treatment. The results showed that there was an improvement in reading comprehension skills of PGSD students in Class M.4.3 using SQ3R method, and better SQ3R enabling SQ3R to improve English comprehension skills.

  19. [Analysis of thickening polysaccharides by the improved diethyldithioacetal derivatization method].

    Science.gov (United States)

    Akiyama, Takumi; Yamazaki, Takeshi; Tanamoto, Kenichi

    2011-01-01

    The identification test for thickening polysaccharides containing neutral saccharides and uronic acids was investigated by GC analysis of constituent monosaccharides. The reported method, in which monosaccharides were converted to diethyldithioacetal derivatives with ethanethiol followed by trimethylsilylation, was improved in terms of operability and reproducibility of GC/MS analysis. The suitability of the improved diethyldithioacetal derivatization method was determined for seven thickening polysaccharides, i.e., carob bean gum, guar gum, karaya gum, gum arabic, gum ghatti, tragacanth gum and peach gum. The samples were acid-hydrolyzed to form monosaccharides. The hydrolysates were derivatized and analyzed with GC/FID. Each sugar derivative was detected as a single peak and was well separated from others on the chromatograms. The amounts of constituent monosaccharides in thickening polysaccharides were successfully estimated. Seven polysaccharides were distinguished from each other on the basis of constituent monosaccharides. Further examination of the time period of hydrolysis of polysaccharides using peach gum showed that the optimal times were not the same for all monosaccharides. A longer time was needed to hydrolyze glucuronic acid than neutral saccharides. The findings suggest that hydrolysis time may sometimes affect the analytical results on composition of constituent monosaccharides in polysaccharides.

  20. Caring for LGBTQ patients: Methods for improving physician cultural competence.

    Science.gov (United States)

    Klein, Elizabeth W; Nakhai, Maliheh

    2016-05-01

    This article summarizes the components of a curriculum used to teach family medicine residents and faculty about LGBTQ patients' needs in a family medicine residency program in the Pacific Northwest region of the United States. This curriculum was developed to provide primary care physicians and physicians-in-training with skills to provide better health care for LGBTQ-identified patients. The curriculum covers topics that range from implicit and explicit bias and appropriate terminology to techniques for crafting patient-centered treatment plans. Additionally, focus is placed on improving the understanding of specific and unique barriers to competent health care encountered by LGBTQ patients. Through facilitated discussion, learners explore the health disparities that disproportionately affect LGBTQ individuals and develop skills that will improve their ability to care for LGBTQ patients. The goal of the curriculum is to teach family medicine faculty and physicians in training how to more effectively communicate with and treat LGBTQ patients in a safe, non-judgmental, and welcoming primary care environment. © The Author(s) 2016.

  1. Development and Operation of the nuclear technology program for improving the public acceptance by providing the right information

    International Nuclear Information System (INIS)

    Lee, Juwoon; Kang, Mincheol; Min, Sangky; Yi, Jongmin; Yi, Yunyoung

    2013-11-01

    This detailed assignment conducted to improve the communication efficiency through the operation of differentiated programs to accomplish 'Establishment of knowledge diffusion system for improvement of Nuclear understanding', which is the purpose of the general assignment. We developed the programs on each social opinion leader groups by providing the right information on nuclear(radiation) technology, and had a forum for providing the right information on each social groups. Also, Consisted the consultant group, which participates humanities and social sciences, civic group, science teachers, the press, national assembly workers. Technology PR was performed 4 times, which is 1 time more than the original plan of 4 times. In the theme of affection of radiation, we broadened the vision of various fields which enabled to approach in general for the PR program. We Induced a positive reaction from the participants in political areas which coexistent of uncertain expectation and difficult vision of nuclear and radiation, by sharing the development possibility in relation with potential values of radiation industry and other industries and delivering accurate information, not a fragmentary knowledge, but in general. We hope that this results will contribute to establishing the effective nuclear knowledge diffusion program system

  2. Development and Operation of the nuclear technology program for improving the public acceptance by providing the right information

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Juwoon; Kang, Mincheol; Min, Sangky; Yi, Jongmin; Yi, Yunyoung

    2013-11-15

    This detailed assignment conducted to improve the communication efficiency through the operation of differentiated programs to accomplish 'Establishment of knowledge diffusion system for improvement of Nuclear understanding', which is the purpose of the general assignment. We developed the programs on each social opinion leader groups by providing the right information on nuclear(radiation) technology, and had a forum for providing the right information on each social groups. Also, Consisted the consultant group, which participates humanities and social sciences, civic group, science teachers, the press, national assembly workers. Technology PR was performed 4 times, which is 1 time more than the original plan of 4 times. In the theme of affection of radiation, we broadened the vision of various fields which enabled to approach in general for the PR program. We Induced a positive reaction from the participants in political areas which coexistent of uncertain expectation and difficult vision of nuclear and radiation, by sharing the development possibility in relation with potential values of radiation industry and other industries and delivering accurate information, not a fragmentary knowledge, but in general. We hope that this results will contribute to establishing the effective nuclear knowledge diffusion program system.

  3. Improvement of AEP Predictions Using Diurnal CFD Modelling with Site-Specific Stability Weightings Provided from Mesoscale Simulation

    International Nuclear Information System (INIS)

    Hristov, Y; Oxley, G; Žagar, M

    2014-01-01

    The Bolund measurement campaign, performed by Danish Technical University (DTU) Wind Energy Department (also known as RISØ), provided significant insight into wind flow modeling over complex terrain. In the blind comparison study several modelling solutions were submitted with the vast majority being steady-state Computational Fluid Dynamics (CFD) approaches with two equation k-ε turbulence closure. This approach yielded the most accurate results, and was identified as the state-of-the-art tool for wind turbine generator (WTG) micro-siting. Based on the findings from Bolund, further comparison between CFD and field measurement data has been deemed essential in order to improve simulation accuracy for turbine load and long-term Annual Energy Production (AEP) estimations. Vestas Wind Systems A/S is a major WTG original equipment manufacturer (OEM) with an installed base of over 60GW in over 70 countries accounting for 19% of the global installed base. The Vestas Performance and Diagnostic Centre (VPDC) provides online live data to more than 47GW of these turbines allowing a comprehensive comparison between modelled and real-world energy production data. In previous studies, multiple sites have been simulated with a steady neutral CFD formulation for the atmospheric surface layer (ASL), and wind resource (RSF) files have been generated as a base for long-term AEP predictions showing significant improvement over predictions performed with the industry standard linear WAsP tool. In this study, further improvements to the wind resource file generation with CFD are examined using an unsteady diurnal cycle approach with a full atmospheric boundary layer (ABL) formulation, with the unique stratifications throughout the cycle weighted according to mesoscale simulated sectorwise stability frequencies

  4. Formal quality improvement curriculum and DMAIC method results in interdisciplinary collaboration and process improvement in renal transplant patients.

    Science.gov (United States)

    Leaphart, Cynthia L; Gonwa, Thomas A; Mai, Martin L; Prendergast, Mary B; Wadei, Hani M; Tepas, Joseph J; Taner, C Burcin

    2012-09-01

    Broad-based formal quality improvement curriculum emphasizing Six Sigma and the DMAIC approach developed by our institution is required for physicians in training. DMAIC methods evaluated the common outcome of postoperative hyponatremia, thus resulting in collaboration to prevent hyponatremia in the renal transplant population. To define postoperative hyponatremia in renal transplant recipients, a project charter outlined project aims. To measure postoperative hyponatremia, serum sodium at admission and immediately postoperative were recorded by retrospective review of renal transplant recipient charts from June 29, 2010 to December 31, 2011. An Ishikawa diagram was generated to analyze potential causative factors. Interdisciplinary collaboration and hospital policy assessment determined necessary improvements to prevent hyponatremia. Continuous monitoring in control phase was performed by establishing the goal of DMAIC approach and formal quality curriculum for trainees addresses core competencies by providing a framework for problem solving, interdisciplinary collaboration, and process improvement. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Improved methods of creep-fatigue life assessment of components

    Energy Technology Data Exchange (ETDEWEB)

    Scholz, Alfred; Berger, Christina [Inst. fuer Werkstoffkunde (IfW), Technische Univ. Darmstadt (Germany)

    2009-07-01

    The improvement of life assessment methods contributes to a reduction of efforts at design and an effective long term operation of high temperature components, reduces technical risk and increases high economical advantages. Creep-fatigue at multi-stage loading, covering cold start, warm start and hot start cycles in typical loading sequences e.g. for medium loaded power plants, was investigated here. At hold times creep and stress relaxation, respectively, lead to an acceleration of crack initiation. Creep fatigue life time can be calculated by a modified damage accumulation rule, which considers the fatigue fraction rule for fatigue damage and the life fraction rule for creep damage. Mean stress effects, internal stress and interaction effects of creep and fatigue are considered. Along with the generation of advanced creep data, fatigue data and creep fatigue data as well scatter band analyses are necessary in order to generate design curves and lower bound properties inclusive. Besides, in order to improve lifing methods the enhancement of modelling activities for deformation and life time are important. For verification purposes, complex experiments at variable creep conditions as well as at creep fatigue interaction under multi-stage loading are of interest. Generally, the development of methods to transfer uniaxial material properties to multiaxial loading situations is a current challenge. For specific design purposes, a constitutive material model is introduced which is implemented as an user subroutine for Finite Element applications due to start-up and shut-down phases of components. Identification of material parameters have been performed by Neural Networks. (orig.)

  6. A cost-effectiveness analysis of provider interventions to improve health worker practice in providing treatment for uncomplicated malaria in Cameroon: a study protocol for a randomized controlled trial

    Directory of Open Access Journals (Sweden)

    Wiseman Virginia

    2012-01-01

    Full Text Available Abstract Background Governments and donors all over Africa are searching for sustainable, affordable and cost-effective ways to improve the quality of malaria case management. Widespread deficiencies have been reported in the prescribing and counselling practices of health care providers treating febrile patients in both public and private health facilities. Cameroon is no exception with low levels of adherence to national guidelines, the frequent selection of non-recommended antimalarials and the use of incorrect dosages. This study evaluates the effectiveness and cost-effectiveness of introducing two different provider training packages, alongside rapid diagnostic tests (RDTs, designed to equip providers with the knowledge and practical skills needed to effectively diagnose and treat febrile patients. The overall aim is to target antimalarial treatment better and to facilitate optimal use of malaria treatment guidelines. Methods/Design A 3-arm stratified, cluster randomized trial will be conducted to assess whether introducing RDTs with provider training (basic or enhanced is more cost-effective than current practice without RDTs, and whether there is a difference in the cost effectiveness of the provider training interventions. The primary outcome is the proportion of patients attending facilities that report a fever or suspected malaria and receive treatment according to malaria guidelines. This will be measured by surveying patients (or caregivers as they exit public and mission health facilities. Cost-effectiveness will be presented in terms of the primary outcome and a range of secondary outcomes, including changes in provider knowledge. Costs will be estimated from a societal and provider perspective using standard economic evaluation methodologies. Trial Registration ClinicalTrials.gov: NCT00981877

  7. Study on the Application of 6σ Method in Shoemaking Enterprise Quality Improvement

    Directory of Open Access Journals (Sweden)

    Wang Ting

    2017-01-01

    Full Text Available With the development of science as well as technology and the influx of shoemaking companies abroad, our traditional shoemaking enterprises face greater pressure to survive, and product quality problems are in urgent need of improvement. Aiming at the quality problems of M shoemaking enterprise, DMAIC method is used to conduct the product quality improvement, and a mathematical statistics software Minitab is used to analyze the data. Moreover, the optimum combination of the key influencing factors is determined by orthogonal experiment design as well as a set of specific quality improvement plans are put forward. Finally, the production process capability of M enterprise is improved, the product bonding strength is enhanced, customer satisfaction is improved, and the thoughts of product quality improvement and reference are provided for domestic traditional shoemaking enterprises.

  8. Improvement of the accuracy of noise measurements by the two-amplifier correlation method.

    Science.gov (United States)

    Pellegrini, B; Basso, G; Fiori, G; Macucci, M; Maione, I A; Marconcini, P

    2013-10-01

    We present a novel method for device noise measurement, based on a two-channel cross-correlation technique and a direct "in situ" measurement of the transimpedance of the device under test (DUT), which allows improved accuracy with respect to what is available in the literature, in particular when the DUT is a nonlinear device. Detailed analytical expressions for the total residual noise are derived, and an experimental investigation of the increased accuracy provided by the method is performed.

  9. Accuracy of the improved quasistatic space-time method checked with experiment

    International Nuclear Information System (INIS)

    Kugler, G.; Dastur, A.R.

    1976-10-01

    Recent experiments performed at the Savannah River Laboratory have made it possible to check the accuracy of numerical methods developed to simulate space-dependent neutron transients. The experiments were specifically designed to emphasize delayed neutron holdback. The CERBERUS code using the IQS (Improved Quasistatic) method has been developed to provide a practical yet accurate tool for spatial kinetics calculations of CANDU reactors. The code was tested on the Savannah River experiments and excellent agreement was obtained. (author)

  10. An Angular Method with Position Control for Block Mesh Squareness Improvement

    Energy Technology Data Exchange (ETDEWEB)

    Yao, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Stillman, D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2017-09-19

    We optimize a target function de ned by angular properties with a position control term for a basic stencil with a block-structured mesh, to improve element squareness in 2D and 3D. Comparison with the condition number method shows that besides a similar mesh quality regarding orthogonality can be achieved as the former does, the new method converges faster and provides a more uniform global mesh spacing in our numerical tests.

  11. IMPROVING NEAREST NEIGHBOUR SEARCH IN 3D SPATIAL ACCESS METHOD

    Directory of Open Access Journals (Sweden)

    A. Suhaibaha

    2016-10-01

    Full Text Available Nearest Neighbour (NN is one of the important queries and analyses for spatial application. In normal practice, spatial access method structure is used during the Nearest Neighbour query execution to retrieve information from the database. However, most of the spatial access method structures are still facing with unresolved issues such as overlapping among nodes and repetitive data entry. This situation will perform an excessive Input/Output (IO operation which is inefficient for data retrieval. The situation will become more crucial while dealing with 3D data. The size of 3D data is usually large due to its detail geometry and other attached information. In this research, a clustered 3D hierarchical structure is introduced as a 3D spatial access method structure. The structure is expected to improve the retrieval of Nearest Neighbour information for 3D objects. Several tests are performed in answering Single Nearest Neighbour search and k Nearest Neighbour (kNN search. The tests indicate that clustered hierarchical structure is efficient in handling Nearest Neighbour query compared to its competitor. From the results, clustered hierarchical structure reduced the repetitive data entry and the accessed page. The proposed structure also produced minimal Input/Output operation. The query response time is also outperformed compared to the other competitor. For future outlook of this research several possible applications are discussed and summarized.

  12. An improved microculture method for diagnosis of cutaneous leishmaniasis.

    Science.gov (United States)

    Pagheh, Abdolsattar; Fakhar, Mahdi; Mesgarian, Fatemeh; Gholami, Shirzad; Ahmadpour, Ehsan

    2014-12-01

    This study evaluated the performance of three diagnostic methods for cutaneous leishmaniasis (CL). Patients who came to the Health Center Laboratory of Gonbad-e-Qabus in Golestan Province, Iran, were enrolled in the study. Skin scraping smear, improved microculture (IMC) and polymerase chain reaction (PCR) were performed. A total of 303 subjects were recruited, among whom 273 subjects fulfilled the criteria for CL. Sensitivity and specificity were 88.8 % (95 % CI = 84.2-92.2 %) and 100.0 % for smears, 98.4 % (95 % CI = 96.1-99.1 %) and 100.0 % for IMC, both of them 100.0 % for PCR. Although, PCR was relatively more sensitive than the IMC, the high correlation (agreement = 96 %, Kappa = 0.82) between IMC and PCR along with the advantages of simplicity, rapidity, adequate sensitivity and as a needle free method, offers the IMC as a valuable alternative diagnostic method for PCR in diagnosis of CL.

  13. Improving Machining Accuracy of CNC Machines with Innovative Design Methods

    Science.gov (United States)

    Yemelyanov, N. V.; Yemelyanova, I. V.; Zubenko, V. L.

    2018-03-01

    The article considers achieving the machining accuracy of CNC machines by applying innovative methods in modelling and design of machining systems, drives and machine processes. The topological method of analysis involves visualizing the system as matrices of block graphs with a varying degree of detail between the upper and lower hierarchy levels. This approach combines the advantages of graph theory and the efficiency of decomposition methods, it also has visual clarity, which is inherent in both topological models and structural matrices, as well as the resiliency of linear algebra as part of the matrix-based research. The focus of the study is on the design of automated machine workstations, systems, machines and units, which can be broken into interrelated parts and presented as algebraic, topological and set-theoretical models. Every model can be transformed into a model of another type, and, as a result, can be interpreted as a system of linear and non-linear equations which solutions determine the system parameters. This paper analyses the dynamic parameters of the 1716PF4 machine at the stages of design and exploitation. Having researched the impact of the system dynamics on the component quality, the authors have developed a range of practical recommendations which have enabled one to reduce considerably the amplitude of relative motion, exclude some resonance zones within the spindle speed range of 0...6000 min-1 and improve machining accuracy.

  14. Improved Statistical Method For Hydrographic Climatic Records Quality Control

    Science.gov (United States)

    Gourrion, J.; Szekely, T.

    2016-02-01

    Climate research benefits from the continuous development of global in-situ hydrographic networks in the last decades. Apart from the increasing volume of observations available on a large range of temporal and spatial scales, a critical aspect concerns the ability to constantly improve the quality of the datasets. In the context of the Coriolis Dataset for ReAnalysis (CORA) version 4.2, a new quality control method based on a local comparison to historical extreme values ever observed is developed, implemented and validated. Temperature, salinity and potential density validity intervals are directly estimated from minimum and maximum values from an historical reference dataset, rather than from traditional mean and standard deviation estimates. Such an approach avoids strong statistical assumptions on the data distributions such as unimodality, absence of skewness and spatially homogeneous kurtosis. As a new feature, it also allows addressing simultaneously the two main objectives of a quality control strategy, i.e. maximizing the number of good detections while minimizing the number of false alarms. The reference dataset is presently built from the fusion of 1) all ARGO profiles up to early 2014, 2) 3 historical CTD datasets and 3) the Sea Mammals CTD profiles from the MEOP database. All datasets are extensively and manually quality controlled. In this communication, the latest method validation results are also presented. The method has been implemented in the latest version of the CORA dataset and will benefit to the next version of the Copernicus CMEMS dataset.

  15. An accurate and efficient reliability-based design optimization using the second order reliability method and improved stability transformation method

    Science.gov (United States)

    Meng, Zeng; Yang, Dixiong; Zhou, Huanlin; Yu, Bo

    2018-05-01

    The first order reliability method has been extensively adopted for reliability-based design optimization (RBDO), but it shows inaccuracy in calculating the failure probability with highly nonlinear performance functions. Thus, the second order reliability method is required to evaluate the reliability accurately. However, its application for RBDO is quite challenge owing to the expensive computational cost incurred by the repeated reliability evaluation and Hessian calculation of probabilistic constraints. In this article, a new improved stability transformation method is proposed to search the most probable point efficiently, and the Hessian matrix is calculated by the symmetric rank-one update. The computational capability of the proposed method is illustrated and compared to the existing RBDO approaches through three mathematical and two engineering examples. The comparison results indicate that the proposed method is very efficient and accurate, providing an alternative tool for RBDO of engineering structures.

  16. Improved GIS-based Methods for Traffic Noise Impact Assessment

    DEFF Research Database (Denmark)

    Nielsen, Otto Anker; Bloch, Karsten Sand

    1996-01-01

    When vector-based GIS-packages are used for traffic noise impact assessments, the buffer-technique is usually employed for the study: 1. For each road segment buffer-zones representing different noise-intervals are generated, 2. The buffers from all road segments are smoothed together, and 3....... The number of buildings within the buffers are enumerated. This technique provides an inaccurate assessment of the noise diffusion since it does not correct for buildings barrier and reflection to noise. The paper presents the results from a research project where the traditional noise buffer technique...... was compared with a new method which includes these corrections. Both methods follow the Common Nordic Noise Calculation Model, although the traditional buffer technique ignores parts of the model. The basis for the work was a digital map of roads and building polygons, combined with a traffic- and road...

  17. Improved Monte Carlo Method for PSA Uncertainty Analysis

    International Nuclear Information System (INIS)

    Choi, Jongsoo

    2016-01-01

    The treatment of uncertainty is an important issue for regulatory decisions. Uncertainties exist from knowledge limitations. A probabilistic approach has exposed some of these limitations and provided a framework to assess their significance and assist in developing a strategy to accommodate them in the regulatory process. The uncertainty analysis (UA) is usually based on the Monte Carlo method. This paper proposes a Monte Carlo UA approach to calculate the mean risk metrics accounting for the SOKC between basic events (including CCFs) using efficient random number generators and to meet Capability Category III of the ASME/ANS PRA standard. Audit calculation is needed in PSA regulatory reviews of uncertainty analysis results submitted for licensing. The proposed Monte Carlo UA approach provides a high degree of confidence in PSA reviews. All PSA needs accounting for the SOKC between event probabilities to meet the ASME/ANS PRA standard

  18. Improved Monte Carlo Method for PSA Uncertainty Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Jongsoo [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)

    2016-10-15

    The treatment of uncertainty is an important issue for regulatory decisions. Uncertainties exist from knowledge limitations. A probabilistic approach has exposed some of these limitations and provided a framework to assess their significance and assist in developing a strategy to accommodate them in the regulatory process. The uncertainty analysis (UA) is usually based on the Monte Carlo method. This paper proposes a Monte Carlo UA approach to calculate the mean risk metrics accounting for the SOKC between basic events (including CCFs) using efficient random number generators and to meet Capability Category III of the ASME/ANS PRA standard. Audit calculation is needed in PSA regulatory reviews of uncertainty analysis results submitted for licensing. The proposed Monte Carlo UA approach provides a high degree of confidence in PSA reviews. All PSA needs accounting for the SOKC between event probabilities to meet the ASME/ANS PRA standard.

  19. Ensemble Methods in Data Mining Improving Accuracy Through Combining Predictions

    CERN Document Server

    Seni, Giovanni

    2010-01-01

    This book is aimed at novice and advanced analytic researchers and practitioners -- especially in Engineering, Statistics, and Computer Science. Those with little exposure to ensembles will learn why and how to employ this breakthrough method, and advanced practitioners will gain insight into building even more powerful models. Throughout, snippets of code in R are provided to illustrate the algorithms described and to encourage the reader to try the techniques. The authors are industry experts in data mining and machine learning who are also adjunct professors and popular speakers. Although e

  20. Improving support for parents of children with hearing loss: provider training on use of targeted communication strategies.

    Science.gov (United States)

    Muñoz, Karen; Nelson, Lauri; Blaiser, Kristina; Price, Tanner; Twohig, Michael

    2015-02-01

    recommendations. For providers who completed both the prequestionnaires and postquestionnaires, an increase in confidence was reported for several areas of communication; however, as expected, practices remained similar, and all of the practicing professionals and 94% of the graduate students indicated a desire for more training on how to be effective in supporting parents with implementing intervention recommendations. Providers do not necessarily use effective methods of communication, needed to adequately help parents, requiring additional focused training to change how providers interact with parents and how support is provided. American Academy of Audiology.

  1. [Experience feedback committee: a method for patient safety improvement].

    Science.gov (United States)

    François, P; Sellier, E; Imburchia, F; Mallaret, M-R

    2013-04-01

    An experience feedback committee (CREX, Comité de Retour d'EXpérience) is a method which contributes to the management of safety of care in a medical unit. Originally used for security systems of civil aviation, the method has been adapted to health care facilities and successfully implemented in radiotherapy units and in other specialties. We performed a brief review of the literature for studies reporting data on CREX established in hospitals. The review was performed using the main bibliographic databases and Google search results. The CREX is designed to analyse incidents reported by professionals. The method includes monthly meetings of a multi-professional committee that reviews the reported incidents, chooses a priority incident and designates a "pilot" responsible for investigating the incident. The investigation of the incident involves a systemic analysis method and a written synthesis presented at the next meeting of the committee. The committee agrees on actions for improvement that are suggested by the analysis and follows their implementation. Systems for the management of health care, including reporting systems, are organized into three levels: the medical unit, the hospital and the country as a triple loop learning process. The CREX is located in the base level, short loop of risk management and allows direct involvement of care professionals in patient safety. Safety of care has become a priority of health systems. In this context, the CREX can be a useful vehicle for the implementation of a safety culture in medical units. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  2. Numerical Simulation of Antennas with Improved Integral Equation Method

    International Nuclear Information System (INIS)

    Ma Ji; Fang Guang-You; Lu Wei

    2015-01-01

    Simulating antennas around a conducting object is a challenge task in computational electromagnetism, which is concerned with the behaviour of electromagnetic fields. To analyze this model efficiently, an improved integral equation-fast Fourier transform (IE-FFT) algorithm is presented in this paper. The proposed scheme employs two Cartesian grids with different size and location to enclose the antenna and the other object, respectively. On the one hand, IE-FFT technique is used to store matrix in a sparse form and accelerate the matrix-vector multiplication for each sub-domain independently. On the other hand, the mutual interaction between sub-domains is taken as the additional exciting voltage in each matrix equation. By updating integral equations several times, the whole electromagnetic system can achieve a stable status. Finally, the validity of the presented method is verified through the analysis of typical antennas in the presence of a conducting object. (paper)

  3. A improved method for the analysis of alpha spectra

    International Nuclear Information System (INIS)

    Equillor, Hugo E.

    2004-01-01

    In this work we describe a methodology, developed in the last years, for the analysis of alpha emitters spectra, obtained with implanted ion detectors, that tend to solve some of the problems that shows this type of spectra. This is an improved methodology respect to that described in a previous publication. The method is based on the application of a mathematical function that allows to model the tail of an alpha peak, to evaluate the part of the peak that is not seen in the cases of partial superposition with another peak. Also, a calculation program that works in a semiautomatic way, with the possibility of interactive intervention of the analyst, has been developed simultaneously and is described in detail. (author)

  4. Error Estimation and Accuracy Improvements in Nodal Transport Methods

    International Nuclear Information System (INIS)

    Zamonsky, O.M.

    2000-01-01

    The accuracy of the solutions produced by the Discrete Ordinates neutron transport nodal methods is analyzed.The obtained new numerical methodologies increase the accuracy of the analyzed scheems and give a POSTERIORI error estimators. The accuracy improvement is obtained with new equations that make the numerical procedure free of truncation errors and proposing spatial reconstructions of the angular fluxes that are more accurate than those used until present. An a POSTERIORI error estimator is rigurously obtained for one dimensional systems that, in certain type of problems, allows to quantify the accuracy of the solutions. From comparisons with the one dimensional results, an a POSTERIORI error estimator is also obtained for multidimensional systems. LOCAL indicators, which quantify the spatial distribution of the errors, are obtained by the decomposition of the menctioned estimators. This makes the proposed methodology suitable to perform adaptive calculations. Some numerical examples are presented to validate the theoretical developements and to illustrate the ranges where the proposed approximations are valid

  5. Self-Assessment Methods in the Higher Education Quality Improvement

    Directory of Open Access Journals (Sweden)

    Jitka SMUTNÁ

    2009-06-01

    Full Text Available Organizational performance is maximized when it is based on the management and sharing of knowledge within a culture of continuous learning, innovation and improvement. The methodology embodies the principle of self-evaluation or self-assessment. The higher education institutions would learn from feedback by reviewing impact of strategies and actions, trends in results and by comparing through benchmarking. The focus of this paper is the implementation of EFQM excellence model in the higher education (HE sector. This paper describes the specific issues in implementing the model in HE institutions, with a particular focus on the choice of self-assessment methodology. The early signs are that EFQM excellence model self-assessment can help to produce a more customer-oriented culture in HE institutions, providing that the lessons learned from the wider public sector are put into practice.

  6. IMPROVING MANAGEMENT ACCOUNTING AND COST CALCULATION IN DAIRY INDUSTRY USING STANDARD COST METHOD

    Directory of Open Access Journals (Sweden)

    Bogdănoiu Cristiana-Luminiţa

    2013-04-01

    Full Text Available This paper aims to discuss issues related to the improvement of management accounting in the dairy industry by implementing standard cost method. The methods used today do not provide informational satisfaction to managers in order to conduct effectively production activities, which is why we attempted the standard cost method, it responding to the managers needs to obtain the efficiency of production, and all economic entities. The method allows an operative control of how they consume manpower and material resources by pursuing distinct, permanent and complete deviations during the activity and not at the end of the reporting period. Successful implementation of the standard method depends on the accuracy by which standards are developed and promotes consistently anticipated calculation of production costs as well as determination, tracking and controlling deviations from them, leads to increased practical value of accounting information and business improvement.

  7. Computational RNA secondary structure design: empirical complexity and improved methods

    Directory of Open Access Journals (Sweden)

    Condon Anne

    2007-01-01

    Full Text Available Abstract Background We investigate the empirical complexity of the RNA secondary structure design problem, that is, the scaling of the typical difficulty of the design task for various classes of RNA structures as the size of the target structure is increased. The purpose of this work is to understand better the factors that make RNA structures hard to design for existing, high-performance algorithms. Such understanding provides the basis for improving the performance of one of the best algorithms for this problem, RNA-SSD, and for characterising its limitations. Results To gain insights into the practical complexity of the problem, we present a scaling analysis on random and biologically motivated structures using an improved version of the RNA-SSD algorithm, and also the RNAinverse algorithm from the Vienna package. Since primary structure constraints are relevant for designing RNA structures, we also investigate the correlation between the number and the location of the primary structure constraints when designing structures and the performance of the RNA-SSD algorithm. The scaling analysis on random and biologically motivated structures supports the hypothesis that the running time of both algorithms scales polynomially with the size of the structure. We also found that the algorithms are in general faster when constraints are placed only on paired bases in the structure. Furthermore, we prove that, according to the standard thermodynamic model, for some structures that the RNA-SSD algorithm was unable to design, there exists no sequence whose minimum free energy structure is the target structure. Conclusion Our analysis helps to better understand the strengths and limitations of both the RNA-SSD and RNAinverse algorithms, and suggests ways in which the performance of these algorithms can be further improved.

  8. Synthesis of porous graphene powder through improved Hummers' method

    Science.gov (United States)

    Gupta, Siddhant; Bonageri, Shrilakshmi; Achar, Siddarth Krishnaraja; Menon, Atul; Basavaraja R., J.

    2018-05-01

    Graphene due to its high specific surface area is considered to be a potential adsorbent for air and water purification systems. In this study, graphene was synthesized using the recently developed Improved Hummers' method to achieve a high oxidation rate and thermal treatment of the synthesized graphene was done to increase its pore size and make it more capable for applications in purification systems. Graphite flakes were oxidized to obtain graphene oxide which was then reduced to obtain graphene. The synthesized graphene was then thermally treated at 200 °C for two hours in a muffle furnace to improve its surface properties. The characterization results of graphene oxide and graphene show the presence of many impurities which is inferred to be the result of contaminated water used in the experimentation. The analysis of the characterization results also shows that the thermally treated graphene has more spacing and voids when compared to graphene which makes it a better suit for adsorption of gases such as carbon dioxide.

  9. INNOVATIVE USE OF QUALITY MANAGEMENT METHODS FOR PRODUCT IMPROVEMENT

    Directory of Open Access Journals (Sweden)

    Katarzyna MIDOR

    2016-10-01

    Full Text Available Organisations constantly look for new, innovative solutions and methods which could be used to improve their efficiency and increase the quality of their products. Identifying the causes for returns is an important issue for modern compa-nies, as returns are the cause for the increase in production costs and, most importantly, the loss of credibility in the eyes of the client. Therefore, for the company to be able to sustain or strengthen its position on the market, it has to follow the rules of quality management. Especially important is the rule of constant improvement. This rule is primarily connected with preventing errors and defects from occurring at all the stages of the production process. To achieve that, one must, among other things, use quality management tools. The article presents an analysis of causes for returns of a vibrating screen produced by a company which manufactures machinery and equipment for the extractive industry, using quality management tools such as the Ishikawa diagram and Pareto analysis. The analysis allowed for the identifi-cation of the causes of client returns which could not be previously identified, and proposing solutions for them.

  10. Innovative Use of Quality Management Methods for Product Improvement

    Science.gov (United States)

    Midor, Katarzyna; Žarnovský, Jozef

    2016-12-01

    Organisations constantly look for new, innovative solutions and methods which could be used to improve their efficiency and increase the quality of their products. Identifying the causes for returns is an important issue for modern companies, as returns are the cause for the increase in production costs and, most importantly, the loss of credibility in the eyes of the client. Therefore, for the company to be able to sustain or strengthen its position on the market, it has to follow the rules of quality management. Especially important is the rule of constant improvement. This rule is primarily connected with preventing errors and defects from occurring at all the stages of the production process. To achieve that, one must, among other things, use quality management tools. The article presents an analysis of causes for returns of a vibrating screen produced by a company which manufactures machinery and equipment for the extractive industry, using quality management tools such as the Ishikawa diagram and Pareto analysis. The analysis allowed for the identification of the causes of client returns which could not be previously identified, and proposing solutions for them.

  11. Omega-3 polyunsaturated fatty acids provided during embryonic development improve the growth performance and welfare of Muscovy ducks (Cairina moschata).

    Science.gov (United States)

    Baéza, E; Chartrin, P; Bordeau, T; Lessire, M; Thoby, J M; Gigaud, V; Blanchet, M; Alinier, A; Leterrier, C

    2017-09-01

    The welfare of ducks can be affected by unwanted behaviors such as excessive reactivity and feather pecking. Providing long-chain n-3 polyunsaturated fatty acids (LC n-3 PUFA) during gestation and early life has been shown to improve the brain development and function of human and rodent offspring. The aim of this study was to test whether the pecking behavior of Muscovy ducks during rearing could be reduced by providing LC n-3 PUFA during embryonic and/or post-hatching development of ducklings. Enrichment of eggs, and consequently embryos, with LC n-3 PUFA was achieved by feeding female ducks (n-3F) a diet containing docosahexaenoic (DHA) and linolenic acids (microalgae and linseed oil). A control group of female ducks (CF) was fed a diet containing linoleic acid (soybean oil). Offspring from both groups were fed starter and grower diets enriched with DHA and linolenic acid or only linoleic acid, resulting in four treatment groups with 48 ducklings in each. Several behavioral tests were performed between 1 and 3 weeks of age to analyze the adaptation ability of ducklings. The growth performance, time budget, social interactions, feather growth, and pecking behavior of ducklings were recorded regularly during the rearing period. No significant interaction between maternal and duckling feeding was found. Ducklings from n-3F ducks had a higher body weight at day 0, 28, and 56, a lower feed conversion ratio during the growth period, and lower reactivity to stress than ducklings from CF ducks. Ducklings from n-3F ducks also exhibited a significantly reduced feather pecking frequency at 49 and 56 days of age and for the whole rearing period. Moreover, consumption of diets enriched with n-3 PUFA during the starter and grower post-hatching periods significantly improved the tibia mineralization of ducklings and the fatty acid composition of thigh muscles at 84 days of age by increasing the n-3 FA content. © 2017 Poultry Science Association Inc.

  12. A qualitative method proposal to improve environmental impact assessment

    Energy Technology Data Exchange (ETDEWEB)

    Toro, Javier, E-mail: jjtoroca@unal.edu.co [Institute of Environmental Studies, National University of Colombia at Bogotá (Colombia); Requena, Ignacio, E-mail: requena@decsai.ugr.es [Department of Computer Science and Artificial Intelligence, University of Granada (Spain); Duarte, Oscar, E-mail: ogduartev@unal.edu.co [National University of Colombia at Bogotá, Department of Electrical Engineering and Electronics (Colombia); Zamorano, Montserrat, E-mail: zamorano@ugr.es [Department of Civil Engineering, University of Granada (Spain)

    2013-11-15

    In environmental impact assessment, qualitative methods are used because they are versatile and easy to apply. This methodology is based on the evaluation of the strength of the impact by grading a series of qualitative attributes that can be manipulated by the evaluator. The results thus obtained are not objective, and all too often impacts are eliminated that should be mitigated with corrective measures. However, qualitative methodology can be improved if the calculation of Impact Importance is based on the characteristics of environmental factors and project activities instead on indicators assessed by evaluators. In this sense, this paper proposes the inclusion of the vulnerability of environmental factors and the potential environmental impact of project activities. For this purpose, the study described in this paper defined Total Impact Importance and specified a quantification procedure. The results obtained in the case study of oil drilling in Colombia reflect greater objectivity in the evaluation of impacts as well as a positive correlation between impact values, the environmental characteristics at and near the project location, and the technical characteristics of project activities. -- Highlights: • Concept of vulnerability has been used to calculate the importance impact assessment. • This paper defined Total Impact Importance and specified a quantification procedure. • The method includes the characteristics of environmental and project activities. • The application has shown greater objectivity in the evaluation of impacts. • Better correlation between impact values, environment and the project has been shown.

  13. A qualitative method proposal to improve environmental impact assessment

    International Nuclear Information System (INIS)

    Toro, Javier; Requena, Ignacio; Duarte, Oscar; Zamorano, Montserrat

    2013-01-01

    In environmental impact assessment, qualitative methods are used because they are versatile and easy to apply. This methodology is based on the evaluation of the strength of the impact by grading a series of qualitative attributes that can be manipulated by the evaluator. The results thus obtained are not objective, and all too often impacts are eliminated that should be mitigated with corrective measures. However, qualitative methodology can be improved if the calculation of Impact Importance is based on the characteristics of environmental factors and project activities instead on indicators assessed by evaluators. In this sense, this paper proposes the inclusion of the vulnerability of environmental factors and the potential environmental impact of project activities. For this purpose, the study described in this paper defined Total Impact Importance and specified a quantification procedure. The results obtained in the case study of oil drilling in Colombia reflect greater objectivity in the evaluation of impacts as well as a positive correlation between impact values, the environmental characteristics at and near the project location, and the technical characteristics of project activities. -- Highlights: • Concept of vulnerability has been used to calculate the importance impact assessment. • This paper defined Total Impact Importance and specified a quantification procedure. • The method includes the characteristics of environmental and project activities. • The application has shown greater objectivity in the evaluation of impacts. • Better correlation between impact values, environment and the project has been shown

  14. Improved method for the determination of dissolved radium-226

    International Nuclear Information System (INIS)

    Yang, I.C.

    1984-01-01

    Most of the current techniques for radium determination involve chemical separation of radium from major sample constituents by coprecipitation with barium or lead sulfate, followed by further radium purification. However, when samples contain biological materials, such as algae in wastewater from uranium millponds, or brine water from oil fields, the precipitation and purification processes become tedious and time-consuming. An improved method has been developed for the determination of radium-226 in such water samples, which also is applicable to natural waters. This method is based on a radon determination of alpha activity of the radon and its short-lived daughters in an alpha-scintillation cell. The radon-bubbler volume is either 90 millimeters for concentrated samples or 800 milliliters for dilute samples. For radium concentrations less than 1 picocurie per liter, 2 liters of water sample can be concentrated several-fold by simple evaporation, and decreased to 800 milliliters prior to deemanation. Because the process involves no chemical separations, chemical recoveries are nearly 100 percent. The lower limit of detection is 0.05 picocurie per liter for a 1-liter water sample and a counting time of 1000 minutes. 19 references, 3 figures, 3 tables

  15. Methods for improved growth of group III nitride buffer layers

    Science.gov (United States)

    Melnik, Yurity; Chen, Lu; Kojiri, Hidehiro

    2014-07-15

    Methods are disclosed for growing high crystal quality group III-nitride epitaxial layers with advanced multiple buffer layer techniques. In an embodiment, a method includes forming group III-nitride buffer layers that contain aluminum on suitable substrate in a processing chamber of a hydride vapor phase epitaxy processing system. A hydrogen halide or halogen gas is flowing into the growth zone during deposition of buffer layers to suppress homogeneous particle formation. Some combinations of low temperature buffers that contain aluminum (e.g., AlN, AlGaN) and high temperature buffers that contain aluminum (e.g., AlN, AlGaN) may be used to improve crystal quality and morphology of subsequently grown group III-nitride epitaxial layers. The buffer may be deposited on the substrate, or on the surface of another buffer. The additional buffer layers may be added as interlayers in group III-nitride layers (e.g., GaN, AlGaN, AlN).

  16. Improving Hyperspectral Image Classification Method for Fine Land Use Assessment Application Using Semisupervised Machine Learning

    Directory of Open Access Journals (Sweden)

    Chunyang Wang

    2015-01-01

    Full Text Available Study on land use/cover can reflect changing rules of population, economy, agricultural structure adjustment, policy, and traffic and provide better service for the regional economic development and urban evolution. The study on fine land use/cover assessment using hyperspectral image classification is a focal growing area in many fields. Semisupervised learning method which takes a large number of unlabeled samples and minority labeled samples, improving classification and predicting the accuracy effectively, has been a new research direction. In this paper, we proposed improving fine land use/cover assessment based on semisupervised hyperspectral classification method. The test analysis of study area showed that the advantages of semisupervised classification method could improve the high precision overall classification and objective assessment of land use/cover results.

  17. AN IMPROVED INTERFEROMETRIC CALIBRATION METHOD BASED ON INDEPENDENT PARAMETER DECOMPOSITION

    Directory of Open Access Journals (Sweden)

    J. Fan

    2018-04-01

    Full Text Available Interferometric SAR is sensitive to earth surface undulation. The accuracy of interferometric parameters plays a significant role in precise digital elevation model (DEM. The interferometric calibration is to obtain high-precision global DEM by calculating the interferometric parameters using ground control points (GCPs. However, interferometric parameters are always calculated jointly, making them difficult to decompose precisely. In this paper, we propose an interferometric calibration method based on independent parameter decomposition (IPD. Firstly, the parameters related to the interferometric SAR measurement are determined based on the three-dimensional reconstruction model. Secondly, the sensitivity of interferometric parameters is quantitatively analyzed after the geometric parameters are completely decomposed. Finally, each interferometric parameter is calculated based on IPD and interferometric calibration model is established. We take Weinan of Shanxi province as an example and choose 4 TerraDEM-X image pairs to carry out interferometric calibration experiment. The results show that the elevation accuracy of all SAR images is better than 2.54 m after interferometric calibration. Furthermore, the proposed method can obtain the accuracy of DEM products better than 2.43 m in the flat area and 6.97 m in the mountainous area, which can prove the correctness and effectiveness of the proposed IPD based interferometric calibration method. The results provide a technical basis for topographic mapping of 1 : 50000 and even larger scale in the flat area and mountainous area.

  18. An Improved Interferometric Calibration Method Based on Independent Parameter Decomposition

    Science.gov (United States)

    Fan, J.; Zuo, X.; Li, T.; Chen, Q.; Geng, X.

    2018-04-01

    Interferometric SAR is sensitive to earth surface undulation. The accuracy of interferometric parameters plays a significant role in precise digital elevation model (DEM). The interferometric calibration is to obtain high-precision global DEM by calculating the interferometric parameters using ground control points (GCPs). However, interferometric parameters are always calculated jointly, making them difficult to decompose precisely. In this paper, we propose an interferometric calibration method based on independent parameter decomposition (IPD). Firstly, the parameters related to the interferometric SAR measurement are determined based on the three-dimensional reconstruction model. Secondly, the sensitivity of interferometric parameters is quantitatively analyzed after the geometric parameters are completely decomposed. Finally, each interferometric parameter is calculated based on IPD and interferometric calibration model is established. We take Weinan of Shanxi province as an example and choose 4 TerraDEM-X image pairs to carry out interferometric calibration experiment. The results show that the elevation accuracy of all SAR images is better than 2.54 m after interferometric calibration. Furthermore, the proposed method can obtain the accuracy of DEM products better than 2.43 m in the flat area and 6.97 m in the mountainous area, which can prove the correctness and effectiveness of the proposed IPD based interferometric calibration method. The results provide a technical basis for topographic mapping of 1 : 50000 and even larger scale in the flat area and mountainous area.

  19. Improvement of beef cattle genetics provided increasing sustainability of beef cattle production and protein consumption in Thailand

    Energy Technology Data Exchange (ETDEWEB)

    Boonyanuwat, K. [Beef Cattle Research and Development Group, Division of Animal Husbandry, Department of Livestock Development, Bangkok (Thailand)], E-mail: kalayabo@yahoo.com; Sirisom, P [Tak Livestock Breeding and Research Center, Meung (Thailand); Putharatanung, A [Nongkwang Livestock Research and Breeding Center, Photharam (Thailand)

    2009-07-01

    .00%. They were the smallest size. Farmers raised them by main of grass-fed and some added with concentrate. Meat quality from this group was the lowest. The meat texture of this group is the most firm. It was suitable for Thai food cooking. Meat from this group was used to make meatball and Thai food. The second group was around 38.50%. They were fattening 3-6 month. Meat from this group was medium quality. Farmers fed them with grass, agricultural by product, and concentrate. Meat from this group was used for general Thai food and steak cooking. The third and forth group were around 20.00%. In this group, it was added with other beef cattle: Kampangsaen and Ponyangkhum beef cattle. They were fed higher concentrate, up to 90% of concentrate in the last month of fattening. They were fattening 6-12 month. Farmers fed them following feeding plan of cooperative, so they had the greatest ADG and % carcass. Quality of meat from this group was the best, most tender. Meat from this group was used for steak and shabushabu. Meat from this group had quality the same as import meat. Some of them were better than import meat. It was tenderer. The fifth group was less than 0.5%. They were on experiment to establish new breed by DLD. This group was optimized for Thai farmers, small size and low mature age. Meat from this group had the most tenderness and marbling. Meat from this group had more quality than import meat. It was used for steak and shabushabu. Farmers could earn money from beef cattle raising occupation. Beef cattle genetic improvement provided sustainable productivity, profitability, quality of products, and sustained economic growth in rural Thailand. Beef meat production would be the mainly red meat production and provided protein sources for consumer in Thailand. (author)

  20. Improving opioid safety practices in primary care: protocol for the development and evaluation of a multifaceted, theory-informed pilot intervention for healthcare providers

    Science.gov (United States)

    Leece, Pamela; Buchman, Daniel Z; Hamilton, Michael; Timmings, Caitlyn; Shantharam, Yalnee; Moore, Julia; Furlan, Andrea D

    2017-01-01

    Introduction In North America, drug overdose deaths are reaching unprecedented levels, largely driven by increasing prescription opioid-related deaths. Despite the development of several opioid guidelines, prescribing behaviours still contribute to poor patient outcomes and societal harm. Factors at the provider and system level may hinder or facilitate the application of evidence-based guidelines; interventions designed to address such factors are needed. Methods and analysis Using implementation science and behaviour change theory, we have planned the development and evaluation of a comprehensive Opioid Self-Assessment Package, designed to increase adherence to the Canadian Opioid Guideline among family physicians. The intervention uses practical educational and self-assessment tools to provide prescribers with feedback on their current knowledge and practices, and resources to improve their practice. The evaluation approach uses a pretest and post-test design and includes both quantitative and qualitative methods at baseline and 6 months. We will recruit a purposive sample of approximately 10 family physicians in Ontario from diverse practice settings, who currently treat patients with long-term opioid therapy for chronic pain. Quantitative data will be analysed using basic descriptive statistics, and qualitative data will be analysed using the Framework Method. Ethics and dissemination The University Health Network Research Ethics Board approved this study. Dissemination plan includes publications, conference presentations and brief stakeholder reports. This evidence-informed, theory-driven intervention has implications for national application of opioid quality improvement tools in primary care settings. We are engaging experts and end users in advisory and stakeholder roles throughout our project to increase its national relevance, application and sustainability. The performance measures could be used as the basis for health system quality improvement

  1. METHOD IMPROVEMENT FOR DETERMINING THE TECHNICAL LEVEL OF CIVIL AIRCRAFT

    Directory of Open Access Journals (Sweden)

    2016-01-01

    Full Text Available Aircraft are high-tech engineering products which are characterized by a wide range of properties including the two most important groups that respectively characterize the efficiency and technical level.Improving the aircraft efficiency is an essential factor for air transport development, but the efficiency can not be fully describe the technical system, especially in forecasting and new technology requirements development. Aircraft de- signer must evaluate the prospects of a technical solution, but it’s not always possible to calculate the efficiency accuratelyat the design stage. The operator should be able to choose the most technically-advanced aircraft available in the market inorder not to let it grow obsolete quickly. This determines the need for non-economic evaluation of technical systems that can be done by assessment of their technical level.The technical level is a general index that includes a set of technical perfection indicators. Technical perfection is reflected in terms of material and energy intensity, in terms of ergonomics, safety, etc. and is achieved as a result of origi- nal design solutions, the use of new high-strength low-density materials, the introduction of advanced technological pro-cesses, calculation methods, verification, testing, etc.There is a tight connection between the product properties and its weight, because weight is the material reflection of these properties. Therefore, improvement of the product properties usually leads to an intense increase of its weight. To deal with this phenomenon is only possible with widely using scientific and technical progress results. In accordance with this, the technical perfection can be interpreted as a major component of quality that is created without the weight increase. This approach requires investment in research and testing new technical solutions.The method was developed to determine the technical level of civil long-haul aircraft which has been modified to

  2. Beyond Measurement and Reward: Methods of Motivating Quality Improvement and Accountability.

    Science.gov (United States)

    Berenson, Robert A; Rice, Thomas

    2015-12-01

    The article examines public policies designed to improve quality and accountability that do not rely on financial incentives and public reporting of provider performance. Payment policy should help temper the current "more is better" attitude of physicians and provider organizations. Incentive neutrality would better support health professionals' intrinsic motivation to act in their patients' best interests to improve overall quality than would pay-for-performance plans targeted to specific areas of clinical care. Public policy can support clinicians' intrinsic motivation through approaches that support systematic feedback to clinicians and provide concrete opportunities to collaborate to improve care. Some programs administered by the Centers for Medicare & Medicaid Services, including Partnership for Patients and Conditions of Participation, deserve more attention; they represent available, but largely ignored, approaches to support providers to improve quality and protect beneficiaries against substandard care. Public policies related to quality improvement should focus more on methods of enhancing professional intrinsic motivation, while recognizing the potential role of organizations to actively promote and facilitate that motivation. Actually achieving improvement, however, will require a reexamination of the role played by financial incentives embedded in payments and the unrealistic expectations placed on marginal incentives in pay-for-performance schemes. © Health Research and Educational Trust.

  3. An improved method for polarimetric image restoration in interferometry

    Science.gov (United States)

    Pratley, Luke; Johnston-Hollitt, Melanie

    2016-11-01

    Interferometric radio astronomy data require the effects of limited coverage in the Fourier plane to be accounted for via a deconvolution process. For the last 40 years this process, known as `cleaning', has been performed almost exclusively on all Stokes parameters individually as if they were independent scalar images. However, here we demonstrate for the case of the linear polarization P, this approach fails to properly account for the complex vector nature resulting in a process which is dependent on the axes under which the deconvolution is performed. We present here an improved method, `Generalized Complex CLEAN', which properly accounts for the complex vector nature of polarized emission and is invariant under rotations of the deconvolution axes. We use two Australia Telescope Compact Array data sets to test standard and complex CLEAN versions of the Högbom and SDI (Steer-Dwedney-Ito) CLEAN algorithms. We show that in general the complex CLEAN version of each algorithm produces more accurate clean components with fewer spurious detections and lower computation cost due to reduced iterations than the current methods. In particular, we find that the complex SDI CLEAN produces the best results for diffuse polarized sources as compared with standard CLEAN algorithms and other complex CLEAN algorithms. Given the move to wide-field, high-resolution polarimetric imaging with future telescopes such as the Square Kilometre Array, we suggest that Generalized Complex CLEAN should be adopted as the deconvolution method for all future polarimetric surveys and in particular that the complex version of an SDI CLEAN should be used.

  4. Improved statistical method for temperature and salinity quality control

    Science.gov (United States)

    Gourrion, Jérôme; Szekely, Tanguy

    2017-04-01

    Climate research and Ocean monitoring benefit from the continuous development of global in-situ hydrographic networks in the last decades. Apart from the increasing volume of observations available on a large range of temporal and spatial scales, a critical aspect concerns the ability to constantly improve the quality of the datasets. In the context of the Coriolis Dataset for ReAnalysis (CORA) version 4.2, a new quality control method based on a local comparison to historical extreme values ever observed is developed, implemented and validated. Temperature, salinity and potential density validity intervals are directly estimated from minimum and maximum values from an historical reference dataset, rather than from traditional mean and standard deviation estimates. Such an approach avoids strong statistical assumptions on the data distributions such as unimodality, absence of skewness and spatially homogeneous kurtosis. As a new feature, it also allows addressing simultaneously the two main objectives of an automatic quality control strategy, i.e. maximizing the number of good detections while minimizing the number of false alarms. The reference dataset is presently built from the fusion of 1) all ARGO profiles up to late 2015, 2) 3 historical CTD datasets and 3) the Sea Mammals CTD profiles from the MEOP database. All datasets are extensively and manually quality controlled. In this communication, the latest method validation results are also presented. The method has already been implemented in the latest version of the delayed-time CMEMS in-situ dataset and will be deployed soon in the equivalent near-real time products.

  5. Frontline health workers as brokers: provider perceptions, experiences and mitigating strategies to improve access to essential medicines in South Africa.

    Science.gov (United States)

    Magadzire, Bvudzai Priscilla; Budden, Ashwin; Ward, Kim; Jeffery, Roger; Sanders, David

    2014-11-05

    Front-line health providers have a unique role as brokers (patient advocates) between the health system and patients in ensuring access to medicines (ATM). ATM is a fundamental component of health systems. This paper examines in a South African context supply- and demand- ATM barriers from the provider perspective using a five dimensional framework: availability (fit between existing resources and clients' needs); accessibility (fit between physical location of healthcare and location of clients); accommodation (fit between the organisation of services and clients' practical circumstances); acceptability (fit between clients' and providers' mutual expectations and appropriateness of care) and affordability (fit between cost of care and ability to pay). This cross-sectional, qualitative study uses semi-structured interviews with nurses, pharmacy personnel and doctors. Thirty-six providers were purposively recruited from six public sector Community Health Centres in two districts in the Eastern Cape Province representing both rural and urban settings. Content analysis combined structured coding and grounded theory approaches. Finally, the five dimensional framework was applied to illustrate the interconnected facets of the issue. Factors perceived to affect ATM were identified. Availability of medicines was hampered by logistical bottlenecks in the medicines supply chain; poor public transport networks affected accessibility. Organization of disease programmes meshed poorly with the needs of patients with comorbidities and circular migrants who move between provinces searching for economic opportunities, proximity to services such as social grants and shopping centres influenced where patients obtain medicines. Acceptability was affected by, for example, HIV related stigma leading patients to seek distant services. Travel costs exacerbated by the interplay of several ATM barriers influenced affordability. Providers play a brokerage role by adopting flexible

  6. Improved algorithm for three-dimensional inverse method

    Science.gov (United States)

    Qiu, Xuwen

    An inverse method, which works for full 3D viscous applications in turbomachinery aerodynamic design, is developed. The method takes pressure loading and thickness distribution as inputs and computes the 3D-blade geometry. The core of the inverse method consists of two closely related steps, which are integrated into a time-marching procedure of a Navier-Stokes solver. First, the pressure loading condition is enforced while flow is allowed to cross the blade surfaces. A permeable blade boundary condition is developed here in order to be consistent with the propagation characteristics of the transient Navier-Stokes equations. In the second step, the blade geometry is adjusted so that the flow-tangency condition is satisfied for the new blade. A Non-Uniform Rational B-Spline (NURBS) model is used to represent the span-wise camber curves. The flow-tangency condition is then transformed into a general linear least squares fitting problem, which is solved by a robust Singular Value Decomposition (SVD) scheme. This blade geometry generation scheme allows the designer to have direct control over the smoothness of the calculated blade, and thus ensures the numerical stability during the iteration process. Numerical experiments show that this method is very accurate, efficient and robust. In target-shooting tests, the program was able to converge to the target blade accurately from a different initial blade. The speed of an inverse run is only about 15% slower than its analysis counterpart, which means a complete 3D viscous inverse design can be done in a matter of hours. The method is also proved to work well with the presence of clearance between the blade and the housing, a key factor to be considered in aerodynamic design. The method is first developed for blades without splitters, and is then extended to provide the capability of analyzing and designing machines with splitters. This gives designers an integrated environment where the aerodynamic design of both full

  7. The Accident Sequence Precursor program: Methods improvements and current results

    International Nuclear Information System (INIS)

    Minarick, J.W.; Manning, F.M.; Harris, J.D.

    1987-01-01

    Changes in the US NRC Accident Sequence Precursor program methods since the initial program evaluations of 1969-81 operational events are described, along with insights from the review of 1984-85 events. For 1984-85, the number of significant precursors was consistent with the number observed in 1980-81, dominant sequences associated with significant events were reasonably consistent with PRA estimates for BWRs, but lacked the contribution due to small-break LOCAs previously observed and predicted in PWRs, and the frequency of initiating events and non-recoverable system failures exhibited some reduction compared to 1980-81. Operational events which provide information concerning additional PRA modeling needs are also described

  8. Method for making an improved magnetic encoding device

    Science.gov (United States)

    Fox, Richard J.

    1981-01-01

    A magnetic encoding device and method for making the same are provided for use as magnetic storage mediums in identification control applications which give output signals from a reader that are of shorter duration and substantially greater magnitude than those of the prior art. Magnetic encoding elements are produced by uniformly bending wire or strip stock of a magnetic material longitudinally about a common radius to exceed the elastic limit of the material and subsequently mounting the material so that it is restrained in an unbent position on a substrate of nonmagnetic material. The elements are spot weld attached to a substrate to form a binary coded array of elements according to a desired binary code. The coded substrate may be enclosed in a plastic laminate structure. Such devices may be used for security badges, key cards, and the like and may have many other applications.

  9. Implementation of provider-based electronic medical records and improvement of the quality of data in a large HIV program in Sub-Saharan Africa.

    Directory of Open Access Journals (Sweden)

    Barbara Castelnuovo

    Full Text Available INTRODUCTION: Starting in June 2010 the Infectious Diseases Institute (IDI clinic (a large urban HIV out-patient facility switched to provider-based Electronic Medical Records (EMR from paper EMR entered in the database by data-entry clerks. Standardized clinics forms were eliminated but providers still fill free text clinical notes in physical patients' files. The objective of this study was to compare the rate of errors in the database before and after the introduction of the provider-based EMR. METHODS AND FINDINGS: Data in the database pre and post provider-based EMR was compared with the information in the patients' files and classified as correct, incorrect, and missing. We calculated the proportion of incorrect, missing and total error for key variables (toxicities, opportunistic infections, reasons for treatment change and interruption. Proportions of total errors were compared using chi-square test. A survey of the users of the EMR was also conducted. We compared data from 2,382 visits (from 100 individuals of a retrospective validation conducted in 2007 with 34,957 visits (from 10,920 individuals of a prospective validation conducted in April-August 2011. The total proportion of errors decreased from 66.5% in 2007 to 2.1% in 2011 for opportunistic infections, from 51.9% to 3.5% for ART toxicity, from 82.8% to 12.5% for reasons for ART interruption and from 94.1% to 0.9% for reasons for ART switch (all P<0.0001. The survey showed that 83% of the providers agreed that provider-based EMR led to improvement of clinical care, 80% reported improved access to patients' records, and 80% appreciated the automation of providers' tasks. CONCLUSIONS: The introduction of provider-based EMR improved the quality of data collected with a significant reduction in missing and incorrect information. The majority of providers and clients expressed satisfaction with the new system. We recommend the use of provider-based EMR in large HIV programs in Sub

  10. Continued SOFC cell and stack technology and improved production methods

    Energy Technology Data Exchange (ETDEWEB)

    Wandel, M.; Brodersen, K.; Phair, J. (and others)

    2009-05-15

    Within this project significant results are obtained on a number of very diverse areas ranging from development of cell production, metallic creep in interconnect to assembling and test of stacks with foot print larger than 500 cm2. Out of 38 milestones 28 have been fulfilled and 10 have been partly fulfilled. This project has focused on three main areas: 1) The continued cell development and optimization of manufacturing processes aiming at production of large foot-print cells, improving cell performance and development environmentally more benign production methods. 2) Stack technology - especially stacks with large foot print and improving the stack design with respect to flow geometry and gas leakages. 3) Development of stack components with emphasis on sealing (for 2G as well as 3G), interconnect (coat, architecture and creep) and test development. Production of cells with a foot print larger than 500 cm2 is very difficult due to the brittleness of the cells and great effort has been put into this topic. Eight cells were successfully produced making it possible to assemble and test a real stack thereby giving valuable results on the prospects of stacks with large foot print. However, the yield rate is very low and a significant development to increase this yield lies ahead. Several lessons were learned on the stack level regarding 'large foot print' stacks. Modelling studies showed that the width of the cell primarily is limited by production and handling of the cell whereas the length (in the flow direction) is limited by e.g. pressure drop and necessary manifolding. The optimal cell size in the flow direction was calculated to be between approx20 cm and < 30 cm. From an economical point of view the production yield is crucial and stacks with large foot print cell area are only feasible if the cell production yield is significantly enhanced. Co-casting has been pursued as a production technique due to the possibilities in large scale production

  11. Thermal Modeling Method Improvements for SAGE III on ISS

    Science.gov (United States)

    Liles, Kaitlin; Amundsen, Ruth; Davis, Warren; McLeod, Shawn

    2015-01-01

    The Stratospheric Aerosol and Gas Experiment III (SAGE III) instrument is the fifth in a series of instruments developed for monitoring aerosols and gaseous constituents in the stratosphere and troposphere. SAGE III will be delivered to the International Space Station (ISS) via the SpaceX Dragon vehicle. A detailed thermal model of the SAGE III payload, which consists of multiple subsystems, has been developed in Thermal Desktop (TD). Many innovative analysis methods have been used in developing this model; these will be described in the paper. This paper builds on a paper presented at TFAWS 2013, which described some of the initial developments of efficient methods for SAGE III. The current paper describes additional improvements that have been made since that time. To expedite the correlation of the model to thermal vacuum (TVAC) testing, the chambers and GSE for both TVAC chambers at Langley used to test the payload were incorporated within the thermal model. This allowed the runs of TVAC predictions and correlations to be run within the flight model, thus eliminating the need for separate models for TVAC. In one TVAC test, radiant lamps were used which necessitated shooting rays from the lamps, and running in both solar and IR wavebands. A new Dragon model was incorporated which entailed a change in orientation; that change was made using an assembly, so that any potential additional new Dragon orbits could be added in the future without modification of the model. The Earth orbit parameters such as albedo and Earth infrared flux were incorporated as time-varying values that change over the course of the orbit; despite being required in one of the ISS documents, this had not been done before by any previous payload. All parameters such as initial temperature, heater voltage, and location of the payload are defined based on the case definition. For one component, testing was performed in both air and vacuum; incorporating the air convection in a submodel that was

  12. Global policy and programme guidance on maternal nutrition: what exists, the mechanisms for providing it, and how to improve them?

    Science.gov (United States)

    Shrimpton, Roger

    2012-07-01

    Undernutrition in one form or another affects the majority of women of reproductive age in most developing countries. However, there are few or no effective programmes trying to solve maternal undernutrition problems. The purpose of the paper is to examine global policy and programme guidance mechanisms for nutrition, what their content is with regard to maternal nutrition in particular, as well as how these might be improved. Almost all countries have committed themselves politically to ensuring the right of pregnant and lactating women to good nutrition through the Convention on the Elimination of all Forms of Discrimination Against Women. Despite this, the World Health Organization (WHO) has not endorsed any policy commitments with regard to maternal nutrition. The only policy guidance coming from the various technical departments of WHO relates to the control of maternal anaemia. There is no policy or programme guidance concerning issues of maternal thinness, weight gain during pregnancy and/or low birthweight prevention. Few if any countries have maternal nutrition programmes beyond those for maternal anaemia, and most of those are not effective. The lack of importance given to maternal nutrition is related in part to a weakness of evidence, related to the difficulty of getting ethical clearance, as well as a generalised tendency to downplay the importance of those interventions found to be efficacious. No priority has been given to implementing existing policy and programme guidance for the control of maternal anaemia largely because of a lack of any dedicated funding, linked to a lack of Millennium Development Goals indicator status. This is partly due to the poor evidence base, as well as to the common belief that maternal anaemia programmes were not effective, even if efficacious. The process of providing evidence-based policy and programme guidance to member states is currently being revamped and strengthened by the Department of Nutrition for Health and

  13. New generalized and improved (G′/G-expansion method for nonlinear evolution equations in mathematical physics

    Directory of Open Access Journals (Sweden)

    Hasibun Naher

    2014-10-01

    Full Text Available In this article, new extension of the generalized and improved (G′/G-expansion method is proposed for constructing more general and a rich class of new exact traveling wave solutions of nonlinear evolution equations. To demonstrate the novelty and motivation of the proposed method, we implement it to the Korteweg-de Vries (KdV equation. The new method is oriented toward the ease of utilize and capability of computer algebraic system and provides a more systematic, convenient handling of the solution process of nonlinear equations. Further, obtained solutions disclose a wider range of applicability for handling a large variety of nonlinear partial differential equations.

  14. A study on the improved DTC method for estimations of radionuclide activity in radwaste containers

    International Nuclear Information System (INIS)

    Kang, Sang Hee; Hwang, Ki Ha; Lee, Sang Chul; Lee, Kun Jai; Kim, Tae Wook; Kim, Kyoung Deok; Herr, Young Hoi; Song, Myung Jae

    2004-01-01

    Disposal of rad waste containers requires the assessment of the radioactive contents of each container. Some containers can not be assessed by the γ nuclide analyzer because of time constraint and economical burden. One alternative method, dose to curie conversion (DTC) method can provide an estimate of the container activity. This study evaluates the impact of voids, the chemical composition and density of the material and the distribution of the source related to surface dose rate and the development of the improved DTC method for more accurate assessment

  15. IMPROVING THE METHODS OF ESTIMATION OF THE UNIT TRAIN EFFECTIVENESS

    Directory of Open Access Journals (Sweden)

    Dmytro KOZACHENKO

    2016-09-01

    Full Text Available The article presents the results of studies of freight transportation by unit trains. The article is aimed at developing the methods of the efficiency evaluation of unit train dispatch on the basis of full-scale experiments. Duration of the car turnover is a random variable when dispatching the single cars and group cars, as well as when dispatching them as a part of a unit train. The existing methodologies for evaluating the efficiency of unit trains’ make-up are based on the use of calculation methodologies and their results can give significant errors. The work presents a methodology that makes it possible to evaluate the efficiency of unit train shipments based on the processing of results of experimental travels using the methods of mathematical statistics. This approach provides probabilistic estimates of the rolling stock use efficiency for different approaches to the organization of car traffic volumes, as well as establishes the effect for each of the participants in the transportation process.

  16. An improved method for generating axenic entomopathogenic nematodes.

    Science.gov (United States)

    Yadav, Shruti; Shokal, Upasana; Forst, Steven; Eleftherianos, Ioannis

    2015-09-19

    Steinernema carpocapsae are parasitic nematodes that invade and kill insects. The nematodes are mutualistically associated with the bacteria Xenorhabdus nematophila and together form an excellent model to study pathogen infection processes and host anti-nematode/antibacterial immune responses. To determine the contribution of S. carpocapsae and their associated X. nematophila to the successful infection of insects as well as to investigate the interaction of each mutualistic partner with the insect immune system, it is important to develop and establish robust methods for generating nematodes devoid of their bacteria. To produce S. carpocapsae nematodes without their associated X. nematophila bacteria, we have modified a previous method, which involves the use of a X. nematophila rpoS mutant strain that fails to colonize the intestine of the worms. We confirmed the absence of bacteria in the nematodes using a molecular diagnostic and two rounds of an axenicity assay involving appropriate antibiotics and nematode surface sterilization. We used axenic and symbiotic S. carpocapsae to infect Drosophila melanogaster larvae and found that both types of nematodes were able to cause insect death at similar rates. Generation of entomopathogenic nematodes lacking their mutualistic bacteria provides an excellent tool to dissect the molecular and genetic basis of nematode parasitism and to identify the insect host immune factors that participate in the immune response against nematode infections.

  17. OPPORTUNITIES TO IMPROVE THE MANAGEMENT METHODS OF ROMANIAN ORGANIZATIONS

    Directory of Open Access Journals (Sweden)

    Gheorghe Gabriela

    2013-07-01

    Full Text Available Information Technology has responded to the crisis by change and innovation. Competitive organizations are permanently prepared to identify the cutting-edge technologies which will change the future in business by using the concept of Business Intelligence. Information Technology is developing rapidly and providing decision makers with large amounts of information that require processing and analysis. Business Intelligence are critical decisions support applications, their role being to provide to management, based on information from the company, a landscape of its situation at some time, but also predictions on the medium and long term. This paper describes the architecture of the Business Intelligence Platform and highlights the benefits of using decision support systems for business applications. Nowadays, company executives require relevant and accurate business information in real-time to take strategic decisions. It is also essential to have freedom to access this information anywhere and anytime. There is a real need to extend this functionality beyond the office and on the fingertips of the decision makers. After a presentation of the concept of Data mining with examples from a case study, the paper focuses on the potential of the IT&C decisional sector, which embeds simulation and assistance tools for managerial decisions. Developing new methods for predictive modelling and application of existing techniques in many areas will be a permanent concern for both researchers and companies that are interested to gain competitive advantages.

  18. A new method for improving security in MANETs AODV Protocol

    Directory of Open Access Journals (Sweden)

    Zahra Alishahi

    2012-10-01

    Full Text Available In mobile ad hoc network (MANET, secure communication is more challenging task due to its fundamental characteristics like having less infrastructure, wireless link, distributed cooperation, dynamic topology, lack of association, resource constrained and physical vulnerability of node. In MANET, attacks can be broadly classified in two categories: routing attacks and data forwarding attacks. Any action not following rules of routing protocols belongs to routing attacks. The main objective of routing attacks is to disrupt normal functioning of network by advertising false routing updates. On the other hand, data forwarding attacks include actions such as modification or dropping data packet, which does not disrupt routing protocol. In this paper, we address the “Packet Drop Attack”, which is a serious threat to operational mobile ad hoc networks. The consequence of not forwarding other packets or dropping other packets prevents any kind of communication to be established in the network. Therefore, there is a need to address the packet dropping event takes higher priority for the mobile ad hoc networks to emerge and to operate, successfully. In this paper, we propose a method to secure ad hoc on-demand distance vector (AODV routing protocol. The proposed method provides security for routing packets where the malicious node acts as a black-hole and drops packets. In this method, the collaboration of a group of nodes is used to make accurate decisions. Validating received RREPs allows the source to select trusted path to its destination. The simulation results show that the proposed mechanism is able to detect any number of attackers.

  19. Incorporating technology buying behaviour into UK-based long term domestic stock energy models to provide improved policy analysis

    International Nuclear Information System (INIS)

    Lee, Timothy; Yao, Runming

    2013-01-01

    The UK has a target for an 80% reduction in CO 2 emissions by 2050 from a 1990 base. Domestic energy use accounts for around 30% of total emissions. This paper presents a comprehensive review of existing models and modelling techniques and indicates how they might be improved by considering individual buying behaviour. Macro (top-down) and micro (bottom-up) models have been reviewed and analysed. It is found that bottom-up models can project technology diffusion due to their higher resolution. The weakness of existing bottom-up models at capturing individual green technology buying behaviour has been identified. Consequently, Markov chains, neural networks and agent-based modelling are proposed as possible methods to incorporate buying behaviour within a domestic energy forecast model. Among the three methods, agent-based models are found to be the most promising, although a successful agent approach requires large amounts of input data. A prototype agent-based model has been developed and tested, which demonstrates the feasibility of an agent approach. This model shows that an agent-based approach is promising as a means to predict the effectiveness of various policy measures. - Highlights: ► Long term energy models are reviewed with a focus on UK domestic stock models. ► Existing models are found weak in modelling green technology buying behaviour. ► Agent models, Markov chains and neural networks are considered as solutions. ► Agent-based modelling (ABM) is found to be the most promising approach. ► A prototype ABM is developed and testing indicates a lot of potential.

  20. Olympic weightlifting and plyometric training with children provides similar or greater performance improvements than traditional resistance training.

    Science.gov (United States)

    Chaouachi, Anis; Hammami, Raouf; Kaabi, Sofiene; Chamari, Karim; Drinkwater, Eric J; Behm, David G

    2014-06-01

    A number of organizations recommend that advanced resistance training (RT) techniques can be implemented with children. The objective of this study was to evaluate the effectiveness of Olympic-style weightlifting (OWL), plyometrics, and traditional RT programs with children. Sixty-three children (10-12 years) were randomly allocated to a 12-week control OWL, plyometric, or traditional RT program. Pre- and post-training tests included body mass index (BMI), sum of skinfolds, countermovement jump (CMJ), horizontal jump, balance, 5- and 20-m sprint times, isokinetic force and power at 60 and 300° · s(-1). Magnitude-based inferences were used to analyze the likelihood of an effect having a standardized (Cohen's) effect size exceeding 0.20. All interventions were generally superior to the control group. Olympic weightlifting was >80% likely to provide substantially better improvements than plyometric training for CMJ, horizontal jump, and 5- and 20-m sprint times, whereas >75% likely to substantially exceed traditional RT for balance and isokinetic power at 300° · s(-1). Plyometric training was >78% likely to elicit substantially better training adaptations than traditional RT for balance, isokinetic force at 60 and 300° · s(-1), isokinetic power at 300° · s(-1), and 5- and 20-m sprints. Traditional RT only exceeded plyometric training for BMI and isokinetic power at 60° · s(-1). Hence, OWL and plyometrics can provide similar or greater performance adaptations for children. It is recommended that any of the 3 training modalities can be implemented under professional supervision with proper training progressions to enhance training adaptations in children.

  1. THE SIMULATION DIAGNOSTIC METHODS AND REGENERATION WAYS OF REINFORCED - CONCRETE CONSTRUCTIONS OF BRIDGES IN PROVIDING THEIR OPERATING RELIABILITY AND LONGEVITY

    Directory of Open Access Journals (Sweden)

    B. V. Savchinskiy

    2010-03-01

    Full Text Available On the basis of analysis of existing diagnostic methods and regeneration ways of reinforced-concrete constructions of bridges the recommendations on introduction of new modern technologies of renewal of reinforced-concrete constructions of bridges in providing their operating reliability and longevity are offered.

  2. THE SIMULATION DIAGNOSTIC METHODS AND REGENERATION WAYS OF REINFORCED - CONCRETE CONSTRUCTIONS OF BRIDGES IN PROVIDING THEIR OPERATING RELIABILITY AND LONGEVITY

    OpenAIRE

    B. V. Savchinskiy

    2010-01-01

    On the basis of analysis of existing diagnostic methods and regeneration ways of reinforced-concrete constructions of bridges the recommendations on introduction of new modern technologies of renewal of reinforced-concrete constructions of bridges in providing their operating reliability and longevity are offered.

  3. A Mixed-Methods Investigation of Early Childhood Professional Development for Providers and Recipients in the United States

    Science.gov (United States)

    Linder, Sandra M.; Rembert, Kellye; Simpson, Amber; Ramey, M. Deanna

    2016-01-01

    This multi-phase mixed-methods study explores provider and recipient perceptions of the current state of early childhood professional development in a southeastern area of the United States. Professional development for the early childhood workforce has been shown to positively influence the quality of early childhood classrooms. This study…

  4. Perceptions of vaginal microbicides as an HIV prevention method among health care providers in KwaZulu-Natal, South Africa

    Directory of Open Access Journals (Sweden)

    Mantell Joanne E

    2007-03-01

    Full Text Available Abstract Background The promise of microbicides as an HIV prevention method will not be realized if not supported by health care providers. They are the primary source of sexual health information for potential users, in both the public and private health sectors. Therefore, the aim of this study was to determine perceptions of vaginal microbicides as a potential HIV prevention method among health care providers in Durban and Hlabisa, South Africa, using a combination of quantitative and qualitative methods. Results During 2004, semi structured interviews with 149 health care providers were conducted. Fifty seven percent of hospital managers, 40% of pharmacists and 35% of nurses possessed some basic knowledge of microbicides, such as the product being used intra-vaginally before sex to prevent HIV infection. The majority of them were positive about microbicides and were willing to counsel users regarding potential use. Providers from both public and private sectors felt that an effective microbicide should be available to all people, regardless of HIV status. Providers felt that the product should be accessed over-the-counter in pharmacies and in retail stores. They also felt a need for potential microbicides to be available free of charge, and packaged with clear instructions. The media was seen by health care providers as being an effective strategy for promoting microbicides. Conclusion Overall, health care providers were very positive about the possible introduction of an effective microbicide for HIV prevention. The findings generated by this study illustrated the need for training health care providers prior to making the product accessible, as well as the importance of addressing the potential barriers to use of the product by women. These are important concerns in the health care community, and this study also served to educate them for the day when research becomes reality.

  5. Calculation of the energy provided by a PV generator. Comparative study: Conventional methods vs. artificial neural networks

    International Nuclear Information System (INIS)

    Almonacid, F.; Rus, C.; Perez-Higueras, P.; Hontoria, L.

    2011-01-01

    The use of photovoltaics for electricity generation purposes has recorded one of the largest increases in the field of renewable energies. The energy production of a grid-connected PV system depends on various factors. In a wide sense, it is considered that the annual energy provided by a generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. However, a range of factors is influencing the expected outcome by reducing the generation of energy. The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network developed by the R and D Group for Solar and Automatic Energy at the University of Jaen. The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study, mainly due to the fact that this method takes also into account some second order effects, such as low irradiance, angular and spectral effects. -- Research highlights: → It is considered that the annual energy provided by a PV generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. → A range of factors are influencing the expected outcome by reducing the generation of energy (mismatch losses, dirt and dust, Ohmic losses,.). → The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network. → The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study. While classical methods have only taken into account temperature losses, the method based in

  6. Benchmarking: a method for continuous quality improvement in health.

    Science.gov (United States)

    Ettorchi-Tardy, Amina; Levif, Marie; Michel, Philippe

    2012-05-01

    Benchmarking, a management approach for implementing best practices at best cost, is a recent concept in the healthcare system. The objectives of this paper are to better understand the concept and its evolution in the healthcare sector, to propose an operational definition, and to describe some French and international experiences of benchmarking in the healthcare sector. To this end, we reviewed the literature on this approach's emergence in the industrial sector, its evolution, its fields of application and examples of how it has been used in the healthcare sector. Benchmarking is often thought to consist simply of comparing indicators and is not perceived in its entirety, that is, as a tool based on voluntary and active collaboration among several organizations to create a spirit of competition and to apply best practices. The key feature of benchmarking is its integration within a comprehensive and participatory policy of continuous quality improvement (CQI). Conditions for successful benchmarking focus essentially on careful preparation of the process, monitoring of the relevant indicators, staff involvement and inter-organizational visits. Compared to methods previously implemented in France (CQI and collaborative projects), benchmarking has specific features that set it apart as a healthcare innovation. This is especially true for healthcare or medical-social organizations, as the principle of inter-organizational visiting is not part of their culture. Thus, this approach will need to be assessed for feasibility and acceptability before it is more widely promoted.

  7. Method for Improving Indoor Positioning Accuracy Using Extended Kalman Filter

    Directory of Open Access Journals (Sweden)

    Seoung-Hyeon Lee

    2016-01-01

    Full Text Available Beacons using bluetooth low-energy (BLE technology have emerged as a new paradigm of indoor positioning service (IPS because of their advantages such as low power consumption, miniaturization, wide signal range, and low cost. However, the beacon performance is poor in terms of the indoor positioning accuracy because of noise, motion, and fading, all of which are characteristics of a bluetooth signal and depend on the installation location. Therefore, it is necessary to improve the accuracy of beacon-based indoor positioning technology by fusing it with existing indoor positioning technology, which uses Wi-Fi, ZigBee, and so forth. This study proposes a beacon-based indoor positioning method using an extended Kalman filter that recursively processes input data including noise. After defining the movement of a smartphone on a flat two-dimensional surface, it was assumed that the beacon signal is nonlinear. Then, the standard deviation and properties of the beacon signal were analyzed. According to the analysis results, an extended Kalman filter was designed and the accuracy of the smartphone’s indoor position was analyzed through simulations and tests. The proposed technique achieved good indoor positioning accuracy, with errors of 0.26 m and 0.28 m from the average x- and y-coordinates, respectively, based solely on the beacon signal.

  8. Time Matters: Increasing the Efficiency of Antarctic Marine Geology and Paleoceanography Expeditions by Providing Improved Sediment Chronology

    Science.gov (United States)

    Rosenheim, B. E.; Domack, E. W.; Shevenell, A.; Subt, C.

    2015-12-01

    To maximize the areal extent of Antarctic sedimentary records of past deglaciation, it is necessary to ensure more sediment cores can be adequately dated. Antarctic margin sediment is challenging to date due to the lack of preserved calcium carbonate, but the records contained in these sediments readily recount the history of deglaciation. Recent and continued development of new chronological methods for Antarctic margin sediments have allowed better use of the efforts of marine geological coring expeditions to the region. The development of Ramped PyrOx radiocarbon dating has allowed us to 1. improve dates in deglacial sediments where no carbonate is preserved, 2. date glacial sediments lying below the tills marking the last glaciation, and 3. compile core chronologies into a regional framework of ice shelf collapse that has eluded many marine geology campaigns over the last few decades. These advances in a fundamental aspect of geological sciences will put the U.S. and international community on a better foothold to interpret the past as it relates to our warming future. We will present these advances in chronology as well as the science that is enabled by them, while arguing that the future of Antarctic marine science also depends on investments in shore-based technologies that come at a relatively low cost.

  9. Bariatric Surgery Prior to Total Joint Arthroplasty May Not Provide Dramatic Improvements In Post Arthroplasty Surgical Outcomes

    Science.gov (United States)

    Paxton, Elizabeth W.; Fisher, David; Li, Robert A.; Barber, Thomas C.; Singh, Jasvinder A.

    2014-01-01

    This study compared the total joint arthroplasty (TJA) surgical outcomes of patients who had bariatric surgery prior to TJA to TJA patients who were candidates but did not have bariatric surgery. Patients were retrospectively grouped into: Group 1 (n=69), those with bariatric surgery >2 years prior to TJA, Group 2 (n=102), those with surgery within 2 years of TJA, and Group 3 (n=11,032), those without bariatric surgery. In Group 1, 2.9% (95%CI 0.0–6.9%) had complications within 1 year compared to 5.9% (95%CI 1.3–10.4%) in Group 2, and 4.1% (95%CI 3.8–4.5%) in Group 3. 90-day readmission (7.2%, 95%CI 1.1–13.4%) and revision density (3.4/100 years of observation) was highest in Group 1. Bariatric surgery prior to TJA may not provide dramatic improvements in post-operative TJA surgical outcomes. PMID:24674730

  10. Does routine psychosocial screening improve referral to psychosocial care providers and patient-radiotherapist communication? A cluster randomized controlled trial.

    Science.gov (United States)

    Braeken, Anna P B M; Lechner, Lilian; Eekers, Daniëlle B P; Houben, Ruud M A; van Gils, Francis C J M; Ambergen, Ton; Kempen, Gertrudis I J M

    2013-11-01

    This study tests whether using a screening instrument improves referral to psychosocial care providers (e.g. psychologist) and facilitates patient-radiotherapist communication. A cluster randomized controlled trial was used. Fourteen radiotherapists were randomly allocated to the experimental or control group and 568 of their patients received care in accordance with the group to which their radiotherapist was allocated. Patients in the experimental group were asked to complete a screening instrument before and at the end of the radiation treatment period. All patients were requested to complete questionnaires concerning patient-physician communication after the first consultation and concerning psychosocial care 3 and 12 months post-intervention. Patients who completed the screening instrument were referred to social workers at an earlier stage than patients who did not (Pcommunication. Our results suggest that a simple screening procedure can be valuable for the timely treatment of psychosocial problems in patients. Future efforts should be directed at appropriate timing of screening and enhancing physicians' awareness regarding the importance of identifying, discussing and treating psychosocial problems in cancer patients. Psychosocial screening can be enhanced by effective radiotherapist-patient communication. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  11. Polar Bears or People?: How Framing Can Provide a Useful Analytic Tool to Understand & Improve Climate Change Communication in Classrooms

    Science.gov (United States)

    Busch, K. C.

    2014-12-01

    Not only will young adults bear the brunt of climate change's effects, they are also the ones who will be required to take action - to mitigate and to adapt. The Next Generation Science Standards include climate change, ensuring the topic will be covered in U.S. science classrooms in the near future. Additionally, school is a primary source of information about climate change for young adults. The larger question, though, is how can the teaching of climate change be done in such a way as to ascribe agency - a willingness to act - to students? Framing - as both a theory and an analytic method - has been used to understand how language in the media can affect the audience's intention to act. Frames function as a two-way filter, affecting both the message sent and the message received. This study adapted both the theory and the analytic methods of framing, applying them to teachers in the classroom to answer the research question: How do teachers frame climate change in the classroom? To answer this question, twenty-five lessons from seven teachers were analyzed using semiotic discourse analysis methods. It was found that the teachers' frames overlapped to form two distinct discourses: a Science Discourse and a Social Discourse. The Science Discourse, which was dominant, can be summarized as: Climate change is a current scientific problem that will have profound global effects on the Earth's physical systems. The Social Discourse, used much less often, can be summarized as: Climate change is a future social issue because it will have negative impacts at the local level on people. While it may not be surprising that the Science Discourse was most often heard in these science classrooms, it is possibly problematic if it were the only discourse used. The research literature on framing indicates that the frames found in the Science Discourse - global scale, scientific statistics and facts, and impact on the Earth's systems - are not likely to inspire action-taking. This

  12. Bionic optimization in structural design stochastically based methods to improve the performance of parts and assemblies

    CERN Document Server

    Gekeler, Simon

    2016-01-01

    The book provides suggestions on how to start using bionic optimization methods, including pseudo-code examples of each of the important approaches and outlines of how to improve them. The most efficient methods for accelerating the studies are discussed. These include the selection of size and generations of a study’s parameters, modification of these driving parameters, switching to gradient methods when approaching local maxima, and the use of parallel working hardware. Bionic Optimization means finding the best solution to a problem using methods found in nature. As Evolutionary Strategies and Particle Swarm Optimization seem to be the most important methods for structural optimization, we primarily focus on them. Other methods such as neural nets or ant colonies are more suited to control or process studies, so their basic ideas are outlined in order to motivate readers to start using them. A set of sample applications shows how Bionic Optimization works in practice. From academic studies on simple fra...

  13. Impact of an online medical internet site on knowledge and practice of health care providers: a mixed methods study of the Spinal Cord Injury Rehabilitation Evidence project.

    Science.gov (United States)

    Eng, Janice J; Noonan, Vanessa K; Townson, Andrea F; Higgins, Caroline E; Rogers, Jess; Wolfe, Dalton L

    2014-12-23

    It is not known whether ongoing access to a broad-based Internet knowledge resource can influence the practice of health care providers. We undertook a study to evaluate the impact of a Web-based knowledge resource on increasing access to evidence and facilitating best practice of health care providers. The objective of this study was to evaluate (1) the impact of the Spinal Cord Injury Rehabilitation Evidence (SCIRE) project on access to information for health care providers and researchers and (2) how SCIRE influenced health care providers' management of clients. A 4-part mixed methods evaluation was undertaken: (1) monitoring website traffic and utilization using Google Analytics, (2) online survey of users who accessed the SCIRE website, (3) online survey of targeted end-users, that is, rehabilitation health care providers known to work with spinal cord injury (SCI) clients, as well as researchers, and (4) focus groups with health care providers who had previously accessed SCIRE. The online format allowed the content for a relatively specialized field to have far reach (eg, 26 countries and over 6500 users per month). The website survey and targeted end-user survey confirmed that health care providers, as well as researchers perceived that the website increased their access to SCI evidence. Access to SCIRE not only improved knowledge of SCI evidence but helped inform changes to the health providers' clinical practice and improved their confidence in treating SCI clients. The SCIRE information directly influenced the health providers' clinical decision making, in terms of choice of intervention, equipment needs, or assessment tool. A Web-based knowledge resource may be a relatively inexpensive method to increase access to evidence-based information, increase knowledge of the evidence, inform changes to the health providers' practice, and influence their clinical decision making.

  14. Improving protein function prediction methods with integrated literature data

    Directory of Open Access Journals (Sweden)

    Gabow Aaron P

    2008-04-01

    Full Text Available Abstract Background Determining the function of uncharacterized proteins is a major challenge in the post-genomic era due to the problem's complexity and scale. Identifying a protein's function contributes to an understanding of its role in the involved pathways, its suitability as a drug target, and its potential for protein modifications. Several graph-theoretic approaches predict unidentified functions of proteins by using the functional annotations of better-characterized proteins in protein-protein interaction networks. We systematically consider the use of literature co-occurrence data, introduce a new method for quantifying the reliability of co-occurrence and test how performance differs across species. We also quantify changes in performance as the prediction algorithms annotate with increased specificity. Results We find that including information on the co-occurrence of proteins within an abstract greatly boosts performance in the Functional Flow graph-theoretic function prediction algorithm in yeast, fly and worm. This increase in performance is not simply due to the presence of additional edges since supplementing protein-protein interactions with co-occurrence data outperforms supplementing with a comparably-sized genetic interaction dataset. Through the combination of protein-protein interactions and co-occurrence data, the neighborhood around unknown proteins is quickly connected to well-characterized nodes which global prediction algorithms can exploit. Our method for quantifying co-occurrence reliability shows superior performance to the other methods, particularly at threshold values around 10% which yield the best trade off between coverage and accuracy. In contrast, the traditional way of asserting co-occurrence when at least one abstract mentions both proteins proves to be the worst method for generating co-occurrence data, introducing too many false positives. Annotating the functions with greater specificity is harder

  15. An adaptive sampling method for variable-fidelity surrogate models using improved hierarchical kriging

    Science.gov (United States)

    Hu, Jiexiang; Zhou, Qi; Jiang, Ping; Shao, Xinyu; Xie, Tingli

    2018-01-01

    Variable-fidelity (VF) modelling methods have been widely used in complex engineering system design to mitigate the computational burden. Building a VF model generally includes two parts: design of experiments and metamodel construction. In this article, an adaptive sampling method based on improved hierarchical kriging (ASM-IHK) is proposed to refine the improved VF model. First, an improved hierarchical kriging model is developed as the metamodel, in which the low-fidelity model is varied through a polynomial response surface function to capture the characteristics of a high-fidelity model. Secondly, to reduce local approximation errors, an active learning strategy based on a sequential sampling method is introduced to make full use of the already required information on the current sampling points and to guide the sampling process of the high-fidelity model. Finally, two numerical examples and the modelling of the aerodynamic coefficient for an aircraft are provided to demonstrate the approximation capability of the proposed approach, as well as three other metamodelling methods and two sequential sampling methods. The results show that ASM-IHK provides a more accurate metamodel at the same simulation cost, which is very important in metamodel-based engineering design problems.

  16. Providing education on evidence-based practice improved knowledge but did not change behaviour: a before and after study

    Directory of Open Access Journals (Sweden)

    Lovarini Meryl

    2005-12-01

    Full Text Available Abstract Background Many health professionals lack the skills to find and appraise published research. This lack of skills and associated knowledge needs to be addressed, and practice habits need to change, for evidence-based practice to occur. The aim of this before and after study was to evaluate the effect of a multifaceted intervention on the knowledge, skills, attitudes and behaviour of allied health professionals. Methods 114 self-selected occupational therapists were recruited. The intervention included a 2-day workshop combined with outreach support for eight months. Support involved email and telephone contact and a workplace visit. Measures were collected at baseline, post-workshop, and eight months later. The primary outcome was knowledge, measured using the Adapted Fresno Test of Evidence-Based Practice (total score 0 to 156. Secondary outcomes were attitude to evidence-based practice (% reporting improved skills and confidence; % reporting barriers, and behaviour measured using an activity diary (% engaging/not engaging in search and appraisal activities, and assignment completion. Results Post-workshop, there were significant gains in knowledge which were maintained at follow-up. The mean difference in the Adapted Fresno Test total score was 20.6 points (95% CI, 15.6 to 25.5. The change from post-workshop to follow-up was small and non-significant (mean difference 1.2 points, 95% CI, -6.0 to 8.5. Fewer participants reported lack of searching and appraisal skills as barriers to evidence-based practice over time (searching = 61%, 53%, 24%; appraisal 60%, 65%, 41%. These differences were statistically significant (p = 0.0001 and 0.010 respectively. Behaviour changed little. Pre-workshop, 6% engaged in critical appraisal increasing to 18% post-workshop and 18% at follow-up. Nearly two thirds (60% were not reading any research literature at follow-up. Twenty-three participants (20.2% completed their assignment. Conclusion Evidence

  17. A combined usage of stochastic and quantitative risk assessment methods in the worksites: Application on an electric power provider

    International Nuclear Information System (INIS)

    Marhavilas, P.K.; Koulouriotis, D.E.

    2012-01-01

    An individual method cannot build either a realistic forecasting model or a risk assessment process in the worksites, and future perspectives should focus on the combined forecasting/estimation approach. The main purpose of this paper is to gain insight into a risk prediction and estimation methodological framework, using the combination of three different methods, including the proportional quantitative-risk-assessment technique (PRAT), the time-series stochastic process (TSP), and the method of estimating the societal-risk (SRE) by F–N curves. In order to prove the usefulness of the combined usage of stochastic and quantitative risk assessment methods, an application on an electric power provider industry is presented to, using empirical data.

  18. Application of quality-improvement methods in a community practice: the Sandhills Pediatrics Asthma Initiative.

    Science.gov (United States)

    Wroth, Thomas H; Boals, Joseph C

    2005-01-01

    This case study demonstrates the use of quality improvement methods to improve asthma care in a busy community practice. The practice used disease-management strategies, such as population identification, self-management education, and performance measurement and feedback. The practice then applied several practice-based quality improvement methods, such as PDSA cycles, to improve care. From 1998 to 2003, process measures, such as staging of asthmatics, use of long-term control medications, use of peak flow meters and spacers, and use of action plans, improved. There was also a substantial decrease in emergency department use and hospitalizations among patients with asthma. Although there have been several studies demonstrating the efficacy of disease management strategies, most lack generalizability to community practices. Often, interventions are so intensive and cumbersome, that they are unlikely to be replicated in primary care setting. Researchers have been unable to determine which components of the interventions are most effective and replicable. Furthermore, many studies of disease management strategies enroll participants who lack the co-morbidities seen in community practice. There are also few studies of disadvantaged populations that face other barriers to care, such as lack of transportation, poor access to specialists, and medical illiteracy. In this case study, there were several unique factors that enabled the practice to improve care for this population. The AccessCare case manager who worked with the practice not only provided data and feedback to the practice team, but also served as an improvement "coach," often pushing the team and facilitating many of the improvement efforts. AccessCare's approach is in contrast to many of the commercial disease management companies' "carve out" models that do not sufficiently involve providers or practices in their interventions. The other necessary ingredient for success in this project was organizational

  19. COMPARISON OF CRM PROGRAMS BASING ON IMPROVING CUSTOMER PROFITABILITY: USING THE AHP METHOD

    Directory of Open Access Journals (Sweden)

    Dong-Fei Xue

    2014-04-01

    Full Text Available In this paper, we generalize the cause-related marketing (CRM methods that used by most current enterprises. And then, we probe into the difference of the effects of different types of CRM programs aiming at improving customer profitability by analytic hierarchy process (AHP. Consequently, we find out the sequencing results and provide some reference to the enterprises while performing CRM programs.

  20. An Improved Method to Measure the Cosmic Curvature

    Energy Technology Data Exchange (ETDEWEB)

    Wei, Jun-Jie; Wu, Xue-Feng, E-mail: jjwei@pmo.ac.cn [Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing 210008 (China)

    2017-04-01

    In this paper, we propose an improved model-independent method to constrain the cosmic curvature by combining the most recent Hubble parameter H ( z ) and supernovae Ia (SNe Ia) data. Based on the H ( z ) data, we first use the model-independent smoothing technique, Gaussian processes, to construct a distance modulus μ {sub H} ( z ), which is susceptible to the cosmic curvature parameter Ω{sub k}. In contrary to previous studies, the light-curve-fitting parameters, which account for the distance estimation of SN (μ {sub SN}( z )), are set free to investigate whether Ω {sub k} has a dependence on them. By comparing μ {sub H} ( z ) to μ {sub SN}(z), we put limits on Ω {sub k}. Our results confirm that Ω {sub k} is independent of the SN light-curve parameters. Moreover, we show that the measured Ω {sub k} is in good agreement with zero cosmic curvature, implying that there is no significant deviation from a flat universe at the current observational data level. We also test the influence of different H(z) samples and different Hubble constant H {sub 0} values, finding that different H(z) samples do not have a significant impact on the constraints. However, different H {sub 0} priors can affect the constraints of Ω {sub k} to some degree. The prior of H {sub 0} = 73.24 ± 1.74 km s{sup −1} Mpc{sup −1} gives a value of Ω {sub k}, a little bit above the 1 σ confidence level away from 0, but H{sub 0} = 69.6 ± 0.7 km s{sup −1} Mpc{sup −1} gives it below 1 σ .

  1. Opportunities for improved diabetes care among patients of safety net practices: a safety net providers' strategic alliance study.

    Science.gov (United States)

    Reichsman, Ann; Werner, James; Cella, Peggi; Bobiak, Sarah; Stange, Kurt C

    2009-01-01

    To identify barriers and opportunities for quality diabetes care in safety net practices. In 3 federally qualified health centers and 1 free clinic, 19 primary care clinicians profiled patient and visit characteristics and quality of care measures for 181 consecutive visits by adult type 2 diabetic patients. Open-ended questions assessed patient and clinician perception of barriers to diabetes care and patient report of enabling factors. A multidisciplinary team identified themes from open-ended responses. Logistic regression analyses assessed the association of the identified barriers/enablers with 2 measures of quality care: glycosylated hemoglobin and prophylactic aspirin use. Ranked barriers noted by patients included adherence (40%), financial/insurance (23%), and psychosocial (13%) factors. Clinicians ranked systemic factors, including financial/ insurance (32%) and cultural/psychosocial (29%) factors, as important to adherence (29%) in determining quality diabetes care. Patients reported dietary and medical adherence (37%) and family/health care worker support (17%) as helpful factors. Among 175 patients with available data, glycosylated hemoglobin levels were associated with patient report of financial/insurance factors both as a barrier when visits and medications were unaffordable and as an opportunity when free or low-cost medications and services were provided. Patients' adherence with aspirin prophylaxis was strongly associated with African American race, prior prescription of aspirin and distribution of aspirin at the practice site (p<.001). Patients were less likely than clinicians to identify systemic and contextual factors contributing to poor diabetes care. From the front line's perspective, enabling patient self-management and systemic support is a target for improving diabetes care in safety net practices.

  2. Sun protection provided by regulation school uniforms in Australian schools: an opportunity to improve personal sun protection during childhood.

    Science.gov (United States)

    Turner, Denise; Harrison, Simone L

    2014-01-01

    Childhood sun exposure is linked to excessive pigmented mole development and melanoma risk. Clothing provides a physical barrier, protecting skin from ultraviolet radiation (UVR). Extending sleeves to elbow length and shorts to knee length has been shown to significantly reduce mole acquisition in preschoolers from tropical Queensland. We used publicly available uniform images and guidelines from primary schools in Townsville (latitude 19.25°S, n = 43 schools), Cairns (16.87°S, n = 46) and the Atherton Tablelands (17.26°S, n = 23) in tropical Australia to objectively determine the body surface proportion covered by regulation school uniforms. Uniforms of nongovernment, large (≥800 students), urban, educationally advantaged schools with comprehensive sun protection policies covered more skin than those of government schools (63.2% vs 62.0%; P schools (63.4% vs 62.3%; P = 0.009), rural (62.7% vs 61.9%; P = 0.002) and educationally disadvantaged schools (62.8% vs 62.3%; P school uniforms covered identical body surface proportions (62.4%, P = 0.084). Although wearing regulation school uniforms is mandatory at most Australian primary schools, this opportunity to improve children's sun protection is largely overlooked. Recent evidence suggests that even encouraging minor alterations to school uniforms (e.g. slightly longer sleeves/dresses/skirts/shorts) to increase skin coverage may reduce mole acquisition and melanoma risk, especially in high-risk populations. © 2014 The American Society of Photobiology.

  3. Undergraduate medical textbooks do not provide adequate information on intravenous fluid therapy: a systematic survey and suggestions for improvement.

    Science.gov (United States)

    Powell, Arfon G M T; Paterson-Brown, Simon; Drummond, Gordon B

    2014-02-20

    Inappropriate prescribing of intravenous (IV) fluid, particularly 0.9% sodium chloride, causes post-operative complications. Fluid prescription is often left to junior medical staff and is frequently poorly managed. One reason for poor intravenous fluid prescribing practices could be inadequate coverage of this topic in the textbooks that are used. We formulated a comprehensive set of topics, related to important common clinical situations involving IV fluid therapy, (routine fluid replacement, fluid loss, fluids overload) to assess the adequacy of textbooks in common use. We assessed 29 medical textbooks widely available to students in the UK, scoring the presence of information provided by each book on each of the topics. The scores indicated how fully the topics were considered: not at all, partly, and adequately. No attempt was made to judge the quality of the information, because there is no consensus on these topics. The maximum score that a book could achieve was 52. Three of the topics we chose were not considered by any of the books. Discounting these topics as "too esoteric", the maximum possible score became 46. One textbook gained a score of 45, but the general score was poor (median 11, quartiles 4, 21). In particular, coverage of routine postoperative management was inadequate. Textbooks for undergraduates cover the topic of intravenous therapy badly, which may partly explain the poor knowledge and performance of junior doctors in this important field. Systematic revision of current textbooks might improve knowledge and practice by junior doctors. Careful definition of the remit and content of textbooks should be applied more widely to ensure quality and "fitness for purpose", and avoid omission of vital knowledge.

  4. Educating early childhood care and education providers to improve knowledge and attitudes about reporting child maltreatment: A randomized controlled trial.

    Directory of Open Access Journals (Sweden)

    Ben Mathews

    Full Text Available Early childhood care and education providers (CCPs work with over 7 million young children. These children are vulnerable to physical, sexual and emotional abuse, and neglect. However, CCPs make less than 1% of all reports of suspected child abuse and neglect that are made to child protective services. CCPs are therefore an untapped resource in the public health response to child maltreatment. However, their knowledge and attitudes about duties to report child maltreatment are poorly understood. Moreover, no rigorous research has tested whether their knowledge and attitudes about reporting child maltreatment can be improved. These gaps in knowledge are important because knowledge of the duty and positive attitudes towards it produce more effective reporting, and little evidence exists about how to enhance cognitive and affective attributes. Using the CONSORT approach, we report a single-blind test-retest randomized controlled trial evaluating iLook Out for Child Abuse, a customized online educational intervention for CCPs to increase knowledge and attitudes towards the reporting duty. 762 participants were randomized with results analyzed for 741 participants (372 in the intervention group; 369 in the control. Knowledge of the reporting duty increased in the intervention group from 13.54 to 16.19 out of 21 (2.65 increase, 95% CI: (2.37, 2.93; large effect size 0.95, p < 0.001; the control group remained stable, moving from 13.54 to 13.59 (0.05 increase, 95% CI: (-0.12, 0.22; negligible effect size 0.03, p = 0.684. Attitudes were enhanced on all 13 items for the intervention group, remaining stable in the control, with significant differences between groups on all items (p < 0.05. Gains were largely sustained at four month follow-up. Findings support education for CCPs and other professions. Future research should also explore effects of education on reporting behavior.US National Institutes of Health NCT02225301.

  5. Educating early childhood care and education providers to improve knowledge and attitudes about reporting child maltreatment: A randomized controlled trial.

    Science.gov (United States)

    Mathews, Ben; Yang, Chengwu; Lehman, Erik B; Mincemoyer, Claudia; Verdiglione, Nicole; Levi, Benjamin H

    2017-01-01

    Early childhood care and education providers (CCPs) work with over 7 million young children. These children are vulnerable to physical, sexual and emotional abuse, and neglect. However, CCPs make less than 1% of all reports of suspected child abuse and neglect that are made to child protective services. CCPs are therefore an untapped resource in the public health response to child maltreatment. However, their knowledge and attitudes about duties to report child maltreatment are poorly understood. Moreover, no rigorous research has tested whether their knowledge and attitudes about reporting child maltreatment can be improved. These gaps in knowledge are important because knowledge of the duty and positive attitudes towards it produce more effective reporting, and little evidence exists about how to enhance cognitive and affective attributes. Using the CONSORT approach, we report a single-blind test-retest randomized controlled trial evaluating iLook Out for Child Abuse, a customized online educational intervention for CCPs to increase knowledge and attitudes towards the reporting duty. 762 participants were randomized with results analyzed for 741 participants (372 in the intervention group; 369 in the control). Knowledge of the reporting duty increased in the intervention group from 13.54 to 16.19 out of 21 (2.65 increase, 95% CI: (2.37, 2.93); large effect size 0.95, p < 0.001); the control group remained stable, moving from 13.54 to 13.59 (0.05 increase, 95% CI: (-0.12, 0.22); negligible effect size 0.03, p = 0.684). Attitudes were enhanced on all 13 items for the intervention group, remaining stable in the control, with significant differences between groups on all items (p < 0.05). Gains were largely sustained at four month follow-up. Findings support education for CCPs and other professions. Future research should also explore effects of education on reporting behavior. US National Institutes of Health NCT02225301.

  6. Strategies for improving quality and methods for innovation services

    Directory of Open Access Journals (Sweden)

    Bajić Milan

    2009-01-01

    Full Text Available Contemporary concepts of business of service organisations, focus their researches on measuring quality of the services and identification of mistakes. The aim of strategies is the improvement of quality. Marketing concepts shows that the constant creation of new products and the modification of characteristics on the old products, makes possible market strategy that stimulates development of activities. This paper is focusing on the improving of service using the strategies that can innovate and improve the services. Paper seeks to demonstrate one of possible observations and importance of performance, combined with blueprinting of services and benchmarking as a useful strategies for improving and innovation of services.

  7. Evaluation of protection factors provided by full-face masks using man-test method at workplace

    International Nuclear Information System (INIS)

    Izumi, Yukio; Kinouchi, Nobuyuki; Ikezawa, Yoshio.

    1994-01-01

    From a practical angle of view to estimate the protection factors (PFs) provided by full-face masks, a number of protection factors were measured with a man-test apparatus just before the wearers started to do radiation work in radiation controlled area. PFs of the total number of 2,279 cases were measured under five simulated working conditions. The measured PFs were widely distributed from 2.3 to 6,700. About 95% of workers obtained PFs more than 50, and about 64% showed much higher PFs more than 1,000 due to good fitting. In the case of some persons, the measured PFs irregularly varied and changed to a large degree. This method is a reliable technique that has been confirmed to protect unexpected internal exposure. From the results obtained, the method should be necessary to provide a better mask and higher PF for each worker. (author)

  8. Teaching Improvement Model Designed with DEA Method and Management Matrix

    Science.gov (United States)

    Montoneri, Bernard

    2014-01-01

    This study uses student evaluation of teachers to design a teaching improvement matrix based on teaching efficiency and performance by combining management matrix and data envelopment analysis. This matrix is designed to formulate suggestions to improve teaching. The research sample consists of 42 classes of freshmen following a course of English…

  9. A METHOD AND AN APPARATUS FOR PROVIDING TIMING SIGNALS TO A NUMBER OF CIRCUITS, AN INTEGRATED CIRCUIT AND A NODE

    DEFF Research Database (Denmark)

    2006-01-01

    A method of providing or transporting a timing signal between a number of circuits, electrical or optical, where each circuit is fed by a node. The nodes forward timing signals between each other, and at least one node is adapted to not transmit a timing signal before having received a timing...... signal from at least two nodes. In this manner, the direction of the timing skew between nodes and circuits is known and data transport between the circuits made easier....

  10. Non-dental primary care providers' views on challenges in providing oral health services and strategies to improve oral health in Australian rural and remote communities: a qualitative study.

    Science.gov (United States)

    Barnett, Tony; Hoang, Ha; Stuart, Jackie; Crocombe, Len

    2015-10-29

    To investigate the challenges of providing oral health advice/treatment as experienced by non-dental primary care providers in rural and remote areas with no resident dentist, and their views on ways in which oral health and oral health services could be improved for their communities. Qualitative study with semistructured interviews and thematic analysis. Four remote communities in outback Queensland, Australia. 35 primary care providers who had experience in providing oral health advice to patients and four dental care providers who had provided oral health services to patients from the four communities. In the absence of a resident dentist, rural and remote residents did present to non-dental primary care providers with oral health problems such as toothache, abscess, oral/gum infection and sore mouth for treatment and advice. Themes emerged from the interview data around communication challenges and strategies to improve oral health. Although, non-dental care providers commonly advised patients to see a dentist, they rarely communicated with the dentist in the nearest regional town. Participants proposed that oral health could be improved by: enabling access to dental practitioners, educating communities on preventive oral healthcare, and building the skills and knowledge base of non-dental primary care providers in the field of oral health. Prevention is a cornerstone to better oral health in rural and remote communities as well as in more urbanised communities. Strategies to improve the provision of dental services by either visiting or resident dental practitioners should include scope to provide community-based oral health promotion activities, and to engage more closely with other primary care service providers in these small communities. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  11. Improved Savitzky-Golay-method-based fluorescence subtraction algorithm for rapid recovery of Raman spectra.

    Science.gov (United States)

    Chen, Kun; Zhang, Hongyuan; Wei, Haoyun; Li, Yan

    2014-08-20

    In this paper, we propose an improved subtraction algorithm for rapid recovery of Raman spectra that can substantially reduce the computation time. This algorithm is based on an improved Savitzky-Golay (SG) iterative smoothing method, which involves two key novel approaches: (a) the use of the Gauss-Seidel method and (b) the introduction of a relaxation factor into the iterative procedure. By applying a novel successive relaxation (SG-SR) iterative method to the relaxation factor, additional improvement in the convergence speed over the standard Savitzky-Golay procedure is realized. The proposed improved algorithm (the RIA-SG-SR algorithm), which uses SG-SR-based iteration instead of Savitzky-Golay iteration, has been optimized and validated with a mathematically simulated Raman spectrum, as well as experimentally measured Raman spectra from non-biological and biological samples. The method results in a significant reduction in computing cost while yielding consistent rejection of fluorescence and noise for spectra with low signal-to-fluorescence ratios and varied baselines. In the simulation, RIA-SG-SR achieved 1 order of magnitude improvement in iteration number and 2 orders of magnitude improvement in computation time compared with the range-independent background-subtraction algorithm (RIA). Furthermore the computation time of the experimentally measured raw Raman spectrum processing from skin tissue decreased from 6.72 to 0.094 s. In general, the processing of the SG-SR method can be conducted within dozens of milliseconds, which can provide a real-time procedure in practical situations.

  12. Improved Methods of Producing and Administering Extracellular Vesicles | Poster

    Science.gov (United States)

    An efficient method of producing purified extracellular vesicles (EVs), in conjunction with a method that blocks liver macrophages from clearing EVs from the body, has produced promising results for the use of EVs in cancer therapy.

  13. An improved 4-step commutation method application for matrix converter

    DEFF Research Database (Denmark)

    Guo, Yu; Guo, Yougui; Deng, Wenlang

    2014-01-01

    A novel four-step commutation method is proposed for matrix converter cell, 3 phase inputs to 1 phase output in this paper, which is obtained on the analysis of published commutation methods for matrix converter. The first and fourth step can be shorter than the second or third one. The discussed...... method here is implemented by programming in VHDL language. Finally, the novel method in this paper is verified by experiments....

  14. Hybrid Tracking Algorithm Improvements and Cluster Analysis Methods.

    Science.gov (United States)

    1982-02-26

    UPGMA ), and Ward’s method. Ling’s papers describe a (k,r) clustering method. Each of these methods have individual characteristics which make them...Reference 7), UPGMA is probably the most frequently used clustering strategy. UPGMA tries to group new points into an existing cluster by using an

  15. Estimation and improvement of the RF government plan for providing the sustainable social-economic development of Russia in 2016

    Directory of Open Access Journals (Sweden)

    Dmitriy V. Manushin

    2016-09-01

    Full Text Available Objective to assess the anticrisis plan of the RF Government of January 27 2015 to project them onto the anticrisis plan of the RF Government dated March 1 2016 to identify its problems and suggest measures for their solution. Methods abstractlogical. Results the modern Russian economy is facing severe challenges posed by the crisis in the economy Western sanctions and foreign policy of the country. The government aware of these problems for the second year in a row adopts and implements a program of anticrisis measures. Analysis of scientific literature reports of the government and supervisory bodies allowed to formulate conclusions on the low efficiency of the anticrisis plan of 27 January 2015. Most of the indicators have not been achieved in many areas the objectives and their implementation have been haphazard with immeasurable results and lack of accountability for results. Analysis of the structure of anticrisis measures of the Russian government for 2016 demonstrated the persistence of old problems and the emergence of new ones. The number of indicators increased while simultaneously funding reduced as well as the number of specialists engaged in substantive anticrisis measures. Inefficient structure of the anticrisis measures is identified where priority is given to inappropriate support of the regions and the domestic auto industry to the detriment of the social component as well as other problems. As a result the measures are proposed to address the identified problems in the anticrisis plans of the Russian Government dated 27.01.2015 and 01.03.2016. Scientific novelty the following basic steps are formulated to address the identified challenges to modernize the work of the crisis staff to specify the anticrisis measures developing a detailed mechanism for their implementation and indicators for assessing the effectiveness to increase the motivation of civil servants to increase the minimum wage to the subsistence minimum to grant

  16. Search for new and improved radiolabeling methods for monoclonal antibodies

    International Nuclear Information System (INIS)

    Hiltunen, J.V.

    1993-01-01

    In this review the selection of different radioisotopes is discussed as well as the various traditional or newer methods to introduce the radiolabel into the antibody structure. Labeling methods for radiohalogens, for technetium and rhenium isotopes, and for 3-valent cation radiometals are reviewed. Some of the newer methods offer simplified labeling procedures, but usually the new methods are more complicated than the earlier ones. However, new labeling methods are available for almost any radioelement group and they may result in better preserved original natural of the antibody and lead to better clinical results. (orig./MG)

  17. New Technologies Provide Quantum Changes in the Scale, Speed, and Success of SELEX Methods and Aptamer Characterization

    Directory of Open Access Journals (Sweden)

    Abdullah Ozer

    2014-01-01

    Full Text Available Single-stranded oligonucleotide aptamers have attracted great attention in the past decade because of their diagnostic and therapeutic potential. These versatile, high affinity and specificity reagents are selected by an iterative in vitro process called SELEX, Systematic Evolution of Ligands by Exponential Enrichment. Numerous SELEX methods have been developed for aptamer selections; some that are simple and straightforward, and some that are specialized and complicated. The method of SELEX is crucial for selection of an aptamer with desired properties; however, success also depends on the starting aptamer library, the target molecule, aptamer enrichment monitoring assays, and finally, the analysis and characterization of selected aptamers. Here, we summarize key recent developments in aptamer selection methods, as well as other aspects of aptamer selection that have significant impact on the outcome. We discuss potential pitfalls and limitations in the selection process with an eye to aid researchers in the choice of a proper SELEX strategy, and we highlight areas where further developments and improvements are desired. We believe carefully designed multiplexed selection methods, when complemented with high-throughput downstream analysis and characterization assays, will yield numerous high-affinity aptamers to protein and small molecule targets, and thereby generate a vast array of reagents for probing basic biological mechanisms and implementing new diagnostic and therapeutic applications in the near future.

  18. Potential of bacterial fermentation as a biosafe method of improving ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-05-04

    May 4, 2009 ... the organic acid content of fermented feeds has been reported to improve ..... fatty acid and ethanol concentration resulting from the natural fermentation of ..... energy in Atlantic salmon (Salmo salar L.) diets. Aquaculture 210:.

  19. A Video Based System and Method for Improving Aircraft Security

    National Research Council Canada - National Science Library

    Meitzler, Tom; Ebenstein, Sam; Smith, Greg; Rodin, Yelena; Zorka, Nick

    2004-01-01

    In late September of 2001 the Commercial Airline Pilots Association (CAPA) endorsed president Bush's plan for improved airline security but expressed concern that it did not address many critical issues...

  20. An Experimental Investigation of Improving Human Problem-Solving Performance by Guiding Attention and Adaptively Providing Details on Information Displays

    National Research Council Canada - National Science Library

    Narayanan, N. H

    2007-01-01

    .... Results showed that various display strategies for augmenting information presented based on knowledge about both the viewer's gaze patterns and the problem solving procedure he or she is employing could indeed improve problem-solving performance.

  1. Methods and Conditions for Achieving Continuous Improvement of Processes

    OpenAIRE

    Florica BADEA; Catalina RADU; Ana-Maria GRIGORE

    2010-01-01

    In the early twentieth century, the Taylor model improved, in a spectacular maner the efficiency of the production processes. This allowed obtaining high productivity by low-skilled workers, but used in large number in the execution of production. Currently this model is questioned by experts and was replaced by the concept of "continuous improvement". The first signs of change date from the '80s, with the apparition of quality circles and groups of operators on quality issues, principles whi...

  2. Biotechnological interventions in sugarcane improvement: strategies, methods and progress

    International Nuclear Information System (INIS)

    Suprasanna, P.

    2010-01-01

    Work has been conducted towards employing in vitro culture system combined with radiation induced mutagenesis in the improvement of sugarcane. Several radiation induced mutants with agronomically desirable traits were isolated and evaluated under field conditions, besides studying abiotic stress responses using biochemical, physiological and molecular tools. This article describes the developments in the in vitro culture systems and related biotechnologies that are evolving as novel strategies in the recent years for use in sugarcane improvement

  3. A Similarity-Ranking Method on Semantic Computing for Providing Information-Services in Station-Concierge System

    Directory of Open Access Journals (Sweden)

    Motoki Yokoyama

    2017-07-01

    Full Text Available The prevalence of smartphones and wireless broadband networks have been progressing as a new Railway infomration environment. According to the spread of such devices and information technology, various types of information can be obtained from databases connected to the Internet. One scenario of obtaining such a wide variety of information resources is in the phase of user’s transportation. This paper proposes an information provision system, named the Station Concierge System that matches the situation and intention of passengers. The purpose of this system is to estimate the needs of passengers like station staff or hotel concierge and to provide information resources that satisfy user’s expectations dynamically. The most important module of the system is constructed based on a new information ranking method for passenger intention prediction and service recommendation. This method has three main features, which are (1 projecting a user to semantic vector space by using her current context, (2 predicting the intention of a user based on selecting a semantic vector subspace, and (3 ranking the services by a descending order of relevant scores to the user’ intention. By comparing the predicted results of our method with those of two straightforward computation methods, the experimental studies show the effectiveness and efficiency of the proposed method. Using this system, users can obtain transit information and service map that dynamically matches their context.

  4. The Architecture Improvement Method: cost management and systematic learning about strategic product architectures

    NARCIS (Netherlands)

    de Weerd-Nederhof, Petronella C.; Wouters, Marc; Teuns, Steven J.A.; Hissel, Paul H.

    2007-01-01

    The architecture improvement method (AIM) is a method for multidisciplinary product architecture improvement, addressing uncertainty and complexity and incorporating feedback loops, facilitating trade-off decision making during the architecture creation process. The research reported in this paper

  5. Coaching and Quality Assistance in Quality Rating Improvement Systems: Approaches Used by TA Providers to Improve Quality in Early Care and Education Programs and Home-Based Settings

    Science.gov (United States)

    Smith, Sheila; Robbins, Taylor; Schneider, Will; Kreader, J. Lee; Ong, Christine

    2012-01-01

    Quality Rating Improvement Systems (QRISs) commonly offer on-site technical assistance (TA) and coaching to help early care and education settings achieve quality improvements and a higher QRIS rating. In surveys of administrators overseeing statewide QRISs, almost all states reported the use of on-site TA and coaching in both center-based and…

  6. Mixed Methods Survey of Zoonotic Disease Awareness and Practice among Animal and Human Healthcare Providers in Moshi, Tanzania.

    Directory of Open Access Journals (Sweden)

    Helen L Zhang

    2016-03-01

    Full Text Available Zoonoses are common causes of human and livestock illness in Tanzania. Previous studies have shown that brucellosis, leptospirosis, and Q fever account for a large proportion of human febrile illness in northern Tanzania, yet they are infrequently diagnosed. We conducted this study to assess awareness and knowledge regarding selected zoonoses among healthcare providers in Moshi, Tanzania; to determine what diagnostic and treatment protocols are utilized; and obtain insights into contextual factors contributing to the apparent under-diagnosis of zoonoses.We conducted a questionnaire about zoonoses knowledge, case reporting, and testing with 52 human health practitioners and 10 livestock health providers. Immediately following questionnaire administration, we conducted semi-structured interviews with 60 of these respondents, using the findings of a previous fever etiology study to prompt conversation. Sixty respondents (97% had heard of brucellosis, 26 (42% leptospirosis, and 20 (32% Q fever. Animal sector respondents reported seeing cases of animal brucellosis (4, rabies (4, and anthrax (3 in the previous 12 months. Human sector respondents reported cases of human brucellosis (15, 29%, rabies (9, 18% and anthrax (6, 12%. None reported leptospirosis or Q fever cases. Nineteen respondents were aware of a local diagnostic test for human brucellosis. Reports of tests for human leptospirosis or Q fever, or for any of the study pathogens in animals, were rare. Many respondents expressed awareness of malaria over-diagnosis and zoonoses under-diagnosis, and many identified low knowledge and testing capacity as reasons for zoonoses under-diagnosis.This study revealed differences in knowledge of different zoonoses and low case report frequencies of brucellosis, leptospirosis, and Q fever. There was a lack of known diagnostic services for leptospirosis and Q fever. These findings emphasize a need for improved diagnostic capacity alongside healthcare

  7. An Improved Isotropic Periodic Sum Method That Uses Linear Combinations of Basis Potentials

    KAUST Repository

    Takahashi, Kazuaki Z.

    2012-11-13

    Isotropic periodic sum (IPS) is a technique that calculates long-range interactions differently than conventional lattice sum methods. The difference between IPS and lattice sum methods lies in the shape and distribution of remote images for long-range interaction calculations. The images used in lattice sum calculations are identical to those generated from periodic boundary conditions and are discretely positioned at lattice points in space. The images for IPS calculations are "imaginary", which means they do not explicitly exist in a simulation system and are distributed isotropically and periodically around each particle. Two different versions of the original IPS method exist. The IPSn method is applied to calculations for point charges, whereas the IPSp method calculates polar molecules. However, both IPSn and IPSp have their advantages and disadvantages in simulating bulk water or water-vapor interfacial systems. In bulk water systems, the cutoff radius effect of IPSn strongly affects the configuration, whereas IPSp does not provide adequate estimations of water-vapor interfacial systems unless very long cutoff radii are used. To extend the applicability of the IPS technique, an improved IPS method, which has better accuracy in both homogeneous and heterogeneous systems has been developed and named the linear-combination-based isotropic periodic sum (LIPS) method. This improved IPS method uses linear combinations of basis potentials. We performed molecular dynamics (MD) simulations of bulk water and water-vapor interfacial systems to evaluate the accuracy of the LIPS method. For bulk water systems, the LIPS method has better accuracy than IPSn in estimating thermodynamic and configurational properties without the countercharge assumption, which is used for IPSp. For water-vapor interfacial systems, LIPS has better accuracy than IPSp and properly estimates thermodynamic and configurational properties. In conclusion, the LIPS method can successfully estimate

  8. An Improved Isotropic Periodic Sum Method That Uses Linear Combinations of Basis Potentials

    KAUST Repository

    Takahashi, Kazuaki Z.; Narumi, Tetsu; Suh, Donguk; Yasuoka, Kenji

    2012-01-01

    Isotropic periodic sum (IPS) is a technique that calculates long-range interactions differently than conventional lattice sum methods. The difference between IPS and lattice sum methods lies in the shape and distribution of remote images for long-range interaction calculations. The images used in lattice sum calculations are identical to those generated from periodic boundary conditions and are discretely positioned at lattice points in space. The images for IPS calculations are "imaginary", which means they do not explicitly exist in a simulation system and are distributed isotropically and periodically around each particle. Two different versions of the original IPS method exist. The IPSn method is applied to calculations for point charges, whereas the IPSp method calculates polar molecules. However, both IPSn and IPSp have their advantages and disadvantages in simulating bulk water or water-vapor interfacial systems. In bulk water systems, the cutoff radius effect of IPSn strongly affects the configuration, whereas IPSp does not provide adequate estimations of water-vapor interfacial systems unless very long cutoff radii are used. To extend the applicability of the IPS technique, an improved IPS method, which has better accuracy in both homogeneous and heterogeneous systems has been developed and named the linear-combination-based isotropic periodic sum (LIPS) method. This improved IPS method uses linear combinations of basis potentials. We performed molecular dynamics (MD) simulations of bulk water and water-vapor interfacial systems to evaluate the accuracy of the LIPS method. For bulk water systems, the LIPS method has better accuracy than IPSn in estimating thermodynamic and configurational properties without the countercharge assumption, which is used for IPSp. For water-vapor interfacial systems, LIPS has better accuracy than IPSp and properly estimates thermodynamic and configurational properties. In conclusion, the LIPS method can successfully estimate

  9. Enhancing diabetes management while teaching quality improvement methods.

    Science.gov (United States)

    Sievers, Beth A; Negley, Kristin D F; Carlson, Marny L; Nelson, Joyce L; Pearson, Kristina K

    2014-01-01

    Six medical units realized that they were having issues with accurate timing of bedtime blood glucose measurement for their patients with diabetes. They decided to investigate the issues by using their current staff nurse committee structure. The clinical nurse specialists and nurse education specialists decided to address the issue by educating and engaging the staff in the define, measure, analyze, improve, control (DMAIC) framework process. They found that two issues needed to be improved, including timing of bedtime blood glucose measurement and snack administration and documentation. Several educational interventions were completed and resulted in improved timing of bedtime glucose measurement and bedtime snack documentation. The nurses understood the DMAIC process, and collaboration and cohesion among the medical units was enhanced. Copyright 2014, SLACK Incorporated.

  10. An Improved Split-Step Wavelet Transform Method for Anomalous Radio Wave Propagation Modelling

    Directory of Open Access Journals (Sweden)

    A. Iqbal

    2014-12-01

    Full Text Available Anomalous tropospheric propagation caused by ducting phenomenon is a major problem in wireless communication. Thus, it is important to study the behavior of radio wave propagation in tropospheric ducts. The Parabolic Wave Equation (PWE method is considered most reliable to model anomalous radio wave propagation. In this work, an improved Split Step Wavelet transform Method (SSWM is presented to solve PWE for the modeling of tropospheric propagation over finite and infinite conductive surfaces. A large number of numerical experiments are carried out to validate the performance of the proposed algorithm. Developed algorithm is compared with previously published techniques; Wavelet Galerkin Method (WGM and Split-Step Fourier transform Method (SSFM. A very good agreement is found between SSWM and published techniques. It is also observed that the proposed algorithm is about 18 times faster than WGM and provide more details of propagation effects as compared to SSFM.

  11. An improved cellular automaton method to model multispecies biofilms.

    Science.gov (United States)

    Tang, Youneng; Valocchi, Albert J

    2013-10-01

    Biomass-spreading rules used in previous cellular automaton methods to simulate multispecies biofilm introduced extensive mixing between different biomass species or resulted in spatially discontinuous biomass concentration and distribution; this caused results based on the cellular automaton methods to deviate from experimental results and those from the more computationally intensive continuous method. To overcome the problems, we propose new biomass-spreading rules in this work: Excess biomass spreads by pushing a line of grid cells that are on the shortest path from the source grid cell to the destination grid cell, and the fractions of different biomass species in the grid cells on the path change due to the spreading. To evaluate the new rules, three two-dimensional simulation examples are used to compare the biomass distribution computed using the continuous method and three cellular automaton methods, one based on the new rules and the other two based on rules presented in two previous studies. The relationship between the biomass species is syntrophic in one example and competitive in the other two examples. Simulation results generated using the cellular automaton method based on the new rules agree much better with the continuous method than do results using the other two cellular automaton methods. The new biomass-spreading rules are no more complex to implement than the existing rules. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Improving Object-Oriented Methods by using Fuzzy Logic

    NARCIS (Netherlands)

    Marcelloni, Francesco; Aksit, Mehmet

    2000-01-01

    Object-oriented methods create software artifacts through the application of a large number or rules. Rules are typically formulated in two-valued logic. There are a number of problems on how rules are defined and applied in current methods. First, two-valued logic can capture completely neither

  13. New reference materials improvement of methods of measurements

    International Nuclear Information System (INIS)

    Marchandise, H.

    1985-01-01

    The report summarizes the development of about 120 reference materials in a variety of fields (non ferrous metals, trace element analysis, food products, biomedical analysis, physical and technical properties of solid materials). The document also provides practical advice for trace element analyses, describes the principles followed for certifying reference materials and provides recommendations for their use

  14. Aircraft Route Recovery Based on An Improved GRASP Method

    Directory of Open Access Journals (Sweden)

    Yang He

    2017-01-01

    Full Text Available Aircrafts maintenance, temporary airport closures are common factors that disrupt normal flight schedule. The aircraft route recovery aims to recover original schedules by some strategies, including flights swaps, and cancellations, which is a NP-hard problem. This paper proposes an improved heuristic procedure based on Greedy Random Adaptive Search Procedure (GRASP to solve this problem. The effectiveness and high global optimization capability of the heuristic is illustrated through experiments based on large-scale problems. Compared to the original one, it is shown that the improved procedure can find feasible flight recovered schedules with lower cost in a short time.

  15. Tanzanian farmers' knowledge and attitudes to GM biotechnology and the potential use of GM crops to provide improved levels of food security. A Qualitative Study

    Directory of Open Access Journals (Sweden)

    Herron Caroline M

    2010-07-01

    Full Text Available Abstract Background Genetically Modified (GM crops have been championed as one possible method to improve food security and individual nutritional status in sub Saharan Africa. Understanding and acceptability of GM crop technology to farmers and consumers have not been assessed. We developed a qualitative research study involving farmers as both producers and consumers to gauge the understanding of GM crop technology, its acceptability, and identifying issues of concern. Methods Nineteen individual interviews (10 male and 9 female and five mixed gender focus group discussions with local farmers were conducted in 3 regions in Tanzania. Analysis took place concurrently with data collection. Following initial interviews, subsequent questions were adjusted based on emerging themes. Results Understanding, awareness and knowledge of GM crop technology and terminology and its potential risks and benefits was very poor in all regions. Receptivity to the potential use of GM crops was, however, high. Respondents focused on the potential benefits of GM crops rather than any potential longer term health risks. A number of factors, most significantly field trial data, would influence farmers' decisions regarding the introduction of GM crop varieties into their farming practice. Understanding of the potential improved health provision possible by changes in agricultural practice and food-related decision making, and the health benefits of a diet containing essential vitamins, minerals and micronutrients is also poor in these communities. Conclusion This study forms a basis from which further research work can be undertaken. It is important to continue to assess opinions and attitudes of farmers and consumers in sub Saharan Africa towards potential use of GM technologies whilst highlighting the importance of the relationship between agriculture, health and development. This will allow people in the region to make accurate, informed decisions about whether they

  16. A 'special effort' to provide improved sounding and cloud-motion wind data for FGGE. [First GARP Global Experiment

    Science.gov (United States)

    Greaves, J. R.; Dimego, G.; Smith, W. L.; Suomi, V. E.

    1979-01-01

    Enhancement and editing of high-density cloud motion wind assessments and research satellite soundings have been necessary to improve the quality of data used in The Global Weather Experiment. Editing operations are conducted by a man-computer interactive data access system. Editing will focus on such inputs as non-US satellite data, NOAA operational sounding and wind data sets, wind data from the Indian Ocean satellite, dropwindsonde data, and tropical mesoscale wind data. Improved techniques for deriving cloud heights and higher resolution sounding in meteorologically active areas are principal parts of the data enhancement program.

  17. The awareness of employees in safety culture through the improved nuclear safety culture evaluation method

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Young Ga; Sung, Chan Ho; Jung, Yeon Sub [KHNP Central Research Institute, Daejeon (Korea, Republic of)

    2012-10-15

    After the Chernobyl nuclear accident in 1986, nuclear safety culture terminology was at first introduced emphasizing the importance of employees' attitude and organizational safety. The concept of safety culture was spread by INSAG 4 published in 1991. From that time, IAEA had provided the service of ASCOT for the safety culture assessment. However, many people still are thinking that safety culture is abstract and is not clear. It is why the systematic and reliable assessment methodology was not developed. Assessing safety culture is to identify what is the basic assumption for any organization to accept unconsciously. Therefore, it is very difficult to reach a meaningful conclusion by a superficial investigation alone. KHNP had been doing the safety culture assessment which was based on ASCOT methodology every 2 years. And this result had contributed to improving safety culture. But this result could not represent the level of organization's safety culture due to the limitation of method. So, KHNP has improved the safety culture method by benchmarking the over sea assessment techniques in 2011. The effectiveness of this improved methodology was validated through a pilot assessment. In this paper, the level of employees' safety culture awareness was analyzed by the improved method and reviewed what is necessary for the completeness and objectivity of the nuclear safety culture assessment methodology.

  18. The awareness of employees in safety culture through the improved nuclear safety culture evaluation method

    International Nuclear Information System (INIS)

    Kim, Young Ga; Sung, Chan Ho; Jung, Yeon Sub

    2012-01-01

    After the Chernobyl nuclear accident in 1986, nuclear safety culture terminology was at first introduced emphasizing the importance of employees' attitude and organizational safety. The concept of safety culture was spread by INSAG 4 published in 1991. From that time, IAEA had provided the service of ASCOT for the safety culture assessment. However, many people still are thinking that safety culture is abstract and is not clear. It is why the systematic and reliable assessment methodology was not developed. Assessing safety culture is to identify what is the basic assumption for any organization to accept unconsciously. Therefore, it is very difficult to reach a meaningful conclusion by a superficial investigation alone. KHNP had been doing the safety culture assessment which was based on ASCOT methodology every 2 years. And this result had contributed to improving safety culture. But this result could not represent the level of organization's safety culture due to the limitation of method. So, KHNP has improved the safety culture method by benchmarking the over sea assessment techniques in 2011. The effectiveness of this improved methodology was validated through a pilot assessment. In this paper, the level of employees' safety culture awareness was analyzed by the improved method and reviewed what is necessary for the completeness and objectivity of the nuclear safety culture assessment methodology

  19. Research on Improved Control Strategy for STATCOM Based on Virtual Matrix Method

    Directory of Open Access Journals (Sweden)

    Wang Xudong

    2016-01-01

    Full Text Available Fast and accurate detection of reactive current is the precondition for the realization of static synchronous compensator (STATCOM reactive power compensation and harmonic suppression. Aiming at deviation and delay of the traditional reactive current detection algorithm with phase-locked loop (PLL and low-pass filter (LPF of STATCOM, a novel improved reactive current detection algorithm without PLL is proposed, in which the virtual matrix (VM is built to replace the original PLL, and improved current average value filter is used to realize the function of LPF, so as to improve the real-time performance and robustness of reactive current detection. The realization process of VM detection method is derived in this paper, and improved control strategy for STATCOM is designed based on the VM detection method. Simulation analysis of the proposed detection algorithm and control strategy is conducted in Matlab platform so as to verify the correctness and effectiveness of the control strategy. The VM detection has the advantages of simple structure, fast response and easy for digital realization, which provides reference for the improvement of reactive power compensation precision for STATCOM.

  20. Effectiveness of Provider and Community Interventions to Improve Treatment of Uncomplicated Malaria in Nigeria: A Cluster Randomized Controlled Trial.

    Directory of Open Access Journals (Sweden)

    Obinna Onwujekwe

    Full Text Available The World Health Organization recommends that malaria be confirmed by parasitological diagnosis before treatment using Artemisinin-based Combination Therapy (ACT. Despite this, many health workers in malaria endemic countries continue to diagnose malaria based on symptoms alone. This study evaluates interventions to help bridge this gap between guidelines and provider practice. A stratified cluster-randomized trial in 42 communities in Enugu state compared 3 scenarios: Rapid Diagnostic Tests (RDTs with basic instruction (control; RDTs with provider training (provider arm; and RDTs with provider training plus a school-based community intervention (provider-school arm. The primary outcome was the proportion of patients treated according to guidelines, a composite indicator requiring patients to be tested for malaria and given treatment consistent with the test result. The primary outcome was evaluated among 4946 (93% of the 5311 patients invited to participate. A total of 40 communities (12 in control, 14 per intervention arm were included in the analysis. There was no evidence of differences between the three arms in terms of our composite indicator (p = 0.36: stratified risk difference was 14% (95% CI -8.3%, 35.8%; p = 0.26 in the provider arm and 1% (95% CI -21.1%, 22.9%; p = 0.19 in the provider-school arm, compared with control. The level of testing was low across all arms (34% in control; 48% provider arm; 37% provider-school arm; p = 0.47. Presumptive treatment of uncomplicated malaria remains an ingrained behaviour that is difficult to change. With or without extensive supporting interventions, levels of testing in this study remained critically low. Governments and researchers must continue to explore alternative ways of encouraging providers to deliver appropriate treatment and avoid the misuse of valuable medicines.ClinicalTrials.gov NCT01350752.

  1. BIOTECHNOLOGY AND MOLECULAR-BASED METHODS FOR GENETIC IMPROVEMENT OF TULIPS

    Directory of Open Access Journals (Sweden)

    Aurel Popescu

    2012-04-01

    Full Text Available Although the conventional methods of improvement have changed significantly throughout the last fifty years, additional tools and novel approaches are needed in order to fasten the process of creation new and highly valuable tulip varieties. The genetic base of tulip production can be preserved and widen by an integration of biotechnology tools in conventional breeding. Micropropagation in vitro may produce very fast large numbers of vigorous plants with high quality and free of endogenous pathogens. The in vitro rescue of embryos resulted from interspecific crosses between more or less distant species, chromosome doubling, somaclonal variation, transformation, and marker-aided selection and breeding are just a few of the examples of the applications of biotechnology in tulip improvement. This review provides an overview of the opportunities presented by the integration of plant biotechnology into the tulip improvement efforts.

  2. Behavioural responses to hypoxia provide a non-invasive method for distinguishing between stress coping styles in fish

    DEFF Research Database (Denmark)

    Laursen, Danielle Caroline; Olsén, Hanna L.; Ruiz-Gomez, Maria de Lourdes

    2011-01-01

    . These individual differences may result in suboptimal production and compromised welfare in aquaculture. An approach to overcome these problems could be to sort fish and optimise rearing conditions according to coping style. It has been previously demonstrated that the proactive and reactive coping styles in fish......, these fish provided an opportunity for verifying a method for sorting fish with respect to coping style by exposure to hypoxia. Groups consisting of 24 individually tagged fish, 12 HR and 12 LR were exposed to hypoxia in a two choice system. The system consisted of a “home” tank provided with cover connected...... to a second brightly “illuminated” tank via a closable doorway. During the experiment, the doorway between the two tanks was opened and hypoxic conditions were gradually induced in the “home” tank by bubbling with nitrogen. The latency time to move away from hypoxic conditions to normoxic conditions...

  3. Improving the Green Building Evaluation System in China Based on the DANP Method

    Directory of Open Access Journals (Sweden)

    Qi-Gan Shao

    2018-04-01

    Full Text Available Against the background of sustainable development, green building practices could be part of the strategy for solving environmental and energy problems in developing countries. The aim of this paper is to explore a system for the assessment of green buildings in China that provides the government and stakeholders with ways to improve their strategies for green building development. We apply a hybrid model, developed by integrating the Decision-Making Trial and Evaluation Laboratory and Analytical Network Process (called DANP method, to build an influential network relationship map (INRM between assessment systems and to derive the criterion weights. The INRM and derived weights can help us to understand this complex assessment system and to set improvement priorities for green building development. The results demonstrate that indoor environment, materials, and smart facilities are the top three critical factors for green building evaluation. Finally, we discuss some management implications based on an actual case study with solutions provided using this model.

  4. The paradox of compassionate work: a mixed-methods study of satisfying and fatiguing experiences of animal health care providers.

    Science.gov (United States)

    Polachek, Alicia J; Wallace, Jean E

    2018-03-01

    Compassionate work appears paradoxical as it may provide great rewards, but may also come at great costs to care providers. This paper explores the paradox of compassionate work by examining what interactions contribute to compassion satisfaction and what interactions contribute to compassion fatigue. This mixed-methods, cross-sectional study uses qualitative interview data from animal health care providers (N = 20) to identify work interactions that they find satisfying or stressful. Quantitative survey data (N = 572) are used to test hypotheses generated from the interviews regarding predictors of compassion satisfaction and compassion fatigue. Interview transcripts were analyzed using a directed content analysis approach. Survey data were analyzed using ordinary least squares regression. The results highlight the complex nature of compassionate work. As hypothesized, making a difference to animals and building relationships with animal patients and human clients relate to greater compassion satisfaction. Human client barriers to animal care and witnessing client grief relate to greater compassion fatigue, as predicted. None of the predictors relate to less compassion fatigue, but forming relationships with animal patients relates to both greater compassion satisfaction and compassion fatigue. This paper enhances our understanding of provider-client-patient interactions and highlights the paradox of compassionate work.

  5. runjags: An R Package Providing Interface Utilities, Model Templates, Parallel Computing Methods and Additional Distributions for MCMC Models in JAGS

    Directory of Open Access Journals (Sweden)

    Matthew J. Denwood

    2016-07-01

    Full Text Available The runjags package provides a set of interface functions to facilitate running Markov chain Monte Carlo models in JAGS from within R. Automated calculation of appropriate convergence and sample length diagnostics, user-friendly access to commonly used graphical outputs and summary statistics, and parallelized methods of running JAGS are provided. Template model specifications can be generated using a standard lme4-style formula interface to assist users less familiar with the BUGS syntax. Automated simulation study functions are implemented to facilitate model performance assessment, as well as drop-k type cross-validation studies, using high performance computing clusters such as those provided by parallel. A module extension for JAGS is also included within runjags, providing the Pareto family of distributions and a series of minimally-informative priors including the DuMouchel and half-Cauchy priors. This paper outlines the primary functions of this package, and gives an illustration of a simulation study to assess the sensitivity of two equivalent model formulations to different prior distributions.

  6. Improving opioid safety practices in primary care: protocol for the development and evaluation of a multifaceted, theory-informed pilot intervention for healthcare providers.

    Science.gov (United States)

    Leece, Pamela; Buchman, Daniel Z; Hamilton, Michael; Timmings, Caitlyn; Shantharam, Yalnee; Moore, Julia; Furlan, Andrea D

    2017-04-26

    In North America, drug overdose deaths are reaching unprecedented levels, largely driven by increasing prescription opioid-related deaths. Despite the development of several opioid guidelines, prescribing behaviours still contribute to poor patient outcomes and societal harm. Factors at the provider and system level may hinder or facilitate the application of evidence-based guidelines; interventions designed to address such factors are needed. Using implementation science and behaviour change theory, we have planned the development and evaluation of a comprehensive Opioid Self-Assessment Package, designed to increase adherence to the Canadian Opioid Guideline among family physicians. The intervention uses practical educational and self-assessment tools to provide prescribers with feedback on their current knowledge and practices, and resources to improve their practice. The evaluation approach uses a pretest and post-test design and includes both quantitative and qualitative methods at baseline and 6 months. We will recruit a purposive sample of approximately 10 family physicians in Ontario from diverse practice settings, who currently treat patients with long-term opioid therapy for chronic pain. Quantitative data will be analysed using basic descriptive statistics, and qualitative data will be analysed using the Framework Method. The University Health Network Research Ethics Board approved this study. Dissemination plan includes publications, conference presentations and brief stakeholder reports. This evidence-informed, theory-driven intervention has implications for national application of opioid quality improvement tools in primary care settings. We are engaging experts and end users in advisory and stakeholder roles throughout our project to increase its national relevance, application and sustainability. The performance measures could be used as the basis for health system quality improvement indicators to monitor opioid prescribing. Additionally, the

  7. DETECTION OF REPORTS FALSIFICATION PROVIDED TO A BANK BY A BORROWER USING THE METHOD OF DYNAMIC PARAMETERS ANALYSIS

    Directory of Open Access Journals (Sweden)

    M. S. Lyuft

    2015-01-01

    Full Text Available Summary. The main stop-factors in a landing were formed in the article according to the procedure of the European Bank for Reconstruction and Development by the means of questioning the leading Russian banks that finance small-scale business. It is given the description of this method, also it is identified the main weaknesses of the EBRD methodology. There is a description of the main methods of the borrowing company’s analytical balance and thereupon it is made the conclusion about the necessity of the analysis of the balance’s principal factors across time. The analysis of indicators and factors in the dynamics enables us to see trends in the development of the company, and to identify deviations in the coefficients. Either materiality or difference from normal values of these coefficients may indicate the factors of the borrowers’ misconduct, and in particular it gives evidence concerning falsification of reports provided to a bank. There are stages of information processing for falsification’s detection, excluding the interest from decision-makers about the possibility of lending in the results of a transaction. The formula that determinates the value of net profit falsification has been made on basis of dynamic parameters of the analytical balance and the connection with the administrative profit-and-loss report. Further, the article provides the second method of a determination of the net profit falsification already based on data of the parameters in dynamics namely business profitability rate. The process of calculation Payment To Income - payment to income - an indicator, in order to obtain good data on who falsify net income. Are key strengths of this method of identifying and conclusions paragraph article.

  8. An Improved Optimization Method for the Relevance Voxel Machine

    DEFF Research Database (Denmark)

    Ganz, Melanie; Sabuncu, M. R.; Van Leemput, Koen

    2013-01-01

    In this paper, we will re-visit the Relevance Voxel Machine (RVoxM), a recently developed sparse Bayesian framework used for predicting biological markers, e.g., presence of disease, from high-dimensional image data, e.g., brain MRI volumes. The proposed improvement, called IRVoxM, mitigates the ...

  9. An improved radiofrequency method to pasteurize salmonella in shell eggs

    Science.gov (United States)

    The goals of this study were to improve radio frequency (RF) shell egg pasteurization technology to make it more commercially feasible, to evaluate its efficacy in reducing Salmonella, and to determine its effect on the quality changes of the egg. The original RF technology inactivated 6.8 log of E....

  10. A Critical Evaluation and Framework of Business Process Improvement Methods

    NARCIS (Netherlands)

    Vanwersch, R.J.B.; Shahzad, K.; Vanderfeesten, I.; Vanhaecht, K.; Grefen, P.; Pintelon, L.M.; Mendling, J.; van Merode, G.G.; Reijers, H.A.

    2016-01-01

    The redesign of business processes has a huge potential in terms of reducing costs and throughput times, as well as improving customer satisfaction. Despite rapid developments in the business process management discipline during the last decade, a comprehensive overview of the options to

  11. A Novel Mesh Quality Improvement Method for Boundary Elements

    Directory of Open Access Journals (Sweden)

    Hou-lin Liu

    2012-01-01

    Full Text Available In order to improve the boundary mesh quality while maintaining the essential characteristics of discrete surfaces, a new approach combining optimization-based smoothing and topology optimization is developed. The smoothing objective function is modified, in which two functions denoting boundary and interior quality, respectively, and a weight coefficient controlling boundary quality are taken into account. In addition, the existing smoothing algorithm can improve the mesh quality only by repositioning vertices of the interior mesh. Without destroying boundary conformity, bad elements with all their vertices on the boundary cannot be eliminated. Then, topology optimization is employed, and those elements are converted into other types of elements whose quality can be improved by smoothing. The practical application shows that the worst elements can be eliminated and, with the increase of weight coefficient, the average quality of boundary mesh can also be improved. Results obtained with the combined approach are compared with some common approach. It is clearly shown that it performs better than the existing approach.

  12. A critical evaluation and framework of business process improvement methods

    NARCIS (Netherlands)

    Vanwersch, R.J.B.; Shahzad, K.; Vanderfeesten, I.T.P.; Vanhaecht, K.; Grefen, P.W.P.J.; Pintelon, L.M.; Mendling, J.; Merode, van G.G.; Reijers, H.A.

    2016-01-01

    The redesign of business processes has a huge potential in terms of reducing costs and throughput times, as well as improving customer satisfaction. Despite rapid developments in the business process management discipline during the last decade, a comprehensive overview of the options to

  13. Improving Instruction in the Mathematics Methods Classroom through Action Research

    Science.gov (United States)

    Mostofo, Jameel; Zambo, Ron

    2015-01-01

    There is a continuing emphasis in the United States on improving students' mathematical abilities, and one approach is to better prepare teachers. To investigate the potential usefulness of Lesson Study to better prepare teachers, one author set out to conduct action research on his classroom practice. Specifically, he sought to determine whether…

  14. Facial primer provides immediate and long-term improvements in mild-to-moderate facial hyperpigmentation and fine lines associated with photoaging

    Directory of Open Access Journals (Sweden)

    Roberts WE

    2015-09-01

    Full Text Available Wendy E Roberts,1 Lily I Jiang,2 James H Herndon Jr3 1Generational and Cosmetic Dermatology, Rancho Mirage, CA, 2Thomas J Stephens and Associates, Richardson, 3Dermatology Center of Dallas, Dallas, TX, USA Background: Photoaged skin results from various environmental factors, most importantly chronic sun exposure. Dyschromia and fine lines/wrinkles are common clinical manifestations of photodamaged skin. Purpose: This single-center clinical trial was conducted to assess the efficacy and tolerability of a new multifunctional facial primer (camouflage, broad-spectrum SPF 50, and a treatment for hyperpigmentation when used by females with mild-to-moderate facial hyperpigmentation and fine lines due to photoaging over a course of 12 weeks. Patients and methods: Subjects were provided test material (Even Up-Clinical Pigment Perfector and supporting products to use on their face and neck. Products were used according to specific application instructions. Clinical grading for efficacy and tolerability assessments were performed by an expert grader at baseline, baseline (post-application primer, week 4, week 8, week 12, and week 12 (post-application primer. Standardized digital photographs were taken, and self-assessment questionnaires were conducted. Results: Twenty-eight female subjects completed the 12-week trial. The facial primer improved scores for the appearance of hyperpigmentation and other photoaging parameters immediately after the first application. The treatment also showed a progressive improvement in the clinical assessment of hyperpigmentation and other photoaging parameters over the 12-week trial. These long-term benefits can be attributed to an improvement in the underlying skin condition. The facial primer was well tolerated. Subject questionnaires showed that the product was highly rated at all visits. Conclusion: The facial primer was shown to be effective and well tolerated for immediate and long-term improvement in the appearance

  15. Kaizen: a method of process improvement in the emergency department.

    Science.gov (United States)

    Jacobson, Gregory H; McCoin, Nicole Streiff; Lescallette, Richard; Russ, Stephan; Slovis, Corey M

    2009-12-01

    Recent position statements from health care organizations have placed a strong emphasis on continuous quality improvement (CQI). CQI finds many of its roots in kaizen, which emphasizes small, low-cost, low-risk improvements. Based on the successful Kaizen Programs at organizations such as Toyota, the authors thought the emergency department (ED) would be an ideal environment to benefit from such a program. The authors sought to create a CQI program using a suggestion-based model that did not require a large time commitment, was easy to implement, and had the potential to empower all physicians in the department. It would not take the place of other improvement efforts, but instead augment them. The hypothesis was that such a program would foster sustainable engagement of emergency physicians in system improvement efforts and lead to a continuous stream of low-cost implementable system improvement interventions. A CQI program was created for the physician staff of the Department of Emergency Medicine at Vanderbilt University Medical Center, focusing on a suggestion-based model using kaizen philosophy. Lectures teaching kaizen philosophy were presented. Over the past 4 years, a methodology was developed utilizing a Web-based application, the Kaizen Tracker, which aids in the submission and implementation of suggestions that are called kaizen initiatives (KIs). The characteristics of the KIs submitted, details regarding resident and faculty participation, and the effectiveness of the Kaizen Tracker were retrospectively reviewed. There were 169, 105, and 101 KIs placed in the postimplementation calendar years 2006, 2007, and 2008, respectively. Seventy-six percent of KIs submitted thus far have identified a "process problem." Fifty-three percent of KIs submitted have led to operational changes within the ED. Ninety-three percent of the resident physicians entered at least one KI, and 73% of these residents submitted more than one KI. Sixty-nine percent of the

  16. SQ house dust mite (HDM) SLIT-tablet provides clinical improvement in HDM-induced allergic rhinitis

    DEFF Research Database (Denmark)

    Klimek, Ludger; Mosbech, Holger; Zieglmayer, Petra

    2016-01-01

    -consuming treatment regimen and a risk of systemic adverse reactions, sublingually administered allergy immunotherapy (SLIT) has been investigated as a more convenient treatment option with similar levels of efficacy and an improved safety profile that allows for at-home daily administration. In this Drug Profile, we...

  17. An improved method for isolating viruses from asymptomatic carrier fish

    Science.gov (United States)

    Amend, Donald F.; Pietsch, John P.

    1972-01-01

    This paper describes a method using elevated levels of penicillin, streptomycin, and nystatin instead of filters to control bacteria and mold contaminants in specimens processed for virus isolation. Filters were shown to significantly reduce the virus concentration. Virus and tissue cultures were not affected by this procedure. In field tests nearly three times more specimens were positive for virus with this method than with the widely used filter technique. Moreover, the cost of materials was less. This method is recommended for inspection and certification purposes.

  18. Improvements in or relating to methods of producing superconductors

    International Nuclear Information System (INIS)

    McDougall, I.L.

    1975-01-01

    A method is described for manufacturing a superconductor comprised of a superconducting intermetallic compound of at least two elements. The method consists of producing a composite containing at least one filament of at least one of the elements, this filament being embedded in a matrix material comprising a support material and the remainder of the elements. This material is coated with a material having a low self diffusion coefficient and which is insoluble in the matrix material. The remainder of the elements are allowed to diffuse into the filament and react to form the intermetallic compound. Full details are given of the application of the method, and examples are given. (U.K.)

  19. Improved determination of hadron matrix elements using the variational method

    International Nuclear Information System (INIS)

    Dragos, J.; Kamleh, W.; Leinweber, D.B.; Zanotti, J.M.; Rakow, P.E.L.; Young, R.D.; Adelaide Univ.

    2015-11-01

    The extraction of hadron form factors in lattice QCD using the standard two- and three-point correlator functions has its limitations. One of the most commonly studied sources of systematic error is excited state contamination, which occurs when correlators are contaminated with results from higher energy excitations. We apply the variational method to calculate the axial vector current g A and compare the results to the more commonly used summation and two-exponential fit methods. The results demonstrate that the variational approach offers a more efficient and robust method for the determination of nucleon matrix elements.

  20. Organizational and provider level factors in implementation of trauma-informed care after a city-wide training: an explanatory mixed methods assessment.

    Science.gov (United States)

    Damian, April Joy; Gallo, Joseph; Leaf, Philip; Mendelson, Tamar

    2017-11-21

    While there is increasing support for training youth-serving providers in trauma-informed care (TIC) as a means of addressing high prevalence of U.S. childhood trauma, we know little about the effects of TIC training on organizational culture and providers' professional quality of life. This mixed-methods study evaluated changes in organizational- and provider-level factors following participation in a citywide TIC training. Government workers and nonprofit professionals (N = 90) who participated in a nine-month citywide TIC training completed a survey before and after the training to assess organizational culture and professional quality of life. Survey data were analyzed using multiple regression analyses. A subset of participants (n = 16) was interviewed using a semi-structured format, and themes related to organizational and provider factors were identified using qualitative methods. Analysis of survey data indicated significant improvements in participants' organizational culture and professional satisfaction at training completion. Participants' perceptions of their own burnout and secondary traumatic stress also increased. Four themes emerged from analysis of the interview data, including "Implementation of more flexible, less-punitive policies towards clients," "Adoption of trauma-informed workplace design," "Heightened awareness of own traumatic stress and need for self-care," and "Greater sense of camaraderie and empathy for colleagues." Use of a mixed-methods approach provided a nuanced understanding of the impact of TIC training and suggested potential benefits of the training on organizational and provider-level factors associated with implementation of trauma-informed policies and practices. Future trainings should explicitly address organizational factors such as safety climate and morale, managerial support, teamwork climate and collaboration, and individual factors including providers' compassion satisfaction, burnout, and secondary